You are on page 1of 267

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD

ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA


CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA

2010

_________________________
1
MSc. Ciencias Biológicas; MSc. Docencia Universitaria; Especialista en Nutrición Animal
Sostenible; Especialista en Informática y Multimedia.
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
2

ASPECTOS DE PROPIEDAD INTELECTUAL Y VERSIONAMIENTO

El presente módulo fue diseñado en el año 2005 por Carmen Eugenia Piña López, MSc.
Ciencias Biológicas; MSc. Docencia Universitaria; Especialista en Nutrición Animal
Sostenible; Especialista en Informática y Multimedia. Docente de la UNAD desde 1986

El presente módulo ha tenido tres actualizaciones durante los cuales se han realizado
mejoramientos académico-pedagógicos en los siguientes aspectos:

1. Mejoramiento en áreas temáticas:

Incorporación de contenidos de biotecnología, profundización en área de ecología y


ampliación de vínculos hipertextuales para actualización disciplinar según el estado del
arte y experiencias didácticas con objetos virtuales.

2. Mejoramiento didáctico:

Adecuación de unidades para manejo mediante el sistema de créditos con el tiempo


regulado para 3 créditos académicos.

Realización de curso hipermedia tanto para el contenido teórico como para el desarrollo
de laboratorios con estrategias de aprendizaje por fases de reconocimiento,
profundización y transferencia.

El material explicita la estrategia pedagógica mediante un protocolo académico y una


guía de actividades en concordancia con los parámetros institucionales y el Proyecto
Académico Pedagógico.

3. Mejoramiento académico-pedagógico:

2
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
3

La organización sistemática de actividades de aprendizaje, por fases de reconocimiento,


profundización y transferencia, está orientada a propiciar la investigación formativa y la
resolución de problemas del entorno del estudiante, aspecto que propicia la articulación
con proyectos interdisciplinarios, para generar campos de desarrollo académico en las
regiones, como estrategia para fortalecer la comunidad académica.

4. Avance cognitivo-pedagógico mediante el aprovechamiento de las TIC:

Los estudiantes encuentran en el manejo hipertextual del curso virtual de biología,


oportunidades para establecer una relación personalizada con el conocimiento, de
acuerdo con su propio tipo cognitivo, su ritmo de autoaprendizaje, el desarrollo de
competencias de autocontrol y autorregulación del estudio, el aprovechamiento de
objetos virtuales de aprendizaje que aportan una riqueza explicativa difícil de conseguir
en tutorías presenciales, opciones selectas de navegación por fuentes de consulta que
renuevan permanentemente el estado del arte en las temáticas del curso, y la orientación
para un futuro desempeño profesional sobre los vínculos posibles y más pertinentes con
la comunidad académica nacional e internacional en la disciplina.

3
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
4

CONTENIDO
Unidad Capítulos Lecciones Secciones
1. El comienzo de El comienzo de la vida, Experimento de Miller
la vida Las células primitivas.,
2. Experimento de Etapas evolutivas de la célula, Teoría
Miller endosimbiótica
Estructura y función de los seres vivos
1. Origen y 3. Evolución
Descripción de las características de los seres
característi- celular
vivos
cas 4. Estructura y ¿Qué son los seres vivos?
función
5. Descripción
características
Historia de la Célula
6. Historia Teoría celular

7. Estructura y Diferenciación entre células procariotas y


función en eucariotas
eucariotas y
procariotas
1. Seres Membrana Plásmatica, funciones, tipos de
vivos 8. Estructuras y transporte a través de la membrana:
organelos en transporte pasivo, transporte activo.
eucariotas Aplicaciones y análisis de casos en el proceso
de transporte a través de la membrana,

Citoplasma , núcleo, cromatina y


2. La célula 9. Estructuras y cromosomas, nucleolo, reticulo
organelos en endoplasmático, ribosomas, mitocondrias,
eucariotas aparato de Golgi ,
2acuolas, lisosomas, peroxisomas,
centrosomas y centríolos, plastos,
10. Estructuras y citoesqueleto, pared celular, diferencias entre
organelos en célula animal y vegetal, interactividad sobre la
eucariotas célula

11. Procesos Nutrición, Metabolismo, Respiración,


Celulares Fotosintesis, Relación
12.División Divisón celular, interfase, mitosis, profase,
celular-Mitosis metafase, anafase, telofase, citocinesis,

4
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
5

Meiosis, Interfase, profase l, metafase l,


13. Meiosis I
anafaseI, telofase y citocinesis I,
Meiosis ll, profase ll, metafase ll, telofase y
14. Meiosis II citocinesis II, división directa o amitosois,
Interactividad sobre meiosis
15. Tejidos Tejidos Animales: Epitelial, Conectivo,
animales Nervioso, Muscular

16. Tejidos Tejidos Vegetales:Protector, Parenquimático,


vegetales Conductor, Sostén

Sistemas Animales: Digestivo, partes,


estructura y función, interactividad sobre
17. Sistema sistema digestivo , animación sistema
Digestivo digestivo .

Circulatorio, Tejido sanguíneo, Estructura y


Función del Corazón , Circulación Sanguínea,
18. Sistemas
Animación sobre el ciclo cardiaco y la
Circulatorio y
circulación sanguínea , Mecanismo
Linfático
Hemostasis, Mapas conceptuales
3. Sistemas Coagulación sanguínea , Linfático
Orgánicos Sistema Respiratorio, Excretor, Reproductor
19.Sistemas masculino, reproductor femenino, fecundación
Respiratorio ,
excretor y
reproductor

Nervioso, Neurona, conducción dentro de la


20.Sistemas neurona, Receptores Sensoriales, Organo de
Nervioso, la Visión, oido , olfato, gusto , tacto, Muscular,
endocrino Oseo, Endocrino, Glándulas y funciones
hormonales

Organos de las plantas, Diferencias entre


21. Organos de
monocotilédoneas y dicotilédoneas, Organos
las plantas
vegetativos, Organos reproductivos

5
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
6

Los virus: Características, formas de acción


viral, clasificación de los virus, origen de los
22. Seres virus, enfermedades virales, importancia
acelulares los biológica de los virus,
virus viroides, priones, poder infectivo de los
Priones

Introducción, Características de las Arqueas ,


Eubacterias: Cianobacterias , Importancia
23. Seres vivos biológica de cianobacterias , Las bacterias: ,
4. Microor- características, estructura , reproducción,
ganismos procariotas las
bacterias, Intercambio genético en bacterias , Nutrición ,
arqueobacterias clasificación de las bacterias, utilidad de las
bacterias, enfermedades de origen bacteriano

Los Protozoos: Características clasificación:


24. Los protozoos sacordinos, ciliados, flagelados, esporozoos.

Algas: Principales características, Importancia


25. Las algas biológica
Hongos: Características, Reproducción
26. Los hongos Enfermedades causadas por hongos ,
Importancia biológica
27. Introducción Introducción

28. Taxonomía y Taxonomía, Sistemas de clasificación: de


sistemas de Robert Whittaker, de Lynn Margulis , de Carl
clasificación Woese

Categorías supraespecíficas y claves


29. Categorías
supraespecíficas
Concepto de especie
5. Sistemática y claves
Nomenclatura
30. Concepto de Construcción de árboles filogenéticos
especie Mapa conceptual Taxonomía
Mapa conceptual Cladismo
31. Nomenclatura

6
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
7

2. 32. Cromosomas , Introducción. Cromosomas, ADN, Replicación


Genética 1. genotipo, fenotipo del ADN , Transcripción o sintesis de ARN,
La 33. Leyes de la Sintesis de proteína , Genotipo, Fenotipo,
información herencia Genes; Alelos
genética 34.Síntesis
Leyes de Mendel, Aplicación de las leyes de
proteica
Mendel, ejemplos de cruces
35.Conocimientos
básicos Síntesis proteica
36.Los pasos de
la Ingeniería
2. Genética
Biotecnología
37. Transferencia
de genes
38.Desafíos
tecnológicos
Links
3. 1. Ecología, Mapa conceptual ,Organización del
Ecología Ecología conocimiento ecológico, Campos problémicos
que aborda el ecólogo, los ecosistemas como
39. Ecología y
unidad de estudio, Biocenosis, biotopo,
Ecosistemas
habitat y nicho ecológico.

Ejemplos de ecosistemas, Funcionamento del


ecosistema, Enfoque para el estudio del
ecosistema, relaciones alimentarias,
40. Ecosistemas
Pirámides biológicas, Biomasa y energía,
Pirámide de energía, Ciclos de la materia,
flujos de energía
41. Productividad
de los
Productividad de los ecosistemas como base
ecosistemas
para la intervención humana sostenible.
como base para la
Condiciones de las interacciones en los
intervenón
factores abióticos y bióticos,
humana
sostenible
Relaciones entre individuos, La colonia,
42. Relaciones Sociedades, Componentes de las relaciones
intra e ínter-específicas: simbiosis, mutualismo,
interespecificas Comensalismo, Parasitismo, Depredación,
Amensalismo , Atributos de las poblaciones ,

7
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
8

Tabla Niveles de Integración de los materiales


biológicos en los ecosistemas, Relaciones
entre individuos.
43.Pensamiento Aplicaciones para conservación de la
agroecológico biodiversidad
44. Pensamiento
Sistémico y
Desarrollo
Sustentable
45. Teorías
2. Evolución Teorías evolucionistas
evolucionistas

8
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
9

INTRODUCCIÓN

Este curso de Biología busca unir la calidad académica de los contenidos disciplinares
con posibilidades de interacción del estudiante con las fuentes hipertextuales e
hipermediales organizadas para un uso amigable y de óptimo refuerzo didáctico, que
motive una navegación entusiasta en el proceso de construcción autónoma de los
conceptos disciplinares y un proceso de interacción con las herramientas de
comunicación del curso, tales como foro, chat, correo electrónico y otros.

El curso está orientado a la autogestión estudiantil de los conocimientos teóricos


necesarios para la comprensión de la estructura y funcionamiento de los organismos
vivos en su biodiversidad como resultado evolutivo. Este conocimiento se aborda como
un insumo de transferible a futuras situaciones de desempeño profesional y de
comportamiento bioético, como un bagaje de trabajo inter y transdisciplinar (orientado
con procesos de investigación formativa) totalmente necesario para seres que deben
actuar con inteligencia en su medio ambiente, o sea en su base material y cultural de
supervivencia como especie.

En otros aspectos, se puede decir que la apropiación teórica del conocimiento en


biología, se guiará por el cuerpo disciplinar que maneja la comunidad académica
internacional (ver estado del arte), identificando, seleccionando y organizando de manera
pedagógica unos contenidos básicos fundamentales, totalmente necesarios para
aprehender los conocimientos estructurales de la disciplina, de los cuales se deriva el
resto de conocimientos del área biológica y sus aplicaciones.

El componente práctico se desarrollará mediante laboratorios previamente apoyados en


vídeos didácticos introductorios y se complementará con observaciones de campo.

Para efectos de precisión de conceptos el estudioso puede apoyarse en el glosario,


espacio que además de definiciones importantes, agrupa respuestas a preguntas
enviadas por los estudiosos en busca de una mayor aclaración. El objetivo es trabajar en
red colaborativa de tutores y estudiosos para enriquecer este banco de definiciones y de
respuestas a preguntas frecuentes.

¡Bienvenidos!

Carmen Eugenia Piña López (Autora)

9
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
10

UNIDAD 1 SERES VIVOS


Capítulo 1 Origen y características

Lección 1 El comienzo de la vida

Gráfica 1 Origen de la vida.


Fuente: diseñado por Carmen Eugenia Piña L.

Según los cálculos más modernos, la Tierra se formó hace unos 4.500 millones de años
y un millón de años después aparecería la vida. En 1924, el bioquímico Alexander
Oparin formuló su hipótesis sobre el origen de la vida a partir moléculas inorgánicas que
se encontraban en una atmósfera gaseosa, carente de oxígeno y sin capa de ozono que
filtrara los rayos ultravioletas.

La energía de descargas eléctricas producidas durante grandes tormentas o la radiación


ultravioleta facilitó la unión de las moléculas inorgánicas de la atmósfera primitiva como:
dióxido de carbono CO2, metano CH4, hidrógeno H2, nitrógeno N2, ácido clorhídrico HCl,
sulfuro de hidrógeno, H2S, amoníaco NH3 y vapor de agua para formar aminoácidos,
azúcares, ácidos grasos y nucleótidos . Estas moléculas orgánicas simples a su vez
sintetizaron proteínas y ácidos nucleicos. Las lluvias llevaron las moléculas orgánicas a
los mares y lagos, donde se concentraron y formaron lo que se denominó una sopa
primitiva.

Dentro de esta sopa primitiva pequeñas gotas de material lipídico fueron rodeadas por
agrupaciones de moléculas orgánicas. Eventualmente las gotas de lípidos pudieron
incorporar a su estructura nuevos materiales de las moléculas orgánicas que las
rodeaban, con un proceso simultáneo de liberación de la energía almacenada en las
moléculas orgánicas. La repetición de este proceso permitió un crecimiento de las
agrupaciones moleculares que al separarse de la solución acuosa formaron coacervados
que alcanzaban cierta estabilidad para generar procesos metabólicos simples, crecer y
reproducirse formando coacervados hijos que a veces conservaban las propiedades
químicas de su progenitor, lo cual prefiguró un rudimento de herencia, que permite
hablar de un modelo para el inicio de la vida.

10
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
11

Oparin estudió la acción de selección natural sobre gotas de coacervados que


consiguieron captar del medio los catalizadores adecuados para llevar a cabo procesos
metabólicos que aseguraran estabilidad, crecimiento, reproducción y predominio sobre
las demás. Estos procesos serían la base para la formación de células ancestrales y
posteriormente de organismos más complejos. La comunidad científica de entonces
ignoró sus ideas.

Lección 2 Experimento de Miller

En 1950 un estudiante de la Universidad de Chicago, Stanley Miller, probó la hipótesis


de Oparin.

Stanley Miller demostró en el laboratorio, utilizando un aparato diseñado por él, los
mecanismos por los cuales los rayos producidos por descargas eléctricas pudieron
afectar la atmósfera terrestre primitiva y a partir de la combinación de elementos
inorgánicos la posibilidad de formar los precursores de sustancias orgánicas.
Para ello en un recipiente de cristal diseñado para simular las condiciones de los
océanos y mares primitivos sometió a descargas eléctricas una mezcla de gases con
composición parecida a la de la atmósfera terrestre primitiva (CH4, NH3, H2, N2 y vapor
de agua). Luego la mezcla fue enfriada y condensada. El resultado fue la formación de
una serie de moléculas orgánicas como aminoácidos y otros componentes orgánicos. La
siguiente etapa de formación de vida fue la síntesis abiótica de polímeros orgánicos con
la formación de proteínas, lípidos, carbohidratos y ácidos nucleicos

En la actualidad, es de alta resonancia internacional una teoría aparentemente


"contendiente" desarrollada por un grupo de científicos del departamento de biología de
la Universidad Estatal de California, Fresno, quienes están realizando investigaciones
con el meteorito Murchison (que se cree formó parte de un cometa) el cual contiene
algunos aminoácidos similares a los obtenidos por Miller. Se plantean entonces dos
posibles orígenes de las primeras moléculas orgánicas que dieron inicio a la evolución
de la vida en la tierra: un origen endógeno terrestre, al estilo del experimento de Miller, y
un origen extraterrestre, aportado por los meteoritos tipo Murchison. Otra opción sería
que estos dos mecanismos coexistieron y se complementaron. En todo caso, cualquiera
de las dos teorías permite concluir positivamente sobre la capacidad de la materia del
cosmos primigenio para generar reacciones conducentes a la formación de moléculas
orgánicas, las cuales encontraron en la tierra condiciones aptas para dar origen a la vida.

Ver video en esta dirección:

http://www.youtube.com/watch?v=w9kiP7knmdg&feature=player_embedded

11
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
12

Gráfica 2. Experimento de Miller.


Fuente: diseñado por Carmen Eugenia Piña L.

1. Agua 2. Calor 3. Vapor de agua 4. Entrada de gases. 5. Matraz con mezcla de gases
simulando atmósfera 6. Descargas eléctricas (electrodos de tungsteno) 7. Condensador
de agua (enfriamiento) 8. Erlemeyer con moléculas orgánicas.

Animación

Lección 3 Evolución celular

Las células primitivas

El proceso de evolución celular es un resultado paralelo de la evolución en las


condiciones de la atmósfera primitiva hacia la atmósfera actual.

Con base en el enfoque evolutivo del biólogo molecular Carl Woese, las células
primitivas para ser consideradas unidades vivientes, de alguna manera debían contar
con un mecanismo que permitiera realizar procesos de transcripción genética. A esta
célula primitiva precursora de los diversos tipos de células vivientes, la denominó
protobionte, y por ser el antepasado común de todos los organismos genéticamente
codificados, también la denominó progenota.

12
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
13

En el siguiente mapa conceptual se resume todo el proceso.

13
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
14

Con base en el proceso esquematizado en el mapa conceptual se pueden ilustrar las


etapas evolutivas de la célula procariota primitiva en el siguiente diagrama:

Fuente: diseñadas por Carmen Eugenia Piña L.

La teoría endosimbiótica

La teoría endosimbiótica propuesta por la científica Lynn Margulis explica el origen de las
células eucariotas a partir de la evolución de células procariotas primitivas así:

Alguna célula procariota primitiva perdió su pared celular rígida quedando rodeada por la
membrana plasmática que al presentar una estructura más flexible fue replegándose
aumentando de esta manera su superficie membranosa con el consecuente aumento del
tamaño de la célula.

Gráfica 3 Proceso evolutivo planteado por la teoría endosimbiótica


Fuente: diseñadas por Carmen Eugenia Piña L

14
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
15

A esta célula procariota de mayor tamaño y carente de pared celular se le llamó


urcariota.

De acuerdo con esta teoría, la célula urcariota por el mecanismo de fagocitosis ingirió
pero no digirió otras células procariotas de menor tamaño tipo bacteria con las cuales
estableció una relación de mutua colaboración llamada endosimbiosis -vivir juntas
dentro-

Una de estas asociaciones fue la que se estableció entre la célula urcariota y algunas
bacterias aerobias en donde la célula urcariota anaerobia heterótrofa suministraba a la
bacteria aerobia algunos componentes orgánicos para su nutrición y la bacteria aerobia a
su vez permitió a la urcariota utilizar el oxígeno y realizar la respiración aerobia o
metabolismo oxidativo. La estabilización evolutiva de la ventajosa y competitiva
interacción urcariota-bacteria aerobia, generó a partir de la bacteria aerobia la estructura
actual (organelo) presente como mitocondria en las células animales y vegetales.

15
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
16

Otra combinación ventajosa la constituyó la incorporación de bacterias fotosintéticas -


cianobacterias- a la célula urcariota.

Igualmente la estabilización evolutiva de la ventajosa y competitiva fusión urcariota-


bacteria fotosintética, generó a partir de la bacteria fotosintética la estructura actual
(organelo) presente como cloroplasto presente en las células vegetales.

El origen de los organelos denominados peroxisomas presentes en las células


eucariotas se cree partió de bacterias huéspedes en la célula urcariota capaces de
eliminar residuos tóxicos como el agua oxigenada. El núcleo rodeado de membrana
nuclear presente en las actuales células animales y vegetales se generó de alguna
célula del tipo arqueobacteria o Archaeabacteria, al incorporarse en la célula
hospedadora. De igual manera se piensa que la fusión de urcariotas con bacterias como
las espiroquetas dio origen a los cilios y flagelos de las células eucariotas. Por otra parte
como consecuencia de las invaginaciones de la membrana plasmática se formaron
compartimentos de doble membrana que fueron rodeando cada tipo de bacteria origen
de los organelos.

16
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
17

Animación

Lección 4 Estructura y función de los seres vivos

En todos los procesos que involucren seres vivos, recursos de biodiversidad o


simulaciones como en el caso de transferencia por redes neuronales y procesos
inteligentes en general, se requiere conocer la estructura y función a nivel macro y micro
de los seres vivos, como una forma fundamental para la comprensión de la realidad y
para la gestión sostenible del entorno.

La estructura se analiza por niveles de organización que normalmente se discriminan en


genético a nivel de gen; celular células, tisular: los tejidos resultantes del conjunto de
células especializadas; el organístico donde los tejidos conforman un órgano que
desempeña una o varias funciones y sistémico como el sistema digestivo donde un
conjunto de órganos cumplen un mismo propósito o función por ejemplo la digestión.

Un nivel superior es el de los organismos, pero la biología además de estudiarlos


individualmente los analiza también como componentes de ecosistemas y como
resultado de la evolución de las especies.

Por el lado de la función, el estudio de la biología analiza las condiciones en que se


mantienen procesos de equilibrio biológico interno y en relación con el ambiente o sea la
homeostasia y analiza sobre el particular, la dinámica de poblaciones o sea la sinergia
de los organismos para buscar su preponderancia y sostenibilidad dentro de nichos
específicos de los ecosistemas en el proceso de evolución de las especies.

Lección 5 Descripción de las características de los seres vivos

Ver videos:

El umbral de la vida parte 1:


http://www.youtube.com/watch?v=ReUjkwAESg0&feature=related

El umbral de la vida parte 2


http://www.youtube.com/watch?v=2YeJoyFQnW8&feature=related

Los seres vivos a diferencia de los objetos inertes presentan las siguientes
características:

17
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
18

Reproducción

Tomado de Microsoft Encarta

Uno de los principios fundamentales de la biología es que "toda vida proviene


exclusivamente de los seres vivos". Cada organismo sólo puede provenir de organismos
preexistentes. La autoperpetuación es una característica fundamental de los seres vivos.

Movimiento

Todos los seres vivos son capaces de moverse. Este movimiento no debe confundirse
con el desplazamiento: un objeto se desplaza cuando cambia su posición dentro de un
marco referencial, en cambio un ser vivo se puede mover sin cambiar de ubicación.

El movimiento de locomoción de los animales es muy obvio: se agitan, reptan, nadan,


corren o vuelan.

Las plantas tienen movimientos más lentos, por ejemplo: los tropismos, las nastias y los
seguimientos solares. Los tropismos son respuestas de crecimiento de las plantas a
estímulos como la luz en este caso hablamos de fototropismo que puede ser negativo si
se aleja del estímulo como en el caso de las raíces, o positivo como ocurre con las hojas
o tallos que se orientan hacia la luz. Otro tipo de tropismo es el geotropismo que es una
respuesta a la gravedad, puede ser positivo como el que presentan las raíces que son
atraídas hacia el centro de la tierra o negativo como en el caso de los tallos que crecen
erguidos en contra de la gravedad. Las nastias ocurren independientemente del estímulo
por ejemplo: cuando las flores se cierran en la noche. Los seguimientos solares cuando
las plantas orientan sus hojas o flores en dirección a la luz solar, como ocurre con la flor
del girasol o del algodón. Otra clase de movimiento es el flujo del material vivo en el
interior de las células de las hojas de las plantas conocido como ciclosis.

Animación de Tropismo Negativo

18
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
19

Adaptación

Esta característica se refiere a la capacidad de todos los seres vivos para adaptarse a su
ambiente y así poder sobrevivir en un mundo en constante cambio. Las modificaciones
que el organismo realiza frente a estímulos del medio interno y externo para adaptarse
pueden ser estructurales, conductuales o fisiológicas o una combinación de ellas. Es
decir, la adaptación es una consecuencia de la irritabilidad.

La adaptación trae consigo cambios en la especie, más que en el individuo. Si todo


organismo de una especie fuera exactamente idéntico a los demás, cualquier cambio en
el ambiente sería desastroso para todos ellos, de modo que la especie se extinguiría.

La mayor parte de las adaptaciones se producen durante periodos muy prolongados de


tiempo, y en ellas intervienen varias generaciones. Las adaptaciones son resultado de
los procesos evolutivos.

Tomado de Microsoft Encarta

El cactus tiene pliegues en forma de acordeón con los que pueden dilatarse para
almacenar la mayor cantidad de agua posible y sus espinas no solamente lo protegen
del sol y de los animales sedientos.

Los pingüinos tienen unas adaptaciones únicas externas que les ayudan a conservar
este calor

Irritabilidad

Los seres vivos reaccionan a los estímulos, que son cambios físicos o químicos en su
ambiente interno o externo. Los estímulos que evocan una reacción en la mayoría de los
organismos son: cambios de color, intensidad o dirección de la luz; cambios en
temperatura, presión o sonido, y cambios en la composición química del suelo, aire o
agua circundantes.

En los animales complejos, como el ser humano, ciertas células del cuerpo están
altamente especializadas para reaccionar a ciertos tipos de estímulos; por ejemplo las
células de la retina del ojo reaccionan a la luz. En los organismos más simples esas

19
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
20

células pueden estar ausentes, pero el organismo entero reacciona al estímulo. Ciertos
organismos celulares reaccionan a la luz intensa huyendo de ella.

La irritabilidad de las plantas no es tan obvia como la de los animales, pero también los
vegetales reaccionan a la luz, a la gravedad, al agua y a otros estímulos, principalmente
por crecimiento de su cuerpo. El movimiento de flujo del citoplasma de las células
vegetales se acelera o detiene a causa de las variaciones en la intensidad de la luz.

Complejidad estructural

Los seres vivos poseen una complejidad estructural única para poder desarrollar todas
sus actividades. Esta complejidad es mantenida gracias al flujo constante de materia y
energía que pasa por los organismos.

Metabolismo

Es el conjunto de reacciones químicas que ocurren al interior de las células y que le


proporcionan a los seres vivos la materia y energía indispensable para desarrollar sus
actividades vitales. En todos los seres vivos ocurren reacciones químicas esenciales
para la nutrición, el crecimiento y la reparación de las células, así como para la
conversión de la energía en formas utilizables. Para mantener el metabolismo, los
organismos recurren a otras características secundarias como la nutrición, excreción y
respiración.

Las reacciones metabólicas ocurren de manera continua en todo ser vivo; en el momento
en que se suspenden se considera que el organismo ha muerto.

Homeostasis

Es la capacidad de todos los seres vivos de mantener constante las condiciones físicas y
químicas de su medio interno. La tendencia de los organismos a mantener un medio
interno constante se denomina homeostasis, y los mecanismos que realizan esa tarea se
llaman mecanismos homeostáticos.

La regulación de la temperatura corporal en el ser humano es un ejemplo de la operación


de tales mecanismos. Cuando la temperatura del cuerpo se eleva por arriba de su nivel
normal de 37°C., la temperatura de la sangre es det ectada por células especializadas del
cerebro que funcionan como un termostato. Dichas células envían impulsos nerviosos
hacia las glándulas sudoríparas e incrementan la secreción de sudor. La evaporación del
sudor que humedece la superficie del cuerpo reduce la temperatura corporal. Otros
impulsos nerviosos provocan la dilatación de los capilares sanguíneos de la piel,
haciendo que esta se sonroje. El aumento de flujo sanguíneo en la piel lleva más calor
hacia la superficie corporal para que desde ahí se disipe en radiación.

20
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
21

Otro ejemplo lo constituyen las plantas, cuando les falta agua cierran los estomas de sus
hojas evitando la pérdida de agua por evaporación.

Crecimiento

Todos los seres vivos crecen a lo largo de su vida. En el crecimiento interviene la


síntesis de nuevas sustancias a partir de alimento tomado del medio. El crecimiento se
produce por la expansión celular y por división celular.

El crecimiento implica un aumento del tamaño. Los individuos pluricelulares crecen por
aumento en la cantidad de células que los componen (si bien en los organismos
unicelulares se registra un crecimiento por aumento del tamaño de su célula, esto es
hasta un límite definido, en el cual la célula detiene su crecimiento y se divide para
formar dos organismos).

El desarrollo está relacionado con las transformaciones que sufre un individuo a lo largo
de su vida. Así, las células de un individuo pluricelular adquieren diferentes formas de
acuerdo a su función.

¿Qué son los seres vivos?

¿Qué son los seres vivos?

El pensamiento de Maturana tiene su punto central en el concepto de "autopoiesis":


(...) los seres vivos son verdaderos remolinos de producción de componentes, por los
que las sustancias que se toman del medio, o se vierten en él, pasan participando
transitoriamente en el interrumpido recambio de componentes que determina su continuo
revolver productivo. Es esta condición de continua producción de sí mismos, a través de
la continua producción de recambio de sus componentes, lo que caracteriza a los seres
vivos, y lo que se pierde en el fenómeno de la muerte. Es a esta condición a la que me
refiero al decir que los seres vivos son sistemas autopoiéticos, y que están vivos sólo
mientras están en autopoiesis. (Biología del fenómeno social, p. 5)

Los seres vivos tienen dos "dominios operacionales": el que llamaríamos interior, el de
su "dinámica estructural", su fisiología, y el del "entorno", que se manifiesta en unas
"conductas" determinadas. Desde esta perspectiva, "la historia individual u ontogenia de
todo ser vivo transcurre, o se da, constitutivamente como una historia de cambios
estructurales que siguen un curso que se establece momento a momento determinado
por la secuencia de sus interacciones en el medio que lo contiene" (Origen de las
especies por medio de la deriva natural, p. 110). Los sistemas vivos, todos los
organismos, de los más simples a los más complejos, "son sistemas estructuralmente
determinados, y nada externo a ellos puede especificar o determinar qué cambios
estructurales experimentan en una interacción; un agente externo, por lo tanto, puede
sólo provocar en un sistema vivo cambios estructurales determinados en su estructura"

21
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
22

(Biología de la experiencia estética, p. 43). Esto significa básicamente que son los
organismos los que modifican su propia estructura.

Los elementos exteriores no pueden producir modificaciones de las estructuras; las


estructuras se van modificando, pero por medio de cambios desde el interior. No es el
entorno el elemento que modifica la estructura, ya que los cambios son cambios que
provienen del interior

BIOLOGÍA DEL FENÓMENO SOCIAL [i] Humberto Maturna R.


Entrevista ecovisiones nº 6

Capítulo 2 La Célula

Lección 6 Historia

Gracias a la invención del microscopio se hizo posible investigar cómo son las células y
los descubrimientos sobre la estructura celular que tuvieron lugar a lo largo del siglo XVII
marcan una verdadera revolución científica y dan origen a la Biología moderna.

El inglés Robert Hooke (1637-1703) fue el primero que utilizó el término "célula" en 1665
para referirse a los compartimentos vacíos semejantes a celdas que observó a través del
microscopio en una lámina de corcho. Hooke observó células secas, después de muchos
años los investigadores determinaron que las células no estaban vacías sino llenas de
sustancia acuosa.

En 1673, Anton Van Leeuwenhoeck realizó observaciones de células vivas como


eritrocitos y espermatozoides, igualmente al examinar agua de los charcos vio por
primera vez organismos microscópicos.

Después del perfeccionamiento del microscopio en 1838 el botánico alemán Mathias


Schleiden al observar al microscopio tejidos vegetales concluyó que estaban formados
por células y que el embrión de una planta tuvo su origen a partir de una sola célula.

Un año más tarde el zoólogo alemán Theodor Schwann en sus estudios microscópicos
de tejidos animales y vegetales determina que los tejidos animales están constituidos por
células, y que las células de plantas y animales presentan estructuras semejantes.

Estos alemanes planteraon los dos primeros postulados de la teoría celular, afirmando
que todos los organismos vivos están constituidos por células y que la célula es la
unidad estructural.

En 1859 el biólogo alemán Rudolf Virchow propuso que todas las células vienen de
células preexistentes: omnis cellula e cellula.

22
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
23

La teoría celular

La teoría celular moderna se resume en tres postulados:

• La célula es la unidad básica estructural de todos los seres vivos, todos los
organismos están formados por células.

• La célula es la unidad funcional de todos los organismos. Todo el funcionamiento


del organismo depende de las funciones que ocurren al interior de la célula,
respiración, reproducción, digestión, crecimiento entre otras.

• Todas las células se originan por la división de células preexistentes (en otras
palabras, a través de la reproducción). Cada célula contiene material genético que
se transmite durante este proceso.

Lección 7 Estructura y función en procariotas y eucariotas

La célula es la unidad fundamental de la vida. Es la estructura más pequeña del cuerpo,


capaz de realizar todos los procesos que definen la vida. Las células poseen una
estructura altamente organizada, tienen capacidad de autorregulación, de responder
ante diferentes estímulos, de respiración, de movimiento, de digestión, de reproducción,
de comunicación, aunque no todas las células pueden realizar todas estas funciones.

En los organismos unicelulares como los protozoos y las bacterias la célula es


autónoma, realiza todas las funciones, mientras que organismos como las plantas y los
animales están formados por muchos millares de células organizadas en tejidos y
órganos con funciones específicas.

La mayoría de las células son invisibles para el ojo humano. Hasta el óvulo femenino,
que es la célula más grande del cuerpo, no es más grande que el punto situado al final
de esta frase. El tamaño y la forma varían con las funciones celulares. Todas las células
constan de tres partes principales: la membrana citoplasmática, el citoplasma y una
región nuclear que alberga el material genético.

Diferenciación entre células procariotas y eucariotas

Existen dos tipos básicos de células según la evolución del mundo biológico y el grado
de complejidad en su organización: procariotas y eucariotas

23
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
24

Las células procariotas

Gráfica 4 Esquema de una célula procariota


Fuente: diseñado por Carmen Eugenia Piña L.

Características

• Carecen de membrana que rodee el material genético el cual se halla más o


menos disperso en el citoplasma.
• Tienen tamaños comprendidos entre 1 y 10 micrómetros (1 micrómetro equivale a
1/1000mm).
• Son células características de seres como las bacterias.
• Se dividen por bipartición.
• Su citoplasma no posee estructuras membranosas.
• Los ribosomas son de menor tamaño.
• No poseen citoesqueleto.
• Poseen un solo cromosoma.

Las células eucarióticas

24
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
25

Características

• Presentan una membrana nuclear que delimita el espacio donde se encuentra el


material genético.
• Tienen tamaños muy variables que van desde los 10 hasta los 100 micrómetros.
• Son células características de los animales, los vegetales, los protistos y los
hongos.
• Las eucariotas se dividen por división mitótica, por eso tienen centríolos.
• Poseen estructuras membranosas como el retículo endoplasmático, y el aparato
de Golgi que están ausentes en las procariotas.
• Otros orgánelos de importancia capital para las eucariotas son las mitocondrias y
los cloroplastos, que faltan en los procariotas.
• Los ribosomas son de mayor tamaño.
• Presentan citoesqueleto.

25
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
26

Lección 8 Estructuras y organelos de la célula eucariótica

Gráfica 5 célula eucariótica vegetal


Fuente: diseñado por Carmen Eugenia Piña L.

La Membrana Plasmática o Celular En la superficie de la célula hay una capa


citoplasmática muy delgada que forma una envoltura continua: la membrana plasmática
que separa la célula de su medio externo. Por una de sus caras, esta membrana se
encuentra en contacto con el medio extracelular, por la otra, con el citosol.

La membrana citoplasmática está compuesta de lípidos, proteínas e hidratos de carbono


en proporciones aproximadas de 40%, 50% y 10%, respectivamente.

Según el modelo de membrana "Modelo de mosaico fluido" propuesto en 1972 por J.


Singer y G. Nicolson, la membrana está formada por una doble capa lipídica a la que se
adosan moléculas proteicas. Si se adosan en ambas caras de la superficie reciben el
nombre de proteínas extrínsecas y si, por el contrario, atraviesan la capa de lípidos,
reciben el nombre de proteínas intrínsecas o integrales. Los lípidos que forman la
membrana son principalmente fosfolípidos, también encontramos cefalinas, lecitinas y
colesterol. Los fosfolípidos en contacto con el agua forman una capa doble de moléculas
de manera que el extremo hidrofílico o polar (amigo del agua) se dispone hacia el
exterior de la célula, es decir, hacia el citoplasma o hacia el líquido extracelular y el
extremo hidrofóbico no polar o lipófilo (amigo de los lípidos, repelente al agua) se
dispone dentro de la bicapa.

El otro componente de la membrana plasmática son los hidratos de carbono:


glicoproteínas y glicolípidos según se unan a proteínas o lípidos. Los glicolípidos tienen
función estructural. Las glicoproteínas forman el glicocáliz que es una capa densa de
carbohidratos que cubre la cara externa de la membrana plasmática y participan en los
procesos de endocitosis, en las reacciones antígeno-anticuerpo y en la transducción de
señales.

26
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
27

http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookCELL2.html#The%20Cell%20Membrane

La estructura de la membrana no es estática y tanto los lípidos como las proteínas tienen
gran libertad de movimientos (se comporta como un fluido). La movilidad de los lípidos
en el plano de la bicapa que forman, es tanto mayor cuánto más alta es la temperatura
ambiente y las cadenas de ácidos grasos estén menos saturadas y sean más cortas.

La estabilidad y estructura básica de la membrana se mantiene gracias al colesterol que


se une a los fosfolípidos mediante enlaces débiles, manteniendo la estructura de la
bicapa

Los compuestos proteínicos de la membrana desarrollan las siguientes funciones:

• El transporte selectivo de sustancias (iones, moléculas polares) de un lado a otro


de la membrana.
• EL control de las reacciones bioquímicas que ocurren en la célula (por enzimas
que aceleran o retardan las reacciones químicas)
• Actuar como marcadores que identifican a las células para su reconocimiento por
otras sustancias u hormonas.

Funciones de la membrana celular

La membrana mantiene la integridad estructural de la célula, pero además controla la


actividad celular, sus funciones básicas son:

• Proteger las células y mantener las condiciones necesarias para el desarrollo de


las funciones vitales.
• Regular los intercambios de sustancias entre el medio exterior e interior.
• Comunicar a la célula con otras células
• Mantener la identidad celular
• Recibir y transmitir información

27
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
28

Tipos de transporte a través de la membrana

El transporte a través de la membrana ocurre por dos mecanismos transporte activo y


transporte pasivo.

Transporte pasivo Es un proceso de difusión de sustancias a través de la membrana.


No requiere gasto de energía celular, se realiza a favor del gradiente (es decir, de donde
hay más hacia donde hay menos) de concentración, de presión o de carga eléctrica.

Hay varios mecanismos de transporte pasivo:

Difusión simple: si dos sustancias de diferente concentración se encuentran separadas


por una membrana semipermeable, las moléculas de la sustancia (soluto) con mayor
concentración atraviesan la membrana hacia la solución menos concentrada para igualar
las concentraciones de soluto.

Ejemplo: El agua, el dióxido de carbono, el oxígeno, moléculas solubles en lípidos como


las vitaminas A, E, algunas hormonas esteroideas, atraviesan la membrana de esta
forma.

Difusión facilitada: es la difusión de moléculas y los iones solubles en agua a través de


la membrana, con la participación de las proteínas de la membrana. Las proteínas
pueden formar poros o canales con diámetros específicos y cargas eléctricas que
permiten el paso selectivo de iones. Los iones de Na+, K+, Ca2+, Cl- atraviesan la
membrana de esta manera. Hay canales que permanecen abiertos y otros que solo se
abren cuando llega una molécula portadora que se une a las moléculas e induce a una
variación de la configuración que abre el canal, o bien cuando ocurren cambios en la
polaridad de la membrana.

Es así como la difusión puede ser facilitada por proteínas portadoras que se unen a las
moléculas facilitando la apertura del canal y su paso a través de la membrana. Los
neurotrasmisores atraviesan la membrana de esta forma.

Ósmosis: cuando 2 disoluciones se encuentran separadas por una membrana


semipermeable el solvente (agua) pasa a través de la membrana desde la región de
mayor concentración de solvente hacia la de menor concentración hasta igualar las
concentraciones.

La concentración de agua dentro y fuera de las células animales es igual (isotónica), por
lo tanto no existe tendencia del agua a entrar o salir de éstas.

La ósmosis es clave para la supervivencia de los seres vivos. La absorción de agua y


minerales a través de las raíces de las plantas ocurre a través del mecanismo de
ósmosis, igualmente la reabsorción de agua y minerales en el riñón.

28
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
29

Transporte activo En el proceso de transporte activo también actúan proteínas de


membrana, pero éstas requieren energía celular en forma de ATP, para transportar las
moléculas al otro lado de la membrana. Se produce cuando el transporte se realiza en
contra del gradiente electroquímico.

Mecanismo de transporte activo para moléculas de bajo peso molecular

Para el transporte de moléculas de bajo peso molecular y en contra del gradiente se


requiere la ayuda de las proteínas de transporte denominadas bombas, por su similitud
con las bombas de agua. Las proteínas de transporte utilizan energía para mover las
moléculas en contra del gradiente de concentración.

Son ejemplos de transporte activo la bomba de Na+/K+, y la bomba de Ca.++ . La


bomba de Na+/K+ requiere una proteína de transporte que bombea Na+ hacia el exterior
de la membrana y K+ hacia el interior.

La absorción de minerales en las plantas es un ejemplo de transporte activo

Mecanismos de transporte activo para moléculas de elevado peso molecular

Existen dos mecanismos principales para el transporte de estas moléculas en contra del
gradiente: endocitosis y exocitosis

La endocitosis es un proceso de incorporación de sustancias del medio externo a la


célula mediante una invaginación en la superficie exterior de la membrana que engloba
las partículas o líquidos a ingerir. Una vez las partículas o sustancias dentro de la
invaginación se produce la estrangulación de la invaginación originándose una vesícula
que encierra el material ingerido el cual es transportado al interior del citoplasma.

Según la naturaleza de las partículas englobadas, se distinguen diversos tipos de


endocitosis: pinocitosis y fagocitosis.

