Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

Comparative High Water Temperature Effects of White Spot Syndrome Virus (WSSV) and Yellow-Head Virus (YHV) infections in Litopenaeus setiferus
Krystal M. Drysdale, Verlee Breland, and Jeffrey M. Lotz
Department of Coastal Sciences, University of Southern Mississippi, Gulf Coast Research Laboratory, Post Office Box 7000, Ocean Springs, Mississippi 39566-7000, USA Abstract. - With the rapid expansion of high density aquaculture of penaeid shrimp and the economic significance of these commercial fisheries, the detection and prevention of infectious diseases, has become increasingly important. In this study we consider more closely the significance of White Spot Disease (WSSV) and Yellow-Head Disease (YHV) in Litopenaeus setiferus (formerly Penaeus setiferus). White spot syndrome virus (WSSV) is an important pathogen of penaeid shrimp and has been an area of research interest. Studies have also shown that temperature controls around 33 C is effective to prevent disease, reduce mortality and block WSSV replication. In this experiment, we are considering if this is true for Yellow Head virus (YSV) as well. This study uses hemolymph extractions under PCR treatment to consider the effects and virological outcome of increased water temperatures on YSV in Litopenaeus setiferous when compared to the known significance of water temperature on WSSV. A total of 64 gulf white shrimp, Litopenaeus setiferus were divided into 4 groups of 16 and held at comparative high and low temperature. The viral dosage standard was .02 mL of viral homogenate per 5 grams of shrimp. The study was carried out over a 10 day period with the aquarium containing WSSV injected shrimp at a minimum 31 C as the positive control group. All shrimp within the positive control group were determined to be viral antigen negative while the rest of the study individuals resulted in viral antigen positive concluding that a significant difference occurs in the shrimps ability to become susceptible to YSV compared to WSSV when placed in aquariums regulated at temperatures 31-34 C. Although, previous studies have shown that temperature can be a good regulator and cost effective control of White Spot virus, this study supports the conclusion that temperature is not a regulator for controlling the widespread mortality that can occur from YSV and further experiments need to be conducted to better understand the virus and possible prevention methods in an aquaculture setting.

Introduction Litopenaeus setiferus (formerly Penaeus setiferus), is a species found along the Atlantic coast of North America and in the Gulf of Mexico (Muncy, 1984). The Atlantic white shrimp (Litopenaeus setiferus) and the Pacific white shrimp (Litopenaeus vannamei) are 2 species of commercially important penaeid shrimp. Litopenaeus vannamei is already widely aquacultured, while L. setiferus currently supports trawl fisheries in the U.S. mid-Atlantic coastal waters (Bartlett et al. 2002). With the rapid expansion of high density aquaculture of penaeid shrimp and the economic significance of these commercial fisheries, the detection and prevention of infectious diseases, has become increasingly important (Chen & Wang, 1999). Shrimp aquaculture has been negatively affected by infectious disease, with losses exceeding billions of dollars in lost crops, jobs, and export revenue (Lightner 1996a, 1999b, 2005c Bartlett et al. 2002). Because the main goal of commercialized aquaculture is to produce the highest maximum yield many times the animals are
1

