You are on page 1of 50

1

BIOLOGIA 2002

01) Leia o texto abaixo com atenção.

No esforço para entender a realidade, somos um homem que tenta compreender o


mecanismo de um relógio fechado. Ele vê o mostrador e os ponteiros, escuta o tique-
taque, mas não tem como abrir a caixa. Sendo habilidoso, pode imaginar o mecanismo
responsável pelo que ele observa, mas nunca estará seguro de que sua explicação é a
única possível.

(Essas palavras foram ditas pelo cientista Albert Einstein, referindo-se ao caminho das
descobertas científicas, e extraídas do livro FAVARETO, J. A. Biologia. 1 ed. São Paulo:
Moderna. v. único, p. 2).

Em relação à ciência e ao método científico, assinale a(s) proposição(ões) CORRETA(S).

1. A ciência pode ser entendida como um contingente aleatório e estático do conhecimento,


baseado em observação, experimentação e generalização.

2. Uma vez levantada, por indução, uma hipótese para explicar um fenômeno, os cientistas
fazem uma dedução, prevendo o que pode acontecer se sua hipótese for verdadeira.
04. Os experimentos, capazes de testar as hipóteses formuladas, devem lidar com uma parte
do problema de cada vez e ser cuidadosamente controlados.

8. Confirmados os resultados, eles devem ser publicados em jornais diários locais, de grande
circulação, para que possam ser analisados e criticados pela população em geral,
constituindo-se, então, em leis científicas.
16. As conclusões do método científico são universais, ou seja, sua aceitação não depende do
prestígio do pesquisador, mas de suas evidências científicas.

02) Os lisossomos são organóides membranosos, com formato esférico, que contêm enzimas
digestivas. Em relação a essa estrutura citoplasmática, assinale a(s) proposição(ões)
CORRETA(S).

01. Os lisossomos desempenham, entre outras, funções de defesa celular.

02. As enzimas lisossômicas são fabricadas no retículo endoplasmático liso, passando em


seguida para o sistema de Golgi, que as “empacota” e as libera sob a forma de
lisossomos secundários.

04. A função heterofágica dos lisossomos refere-se à digestão de substâncias que são
absorvidas pela célula por fagocitose ou pinocitose.

08. O lisossomo secundário é formado pela fusão do vacúolo alimentar, que contém o
alimento englobado por pinocitose ou fagocitose, com o lisossomo primário, que contém
as enzimas digestivas.

16. Juntamente com as mitocôndrias, os lisossomos são responsáveis por uma reciclagem de
moléculas e organóides inativos.

32. Em girinos, o fenômeno de reabsorção da cauda é comparado a um “suicídio celular” já


que, com o rompimento dos lisossomos, ocorre uma autodigestão das moléculas e dos
organóides que constituem as células daquela estrutura.

03) O cariótipo consiste na montagem fotográfica, em seqüência, de cada um dos tipos


cromossômicos. Ele nos permite saber qual o número e qual a forma dos cromossomos de

http://www.meninasetequilas.blogspot.com
2

uma espécie, bem como estabelece o seu padrão cromossômico normal. A partir da
análise da figura abaixo, e em relação a esse estudo, é CORRETO afirmar que:

01. o cariótipo é o “quadro cromossômico” das células haplóides de cada espécie.

02. na espécie humana, os cromossomos são classificados em 7 grupos, compreendendo 22


pares de cromossomos autossômicos, e mais um par de cromossomos sexuais que, no
homem, é XY e, na mulher, XX.

04. para a obtenção do cariótipo, são utilizadas células de leucócitos em anáfase meiótica.

08. em fetos, normalmente a cariotipagem só deve ser feita quando há real suspeita de algum
tipo de alteração cromossômica, já que as técnicas de coleta de material apresentam
risco de aborto.

16. a partir da análise de cariótipos, informações valiosas podem ser obtidas, tais como a
existência de cromossomos extras ou de quebras cromossômicas, auxiliando no
diagnóstico de certas anomalias genéticas.

32. a Síndrome de Down, ou trissomia do cromossomo 16, e o daltonismo são exemplos de


doenças de origem genética que podem ser diagnosticadas através do exame cariotípico.

04) Tecido epitelial, ou simplesmente epitélio, é aquele que reveste todas as superfícies
internas ou externas do corpo, além de formar as glândulas. Com relação a esse tecido, é
CORRETO afirmar que:

01. os epitélios de revestimento caracterizam-se por apresentar células justapostas, de


forma prismática, cúbica ou achatada, praticamente sem material intercelular.
02. os epitélios de revestimento não são vascularizados, recebendo alimento por difusão a
partir de capilares existentes no tecido conjuntivo sobre o qual repousa.
04. os epitélios de revestimento conferem proteção contra atritos e invasão de
microorganismos, servindo também para a absorção de alimento e oxigênio.
08. os epitélios glandulares apresentam células especializadas em produzir secreções e, no
caso das glândulas endócrinas, apresentam ductos por onde seus produtos são eliminados
para o exterior do corpo.
16. a epiderme humana é pluriestratificada e queratinizada e apresenta-se bastante espessa
nas áreas de muito atrito, como a sola dos pés.
32. as células do epitélio intestinal apresentam cílios que auxiliam no movimento e
deslocamento das substâncias que transitam pelo intestino.

http://www.meninasetequilas.blogspot.com
3

64. nas células do epitélio intestinal existe o complexo unitivo, constituído pela zônula de
oclusão, zônula de adesão e desmossomo, que funciona como eficiente barreira à
passagem de substâncias indesejáveis.

05) As figuras abaixo mostram as variações hormonais da mulher, no decorrer do ciclo


menstrual, que determinam as alterações nos folículos ovarianos e na parede do útero. A
partir da interpretação e análise das figuras, assinale a(s) proposição(ões) CORRETA(S).

01. A ovulação ocorre por volta do 14o dia do início do ciclo, quando a taxa de hormônio
luteinizante (LH) está muito baixa.

02. Por volta do 28o dia do início do ciclo, as taxas de progesterona e de estrógeno no sangue
estão muito baixas, o que determina uma perda de sangue denominada menstruação.

04. Após a ovulação, forma-se o corpo lúteo, que coincide com o pico de produção da
progesterona.

08. A ovulação é precedida por um aumento na taxa de estrógenos no sangue.

16. Ao longo do ciclo, observa-se uma retração do endométrio.

32. A cada ciclo menstrual, normalmente um novo folículo maduro entra em crescimento para
formar dois novos folículos.

64. Durante a segunda metade do ciclo menstrual, enquanto as taxas de LH e FSH se


equivalem, as de progesterona e estrógeno se diferenciam.

06) As figuras abaixo representam cortes transversais de dois momentos da organogênese, em


anfioxo. Considerando as características dessa etapa do desenvolvimento embrionário e
as figuras, assinale a(s) proposição(ões) CORRETA(S).

http://www.meninasetequilas.blogspot.com
4

01. A organogênese precede a mórula e caracteriza-se pela diferenciação dos órgãos a partir
dos folhetos embrionários formados no período da gastrulação.
02. A partir do achatamento da ectoderme, da região dorsal do embrião, diferencia-se a placa
neural (a) e, posteriormente, o tubo neural (b), que dará origem ao sistema nervoso do
indivíduo.
04. Da endoderme (c) deriva o epitélio de revestimento do tubo digestivo, exceto as
cavidades oral e anal, que são formadas a partir da ectoderme.
08. O celoma (d) é uma cavidade do embrião, derivado das bolsas mesodérmicas (e), e está
delimitado pela mesoderme (f).
16. Do teto do arquêntero (g) diferencia-se a notocorda (h), que é uma estrutura maciça,
localizada na região dorsal, logo abaixo do tubo neural (b).

07) A revista Época, em 30/07/2001, anunciou em sua capa: O DNA não falha. O título
referiu-se a uma reportagem da qual foi extraído o trecho abaixo:
Depois da pílula anticoncepcional, que transferiu para as mulheres o controle da
fertilidade, da fertilização “in vitro” e da barriga de aluguel, métodos que permitem a
gravidez sem sexo, o teste de DNA surge como uma das grandes descobertas do mundo
ocidental. Para muitos especialistas [...] a técnica só traz benefícios. Outros acreditam
que reflexos da descoberta vão alterar o universo das relações familiares.

Sobre a utilização dos testes de DNA, e as implicações dessa prática para os indivíduos e a
sociedade em geral, é CORRETO afirmar que:

01. os testes de DNA podem ser empregados para finalidades de investigação de paternidade
e também para identificação de supostos criminosos, como em casos de estupros e
assassinatos.
02. o melhor material biológico para um teste de DNA é aquele extraído de núcleos de
glóbulos brancos do sangue, mas outros tecidos, como pele e ossos, também podem ser
utilizados.
04. para uma investigação de paternidade, a partir de testes de DNA, coletam-se amostras
biológicas do suposto pai, não sendo necessário obter informações do(a) filho(a) e de sua
mãe.
08. os exames de investigação de paternidade, a partir de testes de DNA, oferecem,
atualmente, resultados com exatidão total, não restando qualquer questionamento ou
dúvida sobre os diagnósticos apresentados.
16. o custo do exame de DNA, ainda muito elevado no Brasil, é um dos fatores que dificulta
sua utilização em larga escala pelos segmentos populacionais menos favorecidos
economicamente.

http://www.meninasetequilas.blogspot.com
5

32. a criação de bancos de dados, com a identificação genética de criminosos e suspeitos, em


países como a Inglaterra, vem gerando grande polêmica, uma vez que podem ser
entendidos como uma violação da privacidade biológica dos indivíduos.08) Há mais de
250 milhões de anos, as gimnospermas, originadas das pteridófitas, dominaram as
paisagens terrestres durante o Triássico e o Jurássico, juntamente com os
dinossauros. Hoje, esse grupo vegetal está restrito a alguns locais da Terra,
conhecidos como Florestas de Coníferas, como as ainda existentes no sul do Brasil.
Com relação a esse grupo de plantas, é COR-
RETO afirmar que:

01. sua madeira é utilizada na indústria de papel e celulose, na indústria de móveis e na


construção de casas.
02. algumas espécies têm caráter ornamental, como os ciprestes e os populares pinheiros de
Natal.
04. no Brasil, é comum o consumo do pinhão como alimento, que é a semente do pinheiro-do-
paraná.
08. suas plantas produzem sementes nuas, ou seja, não há a formação de frutos.
16. são plantas avasculares, com flores perfeitas.
32. todas as espécies do grupo são dióicas.

09) Em um ecossistema, há muitos tipos de interação entre os componentes das diversas


espécies. Algumas interações são mutuamente proveitosas, outras são mutuamente
prejudiciais e outras, ainda, beneficiam apenas uma das espécies, prejudicando ou não a
outra. Dessa forma, as interações podem ser classificadas como harmônicas ou
desarmônicas.
Em relação a esse assunto, assinale a(s) propo-
sição(ões) CORRETA(S).

01. A interação das plantas epífitas (bromélias, por exemplo) e suas plantas hospedeiras é um
tipo de parasitismo, já que a árvore hospedeira é prejudicada em seu desenvolvimento.
02. Quando o caranguejo paguru (também conhecido como ermitão) ocupa a concha vazia de
um caramujo, ocorre um caso de favorecimento mútuo entre as duas espécies envolvidas.
04. Quando algas e fungos se associam, formando os liquens, ambos se favorecem, e tal
relação é um exemplo de simbiose.
08. As sociedades e as colônias representam relações harmônicas que são estabelecidas,
necessariamente, entre indivíduos de uma mesma espécie.
16. O predatismo é um tipo de relação desarmônica, em que apenas o predador leva
vantagem, já que o resultado final da interação é a morte da presa.
32. A ocorrência de vermes tipo Ascaris e Taenia, no interior do homem, é um caso de
endoparasitismo, enquanto insetos hematófagos, como a pulga e o mosquito, são
exemplos de ectoparasitas.

10) O Brasil possui uma enorme extensão territorial, com grandes variações climáticas, e
uma ampla diversidade de tipos de solo. Em função dessas características, há uma
evidente diversidade de biomas, definidos sobretudo pelo tipo de cobertura vegetal.
Com relação à distribuição dessa cobertura ve-
getal no Brasil, assinale a(s) proposição(ões)
CORRETA(S).

01. A Floresta Amazônica tem uma grande extensão e se espalha pelas regiões Norte, Centro-
Oeste e parte da região Sudeste.

02. Tanto o pampa como a Mata de Araucárias são formações vegetais exclusivas da região
Sul.

04. Originalmente, a Mata Atlântica era uma formação vegetal que se estendia, pela região
costeira, do Rio Grande do Norte até o Sul do Brasil.

08. A zona de Cocais se distribui, principalmente, na costa nordestina.

http://www.meninasetequilas.blogspot.com
6

16. Os manguezais preenchem uma faixa larga e descontínua, paralela ao litoral do país.

32. Enquanto o cerrado se espalha, principalmente, pela região central do país, a distribuição
do pantanal se restringe à região Centro-Oeste brasileira.

64. A caatinga é uma formação exclusiva do Brasil central.

11) O controle das infecções que ocorrem em hospitais é uma tarefa árdua e contínua [...] A
microbiota (conjunto de organismos encontrados no corpo humano) do paciente pode se
tornar patogênica, principalmente naqueles que estão com o sistema imunológico
comprometido,...

(Trecho do texto: “Infecção hospitalar: a solução em suas mãos”, extraído da Revista


Ciência Hoje, 29 (173), de julho de 2001, p. 80).

Com relação a esse assunto, suas causas e


medidas de redução, é CORRETO afirmar que:

01. a maioria dos casos de infecção hospitalar é causada por agentes bacterianos.

02. os traumatismos e a contaminação por vermes acarretam o surgimento desses tipos de


infecção.

04. entre os pacientes com maior risco de contraírem infecção hospitalar estão os
soropositivos para o HIV, uma vez que eles apresentam maior chance de terem seus
sistemas imunológicos comprometidos.

08. o uso indiscriminado de antibióticos também pode levar a uma maior incidência de
infecção hospitalar, pois ele facilita o surgimento de microorganismos resistentes.