Pinocitosis. Implica la ingestión de líquidos y partículas en disolución a través de una


invaginación de la membrana plasmática que forma pequeñas vesículas o vacuolas que
luego se introducen al citoplasma con los líquidos ingeridos. La pinocitosis incorpora
grandes moléculas como glúcidos, ácidos grasos y aminoácidos, por ejemplo, del quilo
alimenticio en las microvellosidades intestinales

La fagocitosis implica la incorporación de partículas grandes, o de microorgansimos a


través de extensiones de la membrana plasmática, denominadas pseudópodos los
cuales engloban las partículas, luego los extremos de los pseudópodos se fusionan
dando origen a una vesícula o vacuola alimenticia con las partículas dentro. Las
partículas incluidas en la vacuola son digeridas por enzimas digestivas llamadas
lisosomas. La fagocitosis la realizan las amebas en su proceso digestivo, los leucocitos

29
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
30

para destruir bacterias y las células de microglía del sistema nervioso que destruyen y
eliminan las neuronas muertas por heridas o por envejecimiento.

Exocitosis La exocitosis es el proceso contrario a la endocitosis. Tiene como objetivo la


excreción de sustancias, ocurre cuando una macromolécula o una partícula debe pasar
del interior al exterior de la célula. Las macromoléculas contenidas en vesículas
citoplasmáticas creadas por el aparato de Golgi, se desplazan hasta la membrana
plasmática, la membrana plasmática y la vesícula se fusionan y la vesícula vierte su
contenido al medio extracelular.

Productos de desecho de la digestión celular, secreción de hormonas son vertidas hacia


el líquido extracelular por este mecanismo. En toda célula existe un equilibrio entre la
exocitosis y la endocitosis para que quede asegurado el mantenimiento del volumen
celular.

Aplicaciones y análisis de casos en el proceso de transporte a través de la


membrana

Tanto las células animales como vegetales deben vivir en un medio isotónico, (es decir,
la concentración del medio en que se encuentra la célula es igual a la concentración del
medio interno de la célula) porque de lo contrario se ven afectados por la ley de la
ósmosis.

Cuando la célula se encuentra en un medio externo con una concentración salina, o


proteínica, menor que en su citoplasma o medio interno, diríamos que el medio externo
es hipotónico con respecto a ella. La célula reaccionaría buscando el equilibrio, con lo
cual, tomará moléculas de agua del medio externo y se hinchará mediante un proceso
llamado turgencia, es decir, se hincha hasta que finalmente se puede producir la lisis o
rompimiento.

Cuando una célula se encuentra en un medio externo que posee una mayor
concentración que su medio interno, se dice que es hipertónico con respecto a la célula.
En este caso, la célula intentará adaptarse al medio expulsando moléculas de agua de
su citoplasma al medio externo. Este fenómeno originaría una deshidratación en la célula
llamado plasmólisis. Es un fenómeno reversible.

Ejemplos. Si regáramos una planta con agua de mar, las células de los pelos de las
raíces (por donde se capta el agua y las sales minerales), al tratar de buscar el equilibrio
entre los medios se deshidrataría, sufrirían una plasmólisis y por consiguiente, morirían.

Las hojas de lechuga se ponen turgentes cuando se dejan en agua y luego al aliñar la
ensalada se arrugan. Al dejarlas en agua se están colocando en un medio hipotónico,
por lo que mediante un proceso osmótico entrará agua al interior de las células de la
lechuga, atravesando sus membranas celulares que son semipermeables; se producirá

30
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
31

por tanto el proceso de turgencia. Al añadirle la sal del aliño, el medio se convierte en
hipertónico y ocurre el proceso inverso: las hojas pierden agua pues ésta se desplaza al
medio externo (de mayor concentración salina) por ósmosis, lo que da lugar a que se
arruguen las hojas.

Los glóbulos rojos normalmente tienen una forma bicóncava y se encuentran


suspendidos en un líquido denominado plasma que contiene sales, proteínas y otros
solutos. La concentración del interior celular del glóbulo rojo, así como de todas las
células de mamífero en general, equivale a una concentración de NaCl de 154 mM. Las
soluciones que se administran vía venosa deben ser isotónicas para los eritrocitos en
esta situación no hay entrada ni salida neta de agua a los eritrocitos u otras células
sanguíneas (equilibrio osmótico). Si se administra a los glóbulos rojos una solución de
mayor concentración de solutos, el glóbulo rojo se deshidrata y su volumen disminuye.
En este caso los glóbulos rojos sufren un cambio en su morfología discoidal,
deformándose debido a que se ha producido la salida de parte del agua de su citoplasma
al medio externo debido a la ley osmótica. Esta falta de agua produce un arrugamiento
celular y una pérdida de volumen debido al fenómeno de plasmólisis como lo
demuestran los arrugamientos de su membrana que deja de estar tersa..

Por el contrario, cuando el glóbulo rojo es colocado en una solución hipotónica o de


menor concentración de solutos, como el agua, el agua entra al glóbulo rojo , éste se
hincha, se produce lisis o rotura de los glóbulos rojos debido a la entrada de agua del
medio externo al interior de la célula, como se observa en la figura lV

Por este motivo cuando se produce una herida resulta conveniente lavarla con suero
salino (de igual composición salina que el plasma sanguíneo), resultando perjudicial
lavarla con agua destilada. Al lavar un herida (células vivas) con suero salino, no se
altera el equilibrio osmótico de las células, por lo que no sufrirán daño; en cambio, si se
lava con agua destilada, se las somete a un medio muy hipotónico, por lo que sufrirán
una entrada masiva de agua por procesos osmóticos, que las perjudica, pudiendo llegar
a destruirlas.

31
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
32

Lección 9

Citoplasma forma un fluido viscoso que circunda el núcleo y está limitado por la
membrana plasmática. Se compone básicamente de agua y numerosas sustancias
minerales y orgánicas disueltas en solución coloidal. Las sustancias minerales
contenidas están ionizadas. Sobre todo hay potasio, sodio, calcio y magnesio, en dosis
extremadamente exactas. Las sustancias orgánicas son básicamente proteínas y en
menor proporción lípidos, carbohidratos, ácidos nucleicos.

En el citoplasma de la célula eucariota encontramos el citoesqueleto, orgánelos como las


mitocondrias, los lisosomas, el núcleo, además de un sistema de membranas el retículo
endoplasmático, unos gránulos los ribosomas y vacuolas en células vegetales. La
función del citoplasma está relacionada con los procesos metabólicos encargados de las
síntesis de compuestos como aminoácidos, lípidos, carbohidratos entre otros.

El Núcleo

Fuente: diseñado por Carmen Eugenia Piña L

El núcleo es el organelo que gobierna todas las funciones de la célula. Las principales
funciones son: crecimiento y reproducción celular, almacenamiento y organización de los
genes, trasmisión de la información genética.

En las células eucariotas está rodeado por una membrana nuclear, mientras que en las
procariotas no existe dicha membrana, por lo que el material nuclear está disperso en el
citoplasma.

En las células eucariotas al núcleo también se le llama carioplasma, se localiza en el


centro de la célula y suele tener una forma redondeada o elíptica en las células
prismáticas.

32
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
33

El núcleo de una célula eucariota puede presentarse en dos formas distintas, según sea
la etapa en que se halle la propia célula. En las células que no están en división y
consecuentemente su núcleo no está en proceso de transformación, el DNA se
encuentra combinado con proteínas como las histonas, dándole una apariencia fibrilar.
Esta combinación de DNA y proteínas se llama cromatina.

Durante la división celular o mitosis la cromatina se condensa en cromosomas


susceptibles de ser coloreados y observados al microscopio óptico. Los cromosomas
tienen como función portar los factores hereditarios o genes y trasmitir la información
genética de una célula a otra sin modificarla ni empobrecerla, esta transmisión ocurre
durante la división de la célula. No se conoce todavía de modo exacto la estructura de
cada cromosoma, pero se supone que cada uno de ellos consta de una o varias dobles
hélices de ADN, varias veces envueltas sobre sí mismas.

El número de cromosomas de cada célula es constante para cada especie, pero se


reduce a la mitad en las células sexuales o gametos. A raíz de este fenómeno, estas
células se denominan haploides, frente a la denominación de diploides que tienen las
demás células.

Cromatina y Cromosomas

Gráfica Cromosoma. Fuente: diseñado por Carmen Eugenia Piña L

La cromatina que se puede observar durante la interfase a través del microscopio


electrónico como filamentos muy delgados y retorcidos está constituida por ADN,
proteínas y ácidos nucleicos; pero cuando la célula entra en división la cromatina se
organiza en estructuras individuales que son los cromosomas

Un cromosoma es una molécula de ADN muy larga que contiene una serie de genes. Un
cromosoma está formado por dos cromátidas. En cada una de ellas hay un
nucleofilamento de ADN replegado e idéntico en ambas cromátidas.

33
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
34

Las cromátidas están unidas a través del centrómero. En las cromátidas también se
observa un cinetócoro que es el centro organizador de microtúbulos que se forman
durante la mitosis y que ayudan a unir los cromosomas con el huso mitótico.

El Nucleolo

Se encuentra dentro del núcleo de células eucarióticas aparentemente sin membrana


delimitadora y asociado con una región específica de un cromosoma llamado
organizador nuclear, que al parecer atraviesa al nucleolo. Cuando la célula eucariota
permanece sin dividirse (período de interfase), el nucleolo se puede observar al
microscopio óptico como un organelo de color más oscuro, de tamaño pequeño (1 a 7
micrómetros) y de forma redondeada. El nucleolo está compuesto por de proteína, ARN
y ADN.

El tamaño y la morfología de los nucleolos varía en función de la especie, del tipo celular
y del estado fisiológico de la célula. Es así como su número y tamaño aumentan durante
la síntesis de proteínas. Durante la división celular el nucleolo desaparece. La función del
nucleolo es la síntesis de ribosomas. En las células procariotas el nucleolo está ausente.

El Retículo Endoplasmático

Fuente: diseñado por Carmen Eugenia Piña L

Se encuentra en todas las células eucariotas y ocupa hasta el 10% del espacio interior
de éstas. Se trata de un sistema de membranas cuyas dimensiones dependen del
estado fisiológico de la célula: es más reducido en las células poco activas o poco
diferenciadas.

El retículo endoplasmático forma una red de pequeños canales múltiples, comunicantes


entre sí, que atraviesan el citoplasma y van desde la membrana nuclear hasta la
membrana plasmática. Su función consiste en transportar materiales dentro de la célula
a manera de un sistema circulatorio. En puntos diversos forma pequeñas cavidades o
vesículas, y está constituido por una doble lámina que limita dos espacios: el
citoplasmático y el reticular. El espacio que queda limitado en el interior se denomina
lumen.

34
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
35

La membrana externa puede ser rugosa, con la presencia de ribosomas y se denomina


retículo endoplasmático rugoso, o lisa carente de ribosomas y en este caso se denomina
retículo endoplasmático liso. El retículo endoplasmático liso es responsable de: la
síntesis de fosfolípidos y colesterol y el procesamiento de sustancias tóxicas
procedentes del exterior de la célula.

La actividad del retículo endoplasmático rugoso está estrechamente relacionada con la


síntesis de proteínas y viene determinada por la presencia de ribosomas.

Ribosomas

Son organelos compactos y globulares, se encuentran tanto en las células procariotas


como en las eucariotas. Están compuestos por ARN y proteínas. Son unos gránulos
cuyas dimensiones se miden en millonésimas de milímetro, se hallan situados sobre las
membranas del retículo endoplasmático rugoso o sobre la cara externa de la membrana
nuclear, o incluso aislados en el plasma.

Fuente: diseñado por Carmen Eugenia Piña L

En los ribosomas tiene lugar la síntesis de proteínas, es decir, la unión de los


aminoácidos de una proteína siguiendo una secuencia establecida genéticamente.

Mitocondrias

Fuente: diseñado por Carmen Eugenia Piña L

35
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
36

Son minúsculos orgánelos celulares, se hallan, generalmente en gran número, en casi


todas las células vegetales y animales (células eucariotas). Las mitocondrias Suelen
tener forma de saco tubular, ovalado. Observadas al microscopio electrónico presentan
dos membranas separadas.

La membrana interna presenta crestas o repliegues hacia el interior que aumentan la


superficie de la membrana. Contiene numerosas proteínas de transporte y otras con
funciones muy especializadas, como los complejos que forman la cadena respiratoria y
el ATP (trifosfato de adenosina)

La membrana externa. Contiene numerosas proteínas que regulan los intercambios de


sustancias con el citosol (parte líquida del ciptoplasma). Se destacan las proteínas de
canal, las cuales forman grandes poros que la hacen muy permeable.

Las mitocondrias se constituyen en fábricas de energía celular; ellas extraen la energía


de las moléculas alimenticias y la almacenan en forma de ATP, dicha energía es
utilizada en todos los procesos metabólicos, ésto se lleva a cabo a través de la
respiración celular. El proceso de oxidación de alimentos se constituye en la respiración
celular aerobia, y consiste en una serie de reacciones catalizadas enzimáticamente y
tiene como propósito la producción de energía biológicamente útil ATP en células que
viven en presencia de oxígeno.

En este proceso, se transfieren electrones desde la glucosa (molécula proveniente del


alimento) hasta el oxígeno molecular para producir energía, bióxido de carbono y agua

Glucosa + 6O2 CO2 + 6H2O + 36 ATP

Aparato de Golgi

Fuente: diseñado por Carmen Eugenia Piña L

Es un organelo común a todas las células eucariotas y está especialmente desarrollado


en aquellas que tienen actividad secretora.

El aparato de Golgi se deriva del retículo endoplasmático y está constituido por una serie
de cavidades planas paralelas, delimitadas por una membrana, en cuya periferia hay
unas vesículas llamadas asimismo de Golgi.

36
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
37

La función del aparato de Golgi consiste en:

• El aislamiento dentro del citoplasma y mediante una membrana, de algunas


sustancias (por ejemplo separa proteínas, de lípidos)
• Empacar esas sustancias en las vesículas con el fin de llevarlas al interior del
propio citoplasma o a su parte exterior.
• Intervenir en los procesos de secreción y la excreción celular
• Proteger a la célula de la acción tóxica de determinadas sustancias.
• Intervenir en la formación de los lisosomas

Lección 10

Vacuolas

Las vacuolas son organelos abundantes en las células vegetales y bastante escasos y
muy pequeños en las células animales. Están rodeadas de una membrana denominada
tonoplasto y en su interior se encuentra una sustancia fluida de composición variable.
Las vacuolas pueden ocupar entre un 5 y un 90% del volumen celular, aunque, de
hecho, casi siempre es superior al 30%.

Desempeñan funciones muy diversas, hasta el punto de que en una misma célula
pueden encontrarse vacuolas con funciones distintas.

En las células vegetales las vacuolas intervienen en los siguientes procesos:

• Constituyen reservas de sustancias nutritivas (azúcares, grasas), que están a


disposición de las necesidades de la célula.
• Actúan como almacenes de productos tóxicos para la célula.
• Dan soporte a la célula.
• Contribuyen al crecimiento de los tejidos.
• En organismos unicelulares sirven para realizar el proceso digestivo. Eliminan el
exceso de agua que entra a la célula.

Lisosomas

Los lisosomas son organelos característicos de las células eucariotas. Son más
abundantes en células animales.

Son pequeñas vesículas de forma y tamaño variables, aunque, por lo general, son
esféricas. Los lisosomas están limitados por una membrana y en su interior, contienen
enzimas como lipasas y nucleasas.

Los lisosomas se encargan de:

37
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
38

• La hidrólisis de macromoléculas. Esas macromoléculas pueden proceder del


exterior de la célula por endocitosis, como las sustancias nutritivas que deben
digerirse.
• Digerir organelos de la propia célula defectuosos, que no funcionan bien o que
envejecen
• Destruir microorganismos como virus o bacterias nocivos para la célula.

Peroxisomas

Están presentes en las células eucariotas y pueden encontrarse dispersos por el


citoplasma o bien estrechamente relacionados con otros organelos como mitocondrias o
cloroplastos.

Son organelos pequeños y esféricos, rodeados por una membrana, contienen: enzimas
oxidasas y catalasas.

Las funciones de los peroxisomas son:

• Llevar a cabo reacciones oxidativas de degradación de ácidos grasos y


aminoácidos por acción de las oxidasas. Es así como, las oxidasas utilizan el
oxígeno molecular para eliminar átomos de hidrógeno de los sustratos. Como
resultado de esta oxidación en unos casos se obtiene agua y en otros peróxido de
hidrógeno.
• Degradar el peróxido de hidrógeno sustancia que es muy tóxica para la célula, por
acción de la enzima catalasa, con la producción de agua y oxígeno.
• Intervenir en reacciones de detoxificación (por ejemplo, gran parte del etanol que
bebemos es detoxificado por peroxisomas de células hepáticas)

Centrosomas y Centríolos

Los centrosomas están constituidos por un par de centriolos presentes en células


animales. Su función principal es formar las fibras del huso acromático en el proceso de
división celular.

Los centriolos se encuentran en número par, son muy pequeños y de difícil observación
en el período de interfase. Observado con el microscopio electrónico, cada centriolo

38
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
39

aparece como un cilindro hueco, con un diámetro de 0,15 micras y una longitud de 0,5
micras. La pared del centriolo está constituida por una serie de agrupamientos de
túbulos.

Los centriolos se hacen visibles durante la división celular, cuando desempeñan su


función principal consistente en la producción del huso mitótico. Forman también los
cilios y flagelos de las células.

Plastos o Plastidios

Los plastos se encuentran exclusivamente en las células vegetales, tienen forma de


disco o esférica limitados por una membrana doble. Se agrupan en tres tipos:
cloroplastos, leucoplastos y cromoplastos.

Fuente: diseñado por Carmen Eugenia Piña L

Los cloroplastos son característicos en vegetales y en algunas algas unicelulares. Están


rodeados por una membrana doble: la externa que presenta plegamientos o crestas y es
muy permeable, y la interna lisa, es decir sin crestas, menos permeable que la externa y
con numerosas proteínas especializadas en el transporte selectivo de sustancias.

La membrana interna contiene un semifluido denominado estroma compuesto de


enzimas, ADN y ribosomas. Dentro del estroma se localizan unos sáculos aplanados y
membranosos, a los cuales en forma individual se les llama tilacoides y contienen el
pigmento verde o clorofila, así como otros pigmentos. Los tilacoides tienden a formar
apilamientos denominados grana, los cuales se conectan entre sí formando una red de
cavidades.

Los cloroplastos tienen como función realizar la fotosíntesis.

Leucoplastos: son estructuras incoloras o blancas que almacenan almidón, grasa,


proteínas y otras sustancias.

Cromoplastos: Dan color a las flores, la cáscara y la pulpa de muchos frutos y son
organelos con pigmentos de diferentes colores, excepto el verde.

39
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
40

Citoesqueleto Presente en células eucariotas está compuesto por una red de fibras
protéicas en forma de microfilamentos, filamentos y microtúbulos gruesos.

Las funciones del citoesqueleto son:

• Dar forma y sostén a la célula.


• Facilitar el movimiento celular ameboideo y de migración por acción del
deslizamiento y ensamblado y desamblado de los microfilamentos y microtúbulos.
• Ayudar al sostén, posición y movimiento de organelos. Participar en la división
celular al mover los cromosomas hacia las células hijas y al contraer el citoplasma
para su división.

Pared Celular

Presente en las células eucariotas vegetales y fúngicas, externa a la membrana


plasmática. Básicamente está compuesta de celulosa, y en menor cantidad de otras
sustancias como la hemicelulosa, los pectatos o pectinas, lignina, suberina, cutina,
proteínas, sales minerales y ceras.

La pared celular cumple un papel importante en la absorción, transpiración, secreción y


traslocación. Sirve de protección contra la desecación y de defensa contra bacterias y
otros patógenos

Diferencias entre la célula eucariota vegetal y animal

La célula eucariota vegetal

• Utiliza la materia inorgánica para sintetizar compuestos orgánicos.


• Aprovecha la energía lumínica para que tenga lugar el proceso anterior.
• Utiliza después la energía química de las moléculas orgánicas que ella ha
sintetizado.
• Desarrolla un proceso de nutrición autótrofa.
• Presenta pared celular.
• Contiene plastos.
• Tiene mayor número de vacuolas

La célula eucariota animal

• No puede sintetizar moléculas orgánicas a partir de moléculas inorgánicas.


• No aprovecha la energía lumínica en la síntesis de moléculas orgánicas.
• Depende de las moléculas orgánicas que toma del exterior y de la energía
química que estas contienen.
• Desarrolla un proceso de nutrición heterótrofa.
• Tiene mayor número de lisosomas.

40
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
41

• Presenta centríolos.

Interactividad sobre la célula

Lección 11. Procesos Celulares

• Nutrición Consiste en la captación de materia para crecer, reponer las partes de


la célula que estén envejecidas y disponer de materias primas para las distintas
actividades celulares y obtener la energía. Todos estos procesos se realizan
mediante reacciones bioquímicas.

Metabolismo Es el conjunto de reacciones que se producen dentro de las células
de los seres vivos, estas reacciones son catalizadas por enzimas concretas. Hay
dos grupos de reacciones metabólicas:

Anabolismo (síntesis) Es el conjunto de reacciones cuyo objetivo es la obtención de


moléculas complejas y ricas en energía (glúcidos, ácidos grasos) a partir de moléculas
simples. Estas reacciones consumen energía que se incorpora a la molécula
sintetizadadora, son reacciones endergónicas.

Catabolismo (degradación) El conjunto de transformaciones bioquímicas que las


células realizan a partir de moléculas energéticamente ricas. Se produce energía
química disponible para otras reacciones y se obtienen productos más simples. Son
reacciones exergónicas.
La materia y la energía que proporciona la nutrición ponen en marcha todas las
reacciones metabólicas, el proceso comienza con la entrada de nutrientes del exterior.

• Respiración celular Es una oxidación de moléculas orgánicas para suministrar


energía a plantas y animales. La energía obtenida se utiliza para unir un grupo de
fosfatos de alta energía ADP y formar un portador de energía a corto plazo el
ATP. En las células vegetales la respiración se realiza a partir de la glucosa
obtenida en la fotosíntesis. En las animales, se realiza a partir de la glucosa
obtenida al ingerir los alimentos.

La respiración necesita:

• Monómeros de la grandes biomoléculas (glucosa).


• Moléculas transportadoras de electrones.
• Molécula receptora que es el oxígeno.
• Un espacio cerrado para que se lleve acabo la transferencia de electrones, este
espacio es la mitocondria.

Hay dos tipos de respiración: respiración aeróbica y respiración anaeróbica.

41
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
42

Respiración Aeróbica El oxígeno libre se utiliza para oxidar moléculas orgánicas y


convertirlas en bióxido de carbono y agua con alta liberación de energía.

Respiración Anaeróbica Respiración propia de levaduras, algunas bacterias


anaerobias, y ocasionalmente presente en los tejidos cuando no interviene el oxígeno. El
sustrato orgánico no está totalmente oxidado y la producción de energía es baja al
convertirse la glucosa de los tejidos musculares en ácido pirúvico por glucólisis y
también en ácido láctico, que luego puede oxidarse cuando vuelve la presencia de
oxígeno.

• Fotosíntesis La fotosíntesis es el paso previo de los seres autótrofos para


obtener la materia que utilizará en procesos posteriores. Su objetivo es obtener
moléculas orgánicas (glúcidos) a partir de moléculas inorgánicas.

Para que esto ocurra se necesita:

• Luz
• Cloroplasto con pigmentos: cLección lorofila.
• Moléculas transportadoras y receptoras de electrones

Sucede:

• Al incidir la luz en la clorofila, se produce el desprendimiento de electrones


activados.
• Las moléculas transportadoras de electrones los llevan hacia el aceptor final.
• En el espacio cerrado del cloroplasto se intercambian los electrones sin
dispersarse.
• La eficacia es máxima.

Fases de la fotosíntesis

Fase dependiente de la luz

El cloroplasto capta la energía lumínica que se invierte en:

• Activar la clorofila para que se desprendan electrones.


• Romper moléculas de agua.
• Formar moléculas de ATP que contienen en sus enlaces la energía química
procedente de los electrones activados.

Fase independiente de la luz.

• No requiere presencia de luz.

42
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
43

• Se llama también fase de fijación del carbono porque se capta CO2 atmosférico,
que se incorpora para formar glucosa, proceso que permitirá producir almidón.
• Los glúcidos (glucosa, almidón) obtenidos se utilizarán también en la síntesis de
otro tipo de biomoléculas como los aminoácidos, los lípidos y los nucleótidos.

• Relación Consiste en captar las condiciones del ambiente y elaborar las


respuestas más indicadas para sobrevivir en cada caso.

Las células deben presentar sensibilidad respecto a ciertos estímulos como son: la luz,
las sustancias químicas, el contacto con otros elementos. Las reacciones frente a estos
estímulos son respuestas. Ejemplo: el movimiento de corrientes citoplasmáticas que
provocan que la célula se pueda desplazar. Estos desplazamientos se realizan mediante:
seudópodos, cilios y flagelos.

Los seudópodos: son prolongaciones del citoplasma que arrastran y desplazan la célula.
Este movimiento característico de amebas y leucocitos se conoce como ameboide. Se
origina por variaciones de la viscosidad del citoplasma al pasar del estado de sol al de
gel, o por una disminución de la tensión superficial.

Cilios y flagelos: son tubos redondeados, que salen desde la membrana plasmática y se
prolongan fuera de la célula. Su movimiento es vibrátil. Los cilios son pequeños y
numerosos y el desplazamiento se produce por movimientos bruscos como látigos.

Los flagelos son de mayor tamaño, su cantidad es menor (puede haber solo uno) y su
movimiento es suave.

Otro tipo de respuesta ante condiciones ambientales muy desfavorables, es el de


algunas células que producen esporas (estructuras muy resistentes) las cuales engloban
una parte del citoplasma y el cromosoma para protegerlo y conservarlo. Las esporas
pueden resistir mucho tiempo y cuando las condiciones mejoran, las esporas absorben
agua, activan su metabolismo y la célula se reproduce.

Otros procesos celulares fundamentales son los de división celular: mitosis y meiosis, los
cuales por su importancia se tratan por separado.

Lección 12. División celular

Según el tercer principio de la teoría celular, las células se originan a partir de otras
células; este proceso se denomina división celular. La división celular puede ocurrir por
mitosis en las células somáticas (las que forman el cuerpo) y tienen dos juegos de
cromosomas (2n) o por meiosis en las células germinativas que originan los gametos
(óvulo y espermatozoide) con número haploide (n) de cromosomas.

43
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
44

La división mitótica permite que de una célula madre se originen dos nuevas células
hijas, con las mismas características morfológicas y fisiológicas de la célula preexistente.
El objetivo de la división mitótica es conseguir la duplicación de la célula de modo que
las dos células hijas reciban la dotación cromosómica idéntica a la de sus progenitores.

En los organismos unicelulares la división mitótica da origen a un nuevo organismo. En


los organismos multicelulares las células somáticas diploides se reproducen para formar
tejidos, órganos, para reemplazar las partes envejecidas, desgastadas, muertas y para
permitir el crecimiento del organismo. Las etapas a través de las cuales pasa una célula
de una división celular a otra constituyen el ciclo de la célula. La duración y las
características del ciclo celular son variables y dependen del tipo de célula y de las
circunstancias en que se desarrolla.

El Ciclo celular se divide en dos fases principales:

• La interfase período durante el cual los cromosomas se duplican y


• La mitosis fase en la cual los cromosomas duplicados se reparten en dos núcleos

Al final de la mitosis ocurre la citocinesis cuando la célula se divide originando dos


células hijas.

Interfase La mayor parte del tiempo del ciclo celular transcurre en la etapa de interfase
durante la cual la célula duplica su tamaño y el contenido cromosómico, la interfase
puede durar horas, días o semanas según el tipo de célula.

Interfase en célula de cebolla Interfase en célula animal

Gráfica Ilustraciones comparativas de interfase


Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html
All images are copyrighted 2001 by Dale M. Benham. However these images may be used
for educational, non-profit endeavors without permission.

En la etapa de interfase la célula está ocupada en la actividad metabólica preparándose


para la mitosis. Los cromosomas no se observan fácilmente en el núcleo, mientras que
el nucleolo puede ser visible como una mancha oscura .Durante la interfase se sintetiza
el ARN mensajero y ribosomal; se replica el ADN; la célula animal puede contener un par
de centríolos los cuales forman el huso acromático.

44
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
45

Mitosis Aunque la mitosis es un proceso dinámico, secuencial y continuo por razones


prácticas para facilitar el análisis y la experimentación se divide en cuatro fases o etapas:
profase, metafase, anafase y telofase. Durante la mitosis hay variación en el núcleo de la
célula, los cromosomas duplicados se separan y se producen dos núcleos cada uno con
una copia fiel de cada cromosoma. La mitosis a menudo se acompaña de citocinesis,
proceso durante el cual la célula divide su citoplasma produciendo dos células hijas con
iguales organelos. La fase mitótica (mitosis y citocinesis) generalmente dura 30 minutos.

Profase La célula parece más esférica y el citoplasma más viscoso. Al comienzo de la


profase los cordones de cromatina se enrollan lentamente y se condensan, aparecen los
cromosomas.

Profase en célula de cebolla Profase en célula animal


Gráfica Ilustraciones comparativas de profase
Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html
All images are copyrighted 2001 by Dale M. Benham. However these images may be used
for educational, non-profit endeavors without permission.

En esta fase los cromosomas están agrupados por parejas llamándose a cada uno de
los dos que conforman el par, cromosoma homólogo (tienen igual longitud, igual posición
del centrómero e iguales genes), y cada cromosoma del par está a su vez constituido por
dos cromátidas unidas por el centrómero. En las células de la mayoría de los
organismos, exceptuando las plantas superiores se ven dos pares de centríolos a un
lado del núcleo, fuera de la envoltura nuclear. Durante la profase los pares de centríolos
empiezan a alejarse el uno del otro, y a medida que éstos se separan aparecen entre
ambos pares de centríolos las fibras del huso acromático, consistentes en microtúbulos y
otras proteínas. Los nucléolos dejan de ser visibles. La envoltura nuclear se disgrega. Al
terminar la profase, los cromosomas se han condensado por completo, los pares de
centríolos están en extremos opuestos de la célula. El huso se ha formado por completo.

Metafase En etapa de metafase cada cromosoma se une a dos fibras del huso,
provenientes cada una de un polo, y se alinean en el plano ecuatorial, es decir, en el
centro de la célula

45
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
46

Metafase en célula de cebolla Metafase en célula animal

Gráfica Ilustraciones comparativas de metafase


Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html
All images are copyrighted 2001 by Dale M. Benham. However these images may be used
for educational, non-profit endeavors without permission.

Anafase

Anafase en célula de cebolla Anafase en célula animal

Gráfica Ilustraciones comparativas de anafase

Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html
All images are copyrighted 2001 by Dale M. Benham. However these images may be
used for educational, non-profit endeavors without permission.

Mientras se ha ido formando el huso acromático, los cromosomas se han dividido en dos
mitades o cromátidas, las dos cromátidas se separan, arrastradas por los filamentos
tractores del huso acromático y se dirigen a los dos polos de la célula, convertidos ya en
cromosomas hijos.

Telofase Los cromosomas se sitúan en cada polo, las fibras del huso se dispersan por el
citoplasma, se inicia la formación de las envolturas nucleares que rodearán a los dos
núcleos hijos. Los cromosomas se tornan difusos, pues se empiezan a desenrollar.
Aparece un nucleolo en cada polo, se inicia la citocinesis (división del citoplasma por la
mitad), se forman dos células hijas.

46
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
47

Telofase en célula de cebolla Telofase en célula animal

Gráfica Ilustraciones comparativas de telofase

Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html
All images are copyrighted 2001 by Dale M. Benham. However these images may be used
for educational, non-profit endeavors without permission.

Citocinesis Etapa de la división celular que consiste en la división del citoplasma. El


proceso visible de la citocinesis suele empezar en la telofase de la mitosis y por lo
general divide la célula en dos partes más o menos iguales. La citocinesis difiere en
ciertos aspectos en células animales y vegetales.

En las células animales, durante la telofase, la membrana celular empieza a estrecharse


en la zona donde estaba el ecuador del huso. Al principio se forma en la superficie una
depresión, que poco a poco se va profundizando para convertirse en un surco hasta que
la conexión entre las células hijas queda reducida a un hilo fino, que no tarda en
romperse para así separar las dos células hijas.

En las células vegetales, este proceso es un tanto diferente, puesto que estas células
presentan externamente a la membrana plasmática, una pared bastante rígida. En este
caso, la citocinesis se produce por la formación de un tabique entre los dos nuevos
núcleos, este tabique va creciendo desde el centro hacia la periferia de la célula, hasta
que sus membranas hacen contacto con la membrana plasmática, con la que
posteriormente se fusionan completándose la división celular.

Lección 13 Meiosis I

La meiosis se realiza siempre en las células sexuales o gametos, a diferencia de la


mitosis que se realiza en las células somáticas. Las células sexuales o gametos a
diferencia de las células somáticas que contienen doble juego de cromosomas, sólo
contienen un juego de cromosomas (n) o número haploide. La meiosis es la división
celular por la cual se obtienen cuatro células hijas (gametos) con la mitad de los juegos
cromosómicos que tenía la célula madre o germinativa, conservando toda la información
genética de los progenitores.

47
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
48

El proceso de meiosis ocurre en dos fases meiosis l meiosis II, cada una de las cuales
consta de las mismas etapas que la mitosis con algunas diferencias en la profase I.En la
célula germinativa existen dos juegos de cromosomas o material genético, uno de origen
paterno y otro de origen materno. En la Profase I, cada par de cromosomas se aparea
con su homólogo, formando lo que se denomina una tétrada, es decir cuatro cromátidas
y dos centrómeros. Este apareamiento es una característica propia de la meiosis y tiene
importancia porque ocurre el entrecruzamiento de cromátidas (no hermanas) de origen
materno y paterno o recombinación genética que permite la variabilidad

La meiosis ocurre mediante dos mitosis consecutivas: La primera división de la célula


germinativa es reduccional y el resultado es la formación de dos células hijas cada una
con un número "n" cromosomas. La segunda división es una división mitótica normal al
final se obtienen cuatro gametos haploides a partir de la célula madre diploide.

Interfase

Célula animal en Interfase en meiosis I


Gráfica Fuente: diseñado por Carmen Eugenia Piña L

La célula sexual se prepara para la división hay replicación del ADN. En las células
animales se pueden observar dos centrosomas cada uno conteniendo un par de
centríolos. Desde los centrosomas se extienden los microtúbulos que son sitios de
formación del huso acromático. En las células vegetales no hay centrosomas.

Profase I Es la fase más larga y compleja de la meiosis. Durante la profase I se presenta


compactación y acortamiento de los cromosomas, los cromosomas homólogos
duplicados durante la interfase, se disponen uno al lado del otro. Ocurre un proceso de
apareamiento para formar parejas (diploides = 2n) o pares de cromosomas, un par
materno y el otro par paterno.

48
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
49

Gráfica Profase I a
Fuente: diseñado por Carmen Eugenia Piña L

Gráfica Profase I b
Fuente: diseñado por Carmen Eugenia Piña L

Ambos pares de cromosomas llevan el mismo tipo de genes y codifican un mismo tipo de
información, aunque en uno de los alelos ésta puede ser de carácter dominante y en el
otro puede ser recesiva. Ejemplo un alelo A dominante para la información color de los
ojos en el par cromosómico paterno y un alelo a recesivo para la misma información en
el par cromosómico materno. A través del microscopio se puede observar cada
cromosoma formado por dos cromátidas y un centrómero.

Gráfica Esquema con representación de Gráfica Esquema con representación de


cromosomas con alelos para un carácter entrecruzamiento de cromosomas no hermanos
Fuente: diseñado por Carmen Eugenia Piña L Fuente: diseñado por Carmen Eugenia Piña L

49
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
50

Las cromátidas no hermanas (una procedente del padre y otra de la madre) se enrollan
una alrededor de la otra, formando una región denominada quiasma en donde se puede
presentar entrecruzamiento de cromosomas homólogos. Durante el entrecruzamiento un
fragmento de una cromátida puede separarse e intercambiarse por otro fragmento de su
correspondiente homólogo, con el consecuente intercambio de genes. Esta
recombinación genética entre los cromosomas, permite la variabilidad y de esta manera
mejorar las características de la descendencia. Este apareamiento que se realiza a lo
largo del cromosoma, alelo por alelo, en toda su extensión, se denomina sinapsis.

Gráfica Esquema con


representación de Gráfica profase I c Formación de
cromosomas no hermanos tétradas en la prfoase l
en sinapsis
Fuente: diseñados por Carmen Eugenia Piña L

El resultado del proceso de sinapsis son las tétradas o pares bivalentes, es decir que
cada par de cromosomas está formados por 4 cromátidas y dos centrómeros. Al final de
la profase I el nucleolo y la membrana nuclear han desaparecido y en el citoplasma se
forma el huso acromático.

Metafase l

Gráfica metafase I
Fuente: diseñado por Carmen Eugenia Piña L

50
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
51

Desaparecen la membrana nuclear y el nucleolo. Las tétradas se alinean en el plano


ecuatorial. La alineación es al azar. Esto quiere decir que hay un 50% de posibilidad de
que las células hijas reciban el homólogo del padre o de la madre por cada cromosoma.

Gráfica anafase I a Gráfica anafase Ib


Fuente: diseñados por Carmen Eugenia Piña L

Anafase l Las tétradas se separan y los cromosomas se desplazan hacia los polos
opuestos, el huso acromático desaparece, se forman cromosomas hijos haploides con
dos cromátidas cada uno.

Telofase I y Citocinesis I

Gráfica Telofase I Gráfica Citocinesis I Gráfica Citocinesis I


Fuente diseñado por Carmen Eugenia Piña

Ocurre la primera división meiótica. Se forman núcleos hijos alrededor de los


cromosomas que se encuentran en los polos, el citoplasma se divide en dos (citocinesis)
para formar las dos células hijas con número haploide de cromosomas

Lección 14.

51
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
52

Meiosis II Cada célula resultante de la primera división realizará la segunda división


meiótica. El número de cromosomas es haploide y la cromatina de cada cromosoma
sufrió recombinación genética.

Intercinesis La fase de intercinesis o preparación de la célula es muy rápida. No hay


duplicación del ADN por lo tanto no hay duplicación de cromosomas.

Profase II

Gráficas profase II
Fuente: diseñados por Carmen Eugenia Piña L

Empiezan a desaparecer la membrana nuclear y el nucleolo, se vuelve a formar el huso


acromático, los cromosomas se condensan más, y su número es haploide.

Metafase II La membrana nuclear y el nucleolo desaparecen. Los cromosomas dobles


se alinean en el plano ecuatorial, los centrómeros se encuentran asociados a las fibras
de polos opuestos

Gráficas metafase II
Fuente: diseñados por Carmen Eugenia Piña L

Anafase II Las cromátidas se separan, se forman dos cromosomas hijos, los


cromosomas hijos emigran hacia los polos

52
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
53

Gráficas anafase II
Fuente: diseñados por Carmen Eugenia Piña L

Telofase II y Citocinesis

Gráfica telofase II
Fuente: diseñados por Carmen Eugenia Piña L

Se forman cuatro núcleos rodeados de membrana nuclear y con número de cromosomas


haploides, las células se dividen por segunda vez por medio de la citocinesis.

Gráfica citocinesis II
Fuente: diseñados por Carmen Eugenia Piña L

53
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
54

División Directa o Amitosis

Amitosis

Es un tipo de reproducción asexual que se da en los animales unicelulares. En este tipo


de reproducción el organismo se divide en dos y cada célula resultante tiene las mismas
características genéticas de la célula madre. Hay tres tipos de amitosis: fisión binaria o
bipartición, gemación y esporulación.

Fisión binaria o Bipartición Es un tipo de reproducción celular por medio de la cual


una célula se divide en dos partes iguales estas se separan de la madre formando un
núcleo propio y transformándose en otros organismos mas pequeños pero
genéticamente idénticos a la madre. Es característico de organismos procariotas como
las bacterias

Gemación En este tipo de reproducción se forma una protuberancia o yema en la pared


de la célula madre. Estas pequeñas protuberancias crecen llevándose a la vez una parte
del núcleo y del citoplasma de la célula madre. Finalmente se desprenden y forman
nuevos organismos. Ej.: la levadura

Esporulación Es el tercer tipo de amitosis y se da cuando el núcleo de una célula se


divide en muchas partes pequeñas. Estas se cubren con citoplasma formando esporas
que pueden permanecer latentes cuando se presentan condiciones adversas. Cuando
las condiciones son adecuadas o para su desarrollo, se dividen formando nuevas
organismos con la misma información genética.

Capitulo 3 Sistemas Orgánicos


Lección 15

Tejidos, órganos y sistemas

La célula es el nivel de organización básico de los seres vivos que interesa a la biología.
En la naturaleza los átomos están organizados en moléculas y estas en células. Las
células forman tejidos y estos órganos, que a su vez se reúnen en sistemas, como el
digestivo o el circulatorio entre otros. Un organismo vivo está formado por varios
sistemas anatómico fisiológicos íntimamente unidos entre sí.

Tejidos animales

Los tejidos son grupos de células con un origen común, que cumplen una función
específica dentro de un organismo. La ciencia que estudia los tejidos se denomina
Histología. En los animales se encuentran básicamente cuatro tipos de tejidos:

54
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
55

• Epitelial,
• Conectivo,
• Nervioso
• Muscular.

Tejido epitelial

El tejido epitelial según su función puede ser: tejido de revestimiento y tejido glandular,
aunque puede tener función mixta.

Tejido epitelial de revestimiento

Epitelio simple Epitelio cilindrico Epitelio seudoestratificado


cúbico simple ciliado

http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citología.htm

Se encuentra cubriendo la piel, u órganos internos como: el sistema digestivo, urinario,


respiratorio y los vasos sanguíneos. Tiene función sensitiva, protectora contra daños
mecánicos, de defensa al impedir la entrada de microorganismos, y en el intestino tiene
función de absorción.

