Jimenez 1

Antibiotic Resistance of Escherichia coli on

Rifampicin caused by Mutations within
the rpo Gene, Transcription Factors, and
RNA Polymerase using an In Vitro Method

Med Jimson D Jimenez

Niles North High School

Jimenez 2

TABLE OF CONTENTS
I. Acknowledgements .1
II. Purpose ..2
III. Hypothesis.3
IV. Review of Literature 4-11
V. Materials & Equipment ...12-13
VI.Procedures & Protocols ....14-22
VII.Variables ..23
VIII.Data & Results ..24-31
IX.Data Analysis .32
X. Experimental Error .33
XI.Conclusions & Societal Impact ..34-36
XII.Reference List .37-38

Jimenez 1

Acknowledgements
This paper is dedicated to my family, for their continuous support and their help. I hope
they will always be encouraging in all the events and milestones ahead in my life. I would like to
thank The University of Chicago for being very hospitable during the couple weeks I was there
for my research. To Doctor Beatrice Fineschi, I thank her for all of her suggestion and for her
help in improving my research experiment. I would also like to thank her for introducing me to
the wonderful world of Microbiology and Immunology, and for this I am truly grateful. To Dawn
Sweeney, I thank her for being a spectacular Teachers Assistant. Thanks for everything and for
the life lessons you helped teach me. To The University of Chicagos Sequencing and
Genotyping facility, thank you for mapping out my protein. I also thank Ms. Camel for being an
amazing SIRS teacher, for helping me along the way, and for printing out all of the materials I
need for my research project. I would also like to thank her for editing my Review of Literature,
giving detailed analysis and sending me reminder updates for the project.

Jimenez 2

Purpose
Antibiotic Resistance is created towards rifampicin resistance with a 4-methyl-1piperazinaminyl group using DH5 Escherichia coli strain. This is used to determine how the
rifampicin inhibited the bacteria from performing binary fission and eventually causing it to
undergo cell apoptosis. Transcription factors are also looked with the bacterial RNA Polymerase
and analyzed using a Polymerase Chain Reaction and a sequencing and genotyping facility at
The University of Chicago. The rpo gene will be used to determine the allosteric sites of
inhibition causing the mutations within the beta subunit pocket groove. After sequencing the
gene, the mutated DNA from the rifampicin resistant bacteria will be compared to the wild type
DH5 Escherichia coli strain and analyzed for points of mutations using Sequencher.

Jimenez 3

Hypothesis
Hypothesis 1
If DH5 E. coli is exposed to rifampicin, an antibiotic known to impede on transcription and
RNA Polymerase, then the DH5 E. coli will survive because DH5 E. coli has the ability to
mutate rapidly around the points of mutation, and as the concentration of rifampicin increase, the
colonies should decrease.
Rationale: Mutations within the rpo will cause the pocket (groove) of the bacteria to warp as it
will code for different proteins. This change of protein is enough to directly alter the
intermolecular forces that exist within the structure and the shape of the structure. With the
change of shape, rifampicin cannot bind as well in the receptor site causing the E. coli to
continue replicating.

Hypothesis 2
If the DH5 E. coli survived because of the rapid mutations, then after DNA sequencing and
protein modeling, it will be found that the allosteric site of inhibition will be changed due to one
point mutation to cause the pocket groove.
Rationale: The changes of protein cannot happen simultaneously in an allosteric groove site. The
proportion of change over the three day span is not enough to cause multiple mutations within
the rpo subunit of the protein. Also it is highly unlikely to have more than one point of mutation
because the rpo is a well preserved DNA fragment of the E. coli showing that specific changes
in this gene will allow it to undergo a microevolution.

Jimenez 4

Review of Literature
Through the process of evolution, many species arose from a common ancestor and made
Earth their homes. Over time as these species received genetic mutations in their genomes, they
created different organisms. Charles Darwin's once said, One general law, leading to the
advancement of all organic beings, namely, multiply, vary, let the strongest live and the weakest
die. (Darwin, 1996). In his Theory of Evolution he is implicating in essence that some cells that
are not suitable to adapt will die. In this experiment, DH5 E. coli is exposed to Rifampicin a
known antibiotic that inhibits bacterial DNA-dependent RNA synthesis by inhibiting bacterial
DNA-dependent RNA polymerase (Bethesda, 2011). The experiments' goal is too see whether or
not E. coli can mutate and adapt around Rifampicin and by doing so it has to change its proteins
shape where the Rifampicin binds to it in the rpo Beta subunit.
Mutations make it possible for organisms to
adapt and survive the obstacles present to them and to
continue making progenies. In this sense E. coli's rate
of mutations actually occur faster that human DNA.
There is usually one mutation per 10^7 amount of
bases copied in DH5 E. coli as compared to human
DNA which is 10^8 (Drake, 1998). This makes sense
as bacterial genomes are far greatly smaller in number

Photo 1.0 shows the growth curve of a wild

type E. coli in just a couple of hours

than human DNA as well as the fact that eukaryotes are more complex than E. coli. In
fact ,bacteria can replicate every twenty minutes showing that the process of binary fission
occurs much more rapidly than the rate of mitosis in humans. Again, this is because their genes

Jimenez 5
are smaller and contain everything vital for the bacteria, the rest are located in its plasmids where
nonessential genetic information are stored (Fineschi, 2014).
Rifampin specifically inhibits bacterial RNA polymerase, the enzyme responsible for
DNA transcription as mentioned previously. So the only way for E. coli to survive is if exposed
to Rifampicin and if it changes its protein structure within the beta sub unit of its RNA
Polymerase. However, it does not do so because of Rifampicin, and because the E. coli mutated
as mutations occur randomly. By changing its structure, Rifampicin cannot properly bind along
the receptor sites making the E. coli strain resistant to it and continue replication and making
proteins. This is because RNA Polymerase plays a crucial role for the bacteria. It uses the DNA
found in E. coli as a template and transcribes them in the promoter region of the cell. Through
the Central Dogma of Biology, DNA is converted into RNA through the process of transcription
and then it is converted into proteins through translation (Gerstein, 2007). So this shows that if
Rifampicin inhibits RNA Polymerase,
transcription cannot take place and so the
bacteria cannot make more proteins and will
Photo 2.0 shows the basic structure of the
Central Dogma Theory of Molecular Biology

lyse.

