You are on page 1of 20

ANHANGUERA EDUCACIONAL Faculdade Anhanguera de Anpolis

Curso: Disciplina: Professor: Aluno (a):

Farmcia Gentica Marcelo Garcez Rodrigues

Perodo: 2 Turma: Visto: Matutino e Noturno Aula de Reviso Data: ____/____/2013

Estudo Dirigido [2 Verificao da Aprendizagem] Alelos Mltiplos: 1. Uma pessoa do grupo sanguneo A pode receber sangue de pessoas de que grupos e doar para pessoas de que grupos? a) Pode receber de A, B, AB e O, e doar apenas para AB. b) Pode receber de A e O, e doar para A e AB. c) Pode receber de B e O, e doar para B e AB. d) Pode receber apenas de O, e doar para A, B, AB e O. 2. Uma pessoa do grupo sanguneo B pode receber sangue de pessoas de que grupos e doar para pessoas de que grupos? a) Pode receber de A, B, AB e O, e doar apenas para AB. b) Pode receber de A e O, e doar para A e AB. c) Pode receber de B e O, e doar para B e AB. d) Pode receber apenas de O, e doar para A, B, AB e O. 3. Uma pessoa do grupo sanguneo AB pode receber sangue de pessoas de que grupos e doar para pessoas de que grupos? a) Pode receber de A, B, AB e O, e doar apenas para AB. b) Pode receber de A e O, e doar para A e AB. c) Pode receber de B e O, e doar para B e AB. d) Pode receber apenas de O, e doar para A, B, AB e O. 4. Uma pessoa do grupo sanguneo O pode receber sangue de pessoas de que grupos e doar para pessoas de que grupos? a) Pode receber de A, B, AB e O, e doar apenas para AB. b) Pode receber de A e O, e doar para A e AB. c) Pode receber de B e O, e doar para B e AB. d) Pode receber apenas de O, e doar para A, B, AB e O. 5. Em uma transfuso de sangue, um indivduo AB Rh+ recebe sangue de um indivduo A Rh-. Nessa transfuso, espera-se que: a) no ocorra aglutinao, pois o soro do receptor no possui aglutininas, e o doador no possui o fator Rh. b) ocorra aglutinao, pois as hemcias do doador possuem aglutinognio A, e o receptor possui o fator Rh. c) ocorra aglutinao, pois o soro do doador contm aglutinina anti-B, que aglutinar as hemcias do receptor.

d) no ocorra aglutinao, pois as hemcias do receptor so indiferentes s aglutininas anti-A do soro do doador. e) no ocorra aglutinao, pois o soro do doador no possui aglutininas incompatveis com os aglutinognios do receptor. 6. Uma mulher do grupo sanguneo B precisa urgentemente receber sangue. Sabendo que seu marido pertence ao grupo A e que seus dois filhos so um do grupo AB e outro do grupo O, determine: a) as pessoas, dentre as citadas, que podero doar sangue a essa mulher; b) o gentipo das pessoas envolvidas. 7. Uma mulher do grupo AB casada com um homem cujos avs paternos e maternos pertencem ao grupo O. Como podero ser os fentipos sanguneos dos filhos desse casal? 8. Num casal, o homem e a mulher tm o sangue do mesmo tipo (AB). Se esse casal tiver oito filhos, qual o nmero provvel de filhos portadores do grupo sanguneo AB? 9. Qual a condio para que pais com sangue tipo A e tipo B tenham filhos com sangue tipo O? 10. Quais os tipos de sangue dos filhos de um casal em que o pai pertence ao grupo AB e a me ao grupo O? 11. Explique por que uma pessoa do grupo A no pode doar sangue a uma pessoa do grupo O. 12. Explique por que uma pessoa do grupo AB no pode doar sangue a uma pessoa do grupo B. 13. Uma mulher teve, numa segunda gravidez, uma criana com DHRN. O terceiro filho, porm, nasceu normal. Determine os fentipos e gentipos do casal e de seus trs filhos quanto ao sistema Rh. 14. Uma mulher teve um beb com doena hemoltica do recm-nascido (eritroblastose fetal) por incompatibilidade sangunea do sistema Rh. Por que a criana desenvolveu a doena? Qual o gentipo da mulher, do marido e do beb, quanto ao grupo Rh? 15. O sangue de uma criana Rh- O e o de sua me Rh+ A. O gentipo do pai pode ser: a) RrIAIA. b) RRIAi. c) RRii. d) rrIAIB. e) RrIAi. 16. Um casal de sangue Rh positivo, cujo gentipo Rr, tem trs filhos tambm Rh positivos. A probabilidade de o quarto filho desse casal ter o mesmo fentipo dos pais e dos irmos : a) nula. b) 25%. c) 50%. d) 75%. e) 100%. 17. Um homem Rh+ heterozigoto com sangue do grupo AB casa-se com mulher Rh- , com sangue do grupo O. O casal no pode ter filhos: a) Rh+AB. b) Rh+A. c) Rh-B. d) Rh+B. e) Rh-A. 18. O pai de uma criana do grupo sangneo A e Rh+, cuja me B e Rh-, poderia ser: a) AB e Rh+. b) AB e Rh-. c) B e Rh+. d) A e Rh-. e) O e Rh+.