Tejido epitelial glandular

Glándula mucosa de la Glándula serosa del Glándula sebácea


glándula mamaria páncreas del oído

http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citología.htm

Especializado en secretar sustancias a la sangre o al exterior del organismo se


encuentra en las glándulas endocrinas y exocrinas.

55
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
56

Tejido conectivo

Puede ser de tres tipos: conjuntivo, cartilaginoso, y óseo.

Tejido conjuntivo

Tejido conjuntivo Tejido conjuntivo elastico


esófago en arteria

http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citología.htm

Forma la dermis de la piel, se encuentra en las submucosas de órganos como pulmones,


corazón, órganos digestivos, en la parte interna de los vasos sanguíneos, en los
tendones, en el tejido adiposo donde almacena grasa.

Sus funciones son: sostén, defensa, protección, reparación, transporte de metabolitos,


rellenar los espacios entre tejidos u órganos.

Tejido cartilaginoso

Tejido conjuntivo cartilaginoso


en tráquea

http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citología.htm

Es un tejido de sostén y soporte, se encuentra en el esqueleto de embriones en el


tabique nasal, laringe, tráquea, bronquios, en los discos intervertebrales, en los meniscos
de la rodilla. Es menos resistente y rígido que el óseo.

Tejido óseo forma los huesos del cuerpo, tiene funciones de sostén, mecánica, y
protección de órganos blandos. Es bastante rígido y resistente.

56
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
57

Tejido nervioso

Tomado de: http://www.joseacortes.com/galeriaimag/index.htm.joseacortes.com/galeriaimag/index.htm

Se encuentra formando todo el sistema nervioso (encéfalo, médula espinal, nervios),


está formado por dos tipos de células: neuronas y células de glia.

Las principales funciones del tejido nervioso son: Detectar, transmitir, analizar y dar
respuesta a las variaciones internas y externas. Coordinar el funcionamiento de todas las
funciones del organismo. Servir de sostén, nutrición y defensa del tejido nervioso función
a cargo de las células de glia.

Las neuronas o células nerviosas reciben información del exterior, se comunican entre si
a través de sinapsis, deciden y actúan. Las sinapsis pueden producir mensajes
excitatorios o inhibitorios.

Las células de glia forman el tejido de sostén del sistema nervioso y son de tres tipos:
astroglia, oligondendroglia cuya función es sostener y nutrir el sistema nervioso, además
de formar la barrera hematoencefálica al adherirse a vasos sanguíneos y microglía
encargadas de fagocitar los elementos nocivos para el sistema nervioso.

Tejido muscular

Hay tres tipos de tejido muscular: liso, esquelético o estriado y cardiaco.

Tejido muscular liso Se encuentra en los vasos sanguíneos, en las paredes del sistema
digestivo, en la vejiga urinaria, en el útero y en el sistema respiratorio. Sus contracciones
son lentas e involuntarias.

57
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
58

Tejido muscular liso

Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

Tejido muscular estriado

Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

Se encuentra cubriendo los huesos del esqueleto, y en los esfínteres. Sus contracciones
son rápidas y permiten el movimiento de las diferentes partes del cuerpo.

Tejido muscular cardiaco

Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

Es una variación del estriado, se encuentra en el corazón, permite mantener el latido


cardiaco, sus contracciones son rápidas e involuntarias.

Lección 16 Tejidos Vegetales

58
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
59

Las células vegetales se agrupan, al igual que las de los animales, formando tejidos.

Las plantas vasculares, adaptadas a la vida terrestre y aérea presentan tejidos


diferenciados.

Los tipos de tejidos vegetales son:

• Meristemático,
• protector,
• parenquimático,
• conductor y
• de sostén

Tejidos meristemáticos

Son tejidos formados por células embrionarias con gran capacidad de división mitótica,
permiten el crecimiento de las plantas. Pueden ser de dos tipos: primario y secundario.

Tejido meristemático en mitosis de cebolla

Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

Tejido meristemático primario se encuentran en la raíz, tallo, yemas (botones). Son


responsables del crecimiento longitudinal de la planta

Tejido meristemático secundario se encuentra en toda la planta y es responsable de su


crecimiento en grosor.

Tejidos protectores

Tienen como función proteger a la planta de la desecación y de factores externos que


puedan agredirla. Pueden estar localizados en la epidermis, corcho y endodermis de

59
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
60

raíces, tallos y hojas. Las células epidérmicas forman una capa continua sobre la
superficie del cuerpo de la planta. Su forma frecuentemente es tubular.

Tejido epidermal con estomas


Tejido epidermal de bulbo de cebolla
Fuente:Carmen Eugenia Piña
Tomado de: http://www.joseacortes.com/
galeriaimag/ index.htm

Tejidos parenquimáticos

Tienen como función la producción y almacenamiento de alimento, la reserva de aire y


agua, se divide en: clorofílico, de almacenamiento, aerífero y acuífero. La forma de sus
células puede ser poliédrica, estrellada o alargada.

Tejido parenquimático clorofílico o clorénquima se encuentra en las hojas y tallos


verdes; tiene como función realizar la fotosíntesis por lo que presenta muchos
cloroplastos.

Tejido epidermal y Tejido epidermal y


parenquimático en hoja de parenquimático en hoja de
Elodea 40X Elodea 100X
Fuente:Carmen Eugenia Piña Fuente:Carmen Eugenia Piña

Tejido parenquimático de almacenamiento tiene como función almacenar almidones


como en la papa, lípidos, proteínas. Se encuentra en raíces, bulbos, tallos subterráneos
como tubérculos y rizomas y en las semillas.

60
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
61

Tejido parenquimático en
corte de papa 40X
Fuente:Carmen Eugenia Piña

Tejido parenquimático aerífero se localiza en las plantas acuáticas tiene como función
almacenar agua permitiéndole a la planta flotar y realizar el intercambio gaseoso.

Tejido parenquimático acuífero se presenta en plantas que viven en ambientes secos


y necesitan de un tejido que almacene grandes reservas de agua. Es el caso de los
cactus.

Tejidos conductores

Tienen como función el transporte de agua y sustancias minerales. Se divide en dos


tipos: Xilema y Floema.

Xilema

Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

Xilema está formado por células muertas y endurecidas por lignina tiene como función
conducir el agua y los minerales del suelo, desde la raíz hasta las hojas, además de
servir de sostén a la planta.

61
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
62

El crecimiento de los árboles se debe a la formación de nuevos canales de xilema que


cada año van formando un anillo de crecimiento en el tronco. Al realizar un corte
transversal de un tronco y observar los anillos se puede calcular la edad del árbol.

Floema está formado por células vivas ubicadas en la parte externa del xilema, tienen
como función conducir el alimento (azúcares y proteínas) desde las hojas hacia el resto
de la planta.

Tejido de sostén como su nombre lo indica permite a la planta mantenerse erguida. Hay
dos tipos de tejido de sostén: colénquima y esclerénquima.

Colénquima
Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

Colénquima está formada por células vivas. Se encuentra en tallos y hojas de plantas
jovénes y herbáceas.

Esclerénquima está formado por células muertas. Se encuentra en plantas leñosas y


adultas, íntimamente relacionado con el parénquima.

Lección 17 Organos y sistemas de los Seres Vivos

Órgano: Es un conjunto de tejidos que realizan una o varias funciones específicas. Sin
embargo hay órganos que funcionan como parte de un grupo de órganos denominado
sistema.

Sistema: Es el conjunto de órganos homogéneos, relacionados entre sí, cada uno


desarrolla actividades específicas para cumplir con una función común

Aparato: Es el conjunto de órganos heterogéneos relacionados entre sí para que cumplir


una función común

Todos los sistemas, digestivo, circulatorio, respiratorio, excretor, nervioso, endocrino,


reproductivo, urinario, muscular y óseo interactúan para mantener en óptimo
funcionamiento el organismo y ninguno de ellos funcionaría aisladamente.

62
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
63

Por razones prácticas explicativas se analiza a continuación cada sistema.

Sistema digestivo del hombre

Todos los seres vivos, deben tomar del medio exterior los alimentos necesarios para
obtener la energía requerida para realizar sus funciones y mantenerse con vida. Para
poder utilizar los alimentos y convertirlos en energía el organismo realiza la función de la
nutrición.

Existen dos tipos de nutrición: autótrofa cuando los organismos producen su propio
alimento como en el caso de las plantas y heterótrofa cuando el organismo necesita
alimentarse de sustancias orgánicas ya elaboradas por las plantas o de otros
organismos heterótrofos. Estas sustancias reciben el nombre de nutrientes y el conjunto
de procesos que se llevan a cabo para obtenerlas y utilizarlas se llama nutrición.

La nutrición comprende siete procesos: ingestión, digestión, absorción, circulación,


respiración, asimilación y secreción.

La ingestión es la toma de alimentos del medio, la digestión consiste en transformar los


alimentos ingeridos en moléculas más pequeñas: los nutrientes, que pueden ser
fácilmente absorbidos y distribuidos por todo el organismo.

Podemos diferenciar dos tipos de digestion: la digestion mécanica, llevada a cabo por los
dientes y por los movimientos peristálticos, que son movimientos musculares
involuntarios que se originan para transportar el bolo alimenticio del esófago al
estómago, y la digestión química, que es llevada a cabo por las enzimas y los jugos
gastricos, que aceleran las reacciones químicas del metabolismo y transforman las
macromoleculas de los alimentos en moleculas más simples.

El proceso de nutrición se realiza a través de los órganos que conforman el sistema


digestivo. El sistema digestivo esta formado por un tubo largo y musculoso que comienza
en la boca y termina en el ano.

63
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
64

Representación de la boca
Fuente: Diseño Carmen Eugenia Piña L.

Representación del sistema digestivo


Fuente: Diseño Carmen Eugenia Piña L.

Representación de los esfínteres cardias y piloro


Fuente: Diseño Carmen Eugenia Piña L.

64
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
65

Tabla Estructura y función del sistema digestivo de los mamíferos

Órgano Función
Aprehensión e ingestión del alimento, mezcla con la
Boca compuesta de:
saliva y trituración física de los alimentos,
labios, cavidad bucal,
desdoblamiento parcial de carbohidratos por acción de la
lengua, dientes,
enzima amilasa salival, formación y deglución del bolo
glándulas salivares
alimenticio hacia la faringe.
Órgano común para los sistemas digestivo y respiratorio
Comunicación de la cavidad bucal con el esófago durante
Faringe
la deglución con mecanismos de oclusión de los orificios
que comunican con el sistema respiratorio.
Transporte del bolo alimenticio del esófago al estómago a
Esófago través del cardias (primer esfínter que los comunica)
mediante movimientos peristálticos.
Mezcla del bolo alimenticio con la enzima pepsina y con
el ácido clorhídrico este último cumple acción bactericida
y proporciona el pH ácido adecuado para acción de la
Estómago
pepsina sobre las proteínas para convertirlas en
peptonas (digestión), formación del quimo y paso de éste
a través del píloro (segundo esfínter) al intestino delgado.
Intestino delgado Mezcla del quimo con:
formado por tres
partes: • sales biliares provenientes del hígado,
• bicarbonato de sodio secretado por el páncreas
Duodeno, para neutralizar la acidez del quimo y proporcionar
el pH adecuado para la acción de las enzimas
yeyuno e pancreáticas e intestinales.
• jugo pancreático proveniente del páncreas y
íleon con sus • jugo intestinal (entérico).
microvellosidades
El jugo pancreático e intestinal contienen diferentes tipos
de enzimas que continúan con el proceso digestivo

El jugo entérico contiene la lipasa entérica, la amilasa


entérica y peptidasas, enzimas que continúan realizando
el proceso digestivo es decir, convirtiendo las
macromoléculas en moléculas de fácil absorción por las
vellosidades del intestino delgado.

El intestino delgado presenta tres tipos de movimientos:

65
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
66

* oscilatorios o pendulares que permiten la mezcla del


quimo con las enzimas de los jugos enterico y
pancreático y con la bilis.

* segmentarios dividen el quimo en fracciones más


pequeñas

* Peristálticos o evacuantes permiten que el quimo


avance de la parte anterior hacia la parte posterior. Hay
también movimientos antiperistálticos que devuelven el
quimo en sentido contario.

Todos estos movimientos tienen como finalidad favorecer


la digestíón y absorción de los nutrientes.

En las paredes del intestino se lleva a cabo la absorción


que es el paso de los nutrientes (azúcares simples,
ácidos grasos, glicerina, aminoácidos, y vitaminas; parte
del agua y algunas sales minerales), por difusión al
torrente sanguíneo y a la linfa para ser distribuidos por
todas las células y tejidos.
Intestino grueso Reabsorción de agua y minerales,
Formación de heces
formado por el colon y Almacenamiento de heces
el recto
Glándulas anexas
Hígado Productor de bilis
Páncreas Secreta bicarbonato de sodio y jugo pancreático. El jugo
pancreático contiene: la lipasa pancreática que actúa
desdoblando las grasas previamente emulsificadas por
las sales biliares almacenadas en la vesícula biliar, las
proteasas como el tripsinógeno que actúa sobre las
peptonas convirtiéndolas en péptidos y aminoácidos , la
amilasa pancreática que actúa sobre los azúcares
degradándolos a fructuosa, glucosa o galactosa.
Vesícula biliar Organo de almacenamiento de la bilis.

Animación Sistema digestivo

66
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
67

Lección 18. Sistema Circulatorio

Gráfica Representación del sistema circulatorio


Fuente: Diseño Carmen Eugenia Piña L

El sistema circulatorio comprende el corazón que hace las veces de bomba impelente y
el sistema vascular (arterias y venas) por donde circula la sangre

El sistema cardiovascular contiene la sangre y es el encargado de transportar nutrientes


y oxígeno a los tejidos y órganos y de recoger bióxido de carbono y sustancias de
desecho productos del metabolismo y llevarlas a los sistemas excretores. Este sistema
transportador de líquido conserva la homeostasia interna del organismo.

Tabla: Estructura y función del sistema circulatorio de los mamíferos

Estructura Función Complementación


a) Sangre con sus Respiración El 55% de la sangre es un
componentes: Vinculación con sistema líquido amarillo denominado
respiratorio plasma, el otro 45% son los
Es un tejido formado por una Defensa, componentes celulares
parte sólida: las células Nutrición, vinculación
sanguíneas de tres tipos: con sistema digestivo. En el plasma se encuentran
Eritrocitos o glóbulos rojos, Excreción de proteinas como la albumina cuya
leucocitos o glóbulos blancos, productos del función es mantener la presión
y las plaquetas y por una metabolismo a órganos ósmotica de la samgre; el
parte líquida el plasma. de excreción fribrinógeno y la protrombina que
vinculación con participan en la coagulación de
sistemas excretores la sangre y algunas globulinas
Regulación de pH que defienden el organismo de

67
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
68

Regulación de presión agentes extraños.


osmótica
Transporte de La cantidad de sangre que
hormonas vinculación circula por el cuerpo es
con sistema endocrino aproximadamente 1/12 del peso
Regulación de presión coprporal
sanguínea.
Ejemplo, en un adulto de
aproximadamente 60 kilos de
peso circulan 5 litros de sangre
Eritrocitos o glóbulos rojos *Transporte de oxígeno * Su forma es biconcava los que
y nutrientes a todos los les proporciona una mayor
tejidos del organismo. superficie de intercambio de
oxígeno por dióxido de carbono
*Recoger bióxido de en los tejidos.
carbono y sustancias
de desecho * Contienen la hemoglobina una
proteina que contiene hierro y
les da la coloración roja y es la
encargada de recoger el oxígeno
de los pulmones donde se
encuentra en alta concentración
Fuente: Carmen Eugenia Piña para luego liberarlo en los
tejidos.

* Carecen de núcleo en el
torrente sanguíneo. Constituyen
el 40-45 % de la sangre

* En el hombre la cantidad varía


entre 5 a 5,5 y en la mujer 4,5 a
5 millones por cc3 de sangre
Leucocitos o glóbulos Defender el organismo El número de leucocitos es
blancos de infecciones mucho menor que el de
ocasionadas por la eritrocitos
entrada de
microorganismos Su cantidad varía entre 4.600 a
patógenos, alergenos, 6.000 por cc3 de sangre
mediante el proceso de
fagocitosis Son de cinco tipos:

Eosinófilos, Basófilos,
Neutrófilos con gránulos en el

68
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
69

citoplasma y con un solo núcleo


lóbulado por lo que se les
denomina polinucleados;
Linfocitos y Monocitos carecen
de gránulos en sus citoplasma
poseen un núcleo único no
lóbulados.

Fuente: Carmen Eugenia Piña


Plaquetas Intervienen en la * Son fragmentos celulares, su
coagulación de la número esta comprendido entre
sangre 200.000 a 300.000 po rcc3 de
sangre

Fuente: Carmen Eugenia Piña

Corazón

Gráfica Representación del corazón


Fuente: Diseño Carmen Eugenia Piña L

69
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
70

Estructura Función Complementación


b) Corazón: un órgano Bombear la sangre a todo el El ventrículo izquierdo
muscular hueco cuerpo. es más grande que el
(miocardio) con cuatro derecho pues es el que
cavidades: dos superiores El corazón funciona bombea la sangre a todo
las aurículas y dos ritmicamente para impulsar el cuerpo, mientras que
inferiores los ventrículos la sangre a todo el cuerpo el derecho sólo bombea
cuenta además con dos durante la fase de la sangre a los
válvulas: la tricúspide que contracción o sistole y para pulmones.
comunica la aurícula su llenado en la fase de
derecha con el ventrículo relajación o diástole La función de las
derecho y la bicúspide que válvulas es impedir el
comunica la aurícula retroceso de la sangre
izquierda con el ventrículo
izquierdo El corazón expulsa 5
litros de sangre por
minuto

Principales Venas y Arterias

Gráfica Representación de los principales vasos del corazón


Fuente: Diseño Carmen Eugenia Piña L

70
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
71

Estructura Función Complementación


c) Sistema vascular Conducir sangre a los
formado por : tejidos
Arterias Son tubos muy Transportar la sangre Parten del corazón hacia
gruesos y elásticos; oxigenada que sale del los órganos y tejidos del
disminuyen su calibre a corazón. La única organismo. Las
medida que se alejan del arteria que conduce principales son: la aorta
corazón, dando lugar a sangre pobre en que sale del ventrículo
arteriolas, y luego a capilares. oxígeno y rica en izquierdo emitiendo
Su luz es menor que la de las bióxido de carbono es ramas hacia todo el
venas. la pulmonar. organismo y las
pulmonares que salen
del ventrículo derecho
hacia los pulmones.
Venas Son tubos de mayor Conductora, retorna la Las principales son: la
diámetro que las arterias, sangre desoxigenada vena cava inferior y la
menos elásticas y la mayoría al corazón. Las únicas vena cava superior que
poseen válvulas que impiden venas que transportan traen sangre a la
el retroceso de la sangre. sangre oxigenada son aurícula derecha del
Comienzan con vasos las pulmonares. corazón y las venas
pequeños (capilares) y van Comienza con vasos pulmonares que
aumentando su tamaño en pequeños y va transportan sangre de
sentido de la circulación hasta aumentando su los pulmones al
formar grandes vasos. tamaño en sentido de corazón..
Acompañan a las arterias en la circulación
su recorrido hasta
desembocar en la aurícula
derecha del corazón.
Capilares Son vasos de Intercambio de
calibre muy fino distribuidos sustancias en los
en todos los órganos del tejidos
cuerpo. Aportan nutrientes
Recogen desechos

Circulación sanguínea

La circulación es un circuito cerrado, se inicia en el corazón y termina en el corazón. La


circulación se divide en circulación menor de corazón a pulmones y circulación mayor de
corazón a todos los tejidos y retorno al corazón.

71
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
72

Funcionamiento del corazón

1. La sangre rica en 2. La aurícula derecha se 3. Luego el ventrículo derecho se


bióxido de carbono contrae (sístole), se abre la contrae, la válvula tricúspide se
y pobre en oxígeno válvula tricúspide y la sangre cierra, se abre la válvula pulmonar
procedente de todo desciende al ventrículo y la sangre va por la arteria
el cuerpo derecho. pulmonar (que se ramifica en dos
(circulación ramas derecha e izquierda) hacia el
general) llega a la pulmón correspondiente donde es
aurícula derecha oxigenada.
por las venas cava
superior e inferior.

4. En los capilares de los pulmones el bióxido de carbono es cambiado por el oxígeno


del aire alveolar. (Circulación menor o pulmonar). La sangre oxigenada circula por
vasos cada vez mayores que se reúnen en las venas pulmonares.

72
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
73

6. El ventrículo izquierdo se Animación sobre el ciclo cardiaco


contrae y a través de la
arteria aorta y sus http://www-
ramificaciones envía la medlib.med.utah.edu/kw/
sangre oxigenada a todas pharm/ hyper_heart1.html
las células y tejidos.
http://www.guidant.es/
Complementación Patient/ Heart-BV-
5. Luego la sangre
Basics/heart_intro.aspx
rica en oxígeno por
El mecanismo de
las venas
contracción del corazón es Contiene aspectos básicos
pulmonares (las
el siguiente: primero se teóricos, imágenes y animaciones
únicas venas que
contraen las dos aurículas y sobre el corazón, la circulación,
transportan sangre
de forma sincrónica, es decir enfermedades
oxigenada) regresa
al mismo tiempo , período
a la aurícula
llamado Sístole Auricular, http://www.nlm.nih.gov/medlineplus/
izquierda del
luego se contraen los dos spanish/tutorials/
corazón. Esta
ventrículos igualmente de
aurícula se contrae
manera sincrónica (Sístole echocardiogramspanish/
y la sangre pasa a
Ventricular), y después, el ct1791s1.html
través de la válvula
corazón completo tiene una
bicúspide al
relajación (Diástole o reposo
ventrículo
general), hasta que se
izquierdo.
produce la nueva Sístole
Auricular.

El funcionamiento del
corazón es autónomoo
involuntario, regido por el
sistema nervioso autónomo
o vegetativo
Gráficas: Representación del funcionamiento del corazón
Fuente: Diseño Carmen Eugenia Piña L

73
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
74

Circulación portal

Gráfica Representación del funcionamiento del corazón


Fuente: Diseño Carmen Eugenia Piña L

Los nutrientes que el organismo requiere pasan a través de las vellosidades del intestino
delgado (segmento duodenal) a la vena porta que los transporta hasta el hígado donde
éste los detoxifica y envía por la vena hepática al torrente sanguíneo.

Coagulación sanguínea

Adaptado de: http://www.canal-h.net/webs/sgonzalez002/Fisiologia/HEMOSTAS.htm

HEMOSTASIS es el conjunto de mecanismos con los que se controla la pérdida de


sangre del organismo. Estos mecanismos se desencadenan cuando hay un traumatismo
o cuando hay pequeñas lesiones de forma espontánea en el organismo. Son
fundamentales para la vida. Si se eliminan estos mecanismos, se ocasiona la muerte en
pocas horas.

MECANISMO DE LA HEMOSTASIS Estos mecanismos están interrelacionados entre


ellos. Además, existe un tiempo determinado para cada uno e ellos. Siguen un orden
preestablecido.

Vasoconstricción: Cuando hay un traumatismo o una pequeña lesión, se produce una


vasoconstricción de forma natural o por reflejos, estimulación de las terminaciones
simpáticas que inervan la pared vascular. El objetivo es producir una contracción para
que haya una disminución del flujo de sangre. l endotelio de los vasos sanguíneos
segrega factores relajantes derivados del endotelio, que si está intacto, mantiene la
estructura relajada. Cuando hay un traumatismo, desaparecen estos factores relajantes y
se produce una contracción. Estos factores relajantes derivados del endotelio son el
óxido nítrico (NO). A nivel vascular, el NO mantiene relajado ciertas estructuras

74
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
75

vasculares. Cuando hay un traumatismo leve las plaquetas se adhieren o agregan entre
sí y liberan tromboxano A2 que produce una potente vasoconstricción.

Formación del tapón plaquetario: las plaquetas, con forma más o menos redonda,
cuando se encuentran en la sangre, tienen unos receptores en su membrana, de forma
que, cuando detectan que en un vaso falta el endotelio y aparece el colágeno, las
plaquetas forman la adhesión plaquetaria. Los receptores de la membrana de las
plaquetas son receptores para residuos de aminoácidos del colágeno, de manera que
hacen que las plaquetas se anclen contra el colágeno y se comience la adhesión
plaquetaria (plaquetas adheridas al colágeno y que se vuelven mucho más planas).

A nivel de la célula, se produce el incremento de calcio entre el reconocimiento entre


colágeno y receptor. Cuando se incrementa el nivel de Ca2+ a nivel de la plaqueta, se
produce la liberación de sustancias (tromboxanos A2 que producen vasoconstricción;
ADP que favorece la adhesión de las plaquetas; es un feed-back negativo; los
tromboxanos A2 también favorecen la adhesión plaquetaria; factor de crecimiento
plaquetario que induce la mitosis en las células endoteliales; factor plaquetario 3, que
sirve para favorecer la coagulación sanguínea.)

La mitosis de las células endoteliales es el primer mecanismo de reparación. Las


plaquetas se unen sólo en la zona lesionada, porque en la zona sana hay
prostaglandinas I2 que son fuertemente antiagregantes.

Coagulación sanguínea La coagulación es la modificación del estado físico de la


sangre, que pasa de un estado líquido a otro de gel. Esta transformación se debe a que
el fibrinógeno (proteína plasmática) se transforma en una red de fibrina, que refuerza el
trombo plaquetario o tapón hemostático, para interrumpir de forma definitiva la
hemorragia.

Mecanismo de coagulación Este proceso necesita una serie de reacciones en varias


proteínas plasmáticas, para transformarlas de un estado inactivo a otro activo, que a su
vez, ayudará a que otra reacción del mismo tipo se dé con otra proteína.

Estas proteínas plasmáticas se denominan "Factores de coagulación", de los cuales hay


12 que se denominan con números romanos, más otros factores que no tienen asignado
numeral y que son los factores contacto.

Los factores de coagulación

Son un grupo de proteínas responsables de activar el proceso de coagulación. Hay


identificados 13 factores ( I, II, ..., XIII).
Factor I (fibrinógeno)
Factor II (protrombina)
Factor III (factor tisular)

75
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
76

Factor IV (calcio)
Factor V (giobulina aceleradora)
Factor VII (proconvertina)
Factor VIII (factor antihemofílico)
Factor IX (componente de tromboplastina en plasma)
Factor X (factor de Stuart)
Factor XI (antecedente de tromboplastina en plasma)
Factor XII (factor de Hageman)
Factor XIII (factor estabilizador de la fibrina

Vía Extrínseca de coagulación La vía extrínseca se inicia cuando la sangre hace


contacto con el tejido lesionado, que a su vez libera la tromboplastina tisular, que en
presencia del factor VII y de iones de calcio, actúan sobre el factor X para formar factor X
activado. El factor X activado, y en presencia de iones de calcio, libera el activador de la
protrombina que favorece el paso de la protrombina (proteína del plasma que se produce
en le hígado en presencia de vitamina K) en trombina (enzima de acción proteolítica), la
cual a su vez actúa sobre las moléculas de fibrinógeno (otra proteína presente en el
plasma sanguíneo y producida en el hígado) para formar monómeros de fibrina que al
unirse entre ellas se polimerizan en largos hilos de fibrina que forman el retículo del
coágulo. Para que el coágulo no se desintegre las plaquetas liberan el factor
estabilizador de la fibrina.

La Vía intrínseca de coagulación Comienza con la activación del factor XII producida
por el contacto con una superficie lesionada, esto es, sin endotelio.
Esta activación, que requiere de enzimas, activa al factor XI, y éste activado activa a su
vez al factor IX. El factor IX activado, junto con el factor VII activado, calcio,
tromboplastina y otras sustancias, entre las que está el factor VIII, activan al factor X,
punto de encuentro de la vía común.

En la vía común, los factores X y V activados, en presencia de calcio y fosfolípidos


plaquetarios trasforman la protombina en trombina, que hace que el fibrinógeno pase a
ser fibrina, que es estabilizada con el factor XIII. En todas las reacciones de la cascada
de la coagulación hay además otras sustancias que activan o inhiben las reacciones. El
aumento o el déficit de los factores de la cascada, de las plaquetas o de los múltiples
activadores o inhibidores de la coagulación pueden crear serios problemas, como
pueden ser el que nuestro organismo no pueda responder favorablemente a las lesiones
que sufren nuestros vasos, y podamos morir desangrados, siendo otro problema todo lo
contrario, esto es, que el organismo cree trombos plaquetarios que obstruyen los vasos y
que a su vez puedan desprenderse y causar obstrucciones a distancia.

Cascada de coagulación. Secuencia de reacciones que involucran varias proteínas


conocidas como factores de coagulación. Los factores de coagulación actúan en

76
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
77

cascada, es decir, uno activa al siguiente; si se es deficitario de un factor, no se produce


la coagulación o se retrasa mucho.

Sistema Linfático

El sistema linfático es una red microscópica de capilares que se encuentran por todos los
tejidos, transcurriendo entre los vasos arteriales y venosos. Su función es mantener el
equilibrio entre los líquidos, devolviendo el exceso de líquido intersticial
(aproximadamente unos 3 litros) a la circulación general.

Está formado por:

• la linfa que es un líquido claro de composición parecida a la sangre contiene


glóbulos blancos; su función es transportar los lípidos digeridos desde las
vellosidades del intestino delgado hacia el torrente sanguíneo.

• los vasos linfáticos o conductos por donde circula la linfa, los capilares linfáticos.

• los ganglios linfáticos que son pequeñas estructuras en forma de riñón con gran
cantidad de glóbulos blancos cuya función es filtrar la linfa , destruir y eliminar de
ella las sustancias tóxicas y los microorganismos infecciosos antes de su
circulación por el torrente sanguíneo.

Lección 19

Sistema Respiratorio del hombre

La respiración implica un intercambio de gases con el medio ambiente. Durante la


respiración se realiza el transporte de oxígeno de la atmósfera a las células y a la inversa
transporte de bióxido de carbono de las células a la atmósfera. Para realizar esta función
el organismo cuenta con los pulmones y con unos conductos por los que circula el aire
inspirado y expirado.

77
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
78

Gráfica: Aparato Respiratorio


Modificado de http://www.emc.maricopa.edu/faculty/
farabee/BIOBK/humrespsys_1.gif

Los conductos o pasos del aire son:

• Las ventanas o fosas nasales por donde penetra el aire inspirado.

• La cavidad nasal cuya función es filtrar, humedecer y calentar el aire inspirado.


Para este fin su mucosa cuenta con una gran cantidad de vasos sanguíneos.

• La faringe permite el paso del aire a la laringe.

• La laringe su función es regular el paso del aire en la respiración, impedir la


entrada de cuerpos extraños a la tráquea y es el órgano principal de la fonación o
de los sonidos.

• La tráquea es un tubo formado por anillos cartilaginosos que se bifurcan en


bronquios. En su interior la tráquea y los bronquios cuentan con una serie de cilios
que le permiten realizar su función de llevar secreciones o cuerpos extraños a la
cavidad bucal impidiendo su entrada a los pulmones.

• Los bronquios se ramifican en bronquíolos de diámetro más reducido. Los


bronquíolos terminan en pequeños saquitos denominados alvéolos los cuales se
encuentran rodeados de capilares sanguíneos.

• Los pulmones se encuentran dentro de la caja torácica su interior está formado


por un tejido esponjoso. Los pulmones son los órganos terminales donde se
efectúa el intercambio gaseoso.

78
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
79

• El diafragma y la caja torácica también se incluyen en las estructuras que toman


parte de la respiración.

Mecanismos de la Respiración

La respiración se realiza con dos mecanismos básicos de expansión y contracción de los


pulmones por acción de:

• El diafragma que se contrae moviéndose hacia arriba acortando la caja torácica o


se relaja desplazándose hacia abajo alargando la caja torácica.

• Las costillas que aumentan o disminuyen el diámetro de la caja torácica.

Durante la inspiración el diafragma se contrae, la caja torácica se eleva , su diámetro


aumenta, los pulmones se distienden y el aire entra a los alvéolos.

Animación sobre inspiración expiración:


http://www.juntadeandalucia.es/averroes/recursos_informaticos/concurso99/002/respira.h
tm

Intercambio de gases en los pulmones

Gráfica: Representación del alvéolo pulmonar rodeado de capilares


Fuente: Diseño Carmen Eugenia Piña L

Debido a la diferencia de concentración de gases entre el exterior y el interior de los


alvéolos, el oxígeno del aire pasa por difusión de los alvéolos a los capilares sanguíneos
que rodean a los alvéolos, luego el oxígeno penetra en los glóbulos rojos o hematíes
para ser transportado con el torrente sanguíneo a todas las células y tejidos.

79
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
80

Gráfica: Representación del intercambio de gases en el alvéolo pulmonar


Fuente: Diseño Carmen Eugenia Piña L

El bióxido de carbono se traslada en sentido opuesto desde los tejidos a los capilares y
de ahí a los alvéolos.

El mecanismo de la respiración es un acto reflejo casi por entero.

Animación del proceso respiratorio

Sistema excretor del hombre

La excreción tiene como función mantener constante el volumen de los líquidos


corporales, la concentración de los electrólitos y el equilibrio ácido - básico
independientemente de las variaciones en la ingesta. La homeostasis de los líquidos
corporales se conserva sobre todo por la acción de los riñones y está controlada por
diversos mecanismos fisiológicos todos ellos interrelacionados.

El sistema excretor en los mamiferos está formado por:

80
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
81

Gráfica Representación del sistema renal


Fuente: Diseño Carmen Eugenia Piña L

Estructura Función
Dos riñones formados por millares de nefronas
Producir la orina que es un
que son la unidad estructural y funcional del
producto de desecho tóxico
riñón
Conducir la orina del riñón a
Dos Uréteres o tubos
la vejiga.
La Vejiga urinaria Almacenar la orina.
Excretar la orina de la vejiga
La Uretra
al exterior

Funciones del Sistema Renal

• Filtración de la sangre y eliminación de sustancias de desecho resultantes del


metabolismo celular. La sangre oxigenada le lleva al riñón nutrientes y oxígeno y
la desoxigenada le trae del hígado la urea que se elimina con la orina.
• Controlar el equilibrio hídrico a través de la orina.
• Controlar el equilibrio electrolítico (sodio, potasio, calcio, fósforo, cloro entre
otros).
• Controlar el equilibrio ácido – básico ( pH) Controlar la presión arterial por medio
de la hormona renina que tiene acción hipertensora.

La Nefrona

Gráfica No 30 La Nefrona
Tomada de http://iris.cnice.mecd.es/biosfera/profesor/galeria_imagenes/images/circul6-6.jpg

81
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
82

La nefrona esta formada por un paquete o red capilar que recibe el nombre de
glomérulo, envuelve a este sistema glomerular una cápsula de Bowman. La unión
funcional entre la cápsula de Bowman y el glomérulo recibe el nombre de tubo de
Malpighi y es el lugar donde ocurre la primera filtración del plasma sanguíneo que
contiene sustancias de desecho, además de sustancias como glucosa, sales minerales y
agua que aún son útiles al organismo. En la cápsula de Bowman se forma la orina
primaria. La cápsula de Bowman se continúa con un tubo renal contorneado proximal, de
él se origina el asa de Henle. Esta asa se continúa con otros tubos contorneados
distales. En los túbulos contorneados ocurre el segundo filtrado con la consecuente
resorción de agua, glucosa y sales al torrente sanguíneo y secreción de sustancias de
desecho. Los tubos contorneados distales van drenando a túbulos colectores para
formar los cálices los cuales drenan en la pelvis renal. Los túbulos colectores reciben la
orina formada en las nefronas. La pelvis renal comunica con los uréteres que llegan a la
vejiga.

Sistema Reproductor

Los seres vivos tienen capacidad de dar origen a otros seres vivos. En los seres
eucarióticos pluricelulares la reproducción implica la participación de gametos o células
sexuales masculina y femenina las cuales se fusionan para originar un cigoto. Los
órganos del aparato reproductivo masculino y femenino son los encargados de la
producción de gametos

Aparato reproductor masculino del hombre

Gráfica Aparato Reproductor masculino


Tomado de http://www.arrakis.es/~lluengo/reproduccion.html

82
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
83

Tabla Estructura y función del sistema reproductor masculino

Órgano Función
Producción de espermatozoides o células
sexuales masculinas
Producción de la hormona testosterona que
determina los caracteres masculinos.
El escroto mantiene la temperatura adecuada
Testículos contenidos en el escroto para los espermatozoides (unos tres grados
por debajo de la temperatura del cuerpo)
El parénquima testicular está formado por
lóbulos donde se encuentran los túbulos
seminiferos lugar donde se forman los
espermatozoides.
Epidídimo Almacenamiento y maduración de los
Conducto alargado y flexuoso, adherido espermatozoides y conducción de los
al testiculo espermatozoides hacia los conductos
deferentes
Conductos eferentes Transportar los espermatozoides desde los
tubos semíniferos hasta el epididimo
Conductos deferentes Almacenamiento de los espermatozoides
hasta el momento de la eyaculación
Glándulas accesorias
Producción de líquido viscoso denominado
* Vesículas seminales semen, que se mezcla con los
espermatozoides y sirve para transpórtalos.
Secreción de líquido lechoso que da olor
* Próstata
característico al semen
* Glándulas de Cooper Secreción de líquido que mantiene lubricada
la uretra y el pene
Pene Órgano copulador

83
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
84

Aparato Reproductor Femenino de mamíferos

Gráfica Aparato reproductor femenino


Tomado de: http://www.arrakis.es/~lluengo/reproduccion.html

Tabla Estructura y función del sistema reproductor femenino de mamíferos

Órgano Función
Dos ovarios Formación del los óvulos o células sexuales femeninas

Producción de estrógenos hormonas que dan los


caracteres sexuales femeninos
Dos trompas de Estos conductos comunican con el útero a donde
Falopio transportan los óvulos. En el primer tercio de las trompas
ocurre la fecundación
Útero Recibir el óvulo fecundado, albergar y alimentar el embrión.
En el caso de no haber fecundación su mucosa interna
llamada endometrio se desprende produciendo la
menstruación.
Durante el parto se contrae para expulsar el feto.
Cuello uterino Comunica la vagina con el útero
Recibir el líquido seminal con los espermatozoides.
Vagina Expulsa el feto durante el parto
Órganos
genitales
externos:
Vulva constituida por los labios mayores y menores
Clítoris órgano de excitación

84
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
85

Fecundación

Consiste en la fusión de los núcleos de los gametos o células sexuales masculina y


femenina, es decir la unión del óvulo y del espermatozoide para formar el cigoto. La
fecundación ocurre en las trompas de Falopio y a medida que el cigoto desciende por las
trompas hacia el útero tienen lugar las divisiones celulares que dan comienzo al proceso
embrionario o formación del embrión.

Lección 20.

Sistema Nervioso

El sistema nervioso coordina y preside el funcionamiento de todos los órganos y


sistemas de los seres vivos. La función final del sistema nervioso es la conducta. El
sistema nervioso percibe estímulos e informa sobre lo que ocurre en el entorno para que
los comportamientos o conductas logren adaptarse y de esta amaner actuar de manera
útil.

Fisiológicamente el sistema nervioso se divide en sistema nervioso central, voluntario y


sistema nervioso autónomo o involuntario.

Las funciones del sistema nervioso central son:

• Poner en relación al organismo con el medio exterior en que vive.

• Recibir información, coordinar y producir respuestas conscientes - función


sensitiva.

• Producir movimientos musculares - función motora.

• Proporcionar integridad al organismo - función integradora.

Las funciones del sistema nervioso autónomo son:

• Inervar vísceras de los aparatos: respiratorio, circulatorio, digestivo, urinario,


glandular, reproductor.

• Coordinar las funciones de todos los sistemas.

• Mantener la homeostasis.

• Presidir la vida interior

85
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
86

Gráfica Sistema Nervioso Central


Tomado de: http://personales.ya.com/erfac/snc.gif

Gráfica Encéfalo
Fuente: Diseño Carmen Eugenia Piña L

86
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
87

Tabla: Estructura y función del Sistema Nervioso Central

El sistema nervioso central está formado por:

Órgano Función
Encéfalo que
comprende:
Órgano que permite utilizar todos los sentidos, en él se
encuentran los centros del lenguaje de la escritura, de
las imágenes auditivas, de la olfación, tacto, dolor,
Cerebro
gusto, las zonas motoras; en el cerebro es donde todas
las emociones toman forma: los pensamientos, la
actividad imaginativa y el recuerdo.
Cerebelo con el Interviene en el mantenimiento de la posición y el
Hipotálamo equilibrio del cuerpo, coordina los movimientos,
mantiene el tono muscular.

El hipotálamo controla todas las funciones vegetativas o


internas del cuerpo como: presión arterial, actividad
sexual, equilibrio de líquidos corporales, alimentación,
actividad digestiva, secreción de glándulas endocrinas,
regulación de la temperatura, reacciones de defensa.
Médula oblonga o Tiene el control de las funciones de los centros de la
Bulbo raquídeo respiración, cardiaco, vasoconstrictor , respiratorio y del
vómito
Médula espinal Conduce información desde los nervios periféricos que
vienen de
diferentes partes del cuerpo hacia el encéfalo o desde el
encéfalo al resto del cuerpo.
Las prolongaciones Transportan los impulsos al sistema nervioso central y
o nervios craneales llevan información al exterior.
y espinales. Son motores y sensitivos y vienen de los órganos de los
sentidos

Neurona

La neurona o célula nerviosa es la unidad estructural y funcional del sistema nervioso.


Su función es la trasmisión de información entre las diferentes partes del cuerpo. La
mayoría de neuronas se encuentran en el cérebro y en la médula espinal, otras se

87
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
88

encuentran el sistema nervioso periférico. En el hombre se encuentran entre cien y mil


billones de neuronas

Gráfica La Neurona
Tomado de: http://mensual.prensa.com/mensual/contenido/2002/03/03/hoy/revista/468858.html

La neurona consta de:

• Cuerpo con núcleo, citoplasma y organelos.