16. entre os procedimentos que podem aumentar as chances da ocorrência da infecção


hospitalar, estão aqueles que requerem a entubação endotraqueal e/ou a nasogástrica, já
que exigem tempo prolongado de respiração mecânica e riscos de contaminação
secundária (através das mãos).

32. uma simples medida ― a lavagem adequada das mãos antes do contato com o paciente ―
pode reduzir drasticamente o índice de infecção hospitalar.

12) Empresas criam programas para detectar e ajudar os funcionários viciados em


substâncias químicas. Com essa manchete, a revista Veja, de 4/7/2001, divulga uma
matéria sobre “As Drogas no trabalho”. Com relação ao tipo, uso e conseqüências das
drogas, assinale a(s) proposição(ões) CORRETA(S).

1. As drogas que usualmente chamamos de “drogas psicotrópicas” são aquelas que agem
sobre o sistema nervoso do indivíduo, modificando sua maneira de sentir, pensar ou agir.
02. As anfetaminas, muitas vezes utilizadas pelos caminhoneiros, para permanecerem mais
tempo acordados, são poderosos estimulantes, cujo consumo constante acaba provocando
tolerância, o que leva o usuário a um aumento das dosagens.
04. O uso contínuo da maconha traz dificuldades de aprendizagem e de memorização, além
de ocasionar, como o fumo, problemas respiratórios.
08. A cocaína e o crack são drogas que têm alto poder de dependência e, quando consumidos
em grandes quantidades, podem provocar a morte por parada cardíaca.
16. O consumo de bebidas alcoólicas produz uma sensação de bem-estar, sem comprometer
a saúde das pessoas.
32. A heroína e outras drogas injetáveis, além de causarem dependência química, também
representam risco de contágio pelo vírus HIV.

http://www.meninasetequilas.blogspot.com
7

BIOLOGIA 2003
01) “Do mesmo modo que os vírus de computador estragam programas inteiros e podem
comprometer seriamente o disco rígido, tornando-o imprestável, os vírus biológicos
funcionam como verdadeiros hackers da célula”. (UZUNIAM, A.; BIRNER, E. Biologia. São
Paulo: Harbra, 2001. v. único, p. 267).

Em relação aos vírus biológicos, assinale a(s) proposição(ões) CORRETA(S).

01. Os vírus são parasitas intracelulares obrigatórios em que a falta de hialoplasma e


ribossomos impede que os mesmos tenham metabolismo próprio.

02. Os vírus são organismos acelulares, constituídos por uma capa protéica envolvendo uma
molécula de ácido nucléico, que pode ser DNA ou RNA, e pequenos mesossomos, que
realizam a síntese das proteínas virais.

04. Existem vírus que infectam células animais penetrando nelas com a cápsula e o ácido
nucléico.

08. Hepatite, esquistossomose e tuberculose são exemplos de doenças viróticas.

16. A dificuldade de produzir vacinas eficientes contra a gripe e outras viroses independe do
elevado grau de mutação do patrimônio genético dos vírus.

32. A capacidade reprodutiva dos vírus é assombrosa, considerando-se que um único vírus é
capaz de produzir, após algumas horas, milhões de novos indivíduos.

02) Considere os compostos, apresentados na coluna da esquerda, e as características,


apresentadas na coluna da direita e, após, assinale a(s) proposição(ões) que apresenta(m)
correlação(ões) CORRETA(S).

( I ) água ( A ) biocatalizador de origem protéica


( II ) sal mineral ( B ) molécula mais abundante na matéria viva
( III ) monossacarídeo ( C ) composto orgânico
( IV ) lipídeo ( D ) composto inorgânico
( V ) enzima ( E ) tipo de carboidrato

01. III – E
02. II – B
04. III – C
08. I–C
16. IV – C
32. V–D
64. V–A

03) “A ingestão em quantidades elevadas de aspirina (5 a 10 gramas, no caso de crianças)


pode acarretar o bloqueio da respiração celular, um quadro de intoxicação fatal”.
(Texto extraído do Jornal Universitário da UFSC, publicado em julho de 2001, p. 12).

Sobre o processo de respiração celular, assinale a(s) proposição(ões) CORRETA(S).

01. Parte dele acontece no hialoplasma, quando ocorre a quebra da molécula de glicose.
02. Durante a glicólise, uma molécula de 6 carbonos é quebrada em duas moléculas de 3
carbonos, produzindo energia sob a forma de ATP.
04. Esse processo é menos eficiente na obtenção de ATP do que a respiração anaeróbica, já
que esta independe da presença de oxigênio e de glicose.
08. Uma organela fundamental para a sua ocorrência é o centríolo, que permite a entrada da
glicose na célula.
16. Ao seu final, são produzidas moléculas de gás carbônico, água e ATP.

http://www.meninasetequilas.blogspot.com
8

32. Algumas etapas desse processo ocorrem dentro das mitocôndrias.


04) A meiose caracteriza-se pela ocorrência de apenas uma duplicação do material genético
para cada duas divisões nucleares, e é responsável pela formação de células haplóides a
partir de células diplóides. Em relação a esse tipo de divisão celular, é CORRETO afirmar
que:

01. o crossing over ocorre na prófase da meiose I e caracteriza-se pela permuta entre os
segmentos das cromátides irmãs do mesmo cromossomo.

02. a redução, pela metade, do número cromossômico confere à meiose uma importância
fundamental na manutenção do número constante de cromossomos da espécie.

04. a meiose ocorre durante o processo de produção das células reprodutivas e possibilita o
aumento da variabilidade genética dos seres vivos que a realizam.

08. a primeira divisão meiótica é reducional, enquanto a segunda é equacional, já que a


partir delas são formadas duas células diplóides e quatro células haplóides,
respectivamente.

16. na anáfase I ocorre a separação dos pares de homólogos, havendo a migração polar dos
cromossomos duplicados.

32. as anáfases I e II são semelhantes entre si, à medida que os centrômeros se dividem e as
cromátides de cada díade migram para o pólo da célula.

64. na metáfase I, os pares de cromossomos homólogos duplicados encontram-se na placa


equatorial da célula.

05) Considere o esquema abaixo e, após, assinale a(s) proposição(ões) CORRETA(S).


Frouxo

Tecido conjuntivo
propriamente dito

Adiposo

Tecido conjuntivo B

Ósseo

Hematopoético

http://www.meninasetequilas.blogspot.com
9

01. A é um tipo de tecido muito resistente à tração e forma os tendões que fixam os
músculos aos ossos.

02. B é uma variedade de tecido conjuntivo denominado sustentação.

04. C representa os músculos.

08. D é constituído por uma parte líquida, por elementos figurados e por células alongadas.

16. O tecido conjuntivo é um tecido de conexão de outros tecidos.

06) “O aparecimento da placenta no processo evolutivo das espécies veio contribuir para
que, nos mamíferos, as fêmeas pudessem desenvolver suas crias dentro de seus próprios
ventres, evitando o ataque de predadores aos ovos e tornando desnecessária a produção
de elevado número de descendentes para a sobrevivência de algumas poucas crias....”
(SOARES, J. L. Biologia. São Paulo: Scipione, 1999, v. único, p. 211).

Com relação ao processo reprodutivo dos mamíferos e ao desenvolvimento embrionário


dessa classe de animais, assinale a(s) proposição(ões) CORRETA(S).

01. Algumas espécies de mamíferos atuais são ovíparas, como é o caso do ornitorrinco que
põe ovos semelhantes aos dos répteis, incubando-os para manter a temperatura.

02. Os mamíferos são animais de fecundação externa, e na maioria absoluta das espécies o
desenvolvimento embrionário ocorre dentro do corpo da fêmea.

04. Através da placenta, a mãe fornece alimento e oxigênio para o feto e este passa para a
circulação materna o gás carbônico e restos de seu metabolismo, como é o caso de
produtos nitrogenados.

08. A placenta secreta hormônios que mantêm a integridade do endométrio durante a


gravidez.

16. A placenta transmite ao feto anticorpos maternos, que lhe conferem imunidade contra
todas as doenças congênitas.

32. As trocas entre mãe e feto, através da placenta, são efetuadas por difusão, graças à
proximidade dos vasos sangüíneos maternos e dos vasos sangüíneos do embrião.

07) A hemofilia é uma doença hereditária em que há um retardo no tempo de coagulação do


sangue, e decorre do não funcionamento de um dos fatores bioquímicos de coagulação.

Com relação a essa doença, assinale a(s) proposição(ões) CORRETA(S).

01. Não é possível a existência de mulheres hemofílicas.

02. É condicionada por um gene que se localiza no cromossomo X, em uma região sem
homologia no cromos-somo Y.

04. Entre as mulheres, é possível encontrar um máximo de três fenótipos e dois genótipos.

08. Entre os homens, é possível ocorrer apenas um genótipo; por isso, há uma maior
incidência dessa doença entre eles.

16. Entre os descendentes de um homem hemofílico e de uma mulher normal, não portadora,
espera-se que 50% deles sejam normais e 50% sejam hemofílicos.

http://www.meninasetequilas.blogspot.com
10

32. É um exemplo de herança ligada ao sexo, em que os indivíduos afetados têm graves
hemorragias, mesmo no caso de pequenos ferimentos.

08) A dispersão das sementes, que acontece após a polinização e a formação dos frutos, é a
fase mais crítica na vida de uma planta. As sementes precisam mover-se para longe da
planta-mãe, a fim de que as plantas-filhas tenham maior chance de sobrevivência.

Em relação ao conteúdo do texto acima e das formas “utilizadas” pelas plantas na


dispersão de suas sementes, assinale a(s) proposição(ões) CORRETA(S).

01. A dispersão permite às plantas-filhas evitarem uma competição por luz e água com a
planta-mãe.

02. As samambaias são bons exemplos de plantas que utilizam animais dispersores de
suas sementes, ao contrário das angiospermas, que utilizam principalmente o vento como
agente dispersor de sementes.

04. Características como formas, cores e aromas devem ter sido importantes ao longo do
processo evolutivo de plantas que têm sementes recobertas por frutos, já que as
tornariam mais atraentes para os animais dispersores.

08. Um tipo de agente dispersor de sementes são as aves, que se alimentam de frutos e
eliminam as sementes em locais distantes, através de suas fezes.

16. Uma das vantagens da dispersão é a redução das taxas de mortalidade causadas por
predadores de sementes e por fungos.

09) As curvas abaixo ilustram a diferença de crescimento entre os animais. Com base na
figura e no assunto crescimento em animais, é CORRETO afirmar que:

TAMANHO
A B

D TEMPO

01. as curvas A e B representam, respectivamente, tipos de crescimento descontínuo e


contínuo.
02. a curva A pode representar o crescimento de um vertebrado.
04. a curva B pode representar o crescimento de um artrópode.
08. os intervalos assinalados pelas letras C e D representam momentos de crescimento nulo.
16. em C e D, os animais poderiam estar sofrendo muda.
32. os animais, cujos crescimentos são representados pela curva A, apresentam exoesqueleto.

10) Na natureza, há um constante ciclo de elementos e compostos químicos que passam dos
seres vivos ao ambiente e deste aos seres vivos. Com relação ao cálcio e o seu ciclo, é
CORRETO afirmar que:

01. nos seres vivos, o cálcio se apresenta, principalmente, na forma de carbonatos e fosfatos.

http://www.meninasetequilas.blogspot.com
11

02. com a morte dos animais que possuem esse elemento em sua constituição, e com a
decomposição das estruturas dos mesmos, os sais de cálcio se dissolvem na água e no
solo.
04. os sais de cálcio são encontrados na organização do corpo de esponjas e corais.
08. o cálcio integra as conchas de moluscos e os esqueletos de vertebrados.
16. ele é um elemento químico importante na constituição das moléculas orgânicas, como as
proteínas e os lipídeos.

11) “A produção, em larga escala, de lixo e dejetos sólidos é um traço característico da


civilização urbana e industrial. Em geral, quanto maior é o PIB per capita, tanto maior a
quantidade de lixo gerada pelas residências e indústrias. O lixo doméstico é um
subproduto do consumo de bens duráveis e não-duráveis. No Brasil, cada pessoa origina
uma média diária de 0,6 kg de lixo doméstico; nos Estados Unidos, essa média chega a
2,0 kg.”
(FAVARETTO, J. H.; MERCADANTE, C. Lixo e Civilização. In: Biologia. São Paulo:
Moderna, 1. ed. v. único, p. 73).

Em relação a essa temática, é CORRETO afirmar que:

01. um dos sérios problemas ambientais decorrentes da incineração do lixo é a poluição do ar,
em razão da liberação de monóxido e dióxido de carbono, entre outros poluentes.

02. os lixões são locais propícios à procriação de insetos, muitos dos quais transmissores de
doenças como a esquistossomose e a malária, que podem ser veiculadas por mosquitos e
baratas.

04. em alguns aterros sanitários, o metano é coletado e canalizado, sendo empregado como
combustível domiciliar, o que beneficia o ambiente.

08. a compostagem, transformação do lixo orgânico (restos de alimentos, folhas, etc.) em


adubo, resulta da ação de minhocas, fungos e bactérias.

16. a reciclagem é importante pois, entre outras vantagens, poupa recursos naturais,
economiza energia e auxilia a reduzir a poluição atmosférica.

12) A partir de fevereiro de 2002, começou a circular no Brasil a nova safra de maços de
cigarros impressos de acordo com a resolução da Agência Nacional de Vigilância Sanitária.
(...) As sessenta marcas vendidas no país passaram a estampar, no verso da embalagem,
uma entre nove imagens associadas aos malefícios do cigarro. (VEJA. São Paulo: Editora
Abril, jan. 2002, p. 76).

Em relação ao texto e aos prejuízos provocados pelo cigarro, assinale a(s)


proposição(ões) CORRETA(S).

01. A nicotina é a droga do tabaco responsável pela dependência.

02. A oxigenação dos tecidos não é afetada pelo monóxido de carbono, produzido pelo
cigarro.

04. A exposição prolongada à nicotina nos fumantes, ativos e passivos, leva à toxidade que
contribui para a patologia de doenças como o diabetes e a cirrose hepática.