19. Um homem, cujo grupo sangneo do tipo AB, casa-se com uma mulher do grupo O. Qual a probabilidade de este casal ter um filho com grupo sangneo do tipo AB? E do tipo O? 103. Uma mulher do tipo sangneo B e Rh+. Tem um filho do tipo A e Rh-. Dentre dois homens, um do grupo O e Rh+ e outro do AB e Rh+, est o possvel pai. Pergunta-se: a) Qual dos homens poderia ser excludo da paternidade? b) Qual o gentipo da me e do provvel pai? 20. O pai e a me de um par de gmeos dizigticos tm tipo sangneo A. Uma outra criana desse casal do grupo sangneo O. a) Quais os gentipos do pai e da me? b) Qual a probabilidade de que ambos os gmeos tenham sangue do tipo O? 21. A rvore genealgica a seguir representa uma famlia estudada quanto aos grupos sanguneos do sistema ABO e do sistema Rh. Na rvore, o smbolo que representa as pessoas quadrado para homem e crculo para mulher dividido por um trao vertical, com o lado esquerdo representando o fentipo para o sistema ABO, e o lado direito representando o fentipo para o sistema Rh. AB 1 ARh5 O 2 3 ORh+ 6 Rh4

a) Qual a probabilidade de um filho do casal 5 x 6 ter sangue dos tipos O/Rh + ou A/Rh? b) Quando o homem 6 ainda era noivo da mulher 5, uma antiga namorada O/Rh+ o acusou de ser pai de seu filho, uma criana A/Rh-. Pelo que se conhece sobre herana dos grupos sanguneos, essa acusao tem procedncia? 22. Esto representados na rvore genealgica os tipos de grupo sanguneo de cada um de seus integrantes. De acordo com a mesma, responda: B A 2 A 5 1 O 6 1 O 10 11 A 12 B O

B 7 1 B 13 B 8 1 B 14

4 1
AB 9 1 A 15 A

a) Quais os gentipos dos indivduos mostrados na genealogia? b) Qual a probabilidade de um descendente do casal 12 x 13 ter sangue do tipo O? c) Imagine que o casal 12 x 13 gere um filho que no pode receber nenhum tipo de sangue, a no ser de tipo idntico ao seu. Se esse indivduo vier a se casar com uma mulher de sangue tipo A, heterozigota, qual ser a probabilidade de o casal ter um filho com sangue do tipo O e do sexo masculino? 23. Analisando o heredograma abaixo, sabe-se que os indivduos (1) e (3) pertencem ao grupo sanguneo AB e que suas respectivas esposas (2) e (3) pertencem ao grupo sanguneo O. AB 1 O 2 AB 3 O 4

Neto A probabilidade de o neto desses dois casais pertencer ao grupo sanguneo O (zero) de: a) 1/4. b) zero. c) 1/3. d) 1/2. e) 3/4. 24. Com base no heredograma abaixo, responda: ABRh+ 1 BRh+ 5 ORh2 ORh3 ARh6 ABRh+ 4

a) Qual a probabilidade de o casal formado por 5 e 6 ter duas crianas com sangue ABRh+? b) Se o casal em questo j tiver uma criana com sangue ABRh+, qual a probabilidade de ter outra com o mesmo fentipo sanguneo e do sexo masculino? Herana e Sexo: 25. Quais das estruturas mencionadas permitem diferenciar os dois sexos em diversas espcies? a) Autossomos. b) Crommeros. c) Cromossomos homlogos. d) Cromossomos sexuais.