• Prolongaciones que son extensiones protoplasmáticas y son de dos tipos:
dendritas y axón.

Las dendritas son aferentes o sensitivas. Conectan una neurona con otra y conducen
impulsos de órganos (articulaciones, músculos, tendones, huesos etc.) hacia el cuerpo
de la célula nerviosa

El axón que es eferente o motor. Conduce impulsos del cuerpo de la célula nerviosa
hacia los botones terminales órganos o tejidos. En la terminación de los axones se
encuentran los botones terminales

Conducción dentro de la neurona

Cuando una neurona se encuentra en estado de reposo su interior tiene una carga
eléctrica ligeramente negativa con respecto al exterior. Esto ocurre porque dentro de la
célula hay una cantidad importante de iones negativos debido a que la bomba de sodio
impulsa hacia afuera de la fibra nerviosa los iones de NA+. Esta carga se denomina
potencial de reposo.

88
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
89

Cuando se estimula una neurona la permeabilidad de la membrana cambia permitiendo


la entrada de iones positivos de Na+ al interior de la célula, desapareciendo el potencial
de reposo y generando un potencial de acción que viaja a lo largo de la neurona hasta
los botones terminales.

Cuando el potencial de acción llega a los botones terminales se liberan sustancias


químicas o neurotrasmisores al espacio potsináptico (espacio entre la unión de dos
neuronas) . Estos cambios en el potencial de membrana duran una pequeña fracción de
segundos, seguidos inmediatamente al estado de reposo. El establecimiento del estado
de reposo depende casi totalmente de la salida por difusión de iones de K+ al exterior.

Receptores Sensoriales

En el ser humano y animales superiores los estímulos del exterior son captados a través
de receptores sensoriales u órganos de los sentidos. Los órganos de los sentidos son
cinco: vista, oído, olfato gusto y tacto. El sistema sensorial está formado por un receptor,
una neurona aferente sensitiva y el centro sensitivo en la corteza cerebral.

Para que haya percepción y respuesta motora de un estímulo se requiere de un receptor,


una neurona aferente, un centro coordinador y decodificador de la información, una
neurona eferente o motor

Sistema Sensorial

Adaptado de: http://www.uc.cl/sw_educ/neurociencias/html/frame04.html

Los sistemas sensoriales son conjuntos de órganos (órganos de los sentidos) altamente
especializados que permiten a los organismos captar una amplia gama de señales
provenientes del medio ambiente. Ello es fundamental para que dichos organismos
puedan adaptarse a ese medio. Pero, para los organismos es igualmente fundamental

89
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
90

recoger información desde su medio interno con lo cual logran regular eficazmente su
homeostasis. Para estos fines existen sistemas de detectores con una organización
morfofuncional diferente y que podemos llamar receptores sensitivos.

Los receptores están ligados a sistemas sensoriales/sensitivos capaces de transformar


la energía de los estímulos en lenguaje de información que manejan los organismos
(señales químicas, potenciales locales y propagados). Es decir, son capaces de
transducir información. En cada sistema sensorial o sensitivo es fundamental la célula
receptora. Es ella la célula transductora, es decir, la que es capaz de traducir la energía
del estímulo en señales reconocibles y manejables (procesamiento de la información)
por el organismo. Esas señales son transportadas por vías nerviosas específicas (haces
de axones) para cada modalidad sensorial hasta los centros nerviosos. En estos, la
llegada de esa información provoca la sensación y su posterior análisis, por esos centros
nerviosos, llevará a la percepción. La sensación y la percepción son entonces, procesos
íntimamente ligados a la función de los receptores

Los receptores sensoriales son células, especialmente nerviosas, altamente


especializadas, encargadas de reconocer y convertir en forma específica diferentes
formas de energía presentes en el medio ambiente o en el medio interno de un
organismo en señales bioeléctricas que son transportados a centros nerviosos
específicos. Según el tipo de estímulo que excita las células sensoriales, se pueden
clasificar los receptores en grandes grupos: mecánicos , químicos , térmicos Y luminosos

Complementación: En el siguiente link


http://bibi.avila.googlepages.com/receptoressensorialeshumanos encuentra una
descripción muy didáctica de los Receptores sensoriales humanos. Complementación
realizada por la tutora Bibiana Avila. Se recomienda aprovechar este material.

Organo de la Visión

El sentido de la vista se sitúa en los ojos. En los animales superiores es par, ubicado en
el interior de los huesos de la cara, en las cavidades orbitarias que presenta la parte
anterior de la cabeza. Está constituido por el globo ocular y otros órganos anexos.
Básicamente es una cámara cerrada con la parte anterior transparente para permitir la
entrada de la luz, y una zona interna sensible donde convergen los rayos luminosos para
formar la imagen.

El globo ocular está compuesto por tres membranas concéntricas cuya parte más
externa es la esclerótica o blanco del ojo, consistente en un tejido opaco, fibroso y duro,
salvo en su zona anterior que es transparente y convexa formando la córnea, y su zona
posterior que está perforada para dar salida al nervio óptico. La parte intermedia del
globo ocular, desde la esclerótica hasta la retina, es un tapizado muy vascularizado
llamado coroides, que finaliza por delante mediante un anillo multiciliar blanquecino
(anillo circular) en la unión entre la esclerótica y la córnea.

90
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
91

Tras la córnea se sitúa una cámara acuosa transparente (humor acuoso), en medio de la
cual se halla el iris; éste es un diafragma musculoso, contráctil y opaco, en cuyo centro
está la pupila o niña, la cual regula la cantidad de luz que penetra en el ojo variando su
diámetro, función que es llevada a cabo mediante la contracción o dilatación de sus
músculos circulares y radiales. Detrás del iris está el cristalino, un cuerpo lenticular,
transparente y biconvexo cuya misión es hacer converger los rayos luminosos de
manera que formen imágenes en la retina; la pérdida de transparencia del cristalino da
lugar a una enfermedad conocida vulgarmente como cataratas.

La capa más interna del globo ocular es la retina, constituida por diez capas
superpuestas que acoge variados elementos nerviosos y de sostén; sus células (conos,
bastoncillos, neuronas bipolares y multipolares) se prolongan y agrupan para constituir el
nervio óptico, el cual parte de un punto llamado ciego, debido a que en él no se produce
ninguna visión. Las células de la retina contienen una materia pigmentaria altamente
sensible a las impresiones luminosas que recibe, y que producen la sensación visual; la
zona de mayor agudeza visual es la posterior, llamada fóvea, mácula o mancha amarilla.
Los conos de la retina se relacionan con esa agudeza visual, mientras que los
bastoncillos tienen que ver con las condiciones de escasa iluminación. Todo el resto del
globo ocular está ocupado por el llamado humor o cuerpo vítreo

Órganos anexos

Los órganos anexos del globo ocular están constituidos por las glándulas lacrimales,
órbitas, cejas, párpados, pestañas y seis músculos. Las glándulas lacrimales se sitúan
en la parte más externa de la cavidad orbitaria, en su región antero-superior. Existen dos

91
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
92

por cada ojo: una principal o superior y otra accesoria o inferior, cada una de ellas
comunicada con el ángulo más externo del ojo y las fosas nasales mediante un conducto
lacrimal. Estas glándulas son las encargadas de segregar las lágrimas, un líquido
ligeramente alcalino, lubricante y limpiador de la superficie ocular

Los párpados, superior e inferior, son repliegues cutáneos movibles, unas láminas
fibrosas tapizadas exteriormente por la piel, e interiormente por mucosa y la conjuntiva,
una membrana transparente que recubre también la córnea. Los párpados poseen unas
glándulas que segregan grasa llamadas de Meibomio, en referencia al médico
anatomista alemán Heinrich Meibom (1638-1700) que las descubrió y estudió.

En el borde de los párpados se encuentran las pestañas, unos pelillos tamizadores de la


luz, que limpian el ojo y las ya citadas glándulas de Meibomio. También se encuentran
los seis músculos motores del ojo, los cuales permiten su movimiento y sujeción: los
cuatro rectos (interno, externo, superior e inferior), y dos oblicuos (pequeño y grande).
Los músculos del ojo se controlan por pares de nervios craneales (motor ocular común,
patético y motor ocular externo).

Mecanismo de la visión

La visión es un proceso fisiológico, resultado de varios fenómenos sucesivos, que nos


permite revelar la presencia de los cuerpos, con identificación de su forma, color y
dimensiones. En ese proceso intervienen el ojo y la zona de la corteza cerebral
encargada de interpretar las sensaciones luminosas que se proyectan sobre la retina de
aquél. La visión es pues una actividad que implica la necesidad de luz; sin ella no existe
visión.

El mecanismo de la visión se produce de forma similar al utilizado para obtener la


imagen en una cámara fotográfica. Así como en la cámara existe una película sensible a
la luz que se sitúa detrás del objetivo, en donde se materializa la impresión de la imagen
captada, en el ojo esa función la realiza la retina, donde las células receptoras son
estimuladas para después conducir los impulsos nerviosos que generan hacia el cerebro.

92
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
93

En la cámara se regula la cantidad de luz que penetra en el interior mediante un


diafragma mecánico; de manera homóloga. El ojo utiliza el iris como diafragma,
contrayendo o relajando los músculos que lo gobiernan. En ambos ejemplos, tanto la
imagen formada en la retina como en la película se proyecta invertida, es decir, si
visualizamos un árbol éste se proyecta con la copa hacia abajo y la base hacia arriba, sin
embargo, en el ojo humano esa característica es interpretada correctamente tras ser
enviada por el nervio óptico hasta el lóbulo de la corteza cerebral correspondiente. Por
su parte, la mayoría de cámaras permiten ajustar el enfoque del objeto que se desea
impresionar; en el ojo esa función la llevan a cabo los músculos ciliares del cristalino,
que acomodan el ojo para enfocar los objetos según la distancia a que se encuentren.

Oído

En los animales superiores el oído es el órgano sensorial de la audición, también acoge


otro sentido, el del equilibrio, que se encuentra en los canales semicirculares del oído
interno. Es par, y se halla situado a uno y otro lado de la cabeza.
Consta de tres partes: oído externo (oreja y conducto auditivo), oído medio (caja del
tímpano), y oído interno (laberinto).

El oído externo comprende el pabellón u oreja y el conducto auditivo. El pabellón


consiste en una lámina replegada e internamente cartilaginosa, cuya misión es conducir
las ondas sonoras hacia el conducto auditivo. Éste es un tubo de unos 3 cm. de longitud,
de cartílago al principioy óseo en su parte final, en la membrana del tímpano. Este
conducto acoge las glándulas sebáceas y ceruminosas segregadoras del cerumen.

El oído medio comienza en la caja del tímpano, una cavidad del hueso temporal que a
través de dos orificios o ventanas (la oval y la redonda) comunican con el oído interno
por su parte posterior. La faringe también se comunica con el oído a través de un orificio
existente en el canal de la trompa de Eustaquio, de esta forma la presión interior y

93
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
94

exterior quedan equilibradas.


En el oído medio se distingue una cadena de cuatro huesecillos movibles y conectados
entre sí, que se sitúan entre el tímpano y la ventana oval. Son el martillo, yunque,
lenticular y estribo. Su función es transmitir las ondas sonoras

El oído interno se sitúa detrás de la caja del tímpano. Comprende el laberinto, caracol o
coclea y canales semicirculares.

El Caracol o coclea consiste en una cavidad en la que reside el llamado órgano de


Corti, en alusión a su descubridor, el anatomista italiano Alfonso Corti (1822-1876). Es
un órgano arrollado en espiral, ósea en su parte externa y membranosa en la interna;
entre ambas partes se encuentra un líquido llamado perilinfa, y en el interior de la
membranosa se halla otro líquido llamado endolinfa. En el caracol residen las
terminaciones ciliadas de las células sensitivas del oído.

Laberinto está constituido por un conjunto de cavidades situadas en el interior del


peñasco del hueso temporal, por dentro de la caja del tímpano. Su parte externa es ósea
y en su interior se halla el laberinto membranoso formado por el utrículo (saco del que
parten los tres canales semicirculares) y sáculo (bolsa que comunica con el caracol).
Éstos y los canales contienen endolinfa, en ellos reside el sentido del equilibrio. Mediante
los movimientos de la endolinfa las células sensoriales de los canales envían impulsos al
cerebro, informando sobre la posición de la cabeza, permitiendo así mantener el
equilibrio. Cuando el nivel de la endolinfa se altera por cualquier motivo, se produce
entonces una pérdida de orientación dando lugar a mareos.

El Olfato es un sentido quimiorreceptor, como el del gusto, que se estimula mediante las
sustancias volátiles que se desprenden de los cuerpos, o las que se encuentran en
estado gaseoso, permitiendo así percibir los olores. Está constituido por el nervio
olfatorio y sus terminaciones nerviosas, las cuales se diseminan por la parte superior de
la mucosa pituitaria, que tapiza las fosas nasales. Los impulsos nerviosos se transmiten
a través de las terminaciones nerviosas hasta el bulbo raquídeo, y desde éste hacia la
corteza cerebral olfatoria. El sentido del olfato es fácilmente fatigable, ya que tras un
corto periodo de tiempo sometido a la percepción de un olor de nivel estable, éste deja
de percibirse por adaptación de los receptores olfatorios

El Gusto es un sentido quimiorreceptor, como el del olfato, que se localiza en la boca.


Las sensaciones del gusto son percibidas en aquellas sustancias líquidas o disueltas,
mediante receptores gustativos de tipo químico, los cuales se agrupan en los llamados
botones gustativos u olivas, que se sitúan en los laterales de las papilas linguales. Los
impulsos nerviosos de estas sensaciones son transmitidos por los nervios craneales
(lingual y glosofaríngeo) al bulbo raquídeo y a la corteza cerebral.

94
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
95

El Tacto se localiza en la piel. Se trata de una forma exteroceptiva de sensibilidad, que


permite detectar y localizar sobre la superficie cutánea el estímulo por diferencia de
presión que produce un objeto, e incluso determinar su textura. El tacto reside
fundamentalmente en las terminaciones nerviosas y corpúsculos táctiles, que se
localizan en la epidermis y en el espesor de la dermis. La abundancia de corpúsculos
táctiles se relacionan directamente con la mayor o menor agudeza táctil. El tacto también
permite transmitir sensaciones térmicas y dolorosas, pero a través de otros puntos
sensibles distintos y en localizaciones diferentes de los citados puntos táctiles.

Profundización sugerida para estudiantes de Psicología y Regencia en Farmacia:


Curso sobre estructura, desarrollo, funciones del sistema nervioso de la Pontificia
Universidad Católica de Chile

http://www.uc.cl/sw_educ/neurociencias/

Sistema Músculo Esquelético

El sistema músculo-esquelético tiene como función el movimiento de los animales y el


hombre. La estructura funcional del sistema esquelético está formada por los huesos los
cuales forman el sistema esquelético axial que comprende cráneo y caja torácica; y el
apendicular formado por las extremidades.Los huesos se unen a través de las
articulaciones, que son móviles e inmóviles. El sistema muscular recubre el sistema
esquelético, y está conformado por músculos estriados voluntarios. El sistema muscular
se caracteriza por la contractibilidad, la excitabilidad y elasticidad. La contracción
muscular está determinada por dos proteínas la actina y la miosina.

Profundización Curso sobre el sistema óseo de la Universidad Estatal de


California, Chico, sugerido para estudiantes de todos los programas

http://www1.universia.net/CatalogaXXI/pub/ir.asp?IdURL=84322&IDC=10010&IDP=ES&I
DI=1

Esta conformado por un conjunto de glándulas de secreción interna de hormonas, las


cuales son mensajeros químicos que producen efectos fisiológicos en el organismo,
como respuesta coordinada ante los mensajes del sistema nervioso. El sistema
endocrino tiene como función regular las actividades internas de los seres vivos a través
de sus relaciones con el sistema nervioso el cual ha tomado el nombre de sistema
neuroendocrino a través de un proceso de retroalimentación. La regulación del sistema
endocrino se hace a través de proteínas especializadas denominadas hormonas, las
cuales son producidas por glándulas específicas como la hipófisis, tiroides,
suprarrenales, páncreas y gónadas. Las hormonas regulan muchos procesos biológicos
como el crecimiento, metabolismo, reproducción y funcionamiento de los diferentes
órganos.

95
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
96

Canalización del efecto hormonal

Las hormonas se transportan por vía sanguínea y entregan su mensaje a determinados


conjuntos de células que tengan receptores químicos específicos en sus membranas.

Tipos de hormonas y su acción

La acción de las hormonas se ejerce mediante mecanismos bioquímicos, en


dependencia de su naturaleza específica, como se explica a continuación:

a) Hormonas esteroideas: Son mensajeros químicos de naturaleza lipídica apta para


atravesar las membranas celulares hasta localizar receptores proteicos en el citoplasma.
El efecto se desencadena en el núcleo celular al inducir la actividad de sínteis proteica
mediante la desinhibición de ciertos genes, que logran la transcripción de mensajes de
ARNm.

b) Hormonas proteicas: no atraviesan la membrana celular pero transmiten su mensaje


químico desde la superficie de dicha membrana mediante un receptor de AMPc que sí
llega al núcleo celular y activa enzimas desencadenantes de efectos metabólicos.

El ciclo de retroalimentación hormonal

La primera etapa de los procesos de retroalimentación hormonal comienza en el


hipotálamo, glándula que secreta neurohormonas que emigran a la hipófisis, donde
desencadenan la producción de hormonas trópicas (tireotropa, corticotropa,
gonadotropa), encargadas de llevar los mensajes a las diversas glándulas del organismo
para inducir la secreción de las hormonas de acción directa sobre el cuerpo, como son la
tiroxina, los corticosteroides y las hormonas sexuales, las cuales al alcanzar ciertos
niveles retroalimentan a la hipófisis y al hipotálamo para que cesen su acción estimulante
y equilibren su interacción con la glándula ya accionada.

Glándulas y funciones hormonales

En el siguiente cuadro se presenta un resumen de las diversas glándulas que conforman


el cuerpo humano, las hormonas que secretan y sus respectivas funciones:

96
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
97

Glándula Hormona que secreta Función


Trópicas: Estimulan a las glándulas
TSTH o tireotropa En la tiroides, controla la
secreción de tiroxina
Regula las hormonas
ACTH o adrenocorticotropa
suprarrenales.
FSH o folículo estimulante Induce secreción de
estrógenos en los ovarios y
maduración de
espermatozoides en los
Adenohipófisis testículos
(lóbulo anterior) Induce secreción de
progesterona por el cuerpo
LH o luteotropina
lúteo y de testosterona por los
testículos.
Actúan directamente sobre
Hipófisis No trópicas:
las células
Controla el crecimiento de
STH o somatotropina
huesos y cartílagos.
Induce la secreción de leche
PRL o prolactina
en las glándulas mamarias.
MSH o estimulante de los Induce la síntesis de
Lóbulo medio
melonóforos melanina.
Neurohipófisis Oxitocina Estimula las contracciones
(lóbulo del útero en el parto y la
posterior) secreción láctea ante la
succión de la glándula
mamaria.
Estimula la reabsorción de
Vasopresina o ADH agua (antidiuresis) por las
nefronas.
Regula el metabolismo y el
Tiroxina
desarrollo.
Tiroides Induce la transferencia del
Calcitonina calcio de la sangre a los
huesos.
Induce la absorción intestinal
del calcio de la sangre
Paratiroides Parathormona
(acción contraria a la
calcitonina).

97
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
98

Induce la absorción de la
Insulina u hormona glucosa de la sangre en las
hipoglucemiante (en células del hígado y del tejido
células alfa) muscular, para su
Páncreas transformación en glucógeno.
(en los islotes de
Langerhans). Estimula la concentración de
Glucagón u hormona glucosa en la sangre por
hiperglucemiante (en descomposición del
células beta). glucógeno del hígado (acción
antagónica de la insulina).
Sus 3 capas segregan
En la corteza:
hormonas.
Mineralocorticoides: (en Formación de glúcidos y
parte más externa) grasas a partir de los
aldosterona aminoácidos. Incrementa
resistencia antiestrés.
Decrece linfocitos y
eosinófilos.
Glucocorticoides (en la Formación de glúcidos y
parte media): cortisona grasas a partir de los
aminoácidos. Incrementa
resistencia antiestrés.
Glándulas suprarrenales Decrece linfocitos y
eosinófilos.
Andrógenocorticoides (en Controla la aparición de
la parte más interna): caracteres sexuales la
hormonas masculinas y pubertad.
femeninas.
Influyen en el metabolismo de
En la médula:
los glúcidos.
Vasodilatación e incremento
Adrenalina
gasto cardiaco.
Vasoconstricción y
Noradrenalina
disminución gasto cardiaco.
Andrógenos: testosterona Producción espermatozoides
y caracteres masculinos
Gónadas Regulación menstrual y
Estrógenos
caracteres femeninos.
Progesterona Es la hormona del embarazo.

98
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
99

Ubicación de las glándulas del sistema endocrino humano

Gráfica Glándulas endocrinas


Fuente: Diseño Carmen Eugenia Piña L

Lección 21 ÓRGANOS DE LAS PLANTAS

Las plantas son organismos que contienen pigmento verde o clorofila, esencial para
realizar el proceso de fotosíntesis a partir del cual producen alimento y liberan energía,
mecanismo conocido como nutrición autótrofa.

Antes de referirse a los órganos de las plantas, es necesario conocer la diferenciación


entre plantas vasculares y no vasculares, aspecto que incide en las características de
algunos órganos de las mismas.

Las plantas no vasculares no poseen tejidos conductores, no poseen raíces verdaderas


en su lugar tiene rizoides a través de los cuales absorben agua y nutrientes del suelo, no
tienen tallos ni hojas verdaderas. Un ejemplo de estas plantas son los musgos de gran
importancia en la naturaleza por ser reservorios de agua y por contribuir en los procesos
de meteorización.

Las plantas vasculares tienen tejidos conductores, raíces, tallo y hojas verdaderas como
es el caso de los helechos. Algunas, las gimnospermas además poseen flores y semillas
desnudas, es decir, la semilla no se desarrolla dentro de un fruto, como es el caso de los

99
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
100

pinos, otras las angiospermas además poseen frutos. Las angiospermas se dividen en
monocotiledóneas y dicotiledóneas.

A continuación se resumirán las principales diferencias entre plantas monocotiledóneas y


plantas dicotiledóneas:

Tabla: Principales diferencias entre plantas monocotiledóneas y dicotiledóneas.

Monocotiledóneas Dicotiledóneas
Pertenecen a este grupo los pastos, los Pertenecen a este grupo el resto de
lirios, la caña, el maíz y las palmas plantas superiores
Tienen un solo cotiledón Poseen dos cotiledones

Tienen hojas estrechas, largas y con Tienen hojas anchas con nervadura
nervadura paralela ramificada

Su raíz es fibrosa, no posee raíz Poseen raíz principal y raíces


principal secundarias.

Organización externa de las plantas

Los órganos vegetativos

Son aquellos órganos de la planta que sirven para mantener la vida individual de la
planta y son: raíz, tallo y hoja.

100
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
101

La raíz

Fuente: Material gráfico cedido po-la A.C. Nitella Flexilis publicado en url www.sobrado-es.com

La principal función de la raíz es la absorción del agua y sales minerales del suelo y la
fijación de la planta al mismo sustrato. Además contribuye a evitar la erosión al mantener
aglutinadas sus partículas.

Las partes de la raíz son la cofia que se encuentra en la punta de la raíz cubriendo el
ápice, sus células efectúan la absorción de nutrientes, por encima de la cofia se
encuentra una zona en donde las células están en constante reproducción, es la zona de
crecimiento apical o meristemático inmediatamente después se halla la región de
alargamiento.

A continuación se encuentra la zona de maduración en donde las células alargadas se


diferencian y convierten en tejidos, esta región está provista de pelos radiculares cuya
función es la de incrementar la superficie de absorción

La raíz principal es la primera en brotar y penetrar en la tierra, luego brotan las raíces
secundarias laterales hasta desarrollar el sistema radicula. Si la raíz principal sobrepasa
en tamaños las raíces laterales, este sistema se llama pivotante. Este sistema es
característico en muchas plantas dicotiledóneas, por ejemplo en todos los árboles y
arbustos de clima medio

101
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
102

Fuente: Diseño Carmen Eugenia Piña L

Las plantas monocotiledóneas carecen de raíz principal, por ejemplo del tallo de maíz
brota un gran número de raíces que le sirven de sostén al tallo. Estas raíces que brotan
del tallo y en algunas plantas de la hoja, se denominan raíces adventicias.

Fuente. Material gráfico cedido po-la A.C. Nitella Flexilis publicado na url www.sobrado-es.com

El sistema radicular formado por raíces finas y ramificadas carente de raíz principal se
denomina fibroso y es característico de todas las plantas monocotiledóneas, pero a
veces se forma en las dicotiledóneas de producción vegetativa.

Las raíces que crecen de tubérculos, de pecíolos de hojas o de pedazos de tallo, poseen
sistema radicular adventicio

Modificaciones de la raíz

En sistemas pivotantes como la zanahoria o en la remolacha, en la raíz principal se


almacenan nutrientes, este sistema de raíz pivotante se denomina napiforme.

En sistemas radiculares fibrosos también se presentan modificaciones, como sucede con


la arracacha, la yuca que forman raíces carnosas tuberosas.

102
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
103

Fuente: Diseño Carmen Eugenia Piña L

El Tallo

El tallo es el órgano que conecta la raíz y las hojas entre sí. Las funciones primordiales
del tallo son soporte y conducción del agua y sales minerales a las hojas y de sustancias
elaboradas de la hoja a la raíz. Algunas plantas se reproducen por medio del tallo
(reproducción vegetativa), en muchas plantas los tallos acumulan sustancias
alimenticias.

El tallo y las raíces de una planta trabajan conjuntamente, desempeñando funciones


diferentes pero estrechamente relacionadas, los tejidos que constituyen las raíces y los
tallos son similares, aunque los órganos en sí tienen diferencias estructurales
importantes.

Los tallos, lo mismo que las raíces, crecen de formas y tamaños muy diferentes, unos
son troncos de los árboles gigantes que se elevan cientos de metros en los bosques,
algunos solo viven algunas semanas, pero otros duran siglos.

Existen muchos tipos de tallos con caracteres externos e internos diferentes:

• Tallo leñoso. Posee una consistencia dura, entre ellos se cuentan árboles, arbustos y
bejucos leñosos.

• Tallo herbáceo: De consistencia maciza o hueca, son erguidos, los claveles, la


hierbabuena y otras plantas de jardín.

103
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
104

• Tallo de monocotiledóneas: De consistencia maciza o hueca, son erguidos y cilíndricos


como el de la guadua, el maíz, los pastos y las palmas.

• Tallos modificados: Son tallos que poseen forma y función excepcional. Entre ellos el
cladodio, los rizomas y los zarcillos.

• Cladodio: tallos aparentemente sin hojas, por ello realiza la función de fotosíntesis y
transpiración. Son suculentos, ejemplo: cactus.

• Estolón: En la fresa, frambuesa, ahuyama, calabaza, el estolón es un tallo con


entrenudos finos y largos con hojas en forma de escama. Se encuentra en la superficie
del suelo y es útil en la reproducción vegetativa.

• Bulbo: Es un tallo subterráneo corto y grueso y envuelto en varias hojas. Su función es


el almacenamiento de sustancias alimenticias y la conservación y la protección de las
yemas en tiempos muy fríos o muy calientes y secos. Este bulbo es útil en la
reproducción vegetativa. Ejemplo: Cebolla.

• Rizoma: Tallo subterráneo como en el lirio, es grueso y carnoso, crece horizontalmente


sobre la superficie del suelo, útil n la reproducción vegetativa.

• Zarcillo: Como en la uva, sirve más como medio de soporte del tallo a otros elementos.
Como fríjol, badea, pepino.

Estructura del tallo

Al observar un tallo podemos encontrar las siguientes estructuras:

104
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
105

• Nudos: Pequeños puntos donde se adhieren las hojas.

• Entrenudos: espacio entre nudo y nudo.

• Yema apical o Terminal: Yema que se localiza al final del crecimiento longitudinal del
tallo.

• Yemas laterales: Se localizan en el ángulo formado por el pecíolo de la hoja y la


continuación del tallo.

• Cicatrices de escamas: Indican donde estuvo ubicada la yema Terminal. Sirven para
detectar la edad de la ramita.

• Ramas: Formaciones laterales del tallo, dan mejor extensión a la planta y facilitan una
mejor utilización de la luz para la fotosíntesis.

La hoja

Su principal función es la fotosíntesis y la transpiración, además sirve de protección a las


yemas laterales. Las principales partes de la hoja son: el limbo o lámina, el pecíolo y en
algunas las estípulas. Las hojas poseen las más diversas estructuras morfológicas
especialmente en su limbo, que puede ser de diferentes tamaños y formas La forma de
las hojas varía ampliamente, dependiendo de la forma del limbo, base, ápice y tipo de
borde, por lo que solo se presentan las más comunes.

Según su forma

• Oval.
• Cordada en forma de corazón.
• Deltoidea.
• Acicular (en forma de aguja).
• Linear (larga y angosta).
• Lobulada (en forma de varios lóbulos).
• Compuesta (formada de foliolos).

105
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
106

• Lanceolada.
• Arriñonada.
• Espatulada.
• Elíptica.

Imagen Tomada de www.juntadeandalucia.es/.../imagenes/imagen2.jpg

Venación

• Reticular: Los nervios presentan ramificaciones en forma de red.


• Paralela: Los nervios van paralelos de un lado a otro.

Borde

• Entero: Liso sin hendiduras.


• Dentado: Hendiduras.
• Aserrado. Borde.

La disposición de sus hojas

106
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
107

• Alterna.
• Opuestas.
• Verticiladas.

Modificaciones de la hoja

Algunas de ellas son:

• Suculentas. Gruesas y carnosas retienen agua, ejemplo: aloe o sábila, algunas plantas
desérticas poseen tallos suculentos y sus hojas están formadas por espinas que
protegen la pérdida de agua de la planta y actúan como órgano de defensa. Ejemplo:
cáctus.

Órganos reproductores de la planta

La Flor

Tomado de: http://www.juntadeandalucia.es/averroes/concurso2004/ver/09/partes.htm

Las flores son órganos reproductores de las plantas superiores, de la cual resultan las
semillas, portadoras de los caracteres genéticos para la siguiente generación.

Morfología de la flor

Al observar una flor vemos que consta de cuatro partes o verticilios florales unidos al
extremo modificado del tallo o receptáculo

107
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
108

El cáliz El primer verticilio de la flor formado por los sépalos, cuya función es la
protección de la yema floral, y los verticilios internos.Existen dos tipos de cáliz:
dialisépalo que presenta sépalos libres y gamosépalo.

Corola Formada por los pétalos de variados colores, su función es atraer a los insectos
útiles en la polinización. Al igual que el cáliz la corola puede ser dialipétala es decir con
los pétalos separados o gamopétala con los pétalos soldados.

La simetría de la flor puede ser de dos tipos: Radical o actinomorfa cuando los pétalos
son de igual tamaño y de distribución uniforme que permiten que la flor sea dividida en
cuatro (4) o más porciones equivalente y bilateral o zigomorfa cuando los pétalos son de
tamaño desigual y con una distribución equidistante entre ellos, lo cual permite dividir la
flor en dos partes iguales. El receptáculo, el cáliz y la corola, juntos forman el perianto o
envoltura protectora de la flor.

Androceo Formado por los estambres y constituyen el aparato sexual masculino. El


estambre consta de un tallo o filamento, que lleva en su ápice una antena en donde se
desarrollan los granos de polen. En el androceo, los estambres pueden estar libres
(dalistémono) o soldados (gamostémono). Los estambres pueden ser todos iguales
(isostémono), agruparse de dos en dos (didinamos) o en grupo de cuatro y otro de dos
(tetradínamos).

Gineceo Formado por varios pistilos que constituyen el aparto sexual femenino de la flor.
El pistilo o carpelo consta de tres partes: El ovario, el estilo y el estigma, que es rugoso y
esponjoso con el fin de atrapar el polen. Los carpelos pueden presentarse separados o
estar soldados entre sí parcial o totalmente. El ovario contiene los óvulos, cada óvulo
contiene un saco embrionario, dentro del cual crece la ovocélula.

La posición del ovario puede ser superada por encima de la inserción de los demás
verticilios florales como en el nabo, tomate, ciruela, durazno, o infera por debajo de esta
inserción.

Plantas monóicas y dióicas

Las plantas pueden ser dióicas cunado poseen flores de un solo sexo, femeninas o
masculinas unisexuales, ejemplo: papayo, joroba o fresno el inchi. Cuando la misma
planta posee flores femeninas y masculinas, ejemplo: maíz y nogal, se denomina
monoica.

Fórmula floral

Permite resumir las características de una flor, para tal fin se utilizan símbolos, letras y
números, los cuales se describen con una determinada secuencia así:

108
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
109

1. Simetría: La cual puede ser actinomorfa simbolizada con un asterisco , o


zigomorfa representada con una flecha invertida

2. Sexo: Si la flor es unisexual se representa su sexo así:

3. Cáliz: Se presenta con la letra C seguida del número de sépalos. En el caso de que
los sépalos sean soldados (gamosépalos) el número de sépalos se encierra en un
paréntesis, ejemplo: C (5).

4. Corola: Se simboliza con la letra K seguida del número de pétalos. Si los pétalos son
unidos o soldados (gamopétala) el número de pétalos se encierra en un paréntesis K(5)
si los pétalos son libres el número de pétalos va sin paréntesis K5.

5. Androceo: Se representa por la letra A seguida del número de estambres, si son


libres se representa sin paréntesis A5 si los estambres son soldados el número de estos
va dentro de un paréntesis A(5). Pueden representarse de acuerdo a su agrupación
A2+2.

6. Gineceo: Se representa con la letra G indicando la posición del ovario con una raya
pequeña así: si es inferior la raya va debajo de la letra (G) si es superior la raya va
encima de la letra (G). Seguida del número de carpelos o pistilos, el cual va sin
paréntesis si son libres o dentro de un paréntesis si los carpelos son soldados G(5).

Ejemplo:

109
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
110

Inflorescencia

En la mayoría de las plantas no se forma una sola flor en el ápice del tallo o en la axila
de una hoja, sino que en una rama o planta se desarrollan arreglos de pequeñas flores,
denominadas inflorescencias.

Las inflorescencias pueden clasificarse en Racemosas, cimosas y compuestas.

1. Racemosas: Tienen crecimiento centrípeto y pueden ser:

- Racimo: Presenta un eje principal alargado y flores pediceladas en toda su extensión.

- Umbela: De un punto del pedúnculo parten pedicelos como radios.

- Corimbo: Tiene un eje principal a lo largo del cual salen pedicelos permitiendo a las
flores estar en un mismo nivel.

- Espiga: Del pedúnculo o eje salen flores sésiles.

- Capítulo o cabezuela: De un eje ensanchado salen flores sésiles.

2. Cimosas: Su crecimiento es centrífugo, definido y pueden ser:

- Monocasio: Formado por una flor principal terminal y otra lateral secundaria.

- Helicoidea: Con un eje prolongado y flores a ambos lados.

- Dicasio: Con una flor lateral y dos secundarias laterales.

- Escorpioidea: Con flores a un solo lado y eje curvado o enmallado.

Las inflorescencias también pueden formarse por la modificación o la combinación de


dos inflorescencias simples. Ejemplo: racimo de racimos, racimos de espigas, umbela de
capítulos.

El fruto y la semilla

Después del proceso de fecundación, el ovario maduro con o sin partes asociadas se
convierte en fruto. La pared del ovario junto con las partes asociadas (si se tienen) se
convierte en pericarpio o partes protectoras que rodean la semilla. Al madurar el
pericarpio puede contener sustancias de reserva que constituyen la pulpa en frutos
carnosos. En otros frutos el pericarpio es seco. La semilla es el óvulo maduro, y contiene
el embrión y las sustancias alimenticias necesarias para su desarrollo y crecimiento.En
las ginospermas la semilla se desarrolla en la superficie de las escamas de los conos, en

110
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
111

las angiospermas la semilla se desarrolla dentro de la pared protectora del ovario. Las
sustancias alimenticias se encuentran en el endosperma o en el mismo embrión en las
dicotiledóneas, en monocotiledóneas se ubica en el albumen.

Clasificación de frutos según Fuller y otros (Botánica, Editorial Interamericana)

1. Frutos simples: El fruto simple consta de un solo ovario madurado. Las clases
principales de frutos simples son:

a) Frutos carnosos: Pericarpio blando y carnoso en el momento de la madurez. Las


semillas escapan de los frutos carnosos como resultado de la descomposición de los
tejidos carnosos.

Baya: Pericarpio totalmente carnoso, ejemplo: Uva, banano, tomate, papaya, sandía,
guayaba, naranja, pepino, pimentón.

Drupa: el exocarpio es una capa delgada, el mesocarpio es grueso y carnoso, el


endocarpio es duro y pétreo, ejemplo: melocotón, coco, aceituna, cereza, albaricoque.

b) Frutos secos: Pericarpio seco, quebradizo y duro en la madurez, contiene varias


semillas.

Frutos deshiscentes: Se abren en forma natural para liberar las semillas, ejemplo:
arveja, fríjol, habichuela, magnolia, lirio, tulipán, violeta.

Frutos indehiscentes: No se abren al llegar la madurez contienen una o dos semillas.

Frutos agregados: Es un racimo de varios ovarios madurados, producidos por una sola
flor y llevados en el mismo receptáculo. Ejemplo: frambuesa y zarzamora.

Frutos múltiples: Racimos de muchos ovarios madurados producidos por varias flores
amontonadas en la misma inflorescencia, ejemplo: mora y piña, higuera.

Frutos accesorios: Frutos que constan de uno o más ovarios madurados, con tejidos de
otras partes florales, como el cáliz o el receptáculo. En un fruto accesorio, estos tejidos
complementarios están a menudo muy desarrollados, hasta constituir la parte principal
de la estructura designada popularmente “fruto”, entre los frutos accesorios familiares
figuran las fresas. en la que los frutos individuales son aquenios, llevados a un
receptáculo suculento, rojo, dulce, extensamente desarrollado. Otro tipo de fruto
accesorio es el pomo ejemplificado por manzanas y peras, en que los ovarios maduros
están rodeados de tejido de receptáculo y cáliz agrandado, en los que están
almacenadas grandes cantidades de alimento y agua.

111
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
112

En la tabla siguiente se resume la función que realiza cada uno de los órganos que
conforman la planta

Órgano Función
Raíz Fijación de la planta al suelo
Absorción de agua y minerales del suelo
En algunas plantas son órganos de almacenamiento como
en la zanahoria y la yuca
Tallo Conecta la raíz y las hojas
Conduce agua y sales minerales de la raíz a las hojas
Conduce sustancias elaboradas de las hojas a la raíz
En algunas plantas son órganos de almacenamiento como
en la papa y la cebolla cabezona
Puede servir para la reproducción vegetativa de algunas
plantas.
Hoja Fotosíntesis o producción de alimento
Respiración de la planta a través de estomas
Transpiración
Flor Formación de semillas
Reproducción sexual de la planta
Almacenamiento como en el brócoli, el coliflor
Fruto Guardar y proteger las semillas
Almacenamiento de sustancias alimenticias
Semilla Contener el embrión de la nueva planta
Reservar sustancias alimenticias para el desarrollo y
crecimiento del embrión

112
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
113

Capitulo 4 Microorganismos
Introducción

La microbiología estudia los microorganismos u organismos unicelulares generalmente


microscópicos que se dividen en: virus; bacterias; protozoos, algunas algas y hongos.
Según el objeto de estudio o de interacción entre el hombre y los microorganismos se
pueden señalar múltiples clasificaciones para casos específicos de la microbiología. Por
ejemplo: bacteriología, microbiología agrícola, microbiología de alimentos, microbiología
ambiental, protozoología, micología, virología, entre otras.

El objeto material de la microbiología viene delimitado por el tamaño de los seres que
investiga, lo que supone que abarca una enorme heterogeneidad de tipos estructurales,
funcionales y taxonómicos: desde partículas no celulares como los virus, viroides y
priones, hasta organismos celulares tan diferentes como las bacterias, los protozoos y
parte de las algas y de los hongos, los cuales según la clasificación de Whittaker
conforman reinos distintos a plantas y animales.

Lección 22 Los Virus

Características

Los virus son organismos submicroscópicos, de forma variable pueden ser alargados,
icosaédricos (polígono de 20 lados), algunos como los bacteriófagos que atacan a las
bacterias, tienen forma más compleja su estructura presenta cabeza y cola. Los virus
contienen solamente un tipo de ácido nucleico que puede ser: ADN (ácido
desoxirribonucleico) o ARN (ácido ribonucleico), rodeado de una cubierta de proteína
denominada cápsida la cual tiene función protectora.

Microfotografía de Adenovirus
Tomada de http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookDiversity_1.html
http://web.uct.ac.za/depts/mmi/stannard/linda.html

113
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
114

Algunos tipos de virus poseen también una envoltura, constituida por lípidos y proteínas,
que tiene su origen en la membrana de la célula infectada y envuelve la cápsida, es el
caso del virus de inmunodeficiencia humana. A esta estructura completa se la denomina
partícula vírica o virión. Los virus no tienen organización celular, ni pueden realizar sus
procesos metabólicos de manera independiente, por lo que se les sitúa en el límite entre
lo vivo y lo no vivo. Para su replicación necesitan de células vivas constituyéndose en
parásitos intracelulares obligados. Los virus pueden actuar de dos formas distintas:

• Como agentes infecciosos productores de enfermedades en el hombre, las plantas y


los animales. Se reproducen en el interior de las células que infectan de donde obtienen
todo el material y los mecanismos requeridos para su replicación.

• Como agentes genéticos que modifican el material hereditario de las células que
infectan, al unirse a su material genético y causar variabilidad genética.