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

maintained in highly dense populations. Effective high density parameters are set and utilized so that the largest amount of shrimp can be produced at the lowest per unit of effort (Lotz, et al. 1995). These situations however, generally lead to increased stress and the shrimps susceptibility to infectious diseases. Although there are nearly 20 different viruses recognized in penaeid shrimp, specifically four are of great importance historically and have the potential for significant future adverse effects on shrimp-farming industries including White spot syndrome virus (WSSV), Yellow-head virus (YHV), Taura syndrome virus (TSV), and infectious hypodermal and hematopoietic necrosis virus (IHHNV) (Lightner 1996a, 1996b, 2003c, 2005). In this study we consider more closely the significance of White Spot Disease (WSSV) and Yellow-Head Disease (YHV) which are known to be causative agents of disease, mass mortality and economic loss of cultured penaeid shrimp (Chen & Wang, 1999). Further studies have shown that temperature can have significant effects on decreasing WSSV disease mortality of shrimp populations and act as a regulatory control in minimizing overall economic losses. White spot syndrome virus (WSSV) is an important pathogen of penaeid shrimp and has been an area of research interest. It is widely distributed in most Asian countries where penaeid shrimp are cultured, as well as in North American fisheries including the Gulf of Mexico (Wang et al. 1998). The causative agent of White Spot Disease is white spot syndrome virus (WSSV) or white spot virus (WSV), which is a very large doublestranded DNA (dsDNA) virus recently assigned to its own new genus, Whispovirus, and family, Nimaviridae (Mayo 2002a, 2002b, Lightner 2005). Yellow head disease (YHD), also of great interest to the shrimp-farming community, can cause high mortality in cultured and wild penaeid species (Lu et al. 1994, 1997; Lightner 1999; Pantoja & Lightner 2003a, Lightner 2005) and is characterized by high and rapid mortality that is sometimes accompanied by the gross signs of yellowing of the cephalothorax and general bleaching of body color from which the disease got its name. The causative agent of YHD is YHV, GAV (Gill-Associated virus) strains (Walker et al. 2001, Lightner 2005) and other closely related strains (OIE 2003, Lightner 2005) of the same virus and is described to be a single-stranded, positive sense RNA (ssRNA) virus (Tang and Lightner 1999, Lightner 2005) related to Nidoviruses in the Coronaviridae and Arteriviridae (Sittidilokratna et al. 2002, Lightner 2005). New experiments and research have shown water temperature to have a direct effect on metabolic rate (Allan et al., 2006, M.M. Rahman et al., 2007) , growth and survival ([Wyban et al., 1995, Ponce-Palafox et al., 1997, M.M. Rahman et al., 2007), molting rate (Vijayan and Diwan, 1995, M.M. Rahman et al., 2007), requirement of dissolved oxygen levels (Zhang et al., 2006, M.M. Rahman et al., 2007), tolerance to ammoniaN (Barajas et al., 2006, M.M. Rahman et al., 2007) and immune response of shrimp (Le Moullac and Haffner, 2000, Cheng et al., 2005, M.M. Rahman et al. 2007). For commercialized settings the optimum temperature for growth of shrimp has been previously suggested to be 27 C. Data on Litopanaeus vannamei indicated that temperature optima (temperature of fastest growth) is size-specific and decreases as shrimp size increases. For small shrimp (< 5 g), temperature optima may be greater than 30 C while for larger shrimp, the temperature optimum is about 27 C. These findings appear consistent with the distribution during its natural life history. For all sizes reduced growth and feeding can be expected when temperature is below 23 C and for
2

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

large shrimp when temperature is 30 C or greater (Wyban et al. 1999), however, given the risk for mass mortality from disease, consideration should be given to optimal temperature settings not only for growth, but prevention of disease as well. Studies have also shown that 33 C is effective to prevent disease, reduce mortality and block WSSV replication in early stages of infection (M.M. Rahman et al. 2007). In this experiment, we are considering if this is true for YSV as well, or if further analysis needs to be given to controlling the virus outside of just temperature adjustments. Yellow head virus has been reported in frozen imported commodity shrimp in the United States (Nunan et al. 1998; Durand et al. 2000, Lightner 2005), and incorrectly reported in farmed shrimp from the Americas based on the presentation of severe necrosis of the lymphoid organ, a lesion once thought to be pathognomonic for YHD. More recent work has shown that the presumptive histological diagnoses were due to severe infections with white spot virus, which can cause histopathology in the lymphoid organ which mimics that occurring in severe acute YHD (Lightner 1996a; Lightner et al. 1998; Lightner and Redman 1998, Lightner 2005). Because WSSV is a dsDNA derived virus and YHV is an ssRNA derived virus, separate procedures need to be used to detect presence or absence and the samples should be analyzed by PCR analysis to confirm or rule out the presence of the virus. This study uses PCR to consider the effects and virological outcome of increased water temperatures on YSV in Litopenaeus setiferous when compared to the known significance of water temperature on WSSV.