08. A nicotina aumenta a deposição de lipídios nos vasos sangüíneos, tornando maiores as
chances de infarto do miocárdio.

16. Em mulheres grávidas, o fumo não acarreta nenhum prejuízo ao feto, mas pode trazer
prejuízos à gestante.
32. Uma alta porcentagem dos casos de câncer de pulmão está associada ao consumo de
fumo.

http://www.meninasetequilas.blogspot.com
12

BIOLOGIA 2004
Mafalda, às vezes me pergunto:
Qual o sentido da vida?

É na direção 5’-- > 3’,


Felipe!!!

01) Neste ano de 2003, são comemorados os 50 anos da “descoberta” da estrutura tridimen-
sional do DNA.

Com relação às características dessa molé-cula, ao papel que ela desempenha nos seres
vivos e aos processos em que se encontra envolvida é CORRETO afirmar que:

01. Em alguns organismos primitivos, ela apre-senta apenas uma fileira de nucleotídeos.

02. Nela está contida a informação genética ne-cessária para a formação de um organismo.

04. Ela tem a capacidade de se autoduplicar.

08. Em sua composição é possível encontrar quatro bases nitrogenadas diferentes: a ade-
nina, a citosina, o aminoácido e a proteína.

16. A mensagem nela contida pode ser transcrita para uma outra molécula denominada RNA.

32. Nos organismos procariontes, ela fica esto-cada dentro do núcleo das células.

64. É formada por duas fileiras de nucleotídeos torcidas juntas em forma de hélice.

02) Experiências com ratos [...] indicam que a mistura de bebidas alcoólicas e energéticos
pode provocar doenças degenerativas do sistema nervoso. A pesquisa verificou que o
etanol acelera a morte de células do sistema nervoso central e esse efeito é
potencializado pela cafeína, principal ingrediente dos energéticos. Altas doses destes
componentes aceleram um mecanismo natural de renovação das células, chamado
apoptose, fazendo com que elas se autodestruam.

(CIÊNCIA HOJE. Rio de Janeiro: SBPC, v. 32, n. 192, p. 55, abr. 2003).

Com relação aos vários conceitos abordados no texto, é CORRETO afirmar:

01. Como o sistema nervoso é formado por células permanentes, os efeitos sobre ele poderão
ser revertidos com alguns poucos cuidados, já que uma das principais características
desse tipo de células é sua capacidade média de regeneração.

02. Experiências com ratos não devem ser estendidas aos humanos uma vez que essas duas
espécies não fazem parte sequer da mesma Classe Zoológica.

04. A apoptose ocorre, por exemplo, quando as membranas entre os dedos do feto são des-
truídas.

http://www.meninasetequilas.blogspot.com
13

08. Se o descrito no texto ocorresse com células epiteliais, o problema seria ainda mais
grave, dado que este tipo de célula tem uma baixa capacidade de regeneração.

16. Um neurônio, em geral, transmite seu poten-cial de ação para outro através de sinapses
geradas pela presença de moléculas neuro-transmissoras.

32. Os neurônios são formados por um corpo celular, pelo axônio e por dendritos.

03) Pouca vantagem representaria, para animais e plantas, serem multicelulares, se todas as
células fossem iguais. [...] Os órgãos das plantas, [...] são formados por tecidos.

(FROTA-PESSOA, O. Os caminhos da vida I. Estrutura e ação. São Paulo: Scipione, 2001,


p. 157).

Com relação a esse assunto é CORRETO afirmar que:

01. As raízes, a epiderme e os estômatos são exemplos de órgãos das plantas.

02. Os frutos, outro tipo de órgão nas plantas, são formados basicamente de células meris-
temáticas.

04. O xilema e o floema compõem o sistema de tecidos vasculares das plantas.

08. Na epiderme existem células meristemáticas com função de aeração da planta.

16. Os diversos tipos de parênquimas exercem funções de respiração, fotossíntese e aeração,


entre outras.

32. O colênquima e o esclerênquima são tecidos de condução, compostos de parênquimas


vivos.

64. Pelo xilema circula a seiva bruta, rica em água e sais minerais.

04) A figura abaixo apresenta uma genealogia hipotética.

I
1 2

II
1 2 3 4 5

III
1 2 3

Com relação a essa figura é CORRETO afirmar que:

01. Os indivíduos II - 3 e II - 4 representam, respectivamente, um homem e uma mulher.

02. Os indivíduos I - 1 e II - 2, por exemplo, são indivíduos afetados pela característica que
está sendo estudada, enquanto II - 1 e III - 3 não o são.

04. III - 1 é neto(a) de I - 1 e I - 2.

http://www.meninasetequilas.blogspot.com
14

08. III - 2 é sobrinho(a) de II - 5.

16. II - 3 não tem nenhuma relação genética com I - 2.

32. II - 1 é mais jovem do que II - 5.

64. Com exceção de II - 3, os demais indivíduos da segunda geração são irmãos.

05) Os fatores evolutivos são aqueles que levam ao desequilíbrio das freqüências gênicas das
populações.

Com relação a esse assunto é CORRETO afirmar que:


01. Alterações destas freqüências, devidas a fa-tores casuais, são mais sentidas em popula-
ções pequenas, sendo este fenômeno conhe-cido como oscilação ou deriva genética.

02. A migração, entrada e/ou saída de genes das populações, é um destes fatores evolutivos.

04. A mutação gênica, apesar de ocorrer em freqüências normalmente muito baixas, é um


fator gerador de variabilidade genética.

08. A seleção natural é um importante fator evo-lutivo, responsável pela adaptação dos tipos
fenotípicos às condições a que eles são expostos, eliminando os tipos mal adaptados.

16. Ao contrário da deriva genética, fator em que não se consegue prever a direção das
altera-ções nas freqüências gênicas, a migração, a seleção natural e a mutação são
fatores cujos resultados são previsíveis.

32. Caso as mutações deixem de ocorrer nas po-pulações, o processo evolutivo ficará estag-
nado, podendo, no máximo, haver a extinção de espécies já existentes.

06) Atualmente a Terra é dominada pelo grupo vegetal das Angiospermas, com cerca de
250.000 espécies espalhadas por todo o mundo. A maior parte dos alimentos de origem
vegetal é derivada de plantas desse grupo.

Com respeito às Angiospermas é CORRETO afirmar que:

01. Alguns de seus frutos são comestíveis; como por exemplo, o chuchu e o tomate.

02. Suas flores podem ser polinizadas por algu-mas aves, mamíferos e insetos.

04. Suas flores originam estruturas chamadas fru-tos que auxiliam na dispersão de suas se-
mentes.

08. Em algumas espécies, o fruto pode se desen-volver sem que ocorra o processo de fecun-
dação, originando os chamados frutos parte-nocárpicos.

16. As monocotiledôneas são uma divisão deste grupo, cujos representantes apresentam raiz
axial ou pivotante, flores tetrâmeras, sementes com dois cotilédones e crescimento
acentuado em espessura.
32. São os únicos vegetais que produzem se-mentes.

http://www.meninasetequilas.blogspot.com
15

07) As figuras I, II e III esquematizam três mode-los de sistemas circulatórios encontrados em


alguns grupos animais.
capilares
dos pulmões
capilares II
I das brânquias

capilares
do corpo capilares
do corpo

capilares
III dos pulmões
A = átrio
V = ventrículo

capilares
do corpo

Com relação às figuras acima e ao sistema circulatório é CORRETO afirmar que:

01. As figuras I, II e III apresentam esquemas de sistemas circulatórios do tipo fechado.


02. A figura I apresenta o esquema do sistema circulatório dos peixes, no qual se pode
observar que pelo coração só circula o sangue venoso.
04. No esquema apresentado na figura II, o san-gue arterial vindo dos pulmões mistura-se ao
sangue venoso.
08. Na figura III, o sangue arterial fica completa-mente separado do sangue venoso.
16. Nenhum dos sistemas circulatórios apresen-tados é encontrado em Poríferos, Cnidários ou
Platelmintos.
32. No sistema circulatório apresentado na figura III, a artéria Aorta é a responsável pelo
trans-porte do sangue venoso do ventrículo direito até os pulmões.
64. Animais como os mamíferos e as aves apre-sentam o tipo de sistema circulatório mostrado
na figura II.

http://www.meninasetequilas.blogspot.com
16

08) Observe bem a figura abaixo e assinale a(s) proposição(ões) CORRETA(S):

SOARES, José Luis. Biologia. São Paulo: Scipione, 1991, v. único, p. 300.

01. A figura representa uma cadeia alimentar com três níveis tróficos.

02. Fungos e bactérias são representantes dos seres decompositores.

04. O fluxo de energia é cíclico, sendo renovado pelos organismos decompositores.

08. A onça e o gavião representam os produtores.

16. Na cadeia: “verdura  veado  onça” existe um decréscimo energético entre os níveis
tróficos.

32. O mocho, o lagarto e a cobra são classifica-dos, nessa figura, como consumidores terciá-
rios ou de 3a ordem.

64. Uma grande parte da energia obtida pelo coelho, ao comer a verdura, é gasta em seu
processo de respiração celular.

09) Preste atenção nos seguintes dados forneci-dos pelo PNUMA (Programa das Nações Unidas
para o Meio Ambiente):

 Em 25 anos, metade da população mundial pode enfrentar problemas em obter água


suficiente para consumo e irrigação.

 Um terço do mundo é composto por áreas em que o consumo de água supera a oferta.

Não à toa as Nações Unidas declararam 2003 o Ano Internacional da Água Doce. Nas
últimas décadas, a escassez de água passou da esfera acadêmica para a cotidiana.

(05/06/2003 disponível em: www.folha.com.br)

Esses dados mostram que existe uma grande preocupação mundial com os recursos
hídricos potáveis.

Com respeito à água doce e suas fontes de obtenção é(são) CORRETA(S) a(s) proposi-
ção(ões):

http://www.meninasetequilas.blogspot.com
17

01. A obtenção de água doce potável, a partir da dessalinização da água do mar, é um proces-
so rápido e econômico.

02. Os lençóis freáticos, devido à sua profundida-de, não são alcançados por contaminantes
lançados no solo.

04. A preservação das matas ciliares e das matas do fundo dos vales é medida importante
para a manutenção da qualidade da água dos rios.

08. Rios e lagos constituem-se na principal fonte de água doce para consumo das populações
humanas.

16. Muitos rios, de grandes cidades brasileiras, poderiam estar sendo usados como fonte de
captação de água potável. Isto, no entanto, não ocorre, devido ao lançamento direto de
esgoto e lixo doméstico nesses rios.

32. A distribuição de água doce no mundo é muito homogênea.

64. No Brasil, graças à fiscalização rigorosa e à observância das leis ambientais, não
existem problemas de contaminação dos rios por efluentes originados de indústrias
têxteis, de papel e de produtos químicos.

10) Os hospitais estão sendo fechados e as pessoas estão morrendo. Um curto e incisivo
relato de uma área da cidade de Cantão proporcionou uma das primeiras descrições
sobre o caos na província de Guangdong, no sul da China, atingida por uma doença
misteriosa, agora conhecida como síndrome respiratória aguda grave (SARS, na sigla em
inglês).

(SCIENTIFIC AMERICAN – BRASIL. São Paulo: Duetto editorial, ano 2, v.13, p. 12, jun.
2003).

A SARS veio se juntar a uma série de outras doenças parasitárias que atingem o homem.

Com relação a essas doenças que podem atingir as populações humanas, é CORRETO
afirmar que:

01. A tuberculose, causada por um vírus, foi res-ponsável por muitas mortes no passado. No
entanto, atualmente, os casos fatais, provo-cados por essa doença no mundo, são raros.

02. SARS, AIDS e Dengue são ocasionadas por vírus.

04. Nas doenças causadas por vírus, esses eventualmente se utilizam da maquinaria de
síntese protéica da célula hospedeira para a construção de suas próprias proteínas.

08. Doenças como a Amebíase, a Doença de Chagas e a Malária são ocasionadas por pro-
tozoários parasitas.

16. O combate ao mosquito Aedes aegypti e a vacinação da população são medidas eficazes
no combate à esquistossomose.

32. Em seu ciclo de vida, muitos parasitas se utilizam de hospedeiros intermediários para
alcançarem seu hospedeiro definitivo.

64. Como medida profilática para todas as doenças parasitárias conhecidas, a Organiza-ção
Mundial de Saúde (OMS) recomenda que os governos dos países atingidos utilizem
campanhas de vacinação.

http://www.meninasetequilas.blogspot.com
18

BIOLOGIA 2005
Questão 01
A maioria das substâncias que constituem as células, que formam o corpo dos seres vivos,
está constantemente interagindo. Com relação a estes processos e às substâncias que deles
participam, é CORRETO afirmar que:

01. sínteses e decomposições se processam mediadas por um intrincado conjunto de


catalisadores.

02. as plantas verdes formam moléculas orgânicas armazenando a energia proveniente do Sol,
por meio de reações que absorvem energia.

04. mesmo em completo repouso, o corpo gasta energia – obtida através do metabolismo
basal – para se aquecer e manter movimentos internos, como os do coração.

08. o conjunto de todas as etapas que resultam nas transformações químicas orgânicas é
denominado catabolismo.

16. a respiração celular é uma reação química do tipo exergônica, uma vez que libera
energia.

32. a síntese de proteínas é um tipo de reação química na qual o produto final, uma cadeia de
nucleotídeos, é construído com gasto de energia e a intermediação de moléculas de
fosfato e glicose.

64. ao destruir um anticorpo, os antígenos provocam reações que degradam moléculas


complexas, quebrando-as em unidades menores.

Questão 02
A Mitose e a Meiose são importantes processos biológicos, pois permitem que o número de
cromossomos de uma célula permaneça igual, ou seja reduzido, para possibilitar sua
restauração numérica após a fecundação. Com relação aos eventos e aos resultados
destes dois processos, é CORRETO afirmar que:

01. ao contrário da Mitose, que ocorre em todas as células, a Meiose restringe-se àquelas da
linha germinativa, que produzirão gametas.