26. Como so denominados os cromossomos que no variam entre os sexos? a) Autossomos. b) Crommeros. c) Cromossomos homlogos. d) Cromossomos sexuais. 27. Como se denomina o sexo que forma dois tipos diferentes de gameta quanto aos cromossomos sexuais? a) Sexo homogamtico. b) Sexo heterogamtico. c) Sexo masculino. d) Sexo feminino. 28. Como se denomina o sexo que forma apenas um tipo de gameta quanto aos cromossomos sexuais? a) Sexo homogamtico. b) Sexo heterogamtico. c) Sexo masculino. d) Sexo feminino. 29. Gene holndrico um termo utilizado para designar genes localizados: a) Na cromatina sexual. b) No cromossomo X. c) No cromossomo Y. d) Nos autossomos. 30. Cromatina sexual refere-se: a) ao cromossomo Y condensado no espermatozoide. b) ao cromossomo X condensado no vulo. c) ao cromossomo X dos machos condensado durante a intrfase. d) a um dos cromossomos X das fmeas condensado durante a intrfase. 31. Em uma espcie de gafanhoto, as fmeas possuem 20 cromossomos nas clulas dos gnglios nervosos. Sabendo-se que nessa espcie o sistema de determinao do sexo do tipo XO, espera-se que: a) 100% dos vulos tenham 10 cromossomos e que 100% dos espermatozoides tenham 9 cromossomos. b) 100% dos vulos e 100% dos espermatozoides tenham 10 cromossomos. c) 100% dos vulos e 50% dos espermatozoides tenham 10 cromossomos, e que 50% dos espermatozoides tenham 9 cromossomos. d) 100% dos espermatozoides e 50% dos vulos tenham 10 cromossomos, e que 50% dos vulos tenham 9 cromossomos. 32. Considere duas espcies, uma com sistema de determinao do sexo do tipo XY e outra com sistema do tipo ZW. Quem determina o sexo da prole : a) a fmea em ambos os casos. b) a fmea no primeiro caso e o macho no segundo. c) o macho em ambos os casos. d) o macho no primeiro caso e a fmea no segundo.

33. Considere as afirmaes: I. Em humanos, a determinao do sexo cromossmicos do zigoto (XX ou XY) depende do gameta masculino que fecunda o vulo. II. Em mamferos, as fmeas possuem apenas um cromossomo X e os machos, dois. III. Em mamferos, nas clulas somticas de fmeas normais, possvel observar o cromossomo X que foi inativado, pois este corresponde ao corpsculo de Barr ou cromatina sexual. Est (o) correta (s)? a) apenas I. b) apenas II. c) apenas III. d) apenas I e II. e) apenas I e III. 34. As chances de um beb nascer menino ou menina so aproximadamente iguais. Faa o cruzamento que justifique tal afirmativa. 35. Complete: As caractersticas que obedecem herana ligada ao __________ so condicionadas por alelos situados na poro do cromossomo _____ no-________________ ao cromossomo _________. Os alelos que condicionam caractersticas do tipo herana ligada ao cromossomo Y (ou __________________ ao sexo), esto presente apenas no cromossomo Y e so denominados ______________, porque existem apenas nos ________________ e so transmitidos diretamente do ___________ para os filhos do sexo ___________________________. A herana dita _____________________ pelo sexo quando os genes que determinam um certo carter expressam-se melhor de acordo com o _____________ do indivduo (exemplo: __________________ humana). 36. O que cromatina sexual ou corpsculo de Barr e qual sua relao com o mecanismo de compensao de dose? 37. O daltonismo (cegueira para cores) condicionado por um alelo recessivo ligado ao cromossomo X. Uma mulher normal, cujo pai era daltnico, casa-se com um homem daltnico. Pergunta-se: a) Quais so os possveis gentipos da me da mulher? E da me do homem? b) Qual a probabilidade de que um filho homem do casal seja daltnico? c) Que porcentagem de mulheres daltnicas se pode prever entre as filhas desse casal? d) Que porcentagem de filhos (homens e mulheres) normais se pode prever entre os descendentes desse casal? 38. Um indivduo daltnico e no mope, filho de pai mope, casa-se com uma mulher normal para ambas as caractersticas. O casal j tem uma filha daltnica e mope. Sabendo que o daltonismo condicionado por um gene recessivo ligado ao sexo e que a miopias uma herana autossmica recessiva, a probabilidade de terem uma menina normal para ambas as caractersticas de: a) 3/16. b) 1/4. c) 1/16. d) 1/2. e) 9/16.