Materials and Methods 2.1 Shrimp & Virus stock In total 64 specimens of gulf white shrimp, Litopenaeus setiferus, were used in this bio-assay. All shrimp were obtained from The University of Southern Mississippis Gulf Coast research Laboratory. Each shrimp ranged in size from 10.5g to 19.5g. Mean shrimp weight was 15.96 g with each aquarias mean weight within 1 g of the overall mean weight (table 1). The virus used in this study is of Chinese origin and was obtained from previous bioassays conducted at the University of Mississippis Gulf Coast Research Laboratory.
Number of Shrimp Mean Weight 10WS- High 3WS-Low 9YH-High 4YH-Low 16 16 16 16 15.67 16.86 15.14 16.16

Table 1: Mean weights for each tank

2.2 WSSV and YSV injection procedure The individual weight was used to determine the injection standard dosage, so that all shrimp received the same volume per weight in grams. The dosage standard was .02 mL of viral homogenate per 5 grams of shrimp. The virus was obtained from minced cephalothoraxes of previously injected shrimp, mixed at a dilution of 1g per .02 of saline solution. Each shrimp was inoculated intramuscularly in the junction between
3

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

the third and fourth abdominal segments containing the specified dose of either WSSV (32 individuals) or YSV (32 individuals). Shrimp were monitored for any deaths due to injection and noted. 2.3 Experimental Conditions The 64 shrimp were divided into 4 groups of 16 and held at comparative high and low temperature. Large 1,000 gallon aquariums were filled with approximately 150 gallons (8 inches deep) of naturally dechlorinated saltwater obtained from the Davis Bayou at a salinity of 15 g/l. Baskets divided into 4 chambers with an individual contained in each chamber were placed inside the larger aquariums. Two aquariums were maintained at temperatures between 25- 27 C using a water evaporative fan cooling system equipped with a chiller while two aquariums were maintained at temperatures between 31-34 C using heated coils inside the tanks. All tanks were maintained on a continuous aeration and circulation system. The study was carried out over a 10 day period with the aquarium containing WSSV injected shrimp at a minimum 31 C as the positive control group. Mortality and water temperature checks were made every 3 hours continuously over the 10 day study period. Approximately .2 g of a commercial shrimp diet was provided per shrimp per day. Upon death or near death (euthanasia) hemolymph was extracted from each individual to determine viral presence or absence in a laboratory using a PCR treatment. 2.4 Laboratory Protocols In order to determine the presence or absence of the virus, molecular procedures were used to analyze the hemolymph extractions of DNA and RNA samples for WSSV and YHV, respectively. 2.4.1 White Spot Disease: DNA was extracted from each hemolymph sample using a Roche High Pure PCR template preparation kit, following the manufacturers guidelines. The purity and concentration of the extracted DNA was assessed using a Nanodrop spectrophotometer. The isolated DNA was used as the unknown template in the PCR reactions. The gene selected was a 500 base pair fragment previously established in past studies as a reliable method of evaluation for presence of WSSV. A GE Healthcare Ready-to-Go PCR beads kit was used for the PCR amplification. 1.0 L of purified DNA, 0.5 L of forward primer, and 0.5 l of reverse primer were added to each bead and the reaction was carried out following the manufacturers protocol.

WSSV Primers & Sequence

500 base Pair Fragment Primer Sequence Forward Primer C C T T C C A T C T C C A C C A C A C T T Reverse Primer C T G T T C C T T G G C A G A G C A T T C