Specifically, bacterial RNA Polymerase is very important in DNA replication of the

bacteria. With DNA replication, gene expression can occur in the bacteria. In one study it was
found out by scientists that, Gene expression is linked to RNA transcription, which cannot
happen without RNA polymerase (Clancy, 2008). In all species, transcription begins with the
binding of the RNA polymerase complex (or holoenzyme) to a special DNA sequence at the
beginning of the gene known as the promoter. Activation of the RNA polymerase complex

Jimenez 6
enables transcription initiation, and this is followed by elongation of the transcript. In turn,
transcript elongation leads to clearing of the promoter, and the transcription process can begin
yet again. Transcription can thus be regulated at two levels: the promoter level (cis regulation)
and the polymerase level (trans regulation). These elements differ among bacteria and eukaryotes
however. In this experiment, the rifampicin binds to the rpo gene that encodes the subunit of
bacterial RNA polymerase.
The binding into the rpo Beta sub unit of E. coli will cause a mutation in this area. It
will also cause the protein structure to bend or arrange itself differently making it hard for the
Rifampicin to bind as easily as it could without the mutation (Martinez, 2001). One mutation is
enough to alter the shape of the bacteria. In fact there are two types of interactions that could
occur: direct or indirect interaction. Direct interaction is if the rotamers around the protein region
bind directly to the site causing movement between the two molecules. Indirect interaction is if
the rotamers around the protein region do not necessarily bind together but however has an
influence around the region due to its electronegative state. Also the idea of Steric Hinderance
arises because if atoms are rearranged it might affect the preferred shape of the molecule and
have different amounts
of rotamers based on the
neighboring molecules
(intermolecular forces)
Photo 3.0 shows the different types of interactions in a simple ELISA
diagram, the various interactions affect the molecule in distinct ways

and the shape of the

protein (Reusch, 2013) This is important to note because one shift can cause a chain reaction of

Jimenez 7
angle bends along the molecular level warping the structure from the original shape. This bent
phenomenon can be seen by observing the rpo Beta sub unit of E. coli.
Specifically, the rpo Beta sub unit of bacteria is what is classified as a preserved gene
sequence. This means that as the bacteria grows over time, many parts and features can change
that give rise to new types of bacterias and strains but the idea of sequences being preserved is
that it is very important for the bacteria to survive. Again this is because the rpo Beta sub unit
contains instructions for RNA Polymerase to divide and replenish DNA. With an inhibition of
this part it can no longer divide. Alterations in this gene might also lead to cell apoptosis
considering that this is important in survival. The mutated genes that will be found that causes
rifampicin resistance may lead scientists to see what sequences within the preserved sequence
can the bacteria live without. This however might cause complications for the bacteria such as
slower movement and growth overall, leading the wild type strain to be better off in competition
in confluence levels if there are no rifampicin or antibiotics present that is derived from
Rifamycin (Fineschi, 2014).
The wild type strain is something that prevails amongst the different types of the same
species. In general terms it is distinct from other
mutant types, it can be seen as the normal and
average strain. It is only through the exchange of
DNA that allows it to derive from the wild type. There
are two specific ways bacteria can pass on its genes
and lead to alterations and mutations, the Vertical Gene
Transfer which is the transfer of DNA from the parent

Photo 4.0 shows the difference between

a mutant and wild type. Sometimes all it
takes is one nucleotide mutation

Jimenez 8
to the daughter cells when the bacteria undergoes binary fission, and through Horizontal Gene
Transfer. Specifically Horizontal Gene Transfer plays a crucial role in DNA exchanges when
talking about antibiotic resistance. There are three main types of this transfer: transformation,
transduction, and bacterial conjugation. Transformation occurs when the bacterial receptor sites
phagocytose floating pieces of DNA and attach it to its own plasmid loop. Transduction occurs
when one bacterium or a phage transfers its
DNA specifically to another bacterium.
Bacterial conjugation happens when DNA
gets transferred through a cell to cell contact
usually recombining the DNA. (Fineschi,
2014). These phenomenon of mutations from
the wild type can easily be observed in the
water.
Lake Michigans fauna makes it one

Photo 5.0 shows the three different types of

Horizontal Gene Transfer

of the more diverse ecosystems in the world. Containing everything from birds, fish, moose all
the way to algae and bacteria (Prescott, 2003). Not only that but extensive changes in weather,
climate, and temperature in Chicago makes it easily accommodating to many species. In fact on
a sunny day in still water, bacteria can actually germinate rapidly making people wonder whether
or not the water is really safe to drink. However in the 21st century, water purification is of a
high priority. The City of Chicagos Water Treatment plant filters the lake water through eight
traveling screens, where it is then chemically treated in a flocculation process, where it is then
allowed to settle. The next day this water is then refiltered, poured in mixing basins for another

Jimenez 9
chemical treatment before finally making its way to pipes and various showers and faucets
around Chicago (Wheat, 2014). With this much said, the water in Chicago is already more clean
compared to other water sources in the world, yet the city makes a lot of effort to ensure that the
water is drinkable to that extent. This is because bacteria can still be lurking and mutating
(Hodgson2012). In fact, Coliforms and E. coli make their homes in the waters so regardless how
clear the water looks, one would simply not drink the water straight from the lake. Birds and
other marine animals suffice to say when they expel their fecal waste, they also expel the bacteria
living in the gastrointestinal tracts. EPA states that for Lake Michigan in the part of Illinois to be
considered safe, it must not exceed 100 Fecal Coliforms/ml (EPA, 2003). In fact EPA also states
that 99% of the water is monitored by the E. coli living there. It is constantly sequenced and
monitored for changes in sequencing to check if pathogens may be lurking in the waters.
Scientists use the 16S ribosomal RNA found in E.
coli as it is known to be a highly conserved part in
the bacteria. The 16S rRNA helps bind together the
two ribosomal subunits of 50S and 30S by
interacting with 23S. In essence, scientists who use
E. coli to monitor the water also developed a method
through PCR that amplifies the bacterial genomic
sequences. In doing so they have developed many
Photo 6.0 shows the 16S rRNA, and the two
ribosomal subunits of 50S and 30S

different oligonucleotide patters (primers) to check

different segments of the 16S gene. One reason why scientists like to use this gene is because
they use it to form ancestral phylogenetic tree of different species of bacteria and the evolved