02. nos dois processos, ocorre a compactação da cromatina, fenômeno este que, além de
facilitar a divisão correta dos cromossomos, impede que o material genético seja atacado
por enzimas, presentes no citoplasma, que destroem o DNA.

04. uma mutação que ocorra em uma das cromátides de uma célula somática será trans-
mitida a todas as suas células-filhas, através da divisão mitótica.

08. a Mitose é o sistema de reprodução dos organismos nos quais não existe a presença de
sexo nem a formação de células germinativas.

16. se considerarmos, em uma mesma espécie, duas células-filhas, uma originada por Mitose
e a outra por Meiose, a primeira conterá metade do número de cromossomos e o dobro
da quantidade de DNA da segunda.

32. na Meiose, existe a possibilidade de ocorrer o fenômeno de recombinação, que é a troca


de segmentos entre quaisquer dois cromossomos, gerando, com isso, alta variabilidade
genética para os indivíduos envolvidos.

64. a Meiose compreende duas etapas de divisão cromossômica, sendo que, após a primeira, o
número de cromossomos das células-filhas é metade do das células-mães.

http://www.meninasetequilas.blogspot.com
19

Questão 03
Cordados e Angiospermas apresentam semelhanças e diferenças em relação a características
citológicas, histológicas e fisiológicas. Com relação a este assunto, assinale a(s)
proposição(ões) CORRETA(S).

01. Enquanto as células dos Cordados são procarióticas, as das Angiospermas são eucarióticas.

02. As células vegetais possuem membranas duplas – a plasmática e a celulósica – enquanto


as animais apresentam apenas a última.

04. O tecido epitelial animal apresenta um alto potencial de diferenciação, ao contrário dos
tecidos meristemáticos vegetais.

08. O tecido ósseo animal é rígido, especializado na sustentação do organismo, e encontra


paralelo no floema dos vegetais, tanto pelas características das células que os compõem,
como em relação às funções que exercem.

16. Cordados e Angiospermas possuem hormônios que controlam, por exemplo, o crescimento
dos indivíduos.

32. O parênquima clorofiliano vegetal e o tecido adiposo animal apresentam funções


semelhantes, uma vez que ambos estão envolvidos com a síntese e reserva de nutrientes.

Questão 04
Nos seres humanos, durante e após a gravidez, a relação entre mãe e filho compreende vários
aspectos endócrinos e imunológicos. Com relação a estes fatos, assinale a(s) proposição(ões)
VERDADEIRA(S).

01. Durante a gravidez, a placenta permite a passagem de macrófagos, neutrófilos e hemácias


maternos para o sangue da criança.

02. A importância do aleitamento materno nos primeiros meses de vida da criança, sob o
ponto de vista imunológico, está relacionada à presença de anticorpos no leite materno.

04. O hormônio prolactina, produzido logo após o parto, estimula a secreção de leite e sua
produção é mantida pelos estímulos nervosos da sucção da mama pela criança.

08. Os anticorpos maternos, durante a gestação, protegem a criança contra doenças e não
podem, em nenhuma situação, causar danos a ela.

16. As hemácias do sangue materno, ao entrarem no sistema circulatório da criança, auxiliam


a ação dos anticorpos.

http://www.meninasetequilas.blogspot.com
20

Questão 05
Na genealogia abaixo, os indivíduos que manifestam uma determinada doença hereditária
são mostrados em preto. Com base na análise da mesma, assinale a(s) proposição(ões)
CORRETA(S).

I 3
1 2 4
1 1 1
1
II
1 3
2 4
1 1 1
1

III
3 4
1 2
1 1 1
1
01. Na genealogia estão representadas 2 gerações.

02. O padrão da herança desta doença é autossômico dominante.

04. Os indivíduos I - 1, II - 3 e III - 3 podem ser homozigotos.

08. Do casamento consangüíneo, apresentado na genealogia, existe 33,3% de possibilidade


de nascer um descendente com a doença.

16. III - 3 e III - 4 têm 50% de probabilidade de terem um descendente portador da doença.

32. A doença só se manifesta nas mulheres, portanto está ligada ao cromossomo X.

Questão 06
O quadro, a seguir, mostra a comparação do número de aminoácidos diferentes, nas cadeias
polipeptídicas da hemoglobina de vários mamíferos. A análise bioquímica de polipetídeos e
proteínas, além de outras evidências, permite aos cientistas traçarem as linhas evolutivas dos
diferentes grupos de seres vivos.

Número de aminoácidos
Espécies comparadas diferentes
homem x chimpanzé 0
homem x gorila 2
homem x macaco Rhesus 12
macaco Rhesus x gorila 14
homem x cavalo 43
cavalo x gorila 45

Com respeito ao quadro e às evidências da evolução dos seres vivos, assinale a(s)
proposição(ões) CORRETA(S).

01. O fato de encontrarmos a enzima tripsina desde protozoários até mamíferos não serve
como uma evidência bioquímica do processo evolutivo.

02. Além do estudo das proteínas, o seqüenciamento do DNA também permite estudos
evolutivos.

04. Quanto à hemoglobina, o quadro mostra que o gorila é uma espécie mais próxima do
homem do que o chimpanzé.

http://www.meninasetequilas.blogspot.com
21

08. Análises cromossômicas também permitem traçar linhas evolutivas.

16. Com relação à hemoglobina, o cavalo apresenta maior similaridade com o gorila do que
com o homem.

32. O fato de não haver diferenças entre a hemoglobina do chimpanzé e a do homem nos
permite classificá-los como pertencentes ao mesmo gênero.

Questão 07
Assinale a(s) proposição(ões) que completa(m) de forma CORRETA a tabela abaixo.

Filos
Característica
s Poríferos Artrópodes

Equinodermos
Aquáticos,
fixos

Habitat A B
Exoesqueleto
Esqueleto de quitina D

C
Excreção Difusão Difusão
E
Fecundação Fecundação
Reprodução interna externa

F
Tubo
Digestão Intracelular digestório
completo
G

01. A – Grande diversidade.

02. E – Glândulas especiais e túbulos de Malpighi.

04. C – Espículas e fibras de espongina.

08. D – Exoesqueleto de placas calcáreas e espinhos.

16. B – Águas doces, salgadas e salobras.

32. F – Fecundação interna.

64. G – Intracelular.

Questão 08
Embora não seja um fato inédito no litoral catarinense, foi noticiado em nível nacional, em
agosto de 2004, o encalhe de uma baleia no Rio de Janeiro. Esse animal pertence ao filo dos
Cordados e à classe dos mamíferos.

Com relação aos mamíferos, assinale a(s) proposição(ões) CORRETA(S).

01. O coração dos mamíferos apresenta 3 cavidades e a circulação é do tipo aberta.

http://www.meninasetequilas.blogspot.com
22

02. As baleias, assim como os golfinhos e o peixe-boi, são exemplos de mamíferos


aquáticos.

04. Os mamíferos terrestres tiveram sua origem evolutiva a partir de cetáceos (baleias) que
migraram para a terra.

08. A presença do músculo diafragma nos mamíferos permite a separação entre os pulmões e
o coração.

16. Uma das principais características dos mamíferos é a presença de uma notocorda bem
desenvolvida na fase embrionária e sua posterior transformação em tubo nervoso.

32. A classe dos mamíferos apresenta representantes com membros locomotores modificados
em asas, patas e nadadeiras.

64. Durante a era dos grandes répteis, mamíferos, como os mamutes, coexistiam com o tigre
de dentes de sabre.

Questão 09
“Nos últimos 10 anos, os imunologistas realizaram avanços impressionantes no conhecimento
sobre a geração de respostas imunes para a defesa do organismo. Um dos resultados mais
promissores levou à retomada dos estudos de imunoterapia para controlar o crescimento de
tumores.”
(Trecho extraído da revista Ciência Hoje, volume 35 (207), p. 28, agosto de 2004).

Com relação aos assuntos citados no texto acima, é CORRETO afirmar que:

01. o corpo humano tem suas defesas, que formam o chamado sistema fisiológico.

02. o câncer é o resultado de modificações genéticas produzidas em células, seja por vírus
ou por agentes externos, como radiação ou substâncias químicas.

04. os leucócitos (células brancas) e as hemácias (células vermelhas) são “unidades móveis”
que atuam na defesa dos organismos.

08. as células imunes, ricas em lisossomos, pe-netram nos tecidos de todo o corpo através da
intermediação de enzimas especiais que possibilitam a realização do transporte ativo.

16. a medula óssea está envolvida com a produção de células do sistema imune.

32. quando do surgimento de um tumor, células normais sofrem alterações que afetam sua
capacidade de divisão.Questão 10
O Diário Catarinense, em sua edição no 6709, de 27/08/2004, publicou que: “Os problemas
evidenciados a cada temporada de Verão nos principais pontos da Ilha de Santa Catarina
devem se repetir daqui a quatro meses. Quase todas as associações de moradores e conselhos
comunitários de praias cuja população multiplica nos meses de calor reclamam da falta de
saneamento básico...”.

Assinale a(s) proposição(ões) CORRETA(S) com relação à poluição da água.

01. Entre as medidas que devem ser implementadas para diminuir a poluição da água, está o
controle da poluição nos garimpos, onde uma grande quantidade de metais pesados é
liberada.

02. O lançamento na água de substâncias biodegradáveis, em algumas circunstâncias, pode


ser considerado um agente de poluição.

04. A água não tratada, a ausência de informação básica e as condições precárias de


saneamento são alguns dos principais geradores de doenças em países pobres.

http://www.meninasetequilas.blogspot.com
23

08. Quando fertilizantes e adubos chegam até as reservas de água, através da chuva ou
despejados diretamente, podem provocar a proliferação exagerada de algas
microscópicas.

16. Um modo de avaliar a qualidade da água é medir sua quantidade de coliformes fecais –
vermes que vivem no estômago do homem e são eliminados com as fezes no esgoto
doméstico.

32. O vazamento de petróleo na água pode levar à intoxicação de animais aquáticos, além
de diminuir a passagem de luz impedindo, assim, a troca dos gases necessários à
realização da fotossíntese.

http://www.meninasetequilas.blogspot.com
24

BIOLOGIA 2006
O aumento da produção de suínos em vários estados do Brasil, como Santa Catarina, evidencia
problemas na adequação e no licenciamento ambiental das propriedades, que podem ser
altamente poluentes, caso não utilizem sistemas de tratamento dos resíduos animais. Seja
qual for a forma de criação, a suinocultura pode representar importante fonte de degradação
do ar, dos recursos hídricos e do solo. O problema crucial está no apreciável volume de
dejetos produzidos, no impacto ambiental e no difícil alcance da sustentabilidade da
produção. Estima-se que um animal destinado ao abate, com peso variando de 25 a 100
quilos, produza uma média de sete litros de dejetos a cada dia.
Texto adaptado de: Πhttp://www.comciencia.br/200405/noticias/4/suinos.htmΘ. Acesso
em: 22/09/2005.
Questão 21
Considerando o texto acima e o tema a que se refere, assinale a(s) proposição(ões) CORRETA(S).
01. Os resíduos da criação de suínos, assim co-mo de outros mamíferos, englobam as fezes,
urina, água desperdiçada pelos bebedouros e higienização, resíduos da ração, pêlos,
entre outros.
02. Uma das principais causas da poluição é a liberação direta desses dejetos, sem o devido
tratamento, em rios e riachos.
04. O excesso de matéria orgânica nos resíduos lançados nas águas aumenta o teor de
oxigênio dissolvido na água, devido ao surgimento de algas fotossintetizantes, fazendo
proliferar os peixes, num fenômeno denominado eutrofização, sendo esta uma vantagem
na criação de suínos.
08. Pode ocorrer disseminação de patógenos (organismos causadores de doenças), mau cheiro
e contaminação de águas potáveis com amônia, nitratos e outros elementos tóxicos.
16. Devido aos resíduos de suínos, as pessoas podem contrair diretamente a Teníase, um
importante parasita intestinal.

O Brasil está entre os cinco maiores importadores mundiais de drogas controladas, como o
femproporex e a anfepramona (medicamentos utilizados para emagrecer). Juntamente com a
Espanha, Alemanha, Estados Unidos e Reino Unido, o país importa 78% de remédios
anorexígenos produzidos no planeta. Segundo dados da Escola Paulista de Medicina e da Junta
Internacional para o Controle de Narcóticos das Nações Unidas, de 80 a 90% dos consumidores
deste tipo de medicamento estão com o peso ideal ou um pouco acima dele, e nove entre dez
são mulheres.
Texto adaptado de: Πhttp://www1.uol.com.br/bemzen/ultnot/geral/ult491u142.htm Θ. Acesso
em: 22/09/2005.
Questão 22
Considerando o texto acima e seus conhecimentos sobre o tema, assinale a(s) proposição(ões)
CORRETA(S).
01. O elevado consumo de drogas anorexígenas deve-se à necessidade real do seu uso para a
manutenção da saúde corporal.
02. Para alcançar o peso tido como ideal com o uso de drogas anorexígenas, o consumidor
delas corre o risco de sofrer efeitos colaterais como irritação, nervosismo, insônia,
taquicardia e hipertensão, entre outros.
04. As referidas substâncias não são consumidas via automedicação, sendo seus usuários
sempre atendidos por especialistas.
08. O femproporex e a anfepramona, como são drogas lícitas, raramente levam à
dependência.
Questão 23
Considere que o caráter analisado – cor da pelagem em coelhos – obedece ao proposto pela 1a
Lei de Mendel, tendo sido realizados os cruzamentos abaixo:

P Preto x Branco
F1 100% Preto
F2 75% Preto e 25% Branco

http://www.meninasetequilas.blogspot.com
25

Todos os descendentes pretos de F2 foram cruzados com os F1, resultando em 192


descendentes.

Assinale no cartão-resposta o número espe-rado de descendentes com pelagem branca.