39. Qual a condio para que uma mulher normal tenha filho (homem) hemoflico? 40. Uma mulher normal, cujo pai era daltnico, casa-se com um homem daltnico. Responda: a) Quais os possveis gentipos da me do homem daltnico? b) Qual a porcentagem de daltonismo prevista entre as filhas do casal? c) Qual a probabilidade de o casal ter um menino daltnico? 41. Um casal normal para hemofilia teve seis filhas normais e trs filhos, sendo um hemoflico e dois normais. Pergunta-se: a) Qual o gentipo dos pais? b) Qual era a probabilidade de as filhas terem nascido portadoras? 42. Fernando hemoflico, embora seus pais, Jorge e Clara, sejam normais. O bisav de Jorge era hemoflico. Por esta razo, Clara tem convico de que Jorge o responsvel pela hemofilia de Fernando. Explique se Clara est certa ou no. 43. Um casal de viso normal tem uma criana daltnica. A partir desses dados, responda: a) Qual o sexo da criana? b) Das 3 pessoas citadas, qual(is) possui(em) o gene recessivo que condiciona o daltonismo? E qual(is) possui(em) o gene que condiciona a viso normal? c) Se os pais da mulher tiverem viso normal, pode-se dizer que ele recebeu o alelo para daltonismo de que genitor? d) Se a criana, mais tarde, se casar com pessoa de viso normal, cujo pai daltnico, que tipos de filhos poder ter em relao viso? 44. Um casal de no-hemoflicos tem um filho com hemofilia. Responda: a) Qual a probabilidade de que uma filha desse casal apresente a doena? b) Qual a probabilidade de que uma outra criana deste casal seja do sexo masculino e hemoflico? 45. Interprete o heredograma abaixo:

Identifique o mais provvel padro de herana representado no heredograma: a) autossmica dominante; b) ligada ao X dominante; c) ligada ao Y dominante; d) ligada ao Y recessiva; e) ligada ao X recessiva.

46. Em seres humanos, uma forma de daltonismo que provoca cegueira para as cores vermelha e verde determinada pelo alelo recessivo d, ligado ao cromossomo X. Ao consultar um mdico, um casal fica sabendo que todos os seus filhos do sexo masculino sero daltnicos; j as meninas sero normais. Qual das opes fenotpicas abaixo corresponde do casal em questo? a) Homem normal e mulher normal. b) Homem normal e mulher daltnica. c) Homem daltnico e mulher daltnica. d) Homem daltnico e mulher normal. e) Homem normal e mulher normal, porm portadora do alelo recessivo d. 47. Em drosfila, o carter cerdas retorcidas determinado por um alelo recessivo e ligado ao sexo. O alelo dominante determina cerdas normais (no retorcidas). Uma fmea heterozigota foi cruzada com um macho normal. A descendncia esperada ser de: a) 50% de machos e 50% de fmeas normais e 50% de machos e 50% de fmeas com cerdas retorcidas. b) 50% de machos normais, 50% de machos com cerdas retorcidas e 100% de fmeas normais. c) 100% de machos normais, 50% de fmeas com cerdas retorcidas e 50% de fmeas normais. d) 100% de machos com cerdas retorcidas e 100% de fmeas normais. e) 100% de machos normais e 100% de fmeas com cerdas retorcidas. 48. No heredograma a seguir, ocorrem dois meninos hemoflicos. A hemofilia tem herana recessiva ligada ao cromossomo X. I I

II I III I a) Qual a probabilidade de que uma segunda criana de II-4 e II-5 seja afetada? b) Qual a probabilidade de II-2 ser portadora do alelo que causa a hemofilia? c) Se o av materno de II-4 era afetado, qual era o fentipo da av materna? Justifique sua resposta. 49. A hemofilia uma doena recessiva ligada ao sexo, que se caracteriza pela dificuldade de coagulao do sangue. Em um casal em que a mulher heterozigota para a hemofilia e o marido normal, a probabilidade de nascimento de uma criana do sexo masculino e hemoflica : a) 1/2. b) 1/3. c) 1/4.