Los virus que infectan a las bacterias se denominan bacteriófagos

Gráfica: Representación esquemática de un virus bacteriófago


Fuente: Carmen Eugenia Piña

Gráfica Representación esquemática de bacteriófago infectando una bacteria


Fuente: Carmen Eugenia Piña

114
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
115

Mecanismo de replicación de los virus

El proceso se inicia con la adhesión del virus a la célula

El virus penetra dentro de la célula e inyecta en ella su ácido nucleico (material


genético).

El ADN de la célula fabrica las proteínas víricas y el ácido nucleico viral se replica en la
célula que parásita utilizando las enzimas, el material y los mecanismos de la célula que
hospeda.

Cuando hay suficiente cantidad de ácido nucleico viral este se ensambla con la proteína
vírica y abandona la célula.

Clasificación de los virus

Los virus no se clasifican en ninguno de los 5 reinos propuestos por Whittaker debido a
que no tienen organización celular, y utilizan los procesos anabólicos de las células
hospedadoras para su replicación. Tampoco se ubican en ninguno de los 3 dominios

El ICTV (Comité Internacional de Taxonomía de Virus) propuso un sistema universal de


clasificación viral. El sistema utiliza una serie de taxones como se indica a continuación:

Orden (-virales).
Familia (-viridae)
Subfamilia (-virinae)
Genero (-virus)
Especie ( ).

Los virus se agrupan en familias y subfamilias cuyo nombre se ha latinizado; por


ejemplo, los virus herpes se agrupan en la familia Herpesviridae. Las subfamilias tienen
el sufijo “nae”, Ej: Herpesvirinae.

El otro tipo de agrupación es el género, que no se nombra en forma latinizada, por


ejemplo, herpesvirus.

Por ejemplo, el virus Ebola de Kikwit se clasifica como:

Orden: Mononegavirales
Familia: Filoviridae
Género: Filovirus
Especie: virus Ebola Zaire

115
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
116

Los criterios utilizados en este sistema de clasificación son:

a) Tipo y naturaleza del genoma. (AND; ARN)

b) Morfología de la partícula vírica o virion: simetría de la nucleocápsula, presencia de


envoltura.

c) Mecanismo de replicación Hospedero

Otro sistema de clasificación se basa en la capacidad de infectar determinadas células


huésped y de acuerdo con ello se subdividen en tres clases principales: virus animales,
virus bacterianos o bacteriófagos y virus de las plantas

Origen de los virus

Existen 2 hipótesis sobre el origen de los virus:

http://bibliotecadigital.ilce.edu.mx/sites/ciencia/volumen2/ciencia3/071/htm/sec_18.htm

1. Una teoría propone que los virus son consecuencia de la degeneración de


microorganismos (bacterias, protozoarios y hongos) que alguna vez fueron parásitos
obligatorios de otras células, a tal grado que se convirtieron en parásitos intracelulares y
perdieron paulatinamente todos los componentes necesarios para desarrollar un ciclo de
vida libre independiente de la célula hospedera. Sin embargo, el hecho de que la
organización de los virus es de tipo no celular, es un importante argumento en contra de
esta teoría, ya que las cápsides virales son análogas, desde el punto de vista
morfogenético, a los organelos celulares constituidos por subunidades de proteína, tales
como flagelos y filamentos que forman el citoesqueleto, y no son parecidas a las
membranas celulares. Por otra parte, las envolturas de los virus no muestran similitudes
arquitectónicas con las membranas celulares o en caso de poseer dicha arquitectura es
debido a que la envoltura viral fue adquirida como consecuencia de la protrusión o brote
de la partícula viral a través de la membrana celular.

2. La otra teoría propone que los virus son el equivalente a genes vagabundos. Por
ejemplo, es probable que algunos fragmentos de ácido nucleico hayan sido transferidos
en forma fortuita a una célula perteneciente a una especie diferente a la que pertenecen
dichos fragmentos, los cuales en lugar de haber sido degradados (como ocurre
generalmente), por causas desconocidas podrían sobrevivir y multiplicarse en la nueva
célula hospedera.

116
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
117

Enfermedades virales

Los virus son causantes de enfermedades infecciosas en el hombre como son : la


viruela, la gripe, la hepatitis, las paperas, la rabia, la poliomielitis, el SIDA, el sarampión ,
la encefalitis, la rubéola, el herpes, la fiebre amarilla ésta última transmitida por un
vector; en los animales originan el moquillo, la rabia, la influenza, la encefalitis, el cólera;
y en las plantas enfermedades como el virus del mosaico del tabaco y el virus del
mosaico amarillo del nabo entre otras.

Los mecanismos de trasmisión son diversos algunos por vía respiratoria cuando la
persona enferma estornuda o tose; otros a través de picaduras de insectos es el caso de
la fiebre amarilla; o por mordedura de animales enfermos como en el caso de la rabia;
los que causan trastornos digestivos por vía oral-fecal y por inoculación con jeringas u
objetos infectados, por transfusión de sangre contaminada, por relaciones sexuales sin
protección y por último a través de la madre al hijo durante el embarazo o en el momento
del parto. En el caso de las plantas la trasmisión se hace por insectos o nematodos. Los
medios para prevenir la infección viral son las vacunas que causan inmunidad, evitar el
contacto con personas infectadas, esterilización de objetos, uso de jeringas desechables.

Importancia biológica de los virus

Los virus sirven para adelantar investigaciones biológicas relacionadas con su


mecanismo de replicación y así poder encontrar mecanismos para controlar su
multiplicación. Los virus permiten la elaboración de vacunas, fueron de los primeros
modelos para el estudio del funcionamiento del genoma, los biólogos utilizan los virus
para estudiar el mecanismo de control de la información genética y extrapolarlo a
organismos más complejos. Algunos virus atacan bacterias e insectos perjudiciales
ayudando a mantener el equilibrio ecológico. Los virus sirven como mediadores en el
intercambio genético entre individuos de una misma o diferentes especies
proporcionando variabilidad de los organismos y por ende disminuyen la susceptibilidad
a ser infectados. Por ejemplo, las bacterias que han sido infectadas por virus –
bacteriófagos- pueden realizar funciones que en otras condiciones no podría realizar

Algunos virus se utilizan en medicina para introducir información a células animales que
presenten defectos genéticos o adquiridos y así lograr que funcionen normalmente.

Viroides

Son moléculas de ARN circular (300-400 nucleotidos) que carecen de cubierta viral o
cápsida, son de tamaño menor que los virus. Se encuentran en células vegetales donde
causan enfermedades. Debido a que los viroides no codifican para ninguna proteína
deben necesariamente reclutar proteínas y vías metabólicas de la célula hospedera para
completar su ciclo infeccioso. Se les considera como la etapa primitiva de los virus. Se
cree que los viroides podrían proceder evolutivamente de los intrones.

117
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
118

Características

1. Bajo peso molecular

2. No tienen cápsula proteica

3. Se multiplican en forma autónoma

4. Parásitos obligados

5. Infecciosos

Priones Son proteínas que se multiplican en la célula hospedadora donde generan


graves alteraciones. Todas las enfermedades ocasionadas por priones son neurológicas,
por ejemplo el síndrome de las vacas locas. A continuación se presenta una ampliación
tomada de:

http://enfenix.webcindario.com/biologia/microbio/priones.phtml

Proteínas del Prion Los priones son agentes patógenos formados por una proteína
(proteína del prión o PPr). Los priones, o las enfermedades producidas por priones,
tienen un comportamiento sorprendente, por un lado se transmiten verticalmente, como
cualquier enfermedad hereditaria típica, mientras que por otro lado se comportan de
manera infectiva, transmitiéndose horizontalmente, mediante contagios que pueden
darse entre individuos de distintas especies. La proteína del prión (PrP) normal, tiene
una secuencia de aminoácidos, (estructura primaria) idéntica a la proteína del prión
patógena. La diferencia entre las dos recae en la estructuras secundaria y terciaria

Proteína de Prion Normal

Proteína de Prion patógeno

118
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
119

Proteína patógena infectando una normal

Interacción de proteína normal con proteína patógena

Estructura terciaria de la proteína del


prión

Estructura secundaria del Prion

La proteína normal es muy rica en hélices alfa , la proteína patógena lo es en láminas


beta . Este cambio de configuración es crucial, ya que las proteínas con láminas beta
son muy resistentes a las enzimas proteolíticas, al calor y no se disuelven en agua. Pero
sobre todo, la proteína alterada tiene una característica única: interacciona con una
molécula de proteína normal, le cambia la conformación y la hace capaz de convertir las
estructuras de más proteínas normales. Ahí radica al parecer, el poder infectivo de los
priones

Esquema explicativo poder infectivo de los Priones

119
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
120

Puede ocurrir que la proteína patógena infecte individuos que producen proteína normal
(a), como ha ocurrido por ejemplo al consumir las vacas piensos elaborados a partir de
ovejas enfermas. En este caso la proteína patógena origina un cambio conformacional
de la proteína normal (b), transformando las hélices alfa de su estructura proteica en
láminas beta. Las nuevas proteínas patógenas inducen el cambio en otras normales, lo
cual produce un efecto de "cascada".

Profundización sugerida para estudiantes de Regencia de Farmacia, Zootecnia, e


Ingeniería de Alimentos. Curso sobre Virología de la Universidad de Rochester:

http://www.medynet.com/usuarios/nnuneza/virologia/indexviral.html

http://www.virology.net/ Journal sobre virología

Lectura

Nuevas investigaciones confirman el origen vírico de la obesidad

El 30% de los casos pueden deberse a infecciones y una vacuna puede prevenir
hasta el 15% del sobrepeso

120
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
121

Nuevas investigaciones confirman que el 30% de los casos de obesidad son debidos a
infecciones víricas y que una vacuna puede reducir el crecimiento de la enfermedad en
un 15%. Lo que en 1997 se descubrió en animales y el año pasado en humanos, se
confirma plenamente ahora: el adenovirus Ad-36 desempeña un papel crucial en la
obesidad humana, originando hasta 20 kilos de más en las personas infestadas. En
consecuencia, de la misma forma que se previenen enfermedades como la rubéola o la
polio, una protección similar aplicada en la infancia evitaría que los niños desarrollasen el
sobrepeso en la edad adulta. Por Marta Morales.

Cierto tipo de obesidad, derivada de un virus, podría evitarse por medio de vacunas,
según el equipo médico que lleva investigando la posible relación de la obesidad con un
tipo de virus y que ha informado del estado de sus conocimientos en el congreso de la
NAASO norteamericana, una asociación líder en investigación científica sobre la
obesidad, celebrado la pasada semana en Vancouver.

El investigador Nikhil V. Dhurandhar, del Centro de Investigaciones Biomédicas de


Pennington, Lousiana, Estados Unidos, afirmó en Vancouver que el exceso de peso está
relacionado, en ciertos casos, con infecciones virales. Explicando el estado actual de sus
investigaciones, que ya fueron objeto de un estudio publicado recientemente por el
International Journal of Obesity, Dhurandhar señaló que se ha comprobado que el
adenovirus 36 (Ad-36) estaba presente seis veces más en los obesos que en las
personas de peso normal.

Hasta ahora se han identificado al menos 40 subtipos de adenovirus que pueden


provocar problemas respiratorios e infecciones gastrointestinales. Según el profesor
Dhurandhar, sus investigaciones demuestran que el Ad-36 desempeña un papel crucial
en la obesidad humana.

En el estudio publicado en el International Journal of Obesity, que analizó a 502


personas, demostró que el 30 por ciento de ellas presentaban anticuerpos del virus Ad-
36, mientras que los mismos anticuerpos estaban presentes únicamente en el 5 por
ciento de las personas no obesas. El estudio reveló asimismo que los obesos infestados
con el Ad-36 pesan una media de 20 kilos más que las demás personas investigadas.
Estos obesos se distinguen además de los otros en que, paradójicamente, tienen una
tasa más baja de colesterol y de triglicéridos. Los investigadores consideran que el Ad-
36 afecta al metabolismo de las células adiposas en crecimiento, favoreciendo la
acumulación de grasa y su rápido crecimiento. Eso significa que una persona infestada
por el virus engorda mucho más que otra persona que coma la misma cantidad y tipo de
alimentos.

Dhurandhar considera que el exceso de peso está relacionado, en ciertos casos, con
infecciones virales. En consecuencia, de la misma forma que se previenen
enfermedades como la rubéola o la polio, señala que una protección similar aplicada en
la infancia evitaría que los niños desarrollasen el sobrepeso en la edad adulta.

121
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
122

Dhurandhar está especializado en la investigación de las relaciones entre los virus y la


obesidad, y ha desarrollado su propia teoría acerca de lo que ha bautizado como el
“virus de la obesidad”, perteneciente al grupo de los llamados adenovirus.

Virus identificado

Los adenovirus son virus de tamaño mediano, de los que existen 49 tipos agrupados en
seis subgéneros (de la A a la F). Generalmente estables contra agentes químicos o
físicos, los adenovirus pueden sobrevivir durante un tiempo prolongado fuera del cuerpo.
Sus efectos más comunes en el organismo humano son las enfermedades respiratorias,
pero también producen gastroenteritis, conjuntivitis, cistitis y sarpullidos.

Uno de estos adenovirus es capaz además de producir obesidad. Las investigaciones de


Dhurandhar han demostrado que existe una relación entre la grasa que genera el cuerpo
y la presencia de los anticuerpos del AD-36 en la sangre. Investigaciones previas ya
habían demostrado que ratones y monos a los que se les había inyectado dicho virus
ganaban peso rápidamente.

Hasta ahora se sabía que la obesidad está relacionada con múltiples factores. Aunque a
menudo vaya asociada a un consumo excesivo de alimentos o a un tipo de vida
sedentaria, el caso es que también existen otras causas, como la herencia genética, el
contacto con los contaminantes o la ingesta de medicamentos.

Evitar graves riesgos

Los riesgos que para la salud entraña la obesidad son múltiples. Además de la muerte, el
sobrepeso propicia un gran número de enfermedades crónicas como la diabetes, la
hipertensión, el exceso de colesterol en la sangre, los infartos cerebrales, los problemas
cardiacos (varios estudios han demostrado que por cada kilogramo de sobrepeso
aumenta en un 1% el riesgo de muerte por enfermedades coronarias), el cáncer
(principalmente de colon en hombres y mujeres, de recto y de próstata en hombres, y de
útero y pecho en mujeres). Otras enfermedades derivadas del exceso de peso serían la
artritis y los problemas respiratorios.

El Dr. Dhurandhar comenzó a interesarse en los casos virales de la obesidad en los años
80, mientras trabajaba como médico en Bombay, en la India. Allí pudo constatar que
ciertos agentes patógenos provocan un rápido aumento del peso en algunos animales
después de ser infestados con el Ad-36.

La NAASO norteamericana ofrece en su web la posibilidad de calcular la masa corporal.


Por su parte, la empresa Obetech ofrece la posibilidad de descubrir si una persona está
infestada por el Ad-36. La obesidad mata cada año en Estados Unidos a 300.000
personas y los descubridores del origen vírico de la obesidad consideran que el AD-36

122
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
123

tiene infectada al 20% de la población norteamericana. Una vacuna podría prevenir el


15% de los casos de obesidad, según sus estimaciones.

Cirugía peligrosa

La divulgación de los avances en esta investigación coinciden con la publicación de otros


estudios en Estados Unidos que desvelan que los riesgos de morir como consecencia de
la cirugía aplicada a la reducción de peso son mayores de lo que se pensaba, incluso
entre las personas con sobrepeso que están entre los 30 y 40 años de edad.

Hasta ahora se pensaba que la tasa de mortalidad en esta categoría de edad, la más
susceptible de sufrir una cirugía para reducir el sobrepeso, era del uno por ciento. Sin
embargo, un nuevo estudio revela que entre los 35 y los 45 años de edad, la muerte se
lleva al 5 por ciento de los hombres y al 3 por ciento de las mujeres que han sufrido este
tipo de intervenciones quirúrgicas. Los porcentajes de mortandad se elevan en los
pacientes que tienen entre 45 y 54 años de edad.

La posible vacuna contra la obesidad y el descubrimiento de los riesgos quirúrgicos,


pueden provocar un giro en los comportamientos asociados a esta enfermedad. El
número de estadounidenses que recurrieron a la cirugía para reducir su peso se
multiplicó por cinco entre 1998 y 2002.

Según un estudio de la Agencia para la Investigación y Calidad de la Sanidad (AHRQ),


mientras que en 1998 sólo 13.386 estadounidenses recurrieron a la cirugía bariátrica, en
2002 la cifra ascendió hasta los 71.733, debido en gran parte a un aumento del 900 por
ciento en las operaciones en pacientes con edades entre los 55 y 64 años.

Written by Marta Morales on miércoles 19 Octubre 2005

Profundización:

http://www.medynet.com/usuarios/nnuneza/virologia/indexviral.html

http://www.virology.net/

Lección 23. Las Arqueobacterias y Bacterias

Introducción

Carl Woese mediante la secuenciación de la molécula de ARNr, comprobó que los


procariotas pertenecientes al reino Mónera se dividían en 2 grupos o dominios: al
primero de ellos lo llamó Eubacteria o Bacterias verdaderas y comprende las bacterias
más comunes que habitan en el cuerpo de los seres vivos, suelo, aire y agua e incluye
las Cianobacterias o algas verdeazules, con capacidad de realizar fotosíntesis. Poseen

123
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
124

además de la clorofila un pigmento azul llamado ficocianina. Las cianobacterias se


utilizan como indicadoras de polución orgánica. Las bacterias o eubacterias son
microorganismos que habitan en el aire, suelo, agua y cuerpo de otros organismos. Son
procariotas, unicelulares de organización muy sencilla. Se estima que existen unas 1700
especies. El segundo grupo lo llamó Arqueobacteria o Arquea e incluye las bacterias
que pueden crecer en condiciones extremas como los hielos antárticos psicrófilas, o en
aguas muy hirvientes son las arqueas llamadas termófilas extremas, o las que habitan en
medios anaerobios, con pH muy ácido, las bacterias productoras de gas metano y las
que se desarrollan en medios salinos o sea las halobacterias. Algunas arqueas son
habitantes del intestino del hombre y animales

Características de las Arqueas

Forma de las Arqueas Presentan formas similares a la de las bacterias verdaderas:


esféricas, individuales o en grupo, bacilares, filamentosas, lobuladas

Estructura de Arquea

Pared Celular semejante a la pared celular de las bacterias gram negativas. Formada
por formada por lípidos, proteína o glicoproteína a diferencia de la pared celular de
peptidoglucano de las eubacterias. La pared presenta simetría hexagonal y adquiere
diferentes morfologías como respuesta a los diferentes ambientes en los cuales se
desarrolla.

Membrana Plasmática puede presentar invaginaciones o mesosomas parecidos a los


de las bacterias gram positivas. Carecen de ácidos grasos y en su lugar tienen cadenas
laterales compuestas de unidades repetitivas de isopreno unidas por enlaces éter al
glicerol que constituyen el gliceroldiéter cuando se distribuyen a manera de bicapa y el
gliceroltetraéter cuando es a manera de monocapa, este último arreglo es muy estable a
temperaturas altas por lo tanto, no es una sorpresa que se encuentre principalmente en
las arqueas termoacidófilas.

Protoplasma (citoplasma), separado en cromoplasma (periférico y pigmentado) y


centroplasma (central, granuloso e incoloro). Los pigmentos que se encuentran en el
citoplasma son: clorofila a, c, carotenoides, phycoxantina, ficocianina C, de color azul,
ficocianobilina, ficoeritrina C, de color rojo, ficoeritrobilina entre otros.

Nucleoplasma contiene el ADN puede aparecer en forma de pequeños gránulos,


pueden aparecer granos de volutina, cianoficina y ribosomas. El ARN y enzimas de
arqueobacterias son diferentes al de las bacterias verdaderas.

124
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
125

Las arqueóbacterias presentan además


mecanismos de defensa contra las condiciones
extremas que podrían afectarlas. Por ejemplo
ellas fabrican una variedad de moléculas y
enzimas protectoras. Las arqueas que viven en
medio ambiente altamente ácidos, poseen en su
superficie celular unas moléculas cuya función es
tomado de:
ponerse en contacto con el ácido para evitar que
http://www.latinoseguridad.com/
penetre en la célula y así evitar que el ADN se
LatinoSeguridad/Fenat/Arqueas.shtml
destruya.
Las arqueas halófilas toman del exterior sustancias como el cloruro de potasio para
equilibrar el interior de la célula y evitar que el agua salada penetre y destruya la célula.
Se pueden encontrar en algunos tipos de alimentos en los que se han utilizado altas
concentraciones de sal (salmueras) para su preservación como es el caso de pescados y
carnes, en donde se reconoce su presencia porque forman manchas rojas. Las arqueas
obtienen energía a partir de compuestos como hidrógeno, dióxido de carbono y azufre.
Algunas lo hacen a partir de la energía solar a través de la bacteriorodopsina, un
pigmento que reacciona con la luz y permite que la arqueobacteria fabrique el ATP.

Eubacterias - Las cianobacterias

Las cianobacterias conocidas comúnmente


como algas verde-azuladas por su color verde-
azulado (a veces rojizo, pardo o negro). Se
caracterizan por que son procariotas (sin núcleo
verdadero), autótrofos (fundamentalmente).

Unicelulares, tamaño entre 1 µm hasta varios


micrómetros.

La reproducción en las cianobacteriaas puede ser asexual, por


bipartición, o por fragmentación de filamentos
Algunas experiencias parecen confirmar que existen fenómenos
que implican la recombinación de material genético, al igual que
en las bacterias.

Los géneros Oscillatoria, Spirulina y Rivularia presentan


movimiento

125
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
126

Importancia biológica de cianobacterias

http://www.eez.csic.es/~olivares/ciencia/fijacion/cianobacterias.htm

Las cianobacterias son organismos antiguos que se caracterizan por conjugar el proceso
de la fotosíntesis oxigénica con una estructura celular típicamente bacteriana. Al ser
responsables de la primera acumulación de oxígeno en la atmósfera, las cianobacterias
han tenido una enorme relevancia en la evolución de nuestro planeta y de la vida en él.

En la actualidad presentan una amplia distribución ecológica, encontrándose en


ambientes muy variados, tanto terrestres como marítimos, e incluso en los más
extremos, siendo la fotoautotrofia, con fijación de CO2 a través del ciclo de Calvin, su
principal forma de vida, y contribuyendo de manera importante a la productividad
primaria global de la Tierra. En relación con esto, es también relevante el hecho de que
muchas cianobacterias sean capaces de fijar el nitrógeno atmosférico, siendo, a su vez,
capaces de hacerlo en condiciones de aerobiosis (de hecho, ciertas cianobacterias
representan los mayores fijadores en amplias zonas oceánicas contribuyendo de forma
importante a la cantidad total de nitrógeno fijado en vida libre).

Cianobacterias y fijación de nitrógeno

La existencia conjunta de la fotosíntesis y de la fijación de nitrógeno ha requerido el


diseño de estrategias que hagan posible el funcionamiento de ambos procesos
antagónicos desde el punto de vista de sus requerimientos ambientales. Entre tales
estrategias la separación en el tiempo o en el espacio de ambas funciones permite el
desarrollo normal de la célula en condiciones de bajos niveles de nitrógeno combinado.
En este sentido, merece particular mención la capacidad de algunas especies
filamentosas de desarrollar unas células llamadas heterocistos, enormemente
especializadas en la fijación del nitrógeno en ambientes aeróbicos.

Los heterocistos son células especializadas, distribuidas a lo largo o al final del filamento
(cianobacterias multicelulares filamentosas), los cuales tienen conexiones intercelulares
con las células vegetativas adyacentes, de tal manera que existe un continuo movimiento
de los productos de la fijación de nitrógeno desde los heterocistos hacia las células
vegetativas y de los productos fotosintéticos desde las células vegetativas hacia los
heterocistos (Todar, 2004).

Las bases moleculares del proceso de diferenciación de los heterocistos y el


establecimiento del patrón de distribución de los mismos en el filamento cianobacteriano
constituyen uno de los campos más activos en el estudio actual de las cianobacterias y,
asimismo, representa un modelo simple de establecimiento de patrones espaciales de
diferenciación cuyo estudio puede abordarse con la gran variedad de herramientas
desarrolladas para el análisis genético-molecular de las cianobacterias, que incluyen la

126
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
127

construcción de especies y la disponiblidad de la secuencia completa de los genomas de


varias de ellas.

Muchas cianobacterias, por ejemplo, Anabaena azolla juegan un papel importante en el


desarrollo de cultivos como el arroz. Anabaena azollae , en simbiosis con helechos ,
proporciona hasta 50 kg de nitrógeno/ha siendo la utilización de este sistema fijador
general en muchas regiones del sudeste asiático.

(Con la contribución de Antonia Herrero, Instituto de Biología Vegetal y Fotosíntesis,


CSIC.)

Las Bacterias o eubacterias son microorganismos que habitan en el aire, suelo, agua y
cuerpo de otros organismos. Son procariotas, unicelulares de organización muy sencilla.

Gráfica Representación esquemática de una bacteria


fuente: Carmen Eugenia Piña López
Características

El tamaño microscópico de las bacterias está determinado genéticamente, y depende de


la cepa, de las condiciones ambientales (nutrientes, sales, temperatura, tensión
superficial).

La unidad de medida bacteriana es el micrómetro, que equivale a 1/1000 milímetros (10-


3 mm) = 1 micrómetro). Para darse una idea de su tamaño se calcula que en un
centímetro cúbico cabe alrededor de un millón de billones de bacilos de tamaño medio.
El rango en el tamaño de las bacterias es muy variado, existen bacterias como las
nanobacterias de aproximadamente un 0.05 m m, o bacterias de un tamaño mayor como
Epulopiscium , un comensal del intestino del pez cirujano que mide 0.5 mm. Algunos
micoplasmas tienen tamaños que oscilan entre 0.2 a 0.3 micrómetros (mm) de diámetro
Escherichia coli habitante natural en el intestino humano mide aproximadamente 0.5 m m
de ancho por 2 m m de largo.

127
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
128

Las bacterias difieren en la forma, las hay esféricas u ovales llamadas cocos, alargadas
cilíndricas en forma de bastón se les denomina bacilos, en forma de espiral o helicoidal,
los espirilos, en forma de coma las llamadas vibrios y algunas en forma cuadrada con
lados y esquinas en ángulo recto. La forma de la bacteria puede ser modificada por las
condiciones ambientales.

Composición Las bacterias están constituidas por un 70% de agua y un 30% de materia
seca, de esta materia seca el 70% corresponde a proteínas, el 3% a ADN, el 12% a
ARN, el 5% a azucares, el 6% lípidos y el 4% a minerales

Estructura de las bacterias: Dentro de este grupo se encuentra la pared celular, los
flagelos, esporas, fimbrias o pelos y cápsula. Estas estructuras no siempre se
encuentran en todas las bacterias, por lo tanto se consideran variables, razón por la cual
se estima que no son esenciales. La célula bacteriana consta de:

* Pared celular: es una estructura rígida, se encuentra rodeando la membrana


citoplasmática de casi todas las bacterias, posee una gran rigidez lo cual le confiere gran
resistencia. Se considera esencial para el desarrollo y división bacteriana; cumple con
dos funciones importantes: mantener la forma de la célula y evitar que la célula colapse
debido a las diferencias de presión osmótica por el constante intercambio de fluidos. El
grosor de la pared de las bacterias oscila entre de 10 y 80 nanómetros. La pared celular
constituye una porción apreciable del peso seco total de la célula; dependiendo de la
especie y de las condiciones de cultivo puede representar del 10 al 40 por ciento del
peso seco del organismo.

En las eubacterias la pared celular contiene peptidoglicano, compuesto que no se


encuentra en las células eucariotas. En las bacterias gram- positivas se halla inmerso en
una matriz aniónica de polímeros azucarados, mientras que en las bacterias gram-
negativas está rodeada por una membrana externa, e inmersa en un espacio
periplásmico. El prefijo gram proviene de la técnica de coloración que se utiliza para la
diferenciación primaria del tipo de bacteria. Además de los compuestos anteriores, se
encuentran el ácido diaminopimélico y ácido teicoico

* Membrana plasmática la cual presenta invaginaciones, que son los mesosomas que
contienen enzimas que participan en la duplicación del ADN, en la membrana plasmática
se localizan también enzimas que intervienen en la producción de energía (ATP), función
que en la célula eucariótica cumple la mitocondria.

* Los mesosomas son repliegues y extensiones de la membrana citoplasmática,


intervienen en procesos metabólicos y de reproducción de la célula bacteriana.

* Citoplasma el cual presenta un aspecto viscoso, en él se encuentran: materiales de


reserva , ARN, ribosomas, un nucleoide ubicado en su zona central donde se encuentra
la mayor parte del ADN bacteriano en algunas bacterias se encuentran dispersos por el

128
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
129

citoplasma fragmentos circulares de ADN con información genética llamados plásmidos y


pigmentos fotosintéticos en el caso de bacterias fotosintéticas. En el citoplasma se
realizan los procesos metabólicos de la célula bacteriana

* Ribosomas son organelos con apariencia de gránulos, algunos se hallan dispersos en


el citoplasma bacteriano y otros s e agrupan en cadena y se les denomina
polirribosomas; están compuestos por ácido ribonucleico - ARN (60%) y proteína (40%).
Su función es la síntesis de proteína.

*Los cuerpos de inclusión o gránulos son materiales de reserva como lípidos, hierro,
azufre que se almacenan en el citoplasma, en los períodos de suficiente aporte
nutricional para ser utilizados en épocas de inanición

*Las vesículas se encuentran en ciertas bacterias que habitan en lagos estas vesículas
les sirven para flotar, contrarrestando la atracción gravitatoria, y así lograr el óptimo de
luz

* La región nuclear esta localizada centralmente en la célula, se compone


principalmente de ADN aunque también puede encontrarse ARN y proteínas asociadas a
éste. El ADN esta dispuesto en un cromosoma largo y circular, algunas veces llamado
nucleoide, genóforo o cuerpo cromatínico.

* Los plásmidos son pequeñas moléculas circulares de ADN extracromosómico, se


encuentran en la región nuclear de algunas bacterias. Las moléculas de ADN plásmico a
pesar de encontrarse fuera del cromosoma, toman una conformación de doble hélice al
igual que el ADN de los cromosomas. Los plásmidos se replican de manera
independiente al cromosoma y contienen información genética para la bacteria
complementaria a la contenida en el nucleoide y que le es útil para su supervivencia en
condiciones desfavorables. Por ejemplo el código que hace resistentes a las bacterias a
los antibióticos, la capacidad de apareamiento, la resistencia y la tolerancia a los
materiales tóxicos. Los plásmidos son muy utilizados en ingeniería genética ya que por
su tamaño resulta fácil manipularlos; se pueden aislar, introducir en ellos información e
introducirlos en otras células bacterianas viables en las cuales se expresa la información
que ellos portan.

* Flagelos presentes en la mayoría de bacterias, generalmente son rígidos, implantados


en la membrana celular mediante un corpúsculo basal. Las bacterias que poseen
flagelos tienen movilidad, o sea, el movimiento de traslación de un punto a otro en forma
rápida y de zig zag permitiéndoles responder a estímulos por ejemplo: químicos cuando
las bacterias son atraídas a determinados compuestos como la glucosa, la galactosa y
se denomina quimiotactismo positivo o por el contrario son repelidas de algunos
compuestos como los antibióticos, quimiotactismo negativo, luminosos es el caso de las
bacterias fotosintéticas que tienen fototactismo positivo a los rayos luminosos.

129
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
130

Los flagelos permiten a la mayoría de bacterias la movilidad en medios líquidos, una


excepción son las bacterias deslizantes que se mueven por flexión de la pared celular.
La movilidad debe distinguirse del movimiento pasivo de las bacterias en una sola
dirección como consecuencia de las corrientes en la preparación, o del movimiento
Browniano que es la constante vibración de las bacterias en un punto fijo
comportamiento que se presenta por estar suspendidas en medio líquido y por su
pequeño tamaño

* Fimbrias o pili muy numerosos y cortos, se encuentran relacionadas con diversas


funciones como la de adherencia a las superficies de tejidos, sitios de adsorción para
virus bacterianos y además pueden servir como pelos sexuales para el paso de ADN de
una célula a otra, no tienen función de motilidad

* Cápsula es una estructura de material viscoso que rodea la pared celular de muchas
bacterias que se encuentran en su ambiente natural. La cápsula no cumple ninguna
función metabólica pero sirve de protección, cuando una bacteria encapsulada invade a
un huésped, la cápsula evita que los mecanismos de defensa del huésped destruyan la
bacteria, permite la adhesión de bacterias hermanas para la formación de colonias,
igualmente permite a las bacterias adherirse a sus sustratos.

* Endosporas Son estructuras generalmente de forma esférica que se forman en ciertas


bacterias gram positivas como respuesta a condiciones ambientales adversas (poca
humedad, temperaturas extremas, agentes químicos y físicos etc.). Cuando las
condiciones ambientales vuelven a ser favorables la endospora se transforma de nuevo
a la forma vegetativa. Ciertas formas filamentosas pueden producir la endospora en el
extremo del filamento y aparecen de manera libre, en otras bacterias como Clostridium
se pueden observar en el interior de las bacterias a las que deforman de una manera
característica, lo que sirve para su identificación

Reproducción

Generalmente las bacterias se reproducen asexualmente por fisión binaria o bipartición,


unas pocas por gemación, algunas especies de bacterias filamentosas se reproducen
por esporas que se forman en los extremos de los filamentos. Durante la bipartición la
célula bacteriana origina dos células iguales o clones. Este mecanismo de división
celular es más rápido y menos organizado que la mitosis y la meiosis. El resultado de la
fisión binaria son dos células hijas por cada célula madre, así, una célula se divide en
dos, dos en cuatro y cuatro en ocho y así sucesivamente. La síntesis de la pared, el
crecimiento bacteriano y la duplicación del ADN regulan la división celular. La bacteria da
lugar a dos células hijas.

La división empieza en el centro de la bacteria por una invaginación de la membrana


citoplasmática que da origen a la formación de un septo o tabique transversal. La

130
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
131

separación de las dos células va acompañada de la segregación en cada una de ellas de


uno de los dos genomas que proviene de la duplicación del ADN materno. El proceso de
división ocurre en tres fases principales: 1. elongación o alargamiento de la célula y
duplicación del material genético o ADN, 2. separación de ADN dentro de las células
hijas formadas y 3. la citocinesis o separación celular. El proceso se inicia con la
duplicación del ADN, luego la pared celular y la membrana plasmática forman un tabique
que divide la célula bacteriana en dos como se ve en el siguiente esquema:

Gráfica Representación reproducción de una bacteria


fuente: Carmen Eugenia Piña López

Intercambio genético en bacterias Sin embargo en algunas bacterias ocurren


intercambios genéticos (intercambio de genes) como resultado de tres mecanismos:
transformación, conjugación, transducción e intercambio de plásmidos.

Transformación: Consiste en el intercambio genético producido cuando una bacteria es


capaz de captar fragmentos de ADN, de otra bacteria que se encuentran dispersos en el
medio donde vive.

Animación sobre proceso de conjugación

131
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
132

Conjugación: En este proceso, una bacteria donadora F+ transmite a través de un


puente o pili, un fragmento de ADN, a otra bacteria receptora F-. La bacteria que se
llama F+ posee un plásmido, además del cromosoma bacteriano.

Transducción: En este caso la transferencia de ADN de una bacteria a otra, se realiza a


través de un virus bacteriófago, que se comporta como un vector intermediario entre las
dos bacterias.

Nutrición

Las bacterias pueden ser autótrofas o heterótrofas.

Las autótrofas utilizan la luz del sol y el bióxido de carbono o compuestos inorgánicos,
por ejemplo, el azufre para fabricar su alimento.

Las heterótrofas (por absorción) pueden utilizar fuente de carbono orgánico para su
alimentación.

Las bacterias pueden vivir como parásitos afectando los organismos donde habitan,
como simbiontes formando parte de la flora bacteriana normal de la piel, cavidades y
tracto digestivo del hombre y de los animales y saprofitas la gran mayoría, ayudando a la
descomposición de la materia orgánica muerta.

Clasificación de las Bacterias

En la siguiente tabla se resumen algunos de los aspectos fundamentales en la


clasificación de las bacterias

132
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
133

Por composición de la pared


Por forma Por ordenamiento Representación celular que reacciona a la
tinción de gram
Gram negativas no retienen el
cristal violeta conservan el
colorante rojo por ejemplo
Coco único
safranina son susceptibles a las
cefalosporinas
Diplococo en parejas

Gram positivas absorben y


conservan el colorante cristal
Diplocococo en violeta son susceptibles a la
parejas penicilina y estreptomicina

Estreptococo en
cadena
Coco
(esférico)

Estafilococo en
racimo de uvas

Sarcina grupo de
ocho cocos
Tetracoco Grupo
de cuatro cocos

Espirilos En forma de espiral

133
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
134

Bacilos En forma de bastón

Otro aspecto a tener en cuenta en la clasificación de bacterias es la necesidad de


oxígeno para poder vivir, las bacterias que requieren de oxígeno para cumplir sus
procesos vitales se denominan aerobias, mientras que las que viven en ausencia de
oxígeno se llaman anaerobias.

Utilidad de las bacterias

Las bacterias son útiles:

• Para fijar el nitrógeno atmosférico que es tomado por las plantas y luego trasferido
a los animales.

• En la descomposición la materia orgánica muerta ayudando de esta manera a la


fertilización del suelo.

• En la producción de algunos antibióticos.

• En la producción de determinadas enzimas.

• En la elaboración de productos lácteos como: queso, yogur , mantequilla

• En la producción de vinagre.

• En la producción de encurtidos.

• En la depuración de aguas residuales.

• En el curtido de cueros.

• La Echerichia coli ha sido manipulada genéticamente para producir insulina

Enfermedades de origen bacteriano

Las bacterias pueden ocasionar enfermedades, entre las bacterias más perjudiciales
tenemos:

134
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
135

• La causante del tétano en caso de heridas contaminadas con Clostridium tetani,


bacteria que afecta el sistema nervioso causando rigidez muscular y la muerte

• La que ocasiona la gangrena gaseosa o putrefacción de tejidos, órganos


especialmente de las extremidades del hombre y de los animales siendo
necesaria su amputación.

• La bacteria contaminante es un Clostridium que penetra en heridas o puede ser


trasmitida por la ingestión de aguas contaminadas.
• El bacilo de Koch o Mycobacterium tuberculosis que causa la tuberculosis cuando
la persona enferma tose y en su esputo se libera el bacilo.

• El bacilo Salmonella typhi causante del tifo a través de alimentos contaminados


con excretas.

• El bacilo Corynebacterium diphtheriae que produce una infección del sistema


respiratorio, la difteria, que además lesiona el corazón y el sistema nervioso
ocasionando la muerte.

• La espiroqueta Treponema pallidum. que produce una enfermedad de trasmisión


sexual denominada sífilis.

• La Brucella, bacteria que causa la brucelosis por contacto con ganado infectado,
leche o carne contaminada y en la mujer provoca el aborto espontáneo.

Profundización: http://www.ugr.es/~eianez/Microbiologia/programa.htm

Lección 24 Los Protozoos

Características y clasificación

Son organismos microscópicos unicelulares, eucarióticos, se encuentran en su mayoría


en medios acuáticos, en el suelo húmedo aunque algunos son endoparásitos y otros
ectoparásitos. La mayoría son heterótrofos, sin embargo algunos son autótrofos. Se
reproducen por división binaria (la célula se divide en dos) tienen capacidad de
locomoción o desplazamiento. Según la forma como se desplazan los protozoos se
clasifican en: sacordinos, ciliados, flagelados y esporozoos.

135
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
136

Sacordinos Se desplazan por medio de pseudópodos (falsos pies), que son


prolongaciones de la célula que les sirven además para capturar el alimento, englobarlo
y formar una vacuola digestiva, donde el alimento es digerido por acción de enzimas.

Gráfica Entamoeba histolítica,


Tomada de: http://hpd.botanic.hr/bio/odgovori/odgovor315.htm

Son representantes de este filo:

- La ameba causante de infección del intestino o del hígado (amebiasis) por la ingestión
de aguas o alimentos contaminados con heces.

- La Entamoeba histolítica, que produce la disentería, enfermedad propia de los países


tropicales y que produce unas diarreas muy intensas.

- Los foraminíferos componentes del plancton (con un caparazón por cuyos orificios
salen los pseudópodos)

136
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
137

Ciliados

Gráfica Paramecium Tomada de Biodidac


http://http://personal.telefonica.terra.es/web/ayma/atlas_p.htm#Paramecium%20caudatum

Se desplazan y capturan el alimento por medio de cilios, filamentos cortos, vibrátiles y


numerosos que rodean su cuerpo. Se caracterizan por ser los únicos organismos con
dos núcleos uno para la reproducción y otro relacionado con la alimentación.

Ejemplos de este filo son: el Paramecio, la Vorticela, el Balantidium coli parásito del
intestino del hombre causante de inflamación del intestino.

Flagelados Para moverse utilizan unos filamentos largos y poco numerosos, llamados
flagelos. Muchos son de vida libre y otros son parásitos, como el Tripanosoma, que
produce la enfermedad del sueño. El tripanosoma es transportado por la saliva de la
mosca tsé-tsé, que contagia al picar a otros seres vivos.

Gráfica No: 46 Tripanosomas en sangre


Tomada de Biodidac. http://www.irabia.org/web/ciencias/microbiologia/microbios/protozoo.htm

137
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
138

Esporozoos

Gráfica. Plasmodio falciparum Tomada de:


http://www.cdc.gov/malaria/spotlights/index_100504.htm

Carecen de órganos de locomoción son parásitos de células del hombre y de los


animales .Se reproducen por división múltiple, formando numerosas esporas.