Figure 1: Primers and sequencing for WSSV PCR treatment

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

A PTC-200 Peltier Thermal cycler was used for the denaturing, binding, and extension of the samples. Thermo-cycling conditions were as follows: 1 cycle at 95 C for 5 min., 30 cycles of [94 for 30 sec., 62 for 30 sec., 72 for 30 sec.], 1 cycle at 72 for 2 min., and then held at 4 C until removed. 2.4.2 Yellow Head Disease: To consider presence or absence of YHV, extractions of RNA were taken from each hemolymph sample using a Roche High Pure Viral Nucleic Acid kit, following protocol as described by Lu et al (2004). The purity and concentration of the extracted RNA was also assessed using the Nanodrop spectrophotometer. The isolated RNA was then used as the unknown template in the PCR reactions. The gene selected was a 273 base pair fragment also to have been previously established in past studies as a reliable method of evaluation for presence of YHV. The same GE Healthcare Ready-to-Go PCR beads kit was used for the PCR amplification. 1.0 L of purified RNA, 0.5 L of forward primer, and 0.5 l of reverse primer were added to each bead and the reaction was carried out following the manufacturers guidelines.

YHV Primers & Sequence

273 base Pair Fragment Primer Sequence Forward Primer CAAGATCTCACGGCAACTCA Reverse Primer CCGACGAGAGTGTTAGGAGG
Figure 2: Primers and sequencing for YHV PCR treatment

The PTC-200 Peltier Thermal cycler was again used for the denaturing, binding, and extension of the samples. Thermocycling conditions were as follows: 1 cycle at 50 C for 30 min., 1 cycle at 94 C for 2 min., 40 cycles of [94 for 15 sec., 55 for 30 sec., 68 for 30 sec.], 1 cycle at 68 for 5 min., and then held at 4 C until removed. 2.4.3 Analyzing the PCR Product The pure DNA and RNA samples were loaded into individual wells on two different 1.5% Agarose gels stained with ethidium bromide to visualize the PCR product. A concentration of 5l of 6x loading dye mixed with 25 l of sample was used. An appropriate ladder, positive, and negative controls were added to the series as a reference. The gel was then processed in an electrophoresis chamber filled with sodium borate for 15 min. at 300 volts. Using a UV transilluminator, the gels were analyzed under light to determine if it was successfully amplified. Result photos were taken of the completed gels with a Biorad ChemDoc imager (see Figure 3 & 4 below).
5

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

Results Because the effects of WSSV in high temperature are already known, this group was considered the positive control group. All animals within this group (10WS-H-(1-16) maintained a 100% survival rate throughout the 10 experimental days and were then euthanized. All shrimp were viral antigen negative (Table 2). The second aquarium containing animals also injected with WSSV but held at lower temperatures (3WS-L(1-16) were all viral antigen positive at death or euthanasia (Table 3). The animals died at an average rate of 28-29 h postexposure (Table 3). The gel results can be seen in Figure 3 below.
Shrimp ID 10WS-H-1 10WS-H-2 10WS-H-3 10WS-H-4 10WS-H-5 10WS-H-6 10WS-H-7 10WS-H-8 10WS-H-9 10WS-H-10 10WS-H-11 10WS-H-12 10WS-H-13 10WS-H-14 10WS-H-15 10WS-H-16 Average Weight (g) 14.5 17.9 14.9 15.5 14.2 16.1 15.9 13.8 18.4 18.2 16.5 16.5 12.8 18.7 10.5 16.3 15.7 viral load (l) 58.0 71.6 59.6 62.0 56.8 64.4 63.6 55.2 73.6 72.8 66.0 66.0 51.2 74.8 42.0 65.2 62.7 Mortality Day Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 Day 10 complete Survival Hours 240 240 240 240 240 240 240 240 240 240 240 240 240 240 240 240 100% Survival in Days 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 10.00 100% Virus 100%

Table 2: Results are from tank 10 containing 16 individuals injected with WSSV and maintained at 31-34 C including animal weights, exact viral loads injected intramuscularly, survival rates and PCR viral presence. (The positive control group.)