Os ossos do pé de alguns dos mais antigos europeus, segundo estudos do paleoantropólogo


americano Erik Trinkaus, da Universidade Washington, em Saint Louis, possuem alterações
sugerindo que os primeiros calçados começaram a ser usados há cerca de 30 mil anos. Foi
nessa época que os sapatos se tornaram mais rígidos do que um simples pedaço de pele usado
para esquentar os pés. E também começaram a ser usados por um período muito maior, com
mais efeitos sobre os dedos. O fato é que, como seria de esperar, quem não usa sapatos tem
uma pisada mais "espalhada", ganhando um dedão ligeiramente mais robusto. Além disso, os
dedos do meio do pé crescem e se fortalecem mais nas pessoas que andam descalças.
Medindo cuidadosamente as falanges dos dedos de povos modernos e hominídeos, que vão de
neandertais com mais de 100 mil anos ao Homo sapiens com pouco menos de 20 mil anos, o
pesquisador descobriu diferenças bastante claras, que aparentemente confirmam a hipótese
dos "dedos do meio".

Texto adaptado de: Πhttp://www.jornaldaciencia.org.br/Detalhe.jsp?id=30902. Θ Acesso em:


22/09/2005.

Questão 24
Com base no texto acima e nos seus conhecimentos de morfologia dos sistemas orgânicos e de
evolução, assinale a(s) proposição(ões) CORRETA(S).
01. É provável que o aspecto dos pés de quem anda descalço por toda a vida seja herdado por
seus descendentes.
02. Ao caminhar descalço, além dos ossos, também os músculos e tendões dos pés sofrem
modificações.
04. Apesar de não ter sido citada no texto, a pele do calcanhar daqueles povos, antes dos
calçados, devia ser mais espessa, num fenômeno de queratinização das células epiteliais.
08. Os dedos do pé apresentam três falanges.
16. Em virtude de anos de uso de calçados, se a humanidade os abandonasse não haveria
retorno ao modelo de pé descrito no texto acima, pois as alterações sofridas são
permanentes.
Questão 25 Nariz e
O esquema abaixo apresenta um modelo simplificado de nosso sistema respiratório.
Assinale a(s) proposição(ões) CORRETA(S) sobre o mesmo e suasBocarelações com os demais
sistemas orgânicos.

Alvéolos
Traquéia

Bronquíolos
Brônquios

Pulmão
Direito
http://www.meninasetequilas.blogspot.com
26

01. Separadas pelo palato (“céu da boca”), as fossas nasais e a boca servem de entrada
para o ar inspirado.
02. A traquéia é um tubo formado por anéis ósteo-cartilaginosos que lhe dão rigidez e boa
sustentação.
04. A hematose ocorre nos alvéolos, com a troca do oxigênio atmosférico pelo gás carbônico
sangüíneo.
08. Pessoas portadoras de fenda palatina produzem sons anasalados pois, quando falam, o ar
sai tanto pela boca como pelo nariz.
16. O esquema apresenta apenas o pulmão di-reito visto ser ele o principal, tendo o esquerdo
função secundária.
32. Em caso de obstrução das vias aéreas (en-gasgo) por balas ou outros objetos estranhos,
em especial se ocorrer nos brônquios, deve-se bater nas costas da pessoa engasgada para
expulsar o objeto estranho.

Questão 26
Os vegetais possuem seu crescimento influen-ciado por substâncias denominadas fitormônios,
ou hormônios vegetais. Entre estas substâncias destacamos as auxinas. O gráfico abaixo
representa a curva de crescimento (em centímetros) de plantas que receberam concentrações
diferentes (em microgramas por litro) de uma determinada auxina.

50
m)
(c 40
nto
me 30 Curva de
crescimento
sci
cre 20
de
a 10
tax
0
0 0,01 0,1 1 10 100
concentração de auxina (µg/L)

Pela análise do gráfico, é CORRETO afirmar que:


01. quanto maior a concentração do hormônio maior será o desenvolvimento vegetal.
02. acima da concentração 1 µg/L, há acentuado crescimento vegetal.
04. concentrações entre 0,1 µg/L e cem vezes esta concentração são consideradas ideais para
quem quiser obter plantas em torno de 40 cm.
08. 0,01 µg/L é a concentração em que ocorre melhor desenvolvimento do vegetal.
16. um centésimo de 1 µg/L desta auxina é suficiente para fazer com que o vegetal atinja
pouco mais de 20 centímetros.
32. o conhecimento das concentrações ótimas das auxinas é valioso na produção de espécies
vegetais comercialmente vantajosas.

Questão 27
Fetos humanos provavelmente não sentem dor antes do início do terceiro trimestre de
gestação, afirmam cientistas em recente estudo feito pela Universidade da Califórnia, em São
Francisco, e publicado no periódico Jama, da Associação Médica Americana (vol. 294, n.8, p.
24-31, ago. 2005). Alguns pesquisadores afirmam, em contraponto, que o feto apresenta uma
resposta hormonal a partir da 22a semana, que seria evidência de dor, mas a nova pesquisa
sugere que as respostas sejam automáticas e não um sinal de desconforto.
Com base no texto acima, assinale a(s) proposição(ões) CORRETA(S).
1. A sensibilidade à dor, em fetos, está acompanhada do desenvolvimento da placenta, o
que só ocorre após a 30a semana de gestação.
2. Um feto que já possui o sistema nervoso completo deve sentir dor e, em humanos, isto
ocorre ao final do primeiro mês de gestação.

http://www.meninasetequilas.blogspot.com
27

4. O fenômeno da gastrulação é importante para a formação do cordão nervoso e, por


acontecer apenas após o terceiro mês de gestação, temos a certeza de que antes disso o
feto não pode sentir dor.
8. Aos oito meses de gestação há consenso, baseado nos dados expostos, de que os fetos
sentem dor.
16. A sensação de dor está vinculada à presença de receptores especiais na pele, presentes
desde a neurulação.

Questão 28

Em março de 2005 foi constatado um surto da Doença de Chagas na região litorânea de Santa
Catarina, atingindo 25 pessoas e resultando em 3 mortes. Este fato, totalmente inesperado
para uma área não endêmica da doença, dificultou inicialmente o diagnóstico por parte dos
profissionais de saúde e chamou a atenção dos meios de comunicação, tendo grande
repercussão em todo o país. A constatação da infecção natural pelo Trypanosoma cruzi em
um gambá e em vários exemplares de triatomíneos confirmou a existência de um ciclo de
transmissão do parasita naquela região.

Texto adaptado da Revista Ciência Hoje: Nº 217, Jul. 2005.

Sobre a origem, transmissão, aspectos clínicos, diagnóstico e tratamento da Doença de


Chagas, é CORRETO afirmar que:

01. em geral, a doença tem duas etapas distintas no homem: a fase inicial, aguda,
caracterizada por elevada parasitemia e estado febril, seguida de uma fase crônica,
caracterizada pela diminuição do número de parasitas circulantes.

02. os hospedeiros intermediários do Trypanosoma cruzi podem ser tanto vertebrados como
invertebrados.

04. uma vez instalado no hospedeiro vertebrado, o parasita invade os tecidos penetrando nas
células, estabelecendo-se no citoplasma e se multiplicando, o que provoca a seguir o
rompimento do conteúdo celular, com conseqüente liberação dos novos indivíduos para o
meio extracelular e a corrente sangüínea.

08. as formas mais comuns de transmissão da doença são o contato com fluidos orgânicos de
doentes e ingestão de alimento contaminado.

16. o tratamento mais eficaz da Doença de Chagas baseia-se na aplicação de antibióticos


potentes.

uestão 29
Há na mídia uma grande quantidade de notícias envolvendo o DNA: testes de paternidade,
engenharia genética, transgênicos, clonagem terapêutica e reprodutiva, terapia gênica,
farmacogenômica etc. Para compreender essas notícias, é necessário conhecer a estrutura da
molécula de DNA e entender seu funcionamento.

Analise os dados dos quadros a seguir, e assinale a(s) proposição(ões) CORRETA(S).


______________________________________

I
TACCGGATGCTT
ATGGCCTACGAA DNA
______________________________________

http://www.meninasetequilas.blogspot.com
28

II
TACCGGATGCTT

AUGGCCUACGAA – RNA m
______________________________________

III
AUGGCCUACGAA – RNA m

Metionina – Alanina – Tirosina – Ácido Glutâmico

01. Em I, observa-se que o pareamento das ba-ses nitrogenadas do DNA é aleatório.

02. O quadro I mostra uma molécula de DNA cuja duplicação ocorre de forma
semiconservativa, pois cada uma das fitas originais em I serve de molde para uma nova
fita, gerando duas novas duplas hélices.

04. Em II, está indicado o processo de transcrição, através do qual formam-se moléculas que
contêm as mesmas bases nitrogenadas presentes no DNA.

08. Em III, está indicado o processo de tradução, que resulta na formação de polipeptídios,
cuja seqüência de aminoácidos está codificada numa molécula de ácido nucléico.

16. A deleção de um dos pares de bases na se-qüência mostrada em I não alteraria


significativamente a seqüência de aminoácidos em III.

Questão 30
Proteínas são moléculas essenciais à vida, atuando como enzimas, hormônios, anticorpos,
antibióticos e agentes anti-tumorais, além de estar presentes nos cabelos, na lã, na seda, em
unhas, carapaças, chifres e penas dos seres vivos.

Em relação às proteínas é CORRETO afirmar que:

01. são biopolímeros constituídos de aminoácidos, os quais são unidos entre si por meio de
ligações peptídicas.

02. a produção destas moléculas se dá sem gasto de energia pelos organismos, já que os
aminoácidos provêm da alimentação.

04. todas as proteínas possuem peso molecular idêntico, característica especial dessas
moléculas.

08. a insulina, que foi o primeiro hormônio a ter sua seqüência de aminoácidos conhecida, é
produzida por células especializadas do pâncreas.
16. apesar da diversidade na constituição e estruturação de seus aminoácidos, essas
moléculas apresentam, no seu conjunto, a mesma velocidade de degradação no meio
ambiente.
32. a grande variabilidade biológica dessas moléculas permite sua utilização para fins de
identificação pessoal, da mesma forma e com a mesma precisão que os exames de DNA.

http://www.meninasetequilas.blogspot.com
29

A 2
B

BIOLOGIA 2007
1

Questão 01

http://www.meninasetequilas.blogspot.com 3
30

Fonte: AMABIS, JM e MARTHO, G. Biologia das Células. 1a ed. São Paulo: Moderna, 2004, p. 130-132.

Em relação aos desenhos acima, é CORRETO afirmar que:

1. o desenho A representa uma célula animal, o desenho B representa uma célula vegetal e
o desenho C representa uma bactéria.
2. a seta 1 indica o local de produção de ATP; a seta 2 indica a organela responsável pela
produção de enzimas digestivas e a seta 3 indica elementos responsáveis pela síntese de
polipeptídeos.
04. a seta 4 indica o local de produção de proteínas, que poderão ser transportadas para o
local indicado pela seta 5, estrutura responsável por liberar as proteínas no meio
extracelular.
08. apesar de sua diversidade, todas as células apresentam membrana plasmática,
citoplasma, núcleo e carioteca.
16. os ribossomos são elementos complexos que aparecem somente nas células eucariotas.
32. a membrana plasmática da célula animal é frágil e flexível, ao passo que a membrana
plasmática da célula vegetal é espessa e rígida, devido à celulose.
64. a clorofila é um pigmento apresentado apenas por células vegetais.

Questão 02
A perpetuação da vida em nosso planeta deve-se à característica mais típica dos seres vivos:
sua capacidade de se reproduzir.

Sobre os mecanismos de reprodução, assinale a(s) proposição(ões) CORRETA(S).

01. Os gametas são formados por divisão meiótica; a gametogênese feminina dá origem a
quatro óvulos e a gametogênese masculina dá origem a quatro espermatozóides.
02. A reprodução assexuada dá origem a clones de um indivíduo e pode ser observada em
bactérias, algas, fungos, plantas e animais.
04. A reprodução assexuada dá origem a clones de um indivíduo e só acontece em bactérias,
algas e fungos.
08. A reprodução sexuada é importante porque promove a variabilidade genética da
descendência.

http://www.meninasetequilas.blogspot.com
31

16. A clonagem de seres vivos é uma técnica muito recente, que só pôde ser concretizada
com o avanço da biotecnologia.
32. Gêmeos monozigóticos podem ser considerados clones um do outro.
64. A fertilização in vitro (técnica para a formação de bebês de proveta) é um tipo de
clonagem.

Questão 03
As anomalias cromossômicas são bastante freqüentes na população humana; um exemplo
disso é que aproximadamente uma a cada 600 crianças no mundo nasce com síndrome de
Down. Na grande maioria dos casos, isso se deve à presença de um cromossomo 21
extranumerário. Quando bem assistidas, pessoas com síndrome de Down alcançam
importantes marcos no desenvolvimento e podem estudar, trabalhar e ter uma vida
semelhante à dos demais cidadãos.

Sobre as anomalias do número de cromossomos, é CORRETO afirmar que:

01. podem ocorrer tanto na espermatogênese quanto na ovulogênese.


02. ocorrem mais em meninas do que em meninos.
04. ocorrem somente em filhos e filhas de mulheres de idade avançada.
08. estão intimamente ligadas à separação incorreta dos cromossomos na meiose.
16. ocorrem ao acaso, devido a um erro na gametogênese.
32. ocorrem preferencialmente em populações de menor renda, com menor escolaridade e
pouca assistência médica.
64. podem acontecer devido a erros na duplicação do DNA.
OS
OS
OR M U DO

NG
NG

GO O

ÉS
AN ND
O OS

TA
DO

AN E
NZ

I
A
LH C

H U PÉC
UN

VE AC A

PA
LA
RI

IM
M

ES
M
CA

CH
GO

5,1 + 0,8
maa*

6,3 + 0,6 Homo


Questão 04 maa*

13,8 + 0,8 MACACOS


maa* AFRICANOS

MACACOS
25,3 + 1,4
maa* ANTROPÓIDES

SÍMIOS

http://www.meninasetequilas.blogspot.com

*milhões de anos atrás


32

AMABIS, JM; MARTHO, G. Biologia das populações. Filogenia publicada na revista científica New
Scientist, maio 2003, 2. ed. São Paulo: Moderna, 2004.

De acordo com a figura acima, assinale a(s) proposição(ões) CORRETA(S).

