Name ______________________________________ Date __________________ Period ____________

DNA Unit Review Worksheet

1) The primary function of DNA in cells is to a. serve as a storage form for unused nucleotides b. occupy space in the nucleus to keep the nucleus from collapsing c. store information that tells the cells hich proteins to make d. serve as template for making long! spiral carbohydrates ") The t o strands of a DNA molecule are held together by a. ionic bonds b. covalent bonds c. peptide bonds #) According to the base$pairing rules! guanine %&) binds ith a. cytosine %') b. adenine %A) c. thymine %T) d. hydrogen bonds d. guanine %&)

() During DNA replication! the en)yme DNA polymerase a. separates the t o nucleotide chains in a DNA molecule b. constructs ne nucleotide chains that are complementary to the chains in the original DNA molecule c. breaks do n the original DNA molecule into individual nucleotides d. *oins t o DNA molecules into a single molecule +) The scientists credited ith establishing the structure of DNA are a. Avery and 'hargaff b. ,atson and 'rick c. -ershey and 'hase d. .endel and &riffith /) A section of one DNA strand has the se0uence A''&A&&TT. ,hat is the se0uence of an m1NA transcribed from this section of DNA2 a. A''&A&&33 b. A''&A&&TT c. T&&'T''AA d. 3&&'3''AA 4) ,hat process is sho n in the diagram to the right2 a. replication b. transcription c. translation d. protein synthesis

5) Describe the differences bet een transcription and translation. _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ 6) ,hat ould be the nucleotide se0uence of the 1NA molecule that is transcribed from DNA ith a nucleotide se0uence of &'TAAT''&2 ___________________________________________

3se the given chart sho ing the genetic code and its corresponding codons and amino acids to help ans er the 0uestions that follo .

17) The m1NA codon of ''& codes for hat amino acid2 a. 8eucine b. Proline c. Arginine d. &lycine

11) &iven the follo ing DNA strand9

TACGTATGCCGTATGGGCATT

a) ,hat is the DNA compliment to given strand2 b) ,hat is the m1NA compliment to the given strand2 c) ,hat is the correct amino acid se0uence to the m1NA strand given in part b2

1") &iven the follo ing amino acid se0uence! fill in the blanks to the corresponding m1NA se0uence. :erine &lutamic Acid Tryptophan -istidine 'ysteine ;soleucine

3 ____ & & A A ____ ____ ____ ' ____ ' 3 & 3 ____ 3 A 1#) <k=think you>re good at this=try this one. ?ill in the blanks according to the rules of DNA transcription and translation. DNA strand m1NA strand Amino Acid :e0uence9 ____ ____ ____ T A ____ & ' A T & ' A & ' ____ ' ____ ____ ' ____ ' 3 & A ____ A ' & ____ A ____ & ____ ____ ____ A ____ ' 3 ____ 3 8eucine ;soleucine ______________ Threonine ____________ :erine ____________