Shrimp ID Weight (g) viral load (l) Mortality Day Survival Hours Survival in Days Virus 3WS-L-1 14.6 58.4 Day 1 18 0.75 + 3WS-L-2 18.1 72.4 Day 2 24 1.00 + 3WS-L-3 14.4 57.6 Day 2 27 1.13 + 3WS-L-4 18.5 74.0 Day 2 24 1.00 + 3WS-L-5 16.1 64.4 Day 2 30 1.25 + 3WS-L-6 19.0 76.0 Day 2 30 1.25 + 3WS-L-7 18.9 75.6 Day 2 27 1.13 + 3WS-L-8 13.0 52.0 Day 2 24 1.00 + 3WS-L-9 19.5 78.0 Day 3 53 2.21 + 3WS-L-10 19.2 76.8 Day 2 24 1.00 + 3WS-L-11 12.8 51.2 Day 3 33 1.38 + 3WS-L-12 19.1 76.4 Day 3 53 2.21 + 3WS-L-13 18.4 73.6 Day 2 30 1.25 + 3WS-L-14 18.7 74.8 Day 1 18 0.75 + 3WS-L-15 12.8 51.2 Day 2 27 1.13 + 3WS-L-16 16.7 66.8 Day 1 21 0.88 + Average 16.9 67.5 28.94 1.21 100%

Table 3: Results are from tank 3 containing 16 individuals injected with WSSV and maintained at 25-27 C including animal weights, exact viral loads injected intramuscularly, survival rates and PCR viral presence.

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

Figure 3: Agarose Gel images for WSSV

Both the high and low temperature aquariums containing the animals injected with YHV turned out to be 100% viral antigen positive at death or euthanasia (Tables 4 & 5). When running the pure PCR product on the agarose gel, for wells 14, 15, & 16, an error did occur by using the wrong result sample ensuing a blank run for those animals. This was corrected and rerun on another gel using the pure PCR product where it also showed positive for presence of the virus (Figure 4). The shrimp exposed to YSV died at an average rate of 55-56 h postexposure in the high temperature tank, and 78-79 h postexposure in the low temperature tank. Six animals died due to injection and were considered to be nonviral mortalities. These can be seen clearly in the gel results (Figure 4), and have been highlighted in the describing tables (Tables 4 & 5). All of these animals died before the first scheduled check (within the first 3 hours of the study). Although the virus is still present, it is not as strong as the others and resulted in a fainter streaking. These shrimp were still included in the analysis, however, since there was evidence in the gels that the virus was present, and it is assumed that they would have died in accordance with the rest of the aquarium population. The results would not have changed if they had been excluded from the overall analysis, as all the remaining shrimp were viral antigen positive.

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

Shrimp ID Weight (g) viral load (l) Mortality Day Survival Hours Survival in Days Virus 9YH-H-1 18.1 72.4 Day 5 96 4.00 + 9YH-H-2 18.2 72.8 Day 5 96 4.00 + 9YH-H-3 17.5 70.0 Day 4 88 3.67 + 9YH-H-4 14.6 58.4 Day 1 3 0.13 + 9YH-H-5 15.5 62.0 Day 3 54 2.25 + 9YH-H-6 15.6 62.4 Day 1 3 0.13 + 9YH-H-7 15.8 63.2 Day 4 83 3.46 + 9YH-H-8 15.1 60.4 Day 3 57 2.38 + 9YH-H-9 14.4 57.6 Day 1 3 0.13 + 9YH-H-10 11.7 `48.0 Day 3 51 2.13 + 9YH-H-11 13.0 52.0 Day 1 3 0.13 + 9YH-H-12 14.8 59.2 Day 3 51 2.13 + 9YH-H-13 16.2 64.8 Day 3 57 2.38 + 9YH-H-14 14.7 58.8 Day 2 42 1.75 + 9YH-H-15 14.0 56.0 Day 4 88 3.67 + 9YH-H-16 13.0 52.0 Day 5 114 4.75 + Average 15.1 61.5 55.56 2.32 100% Avg. Survival Rate (in days) excluding injection deaths 3.05

Table 4: Results for tank 9 containing 16 shrimp injected with YSV and maintained at 31-34 C incl. animal weights, exact viral loads injected intramuscularly, survival rates and PCR viral presence. Highlighted data represents those considered as injection mortalities.