01. A espécie humana e os camundongos originaram-se de um mesmo ancestral.


02. Os chimpanzés compartilham maior número de genes com os gorilas do que com a
espécie humana, pois a distância entre gorilas e chimpanzés é menor que a distância
entre os chimpanzés e a espécie humana.
04. Os primatas mais evoluídos são os da espécie humana, seguidos dos chimpanzés, dos
gorilas, dos orangotangos e finalmente dos macacos do velho mundo.
08. Na escala evolutiva, os macacos mais próximos da espécie humana são os chimpanzés,
seguidos dos gorilas e orangotangos.
16. A espécie humana originou-se dos chimpanzés, que se originaram dos gorilas, que se
originaram dos orangotangos, que por sua vez se originaram dos macacos do velho
mundo.

Questão 05
As DSTs (doenças sexualmente transmissíveis) constituem um dos grandes problemas de saúde
pública mundial. É direito e dever de todo cidadão manter-se informado sobre as doenças
sexualmente transmissíveis, de forma a se proteger do contágio e evitar a sua transmissão.

Sobre elas, é CORRETO afirmar que:

01. caso uma gestante tenha DST, seu filho não corre perigo de contrair a doença, pois não
há contato entre o sangue da mãe e o do bebê.
02. a AIDS (em português, síndrome da imunodeficiência adquirida) sempre causa lesões nos
órgãos genitais.
04. a grande maioria das DSTs pode ser prevenida com o uso de preservativo (camisinha)
durante a relação sexual.
08. as DSTs ocorrem apenas em pessoas que mantêm relações sexuais.
16. toda DST causa lesão nos órgãos genitais.
32. a AIDS pode ser transmitida através do contato direto com o paciente, como um aperto
de mão, ou através do contato indireto, como o uso dos mesmos pratos, copos e
talheres.

http://www.meninasetequilas.blogspot.com
33

64. a AIDS é causada pelo vírus HIV (em português, vírus da imunodeficiência humana), que
ataca as células do sistema imunológico diminuindo a capacidade do organismo de reagir
às infecções mais comuns.

Questão 06
Em relação à condução do impulso nervoso e considerando os desenhos abaixo, assinale a(s)
proposição(ões) CORRETA(S).
V
IV
Na K K Na

VI VII
II
01. As regiões I, II e III do desenho representam, respectivamente, o axônio, o corpo
celular e o dendrito.
02. A região V do desenho é o local onde ocorre a Sinapse.
04. A região VI do desenho indica que aquela parte da fibra está polarizada.
08. A região VII do desenho mostra que aquela parte da fibra está em potencial de ação.
16. A propagação do impulso nervoso em um neurônio ocorre sempre no sentido III, II, I.
32. A região IV do desenho representa um nódulo de Ranvier. Tais nódulos são vistos
somente nos neurônios mielinizados e são responsáveis pelo aumento da velocidade
do impulso nos mesmos. Como a inversão da polaridade na fibra ocorre somente
nesses nódulos, o impulso se propagará “saltando” de nódulo em nódulo e
aumentando sua velocidade na fibra.

Questão 07
Considere que em determinada região existam 6 populações de seres vivos. A população 1 é
constituída de vegetais e a população 6 de microorganismos decompositores. A população 2 se
alimenta da população 4 que, por sua vez, se alimenta somente da população 1. A população
5 se alimenta da população 2 e da população 4. Por fim, a população 3 se alimenta da
população 5.

De acordo com estas informações, assinale a(s) proposição(ões) CORRETA(S).

01. Se a população 3 desaparecer, espera-se que as populações 2 e 4 diminuam.


02. A única população que ocupa mais de um nível trófico é a 3.
04. A população 3 ocupa o primeiro nível trófico e a população 1 ocupa o último.
08. Existem relações de predatismo e competição entre as populações 2 e 5.
16. Todas as populações, exceto a 1, são carnívoras.
32. A situação apresentada caracteriza uma teia com duas cadeias alimentares.

Questão 08
Considere um gene que apresenta 3 alelos, aqui denominados alfa, beta e gama. Considere
que os alelos alfa e beta são co-dominantes e gama é recessivo em relação a ambos. Tal gene
deve determinar:

1. três fenótipos, correspondentes a cinco genótipos.


2. três fenótipos, cada um correspondente a um genótipo.
4. quatro fenótipos, cada um correspondente a dois genótipos.

http://www.meninasetequilas.blogspot.com
34

8. seis fenótipos, correspondentes a quatro genótipos.


16. quatro fenótipos, correspondentes a seis genótipos.

Questão 09
As plantas são seres vivos pluricelulares e organizados que apresentam diferentes tecidos.

Com relação aos tecidos vegetais, assinale a(s) proposição(ões) CORRETA(S).

01. Em plantas vasculares, o tecido condutor especializado na condução da seiva bruta é o


floema e, na condução da seiva elaborada, é o xilema.
02. Os tecidos meristemáticos são formados por células diferenciadas que, por
desdiferenciação destas células, originam todos os demais tecidos da planta.
04. O colênquima e o esclerênquima constituem os tecidos de sustentação do vegetal.
08. Os tecidos parenquimáticos executam numerosas tarefas, tais como o preenchimento
de espaços, a realização da fotossíntese e o armazenamento de substâncias.
16. As cactáceas apresentam parênquima aerífero bem desenvolvido. Já as plantas
aquáticas, como, por exemplo, o aguapé, apresentam o parênquima aqüífero bem
desenvolvido.

Questão 10

Com relação ao Reino Animal, assinale a(s) proposição(ões) CORRETA(S).

1. Formado por animais sésseis e geralmente hermafroditas, a maioria das espécies do filo
Poríferos são aquáticas, apesar de existirem algumas espécies terrestres.
2. A lombriga e a solitária (tênia), parasitas do intestino humano, pertencem aos filos
Platelmintos e Nematelmintos, respectivamente.
4. Animais cujo corpo é formado por numerosos anéis repetidos (metâmeros)
pertencem ao filo Anelídeos, do qual a minhoca é o representante mais
conhecido.
8. O filo Cnidários é formado, basicamente, por dois tipos morfológicos de indivíduos, que
são: pólipos, cujo principal representante é a água-viva, e medusas, representadas pelos
corais.
16. No filo Moluscos existem indivíduos com concha externa, como é o caso das ostras
e mexilhões, e também indivíduos sem ela, como é o caso da lula e do polvo.
32. De todo o reino animal, o filo Artrópodes é o que apresenta o maior número de
espécies.
64. No filo Cordados, somente a classe Mamíferos apresenta circulação dupla e completa.

BIOLOGIA 2008

Questão 01 Pulmões
Com relação ao Sistema Cardiovascular e com base no esquema abaixo, cujas setas indicam o
trajeto do sangue no corpo, assinale a(s) proposição(ões) CORRETA(S).
B
A
I II
IIIIV
C Coração
D

http://www.meninasetequilas.blogspot.com
Tecidos do Corpo
35

01. As cavidades I e II representam os ventrículos e as cavidades III e IV representam os átrios


(ou aurículas).
02. O sangue que leva o oxigênio para as células musculares do coração (miocárdio)
através das artérias coronárias é impulsionado pela cavidade IV.
04. Os vasos sangüíneos representados pelas setas B e C correspondem às veias e os vasos
sangüíneos representados pelas setas A e D correspondem às artérias.
08. O trajeto que o sangue faz da cavidade III até a cavidade II corresponde à circulação
sistêmica, também chamada grande circulação.
16. Nas cavidades I e III circula sangue arterial, ao passo que nas cavidades II e IV circula
sangue venoso.
32. Quando as cavidades III e IV estão em diástole, as cavidades I e II estão em sístole, e
vice-versa.
64. Entre as cavidades I e II localiza-se a válvula bicúspide (ou mitral) e entre as cavidades III
e IV localiza-se a válvula tricúspide.

Questão 02
O Reino Animal apresenta grande variedade de organismos, com cerca de um milhão de
espécies catalogadas.

Sobre os principais grupos animais, assinale a(s) proposição(ões) CORRETA(S).

01. Todas as espécies do grupo Equinodermos são exclusivamente marinhas.


02. A tênia e a lombriga, vermes que causam doenças ao ser humano, pertencem ao grupo
dos Nematódeos.
04. Apesar de terem organização corporal muito simples, os Poríferos apresentam três
folhetos germinativos.
08. Espécies que apresentam exoesqueleto podem ser observadas nos grupos Moluscos,
Artrópodes e Equinodermas.
16. Todos os Cordados possuem vértebras.
32. Os Anelídeos são parasitas obrigatórios.
64. Anêmonas, águas-vivas e corais são representantes dos Cnidários.

Questão 03
Os tecidos conjuntivos derivam do mesoderma do embrião e caracterizam-se por apresentar
diversos tipos de células imersas em material extracelular sintetizado por elas.

Com relação aos tecidos conjuntivos, assinale a(s) proposição(ões) CORRETA(S).

http://www.meninasetequilas.blogspot.com
36

01. Dentre as várias funções dos tecidos conjuntivos, podemos citar a absorção e a secreção
de substâncias através de glândulas.
02. Entre os vários tipos de células existentes nos tecidos conjuntivos encontramos os fibro-
blastos, adipócitos, melanócitos e neurônios.
04. Em indivíduos adultos, os elementos figurados do sangue se originam do tecido conjuntivo
encontrado na medula óssea vermelha, a qual apresenta células-tronco pluripotentes (ou
multipotentes) que após se multiplicarem ativamente se diferenciam em leucócitos,
hemácias e plaquetas.
08. O tecido conjuntivo denso modelado, também chamado de tecido tendinoso, é formado
por fibras grossas orientadas paralelamente, especialmente fibras colágenas, o que
confere grande resistência a estruturas como tendões e ligamentos.
16. Os condrócitos, após formarem a matriz cartilaginosa, sofrem uma pequena retração de
volume e passam a ser chamados de condroblastos.
32. Os ossos de uma criança são mais flexíveis que os ossos de um adulto pois apresentam
maior quantidade de osteoblastos, os quais produzem muitas fibras colágenas.

Questão 04
Os principais grupos vegetais (Briófitas, Pteridófitas, Gimnospermas e Angiospermas)
apresentam em comum um ciclo de vida que ocorre através de alternância de gerações
(metagênese), em que uma geração haplóide alterna-se com outra diplóide.

Com relação a este ciclo e considerando o esquema abaixo, assinale a(s) proposição(ões)
CORRETA(S).

Gametas
haplóides II

I
Zigoto
diplóide

Gametófito Esporófito
haplóide diplóide

IV
III

Esporos
haplóides

01. O esquema representa um ciclo de vida haplodiplobionte (ou haplonte-diplonte) típico dos
principais grupos de vegetais.
02. Os eventos que ocorrem em I e III do esquema correspondem, respectivamente, à meiose
e à mitose.

http://www.meninasetequilas.blogspot.com
37

04. Neste ciclo, o esporófito forma o gametófito por reprodução assexuada e o gametófito
forma o esporófito por reprodução sexuada.
08. Nas gimnospermas e angiospermas, o esporófito é originado pela fusão dos gametas
masculino e feminino que são, respectivamente, o androceu e o gineceu.
16. Os eventos II e IV do esquema correspondem, respectivamente, à fecundação e à
germinação.
32. Nas briófitas e pteridófitas, a fase gametofítica é duradoura e evidente e a fase
esporofítica, ao contrário, é reduzida e pouco evidente.

Questão 05
Entre os seres vivos que habitam determinado ambiente, podem ser observadas interações
biológicas com diferentes tipos de relações. Estas relações podem ser harmônicas ou
desarmônicas, entre espécies diferentes ou entre indivíduos da mesma espécie.
Sobre estas relações, assinale a(s) proposição(ões) CORRETA(S).

01. Relações interespecíficas são aquelas estabelecidas entre indivíduos de mesma espécie e
relações intra-específicas são aquelas estabelecidas entre indivíduos de espécies dife-
rentes.
02. O predatismo e o parasitismo são exemplos de relações desarmônicas.
04. Colônia é uma associação entre indivíduos da mesma espécie, que se mantêm ligados
anatomicamente formando uma unidade estrutural.
08. O mutualismo é um tipo de relação desarmônica interespecífica.
16. A bactéria Mycobacterium tuberculosis é um ectoparasita que causa a tuberculose no ser
humano.
32. Apesar do predatismo ser uma relação interespecífica desarmônica, ela pode ser benéfica
e importante para o controle da população de presas e a manutenção do equilíbrio do
ecossistema.

Questão 06
A figura abaixo mostra o corte transversal de um embrião e anexos embrionários.

AMABIS,J. M.; MARTHO, G. R. Biologia das células. 2. ed.


São Paulo: Moderna, 2004. p. 422. (adaptado)

http://www.meninasetequilas.blogspot.com
38

Em relação à figura, é CORRETO afirmar que:

01. a seta 1 indica o principal local de produção da gonadotrofina coriônica, hormônio que
quando está presente na urina é sinal inequívoco de gravidez.
02. a seta 2 indica a bolsa amniótica, que tem por função hidratar e proteger o feto
contra eventuais choques mecânicos.
04. a figura representa um embrião de mamífero.
08. a figura representa o embrião de uma ave.
16. a placenta (indicada pela seta 3) é responsável pela intensa troca de substâncias entre
mãe e filho. Esta troca ocorre porque há passagem do sangue da mãe para o filho e vice-
versa.
32. a figura difere da representação de um embrião de répteis por possuir âmnio e cório,
anexos inexistentes nesses animais.

Questão 07
Sobre os cromossomos X e Y, responsáveis pela determinação cromossômica do sexo da
espécie humana, é CORRETO afirmar que:

01. todos os homens normais receberam o cromossomo Y de seu avô paterno, mas nem
todos receberam o cromossomo X de sua avó materna.
02. todas as mulheres normais receberam um cromossomo X de sua avó paterna, mas nem
todas receberam um cromossomo X de sua avó materna.
04. todos os genes presentes nos cromossomos X e Y são responsáveis pelo desenvolvimento
sexual de um indivíduo.
08. apenas o cromossomo X tem genes responsáveis pelo desenvolvimento sexual, pois o
cromossomo Y tem poucos genes.
16. todos os genes do cromossomo Y são responsáveis pelo desenvolvimento sexual mas-
culino.
32. o sistema XY de determinação cromossômica do sexo está presente apenas na espécie
humana.
64. os cromossomos X e Y são assim denominados porque apresentam a forma de um X e de
um Y.