Jimenez 10
archaea. In this watery environment, bacteria can thrive and easily exchange DNA from one
bacterium to another. By looking at sequences, they can tell right away what type of strain and
type of bacteria lurks in the waters by performing a quick genetic coding test (Markson, 2013).
Genetic sequencing helps to identify the organism right down to its nucleotide sequence
structure. Genetic sequencing also helps develop new and powerful medicine that can be
personalized according to the genetic makeup of a person as can be seen in the Human Genome
Project. In fact, with a Polymerase Chain Reaction (PCR), DNA segments can easily be
sequenced

to thousands of

copies within hours of

thermocycling.

The follow

up of gel electrophoresis to
sort out DNA by sizes and
ExoSAP procedures help
purify the specific locus of

Photo 7.0 shows the amplification process of the

Polymerase Chain Reaction in the thermocycler

DNA that is being currently investigated (Feingold, 2011). The rise of genetic sequencing
specifically helped scientists find mutation points, and this technique is used not to classify the
bacteria in this experiment but to replicate the rpo Beta subunit of a wild type and a rifampicin
resistant mutated E. coli. After the genetic sequences are coded, it can be easily told what part in
the genes caused the antibiotic resistance to happen. This is because three nucleotides make up a
codon which will code a specific amino acid gathered by the tRNA. Essentially a mutation
within the nucleotides will almost always result in a mutation in the protein structure as amino
acids are the building blocks of protein. With this interaction, the one protein misshape may

Jimenez 11
cause the primary, secondary, tertiary, or quaternary structure to reconfirm making it hard for
specific epitopes like the one in rifampicin to easily bind into the rpo Beta subunit.
Looking at the structure of the protein more closely, changes of specific enzymes can be
easily seen by modeling at the molecular level. Nowadays, it is even easier to tell where the
obstruction takes place by pasting the sequence in a protein modeler analysis. Protein modeling
allow scientists to study interactive forces, and charges that case some proteins to behave the
way the do (Fineschi, 2014). Overall the big
picture can be seen, and after modeling the
structure being looked at compared to the structure
that does the interaction, it can be clearly depicted
if binding is occurring or not. This program was
used in this study to look at the orientation of the
rifampicin against the rpo Beta subunit of the E.
coli.

Photo 8.0 shows the an x ray crystal structure

of E. coli RNA Polymerase complex with the
Rifampicin

Jimenez 12

Materials & Equipment

*The Materials & Equipment List is sorted by the five main blocks of the experiment

Plating serial dilutions of E. Coli onto TSA plates/Rifampicin plates

40 petri dish
5g NaCl
5g Tryptone
2.5g yeast extract
7.5g Agar
Deionized H2O
Rifampicin
Pipettes
Stir Rod
Erlenmeyer flask (500 ml)
Hot Plate
PBS
Test Tube Racks
Test Tubes
Light Microscope
Selecting and lysing a mutant colony

The colonies from the precious materials list

Inoculation Loops
10 micro vials 50 l
Test Tubes
Test Tube Racks
Pipetteman 10 l
40 Pipette Tips 10 l

Jimenez 13
Thermocycling and PCR of the mutant

Bacteria Cultures from previous step

10 micro vials 50 l
5 l mixed rpo1240F and rpo2226R primers
Pipetteman 10 l
40 Pipette Tips 10 l
2 test tube racks
50 mL PBS Saline Solution
Forceps

Sequencing

1 mL Taq polymerase

A computer

Thermocycler

Sequencher Data Site

Specific Primers/ Oligonucleotides

Excel Sheet

Centrifuge

A camera

Lyse-N-Go extraction reagent

Gel electrophoresis and ExoSAP

Gel electrophoresis
1% Agarose Gel
Microvials 10 l
PCR Samples
10% ExoSap
40 Pipette Tops 10 l
10 Pipetteman 10 l
PBS
Electrodes
Voltage Source
Casting Trays
(Ethidium Bromide)EtBr 0.5g/m
Microwave

Jimenez 14

Procedures & Protocols

*The Procedures and Protocols Section is sorted by each step of the process
Procedure (A Simplified Overview): The wild type, DH5 Escherichia coli, is first exposed
to various levels of Rifampicin and the mutant strains that evolve around the rpo gene and
allow RNA Polymerase and transcription to occur, will be selected, and put through a
thermocycler in order to perform Polymerase Chain Reaction. The finished product created by
using rpo1240F and rpo2226R primers will undergo gel electrophoresis and and ExoSAP
procedure before being sent out to The University of Chicago sequencing and genomic facility to
be sequenced. After getting the wild type and the mutated DH5 Escherichia coli strains, the
protein will be modeled using Sequencher and analyzed for steric hindrance, rotamers, and
hydrogen bonding to determine the type of interaction and what type of mutation occurred in the
DH5 Escherichia coli strain and the effects of the rifampicin with a 4-methyl-1-piperazinaminyl
group.

Plating serial dilutions of E. Coli onto TSA plates

A serial dilution is a necessary process to use when performing cell counts so the number of
colonies are in the feasible range of counting. By taking a turbid culture of Escherichia coli and
diluting it eight times with each time having nine parts saline and one part of the Escherichia coli
you can get to feasible counting numbers. In this experiment serial dilutions were used in
magnitude of 10 ^-6 , 10^-7, 10^-8 for cell counts the following day as they are prepared onto
the agar solution.

Jimenez 15
Procedure:
1. The diagram depicts the serial dilutions you need to do.