Un representante es el Plasmodio, que produce la malaria, también llamada paludismo.


El Plasmodium hembra infecta los glóbulos rojos causándoles su ruptura. El vector que
transmite la infección es el mosquito Anopheles que al picar a la persona le inyecta con
su saliva el esporozoito.

Importancia Biológica

Los protozoos tienen importancia en las cadenas alimentarias como componentes del
plancton

Profundización:

http://www.alaquairum.com/generalidades_protozoos.htm

Lección 25 Algas

Principales características

Son organismos autótrofos, todas poseen clorofila y algunas poseen otros pigmentos
que pueden enmascarar la clorofila, son eucarióticas con pared celular, habitan en medio
acuático, ambientes húmedos y pertenecen al reino de los Protistos. La mayoría de algas
son unicelulares como las algas doradas o diatomeas, otras como las algas verdes y las
rojas son multicelulares. Pueden vivir solitarias o en colonias. Ejemplo de algas verdes
tenemos: el volvox, y la spirogyra.

138
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
139

Su reproducción puede ser sexual y asexual: por fisión binaria o por producción esporas.

Gráfica 48. Alga Closterium


Tomada de http://www.joseacortes.com/galeriaimag/microorganismos/index.htm#hongos

Gráfica 48. Alga Spirogyra


Tomada de http://www.joseacortes.com/galeriaimag/microorganismos/index.htm#hongos

Importancia biológica

Representan un importante eslabón en la cadena alimentaria, formando parte del


plancton (productores primarios).

Son productoras de oxígeno

Útiles en la elaboración de fármacos

Las algas rojas son importantes en la formación de arrecifes de coral pues viven en
simbiosis con los corales brindándoles carbonato de calcio y suministrándoles el color
rojo brillante

Algunos grupos de algas rojas se utilizan en la producción de Agar que es un medio de


cultivo microbiológico.

139
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
140

Las algas marinas son una importante fuente alimenticia.

Lección 26 Hongos

Características

Los hongos son organismos unicelulares como las levaduras o pluricelulares como los
hongos filamentosos. Los hongos presentan pared celular compuesta de quitina que es
un polisacárido estructural que también se encuentra en el exoesqueleto de los
artrópodos. Habitan en ambientes húmedos y oscuros por ejemplo sobre el suelo, las
frutas el pan, el queso, las plantas.

Gráfica hongo del tomate


Tomada de: http://www.joseacortes.com/galeriaimag/microorganismos/index.htm#hongos

Su tipo de nutrición es la heterótrofa, algunos son parásitos de organismos vivos como


plantas, animales y el hombre, a quienes pueden ocasionar enfermedades, otros son
saprófitos es decir se alimentan de materia orgánica en descomposición y hay hongos
que crecen en simbiosis con las raíces de algunas plantas formando las micorrizas.

Los hongos pluricelulares forman una serie de filamentos denominados hifas; el conjunto
de hifas forman un micelio.

Existen tres tipos de hongos: Las setas formadas por un pie y una sombrilla como el
champiñón, las levaduras que son unicelulares y los mohos que presentan un aspecto de
pelusa.

140
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
141

Reproducción

Las levaduras se reproducen por gemación consistente en que a la célula madre le sale
un botón o gema que poco a poco se va desprendiendo de ella dando origen a una
levadura hija idéntica a la madre.

Los hongos filamentosos como el moho del pan, se reproducen de forma asexual, por
esporas que al caer en el sustrato adecuado dan origen a nuevas hifas, en este tipo de
reproducción el núcleo de la célula madre se divide en varios núcleos, cada uno toma
una parte del citoplasma de la célula madre que luego se rodea de una membrana
celular, la célula madre se rompe y se liberan varias células hijas.

Otro tipo de reproducción asexual presente en los hongos es por fragmentación del
micelio.

La reproducción sexual es otra forma de reproducción de los hongos.

Enfermedades causadas por hongos

En los animales los hongos pueden producir enfermedades graves en la piel y en los
órganos, por ejemplo:

El hongo Aspergillus afecta los pulmones y el sistema nervioso

Las Micotoxinas son toxinas producidas por hongos tóxicos genéticos (Aspergillus,
Penicillium, Fusarium) que se desarrollan en los productos agrícolas.

Candida albicans afecta a las aves causándoles la muerte, en el hombre afecta las
mucosas de la boca, garganta y tracto genitourinario.

Muchos hongos causan enfermedades en la piel del hombre y los animales.

Algunas setas causan envenenamiento.

Los hongos que contaminan los alimentos producen sustancias tóxicas que al ser
consumidas por el hombre o los animales les causan enfermedades letales como la
micotoxicosis. Las aflatoxinas producidas por ciertos hongos contaminantes de cereales
y concentrados también causan enfermedades e inclusive la muerte.

Muchos hongos causan enfermedades en la piel, uñas y cuero cabelludo, por ejemplo la
tiña.

Muchas enfermedades de las plantas son debidas a la presencia de hongos. Por ejemplo
la roya.

141
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
142

Importancia biológica

Los hongos no solamente causan enfermedades, sino que también son utilizados en
procesos industriales por ejemplo:

Del hongo Penicillium notatum se obtiene el antibiótico penicilina

Las levaduras se utilizan para la producción de cerveza

Algunos hongos son utilizados en la elaboración de queso Roquefort y en la maduración


del queso Camembert

Las enzimas de algunos hongos producen fermentación alcohólica en los jugos de frutas
proceso que se utiliza por ejemplo, para la elaboración de vino a partir de jugo de uva.

Algunos son comestibles como el champiñón.

Profundización: http://www.ual.es/GruposInv/myco-ual/clados.htm

142
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
143

Capitulo 5 Sistemática

Introducción

Debido a la gran diversidad de organismos en la naturaleza, los biólogos vieron la


necesidad de utilizar un sistema de clasificación que permitiera agruparlos por sus
características macroscópicas y microscópicas comunes, por su similitud en las etapas
de desarrollo, por su parecido en la composición bioquímica, por su semejanza genética,
con el fin de estudiarlos y así entender su origen, su evolución y las relaciones de
parentesco entre sí.

La taxonomía o, mejor dicho, los taxónomos, son los que se encargan de poner algo de
orden a la inmensidad de la vida, intentando averiguar las relaciones filogenéticas
existentes entre los distintos organismos.

Para conseguir esto se han ido creando una serie de categorías artificiales que no son
sino simples entelequias mentales producto, una vez más de nuestra mente
compartimentalizadora, que busca esquemas lógicos que le permitan reducir la enorme
diversidad existente a algo más sencillo y, por ello, medianamente comprensible.
Podemos hacer una excepción a esto con la especie, que parece ser algo "natural",
aunque sobre ello volveremos más adelante

143
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
144

Taxonomía

La taxonomía es una división de la sistemática relacionada con la clasificación de los


organismos según especializaciones. La Taxonomía proporciona los métodos, principios
y reglas para la clasificación de los organismos vivos en taxones (grupos) a los que se
les asigna un nombre y se los ubica dentro de categorías jerarquizadas.

Las categorías consisten en grupos o niveles dentro de grupos en la que el grupo mayor
abarca al menor. El agrupamiento de los organismos se basa en
las semejanzas y diferencias tanto naturales (estructurales) como filogenéticas
(relaciones de parentesco o afinidades con otros organismos ya desaparecidos).

La taxonomía proporciona información directa e inferida sobre la estructura del cuerpo y


la historia evolutiva de los organismos respectivamente.

144
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
145

Las semejanzas estructurales de los organismos vivientes se conocen bien en su mayor


parte. Pero los estudios de la historia evolutiva, para muchos de categoría superior
inclusive es incompleta.

Frente a esta dificultad taxonómica, se ha intentado establecer sistemas de clasificación


alternativa, que muestren el grado actual de evolución.

Sistemas de clasificación

De Robert Whittaker (1969)

Gráfica tomada de
http://www.euita.upv.es/varios/biologia/images/Figuras_tema18/tema18_figura8.jpg

El esquema filogenético presentado por Whittaker clasifica a los organismos vivientes en


5 reinos: Mónera, Protista, Hongos, Plantas y Animal.

Esta clasificación está basada en el tipo de organización celular: procariote y eucariote;


en la forma de nutrición: autótrofa por fotosíntesis o heterótrofa por absorción; en la
morfología y bioquímica de los organismos sin incluir análisis moleculares sin dar
implicaciones evolutivas.

145
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
146

Algunas características de estos reinos

Mónera microorganismos procarióticos (sin membrana nuclear), unicelulares, con tipo de


nutrición por absorción o fotosintética, con reproducción asexual, rara vez sexual, con
locomoción por medio de flagelos o inmóviles. Se encuentran en todos los medios.
Pertenecen a este reino las bacterias y las cianobacterias.

Protistas microorganismos unicelulares, eucarióticos (con membrana nuclear,


mitocondrias y otros organelos) su tipo de nutrición es la absorción, la ingestión, y la
fotosíntesis, pueden ser inmóviles o desplazarse por medio de flagelos, su reproducción
se puede realizar por procesos asexuales o por procesos sexuales. Pertenecen a este
reino los protozoos y las algas.

Fungi (hongos) organismos eucarióticos, en su mayoría multicelulares, multinucleares,


su nutrición es por absorción, son inmóviles, su reproducción incluye ciclos asexuales y
sexuales. Son representantes de este reino los hongos o mohos pluricelulares y las
levaduras unicelulares.

Plantae (plantas) organismos eucarióticos, multicelulares, la mayoría fotosintéticos


aunque algunos son simultáneamente absortivos, inmóviles con reproducción sexual y
asexual. Pertenecen a este reino, según Witthaker, los vegetales superiores, las algas
rojas, las algas pardas (Nota: actualmente se debe tener en cuenta que las algas se
clasifican más estrictamente como protistas), los helechos, los musgos.

Algunas plantas, al evolucionar, aunque mantienen su condición fotosintética han


adquirido una condición semiparásita, por la cual parte de su nutrición la consiguen por
absorción a partir de otras plantas que perforan para absorberles ciertos nutrientes. Un
ejemplo de este caso es el muérdago.

Algunas plantas insectívoras, además de su condición fotosintética, también adquieren


condición complementariamente absortiva al tomar nutrientes absorbidos de los insectos
que cazan.

Animalia (animal) Organismos eucarióticos, multicelulares, su nutrición es la ingestión y


la digestión, reproducción predominantemente sexual, pertenecen a este reino los
animales invertebrados (artrópodos, no artrópodos) y vertebrados (mamíferos, aves,
reptiles, anfibios y peces).

De Lynn Margulis (1985) A partir de la clasificación de Whittaker surge la de Lynn


Margulis-Schwartz basada en análisis moleculares. Lynn Margulis desarrolla la Teoría
endosimbiótica, su sistema de clasificación presenta implicaciones evolutivas, es más
filogenético y tiene la ventaja de hacer grupos más homogéneos. Cambia el reino
protistas por de PROTOCTISTAS, en el que incluye a protozoos, todas las algas
(excepto cianofíceas) y a los hongos inferiores.

146
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
147

Su sistema de clasificación comprende 5 reinos y 2 subreinos asi:

Reino Prokaryotae o Monera


Subreino: Archaebacteria
Subreino: Eubacteria
Reino Protoctista
Reino Plantae
Reino Fungi
Reino Animalia

De Carl Woese (1990)

Gráfica tomada de
http://www.euita.upv.es/varios/biologia/images/Figuras_tema18/tema18_figura8.jpg

Los trabajos de Carl Woese secuenciando ácidos nucleicos descubrió que dentro del
grupo de los procariotas se habían incluidos organismos que, a nivel molecular, eran
bastante divergentes, en 1990 planteón la necesidad de separar todos los seres vivos en
tres grandes dominios (categoría por encima del reino): Eubacteria (o bacteria
verdadera), Arqueobacteria o Archaea (que significa antiguo) y Eucarya.

Los dos últimos dominios (Archaea y Eucarya) están más próximos filogenéticamente
(siendo grupos hermanos, según la terminología cladista).

147
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
148

Las arqueobacterias se diferencian de las eubacterias por la composición de sus


paredes celulares, su metabolismo y habitat.

http://www.danival.org/100%20biolomar/4000notasbio/clas/clas_3_dominios.html

Los Archaea son células Procariotas. Al contrario de Bacteria y Eucarya, tienen


membranas compuestas de cadenas de carbono ramificadas unidas al glicerol por
uniones de éter y tienen una pared celular que no contiene peptidoglicano. Mientras que
no son sensibles a algunos antibióticos que afectan a las Bacterias, son sensibles a
algunos antibióticos que afectan a los Eucarya. Los Archae tienen rRNA y regiones del
tRNA claramente diferentes de Bacterias y Eucarya. Viven a menudo en ambientes
extremos e incluyen a los metanógenos, halófilos extremos, y termoacidófilos.

Bacteria (Eubacteria)

Las Bacterias son células Prokariotas. Como los Eukarya, tienen membranas
compuestas de cadenas de carbono rectas unidas al glicerol por uniones éster. Tienen
una pared celular conteniendo peptidoglicano, son sensibles a los antibióticos
antibacterianos tradicionales, y tienen rRNA y regiones del tRNA claramente diferentes
de Archaea y Eukarya. Incluyen a mycoplasmas, cyanobacteria, bacterias Gram-
positivas, y bacterias Gram-negativas.

Eukarya (Eukaryota)

Los Eukarya (escrito también Eucaria) son Eukariotas. Como las Bacterias, tienen
membranas compuestas de cadenas de carbono rectas unidas al glicerol por uniones
éster. Si tienen pared celular, no contiene ningún peptidoglicano. No son sensibles a los
antibióticos antibacterianos tradicionales y tienen rRNA y regiones del tRNA claramente
diferente de Bacterias y Archaea. Incluyen a protistas, hongos, plantas, y animales.

Los reinos "clásicos" no son más que unas pequeñas ramitas del gran árbol de la vida,
aunque son las ramitas que mejor conocemos. Por ejemplo, el reino Animalia, es una de
las ramas del dominio Eucarya.

Categorías taxonómicas supraespecíficas

Las clasificaciones de los organismos son jerárquicas.

Linneo trató de clasificar las especies conocidas en su tiempo (1753) para esto agrupo a
los organismos en categorías.

La clasificación Linneana se basó en la premisa que la especie era la menor unidad de


clasificación y que cada categoría o taxón se encuentra comprendida en una categoría
superior.

148
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
149

Las categorías taxonómicas básicas o taxones son 8, cuando se requiere mayor


precisión se recurre a otras categorías secundarias como: subespecie, superfamilia,
infraorden

Los taxones anteriormente mencionados y ordenados del más amplio al menos amplio
(en negrita las principales), son:

Reino
Filo
Superclase
Clase
Subclase
Superorden
Orden
Suborden
Infraorden
Superfamilia
Familia
Subfamilia
Tribu
Subtribu
Género
Subgénero
Especie
Subespecie

Como se puede comprobar en este esquema de categorías enlazadas, un género sería


un conjunto de especies relacionadas por criterios de parentesco; una familia sería un
conjunto de géneros relacionados, un orden un conjunto de familias, una clase un
conjunto de órdenes y un filo un conjunto de clases, todo esto guiado por nuestros
conocimientos en evolución, ya que se pretende que la clasificación se asemeje lo más
posible a la filogenia de los distintos organismos.

La especie es la única unidad que existe en la naturaleza, las demás categorías son
creadas artificialmente. La unidad básica para clasificar los seres vivos es la especie.

149
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
150

Gráfica Categorías supraespecíficas


Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm

Gráfica Categorías supraespecíficas


Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm

150
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
151

Clave taxonómica

Para facilitar la determinación y ubicación taxonómica de los seres vivos los taxónomos
utilizan una serie de claves, una de las más utilizadas es la dicotómica en la cual las
características tenidas en cuenta tienen 2 opciones de selección. Por ejemplo: a)
ausencia de pelo b) presencia de pelo; a) esqueleto óseo b) esqueleto cartilaginoso; a)
poseen exoesqueleto, b) Cuerpo blando

El concepto de especie

A uno le podría parecer que, ya que todo biólogo, sea cual sea su campo de estudio,
debe trabajar de algún modo con especies, se debería tener claro en todo momento que
cosa es una especie. Sin embargo esto dista mucho de ser así. Se han ido dando, a lo
largo de la historia, numerosos conceptos de especie, todos ellos válidos en el momento
en el que fueron enunciados, pero que han ido quedando desfasados por paso del
tiempo o están actualmente en discusión.

A continuación se enumeran una serie de definiciones para dicho concepto (las tres
últimas tomadas en parte de Casares, (1998), que reflejan el pensamiento que en cada
momento se tenía, no sólo sobre lo que era una especie, sino también sobre la vida en
general.

El concepto morfológico de especie fue el que se usó hasta que la evolución y se


convirtió en el paradigma científico en el que se basa la Biología actual.

Este concepto postula que las especies se pueden definir con base en unos caracteres
taxonómicos tipo, que representan la esencia de cada especie; por tanto, basta con
tomar un ser vivo, describirlo tal y como se nos presenta, y todos los que concuerden
con esa descripción serán de su misma especie, siendo de distintas especies aquellos
que difieran.

En este contexto, la variación intraespecífica no es más que un distractor antes de llegar


a la esencia de la especie. Por desgracia, este criterio, que debería haber sido ya
totalmente relegado a la Historia de la Ciencia, sigue vigente en los trabajos de algunos
taxónomos (algo que ellos negarían rotundamente), que ante la mínima diferencia con el
ejemplar tipo, describen nuevas subespecies y/o especies, con lo cual sólo consiguen
enredar las relaciones interespecíficas y dificultar el estudio de los distintos grupos.

El concepto nominal de especie, que tuvo en Darwin a uno de sus máximos


defensores, postula que no existen las especies, solo los individuos concretos, y que la
especie no es más que una abstracción hecha "para entendernos", contingente al
momento actual y carente de significado en el tiempo.

151
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
152

Sin embargo, a la hora de enfrentarse a la práctica cotidiana, los nominalistas describen


especies no sólo en el momento actual (algo que concordaría con su concepto de
especie) sino también en el registro fósil, algo no coherente con ese concepto.
Actualmente este concepto parece descartado.

El concepto biológico de especie; enunciado por Mayr en 1963, que la define como el
"conjunto de poblaciones que real y potencialmente pueden reproducirse entre sí, pero
que están aisladas de otros grupos similares", está basado en el "aislamiento" entre
especies, algo muy aceptado en teoría pero con numerosísimas excepciones en la
práctica. Presenta además problemas con especies de distribución espacial o temporal
amplia, y con organismos de reproducción asexual.

El concepto de reconocimiento de especie, enunciado por Paterson en 1985, que la


define como el "conjunto de individuos y poblaciones que comparten un mismo sistema
de fertilización", es decir, de reconocimiento entre individuos de distinto sexo y de
compatibilidad entre los genes aportados por cada uno. Bastante similar al anterior,
presenta los mismos inconvenientes.

El concepto evolutivo de especie, que la define como el conjunto de poblaciones que


comparten un destino evolutivo común a lo largo del tiempo. Consigue soslayar los
problemas de las definiciones anteriores, pero presenta uno nuevo: ¿qué se entiende por
destino evolutivo común a la hora de considerar organismos vivos?

Convención práctica Para efectos prácticos se puede adoptar convencionalmente la


siguiente definición tomada de Nelson G. (2000) Una especie es una población con
aislamiento reproductivo, que se reconoce por caracteres morfológicos particulares y que
ocupa un área geográfica definida.

Nomenclatura

Como de una forma más o menos implícita insinuábamos antes, cualquier tipo de estudio
en Biología, debe tener una cierta base taxonómica. Si no sabemos el nombre de los
animales o de las plantas con que trabajamos, nos resultará bastante difícil sacar algo en
claro de nuestros estudios.

Una vez que agrupamos a los organismos por especies, se nos presenta el problema de
qué nombre ponerle a cada especie, para poder hacer referencia a ella más adelante.

Al principio se intentó dar nombres vulgares a todas las especies, o se las intentó
describir abreviadamente mediante una frase que resaltara sus características más
conspicuas.

152
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
153

Tras varios intentos de varios autores, se acabó aceptando el sistema binomial de


Linneo, establecido en su obra Systema Naturae, cuya décima edición (1758) sirve como
punto de partida.

Este sistema asigna a cada especie un nombre compuesto de dos palabras. La primera
palabra corresponde al nombre científico del género y se escribe la primera letra con
mayúscula y en cursiva , mientras que la segunda palabra es el epíteto específico y
corresponde a la especie, la cual se escribe también en minúsculas y en cursiva, por
ejemplo, el nombre científico para el hombre es: Homo sapiens.

El nombre científico esta escrito en latín para permitir la comunicación universal.

Si se escribe a mano en cursiva, entonces el nombre científico se subraya.

En el caso de que todo el texto circundante esté escrito en cursiva, el nombre científico
se escribe normal.

Generalmente la comunidad académica dedicada al estudio de determinado reino de


especies biológicas utilizan algunos protocolos particulares para el proceso de
nomenclatura.

Por ejemplo, en el caso de que haya subespecie, ésta se escribe a continuación de la


especie, también en cursiva y sin ninguna palabra intercalada, hecho este que diferencia
el Código Internacional de Nomenclatura Zoológica (CINZ) del Código Internacional de
Nomenclatura Botánica, en el que aparece la abreviatura subsp. intercalada. Según el
CINZ, no tienen validez los táxones infrasubespecíficos.

Por ejemplo, el nombre científico del pez Aphyosemion bivittatum hollyi, el primer nombre
corresponde al género, el segundo a la especie y el tercero a la subespecie

Tras el nombre del taxón específico se incluye el nombre del autor y el año en que fue
descrito por primera vez, Por ejemplo, Poecilia reticulata Peters, 1859.

Si la planta o animal ha cambiado de nombre se pone entre paréntesis el nombre


anterior en letra no cursiva, pero el nombre del autor que lo describió sigue vigente .

En el ejemplo anterior, el pez fue denominado por Peters. Lebistes (género) entonces se
escribe Poecilia reticulata (Lebistes), Peters, 1859.

Los nombres científicos revelan datos interesantes, no sólo sobre la especie en cuestión,
sino también sobre el científico que la describió. Así abundan los nombres científicos
referidos a personajes de la mitología grecorromana, sobre todo en Lepidópteros.

153
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
154

Por ejemplo, dentro de la familia de los Papiliónidos, nos encontramos con Iphiclides
podalirius y Papilio machaon, dos bellas mariposas cuya similitud nos recuerda Linneo al
ponerles los nombres de dos médicos homéricos.

El estudio de estos nombres científicos nos puede proporcionar, como mínimo, unos
ratos muy interesantes.

En el mundo de los insectos las clasificaciones de especies nuevas son difíciles y,


muchas veces extenuantes, de lo que dan fe Stroudia difficilis, Paravespa gestroi
problemática y Bombus perplexus.

Estarían también los nombres puestos por entomólogos sin ninguna imaginación como
Coeleumenes secundus, Leptochilus tertius, Eudynerus nonus (sinonimizado con E.
octavus, para desesperación de los matemáticos).

Naturalmente en la Entomología también existe el peloteo, la egolatría y el autobombo,


del que podría dar fe el lepidóptero Cartwrightia carwrighti cuyo autor, un tal Carwright,
justificó la semejanza con su nombre alegando que había dedicado el nombre genérico a
su padre y el específico a su hermano.

Pero sin duda alguna el caso más alarmante sería el protagonizado por Embrick Strand;
en una revista dirigida por él mismo, y dentro de unos tomos dedicados al editor de la
revista, que casualmente también era él, apareció un artículo firmado por un tal Jan
Obenberger en el que se describían 92 nuevas especies de coleópteros, de las cuales
50 llevaban en alguna parte de su nombre científico un apelativo a Strand, ya usando su
nombre, su apellido, ambos o una derivación de ellos.

La construcción de árboles filogenéticos

Uno de los objetivos de la sistemática es la filogenia o sea la clasificación de las


especies teniendo en cuenta sus relaciones de parentesco.

La construcción de árboles filogenéticos, representa hipótesis evolutivas y trata de definir


grupos monofiléticos (ancestro y descendientes)

Para construirlos, se deben tener datos que provienen de las características usadas en
la clasificación.

Métodos de clasificación

Existen muchos métodos de clasificación, según la manera en que evalúan ciertos


caracteres, entre ellos

154
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
155

a. El tradicional o evolucionista,
b. La fenética o taxonomía numérica y
c. La cladística o filogenética

a. El tradicional o evolucionista

Los criterios usados en la sistemática tradicional enfatizan en tanto el antecesor común


(monofilésis), como en el peso de la divergencia entre grupos

Los organismos se agrupan en especies teniendo en cuenta:

• La utilización del concepto biológico de especie, basado en propiedades biológicas (la


comunidad reproductiva)

• La utilización de caracteres morfológicos y no morfológicos y la necesidad de valorar


adecuadamente (con métodos estadísticos si es necesario) la variabilidad.

• La necesidad de ponderar similitud morfológica y parentesco filogenético en caso de


conflicto

Sin embargo si tomamos como ejemplo la agrupación lagartos, cocodrilos, y aves como
se observa en la gráfica

Gráfica Determinación de grupo monofilético por ancestro común


Tomada de:
http://www.ciencias.uma.es/departamentos/bioanimal/sfonline/sistematicafilogenetica/tema_1.htm

Por su parecido entre sí (caracteres morfológicos) los lagartos y cocodrilos se agrupan


en un taxón Reptiles según la clasificación tradicional.

155
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
156

Pero si tenemos como criterio el parentesco filogenético, es decir, la proximidad de los


ancestrales comunes, aves y cocodrilos son ramas derivadas de un linaje común ( línea
naranja ) y por lo tanto, comparten un mayor grado de parentesco y se agrupan en un
taxón que se ha denominado "Arcosaurios", desde el punto de vista de la clasificación
cladista.

En conclusión al tomar en cuenta ambos criterios: similitud de caracteres morfológicos y


parentesco filogenético, como lo hace la clasificación tradicional o evolucionista, puede
presentarse conflicto en la agrupación y se requiere tomar el sistema de clasificación
más apropiado para ponderar el peso de los caracteres.

b. Fenética o taxonomía numérica

Agrupa a los organismos estrictamente por el número de caracteres que tienen en


común (similitud morfológica) y los cuantifica en índices de similitud o de distancia.

Dichos índices reflejan el parecido global entre los taxones.

Estos procedimientos se basan en el uso de matrices en las que se incluyen valores


numéricos de determinados atributos de las unidades a agrupar, unidades llamadas
OTUs (de operative taxonomical unity) que pueden ser individuos, muestras de
poblaciones o especies, etc.

Los atributos pueden ser medidas, proporciones, recuentos o caracteres


semicuantitativos (por ejemplo: 0=ausencia, 1=presencia).

La idea es que cuanto más similares sean dos OTUs, menor será la diferencia global
entre los valores de sus atributos.

De esta forma se pueden definir índices de distancia fenética, como por ejemplo la media
cuadrática de las diferencias entre cada par de atributos.

En el caso de identidad total entre dos OTUs dicho índice valdría 0, y será mayor cuanto
más disimilares sean los OTUs.

c. Cladística y Cladogramas

156
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
157

157
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
158

La cladística es un tipo de sistemática desarrollada por Willi Hennig, tratando de


conseguir un método mas objetivo de clasificar organismos

En sistemática filogenética o cladistica se agrupan los organismos en los taxones


exclusivamente en función de su grado de parentesco filogenético, es decir, en función
del orden relativo de sus ancestrales comunes.

Dado que los taxones están compuestos por organismos emparentados (descendientes
por tanto de un ancestral común a todos ellos) todos los taxones, todas las unidades de
clasificación, deberán ser estrictamente monofiléticos.

Una agrupación no monofilética, no formada por todos y cada uno de los descendientes
de un ancestral común, no puede ser constituida como taxón

Gráfica: Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm

En la gráfica anterior, el criterio o carácter huevo con amnios se usa para unir al grupo
de aves, reptiles y mamíferos que por compartir este carácter primitivo se deduce que
tienen un antecesor común.

La característica presencia de plumas y el pelo para separar aves y reptiles de


mamíferos en el caso de clasificación tradicional, no es un factor en las hipótesis
cladísticas, o cladograma, dado que son caracteres únicos en un taxón del grupo.

Una de las aplicaciones más interesantes de la cladística es la cuestión de los pandas.


En un principio se pensó que el oso menor era un oso, pero por sus caracteres cercanos
a los mapaches hizo que se los colocara cercanos a ellos.

El panda menor vive en la misma región de China que el panda gigante pero tiene
grandes similaridades con los mapaches, mientras que los estudios de hibridización de
ADN sugieren que el panda gigante esta en el clado de los osos y el panda menor en el
clado de los mapaches.

158
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
159

Ambos comparten un antecesor común, como lo indica los caracteres derivados o


evolutivos que comparten, además de los otros caracteres derivados de la evolución
convergente (adaptaciones a su única fuente de energía: el bambú).

Gráfica Divergencia de antecesor común


Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm

La gráfica muestra esta divergencia del antecesor común, e intenta además mostrar el
tiempo al cual ocurrió esa divergencia.

Un interesante y ameno relato respecto al tema de sí las aves se originan o no de los


dinosaurios se encuentra en Investigación y Ciencia, El origen de las aves y su vuelo, K.
Padian y L.M Chiappe, 1998.

Profundización:Curso intercativo de sistemática


http://www.ciencias.uma.es/departamentos/bioanimal/sfonline/sistematicafilogenetica/indi
ce.htm

159
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
160

UNIDAD 2. GENÉTICA

Capitulo 1 La información Genética

Introduccion

El término genética, introducido por Bateson en 1.906, se refiere al estudio de la


transmisión de la información de caracteres entre padres e hijos a través de los
cromosomas, mediante unidades hereditarias denominadas genes. Los caracteres son
físicos, comportamentales y fisiológicos.

Es así como todas las características que identifican a un organismo han sido
heredadas, es decir, provienen de la información genética contenida en los gametos
masculino, el espermatozoide, y femenino, el óvulo.

Lección 32

Cromosomas

En el proceso de división celular que se desarrolla en el núcleo de la célula, a partir de la


cromatina se forman los cromosomas que son un par de estructuras longitudinales
llamadas cromátidas unidas en un punto denominado centrómero.

Diferenciación de especies por número de cromosomas

Cada especie tiene un número característico de cromosomas en células somáticas (o


sea las de todo el cuerpo excepto las células sexuales). Ejemplo: el hombre posee 46
cromosomas en las células somáticas, en el perro el número de cromosomas se eleva a
78, en el mosquito son 6, en el ciruelo 48, en el chimpancé 48, en el gato 38 y en la papa
48.

Composición química básica de los cromosomas

Composición química básica de los cromosomas

Incluye los siguientes elementos: Ácido desoxirribonucleico o ADN y una proteína la


Histona que al unirse con el ADN forma las nucleoproteínas, que configuran casi hasta el
90% de los cromosomas.

Las principales funciones que debe cumplir un cromosoma son la de replicarse (producir
copias de si mismo), la de transmitirse de una célula a otra y de una generación a la
siguiente y la de expresar la información que contiene

160
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
161

Gráfica Estructura del ADN Tomada de:


http://www.ac-
rennes.fr/pedagogie/svt/cartelec/cartelec_lyc/premiere_s/vegetal/adn/adn.htm

Funciones del ADN

• Almacenamiento codificado de la información genética que determina las


características futuras de la célula y de los organismos que se desarrollen a partir
de dicha información.
• Replicación de si mismo o sea elaboración de una copia idéntica del ADN.
• Síntesis de ARN
• Transferencia mediante el ARN (ácido Ribonucleico) de la información genética a
las moléculas que realizan la síntesis de proteínas por intermedio de los
aminoácidos que son las unidades que forman las proteínas.

Replicación del ADN

Para poder transmitir la información genética codificada en el ADN este tiene que realizar
una copia de sí mismo antes de comenzar el proceso de división celular es decir durante
la interfase.

La replicación se realiza en el núcleo de la célula y consiste en la separación de las dos


cadenas de polinucleótidos del ADN (imaginese la apertura de una cremallera) y cada

161
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
162

una se convierte en una matriz o plantilla para el montaje de una nueva cadena idéntica
de ADN a la que se había separado.

Gráfica replicación del ADN Tomada de:


http://www.acrennes.fr/pedagogie/svt/cartelec/cartelec_lyc/premiere_s/vegetal/adn/adn.htm

En este proceso los nucleótidos de las dos cadenas que formaban el ADN, una vez
separadas, atraen nucleótidos complementarios previamente formados por la célula.
Luego los nucleótidos complementarios se unen con los de la plantilla mediante puentes
de hidrógeno para formar la estructura de una nueva molécula de ADN, semejando los
travesaños de una escalera en espiral.

La enzima ADN polimerasa une los nucleótidos complementarios que van encajando en
la plantilla enlazando el grupo fosfato de uno con la molécula de azúcar del siguiente. De
esta manera se construye la cadena lateral complementaria de ADN. El resultado final es
una nueva molécula de ADN con su estructura de doble hélice.

El significado genético de la replicación es el de conservar la información genética

Animación:

http://www.acrennes.fr/pedagogie/svt/cartelec/cartelec_lyc/premiere_s/vegetal/adn/adn.ht
m#animation

Transcripción o síntesis de ARN

http://www.ucm.es/info/genetica/grupod/Transcripcion/Transcripcion.htm#Transcripción

La transcripción consiste en la síntesis de ARN tomando como molde ADN y significa el


paso de la información contenida en el ADN hacia el ARN. La transferencia de la
información del ADN hacia el ARN se realiza siguiendo las reglas de complementaridad
de las bases nitrogenadas y es semejante al proceso de transcripción de textos, motivo
por el que ha recibido este nombre. El ARN producto de la transcripción recibe el nombre

162
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
163

de transcrito.

En las bacterias la transcripción y la traducción tienen lugar en el citoplasma bacteriano y


al mismo tiempo, son simultáneas. Sin embargo, en eucariontes la transcripción tiene
lugar en el núcleo y la traducción en el citoplasma.

La ARN polimerasa o enzima encargada de llevar a cabo la transcripción toma como


molde el ADN para sintetizar ARN y sigue las reglas de complementaridad, la A del ADN
empareja con U del ARN, la G con C, la C con G y la T con A. Existen experimentos que
demuestran que la proporción (A+U)/G+C) del ARN es similar a la proporción
(A+T)/(G+C) del ADN.

A (de ADN) se complementa con U (de ARN)


T (de ADN) se complementa con A (de ARN)
G (de ADN) se complementa con C (de ARN)
C (de ADN) se complementa con G (de ARN)

Las ARN polimerasas sintetizan ARN siempre en la dirección 5'P a 3'OH, decir el ARN
producto de la transcripción crece solamente en esta dirección.

2. Una secuencia del ADN, llamada promotor, le ordena a la célula comenzar a construir
ARN mensajero, a partir del gen que le sigue.

Se transcribe para cada gen una de las dos hélices de ADN, (Asimetría de la
transcripción) la hélice que se toma como molde para producir el ADN se la denomina
hélice codificadora o hélice con sentido y la otra hélice de ADN, la que no se
transcribe, se la denomina hélice estabilizadora o hélice sin sentido.

3. Luego, cabeza y cola, se agregan al ARNm antes de dejar el núcleo.

163
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
164

4. El ARNm terminado puede ahora servir de molde para la correspondiente proteína.


Sintesis de proteína

Genotipo

La información genética codificada que posee un organismo con relación a un rasgo


particular para transmitirla a la siguiente generación, se conoce como genotipo.

Fenotipo

La apariencia o sea el aspecto externo de los individuos resultante de la herencia y su


expresión durante el desarrollo en condiciones ambientales determinadas, se denomina
fenotipo. Por ejemplo el color de la piel, del cabello, de los ojos, la estatura, la forma del
cabello.

Genes

Los genes son pequeños segmentos de largas cadenas de ADN que determinan la
herencia de una característica determinada, o de un grupo de ellas. Los genes se
encuentran localizados en los cromosomas en donde se disponen en línea a lo largo de
ellos. Cada gen ocupa en el cromosoma una posición, o locus.

El conjunto de genes se denomina genoma.

164
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
165

Alelos

Cada célula somática posee dos cromosomas homólogos, esto quiere decir que para
cada carácter o rasgo se cuenta con un par de genes que pueden tener la misma o
diferente información. De esta manera cada organismo contiene un gen de origen
paterno y otro de origen materno. A este par de genes que determinan la expresión de
una característica o carácter particular se les llama alelos.

Cuando ambos alelos son iguales se aplica el término homocigoto a los individuos que
los poseen. En cambio, si los alelos son diferentes, el organismo es heterocigoto o
híbrido.

Cuando en un individuo heterocigoto sólo uno de los alelos se expresa se le llama


dominante y al otro que se mantiene oculto, se le conoce como recesivo.

El alelo dominante para un carácter determinado se representa con una letra mayúscula
y su alelo recesivo para el mismo carácter, se representa con la misma letra pero
minúscula.

Ejemplo: Para el carácter estatura alto o bajo el alelo dominante alto se representa con la
letra mayúscula A y el alelo recesivo bajo se representa con la letra a minúscula

Lección 33

Leyes de Mendel, Aplicación de las leyes de Mendel, ejemplos de


cruces

165
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
166

Leyes de Mendel

Después de una serie de experimentos con arvejas verdes y amarillas,


observando como se transmitían las características de los padres en varias
generaciones, el botánico Gregor Mendel planteó las leyes básicas de la
transmisión de la herencia.

Durante sus observaciones Mendel encontró que las características o rasgos


almacenados de manera codificada en los genes podían corresponder a
características puras homocigotas o características híbridas heterocigotas, en
este último caso se trata de un par de características alternativas de las
cuales una es dominante (o sea que es la que se manifiesta externamente en
el organismo), y la otra es recesiva, o sea que no se manifiesta
externamente, pero permanece en la dotación genética y puede hacerse
visible en las siguientes generaciones.

Con base en lo anterior Mendel formuló las siguientes leyes:

Ver video sobre las leyes de mendel aquí clic

Primera ley de Mendel - Ley de la Uniformidad Si se cruzan dos líneas


puras (homocigotas) para un determinado carácter, los descendientes de la
primera generación son todos iguales entre sí (igual fenotipo e igual genotipo)
e iguales (en fenotipo) a uno de los progenitores. Como cada uno de los
progenitores es homocigoto, solo le puede pasar a la descendencia el único
alelo o variante del gen que porta.

Segunda ley - Ley de la Segregación Los caracteres recesivos, al cruzar


dos razas puras, quedan ocultos en la primera generación (F1), reaparecen en
la segunda (F2) en proporción de 1:3 uno a tres respecto a los caracteres
dominantes. Los individuos de la segunda generación que resultan de los
híbridos de la primera generación son diferentes fenotipicamente unos de
otros; esta variación se explica por la segregación de los alelos responsables
de estos caracteres, que en un primer momento se encuentran juntos en el
híbrido y que luego se separan entre los distintos gametos

Ley de la Dominancia Cuando se cruzan individuos que difieren sólo en un


carácter por ejemplo color de la semilla (dominante y recesivo para este
determinado carácter), la primera generación F1 será semejante al progenitor
que tiene el carácter dominante. En este caso se habla de cruces
monohíbridos

166
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
167

Ley de la transmisión independiente o de la independencia de


caracteres

Establece que los caracteres son independientes y se combinan al azar. En la


transmisión de dos o más caracteres, cada par de alelos que controla un
carácter se transmite de manera independiente de cualquier otro par de alelos
que controlen otro carácter en la segunda generación, combinándose de todos
los modos posibles.

Cuando se cruzan progenitores con dos caracteres diferentes (ejemplo plantas


puras es decir homocigotas con color de las semillas amarillo dominante AA y
verde recesivo aa y forma de la semilla lisa dominante LL y rugosa recesiva
ll), estos caracteres se trasmiten a la descendencia en forma independiente.
En este caso se habla de cruces dihíbridos.

Esto se observa mejor mediante un cuadro de Punnet que permite visualizar


las posibles combinaciones para los cruces de caracteres.

Ejemplo: En los experimentos de Mendel se encontraron:

• plantas puras de arveja con semillas de color amarillo dominante, o sea


que sus alelos eran idénticos y se pueden denominar
convencionalmente AA
• plantas puras de arveja con semillas de color verde recesivas, las cuales
denominaremos aa
• plantas híbridas o heterocigotas con semillas de color amarillo, Aa
• plantas puras de arveja con semillas lisas como característica
dominante, LL
• plantas puras de arveja con semillas rugosas como característica
recesiva, ll
• plantas híbridas o heterocigotas de arveja con semillas lisas, Ll

Aplicación de las leyes de Mendel en la resolución de problemas sobre cruces


monohibridos

Para aplicar el cuadro de punnet analicemos primero el caso del cruce de plantas
homocigotas o puras de arveja con semillas amarillas dominantes AA y plantas puras
con semillas verdes recesivas aa (caso de cruce monohíbrido, o sea aplicado a un solo
carácter en este caso color de la semilla)

Se elabora una tabla o cuadro con tres columnas y tres filas (cuadro de Punnet):

167
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
168

En las celdas horizontales de color negro, van los alelos o genes aportados por el padre
(en este ejemplo el padre tiene un par de genes AA para el color de la semilla) pero cada
gameto solo recibe un gen para ese carácter por parte del padre.

Entonces se coloca un gen A por cada celda, o sea, un gen para la formación de cada
gameto en el cruce.

Esto se explica de acuerdo con la ley de la segregación Un par de genes es segregado


(separado) en la formación de los gametos.