d) 1/8. e) 3/4. 50. Um homem no transmite seus caracteres ligados ao sexo para seus filhos (homens). A afirmao correta ou errada? Justifique. 51. Um homem trabalha como radiologista e devido ao grande tempo de exposio aos raiosX, foi identificada, nos seus gametas, uma mutao numa regio do cromossomo Y relacionada viso. Este homem teve uma filha (do sexo feminino) cega e a mulher culpa o marido como o responsvel pela deficincia da filha. Ela est certa ou errada? Justifique. 52. Uma mulher portadora de um alelo letal ligado ao sexo, que causa aborto espontneo. Supondo que 3 de suas gestaes se completem, qual o nmero esperado para crianas do sexo masculino, entre as que nascerem? DNA e Mutaes Gnicas: 53. A polimerase do DNA uma enzima que: a) sintetiza a base nitrogenada uracila. b) atua na sntese dos ribonucleotdios. c) sintetiza RNA utilizando uma das fitas do DNA como molde. d) realizao a duplicao das molculas de DNA. 54. A polimerase do RNA uma enzima que: a) sintetiza a base nitrogenada uracila. b) atua na sntese dos ribonucleotdios. c) sintetiza RNA utilizando uma das fitas do DNA como molde. d) realizao a duplicao das molculas de DNA. 55. O RNA transportador (RNAt) sintetizado: a) no cromossomo, tendo como modelo o DNA. b) no DNA, tendo como modelo protenas. c) no ribossomo, tendo como modelo o RNAr. d) no nuclolo, tendo como modelo o RNAm. 56. O RNA mensageiro (RNAm) sintetizado: a) no cromossomo, tendo como modelo o DNA. b) no DNA, tendo como modelo protenas. c) no ribossomo, tendo como modelo o RNAr. d) no nuclolo, tendo como modelo o RNAm. 57. Sobre os diferentes papis dos cidos nuclicos na sntese de protenas, podemos afirmar corretamente que: a) a sequncia de bases no DNA determina a sequncia de aminocidos na cadeia polipeptdica. b) a posio dos aminocidos na cadeia polipeptdica depende da sequncia de bases do RNAt. c) o transporte de aminocidos para o local da sntese feito pelo RNAm. d) a sequncia de bases do RNAr transcrita a partir do cdigo do RNAm. e) a extremidade livre dos diversos RNAt tem sequncia de bases diferentes.

58. Se uma protena possui 100 aminocidos, quantos cdons, que especificam esses aminocidos, devem estar presentes no seu RNAm? a) 100. b) 33. c) 99. d) 300. e) 500. 59. Em um organismo, clulas musculares e clulas nervosas diferem principalmente por: a) possurem genes diferentes. b) possurem ribossomos diferentes. c) possurem cromossomos diferentes. d) expressarem genes diferentes. e) utilizarem cdigo gentico diferente. 60. Erros podem ocorrer, embora em baixa frequncia, durante os processos de replicao, transcrio e traduo do DNA. Entretanto, as consequncias desses erros podem ser mais graves, por serem herdveis, quando ocorrem: a) na transcrio, apenas. b) na replicao, apenas. c) na replicao e na transcrio, apenas. d) na transcrio e na traduo, apenas. e) em qualquer um dos trs processos. 61. Um pesquisador, interessado em produzir em tubo de ensaio uma protena, nas mesmas condies em que essa sntese ocorre nas clulas, utilizou ribossomos de clulas de rato, RNA mensageiro de clulas de macaco, RNA transportador de clulas de coelho e aminocidos ativos de clulas de sapo. A protena produzida teria uma sequncia de aminocidos idntica do: a) rato. b) sapo. c) coelho. d) macaco. e) macaco e do rato. 62. Se a timina constitui 15% das bases em certa amostra de DNA, que percentagem de bases devero ser citosinas? 63. O contedo G + C de uma amostra de DNA de 48%. Quais as propores dos quatro nucleotdeos diferentes? 64. Cada clula do corpo humano contm 46 cromossomos. Quantas molculas de DNA essa afirmativa representa? 65. Um certo segmento de DNA tem a seguinte sequncia de nucleotdeos em um filamento: ATTGGTGCATTACTTCAGGCTCT Qual deve ser a sequncia do outro filamento? 66. Suponha que a seguinte molcula de DNA se replique para produzir duas molculasfilhas. Escreva a sequncia de nucleotdeos dessas molculas-filhas se, no momento da

duplicao, a 2 timina da sequncia de bases da fita de cima converter para sua forma tautomrica enlica. TTGGCACGTCGTAAT AACCGTGCAGCATTA 67. Na molcula de DNA do problema 66, suponha que o filamento de baixo o filamentomolde e escreva o RNA transcrito. 68. Duas mutaes surgem em culturas separadas de um fungo normalmente vermelho (que tem um conjunto de cromossomos). As mutaes so encontradas em diferentes genes. A mutao 1 d uma cor laranja, e a mutao 2 d uma cor amarela. Os bioqumicos que trabalham na sntese do pigmento vermelho nessa espcie j descreveram a seguinte via: Precursor incolor
Enzima A