2. Take three TSA plates and label them on the bottom (agar side) with your section, an
identifier for your group, and the following dilutions: 10-8, 10-7, and 10-6.
3. Take eight sterile microfuge tubes and place them in a microfuge tube rack. Label them with
the dilutions, successively 10-1, 10-2, and so forth. Dont touch the lips of the tubes, so the
tube interiors stay sterile.
4. Using a P-1000 Pipetman, add 0.9 ml (900 l) sterile saline to each tube. This is the ONLY
time you can keep the same tip on the Pipetman. You do want to keep the tip sterile, so if
you touch it or it touches the bench, change the tip. (Why can you reuse this tip but not
reuse tips in other steps like the next one?)
5. Then swirl the DH5 culture tube to suspend the bacteria and use the P-200 Pipetman to
transfer 0.1 ml (100 l) of the culture to the first tube (10-1), cap it, and invert it once to mix.
Then CHANGE THE TIP, and transfer 0.1 ml of this first dilution to the next tube, and so
forth until you are finished with the serial dilution series. CHANGE YOUR TIP EACH
TIME. At this point you should have one tenth as many bacteria in each successive tube.
6. Next, mix the 10-8 dilution tube by inverting the capped tube. Pipette 0.1 ml (100 l) of the
dilution onto the center of an TSA petri plate. Another student should use a sterile spreader
to spread the liquid evenly over the surface of the plate. Spread like you did on the
rifampicin plate.
7. Repeat this for the 10-7 and 0-6 dilutions. Cover the plates and set them aside, lids on top.
Allow the sample to absorb thoroughly.
8. After the liquid has absorbed, collect up your plates, and tape them together with masking
tape. Tape them separately from the rifampicin plates, because the rifampicin plates will be

Jimenez 16
incubated for a longer time. They will be incubated upside-down at 37C (body
temperature).
9. Your microfuge tubes, micropipette tips and spreaders go into the waste container on your
bench.

Plating stock E.Coli onto rifampicin plates

Petri dishes containing 300 microliters of pure Escherichia coli were exposed under the
antibiotic treated agar, Rifampicin. The purpose of step is to grow bacteria that will be resistant
to Rifampicin, a known antibiotic that usually kills E. coli. It is important to expose it to
rifampicin and that the resulting colonies would all be resistant to it and specifically the mutation
would have had to take place in the rpo Beta sub unit because by changing the genes in this
region, the rifampicin would not easily bind.

Procedure:
1. Take your TSA-rifampicin (100 g/ml) plate and, using a marker, label the bottom (agar
side) with your and your partners name and section number.
2. Place the plate on your bench. Swirl the culture tube of E. coli DH5 and pipette 0.3 ml
(300 l) into the center of the TSA-rifampicin plate. Spread this inoculum around on the
plate, as described:
3. Take a spreader. Hold it by the long stem only, and dont touch the short arm of the stick
and dont let it touch anything this will keep it sterile. Use the spreader to spread the
drop of culture evenly over the entire plate. Turn the petri dish with one hand while
moving the spreader around. You want to wet the entire surface evenly.
4. Cover the plate and set it aside, lid on top. Allow the sample to absorb thoroughly.
5. After the liquid has absorbed, collect the rifampicin plates from all the students on your
side of the bench, and tape them together with masking tape. They will be incubated
upside-down at 37C (body temperature).
6. Place your micropipette tips and spreaders into the waste container on your bench.
Selecting and lysing a mutant colony
A sample of Escherichia coli colony was taken from one Petri Dish and placed inside a micro
vial then ran it through a quick spin mode in the centrifuge to create a homogeneous mixture.
This is necessary so that when exposed through the thermocycler it will create an even layer and
will be evenly exposed through the heat inside the machine. Then the thermocycler through an

Jimenez 17
endless loop of varying temperature (hot cold) will bust open the bacterial cell wall and expose
the DNA.

Procedure:
1. Today you will extract DNA from your resistant mutant and then use the Polymerase Chain
Reaction (PCR) to amplify a fragment of the bacterial the rpo gene. Write it down and make
sure you will remember for next weeks lab.
2. To extract DNA from your resistant mutant obtain a 0.2 ml PCR tube (one per pair) with 10
l of the Lyse-N-Go extraction reagent, which is a commercial, proprietary agent that lyses a
wide range of bacteria.
3. Using a sterile Dispo needle, touch one colony. The bacteria should be visible on the
needle, but you need very little. Suspend the bacteria in the Lyse-N-Go reagent; try rotating
the needle rapidly between your fingers to dislodge the bacteria.
4. Cap the tube, being careful when closing the cap. The tubes have thin walls and can be
cracked if pressed too hard. Label the tube with your assigned number on the side and on
top.
PCR of the mutant
Polymerase Chain Reaction served as the step necessary to amplify the genes that are being
isolated in this experiment. With the help of specific oligonucleotides and primers they can
attach and anneal to make billions of copies of this specific sequence in a matter of minutes
through an endless loop of varying temperatures.

Procedure:
1. Place the tube in the thermal cycler. When all samples are ready, the cycler program will be
started. The Lyse-N-Go reagent lyses the bacteria during the changing temperature steps, which
are listed below.
DNA Lysis and extraction sequence
STEP 1: 65C, 30 seconds
STEP 2: 8C, 30 seconds
STEP 3: 65C, 90 seconds
STEP 4: 97C, 180 seconds
STEP 5: 8C, 60 seconds
STEP 6: 65C, 180 seconds
STEP 7: 97C, 60 seconds
STEP 8: 65C, 60 seconds
STEP 9: 4C, hold