Shrimp ID Weight (g) viral load (l) Mortality Day Survival Hours Survival in Days Virus 4YH-L-3 17.3 69.2 Day 4 75 3.13 + 4YH-L-4 18.9 75.6 Day 3 54 2.25 + 4YH-L-5 14.3 57.2 Day 1 3 0.13 + 4YH-L-6 17.9 71.6 Day 5 102 4.25 + 4YH-L-7 16.2 64.8 Day 5 114 4.75 + 4YH-L-8 14.8 59.2 Day 5 78 3.25 + 4YH-L-9 14.3 57.2 Day 5 78 3.25 + 4YH-L-10 15.0 60.0 Day 5 105 4.38 + 4YH-L-11 15.9 63.6 Day 5 117 4.88 + 4YH-L-12 19.0 76.0 Day 3 69 2.88 + 4YH-L-13 17.8 71.2 Day 3 54 2.25 + 4YH-L-14 19.5 78.0 Day 5 114 4.75 + 4YH-L-15 12.4 49.6 Day 3 63 2.63 + 4YH-L-16 13.9 55.6 Day 5 78 3.25 + Average 16.2 64.9 78.86 3.29 100% Avg. Survival Rate (in days) excluding injection deaths 3.44

Table 5: Results for tank 4 containing 16 shrimp injected with YSV and maintained at 25-27 C incl. animal weights, exact viral loads injected intramuscularly, survival rates and PCR viral presence. Highlighted data represents those considered as injection mortalities.

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

Figure 4: Agarose Gel images for YSV

Discussion This study resulted in a significant difference in the shrimps ability to become susceptible to YSV compared to WSSV when placed in aquariums regulated at temperatures 31-34 C. Temperature cannot effectively be a good means of regulating Yellow Head virus in the same manner that it can be used to control mortality of White Spot disease. It was interesting to see a clear difference in the susceptibility and immune response of shrimp to YHV when compared to WSSV. Identification of the viral responsive genes ,including those encoding structural proteins, defense and homeostasis proteins, energy metabolism enzymes, transcription or translation proteins and other unknown functioning proteins, have been identified for WSSV, however, the responses of shrimp to YHV infection at the molecular level are generally poorly described (Pongsomboon et al. 2008). One study conducted by Prapavorat et al., 2010 have recently revealed YHV-responsive genes from SSH libraries including caspases, histidine triad nucleotide-binding protein 2, Rab11, -integrin, tetraspanin, prostaglandin E synthase, transglutaminase, Kazal-type serine proteinase inhibitor and antimicrobial peptides. Among these YHV-responsive genes, several have been previously reported to participate in defense against White Spot Syndrome Virus (WSSV) implying that YHV infection in shrimp induces similar host immune responses as observed during WSSV infection (Prapavorat et al., 2010). Although another previous study has additionally
9

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

suggested that PmRab7 is a common cellular factor required for WSSV or YHV replication in shrimp (Ongvarrasopone, C. et al, 2008) other reported studies have concluded different gene expression profiles observed in response to WSSV and YHV, suggesting different host immune responses between the viruses (Pongsomboon et al., 2008). It is clear from the results of this experiment and our current understanding of Yellow Head disease that more effort needs to be implemented in further understanding YSV and possible control methods for commercialized aquaculture. Currently there is no effective prevention or treatment of YHV infections (Assavalapsakul et al, 2009); although Assavalapsakul et al studies suggest that a YHV-Pro dsRNA (a prophylactic agent to inhibit YHV replication) could efficiently reduce YHV replication when administered prior to infection. At present time the necessary cost analyses have not been conducted to determine if this method could in fact be an implementable tool in a commercialized setting, where costs must be minimized in order to maximize profits. In order for us to increase production in farm raised shrimp, dedication to finding a cost-effective means of control needs to be realized. Although, previous studies have shown that temperature can be a good regulator and cost effective control of White Spot virus, this study supports the conclusion that temperature is not a regulator for controlling the widespread mortality that can occur from YSV.