Pigmento amarelo
Enzima B

Pigmento laranja a) Qual enzima est defeituosa no mutante 1? b) Qual enzima est defeituosa no mutante 2?

Enzima C

Pigmento vermelho

69. Em ervilhas, a cor prpura das ptalas controlada por dois genes, B e D. A via : trabalham na sntese do pigmento vermelho nessa espcie j descreveram a seguinte via: Precursor incolor Precursor incolor Pigmento vermelho
gene B

Prpura Pigmento azul

gene D

a) Que cor de ptalas seria esperada em uma planta que leva duas cpias de uma mutao nula para B? (Uma mutao nula uma mutao que resulta em um gene variante que falha em codificar uma protena funcional).

b) Que cor de ptalas voc esperaria em uma planta que leva duas cpias de uma mutao nula para D?

c) Que cor de ptalas voc esperaria em uma planta que mutante duplo; isto , leva duas cpias de uma mutao nula tanto para B quanto D?

70. O esquema representa alguns passos de uma srie de reaes metablicas, onde quatro genes, I, II, III e IV, produzem quatro tipos diferentes de enzimas, 1, 2 , 3 e 4, transformando o aminocido fenilalanina em quatro possveis substncias.




Um indivduo tem anomalias na pigmentao do corpo e seu metabolismo prejudicado pela falta do hormnio da tireoide. O funcionamento das glndulas supra-renais, porm, normal. De acordo com o esquema, os sintomas que o indivduo apresenta ocorrem devido s alteraes: a) no gene I, somente. b) nos genes I e II, somente. c) nos genes I e III, somente. d) nos genes II e III, somente. e) nos genes III e IV, somente. 71. Sabe-se que o casamento consanguneo, ou seja, entre indivduos que so parentes prximos, resulta numa maior frequncia de indivduos com anomalias genticas. Isso pode ser justificado pelo fato de os filhos apresentarem: a) maior probabilidade de heterozigozes. b) maior probabilidade de homozigozes recessivas. c) menor probabilidade de heterozigozes. d) menor probabilidade de homozigozes dominantes. e) menor probabilidade de homozigoses recessivas. 72. As mutaes representam um importante mecanismo evolutivo para os organismos. Uma das consequncias deste fenmeno est descrita na seguinte alternativa: a) limitao da diversidade biolgica. b) criao de novas variantes de seres vivos. c) extino de espcies nocivas ao ambiente. d) produo exclusiva de alteraes benficas. 73. Quando da diviso da clula, a fita de DNA se duplica de modo semiconservativo: a fita dupla hlice se abre e cada um dos filamentos serve de molde para a sntese de uma fita complementar. Isto assegura que as clulas-filhas contenham a mesma informao gentica da clula-me. Contudo, podem ocorrer erros na incorporao de bases nitrogenadas na fita complementar (mutao). Dentre esses erros, podem-se citar: I. substituio de uma base nitrogenada por outra; II. adio ou deleo de uma base entre duas bases originais da sequencia.