Jimenez 18
2. Pulse-spin the tube in a microfuge to collect the lysate at the bottom of the tube. You need to
use nested adapters for your 0.2 ml tubes. Be sure to balance your tubes.
Put 40 l of distilled water in a clean microfuge tube. Make a 1:5 dilution of your lysate by
transferring your 10 l of lysate to this tube of water. Vortex to mix, then pulse-spin.
Label your tube of diluted DNA and put it on ice. After you remove some of the diluted DNA
for PCR (step 9), put the tube with the remaining lysate in the designated rack to be stored at
20C.
3. For each PCR reaction get a 0.2-ml Ready-to-Go PCR tube. The fluffy pellet inside the tube
is dehydrated PCR mix. The PCR mix contains Taq polymerase, the four nucleoside
triphosphates (dATP, dCTP, dGTP, and dTTP) and buffer with the Mg+2 required by the DNA
polymerase.
4. Assemble your PCR reactions in Ready-to-Go tubes in this order:
17.5 l clean water
5 l mixed rpo1240F and rpo2226R primers, 1M@
2.5 l your 1:5 diluted bacterial lysate
5. After adding the solutions, carefully close the tube. Label the tube with your assigned number
on the side and on top.
6. Finger-tap the tube to dissolve the beads. Pulse centrifuge the tubes briefly.
7. Keep assembled reactions on ice until ready to start the thermal cycler. Your TA will collect
the PCR tubes and start the thermal cycler.
8. Bring your tubes and place them in numerical order in the PCR machine. It is good to have
tubes in order because labels often rub off.
9. Start the thermal cycler. The PCR thermal cycler will be programmed for these conditions:
Initial Step: HOLD at 95C for 4 min.
Cycling steps:
Denature:
95C for 30 sec.
Anneal:
60C for 30 sec
Extend:
72C for 60 sec
Cycle 35 times
Extension Step: HOLD 72C for 10 min.
Final Step: HOLD at 4C
10. After PCR cycling is complete, the samples will be stored at 20C.
For your information:
Primer rpo1240F has the sequence 5- TCGAAGGTTCCGGTATCCTGAGC 23 nts
Primer rpo2226R has the sequence 5- GGATACATCTCGTCTTCGTTAAC 23 nts
Gel electrophoresis
The Gel Electrophoresis works by passing an electric current through the well plates in the gel.
The DNA inside move according to its size and shape and is categorized by the size of its
nucleotides upon the different restriction enzyme cuts. Also a blue dye is used so that when the

Jimenez 19
gel is turned on and exposed to the current, it will glow and give a distinct color for better
mapping. Gel electrophoresis itself also work through magnetism. DNA is naturally negatively
charged and with each end different charges it attracts and repels the DNA at different rates
based on the number of Nucleotides it contains.

Procedure:
1. Retrieve your PCR reaction. If frozen, thaw it and pulse-spin the tube. DO NOT ADD
LOADING DYE TO THE PCR REACTION TUBE.
2. Obtain a tube of loading dye. In a clean 1.5 ml tube, mix with gentle pipetting:
8 l loading dye
2 l Your PCR product
3. Pulse-centrifuge the tube with DNA & loading dye.
4. Leave your original PCR reaction tube on ice. Your TA will collect it later.
5. Tear open the pouch and remove the cassette.
6. Remove the two white seals from cassette. Do not remove the clear side vent hole seals.
7. With a fine Sharpie, label wells 4-7 directly above the well opening (L, N, P, S)
8. Put the cassette into the dock. Slide it until it snaps into the dock.
9. Fill all the wells with deionized (MilliQ) water and then using a Kimwipe, wipe off any
excess water.
10. Plug the dock electrodes into a power supply and prerun the gel at 200V for 15 seconds.
11. Be sure the power supply is off and electrodes are unplugged while loading.
12. Load 5 l of the Low Mass ladder into lane 4.
13. Load 5ul of negative control into lane 5.
14. Load 5 ul of positive control into lane 6.
15. Load 5ul of your sample into lane 7.
16. Plug in the electrodes and set voltage at 200 V note the high voltage. BE CAREFUL and
do not touch the surface of the gel while it is running! Start the run. Set a timer for 7 minutes.
17. To monitor the progress of the electrophoresis, turn on the dock light by pressing the orange
button on top of the unit. Press the button again to turn off the light.
18. When the bands have migrated far enough to separate the top two bands in the mass ladder
clearly (this only takes ~ 7-9 minutes!), turn off the power supply. Be sure the power supply is
OFF before removing the gel from the dock.
19.Take the gel to the BioRad GelDoc station to have the gel photographed.

Jimenez 20
ExoSAP
ExoSAP works by clearing up all unwanted nucleotides and substrates. Its goal it to try to purify
the sample as much as possible to the specific genes that we are looking at after the PCR is
performed on a genetic sequence. 7.5 micrometers was taken from the PCR sample and mixed
with ExoSAP to break down the nucleotides inside the mixture to try to purify the target gene.

Procedure:
1. Obtain a 0.2 ml tube with 3 l of ExoSAP-IT
2. Using a P-20, pipet 7.5 l of your PCR product into the tube with the ExoSAP-IT.
3. Important: Label your ExoSAP-IT tube with the number that you were assigned last week.
Also make a small dot on the hinge to help you distinguish the ExoSAP-IT tube from the
PCR tube.
4. Place your ExoSAP-IT tube into a nested adaptor in the microfuge. With another students
tube as a balance tube, pulse-spin the sample in the microfuge for a few seconds.
5. Place the tubes in the thermal cycler. The ExoSAP-IT program in the thermal cycler first
incubates at 37C for 15 minutes and then 80C for 15 minutes.
6. After this the ExoSAP-IT treated DNA is ready for sequencing. Samples will be stored at
-20C until they are submitted for sequencing.
7. Also return the PCR tube with the rest of your PCR product.
8. It is now ready for sequencing!!!!

Sequencing
The purpose of sequencing the genes to to get match up the original wild type of the lab grade E.
coli with those genes of the rifampicin resistant bacteria. Sequencing gives the genetic makeup
of E. coli and each set of three codes serves as a codon that makes a specific protein. It is
necessary to sequence to know what the proteins are and how it looks like when 3-D modeled
using Sequencher.

Procedure:
Sequencing done behind the scenes at the University of Chicago Comprehensive Cancer Center
DNA Sequencing and Genotyping Facility

Jimenez 21

Computer modeling
The purpose of using a computer model, in this case Sequencher was to render the proteins and
bonding in 3-D mode where changes (mutations) can be observed and how they affect the
bonding of rifampicin.

Protocol Explanations to clarify the procedures

Three way streaking
The process of three way streaking makes sure that a colony of bacteria can be collected and
isolated for further studying. This is important because without it only a lawn would grow, each
successive streak will have less colonies than the previous ensuring isolated colony growth.