10

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011

References
Assavalapsakul, Wanchai, Chinnirunvong, Wanlop, Panyim, Sakol, 2009. Application of YHV-protease dsRNA for protection and therapeutic treatment against yellow head virus infection in Litopenaeus vannamei. Diseases of Aquatic Organisms 84: 167-171 Bartlett, Thomas C., Cuthbertson, Brandon J., Shepard, Eleanor F., Chapman, Robert W., Gross, Paul S. and Warr Gregory W., 2002. Crustins, Homologues of an 11.5-kDa Antibacterial Peptide, from Two Species of Penaeid Shrimp, Litopenaeus vannamei and Litopenaeus setiferus Marine Biotechnology 4: 278-293 Chen, S.N., Wang, C.S. 1999. Establishment of cell culture systems from penaeid shrimp and their susceptibility to white spot disease and yellow head viruses. Methods in Cell Science 21: 199-206 Lightner, Donald V., 2005. The penaeid shrimp viral pandemics due to IHHNV, WSSV, TSV and YHV: History in the Americas and current status. Taken from: http://www.lib.noaa.gov/retiredsites/japan/aquaculture/proceedings/report32/lightner_corrected.pdf Lotz, Jeffrey M., Browdy, Craig L., Carr, William H., Frelier, Paul F., Lightner, Donald V., 1995. USMSFP suggested procedures and guidelines for assuring the specific pathogen status of shrimp broodstock and seed. Pp. 66-75. In C.L. Browdy and J.S. Hopkins editors. Swimming Trough Troubled Waters, Proceedings of the Special Session on Shrimp Farming. The World Aquaculture Society. Lu, Yufeng., Wang, Shiao Y., Lotz, Jeffrey M., 2004. The use of differential display to isolate viral genomic sequence for rapid development of PCR-based detection methods: A test case using Taura syndrome virus. Journal of Virological Methods 121: 107-114 Muncy, Robert J., 1984. White shrimp. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic). United States Fish and Wildlife Service. pp. 119. FWS/OBS-82/11.27 Ongvarrasopone, C., Chanasakulniyom, M., Sritunyalucksana, K., Panyim, S., 2008. Suppression of PmRab7 by dsRNA inhibits WSSV or YHV infection in shrimp. Mar Biotechnol 10: 374-381 Pongsomboon, Siriporn, Tang, Sureerat, Boonda, Suleeporn, Aoki, Takashi, Hirono, Ikuo, Yasuike, Motoshige, Tassanakajon, Anchalee, 2008. Differentially expressed genes in Penaeus monodon hemocytes following infection with yellow head virus Siriporn. Taken from: http://www.bmbreports.org/jbmb/jbmb_files/%5B419%5D0809300835_(670-677)BMB087(08-025).pdf Prapavorarata, Adisak, Pongsomboona, Siriporn, Tassanakajon, Anchalee, 2010. Identification of genes expressed in response to yellow head virus infection in the black tiger shrimp, Penaeus monodon, by suppression subtractive hybridization. Developmental & Comparative Immunology 34: 611-617 Rahman, M.M, Corteel, M., Willie, M., Alday-Sanz, V., Pensaert, M.B., Sorgeloos, P., Nauwynck, H.J., 2007. The effect of raising water temperature to 33 C in Penaeus vannamei juveniles at different stages of infection with white spot syndrome virus (WSSV). Aquaculture 272: 240-245

11

Water temperature effects of WSSV and YHV infections in Litopenaeus setiferus August 10, 2011 Wang Qiong, White, Brenda L., Redman, Rita M. and Lightner, Donald V., 1998. Per os challenge of Litopenaeus vannamei postlarvae and Farfantepenaeus duorarum juveniles with six geographic isolates of white spot syndrome virus 170: 179-194 Wyban, James, Walsh, William A., Godin, David M., 1999 Temperature effects on growth, feeding rate and feed conversion of the Pacific white shrimp (Penaeus vannamei) Aquaculture 138: 267-279

12