Sobre esses dois tipos de mutao, I e II, pode-se afirmar que: a) a mutao do tipo I provoca obrigatoriamente a substituio de um nico aminocido na protena codificada pelo gene. b) a mutao do tipo I provoca a substituio de vrios aminocidos na protena codificada pelo gene. c) a mutao do tipo I tem maior potencial para alterar a composio de aminocidos na protena codificada pelo gene. d) a mutao do tipo II altera toda a composio de aminocidos na protena codificada pelo gene. e) a mutao do tipo II tem maior potencial para alterar a composio de aminocidos na protena codificada pelo gene. 74. Cite 2 situaes para a ocorrncia de mutaes silenciosas ou neutras. 75. Qual o nmero mximo de pares de bases no DNA alteradas em mutaes de ponto? 76. Diferencie as mutaes por substituio de bases por transio e por transverso. 77. Que tipo de mutao representado pelas seguintes sequncias (mostradas como mRNA)? Tipo selvagem .... 5 AAUCCUUACGGA 3 .... Tipo mutante .... 5 AAUCCUACGGA 3 .... 78. Se a forma enol de timina inserida em um molde unifilamentar no curso da replicao, que substituio de base ir resultar? 79. Se a forma imino da citosina inserida em um molde unifilamentar no curso da replicao, que substituio de base ir resultar? 80. Complete: A substituio de um par de _______________ nitrogenadas do DNA por outro nem sempre altera a __________________________ codificada. Neste caso, a mutao _________________________ ou ___________________________. Quando a __________________ da base no DNA ocasiona a ________________ do aminocido na protena codificada, a mutao do tipo sentido _____________________ ou errado, denominada __________________. O efeito depende da _____________________ do aminocido substitudo, podendo levar a uma protena ______________________ com reduo ou ___________________ da atividade biolgica ou protena ______________________ normal (quando h substituio de um aminocido por outro do mesmo _________________________). A mutao sem _____________________ ou _______________________ envolve a substituio de bases e faz surgir um dos 3 __________________________ de _________________________: UAA, UGA e UAG que no codificam nenhum ________________________ e finalizam a sntese ________________________________. A ______________________ ou deleo de bases no DNA alteram toda a leitura do cdigo ________________________ levando a troca dos aminocidos na protena codificada. Esta mutao de mudanas na _________________________ do cdigo gentico chamada de ______________________________). 81. Que tipo de agente mutagnico fsico ocasiona a rompimento da ligao apontada pela seta?

Este agente mutagnico considerado a principal causa de que tipo de mutao? 82. O dmero representado na figura abaixo foi originado, provavelmente, por qual agente mutagnico fsico? Qual o nome do composto formado?

83. Como os corantes aromticos nitrogenados podem levar a mutaes na molcula de DNA? Cite 1 exemplo. 84. Por que as mutaes, apesar de serem frequentes, apresentam baixa taxa de manifestao nos organismos vivos? Mutaes Cromossmicas: 85. Qual mtodo analtico citogentico est representado no caritipo abaixo?

a) Qual banda apresenta genes mais ativos? Quais as bases mais comuns nestas bandas?

b) Qual banda apresenta genes menos ativos? Quais as bases mais comuns nestas bandas?

86. Analise a figura abaixo:

Que nome se d s mutaes cromossmicas estruturais representadas em: a) (A) = _________________________________________________________________. b) (B) = _________________________________________________________________. c) (C) = _________________________________________________________________. d) (D) = _________________________________________________________________. 87. A sequncia normal de nove genes de determinado cromossomo de Drosophila 123 . 456789, onde o ponto representa o centrmero. Alguma moscas-das-frutas foram encontradas tendo cromossomos aberrantes com as seguintes estruturas: a) 123 . 476589 = ___________________________________________________________. b) 123 . 46789 = ___________________________________________________________. c) 1654 . 32789 = ___________________________________________________________. d) 123 . 4566789 = __________________________________________________________. Nomeie cada tipo de rearranjo cromossmico. 88. Em determinado organismo foram encontradas clulas somticas normais (I) e clulas aberrantes (II e III). Os trs caritipos dessas clulas esto esquematizados as seguir:

II III I I I I As aberraes cromossmicas de II e III so, respectivamente, casos de: a) poliploidia e monossomia. b) monossomia e trissomia. c) monossomia e poliploidia. d) trissomia e poliploidia. e) trissomia e monossomia. 89. O caritipo humano normal apresenta:

a) 23 pares de autossomos e 1 par de cromossomos sexuais. b) 22 pares de autossomos e 1 par de cromossomos sexuais. c) 45 pares de autossomos e 2 pares de cromossomos sexuais. d) 44 pares de autossomos e 1 par de cromossomos sexuais. e) 11 pares de autossomos e 2 pares de cromossomos sexuais. 90. Usando os smbolos A para autossomos e X e Y para os cromossomos sexuais, escreva a notao para os caritipos normais de homem e de mulher. 91. Em determinada espcie animal, o nmero diploide de cromossomos 22. Nos espermatozoides, nos vulos e nas clulas epidrmicas dessa espcie sero encontrados, respectivamente: a) 22, 22 e 44 cromossomos. b) 22, 22 e 22 cromossomos. c) 11, 11 e 22 cromossomos. d) 44, 44 e 22 cromossomos. e) 11, 22 e 22 cromossomos. 92. Como ser a pessoa originada pela fecundao de um vulo com 22 autossomos e 1 cromossomo X por um espermatozoide com 22 autossomos e 1 cromossomo X? a) Mulher normal. b) Homem normal. c) Portador da sndrome de Down. d) Portador de sndrome de Klinefelter. e) Portador de sndrome de Turner. 93. Como ser a pessoa originada pela fecundao de um vulo com 22 autossomos e 1 cromossomo X por um espermatozoide com 22 autossomos e 1 cromossomo Y? a) Mulher normal. b) Homem normal. c) Portador da sndrome de Down. d) Portador de sndrome de Klinefelter. e) Portador de sndrome de Turner. 94. Como ser a pessoa originada pela fecundao de um vulo com 22 autossomos e 1 cromossomo X por um espermatozoide com 22 autossomos sem nenhum cromossomo sexual? a) Mulher normal. b) Homem normal. c) Portador da sndrome de Down. d) Portador de sndrome de Klinefelter. e) Portador de sndrome de Turner. 95. Como ser a pessoa originada pela fecundao de um vulo com 22 autossomos e 1 par de cromossomos X por um espermatozoide com 22 autossomos e 1 cromossomo Y? a) Mulher normal. b) Homem normal. c) Portador da sndrome de Down. d) Portador de sndrome de Klinefelter. e) Portador de sndrome de Turner.

96. Hoje possvel retirar clulas de um feto em desenvolvimento no tero da me e determinar seu caritipo. Que informaes importantes a anlise desse caritipo pode fornecer? 97. Que sndrome gentica est ilustrada no caritipo abaixo?

a) Cite 2 manifestaes clnicas desta sndrome.

98. Que sndrome gentica est ilustrada no caritipo abaixo?

a) Cite 3 manifestaes clnicas desta sndrome.

99. Que sndrome gentica est ilustrada no caritipo abaixo?

a) Que manifestao fenotpica caracterstica desta sndrome?

100. Que sndromes genticas esto ilustradas nos caritipos abaixo?

SNDROME = __________________

SNDROME = __________________

101. A sndrome gentica representada na questo 97 uma aberrao cromossmica numrica do tipo: a) Nulissomia. b) Monossomia. c) Trissomia. d) Tetrassomia. e) Euploidia. 102. As sndromes genticas representadas nas questes 98, 99 e 100 so aberraes cromossmicas numricas do tipo: a) Nulissomia. b) Monossomia. c) Trissomia. d) Tetrassomia. e) Euploidia. 103. Qual a principal causa das aberraes cromossmicas numricas? 104. Qual a principal causa das aberraes cromossmicas estruturais? 105. Que sndrome gentica tem como causa a deleo do brao curto do cromossomo 5?

106. A sndrome gentica da questo 108 um caso de aberrao cromossmica: a) Numrica do tipo aneuploidia. b) Numrica do tipo euploidia. c) Numrica do tipo monossomia. d) Numrica do tipo trissomia. e) Estrutural.

107. A partir da dcada de 60 foram descritas muitas aneuploidias ou aberraes cromossmicas humanas. Os indivduos aneuploides apresentam sndromes bem definidas e de fcil constatao pela anlise do caritipo. Assinale a alternativa que apresenta a associao correta: Aneuploidia Caritipo Nome clnico a) Trissomia 44 A + XXY Sndrome de Turner b) Trissomia 45 A + (XX ou XY) Sndrome de Down c) Trissomia 45 A + (XX ou XY) Sndrome de Turner d) Monossomia 44 A + XO Sndrome de Klinefelter e) Monossomia 45 A + (XX ou XY) Sndrome de Down 108. Sabe-se que as anomalias cromossmicas, na espcie humana, causam doenas ou sndromes, caractersticas que so representadas por seus respectivos caritipos. D o nome de cada sndrome abaixo relacionada, quando os caritipos de cada caso so, pela ordem: a) 47, XXY = _______________________________________________________________. b) 45, X = _________________________________________________________________. c) 47, XX, + 21 = ____________________________________________________________. d) 47, XY, + 21 = ____________________________________________________________. e) 47, XX, + 13 = ____________________________________________________________. f) 47, XY, + 18 = ____________________________________________________________. g) 46, XX, - 5 p = ____________________________________________________________.

Bons Estudos!!!