Questão 08
Jean-Baptiste Antoine de Monet (1744-1829), também chamado Jean-Baptiste Lamarck, e
Charles Darwin (1809-1882) deram importante contribuição para o pensamento evolucionista.

Sobre suas idéias, é CORRETO afirmar que:

01. Lamarck acreditava que a adaptação dos seres vivos ao ambiente era resultado de
modificações lentas e graduais ao longo de inúmeras gerações.
02. de acordo com Darwin, os indivíduos sofrem mutações com o propósito de melhor se
adaptarem ao meio em que vivem, e assim deixarem descendentes mais bem adaptados.
04. de acordo com Lamarck, o uso freqüente e repetido de um órgão o fortalece, enquanto o
desuso de tal órgão o enfraquece, processo que atualmente é conhecido como evolução
divergente.
08. Darwin apresentou as observações de fósseis das ilhas Galápagos em defesa de suas
idéias.

http://www.meninasetequilas.blogspot.com
39

Questão 09
Bactérias, protozoários e fungos são microorganismos responsáveis por muitas doenças
humanas. Assinale a(s) proposição(ões) CORRETA(S) a respeito deste assunto.

01. A toxina botulínica é produzida por uma bactéria que pode estar presente em
alimentos industrializados mal processados (enlatados, conservas e embutidos). Sua
ingestão causa o botulismo, cujo principal sintoma é a paralisia muscular.
02. Para combater as infecções causadas por bactérias utilizamos os antibióticos, os quais não
são efetivos no combate às infecções causadas por vírus.
04. Frieiras e outras micoses são causadas por fungos.
08. A doença de Chagas é causada pelo Tripanosoma cruzi, um protozoário presente nas
fezes do barbeiro. A doença é grave e não há tratamento ou prevenção.
16. A giardíase é causada por uma bactéria que provoca diarréia e dores abdominais, e pode
ser contraída pela ingestão de carne crua ou mal cozida.
32. O tétano, a pneumonia e a leishmaniose são doenças causadas por bactérias e podem ser
prevenidas através de vacinação.
64. A malária é causada por um protozoário transmitido ao homem pela picada do
mosquito Aedes aegypti.

Questão 10
Todas as formas de vida do nosso planeta têm suas informações genéticas codificadas nas
seqüências de bases nitrogenadas dos ácidos nucléicos. Assinale a(s) proposição(ões)
CORRETA(S), considerando as informações abaixo:

Seqüência 1 → AAAGATCCCGAATCGGTCGGCGATTTATCG
Seqüência 2 → TTTCTAGGGCTTAGCCAGCCGCTAAATAGC

01. As seqüências 1 e 2 são complementares no DNA e, juntas, representam um segmento de


molécula de DNA.
02. Se considerarmos 1 a seqüência molde, o RNAm formado por esta seqüência conterá as
mesmas bases nitrogenadas da seqüência 2, trocando-se a timina pela uracila.
04. Na seqüência 1 estão representados 30 códons e 10 nucleotídeos.
08. A seqüência 1 pode ser a representação de um DNA ou de um RNA, dependendo de como
for lida.
16. O código genético é exclusivo de cada espécie. Prova disso é que determinados
aminoácidos, como por exemplo a fenilalanina, são encontrados apenas na espécie
humana.
32. Adenina, timina, citosina e guanina são aminoácidos essenciais, presentes em todos os
seres vivos.
64. Com o seqüenciamento do genoma humano foi possível determinar a seqüência de
aminoácidos de todas as proteínas humanas.
BIOLOGIA 2009
Questão 01

Observe a coluna 1, que apresenta processos ocorridos em uma célula eucariótica, e a coluna
2, que apresenta o local da célula onde eles ocorrem.

COLUNA 1 COLUNA 2
(I) Osmose
(II) Fotossíntese (A) Núcleo

http://www.meninasetequilas.blogspot.com
40

(III) Duplicação dos centríolos


(IV) Duplicação do material genético (B) Citoplasma
(V) Transcrição do RNA ribossômico
(VI) Tradução do RNA mensageiro (C) Membrana plasmática
(VII) Respiração celular

Assinale a(s) proposição(ões) cuja(s) correlação(ões) é(são) CORRETA(S).


01. I – A
02. II – B
04. III – C
08. IV – C
16. V – B
32. VI – B
64. VII – C

Questão 02

Ao final da gravidez, é comum haver pequenas rupturas placentárias que permitem a


passagem de hemácias fetais para o sangue materno. A mãe, assim, pode ser sensibilizada e,
dependendo de seu tipo sangüíneo e do tipo sangüíneo do feto em relação ao sistema Rh,
gerar uma doença denominada eritroblastose fetal.

Com relação ao fenômeno descrito e suas conseqüências, é CORRETO afirmar que:

01. a mãe tem que ser Rh negativo.


02. o pai tem que ser Rh positivo.
04. a criança é, obrigatoriamente, homozigota.
08. a mãe é, obrigatoriamente, homozigota.
16. o pai pode ser heterozigoto.
32. a criança é Rh negativo.
64. o pai pode ser homozigoto.

Questão 03

Um pesquisador interessado em estudar dinâmica populacional monitorou, em uma


determinada área e por um período de tempo, as densidades populacionais de cobras e ratos,
obtendo como resultado o gráfico abaixo.
Densidade das populações

Cobras

Ratos

http://www.meninasetequilas.blogspot.com

Tempo
41

Com respeito ao gráfico e aos fatores que influenciam as densidades populacionais, assinale
a(s) proposição(ões) CORRETA(S).

01. O crescimento da população de ratos não influencia o crescimento da população de


cobras.
02. As duas espécies ocupam o mesmo hábitat e nicho ecológico.
04. Se duas espécies ocupam o mesmo nicho ecológico, ocorre simbiose entre elas, o que
pode levar ao desaparecimento de uma delas da área.
08. As densidades populacionais representadas sofreram variações ao longo do tempo.
16. O parasitismo, os intemperismos, a disponibilidade de alimentos e espaço são fatores que
influenciam na densidade das populações.
32. Por serem autótrofas, não são observados mecanismos de controle da densidade
populacional nas espécies vegetais.
64. A territorialidade (estabelecimento de territórios) de algumas espécies animais é fator
influente na densidade populacional de uma área.

Questão 04

O DNA é a molécula biológica responsável pela codificação da informação genética nos seres
vivos.

Sobre esse assunto, é CORRETO afirmar que:

01. a molécula de DNA é formada por duas cadeias caracterizadas por seqüências de bases
nitrogenadas.
02. na molécula de DNA podem existir oito diferentes tipos de complementação de bases
nitrogenadas.
04. a quantidade de adenina presente em uma das cadeias é exatamente igual à quantidade
de timina da cadeia complementar.
08. na molécula de DNA podem existir cinco diferentes tipos de bases nitrogenadas.
16. no processo de mitose, cada molécula de DNA dá origem a quatro moléculas de DNA
exatamente iguais.

Questão 05

Aproximadamente uma a cada 600 crianças nasce com síndrome de Down, pois anomalias
cromossômicas são freqüentes na população. Na grande maioria dos casos, isso se deve à
presença de um cromossomo 21 extranumerário. Quando bem assistidas, pessoas com
síndrome de Down alcançam importantes marcos no desenvolvimento e podem estudar,
trabalhar e ter uma vida semelhante à dos demais cidadãos.

Sobre as anomalias no número de cromossomos, é CORRETO afirmar que:

01. ocorrem ao acaso, sempre devido a um erro na ovulogênese.


02. podem acontecer devido a erros na transcrição do RNA.
04. podem ocorrer tanto na espermatogênese quanto na ovulogênese.
08. ocorrem mais em meninas do que em meninos.
16. ocorrem somente em filhos e filhas de mulheres que dão à luz em idade avançada.
32. ocorrem preferencialmente em populações de menor renda, com menor escolaridade e
pouca assistência médica.

http://www.meninasetequilas.blogspot.com
42

64. estão intimamente ligadas à separação incorreta dos cromossomos na meiose.

Questão 06

Existem várias provas da evolução e dentre elas podemos citar as embriológicas.

Sobre o tema, é CORRETO afirmar que:

01. as nadadeiras dos golfinhos, assim como braço e mão humanos, são ditos órgãos
homólogos e são herdados de um ancestral comum.
02. as nadadeiras dos golfinhos e as asas das aves têm a mesma origem embrionária e
diferentes funções, decorrentes da adaptação a diferentes modos de vida, processo
conhecido como divergência evolutiva.
04. as nadadeiras dos golfinhos e as nadadeiras das tainhas são órgãos de diferentes origens
embrionárias e têm a mesma função, o que é chamado de convergência evolutiva.
08. as asas dos insetos e as asas das aves são ditos órgãos homólogos, pois têm a mesma
origem embrionária.
16. as nadadeiras dos golfinhos, as asas dos morcegos e os braços e as mãos dos humanos têm
origem embrionária diferente.
32. as baleias, os golfinhos, os peixes-boi e as focas pertencem à ordem dos cetáceos, pois
possuem órgãos análogos e sinérgicos em comum, como as nadadeiras e a bexiga
natatória.

Questão 07

Pegue todas as espécies de mamíferos, aves, répteis, anfíbios, peixes e insetos conhecidos da
Amazônia. Agora triture tudo e tente encaixar o que sobrou dentro de um pacotinho de
açúcar. Só assim, talvez, seja possível ter uma idéia – ainda que muito distante – da
biodiversidade de microrganismos que podem ser encontrados em um único grama de solo: um
milhão de espécies de bactérias, segundo um estudo publicado na revista Science.
Com relação às bactérias, assinale a(s) proposição(ões) CORRETA(S).
01. As bactérias encontradas em grandes quantidades no solo são responsáveis por todas as
doenças microbianas em humanos.
02. O ciclo do nitrogênio depende de alguns desses seres microscópicos.
04. A ciclagem de nutrientes e da energia nos ecossistemas está diretamente relacionada ao
metabolismo bacteriano.
08. A diversidade bacteriana é decorrente de sucessivas mutações e da passagem de
material genético entre bactérias geneticamente diferentes.
16. As bactérias, juntamente com as algas verdes microscópicas, compreendem o reino
Monera.

Questão 08
Sobre os vermes do gênero Taenia, assinale a(s) proposição(ões) CORRETA(S).
01. A Taenia solium é um asquelminto do grupo trematoda.
02. A teníase é causada pela ingestão de cisticercos em carne bovina ou suína.
04. A Taenia solium não causa a cisticercose humana.
08. A higiene pessoal e o saneamento básico são importantes medidas na prevenção das
parasitoses causadas por Taenia sp.
16. A Taenia solium adulta é hermafrodita, apresenta o corpo segmentado, escólex com 4
ventosas e uma coroa de acúleos. Os últimos segmentos são cheios de ovos, que ficam
encistados no tecido muscular de suínos.
32. A cisticercose humana é ocasionada pela presença da larva da Taenia solium e é
adquirida pela ingestão de ovos do parasito liberados nas fezes de pessoas infectadas.

http://www.meninasetequilas.blogspot.com
43

Questão 09
Assinale a(s) proposição(ões) que indica(m) CORRETAMENTE doença(s) causada(s) por
protozoário.

01. Raiva
02. Doença de Chagas
04. Toxoplasmose
08. Esquistossomose
16. Giardíase
32. Dengue
64. Febre amarela

Questão 10
A figura abaixo apresenta um corte histológico de vegetal.

fibras
colênquima
epiderme

parênquima

xilema primário

floema primário

Sobre a estrutura vegetal de onde foi extraído este corte, é CORRETO afirmar que:
01. há fluxo de seiva elaborada por ela.
02. pela posição dos vasos, pode ser caule ou raiz envelhecidos.
04. nela a seiva elaborada é transportada mais externamente em relação à seiva bruta.
08. é flexível, ainda não dotada de muitas células com paredes muito espessadas.
16. em virtude de ter menor quantidade de células epidérmicas, deve ser um órgão interno.

http://www.meninasetequilas.blogspot.com
44

32. a presença de células parenquimáticas indica ser um órgão com alto poder de
multiplicação celular.

BIOLOGIA 2010

Questão 31

O meio ambiente pode influenciar o funcionamento do nosso organismo de várias formas,


desde a alteração de funções fisiológicas, das quais geralmente não nos damos conta, até
alterações na nossa percepção sensorial e estado de ânimo. Por exemplo, nas grandes festas
musicais que se estendem madrugada adentro, conhecidas como “raves”, o consumo de
álcool e bebidas estimulantes, como os “energéticos”, chega a níveis alarmantes. No contexto
da ideia de diversão, a mistura destas duas substâncias pode trazer consequências
devastadoras para o organismo humano. A pessoa que consome o energético junto com o
álcool reduz o efeito deste, uma vez que o estimulante diminui o efeito depressor do álcool
sobre o sistema nervoso. Esta ação dos energéticos reduz a percepção da embriaguez, e leva
as pessoas a ingerir mais álcool, as quais não se dão conta dos riscos envolvidos. Uma
superdosagem desta substância aumenta a frequência cardiorrespiratória e pode provocar
irritação estomacal e intestinal. O que a princípio é euforia e excitação, pode transformar-se
em tontura e desmaio.

Sobre o assunto do texto acima, pode-se afirmar CORRETAMENTE que:

01. o sistema nervoso responde pela coordenação e controle do funcionamento do


organismo, independentemente da ação do sistema endócrino.
02. o efeito estimulante das “bebidas energéticas” é consequência da liberação de
neurotransmis-sores, como a dopamina, que provocam sensação de prazer.
04. glicídios ou carboidratos são fontes de energia para o nosso organismo.
08. em nível celular, a organela citoplasmática responsável pela produção de energia é o
lisossomo.
16. a longo prazo, o consumo de álcool em grandes quantidades não provoca alterações
cardiovas-culares, nem prejuízo nas funções hepáticas.
32. o controle da frequência cardiorrespiratória é uma das funções que podem ser atribuídas
ao sistema nervoso autônomo.
64. a interação entre o consumo excessivo de álcool e bebida energética não traz danos
fisiológicos ao organismo.

http://www.meninasetequilas.blogspot.com
45

Questão 32

Para o alto e avante!