Types of plates and concentration of rifampicin

The purpose of using different agar plates is that each is filled with specific nutrients that allow
certain bacteria to grow and inhibit others for example, LB plates only grow gram negative
bacteria.

Primers
These are made of nucleic acids and is important in the Dogma of Biology. The primer was a
specific set of oligonucleotides that recognize a specific sequence in the bacterial DNA. The
primer is also important by starting up the replication process of the DNA. Specific primers are
needed in order to amplify the rpo gene and only that gene.

Thermocycling conditions for lysis and PCR

The temperature inside the thermocycler varies because different enzymes catalyze at different
temperatures. By selecting the correct temperature, the homeostasis inside the thermocycler will
be at its peak at its fastest reaction making the reaction quicker than if the temperature stayed

Jimenez 22
constant throughout the cycles. Also note that at higher temperatures, that protein structure
denatures and warps, however taq polymerase came from extremophilic bacteria (archaea) and
so it will work in this temperature. Note that the bacterial polymerase in the first place will not
work as the bacterial cells at this point already lysed (apoptosis). Once Primer runs out, no matter
how long the cycle is repeated it will do no more reactions as the primer in this case is the
limiting reagent. Unlike other materials used here it is not reusable compared to enzymes
(property to be able to be reused in reactions). At the end of the cycle we will end up with
billions of repeated sequences (rpo) specifically because again the primer we chose selects this
specific genomic sequences. Of course the other genomic strands would still be there but it
would literally be minute compared to the amount of replicated (rpo) bacterial gene. If

Procedure Key Summary Steps:

Jimenez 23

Variables
Variables from Hypothesis 1
Independent Variable: The concentration of rifampicin used (100 l, 200 l, 400 l, 800 l)
Dependent Variable: The colony frequency units found in each petri dish (Measured in cfu/ml)
Control Group: The absence of rifampicin. E. coli grown without the rifampicin solution in the
TSA plates
Constants: stock concentrations used, brand of petri dish, temperature, humidity, the length of
the observations and incubation, microscope, counting methods, sterile inoculation loops, stock
solutions, incubator temperature and location, aseptic techniques, number of plates of each group
of concentrations

Variables from Hypothesis 2

Independent Variable: The DNA Sequences and protein modeling of a mutant E. coli
Dependent Variable: The type of mutation found in the rpo sub unit of E. coli
Control Group: DNA Sequences and protein modeling of the wild type (absence of mutation)
Constants: stock concentrations used, brand of petri dish, temperature, humidity, the length of
the observations and incubation, microscope, counting methods, sterile inoculation loops,
machine used, computer used, Sequencher site, angstrom view in the rotamers, PCR, agarose
sample, gel electrophoresis, ExoSAP, place of sequencing and gentotyping, incubator location
and temperature, aseptic techniques

Jimenez 24

Data & Results

Hypothesis 1 Data and Results:
* does not necessarily mean infinite. Bacteria with this label means that the confluence
level was very high and it was non-countable
**In the purpose of this lab, the usual method of colony counting between 30-300
colonies is ignored because as the rifampicin concentrations increased, some fell below
30 colonies, in order to perform statistical testing one must proceed with caution as <30
colony counts can be unreliable!
Cell Colony Counts for Escherichia coli exposed to Rifampicin after 72 Hours

0 l

100 l

200 l

400 l

800 l

Sample 1

Colonies

68 Colonies

42 Colonies

10 Colonies

0 Colonies

Sample 2

Colonies

73 Colonies

53 Colonies

11 Colonies

6 Colonies

Sample 3

Colonies

61 Colonies

31 Colonies

6 Colonies

4 Colonies

Sample 4

Colonies

70 Colonies

37 Colonies

14 Colonies

0 Colonies

Colony Total

Colonies

272 Colonies

163 Colonies

41 Colonies

10 Colonies

Colony
Average

Colonies

68 Colonies

40.75
Colonies

10.25
Colonies

2.5 Colonies

Mutation Frequency Rates after 72 hours of Rifampicin Exposure

Colony Average

100 l

200 l

400 l

800 l

6.8 cfu/ml

4.75 cfu/ml

1.25 cfu/ml

~ 0 cfu/ml

Jimenez 25

Jimenez 26

Hypothesis 2 Data and Results:

Gel Electrophoresis

**A ladder tells you the length of your sample at various points in the gel. It serves as a guideline
and each mark is a known residue count of the length of genes in that particular sample. This is
because on one end is a negative end and on the other, a positive. The rpo gene is about 900
nucleotide bases long and should be seen around the 1200 ladder mark to confirm that PCR
worked.

Jimenez 27

Sequencing
Sample

Base Position

Nucleobase

Codon

E. coli (reference)

#1,576 Base 339 of 956

CAC (Histidine)

Mutant

#1,576 Base 339 of 956

UAC (Tyrosine)

Protein Modeling
Sample

Amino Acid

Type of Amino H-Bonds w/

Acid Side
amino acid
Chain
residues;
strong/weak

H-Bonds with
rifampicin;
strong/weak

Indirect or
Direct
Interaction
with
Rifampicin

E. coli

Histidine

Electrically
Charged Basic

2 Strong HBonds
1 Weak HBond

2 Strong HBonds
1 Weak HBond

Direct
Interaction

Mutant

Tyrosine

Polar

2 Strong HBonds

2 Strong HBonds

Direct
Interaction
(4 of 5
Rotamers)

**8.000 Angstrom view

Rotamer Number

Steric
Hinderance
? Y/N

Amino Acid
Interactions

H-Bonds or atomic
interactions?