En las celdas verticales negras se colocan los alelos o genes que aportará la madre a los
gametos. De igual manera se cumple la ley de la segregación. Entonces en cada celda
se coloca un solo gen:

Las celdas de color blanco corresponden a los gametos de los hijos que se formarán en
el cruce donde se restablecerá el número par de genes para cada gameto

168
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
169

Ejemplo: Si se cruzan semillas homocigotas amarillas dominantes AA con semillas


verdes homocigotas recesivas aa, o sea que tenemos el caso
AA x aa

En las celdas blancas se formarán los gametos resultantes del cruce o sea la
combinación o entrecruzamiento de los genes aportados por el padre y la madre para
ese carácter (se combina el gen de la primera celda horizontal con el gen de la primera
celda vertical).
En este momento se restablece el número par de genes en lo gametos formados (uno de
cada progenitor)

El resultado del cruce será:

Genotipo: 100 % Heterocigoto Aa

Fenotipo: 100% Semilla de color amarillo. (Ser puede explicar por la ley de la
dominancia: un gen del par determina la expresión fenotípica y enmascara al otro;

El polen de la planta progenitora aporta a la descendencia un alelo o gen para el color de


la semilla, y el óvulo de la otra planta progenitora aporta el otro alelo para el color de la
semilla; de los dos alelos, solamente se manifiesta aquél que es dominante (A), mientras
que el recesivo (a) permanece oculto.

Otro ejemplo. Si se toman semillas heterocigotas lisas Ll y se cruzan con semillas


homocigotas rugosas ll.

Ll x ll siguiendo el anterior procedimiento:

169
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
170

El resultado del cruce será

Genotipo: 50 % Heterocigoto Ll
Fenotipo: 50% semilla de forma lisa y 50% de semillas rugosas.

Interpretación de las leyes de Mendel - Ejemplos de Cruces

Primera ley de Mendel o Ley de la uniformidad de la primera generación filial (F1) o


Ley de la Dominancia

Cuando se aparean o cruzan organismos (fecundación) de raza pura (homocigotos) para


un determinado carácter, todos los individuos de la primera generación son iguales.

Ejemplo: Si se cruzan arvejas amarillas AA


con arvejas verdes aa toda la F1 resultante
del cruce será Aa de color amarillo. Aparece
aquí el concepto de Dominancia y
Recesividad.

Las arvejas amarillas AA son dominantes


sobre las arvejas verdes aa recesivas. La
primera generación o F1 es fenotípicamente
amarilla y genotipícamente heterocigota Aa
imagen tomada de
http://www.biotech.bioetica.org/ap1.htm

170
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
171

Codominancia: La primera ley de Mendel se


cumple también para el caso en que un
determinado gen de lugar a una herencia
intermedia y no dominante, como es el caso
del color de las flores del "dondiego de noche"
(Mirabilis jalapa). Al cruzar las plantas de la
variedad de flor blanca con plantas de la
variedad de flor roja, se obtienen plantas de
flores rosas. La interpretación es la misma
que en el caso anterior, solamente varía la
manera de expresarse los distintos alelos
imagen tomada de
http://www.biotech.bioetica.org/ap1.htm

La segunda ley de Mendel también llamada de la separación o segregación o


disyunción de los alelos

El experimento de Mendel: Mendel tomó


plantas procedentes de las semillas de la
primera generación del experimento anterior Aa
y las polinizó entre sí. Del cruce Aa x Aa obtuvo
semillas amarillas y verdes en la proporción 3:1.
Así pues, aunque el alelo que determina la
coloración verde de las semillas parecía haber
desaparecido en la primera generación filial,
vuelve a manifestarse en esta segunada
generación.

Interpretación del experimento.

Los dos alelos distintos para el color de la


semilla presentes en los individuos de la
primera generación filial, no se han mezclado ni
han desaparecido, simplemente ocurría que se
imagen tomada de manifestaba sólo uno de los dos.
http://www.biotech.bioetica.org/ap1.htm
Cuando el individuo de fenotipo amarillo y
genotipo Aa, forme los gametos, se separan los
alelos, de tal forma que en cada gameto sólo
habrá uno de los alelos y así puede explicarse
los resultados obtenidos

171
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
172

Retrocruzamiento

En el caso de los genes que manifiestan


herencia dominante, no existe ninguna
diferencia aparente entre los individuos
heterocigóticos (Aa) y los homocigóticos (AA),
pues ambos individuos presentarían un fenotipo
amarillo.

La prueba del retrocruzamiento, o simplemente


cruzamiento prueba, sirve para diferenciar el
individuo homo del heterocigótico. Consiste en
cruzar el fenotipo dominante con la variedad
homocigota recesiva (aa). Si es homocigótico,
toda la descendencia será igual, en este caso
se cumple la primera Ley de Mendel. Si es
imagen tomada de heterocigótico, en la descendencia volverá a
http://www.biotech.bioetica.org/ap1.htm aparecer el carácter recesivo en una proporción
del 50%

Tercera ley de Mendel o de la herencia independiente de caracteres:

Hace referencia al caso de que se contemplen


dos caracteres distintos. Cada uno de ellos se
transmite siguiendo las leyes anteriores con
independencia de la presencia del otro carácter.
El experimento de Mendel: Mendel cruzó
plantas de guisantes de semilla amarilla AA y
lisa BB con plantas de semilla verde aa y
rugosa bb(Homocigóticas ambas para los dos
caracteres

Las semillas obtenidas en este cruzamiento


eran todas amarillas y lisas, cumpliéndose así
la primera ley para cada uno de los caracteres
considerados, y revelándonos también que los
alelos dominantes para esos caracteres son los
que determinan el color amarillo y la forma lisa.
Las plantas obtenidas y que constituyen la F1
son dihíbridas (AaBb).
imagen tomada de
http://www.biotech.bioetica.org/ap1.htm

172
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
173

173
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
174

Segunda generación filial F2

Se cruzan entre sí plantas de la F1, teniendo


en cuenta los gametos que formarán cada una
de las plantas

Los alelos de los distintos genes se transmiten


con independencia unos de otros, ya que en la
segunda generación filial F2 aparecen
guisantes amarillos y rugosos y otros que son
verdes y lisos, combinaciones que no se
habían dado ni en la generación parental (P),
ni en la filial primera (F1).

imagen tomada de
http://www.biotech.bioetica.org/ap1.htm

imagen tomada de http://www.biotech.bioetica.org/ap1.htm

174
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
175

Interpretación del experimento: Los resultados de los experimentos de la tercera ley


refuerzan el concepto de que los genes son independientes entre sí, que no se mezclan
ni desaparecen generación trás generación. Para esta interpretación fue providencial la
elección de los caracteres, pues estos resultados no se cumplen siempre, sino
solamente en el caso de que los dos caracteres a estudiar estén regulados por genes
que se encuentran en distintos cromosomas. No se cumple cuando los dos genes
considerados se encuentran en un mismo cromosoma, es el caso de los genes ligados.

Lección 34

Síntesis de proteínas

Animación en Power Point

http://www.cnice.mecd.es/eos/MaterialesEducativos/mem2001/biologia/citoplasma/organ
elas3.htm

Para la síntesis de proteínas se requieren:

• Subunidades ribosómicas pequeñas y grandes

• Cadena de ARN mensajero (ARNm), que es el portador de las instrucciones


codificadas que especifican la secuencia de aminoácidos

• ARN de transferencia (ARNt)

Estos ARNt forman enlaces covalentes con los aminoácidos, con los que forman
aminoacil ARNt, mediante reacciones catalizadas por enzimas específicos. Esto significa
que a cada ARNt le corresponde su propio aminoácido. Cada ARNt contiene, además,
un anticodón que reconoce el codón del ARNm que corresponde al aminoácido del que
es portador.

Todo este proceso de síntesis proteica o traducción a partir de una molécula de RNAm,
requiere que previamente se haya producido la transcripción, mediante la cual a partir de
una molécula de DNA se origina una de RNAm, que luego servirá de "molde" para la
síntesis de nuevas proteínas.

El proceso incluye las siguientes fases:

Etapa 1: se fija un ARNm a la subunidad pequeña. El sitio P de la subunidad ribosomal


pequeña queda ocupado por un ARNt de iniciación, cuyo anticodón reconoce el codón
triplete AUG, que codifica al aminoácido metionina

175
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
176

Etapa 2: la subunidad ribosomal grande se fija a la subunidad pequeña, y el ribosoma se


desplaza a lo largo de la cadena de ARNm, en dirección desde 5' hasta 3', hasta que el
siguiente codón queda alineado con el sitio A de la subunidad pequeña

Etapa 3: un nuevo aminoacil ARNt (es decir, un ARNt que lleva un aminoácido) compara
a su anticodón con el codón del RNAm; si concuerda, el ARNt se fijará sobre el sitio A

176
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
177

Etapa 4: los aminoácidos en los sitios A y P forman un enlace peptídico - El ARNt del
sitio P pasa su aminoácido al ARNt del sitio A, que ahora tiene unidos sobre sí a los dos
aminoácidos (proceso catalizado por la enzima peptidiltransferasa)

Etapa 5: el ARNt desaminado deja libre el sito P, y el ARNm con sus dos aminoácidos
se mueve desde el sito A hacia el sitio P. Al mismo tiempo, el ribosoma se desplaza a lo
largo de la cadena de ARNm hasta que el siguiente codón queda alineado con el sitio A
de la subunidad ribosomal pequeña

Etapa 6: se repiten las etapas 3 a 5, con lo que se alarga la cadena polipeptídica hasta
que se llega al codón de terminación (que pueden ser tres: UAG, UAA o UGA),
responsable de detener el proceso de traducción

Etapa 7: cuando el sitio A de la unidad ribosomal pequeña llega a un codón de


terminación, se fija en el sitio A un factor liberador, encargado de descargar a la cadena
polipeptídica recién formada desde el sitio ARNt del sitio P hacia el citosol

Etapa 8: el ARNt se libera desde el sitio P, el factor liberador se libera desde el sito A, y
las subunidades ribosómicas grande y pequeña se disocian del ARNm quedando libres
en le citosol.

En definitiva, los ribosomas participan en la síntesis de las proteínas que tendrán un


destino u otro según que sean formadas por ribosomas libres o por polirribosomas
adheridos a las membranas del Retículo endoplasmático rugoso

177
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
178

178
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
179

Capitulo 2 Biotecnología

Lección 36. Los pasos de la ingeniería genética

http://www.agronort.com/informacion/abcbiotec/abcbio4.html

El ADN sirve como molde para la síntesis del ARN

1. Una de las bases del ARN es diferente

A (ADN) se complementa con U (ARN)


T (ADN) se complementa con A (ARN)
G (ADN) se complementa con C (ARN)
C (ADN) se complementa con G (ARN)

2. Una secuencia del ADN, llamada promotor, le ordena a la célula comenzar a construir
ARN mensajero, a partir del gen que le sigue.

3. Luego, cabeza y cola, se agregan al ARNm antes de dejar el núcleo.

4. El ARNm terminado puede ahora servir de molde para la correspondiente proteína.

El Código genético

Traducción de ARN en proteína

1. Cada tres bases en el ARN, forman un codón correspondiente a ciertos aminoácidos.

179
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
180

2. La mayoría de los aminoácidos pueden ser codificados por mas de un codón. Aac.

Aac. codones
Cisteina UGU,UGG
Prolina CCU,CCC,CCA,CCG
Histidina CAU,CAC

Stop= UAA, UAG, UGA

3. También hay codones, que ordenan a la maquinaria de la célula, detener la síntesis de


la cadena proteica.

4. Todo este proceso es llevado a cabo por estructuras complejas, llamados ribosomas,
junto con enzimas y moléculas especiales de ARN.

Construcción de una Proteína:

Traducción del ARNm

1. Los ribosomas se mueven a lo largo del ARNm y van adosando los aminoácidos
correspondientes a cada codón.

2. Los aminoácidos se unen entre si por ligaduras de péptidos.

180
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
181

3. La cadena proteica toma una forma tridimensional, basada en la secuencia particular


de aminoácidos.

4. Esta forma particular, es la que le confiere propiedades y funciones únicas.

Resumen:

Pasos desde ADN a Proteína

1. Un gen es parte del ADN, en un cromosoma.

2. El código genético es "transcripto" en el ARN mensajero.

3. El ARNm forma una cabeza y una cola para dejar el núcleo.

4. El código en el ARNm es traducido, construyendo las largas cadenas de aminoácidos


que forman una proteína.

5. La proteína se organiza en su forma funcional.

Los pasos de la Ingeniería Genética

1. Identificar un carácter deseable, pero que no pueda ser manejado por los métodos
clásicos de mejoramiento.

2. Encontrar algún organismo que lo exprese.

3. Encontrar el gen responsable del carácter deseado, en dicho organismo.

4. Combinar dicho gen con otros elementos necesarios para que este sea funcional en la
planta.

5. Mover los genes a las células de la planta.

6. Encontrar las células modificadas exitosamente, y regenerarlas en plantas


completamente funcionales.

181
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
182

Posibilidades de la Biotecnología

Ejemplos

Caracteres de Protección Caracteres de Calidad


Resistencia a Insectos Demora de la maduración
Tolerancia a Herbicidas Aceites modificados
Resistencia a Hongos Proteínas modificadas
Resistencia a Virus Alto contenido de sólidos
Resistencia a Bacterias Producción vegetal de anticuerpos,
enzimas, etc.
Resistencia a Nematodos Búsqueda de fuentes para genes
deseados

Búsqueda de fuentes para genes deseados

1. La bacteria de suelo, Bacillus


thuringiensis (Bt), tiene genes para
diversas proteínas, selectivamente
toxicas para ciertos insectos.

2. El actinomycete de suelo,
Streptomyces tiene un gen para una
enzima que desdobla la molécula del
Glufosinato de Amonio (herbicida).

3. Una línea mutante de Arabidopsis


thaliana, tiene un gen para una versión
de la enzima EPSPS, menos sensible al
Glifosato

182
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
183

Herramientas Básicas

Enzimas "para cortar y pegar"


1. Las enzimas
de restricción
cortan ADN, solo
en ciertas
secuencias
especificas.

2. Muchas dejan
"extremos
pegajosos", de
manera que otras
piezas cortadas
con la misma
enzima, se ligan
automáticamente.
3. El "extremo
pegajoso" de una
pieza puede
hibridar con el de
otra pieza,
cortada por la
misma enzima.
4. Otras enzimas
llamadas ligasas,
terminan las
uniones.

Clonado

183
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
184

1. Además de su principal
cromosoma, muchas bacterias
tienen también pequeñas piezas
circulares de ADN, llamadas
plásmidos. Estos tienen a
menudo, genes de resistencia a
antibióticos.

2. Los plásmidos son fáciles de


manejar en tubos de ensayo,
para "cortar y pegar" nuevas
piezas de ADN

3. Los plásmidos modificados,


pueden ser colocados de nuevo
en la bacteria, y serán copiados
en cada duplicación celular.

4. De esta forma es posible


obtener un gran numero de
copias del gen, tan solo
incrementando la bacteria.

184
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
185

Capturando el Gen

Tomar la pieza de ADN buscada desde el organismo donante


1. Se extrae ADN de muchas células, y se corta en
pequeñas piezas.

2. Las piezas se mezclan con plásmidos cortados con la


misma enzima, las cuales al conjugarse conforman
distintos plásmidos.

3. Los plásmidos, colocados de nuevo en bacterias, son


ahora distintos, y entonces pueden ser separados.
4. Ahora, cada pieza de ADN puede copiarse tanto como
sea necesario.

Encontrando el Gen correcto

1. Los plásmidos usados en la bacteria


(vectores clonados), también contienen
un gen de resistencia a antibióticos, de
manera que solo aquellas que tengan el
nuevo plásmido recombinante, crecerán
en el medio de cultivo. Este gen se llama
"marcador selectivo".

185
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
186

2. Cada clon (progenie de bacterias con


la nueva secuencia de ADN), puede ser
probada para saber si contiene el gen
deseado. Hay diversas maneras,
dependiendo del carácter en cuestión

Lo que acompaña al Gen

La construcción
1. Los genes deben "estar prendidos" para expresarse; para eso se
usa el promotor.

3. Es necesario saber cuales (poco frecuentes) células han sido


modificadas; para eso se agrega un gen marcador selectivo.

4. La combinación terminada del gen + promotor + marcador


selectivo + terminadores, se llama construcción o inserto.

186
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
187

Promotores: dónde se "prenderá" el gen?

1. Para que el ADN transcriba el gen en ARNm, debe haber un


promotor delante de la secuencia.

2. Algunos promotores activan el gen en casi todas las células de la


planta (Pr. Constitutivos).

3. Algunos solo lo hacen en las partes verdes.

4. Otros promotores solo trabajan en tejidos específicos, como polen,


raíz o tejidos dañados.

Marcadores Selectivos

1. El tipo mas común es el de un gen que codifica para una enzima, que desdobla algún
antibiótico o componente del herbicida.

2. El gen marcador también necesita un promotor y terminador.

nptll -------------->kanamicína

bar -->glufosinato de amonio

187
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
188

3. Normalmente la planta moriría ante el químico. Solamente sobrevivirá si ha sido


exitosamente modificada para poseer esta enzima.

Inserto listo para ser transferido a una planta

Lección 37

Transfiriendo los genes a las plantas.

Opciones de Transformación.

Métodos

1. Agrobacterium. Uso de una bacteria como "Ingeniero Genético Natural". La bacteria


conteniendo el inserto, infecta las células de la planta produciendo la recombinación
genética.

188
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
189

2. Acelerador de Partículas (Gene Gun). Un cañón artificial bombardea micropartículas


con el inserto, sobre la célula.

3. Electroporación. Uso de carga eléctrica para que el ADN atraviese la membrana


nuclear. La corriente, fuerza el paso de los insertos al interior del núcleo.

4. Polietilenglicol. La exposición de las membranas al PEG, facilita el movimiento de las


moléculas de ADN.

5. Silicon Wiskers. Inyección mediante fibras microscópicas. Las fibras atraviesan las
membranas, llevando los insertos.

Transformación por Agrobacterium

Fundamentos

1. El patógeno de suelo Agrobacterium


tumefaciens, naturalmente inserta su ADN
(plásmido Ti), en las células expuestas de
sus huéspedes, en tejidos radiculares
dañados.
2. Este ADN extraño se incorpora y
recombina con el ADN propio de la planta
huésped, dividiéndose y creciendo al azar,
como un tumor.

3. El ADN de Agrobacterium toma el control


de las células del tumor, causando la síntesis
de aminoácidos inusuales que sirven de
soporte nutricional a la bacteria.

Preparando un gen para una transformación mediante Agrobacterium

1. Las secuencias del plásmido Ti,


responsable de la virulencia de la
bacteria, se remueven (vírgenes).

189
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
190

2.En otra bacteria, se ubica el gen


deseable, entre las dos secuencias de
borde del plásmido Ti.

3. Se integra el inserto que contiene el


gen deseable, dentro del plásmido Ti, al
ser incorporado nuevamente dentro del
Agrobacterium.
4. Bacteria clonada, lista para
transformar.

Resumen

Transformación mediante Agrobacterium

1. Armar dos construcciones; una con los genes a incorporar (gen principal y marcador),
y otra con las secuencias necesarias del plásmido Ti.

2. Integrar todo esto en un solo plásmido, en Agrobacterium, y usar este clon para
infectar tejido vegetal.

3. Exponer el tejido tratado al agente químico selectivo (antibiótico o herbicida). Solo las
células exitosamente transformadas, sobrevivirán.

4. Usar métodos de cultivo de tejidos para regenerar plantas viables de las pocas células
sobrevivientes.

Transformación por Acelerador de Partículas (Gene Gun)

1. Incorporar el inserto en un
plásmido y hacer un gran
numero de copias en una
bacteria.

190
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
191

2. Extraer los plásmidos y


cubrir con ellos pequeñas
partículas de tungsteno (1
micrón).
3. Disparar las partículas
mediante una explosión, sobre
los tejidos.

4. Exponer las células al


agente selectivo para
regenerar aquellas
exitosamente transformadas.

Porque un evento de transformación es raro y costoso?

1. En todo el proceso hay muchos pasos "poco probables" involucrados, debido a


los siguientes obstáculos:

Tener que introducir ADN en células vivas.

Lograr que el ADN sea insertado en forma estable, en los propios cromosomas de las
células, haciendo viable su replicación.

Lograr que esta inserción sea funcional

2. No hay forma de controlar adonde se ubicara el ADN extraño:

Podría no ser funcional, dependiendo del sitio de inserción.

Podría afectar o anular la acción de algún gen importante de la planta.

Lección 37

Los primeros desafíos

Tolerancia a Glifosato

Objetivo: Transformar plantas sensibles en altamente tolerantes, para su aplicación


directa.

191
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
192

Origen: El Glifosato inhibe una enzima vegetal (EPSPS), necesaria para el crecimiento
celular

Intento 1: Adicionar una nueva copia del gen para EPSPS, de petunia, con un promotor
fuerte, para aumentar la concentración de EPSPS en la planta, y lograr tolerar mayores
dosis de Glifosato.

Resultado 1: Aun con mas EPSPS, las plantas fueron todavía muy sensibles, como para
ser de interés comercial.

Tolerancia a Glifosato: 2do Intento

Objetivo: Generar mutantes de algún organismo fácil de cultivar, hasta hallar algún
individuo tolerante a Glifosato.

Intento 2: Un aislamiento de Agrobacterium resulta menos sensible, pero su EPSPS es


aun funcional; se la transfiere a plantas TG.

Resultado2: En soja, ambos mecanismos sumados funcionan adecuadamente, no así


en maíz, que requiere trabajo adicional.

Tolerancia a Glifosato: 3er Intento

Objetivo: Encontrar un microorganismo que produzca una enzima capaz de detoxificar


la molécula de Glifosato (GOX de Achromobacter sp.).

Intento 3: Juntar los efectos del gen para esta enzima con el gen mutante de EPSPS, en
plantas de maíz.

Resultado 3: Este intento, involucrando ambos genes resulto efectivo, logrando que las
plantas estén protegidas por producir EPSPS insensible al herbicida, mas la capacidad
de detoxificar parte del mismo.

Tecnología Bt

Objetivo: Lograr que la planta produzca su propio insecticida.

Origen: Algunos insectos pueden ser controlados mediante la aplicación de


Deltaendotoxinas de Bacillus thuringiensis. Estas toxinas son altamente selectivas e
inocuas para el hombre y el ambiente, pero se desdoblan rápidamente cuando están
expuestas a la luz ultravioleta.

Intento 1: Poner el gen completo para la toxina-proteína en la planta, con un fuerte


promotor que funcione en todos los tejidos.

192
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
193

Resultado 1: Aun con una transformación exitosa, la planta no producía suficiente


proteína para protegerse a si misma.

Tecnología Bt: 2do Intento

Origen: Cuando la toxina natural (potoxina) entra en el intestino del insecto, se desdobla
en la toxina activa, de cadena mas corta, por acción de las enzimas del insecto.

Intento 2: Insertar un gen truncado que solo codifique para la porción de la proteína
correspondiente a la toxina activa.

Resultado 2: La planta produce mucho mas toxina ahora, pero seria conveniente aun
mas.

Tecnología Bt: 3er Intento

Origen: La planta "prefiere" usar ciertos codones para algunos aminoácidos. Cuando no
tiene estos codones "preferidos" produce mucha menos proteína. Muchos de los
codones en un gen bacterial, no son los "preferidos", por lo tanto el gen no se expresa
bien en la planta.

Intento 3: Realizar cambios en el ADN del gen, base por base, de manera que codifique
para los mismos aminoácidos, pero usando los codones "preferidos".

Original TTAGCACCCTAGGCTAGCGTA

Modificada TTACCACCCTACGCTAGCCTA

Resultado 3: Cuando el gen es trucado y además tiene los codones "preferidos",


expresa suficiente toxina para su autoprotección.

Links

http://www.agronort.com/links.html#Biotecnología

EL PROYECTO GENOMA HUMANO Aspectos científicos

USDA - Novedades, regulación, etc...

Plant Genome Information Resource

Intercambio información s/ cultivo de tejidos - Texas A&M

Regulación (OECD, IANB, G-VIII)

193
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
194

Biotecnología Aplicada - conceptos elementales, ética, etc..

Recursos y herramientas de biología molecular

Portal "porque biotecnología" de A.S.A. (Asociación Semilleros Arg.)

Checkbiotech.org - Información y novedades de biotecnología

National Center for Biotechnology Information

Council for Biotechnology Information

Glosario de términos de la Biotecnología

Genetic Engineering News

Galería gráfica de procesos relacionados a la biotecnología

Ag BioTech InfoNet

Transgenic crops (Colorado State U.)

agbios Agriculture & Biotechnology Strategies Inc. (Canada)

AgBioForum - Economía y gerencia, en biotecnología agrícola.

Biotecnología Agrícola y Pobreza

Electronic Journal of Biotechnology - Universidad Católica de Valparaíso

194
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
195

UNIDAD 3. ECOLOGÍA Y EVOLUCIÓN

Capitulo 1 Ecología

Lección 39

Ecología

El término ecología lo propuso en 1869 el biólogo alemán Ernst Haeckel, para


sistematizar el conocimiento referido al estudio del entorno viviente. Este término se
origina en los vocablos griegos “oikos” (casa o lugar donde vivimos) y “logos” (estudio).

Los graves problemas de contaminación regional y planetaria, han convertido a la


ecología en una disciplina de vital importancia para descubrir y diseñar estrategias de
manejo y de uso sostenible de los recursos de la biosfera.

195
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
196

Organización del conocimiento ecológico La ecología estudia grupos de organismos


en sus relaciones con el medio ambiente. Los grupos de organismos pueden estar
asociados a tres niveles de organización: poblaciones, comunidades y ecosistemas.

Población Una población es un grupo de individuos de cualquier clase de organismo


correspondiente a una sola especie.

Comunidad biótica Agrupa todas las poblaciones que ocupan un área física definida.

Ecosistema

La comunidad, junto con el medio ambiente físico no viviente comprende un ecosistema

Campos problémicos que aborda el ecólogo

Al interior de las cadenas alimenticias de un ecosistema, se analiza por ejemplo: quién


vive a la sombra de quién, quién devora a quién, quién desempeña un papel en la

196
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
197

propagación y dispersión de quién, y cómo fluye la energía de un individuo al siguiente


en una cadena alimenticia.

El ecólogo trata de definir y analizar aquellas características de las poblaciones distintas


de las características de individuos y los factores que determinan la agrupación de
poblaciones en comunidades. En ocasiones el estudio ecológico se centra en un campo
de trabajo muy local y específico, pero en otros casos se interesa por cuestiones muy
generales.

Un ecólogo puede estar estudiando; cómo afectan las condiciones de luz y temperatura
a los árboles de un robledal, mientras otro estudia cómo fluye la energía en la selva
tropical; pero lo específico de la ecología es que siempre estudia las relaciones entre los
organismos y de estos con el medio no vivo, en unidades de análisis denominadas
ecosistemas.

El concepto de ecosistema es vital para comprender el funcionamiento de la naturaleza.


Es un error considerar que nuestros avances tecnológicos: coches, grandes casas,
industria, etc. nos permiten vivir al margen del resto de la biosfera. El estudio de los
ecosistemas, de su estructura y de su funcionamiento, nos demuestra la profundidad de
estas relaciones.

Los ecosistemas como unidad de estudio

El ecosistema es el nivel de organización de la naturaleza que se convierte en la unidad


básica de estudio interesa a la ecología.
Dentro de los ecosistemas los organismos viven en poblaciones que se estructuran en
comunidades. El término autoecología se refiere a estudios de organismos individuales,
o de poblaciones de especies aisladas, y sus relaciones con el medio ambiente. El
término contrastante, sinecología, designa estudios de grupos de organismos asociados
formando una unidad funcional del medio ambiente. Es decir analiza las numerosas
relaciones entre comunidades y ecosistemas.

Los ecólogos emplean el término ecosistema para indicar una unidad natural con partes
vivientes (factores bióticos) o inertes (factores abióticos), que interactúan mutuamente
para producir un sistema estable, en el cual el intercambio de sustancias entre los
organismos vivos y los elementos inertes es de tipo circular.

Entre los factores abióticos tenemos: el agua, el aire, el viento, la temperatura, la luz, los
minerales del suelo, la presión atmosférica; estos factores afectan y permiten la
supervivencia de los seres vivos o factores bióticos como los microorganismos, las
plantas, los animales

Un ecosistema puede ser tan grande como el océano o un bosque, o uno de los ciclos
de los elementos, o tan pequeño como un acuario que contiene peces tropicales, plantas

197
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
198

verdes y caracoles. Para calificar una unidad como ecosistema, la unidad ha de ser un
sistema estable, donde el recambio de materiales sigue un camino circular. Un ejemplo
clásico de un ecosistema bastante compacto para ser investigado en detalle cuantitativo
es una laguna o un estanque. La parte no viviente del lago comprende el agua, el
oxígeno disuelto, el bióxido de carbono, las sales inorgánicas como fosfatos y cloruros
de sodio, potasio y calcio, además de muchos compuestos orgánicos.

En un lago, hay dos tipos de productores: las plantas mayores que crecen sobre la orilla
o flotan en aguas poco profundas, y las plantas flotantes microscópicas, en su mayor
parte algas, que se distribuyen por todo el líquido, hasta la profundidad máxima
alcanzada por la luz. Estas plantas pequeñas, que se designan colectivamente con el
nombre de fitoplancton, no suelen ser visibles, salvo si las hay en gran cantidad, en cuyo
caso comunican al agua un tinte verdoso. Suelen ser bastante más importantes como
productoras de alimentos para el lago que las plantas visibles.

Los organismos consumidores son heterótrofos, por ejemplo, insectos y sus larvas,
crustáceos, peces y tal vez algunos bivalvos de agua dulce. Los consumidores primarios
son los que ingieren plantas; los secundarios los carnívoros que se alimentan de los
primarios, y así sucesivamente. Podría haber algunos consumidores terciarios que
comieran a los consumidores secundarios carnívoros.

El ecosistema se completa con organismos descomponedores o saprofitos como


bacterias y hongos, que desdoblan los compuestos orgánicos de células procedentes de
organismos muertos, y con sustancias inorgánicas que pueden usarse como materia
prima por las plantas verdes.

Aún en el ecosistema más grande y más completo puede demostrarse que está
constituido por los mismos componentes: organismos productores, consumidores y
desintegradores, y componentes inorgánicos.

Biocenosis y biotopo

La estructuración de un ecosistema reúne la biocenosis o conjunto, en equilibrio


dinámico, de organismos vivos, y las características del biótopo o sea de la extensión
física en que se encuentra circunscrita la unidad ecosistémica que se va a estudiar.

El concepto de ecosistema aún es más amplio que el de comunidad porque un


ecosistema incluye, además de la comunidad, el ambiente no vivo, con todas las
características de clima, temperatura, sustancias químicas presentes, condiciones
geológicas, etc.

La organización de la naturaleza en niveles superiores al de los organismos es la que


interesa a la ecología.

198
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
199

Hábitat y nicho ecológico

Dos conceptos fundamentales útiles para describir las relaciones ecológicas de los
organismos son el hábitat y el nicho ecológico.

El hábitat es el lugar donde vive un organismo, su área física, alguna parte específica de
la superficie de la tierra, aire, suelo y agua. Puede ser vastísimo, como el océano, o las
grandes zonas continentales, o muy pequeño, y limitado, por ejemplo, la parte inferior de
un leño podrido, pero siempre es una región bien delimitada físicamente. En un hábitat
particular pueden vivir varios animales o plantas.

En cambio, el nicho ecológico es el estado o el papel de un organismo en la comunidad


o el ecosistema. Depende de las adaptaciones estructurales del organismo, de sus
respuestas fisiológicas y de su conducta.

Puede ser útil considerar al hábitat como la dirección de un organismo (donde vive) y al
nicho ecológico como su profesión (lo que hace biológicamente). El nicho ecológico no
es un espacio demarcado físicamente, sino una abstracción que comprende todos los
factores físicos, químicos, fisiológicos y bióticos que necesita un organismo para vivir.

Para describir el nicho ecológico de un organismo es preciso saber qué come y qué lo
come a él, cuáles son sus límites de movimiento y sus efectos sobre otros organismos y
sobre partes no vivientes del ambiente. Una de las generalizaciones importantes de la
ecología es que dos especies no pueden ocupar el mismo nicho ecológico.

Una sola especie puede ocupar diferentes nichos en distintas regiones, en función de
factores como el alimento disponible y el número de competidores. Algunos organismos,
por ejemplo, los animales con distintas fases en su ciclo vital, ocupan sucesivamente
nichos diferentes. Un renacuajo es un consumidor primario, que se alimenta de plantas,
pero la rana adulta es un consumidor secundario y digiere insectos y otros animales.

En contraste, tortugas jóvenes de río son consumidores secundarios, comen caracoles,


gusanos e insectos, mientras que las tortugas adultas son consumidores primarios y se
alimentan de plantas verdes como el apio acuático.

Lección 40

Ejemplos de ecosistemas

La ecosfera en su conjunto es el ecosistema mayor. Abarca todo el planeta y reúne a


todos los seres vivos en sus relaciones con el ambiente no vivo de toda la Tierra. Pero
dentro de este gran sistema hay subsistemas que son ecosistemas más delimitados. Así,
por ejemplo, el océano, un lago, un bosque, o incluso, un árbol, o una manzana que se
esté pudriendo son ecosistemas que poseen patrones de funcionamiento en los que

199
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
200

podemos encontrar paralelismos fundamentales que nos permiten agruparlos en el


concepto de ecosistema.

Funcionamento del ecosistema

El funcionamiento de todos los ecosistemas es parecido. Todos necesitan una fuente de


energía que, fluyendo a través de los distintos componentes del ecosistema, mantiene la
vida y moviliza el agua, los minerales y otros componentes físicos del ecosistema. La
fuente primaria y principal de energía es el sol. En todos los ecosistemas existe, además,
un movimiento continúo de los materiales. Los diferentes elementos químicos pasan del
suelo, del agua o del aire a los organismos y de unos seres vivos a otros, hasta que
vuelven al suelo, o al agua, o al aire, cerrándose el ciclo. En el ecosistema la materia se
recicla en un ciclo cerrado y la energía fluye linealmente generando organización en el
sistema.

Enfoque para el estudio del ecosistema

Al estudiar los ecosistemas interesa más el conocimiento de las relaciones entre los
elementos, que el cómo son estos elementos. Los seres vivos concretos le interesan al
ecólogo por la función que cumplen en el ecosistema, no en sí mismos como le pueden
interesar al zoólogo o al botánico.

Para el estudio del ecosistema es indiferente, en cierta forma, que el depredador sea un
león o un tiburón. La función que cumplen en el flujo de energía y en el ciclo de los
materiales son similares y es lo que interesa en ecología.
Cualquier variación en un componente del ecosistema repercutirá en todos los demás
componentes. Por eso son tan importantes las relaciones que se establecen para
mantener ciertas dinámicas de equilibrio general a pesar de la gran complejidad de las
interacciones. Una manera simplificada de abordar el estudio de los ecosistemas
consiste en analizar las relaciones alimentarias, los ciclos de la materia y los flujos de
energía.

Relaciones alimentarias

La vida necesita un aporte continuo de energía que llega a la Tierra desde el Sol y pasa
de unos organismos a otros a través de la cadena trófica.

200
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
201

Gráfica Ejemplo de cadena trófica


Tomada de www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

Las redes de alimentación (reunión de todas las cadenas tróficas) comienzan en los
organismos productores (las plantas) que captan la energía luminosa con su actividad
fotosintética y la convierten en energía química almacenada en moléculas orgánicas.

Las plantas son devoradas por otros seres vivos que forman el nivel trófico de los
consumidores primarios (herbívoros).

Los herbívoros suelen ser presa, generalmente, de los carnívoros (depredadores) que
son consumidores secundarios en el ecosistema.

Pero las cadenas alimentarias no acaban en el depredador cumbre (Ej. felino que como
todo ser vivo muere, existen necrófagos, como algunos hongos o bacterias que se
alimentan de los residuos muertos y detritos en general (organismos descomponedores
o detritívoros).

De esta forma se soluciona en la naturaleza el problema de los residuos.

201
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
202

Los detritos (restos orgánicos de seres vivos) constituyen en muchas ocasiones el inicio
de nuevas cadenas tróficas. Por Ej., los animales de los fondos abisales se nutren de los
detritos que van descendiendo de la superficie.

La cadena alimentaria más corta estaría formada por los dos eslabones citados (ej.
cabras alimentándose de la vegetación).

Ejemplos de cadenas alimentarias de tres eslabones serían:

hierba - vaca - hombre


algas - krill - ballena.

Las cadenas alimentarias suelen tener, como mucho, cuatro o cinco eslabones, seis
constituyen ya un caso excepcional. Ej. de cadena larga sería: plantas - insectos - sapos
- serpientes - mangosta – felino.

Las diferentes cadenas alimentarias no están aisladas en el ecosistema sino que forman
un entramado entre sí y se suele hablar de red trófica.

Redes tróficas y alimentarias

Se estima que el índice de aprovechamiento de los recursos en los ecosistemas


terrestres es como máximo del 10 %, por lo cual el número de eslabones en una cadena
trófica, por necesidad, corto.

Reflexión: ¿qué pasa con el 90% correspondiente a la energía no aprovechada al


ascender en la escala trófica? ¿Se pierde o se aprovecha en otra forma?

Sin embargo, un estudio de campo y el conocimiento más profundo de las distintas


especies nos revelará que esa cadena trófica es únicamente una hipótesis de trabajo y
que, a lo sumo, expresa un tipo predominante de relación entre varias especies de un
mismo ecosistema.

La realidad es que cada uno de los eslabones mantiene a su vez relaciones con otras
especies pertenecientes a cadenas distintas. Es como un cable de conducción eléctrica,
que al observador alejado le parecerá una unidad, pero al aproximarse verá que dicho
cable consta a su vez de otros cables conductores más pequeños, que tampoco son una
unidad maciza.

Cada uno de estos cables conductores estará formado por pequeños filamentos de
cobre y quienes conducen la electricidad son en realidad las diminutas unidades que
conocemos como electrones, componentes de los átomos que constituyen el elemento
cobre.

202
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
203

Pero hay que poner de relieve una diferencia fundamental, en el cable todas las
sucesivas subunidades van en una misma dirección, pero en la cadena trófica cada
eslabón comunica con otros que a menudo se sitúan en direcciones distintas.

La hierba no sólo alimenta a la oveja, sino también al conejo y al ratón, que serán presa
de un águila y un búho, respectivamente. La oveja no tiene al lobo como único enemigo,
aunque sea el principal. El águila intentará apoderarse de sus recentales y, si hay un
lince en el territorio, competirá con el lobo, que en caso de dificultad no dudará en
alimentarse también de conejos.

De este modo, la cadena original ha sacado a la luz la existencia de otras laterales y


entre todas han formado una tupida maraña de relaciones ínter- específicas. Esto es lo
que se conoce con el nombre de red trófica.

La red da una visión más cercana a la realidad que la simple cadena. Nos muestra que
cada especie mantiene relaciones de distintos tipos con otros elementos del ecosistema:
la planta no crece en un único terreno, aunque en determinados suelos prospere con
especial vigor.

Tampoco, en general, el herbívoro se nutre de una única especie vegetal y él no suele


ser tampoco el componente exclusivo de la dieta del carnívoro.

La red trófica, contemplando un único pero importante aspecto de las relaciones entre
los organismos, nos muestra lo importante que es cada eslabón para formar el conjunto
global del ecosistema.

Una representación más realista de quien come a quien se llama red alimenticia, como
se muestra a continuación

Gráfica Red alimenticia,


Tomada de: http://www.jmarcano.com/nociones/trofico2.html

203
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
204

Pirámides biológicas

Una representación muy útil para estudiar todo este entramado trófico son las pirámides
de biomasa y energía. En ellas se ponen varios pisos con su anchura o su superficie
proporcional a la magnitud representada.

En el piso bajo se sitúan los productores; por encima los consumidores de primer orden
(herbívoros), después los de segundo orden (carnívoros) y así sucesivamente.

Gráfica Pirámide de energía de una cadena trófica acuática


tomada de: www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

Biomasa y energía

La biomasa es la cantidad total de materia viviente, en un momento dado, en un área


determinada o en uno de sus niveles tróficos, y se expresa en gramos de carbono, de la
materia seca correspondiente.

Las pirámides de biomasa son muy útiles para mostrar la biomasa en un nivel trófico. El
aumento de biomasa en un período determinado recibe el nombre de producción de un
sistema o de un área determinada.

Pirámide de energía

Una pirámide de energía muestra la cantidad máxima de energía en la base, la cual


disminuye uniformemente en cada nivel trófico. La transferencia de energía de un nivel
trófico a otro no es totalmente eficiente.

204
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
205

Los productores gastan energía para respirar, y cada consumidor de la cadena gasta
energía obteniendo el alimento, metabolizándolo y manteniendo sus actividades vitales.

Los estudios muestran que la eficiencia en la transferencia de energía entre los niveles
es del 10 %, es decir, que la energía almacenada en los herbívoros es solo el 10% de la
almacenada en las plantas y así mismo los consumidores secundarios tienen
almacenado solo un 10% de la energía almacenada en los consumidores primarios.

Esto explica por qué las cadenas alimentarias no tienen más de cuatro o cinco
miembros, pues no hay suficiente energía por encima de los depredadores en la cúspide
de la pirámide para mantener otro nivel trófico.

Ciclos de la materia

Los elementos químicos que forman los seres vivos (oxígeno, carbono, hidrógeno,
nitrógeno, azufre y fósforo, etc.) van pasando de unos niveles tróficos a otros.

Las plantas los recogen del suelo o de la atmósfera y los convierten en moléculas
orgánicas (glúcidos, lípidos, proteínas y ácidos nucleicos).

Los animales los toman de las plantas o de otros animales.

Después los van devolviendo a la tierra, a la atmósfera o a las aguas por la respiración,
las heces o la descomposición de los cadáveres, cuando mueren.

Es así como el ciclo de la materia tiene un trayecto cíclico

De esta forma encontramos en todo ecosistema unos ciclos del oxígeno, del carbono, del
hidrógeno, del nitrógeno.