Mecanismo único permite que um inseto salte mais de cem vezes sua própria altura.
Um inseto de apenas seis milímetros de comprimento é capaz de pular
proporcionalmente mais alto que qualquer outro animal na natureza. O salto da cigarra da
espuma (Philaenus spumarius) pode chegar a 70 centímetros – mais de 100 vezes sua própria
altura. Isso seria o equivalente a um homem que saltasse uma altura de 200 metros, ou um
prédio de cerca de 70 andares. A execução dos enormes saltos da cigarra da espuma requer
uma grande quantidade de energia, que não pode ser obtida pela contração direta dos
músculos em um curto espaço de tempo. A força muscular do inseto é gerada lentamente
antes do pulo e é estocada. Assim que os músculos da cigarra geram força suficiente para o
salto, ela ‘solta’ suas pernas, que disparam como um gatilho e a projetam no ar.

Disponível em: <http://www.cienciahoje.uol.com.br/3819>


Acesso em: 15 set. 2009. (Adaptado)

Sobre o assunto do texto, assinale a(s) proposição(ões) CORRETA(S).

01. A energia necessária para o movimento descrito é gerada pela musculatura do tipo lisa, já
que o movimento é lento e contínuo.
02. A fonte primária de energia dos músculos provém da molécula de adenosina trifosfato
(ATP), presente nas células.
04. A cigarra mencionada no texto (Philaenus spumarius) é um artrópode, pertencente ao
grupo dos aracnídeos.
08. Os mecanismos de produção de energia na célula envolvem a participação direta de
organelas celulares, como os lisossomos.
16. O exemplo de movimento citado no texto (salto) é incomum e pode parecer desnecessário
entre os insetos, já que todos possuem asas e podem voar.
32. Em geral uma contração muscular é resultado da interação entre filamentos contráteis
que deslizam em direções contrárias.

Questão 33

A figura abaixo representa uma das hipóteses para explicar a filogenia animal.

Vermes
Água-viva cilíndricos Minhocas Estrela-do-mar
Vermes Artrópod
Esponja achatado Caramujos Cobra
es
s

http://www.meninasetequilas.blogspot.com
46

Disponível em:
<http://www.biosonialopes.editorasaraiva.com.br/sonialopes/site/apoio
aoprofessor/aulasempowerpoint.cfm>
Acesso em: 14 set. 2009. (Adaptado)

Após analisar o gráfico, assinale a(s) proposição(ões) CORRETA(S) quanto à evolução dos
animais.

01. Todos os animais representados possuem ancestralidade comum.


02. A característica mais importante usada para separar os animais em filos distintos é a sua
distribuição no ambiente.
04. Os equinodermos são representados na figura acima por animais como minhocas,
caramujos e vermes cilíndricos.
08. Peixes, anfíbios e cobras são animais cordados.
16. Os répteis não aparecem representados nesta figura.
32. Os cnidários, representados pelas esponjas do mar, são animais muito simples e não
apresentam tecidos verdadeiros.
64. Os animais se caracterizam por serem pluricelulares, eucariontes e heterótrofos.

Questão 34

Enzimas convertem sangue de todos os tipos em sangue “O”.

Um método capaz de transformar em “O” sangue dos tipos A, B e AB foi criado por uma
equipe internacional de pesquisadores. A técnica pode pôr fim aos problemas de suprimento
nos bancos de sangue, onde falta frequentemente o tipo O negativo o mais procurado, pois
pode ser recebido por qualquer paciente. A compatibilidade é fundamental para a
transfusão, pois esses antígenos podem reagir com anticorpos presentes no plasma e levar à
morte em alguns casos. A equipe de Qiyong Liu, da empresa ZymeQuest (EUA), obteve
enzimas capazes de remover da superfície dos glóbulos vermelhos as moléculas responsáveis
pela reação imune. As enzimas foram desenvolvidas em laboratório a partir de proteínas
produzidas por bactérias.

Disponível em:
<http://www.cienciahoje.uol.com.br/controlPanel/materia/view/68658>
Acesso em: 16. set. 2009. (Adaptado)

Sobre esse assunto, é CORRETO afirmar que:

01. a incompatibilidade entre grupos sanguíneos deve-se a uma reação imunológica


entre proteínas dissolvidas no plasma sanguíneo e moléculas presentes na membrana das
hemácias.
02. ao obter enzimas capazes de suprimir a reação imune, os cientistas podem alterar a
herança genética das pessoas quanto ao tipo sanguíneo.
04. a herança dos grupos sanguíneos do sistema ABO é determinada por um gene com alelos
múltiplos (polialelia).

http://www.meninasetequilas.blogspot.com
47

08. o sangue das pessoas que apresentam o tipo O recebe essa denominação pois não
apresenta o antígeno A ou B (aglutinogênio A ou aglutinogênio B) nem as aglutininas anti-
A ou anti-B.
16. existe um pequeno número de pessoas na população mundial que pode ser erroneamente
classificado como pertencente ao grupo sanguíneo O (falso O), embora não possuam
genótipo correspondente a esse grupo (fenótipo Bombaim).
32. para cada fenótipo sanguíneo existente no sistema ABO só existe um genótipo possível que
o determine.

Questão 35

A jovem mãe suspendeu o filho à teta; mas a boca infantil não emudeceu. O leite
escasso não apojava o peito.
O sangue da infeliz diluía-se todo nas lágrimas incessantes que não estancavam dos
olhos; pouco chegava aos seios, onde se forma o primeiro licor da vida.

ALENCAR, José de. Iracema. São Paulo: Ática, 1992. p. 77.

Após ler o excerto acima, analise e assinale a(s) proposição(ões) CORRETA(S).

01. O leite materno, tratado na obra Iracema como “licor da vida”, é considerado um
alimento completo para o recém-nascido, contendo água, sais minerais e até anticorpos
fundamentais para sua saúde.
02. As glândulas sudoríparas, que produzem o suor, são um exemplo de glândula endócrina.
04. Quando o autor diz que o sangue diluía-se todo nas lágrimas e não chegava aos seios, está
afirmando que o funcionamento da glândula mamária não tem relação com a circulação
sanguínea.
08. A oxitocina é o hormônio que, além de estimular os movimentos de contração uterina no
parto, estimula a contração da musculatura lisa das glândulas mamárias na expulsão do
leite materno.
16. A produção do leite materno não tem relação direta com o ato de sucção do seio materno
pelo recém-nascido.
32. As lágrimas e o leite produzidos pela mãe são exemplos de secreções produzidas pelas
glândulas exócrinas.

Questão 36
O uso doméstico dos recursos hídricos tem preocupado as autoridades ambientais de todo o
mundo, tanto no que diz respeito ao desperdício de água quanto à sua conservação.
Um estudo publicado recentemente na Revista Biotemas (www.biotemas.ufsc.br) dá conta de
que é possível criar peixes (tilápias) em lagoas de estabilização de efluentes domésticos
tratados. Segundo o artigo: “O sistema de criação de peixes melhorou a qualidade do efluente
gerado, reduzindo as concentrações de nitrogênio orgânico total e diminuindo os sólidos
suspensos. As análises de coliformes fecais, Salmonella sp. e Staphylococcus aureus dos
efluentes e da carne dos peixes produzidos ficaram dentro dos padrões exigidos pela OMS
(Organização Mundial de Saúde)”.

A respeito do assunto, assinale a(s) proposição(ões) CORRETA(S).

01. Quando uma quantidade excessiva de matéria orgânica é lançada nos rios e lagos pode
haver um fenômeno biológico conhecido como eutrofização.
02. O nitrogênio, sob qualquer forma que se apresente na natureza, não participa da
composição química dos seres vivos.
04. A análise quanto à variação e quantificação de coliformes fecais é um importante
indicador do grau de poluição da água por esgotos domésticos.

http://www.meninasetequilas.blogspot.com
48

08. Salmonelas e estafilococos presentes nas águas são bactérias muito comuns, responsáveis
pelo fenômeno biológico conhecido como “maré vermelha”.
16. Existem bactérias capazes de fixar o nitrogênio atmosférico e transferi-lo para o solo e
para algumas plantas, como o feijão e a soja.
32. A água tratada dos efluentes domésticos das lagoas de estabilização citadas no texto
acima, por ser tóxica não pode ser usada para nenhuma finalidade humana.
Questão 37

Seu José da Silva, um pequeno criador de porcos do Oeste do Estado de Santa Catarina,
desejando melhorar a qualidade de sua criação, comprou um porco de raça diferente daquela
que ele criava. Preocupado com as consequências de criar este animal junto com os outros
porcos, ele discute com seu um vizinho sobre o assunto.

Parte de seu diálogo é transcrito abaixo:

SR. JOSÉ – O porco que comprei e apelidei de Napoleão é maior, mais forte e possui peso
acima da média da raça que crio. Além disso, possui manchas marrons pelo corpo todo.
Gostaria que boa parte de minha criação tivesse estas características.
VIZINHO – Seu José, isto vai ser muito difícil de conseguir; melhor o senhor comprar outros
porcos com esse “jeitão”.

Com base nos conhecimentos de genética, assinale a(s) proposição(ões) CORRETA(S) sobre o
assunto.

01. As preocupações do Sr. José não se justificam, pois animais com fenótipos distintos
apresentam, obrigatoriamente, genótipos distintos para as mesmas características.
02. O vizinho do Sr. José tem razão, pois não se pode obter mistura de características
cruzando animais de raças diferentes na mesma espécie.
04. Atualmente não se pode criar e cruzar porcos de raças diferentes, pois é impossível
controlar a seleção das características geneticamente desejadas.
08. As manchas na pele do porco Napoleão são uma característica determinada
geneticamente; já o peso e o tamanho resultam somente da oferta de boa alimentação.
16. Quando duas raças distintas entram em contato e seus membros passam a cruzar-se
livremente, as diferenças raciais tendem a desaparecer nos descendentes devido à
mistura de genes.
32. O melhoramento genético em animais que apresentam características de valor comercial
é necessariamente prejudicial ao ser humano, já que não ocorre naturalmente.
64. Muitas características animais, como a fertilidade, a produção de carne e a resistência a
doenças, são condicionadas por genes e dependem muito das condições nas quais os
animais são criados.

Questão 38

A figura abaixo representa, ao centro, o esquema de uma estrutura vegetal chamada


estômato.

http://www.meninasetequilas.blogspot.com
49

A respeito da estrutura acima e de seu papel fisiológico, assinale a(s) proposição(ões)


CORRETA(S).

01. O funcionamento dos estômatos está associado aos mecanismos de transporte de seiva
no vegetal.
02. A seta II da figura indica a presença de cloroplastos nas células estomáticas.
04. Os estômatos são estruturas encontradas em várias partes do vegetal, especialmente no
caule.
08. A seta III indica as células-acessórias ou subsidiárias; através delas ocorre a eliminação da
água por transpiração para o exterior do vegetal.
16. Os estômatos são estruturas muito versáteis, participando inclusive dos mecanismos de
defesa vegetal, pois podem produzir e eliminar substâncias tóxicas.
32. A seta I indica a abertura estomática que ocorre entre as células-guarda e por onde se
realizam as trocas gasosas nos vegetais.
64. O funcionamento do estômato é controlado por fatores intracelulares, sendo
independente de fatores externos como a luminosidade e a umidade.

Questão 39

Sobre as formações fitogeográficas ou Biomas existentes no Brasil, assinale a(s)


proposição(ões) CORRETA(S).

01. O Cerrado é uma formação fitogeográfica caracterizada por uma floresta tropical que
cobre cerca de 40% do território brasileiro, ocorrendo na Região Norte.
02. O Mangue ocorre desde o Amapá até Santa Catarina e desenvolve-se em estuários, sendo
utilizados por vários animais marinhos para reprodução.
04. A Caatinga é caracterizada por ser uma floresta úmida da região litorânea do Brasil, hoje
muito devastada.
08. O Pampa ocorre na Região Centro-Oeste onde o clima é quente e seco. A flora e a fauna
dessa região são extremamente diversificadas.
16. A Floresta Amazônica está localizada nos estados do Maranhão e do Piauí e as árvores
típicas dessa formação são as palmeiras e os pinheiros.
32. O Pantanal ocorre nos estados do Mato Grosso do Sul e do Mato Grosso, caracterizando-se
como uma região plana que é alagada nos meses de cheias dos rios.
64. A Mata Atlântica é uma formação que se estende de São Paulo ao Sul do país, onde
predominam árvores como o babaçu e a carnaúba, e está muito bem preservada.

http://www.meninasetequilas.blogspot.com
50

Questão 40

Em 2009 comemora-se 200 anos do nascimento de Charles Darwin e 150 anos da publicação do
livro A Origem das Espécies, obra que coroou um extenso trabalho de Darwin e foi um marco
no estudo da Biologia.

Sobre evolução, assinale a(s) proposição(ões) CORRETA(S).

01. O francês Jean Baptiste Lamarck contribuiu de maneira significativa com o trabalho de
Darwin, pois ele já defendia a ideia de que a modificação das espécies era devido à
seleção natural.
02. Uma das bases da teoria de Darwin foi a Lei da Herança dos Caracteres Adquiridos, que,
embora com mais de 200 anos, se mantém atual até os dias de hoje.
04. Segundo a hipótese da seleção natural, grandes modificações nos indivíduos são
transmitidas de pai para filho.
08. No livro A Origem das Espécies, Darwin formulou a hipótese de que o ambiente
selecionava os mais aptos (seleção natural), que tinham mais chances de sobreviver e
deixar descendentes.
16. Os fósseis, a semelhança embriológica entre as espécies e a existência de estruturas
vestigiais desprovidas de função nos animais são evidências da evolução.
32. Segundo Darwin, o aparecimento de novas mutações é influenciado pelo meio ambiente.

Bons estudos! M&T

http://www.meninasetequilas.blogspot.com