Indirect or Direct
Interaction with
Rifampicin

Rotamer 1

Yes Score 9

4 SH VAL135
2 SH GLN393

2 Hydrogen SER402 Direct Interaction

Rotamer 2

Yes Score 22 1 SH SER402

6 SH ASP396

1 Hydrogen LEU404 Direct Interaction

1 Hydrogen SER402

Rotamer 3

Yes Score 28 8 SH ASP396

1 Hydrogen LEU404 Direct Interaction

1 Hydrogen SER402

Rotamer 4

Yes Score 36 12 SH ASP 396

1 Hydrogen SER403 Direct Interaction

1 Hydrogen ASP396

Rotamer 5

Yes Score 48 3 SH THR19

8 SH SER403

1 Hydrogen SER403 Indirect Interaction

1 Hydrogen SER402
1 Weak Hydrogen
LYS395

Jimenez 28

BLAST results of sequencing

Mutant Forward Sequence of the rpo sub unit of E. coli
NNNNNNGNATNTGCACATGGGCGCAGCCTGATGCAGCCATGCCGCGTGTATGAAGAA
GGCCTTCGGGTTGTAAAGTACTT
TCAGCGGGGAGGAAGGTGTTGTGGTTAATAACCGCAGCAATTGACGTTACCCGCAGA
AGAAGCACCGGCTAACTCCGTGC
CAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAG
CGCACGCAGGCGGTCTGTCAAGT
CGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGA
GTCTTGTAGAGGGGGGTAGAATT
CCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGG
CCCCCTGGACAAAGACTGACGCTC
AGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGAGTCCACGCAN

Mutant Reverse Sequence of the rpo sub unit of E. coli

NNNNNNGCTCNCGCTTTCGCACCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCG
CCACCGGTATTCCTCCAGATCTC
TACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACAAGACTCTAGCCTGCC
AGTTTCGAATGCAGTTCCCAGG
TTGAGCCCGGGGATTTCACATCCGACTTGACAGACCGCCTGCGTGCGCTTTACGCCC
AGTAATTCCGATTAACGCTTGCA
CCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAA
CGTCAATTGCTGCGGTTATTAA
CCACAACACCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACA
CGCGGCATGGCTGCATCAGGCT
TGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGATNCTGGGCCGA

Jimenez 29

Wild Type Forward Sequence of the rpo sub unit of E. coli

NNNNGGGGTATNGCNATGGGCGCAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAG
GCCTTCGGGTTGTAAAGTACTTT
CAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAA
GAAGCACCGGCTAACTCCGTGCC
AGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGC
GCACGCAGGCGGTTTGTTAAGTC
AGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAG
TCTCGTAGAGGGGGGTAGAATTC
CAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGC
CCCCTGGACGAAGACTGACGCTCA
GGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGAGTCCACGCAN

Wild Type Reverse Sequence of the rpo sub unit of E. coli

GNNNNNGNTCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCG
CCACCGGTATTCCTCCAGATCTC
TACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCC
AGTATCAGATGCAGTTCCCAGG
TTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCA
GTAATTCCGATTAACGCTTGCA
CCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAA
CGTCAATGAGCAAAGGTATTAA
CTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACA
CGCGGCATGGCTGCATCAGGCT
TGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGATNCTGGGCCGA

Jimenez 30

Protein 3-D Model of the Interactions of Rifampicin in yellow with the rpo sub unit of E. coli

Jimenez 31

Bonding Structures Sequencher View (8 Angstroms)

Jimenez 32

Data Analysis
The results obtained from the colony counts were proven correct with the stated
hypothesis. Using a t test for comparison of means, with any standard levels of alpha, the null
hypothesis will be rejected. This proves the fact that as concentrations increase for rifampicin
dosage, the harder it is for the bacteria to grow. This can also be seen in the the table for mutation
frequency units per mL of solution that it is very low in bacterial numbers as you increase
rifampicin concentrations. Another thing that was already proven is the fact that bacteria can
mutate around the rifampicin in order for the transcription factors and RNA Polymerase to
continue to work in the bacterium.
For the second part of the hypothesis, it was found that the wild type of E. coli had
mutated one of its base pairs located in base position 339 with a nucleobase of C. This base had a
single point mutation into U. This changed the amino acid sequence of CAC to produce
Histidine, and instead it is UAC that produces Tyrosine leading the beta subunit to evolve around
the rifampicin. Upon further anatomical analysis it can be concluded that this evolution is due to
the formation of direct interaction with the H-Bonds and the amino acid residues located in that
spot of the observed protein interaction. After finding the five different rotamer positions that it
could position itself, it can be found that the direct interaction is proven correct. The one change
in the primary protein structure from a C to a U, caused the quaternary structure to be disrupted
warping and folding in a different direction so rifampicin cannot bind to it. Because of this direct
interaction, it can be seen that the bacteria is able to exist and live as a mutated E. coli strain.

Jimenez 33

Experimental Error
When average counts were being taken from the first hypothesis, it is evident that the
colony count do not meet expected countable amounts of 30-300 Colonies. Some of the higher
dilutions were underrepresented and this may lead to false statistics. This would be a problem
since a t test was performed to show that the first hypothesis was proven. In the second
hypothesis, error in terms of DNA Sequencing may have appeared and an incorrect reading may
have given a false diagnosis, however with the data worked with, it was found that it was a single
point mutation. Discoveries of this in the past may also prove it to be correct that it is through a
single point mutation and not through other types.
One way that the mutations can cause resistance is by blocking the protein to being
bound with it. It can cause a change of shape meaning that a normal antibody that should lyse the
bacteria will not because by changing its receptor site shape, the antibiotic would not fit as nicely
as possible so in the end it would live. Another way is that if it does not change its shape, the
bacteria could simply trigger an override, an inactivation that makes it able to withstand the
process of shut down by the antibiotic.

Jimenez 34

Conclusions & Societal Impact

Conclusions:
In the end of the experiment, it can be concluded that the antibiotic resistance of
Escherichia coli on the Rifampicin is caused by a single point mutation. Because of this
mutation, the transcription factors and the RNA Polymerase is able to continue on because it the
rifampicin no longer fits in the subunit groove of the bacterial DNA. Further conclusions from
this in vitro method shows that the preserved DNA region remains true, the mutation rate cannot
be high around this area as the RNA Polymerase is an essential enzyme for the bacteria. Also,
reproductive stress is evident from the results gathered from the first part in that even though the
bacteria survived, the rate of reproduction seemed to have slowed down in the environment
The mutation allowed E. coli to circumvent the effects of rifampicin because it changed
the overall structure of the rpo subunit of the bacteria. The weak Hydrogen Bond present in the
original unmutated bacteria no longer existed in the mutated bacteria. Specifically, the mutant
formed polar bonds around neighboring molecules, but still kept the 2 original strong H-Bonds.
The loss of a Hydrogen bond will lose a connection of E. coli causing the rifampicin to not easily
bind (it loses this sweet spot). Even though this is the case, the loss of the weak bond and the
changes in angles of formation and steric hinderances caused the subunit to warp preventing the
rifampicin from snugly binding in the receptor sites. This is obvious in the fact that TYR406
formed new bonds with GLN393 while the original HIS406 did not do so. Not to mention the
fact that in protein 3-D mode, the shape caused other parts of the protein to fold differently. Each
rotamer also tilted at different angles prevented Rifampicin to bind to it. In doing so these small
changes in the pocket made rifampicin not fit tightly causing E. coli to proliferate instead of

Jimenez 35
lyse as its RNA polymerase was no longer inhibited by rifampicin. This is again proven true
because the closeup on the rpo in the mutation reveals that it does rifampicin does not interfere
as much as it did with the unmated bacteria.
In the end, the hypothesis was proven and supported as shown in the sequencing models,
and the agar plates that the bacteria continued to grow even after rifampicin was added in the
broth. Again this is true because rifampicin inhibits the rpo subunit of bacteria however bacteria
still continued to grow under these conditions. Upon further scrutiny, it was revealed that a
mutation was the cause of the unaffected growth. It shows again Charles Darwins Theory of
Evolution and how the strong survives, the strong with genes capable of enduring the situation it
was in. In the end, mutations are part of life and without mutations, life cannot possibly exist. It
is because of mutations that caused E. coli to evolve and evade the effects of Rifampicin.
As steric hindrance value goes higher and higher the harder it is for rifampin in to bind
properly. So in this case, yes, a weak steric hindrance can mean that rifampin in still has the
ability to bind to RNA Polymerase. The problem arises as the electron cloud density increases
due to the shape of the bond. Steric hindrance will also increase based on the electromagnetic
and intermolecular forces it is experiencing from the neighboring molecules. In fact in the
research done the four weakest steric hindrance bonds of the mutation with rifampicin it was still
a direct relation between the two as their electron valence clouds touched. It was only until the
last and highest steric hindrance where it was an indirect relation and caused Rifampicin to not
be able to bind properly. This is because at such high levels, it changed the bond angles and the
electrons cannot easily pass through (steric hindrance) and so the forces around it will change the
shape and angle causing it to not properly bind to Rifampicin

Jimenez 36

Societal Impacts
Some of the binding sites of Rifampicin is conserved this is because there are some
proteins and receptor sites that are essential to the bacteria however there are some that are not
and can mutate. In essence the point of this conservation not only helps link different species
with each other by the amount of genetic variability it contains but it also shows scientists why
that part was preserved as it is very important for that specific organism.
This is because rifampicin is specific to certain traits. The receptor binding sites must be
congruent in the rifampicin and the activation site itself. This is true in the bacteria like
Tuberculosis however it is not true for our bodies eukaryotic cells because they are not
compatible. This incompatibility prevents rifampicin from binding to our cells which is why it
does not harm us. However it binds with for example Tuberculosis which is why it is used to kill
it.

Jimenez 37

Reference List

Bethesda. (2011). Rifampin: MedlinePlus Drug Information. Retrieved October 14, 2014,
from http://www.nlm.nih.gov/medlineplus/druginfo/meds/a682403.html

Darwin, C. (1996). The origin of species. Oxford: Oxford University Press. Retrieved January
10, 2015, from http://global.oup.com/academic/product/on-the-origin-ofspecies-9780199219223

Clancy, S. (2008). RNA Transcription by RNA Polymerase: Prokaryotes vs Eukaryotes.

Retrieved February 19, 2015, from http://www.nature.com/scitable/topicpage/rnatranscription-by-rna-polymerase-prokaryotes-vs-961

Drake, J. (1998). Genetics. Retrieved January 10, 2015, from http://www.genetics.org/

content/148/4/1667.full

EPA. (2003). BACTERIAL WATER QUALITY STANDARDS FOR RECREATIONAL WATERS.

Retrieved February 19, 2015, from http://water.epa.gov/type/oceb/beaches/upload/
2003_06_19_beaches_local_statrept.pdf

Feingold, E. (2011, January 1). DNA Sequencing Fact Sheet. Retrieved March 3, 2015, from
http://www.genome.gov/10001177

Fineschi, B. (2014). Contagion. The University of Chicago.

Gerstein, B. (2007). Central Dogma of Biology: Classic View. Retrieved February 19, 2015,
from http://www.ncbi.nlm.nih.gov/Class/MLACourse/Modules/MolBioReview/
central_dogma.html

Hodgson. (2012). Clean Water Crisis, Water Crisis Facts, Water Crisis Resources - National

Jimenez 38
Geographic. Retrieved October 14, 2014, from http://
environment.nationalgeographic.com/
environment/freshwater/freshwater-crisis/

Markson, L. (2013). Aligned 16S rDNA data and tools Retrieved February 22, 2015, from
http://greengenes.lbl.gov/cgi-bin/JD_Tutorial/nph-16S.cgi

Martinez, J. (2001). Mutation frequencies and antibiotic resistance. Retrieved January 10,
2015 from http://www.ncbi.nlm.nih.gov/pubmed/10858329

Prescott. (2003). Michigan - Flora and fauna. Retrieved February 22, 2015, from http://
www.city-data.com/states/Michigan-Flora-and-fauna.html

Reusch, W. (2013). Stereoisomers and Ring Conformations. Retrieved February 19, 2015,
from http://www2.chemistry.msu.edu/faculty/reusch/VirtTxtJml/sterism2.htm

Wheat. (2014). Chicago Water Treatment. Retrieved February 22, 2015, from
http://www.cityofchicago.org/city/en/depts/water/supp_info/education/
water_treatment.html