205
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
206

Gráfica. Ciclo energético del ecosistema


Tomada de: www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

Flujo de energía

El ecosistema se mantiene en funcionamiento gracias al flujo de energía que va pasando


de un nivel al siguiente. La energía fluye a través de la cadena alimentaria sólo en una
dirección: va siempre desde el sol, a través de los productores a los descomponedores.

La energía entra en el ecosistema en forma de energía luminosa y sale en forma de


energía calorífica que ya no puede reutilizarse para mantener otro ecosistema en
funcionamiento. El ciclo de energía sigue una trayectoria lineal a diferencia de los ciclos
de la materia o de los elementos químicos.

Lección 43 Productividad de los ecosistemas como base para la intervención


humana sostenible

La productividad es una característica de las poblaciones que sirve también como índice
importante para definir el funcionamiento de cualquier ecosistema. Su estudio puede
hacerse a nivel de las especies, cuando interesa su aprovechamiento económico, o de
un medio en general.

206
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
207

Las plantas, como organismos autótrofos, tienen la capacidad de sintetizar su propia


masa corporal a partir de los elementos y compuestos inorgánicos del medio, en
presencia de agua como vehículo de las reacciones y con la intervención de la luz solar
como aporte energético para éstas. El resultado de esta actividad, es decir los tejidos
vegetales, constituyen la productividad primaria.

Más tarde, los animales comen las plantas y aprovechan esos compuestos orgánicos
para crear su propia estructura corporal, que en algunas circunstancias servirá también
de alimento a otros animales. Esta es la productividad secundaria.

En ambos casos, la proporción entre la cantidad de nutrientes ingresados y la biomasa


producida nos dará la llamada productividad, que mide la eficacia con la que un
organismo puede aprovechar sus recursos tróficos. Esto también se llama ecoeficiencia

Pero el conjunto de organismos y el medio físico en el que viven forman el ecosistema,


por lo que la productividad aplicada al conjunto de todos ellos nos servirá para obtener
un parámetro con que medir el funcionamiento de dicho ecosistema y conocer el modo
en que la energía fluye por los distintos niveles de su organización.

La productividad es uno de los parámetros más utilizados para medir la eficacia de un


ecosistema, calculándose ésta en general como el cociente entre una variable de salida
y otra de entrada. La productividad de los ecosistemas se mide en gramos o kilogramos
por área de superficie y por año. El desarrollo de la productividad se puede dar en dos
medios principales, las comunidades acuáticas y las terrestres.

El hombre nada puede hacer para aumentar la cantidad de energía luminosa incidente, y
muy poco para elevar el porcentaje de eficacia de transferencia de energía, por lo que
sólo podrá aumentar el aporte de energía de los alimentos, acortando la cadena
alimenticia, es decir, consumiendo productores primarios, vegetales y no animales.

En los países superpoblados como en La India y China, los habitantes son


principalmente vegetarianos porque así la cadena alimenticia es más corta y un área
determinada de terreno puede de esta forma servir de sostén al mayor número de
individuos.

Condiciones de las interacciones en los factores abióticos y bióticos

Factores abióticos

Todos los factores químico-físicos del ambiente son llamados factores abióticos (de a,
"sin", y bio, "vida). Los factores abióticos más conspicuos son la precipitación (lluvias,
nevadas) y temperatura; todos sabemos que estos factores varían grandemente de un
lugar a otro, pero las variaciones de estos factores pueden ser aún mucho más
importantes de lo que normalmente reconocemos.

207
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
208

No es solamente un asunto de la precipitación total o la temperatura promedio. Por


ejemplo, en algunas regiones la precipitación, total promedio es de más o menos 100
mm por año distribuida uniformemente durante el año.

Esto crea un efecto ambiental muy diferente al que se encuentra en otra región donde
cae la misma cantidad de precipitación pero solamente durante 6 meses por año
correspondientes a la estación de lluvias, dejando a la otra mitad del año como la
estación seca.

Igualmente, un lugar donde la temperatura promedio es de 20º C y nunca alcanza el


punto de congelamiento, es muy diferente de otro lugar con la misma temperatura
promedio pero que tiene veranos ardientes e inviernos muy fríos.

De hecho, la temperatura fría extrema – no temperatura de congelamiento,


congelamiento ligero o varias semanas de fuerte congelamiento – es más significativa
biológicamente que la temperatura promedio. Aún más, cantidades y distribuciones
diferentes de precipitación pueden combinarse con diferentes patrones de temperatura,
lo que determina numerosas combinaciones para apenas estos dos factores.

Pero también otros factores abióticos pueden estar involucrados, incluyendo tipo y
profundidad de suelo, disponibilidad de nutrientes esenciales, viento, fuego, salinidad,
luz, longitud del día, terreno y pH (la medida de acidez o alcalinidad de suelos y aguas).

Como ilustración, consideremos el factor terreno: en el Hemisferio Norte, el terreno de


las laderas que dan hacia el norte generalmente presenta temperaturas más frías que las
que dan hacia el sur.

O consideremos el tipo de suelo: un suelo arenoso, debido a que no retiene bien el agua,
produce el mismo efecto que una precipitación menor.

O consideremos el viento: ya que aumenta la evaporación, también puede causar el


efecto de condiciones relativamente más secas. Sin embargo, estos y otros factores
pueden ejercer por ellos mismos un efecto crítico.

Resumiendo, podemos ver que los factores abióticos, que se encuentran siempre
presentes en diferentes intensidades, interactúan unos con otros para crear una matriz
de un número infinito de condiciones ambientales diferentes.

Factores bióticos

En un ecosistema los factores bióticos están relacionados con la interacción de


organismos que contribuyen al desarrollo de biomasa y las condiciones de
predominancia y equilibrio entre diversas poblaciones.

208
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
209

Invariablemente la comunidad vegetal está compuesta por un número de especies que


pueden competir unas con otras, pero que pueden ser de ayuda mutua. También existen
otros organismos en la comunidad vegetal: animales, hongos, bacterias y otros
microorganismos.

Así que cada especie no solamente interactúa con los factores abióticos, sino que está
constantemente interactuando con otras especies (factores bióticos) para conseguir
alimento, protección, territorio u otros beneficios, inclusive, mientras se compite se puede
ser además fuente de alimento para un nivel trófico superior.

Todas las interacciones con otras especies se clasifican como interacciones bióticas
positivas, negativas o neutras.

Óptimos y rangos de tolerancia de las especies a factores abióticos

Veremos ahora la manera en que diferentes especies se "ajustan" a condiciones


ambientales diferentes.

Especies diferentes de plantas, animales o microorganismos varían grandemente en


cuanto a su tolerancia (capacidad para soportar) a diferentes factores abióticos.
Enfatizaremos en las plantas porque es más fácil ilustrar los principios con ellas.

A través de observaciones de campo (observaciones de elementos tal como existen en


la naturaleza en contraposición a experimentos de laboratorio), podemos llegar a la
conclusión que: especies diferentes de plantas varían grandemente en cuanto a su
tolerancia a diferentes factores abióticos.

Esta hipótesis ha sido examinada y verificada a través de experimentos llamados


"pruebas de estrés".

Se cultivan plantas en una serie de cámaras en la que pueden controlarse todos los
factores abióticos; de esta manera, el factor simple que estudiamos puede variarse de
manera sistemática mientras que todos los demás factores se mantienen constantes.

Por ejemplo, mantenemos la luz, el suelo, el agua y otros factores con iguales valores en
todas las cámaras, pero variamos la temperatura de una cámara a otra (para así
distinguir el efecto de la temperatura de los demás factores).

Los resultados muestran que, partiendo desde un valor bajo, a medida que se eleva la
temperatura las plantas crecen mejor hasta alcanzar una tasa máxima de crecimiento.
Sin embargo, si se sigue elevando la temperatura las plantas empiezan a mostrar estrés:
no crecen bien, sufren daños, y finalmente mueren.

209
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
210

La temperatura a la cual se presenta la máxima tasa de crecimiento se llama


temperatura óptima.

La gama o rango de temperatura dentro de la cual hay crecimiento se llama el rango o


gama de tolerancia (en este caso para la temperatura).

A las temperaturas por debajo o por encima de las cuales las plantas no crecen se les
conoce como los límites de tolerancia.

Experimentos similares han sido realizados con la mayoría de los demás factores
abióticos.

Para cada factor abiótico estudiado, los resultados siguen el mismo patrón general: hay
un óptimo, que permite el máximo crecimiento, un rango de tolerancia fuera del cual hay
un crecimiento menos vigoroso, y límites por debajo o por encima de los cuales la planta,
el animal o el microorganismo no puede sobrevivir.

Desde luego, no todas las especies han sido examinadas para todos los factores; sin
embargo, la consistencia de tales observaciones nos lleva a la conclusión de que este es
un principio biológico fundamental.

Entonces podemos generalizar diciendo que cada especie tiene:

• un óptimo,
• un rango de tolerancia,
• un límite de tolerancia con respecto a cada factor.

Además del principio de los óptimos, este tipo de experimentos demuestra que las
especies pueden diferir marcadamente con respecto al punto en que se presenta el
óptimo y los límites de tolerancia. Por ejemplo, lo que puede ser muy poca agua para
una especie puede ser el óptimo para otra y puede ser letal para una tercera.

Algunas plantas no toleran las temperaturas de congelamiento (esto es, la exposición a


0º C o menos es fatal). Otras pueden tolerar un congelamiento ligero pero no intenso, y
algunas realmente requieren varias semanas de temperaturas de congelamiento para
completar sus ciclos de vida. Lo mismo puede decirse para los demás factores. Pero,
mientras que los óptimos y los límites de tolerancia pueden ser diferentes para especies
diferentes, sus rangos de tolerancia pueden sobreponerse considerablemente.

De esta manera, los experimentos controlados apoyan la hipótesis de que las especies
difieren en su adaptación a los diversos factores abióticos.

La distribución geográfica de una especie puede estar determinada por el grado en el


cual sus requerimientos son cumplidos por los factores abióticos presentes.

210
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
211

Una especie puede prosperar donde encuentra condiciones óptimas; sobrevive


malamente cuando las condiciones difieren de su óptimo. Pero no sobrevivirá en
aquellos lugares donde cualquier factor abiótico tenga un valor fuera de su límite de
tolerancia para ese factor.

Relaciones entre individuos

Componentes de las relaciones intra-específicas

Las relaciones intra-específicas son interacciones que se dan entre los individuos de una
misma especie al tener el mismo hábitat o compartir la misma alimentación.

Estas interacciones facilitan el apareamiento, la cría, la protección y la alimentación de


cada individuo.

A nivel unicelular tanto en organismos vegetales (fitoplancton) como en organismos


animales (zooplancton) las relaciones entre individuos de una misma especie están
condicionadas por el medio común (factores de tipo físico y químico) que comparten, al
que vierten sus metabolitos y del que reciben los de otros organismos.

Por ejemplo, la mayoría de formas de algas son microscópicas unicelulares y forman


parte del plancton, es decir, que tienen su hábitat generalmente en el agua, donde
suelen, realizar una rápida multiplicación que puede provocar a veces en ambientes
reducidos una cantidad excesiva de residuos metabólicos o un agotamiento total del
oxígeno disuelto que cause su muerte.

En el caso de los organismos de mayor entidad biológica, de formas pluricelulares,


cualquier relación entre individuos de una misma especie lleva siempre un componente
de cooperación y otro de competencia, con predominio de una u otra en casos extremos.

Así en una colonia de pólipos la cooperación es total, mientras que animales de


costumbres solitarias, como la mayoría de las musarañas, apenas permiten la presencia
de congéneres en su territorio fuera de la época reproductora.

La colonia

La colonia es un tipo de relación que implica estrecha colaboración funcional e incluso


cesión de la propia individualidad. Los corales de un arrecife se especializan en diversas
funciones: hay individuos provistos de órganos urticantes que defienden la colonia,
mientras que otros se encargan de obtener el alimento y otros de la reproducción.

Este tipo de asociación es muy frecuente también en las plantas, sobre todo en las
inferiores.

211
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
212

En los vegetales superiores, debido a la incapacidad de desplazamiento, surgen


formaciones en las que el conjunto crea unas condiciones adecuadas para cada
individuo, por lo que se da una cooperación ecológica, al tiempo que se produce
competencia por el espacio, impidiendo los ejemplares de mayor tamaño crecer a los
plantones de sus propias semillas.

Sociedades

En el reino animal nos encontramos con sociedades, como las de hormigas o abejas,
con una estricta división del trabajo.

En todos estos casos, el agrupamiento sigue una tendencia instintiva automática. A


medida que se asciende en la escala zoológica encontramos que, además de ese
componente mecánico de agrupamiento, surgen relaciones en las que el
comportamiento o la etología de la especie desempeñan un papel creciente

Los bancos de peces son un primer ejemplo de particularidades en el comportamiento de


cooperación que asegura la supervivencia de la especie, al desplazarse en cardúmenes.

En las grandes colonias de muchas aves (flamencos, gaviotas, pingüinos, etc.), las
relaciones entre individuos están ritualizadas para impedir una competencia perjudicial.

Algo similar sucede en los rebaños de mamíferos. Entre muchos carnívoros y, en grado
máximo entre los primates, aparecen los grupos familiares que regulan las relaciones
intra-específicas y en este caso factores como el aprendizaje de las crías, el
reconocimiento de los propios individuos y otros aspectos de los que estudia la etología
pasan a ocupar un primer plano.

Componentes de las relaciones ínter-específicas

Las relaciones inter-específicas son interacciones que se dan entre diferentes especies
por el alimento, el territorio o la defensa o por la predominancia de una especie.

Entre las especies se pueden establecer relaciones de competencia, en este caso prima
el interés de cada especie por el alimento o el espacio.

En muchas ocasiones, para lograr determinados fines se recurre a compromisos con


otras especies que se manifiestan en asociaciones del tipo de una simbiosis.

Simbiosis

La simbiosis se define como una cooperación entre organismos para poder vivir o
adaptarse. Esta colaboración puede darse uno a uno (en forma directa), es decir A

212
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
213

ayuda a B y B ayuda a A, o también puede ser indirecta A ayuda a B, B ayuda a C y C


ayuda a A.

Mutualismo

Un tipo de simbiosis es el mutualismo en el que ambas especies se benefician


recíprocamente, tal es el caso, de un abejorro que poliniza las flores de un arbusto y
obtiene néctar como recompensa, o por ejemplo, el liquen resultado de la asociación
entre algas y hongos , en esta relación el hongo absorbe agua del ambiente y el alga
suministra al hongo el alimento elaborado mediante el proceso de fotosíntesis,
o la asociación Rhizobium - leguminosa en la cual la bacteria Rhizobium produce
sustancias reguladoras del crecimiento que son aprovechadas por la leguminosa y la
leguminosa proporciona a la bacteria un medio y nutrientes para su supervivencia.

Comensalismo

El comensalismo es otro tipo de simbiosis en donde una especie saca provecho de otra
sin que esta última se afecte, es el caso del pez rémora que tiene una aleta transformada
en ventosa, con la que se adhiere al cuerpo del tiburón. Así, la rémora se desplaza junto
al tiburón y se alimenta con los restos de comida que éste deja caer.

Entre otras relaciones particulares posibles, tenemos:

Parasitismo

El parasitismo es un tipo de relación de alimentación en la cual el depredador es mucho


más pequeño que el huésped vivo del cual obtiene su alimento causándole algún daño,
por ejemplo la relación que se establece entre la garrapata y el ganado.

Depredación

La depredación, en este tipo de relación algunos individuos -predadores- devoran a otros


–presas vivas- como es el caso de los carnívoros de segundo y tercer orden que devoran
presas vivas por ejemplo, la mangosta y la serpiente , o el tigre y el venado.

Amensalismo

El amensalismo es el tipo de relación en la que una especie inhibe el crecimiento de otra,


sin afectarse ella. Por ejemplo, el hongo Penicillium produce sustancias antibióticas que
inhiben el crecimiento de otros microorganismos.

La importancia de estas relaciones es que establecen muchas veces los flujos de


energía dentro de las redes tróficas y por tanto contribuyen a la estructuración del
ecosistema.

213
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
214

Las relaciones en las que intervienen organismos vegetales son más estáticas que
aquellas propias de los animales, pero ambas son el resultado de la evolución del medio,
sobre el cual, a su vez las especies actúan, incluso modificándolo, en virtud de las
relaciones que mantienen entre ellas.

Pero también es relevante la interacción comunicativa entre las especies, como pueda
ser la exhibición de colores llamativos o la emisión de sonidos estridentes de una presa
para disuadir a un depredador

Atributos de las poblaciones

Puede definirse la población como un grupo de organismos de la misma especie que


ocupan un área dada.

Posee características en función más bien del grupo en su totalidad que de cada uno de
los individuos, como: densidad de población, frecuencia de nacimientos y defunciones,
distribución por edades, ritmo de dispersión, potencial biótico y forma de crecimiento.

Si bien los individuos nacen y mueren, los índices de natalidad y mortalidad no son
características del individuo sino de la población global.

Las relaciones entre población y comunidad son a menudo más importantes para
determinar la existencia y supervivencia de organismos en la naturaleza que los efectos
directos de los factores físicos en el medio ambiente.

Uno de sus atributos importantes es la densidad, o sea el número de individuos que


habitan en una unidad de superficie o de volumen.

La densidad de población es con frecuencia difícil de medir en función del número de


individuos, pero se calcula por medidas indirectas como por ejemplo, los insectos
atrapados durante una hora en una trampa.

La gráfica en la que se inscribe el número de organismos en función del tiempo es


llamada curva de crecimiento de población. Tales curvas son características de las
poblaciones, no de especies aisladas, y sorprende su similitud entre las poblaciones de
casi todos los organismos desde las bacterias hasta el hombre.

La tasa de nacimientos o natalidad, de una población es simplemente el número de


nuevos individuos producidos por unidad de tiempo. La tasa de natalidad máxima es el
mayor número de organismos que podrían ser producidos por unidad de tiempo en
condiciones ideales, cuando no hay factores limitantes.

La mortalidad se refiere a los individuos que mueren por unidad de tiempo. Hay una
mortalidad mínima teórica, la cual es el número de muertes que ocurrirían en

214
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
215

condiciones ideales, consecutivas exclusivamente a las alteraciones fisiológicas que


acompañan el envejecimiento.

Disponiendo en gráfica el número de supervivientes de una población contra el tiempo se


obtiene la curva de supervivencia. De esas curvas puede deducirse el momento en que
una especie particular es más vulnerable.

Como la mortalidad es más variable y más afectada por los factores ambientales que por
la natalidad, estos tienen una enorme influencia en la regularización del número de
individuos de una población.

Los ecólogos emplean el término potencial biótico o potencial reproductor para expresar
la facultad privativa de una población para aumentar el número, cuando sea estable la
proporción de edades y óptimas las condiciones ambientales.

Cuando el ambiente no llega a ser óptimo, el ritmo de crecimiento de la población es


menor, y la diferencia entre la capacidad potencial de una población para crecer y lo que
en realidad crece es una medida de la resistencia del ambiente.

Tabla Niveles de Integración de los materiales biológicos en los ecosistemas

Los materiales biológicos (proteínas, lípidos, ácidos nucleicos, etc.) se


integran en la naturaleza en un cierto número de niveles de organización cada
vez más complejos: célula - individuo - población - comunidad.

La célula es la unidad biológica funcional más pequeña y sencilla. Está


compuesta por un territorio protoplasmático, limitado por una membrana
plasmática (de lípidos y proteínas), reforzada en los vegetales por una pared
celular.

El protoplasma está constituido por una solución coloidal de proteínas muy


estructurada (citoplasma), en cuyo seno se encuentra el material genético
(ADN, ARN), organizado generalmente en un núcleo, y toda una serie de
orgánulos (mitocondrias, ribosomas, plastos, etc.) que constituyen la
maquinaria metabólica.
El individuo (organismo) es un sistema biológico funcional que, en los casos
más simples, se reduce a una sola célula (unicelular), pero que, en principio,
está compuesto por numerosas células, que pueden estar agrupadas en
tejidos y órganos.

Un individuo se caracteriza por su anatomofisiología y su metabolismo. En un


momento dado, un individuo posee una determinada biomasa que se puede
expresar en peso vivo (fresco) o en peso de materia seca.

215
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
216

La población (o demo) es un sistema biológico formado por un grupo de


individuos de la misma especie que viven en un lugar determinado en un
momento determinado.

Aproximadamente, la especie es un conjunto de individuos semejantes que


transmiten este parecido de generación en generación.
La comunidad (o biocenosis) es un sistema biológico que agrupa el conjunto
de poblaciones habitantes de un mismo lugar determinado, en unas
condiciones dadas del medio y en un momento concreto.
El ecosistema, lo constituyen las relaciones e interdependencias de las
comunidades integradas conjunta y sinérgicamente en su medio.
La biosfera es el conjunto de los ecosistemas naturales desarrollados en el
seno de los mares o en la superficie de los continentes.
La noosfera representa la integración virtual del pensamiento humano sobre
la biosfera, crecientemente tecnologizada.

216
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
217

Gráfica. Niveles de organización en la naturaleza


Tomada de www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

Aplicaciones para conservación de la biodiversidad

El hombre con sus prácticas ecológicas no sostenibles ha transformado el ambiente,


originando grandes desequilibrios de los ecosistemas, causando desastres ecológicos
que ponen en peligro la vida.

Los recursos naturales renovables como la biodiversidad (flora y fauna) los bosques y los
recursos no renovables como los yacimientos minerales, los combustibles fósiles y
nucleares deben ser manejados de manera racional y sostenible para su conservación y
sus beneficios.

217
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
218

Algunas acciones conducentes a la conservación de la biodiversidad

* Policultivos o diversificación de los cultivos


* Evitar la tala de bosques que pone en peligro las especies animales y causa erosión en
los suelos
* Prelación al control biológico en lugar de controles químicos.
* Uso de energías alternativas
* Evitar la caza y la pesca indiscriminada
* Manejo adecuado de las basuras
* Reciclaje de productos no degradables
* Creación de parques naturales y reservas naturales
* Conservación en laboratorios de bancos de germoplasma de plantas, de animales y de
microorganismos.
* Evitar contaminar el agua con desechos procedentes de la agricultura o de la industria
* Controlar el pastoreo libre
* Disminuir el consumo de aerosoles o clorofluorocarbonados que destruyen la capa de
ozono protectora contra las radiaciones cósmicas
* Reducir la contaminación atmosférica producida por los gases expulsados por fábricas,
vehículos que permanecen en la atmósfera causando el efecto invernadero y las lluvias
ácidas.
* Evitar el uso de detergentes no biodegradables.

Conclusión

La misión del ecólogo

Tanto en el medio rural como en el urbano son muchas las tareas que debe llevar a cabo
el ecólogo en el presente.

Su misión fundamental, desde el punto de vista práctico, puede resumirse en una sola
palabra, prevenir. Cualquier acción irracional que se produzca en el medio biológico trae
como consecuencia verdaderas reacciones en cadena.

El consejo del ecólogo debe llegar antes y no después, porque una vez iniciado el
proceso destructivo del ambiente resulta muy difícil detenerlo.

La segunda misión del ecólogo es conservar, que no sólo implica evitar la destrucción
sino favorecer, a veces artificialmente, a las poblaciones cuya existencia peligra.

218
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
219

En síntesis: prevenir deterioros ambientales, potenciar las resiliencias de los


ecosistemas y mantener buenos índices de ecoeficiencia, con aportes teóricos y técnicos
para la productividad limpia.

Pensamiento Sistémico y Desarrollo Sustentable

Tomado de: Congreso Internacional NIKAN

Honorato Teissier Fuentes (*)

Nota: El conocimiento de los ecosistemas habilita al estudiosos para comprender la


posisción epistemológica del pensamiento sistémico, como un aporte de la biología a la
conceptualización ambiental del desarrollo sostenible, comenzando por el manejo de los
agroecosistemas, que no son otra cosa que la intervención productiva del hombre en los
ecosistemas .

Para reflexionar sobre este enfoque de pensamiento sistémico biológico es interesante


revisar el texto tomado de Honorato Teissier Fuentes

La Era Industrial y la Naturaleza

No cabe duda que la industrialización aportó gran parte del desarrollo humano en los
últimos doscientos años. Sin embargo ha traído consigo una gran cantidad de aspectos
negativos.

La era industrial requirió del individuo, la tecnología y las materias primas para la
producción masiva. No obstante de haber sido pensada para beneficio del hombre, ésta
lo volvió su esclavo, convirtiéndolo en un engrane más de su mecanización.

La forma fragmentada de pensar, que contiene al enfoque mecanicista, también generó


una desintegración del mundo. Las materias primas, productos de la Naturaleza, se
volvieron sólo la entrada para el insaciable hambre de riqueza industrial y la ambición del
poder de los gobiernos.

Bajo esta visión analítica, divisionista, lineal y fragmentada hemos llegado a los niveles
de deterioro del Planeta que hoy observamos. Descomponer un sistema es lo mismo que
destruirlo. No sólo implica la separación de sus partes, sino la anulación de sus
propiedades: el agua, separada en oxígeno e hidrógeno deja de ser el compuesto que
ayudó a formar la vida en la Tierra, no es más un sistema.

El concepto de Sistema, a pesar de lo antiguo del vocablo, pues los griegos lo acuñaron,
como visión social es una idea reciente. Es una base que contiene la posibilidad de
apreciar El Todo sin desintegrar sus partes para tratar de entenderlas o controlarlas.

219
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
220

Plantea un conjunto de modelos mentales que se distinguen del pensamiento analítico,


punto de partida del enfoque mecanicista.

El pensamiento sistémico requiere percibir más que medir. Obliga a sintetizar antes de
analizar, pero además fuerza a observar al sistema como parte interactuante con otros
sistemas de su mismo nivel, y como integrante de sistemas superiores, en donde se
encuentra inmerso. Implica comprender que todo tiene relación, interna y externa, por
remota o distante que sea.

Por otro lado, el Desarrollo Sustentable plantea armonizar las relaciones entre el hombre
y la naturaleza. Quisiéramos ver a la raza humana tomando del río sólo el agua que
necesita para saciar su sed, so pena de que aquel nunca más le dé de beber.
El modelo del desarrollo sustentable que se pretende alcanzar, requiere de un cambio de
paradigma y no sólo de las buenas intenciones. Esto es, requiere de un cambio mental
en la visión del hombre. Primero porque necesitamos quitar de nuestra mente las viejas
ideas de que la Naturaleza está en contra del Hombre y de que hay que "vencerla".
Segundo, de que debemos dominarla y controlarla, pues ésta tiene fuerzas y formas
propias. Tercero, de que nos pertenece y son nuestros sus productos. Y cuarto, de que
posee recursos ilimitados, sólo para una ilimitada hambre de poder humano.

Para ello, será necesario comprender las relaciones, directas e indirectas que existen
entre los ecosistemas naturales y los humanos, base del respeto que pretendemos lograr
hacia las fuentes de la vida en la Tierra. También será indispensable sustituir nuestras
formas de vida "progresistas" de manejo del entorno, en aras de las cuales destruimos
todo lo que podemos. Todo esto finalmente podría acercarnos a un desarrollo en
armonía con la Naturaleza, un Desarrollo en la Sustentabilidad.

El pensamiento sistémico y el desarrollo sustentable

En el Pensamiento Sistémico se encuentran las características requeridas para formar


una sociedad que comprenda la necesidad de respetar y cuidar los recursos naturales,
de no desperdiciar la energía, de acrecentar su acervo de conocimientos y de lograr la
equidad, no sólo entre los pueblos del mundo, sino entre todos los seres vivos del
Planeta y, de poder ver el futuro como algo promisorio para todas las generaciones
venideras.

Esta forma de pensar nos obliga a ver los distintos horizontes de tiempo, donde
podemos ubicar nuestra vida, nuestro país, nuestro continente y nuestro planeta. Implica
ver comportamientos y sus estructuras causales, como vía para inducir cambios en los
sistemas. Con todo ello podemos comprender "el todo", aunque no pudiéramos ver o
entender sus partes. Lo haríamos sin necesidad de descomponerlo. Evitaríamos tener
que pensar en soluciones mágicas como la de que al reducir la sobrepoblación se
acabarán los problemas, puesto que existen muchas más relaciones sistémicas.

220
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
221

Al llevar poco a poco esta forma de pensar a nuestra vida diaria modifica la forma de ver
las cosas y genera inquietudes e incomodidad, en un principio. Es común que se lleguen
a poner en discrepancia nuestras actividades con el modelo de sustentabilidad? Sí. Pero
será indispensable pasar por ese enfrentamiento interior en cada uno de nosotros, para
iniciar el camino del Desarrollo Sustentable. No se pueden concebir cambios en la
comunidad si no hay cambios en los individuos.

El Pensamiento Sistémico, como modelo mental, además está poniendo en tela de juicio
varios de los paradigmas con los que hemos vivido hasta hoy. Entre ellos el del método
científico. Será ya tiempo de renovar estos modelos ?.

Para terminar, recordemos la expresión del Jefe Seatle, de los indios norteamericanos:

El hombre no tejió la trama de la vida, es sólo un hilo de ella.

Propuesta

Dada la complejidad de los problemas ambientales, de sostenibilidad de los recursos


naturales, y de la preservación de los ecosistemas, el Pensamiento Sistémico es uno de
los caminos que tenemos más claros, al menos en el presente, para conducirnos hacia lo
que sería una sociedad sustentable.

Proponemos que el Pensamiento Sistémico sea utilizado como herrameinta para


avanzar hacia la sustentabilidad de nuestros sistemas humanos.

Honorato Teissier Fuentes


Una contribución de la
Universidad Autónoma de Coahuila, al
Congreso Internacional NIKAN, celebrado en Quebec,Canada.
Saltillo, Coahuila, México, Septiembre de 1997
Honorato_Teissier@uqac.ca

221
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
222

Referencias

1.- Senge, Peter M., La Quinta Disciplina (Ed. Español), Ed. Granica, 1990.

2.- Aranda A. Armando, Los límites del reduccionismo molecular


Revista Ciencia y Desarrollo, CoNaCyT, Jun 1994, pp 18-25.

3.- Hugunin, Carol, "It´s Time me to bury Darwin


Revista 21´st. Century, USA,. Primavera de 1995, pp 32-45.

4.- Meadows, Dennis y Donella, Más alla de los límites del crecimiento, Ed. El País
Aguilar, Madrid, España, 1992.

5.- Nava Roberto, Gastó Juan, Armijo Roberto, El Ecosistema


UAAAN, Saltillo, Coah., México, 1978.

6.- Estrada Alejandro y Coates-Estrada Rosamond,


Las Selvas de los Tuxtlas, Veracruz. Ciencia y Desarrollo, CoNaCyT, México, May-Jun.
1994, pp 50-61.

7.- Cereijido Alejandro, Del Caos de los demonios al caos de los biólogos , Universidad
de México, Revista de la UNAM,
México, D.F. Abr. 1996, pp 3-7.

8.- Teissier F. Honorato C. El enfoque de sistemas y la ecología, Facultad de Sistemas,


U.A. de Coahuila, México, 1994.
pp. 1-7, Saltillo, Coah., México.

http://www.clades.cl/revistas/1/rev1art1.htm

Lección 44

La Evolución del Pensamiento Agroecológico

Susanna B. Hecht - Universidad de California, Los Angeles

El término agroecología ha llegado a significar muchas cosas. Definidas a groso modo, la


agroecología a menudo incorpora ideas sobre un enfoque de la agricultura más ligado al
medio ambiente y más sensible socialmente; centrada no sólo en la producción sino
también en la sostenibilidad ecológica del sistema de producción. A esto podría llamarse
el uso "normativo" o "prescriptivo" del término agroecología, porque implica un número
de características sobre la sociedad y la producción que van mucho más allá de los
límites del predio agrícola. En un sentido más restringido, la agroecología se refiere al

222
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
223

estudio de fenómenos netamente ecológicos dentro del campo de cultivos, tales como
relaciones predador/presa, o competencia de cultivo/maleza.

Visión Ecológica

En el corazón de la agroecología está la idea que un campo de cultivos es un


ecosistema dentro del cual los procesos ecológicos que ocurren en otras formaciones
vegetales, tales como ciclos de nutrientes, interacción depredador/presa, competencia,
comensalía y cambios sucesionales, también se dan.

La agroecología se centra en las relaciones ecológicas en el campo y su propósito es


iluminar la forma, la dinámica y las funciones de estas relaciones. En algunos trabajos
sobre agroecología está implícita la idea que por medio del conocimiento de estos
procesos y relaciones los sistemas agroecológicos pueden ser administrados mejor, con
menores impactos negativos en el medio ambiente y la sociedad, más sostenidamente y
con menor uso de insumos externos.

Como resultados, un número de investigadores de las ciencias agrícolas y de áreas


afines, han comenzado a considerar el predio agrícola como un tipo especial de
ecosistema -un agroecosistema- y a formalizar el análisis del conjunto de procesos e
interacciones que intervienen en un sistema de cultivos.

El marco analítico subyacente le debe mucho a la teoría de sistemas y a los intentos


teóricos y prácticos hechos para integrar los numerosos factores que afectan la
agricultura (Spedding 1975, Gliessman 1982, Conway 1985, Chambers 1983, Ellen
1982, Altieri 1983, Lowrance et. al. 1984).

La Perspectiva Social

Los agroecosistemas tienen varios grados de resiliencia y de estabilidad, pero estos no


están estrictamente determinados por factores de origen biótico o ambiental.

Factores sociales, tales como el colapso en los precios del mercado o cambios en la
tenencia de las tierras, pueden destruir los sistemas agrícolas tan decisivamente como
una sequía, explosiones de plagas o la disminución de los nutrientes en el suelo.

Por otra parte, las decisiones que asignan energía y recursos materiales pueden
aumentar la resiliencia y recuperación de un ecosistema dañado. Aunque la
administración humana de los ecosistemas con fines de producción agrícola a menudo
ha alterado en forma dramática la estructura, la diversidad, los patrones de flujo de
energía y de nutrientes, y los mecanismos de control de poblaciones bióticas en los
predios agrícolas, estos procesos todavía funcionan y pueden ser explorados
experimentalmente.

223
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
224

La magnitud de las diferencias de la función ecológica entre un ecosistema natural y uno


agrícola depende en gran medida de la intensidad y frecuencia de las perturbaciones
naturales y humanas que se hacen sentir en el ecosistema. El resultado de la interacción
entre características endógenas, tanto biológicas como ambientales en el predio agrícola
y de factores exógenos tanto sociales como económicos, generan la estructura particular
del agroecosistema. Por esta razón, a menudo es necesaria una perspectiva más amplia
para explicar un sistema de producción que está en observación.

Un sistema agrícola difiere en varios aspectos fundamentales de un sistema ecológico


"natural" tanto en su estructura como en su función. Los agroecosistemas son
ecosistemas semi-domesticados que se ubican en un gradiente entre una serie de
ecosistemas que han sufrido un mínimo de impacto humano, como es el caso de las
ciudades.

Odum (1984) describe 4 características principales de los agroecosistemas:

1. Los agroecosistemas requieren fuentes auxiliares de energía, que pueden ser


humana, animal y a combustible para aumentar la productividad de organismos
específicos.

2. La diversidad puede ser muy reducida en comparación con la de otros ecosistemas.

3. Los animales y plantas que dominan son seleccionados artificialmente y no por


selección natural.

4. Los controles del sistema son, en su mayoría, externos y no internos ya que se


ejercen por medio de retroalimentación del subsistema.

El modelo de Odum se basa principalmente en la agricultura modernizada del tipo que se


encuentra en los Estados Unidos. Hay, sin embargo, muchos tipos de sistemas
agrícolas, especialmente en los trópicos, que no corresponden a esta definición. Son
especialmente sospechosas la cuestión de diversidad y la naturaleza de la selección
utilizada en agriculturas complejas donde un sinnúmero de plantas y animales semi-
domesticados y silvestres figuran en el sistema de producción.

Conklin (1956), por ejemplo, describió agroecosistemas tradicionales en Filipinas que


incluían más de 600 especies de plantas que eran cultivadas y manejadas. Aunque esta
agricultura no era tan diversa como la de algunos bosques tropicales, era definitivamente
más multiforme que muchos otros ecosistemas locales.

Los sistemas agrícolas son un interacción compleja entre procesos sociales externos e
internos, y entre procesos biológicos y ambientales. Estos pueden entenderse
espacialmente a nivel de terreno agrícola, pero a menudo también incluyen una

224
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
225

dimensión temporal. El grado de control externo versus control interno puede reflejar
intensidad de administración a lo largo del tiempo, el que puede ser mucho más variable
que el supuesto de Odum.

En sistemas de roza, tumba y quema, por ejemplo, los controles externos tienden a
disminuir en los períodos posteriores de barbecho.

El modelo de agroecosistema de Odum marca un punto de partida interesante para la


comprensión de la agricultura desde una perspectiva de los sistemas ecológicos, pero no
puede abarcar la diversidad y complejidad de muchos agroecosistemas que se
desarrollaron en las sociedades no occidentales, especialmente en los trópicos
húmedos. Más aún, la falta de atención que el modelo pone en las determinantes
sociales de la agricultura tiene como resultado un modelo con un poder explicativo
limitado.

Los sistemas agrícolas son artefactos humanos y las determinantes de la agricultura no


terminan en los límites de los campos. Las estrategias agrícolas no sólo responden a
presiones del medio ambiente, presiones bióticas y del proceso de cultivo, sino que
también reflejan estrategias humanas de subsistencia y condiciones económicas (Ellen
1982).

Factores tales como disponibilidad de mano de obra, acceso y condiciones de los


créditos, subsidios, riesgos percibidos, información sobre precios, obligaciones de
parentesco, el tamaño de la familia y el acceso a otro t6ipo de sustento, son a menudo
críticas para la comprensión de la lógica de un sistema de agricultura. En especial
cuando se analizan las situaciones de los pequeños campesinos fuera de los Estados
Unidos y Europa, el análisis de la simple maximización de las cosechas en sistemas de
monocultivo se hace menos útil para la comprensión del comportamiento del campesino
y de sus opciones agronómicas (Scott 1978 y 1986, Barlett 1984, Chambers 1983).

El Desafío Agroecológico

Los científicos agrícolas convencionales han estado preocupados principalmente con el


efecto de las prácticas de uso de la tierra y de manejo de los animales o la vegetación en
la productividad de un cultivo dado, usando una perspectiva que enfatiza un problema
objetivo, como es el de los nutrientes del suelo o los brotes de plagas.

Esta forma de enfocar sistemas agrícolas ha sido determinada en parte por un diálogo
limitado entre diferentes disciplinas, por la estructura de la investigación científica, la que
tiende a atomizar problemas de investigación, y por un enfoque de la agricultura
orientado a lograr un producto. No cabe duda que la investigación agrícola basada en
este enfoque ha tenido éxito e incrementar el rendimiento en situaciones
agroecológicamente favorables.

225
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
226

Sin embargo, es cada vez mayor el número de científicos que reconoce que este
enfoque reduccionista limita las opciones agrícolas para las poblaciones rurales y en que
el "enfoque objetivo" a menudo involucra consecuencias secundarias no intencionadas
que frecuentemente han producido daños ecológicos y han tenido altos costos sociales.

La investigación agroecológica se concentra en asuntos puntuales del área de la


agricultura, pero dentro de un contexto más amplio que incluye variables ecológicas y
sociales. En muchos casos, las premisas sobre el propósito de un sistema agrícola
difieren del enfoque que enfatiza la maximización del rendimiento y la producción,
expuesto por la mayoría de los científicos agrícolas.

Como mejor puede describirse la agroecología es como un enfoque que integra ideas y
métodos de varios sub-campos, más que como una disciplina específica. La
agroecología puede ser un desafío normativo a las maneras en que varias disciplinas
enfocan los problemas agrícolas. Tiene sus raíces en las ciencias agrícolas, en el
movimiento del medio ambiente, en la ecología (en particular en la explosión de
investigaciones sobre los ecosistemas tropicales), en el análisis de agroecosistemas
indígenas y en los estudios sobre el desarrollo rural.

Cada una de estas áreas de investigación tiene objetivos y metodologías muy diferentes,
sin embargo, tomadas en un conjunto todas han sido influencias legítimas e importantes
en el pensamiento agroecológico.

Influencias de pensamiento agroecológico

Ciencias Agrícolas

Como Altieri (1987) lo ha señalado, el crédito de gran parte del desarrollo inicial de la
agricultura ecológica en las ciencias formales le pertenece a Klages (1928), quien sugirió
que se tomaran en cuenta los factores fisiológicos y agronómicos que influían en la
distribución y adaptación de especies específicas de cultivos, para comprender la
compleja relación existente entre una planta de cultivo y su medio ambiente.

Más adelante, Klages (1942) expandió su definición e incluyó en ella factores históricos,
tecnológicos y socioeconómicos que determinaban qué cultivos podían producirse en
una región dada y en qué cantidad. Papadakis (1938) recalcó que el manejo de cultivos
debería basarse en la respuesta del cultivo al medio ambiente.

La ecología agrícola fue aún más desarrollada en los años 60 por Tischler (1965) e
integrada al curriculum de la agronomía en cursos orientados al desarrollo de una base
ecológica a la adaptación ambiental de los cultivos. La agronomía y la ecología de
cultivos están convergiendo cada vez más, pero la red entre la agronomía y las otras
ciencias (incluyendo las ciencias sociales) necesarias para el trabajo agroeocológico,
están recién emergiendo.

226
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
227

Las obras de Azzi (1956), Wilsie (1962), Tischler (1965), Chang (1968) y Loucks (1977)
representan un cambio de enfoque gradual hacia un enfoque ecosistémico de la
agricultura. En particular fue Azzi (1956) quien acentuó que mientras la meteorología, la
ciencia del suelo y la entomología son disciplinas diferentes, su estudio en relación con
la respuesta potencial de plantas de cultivo converge en una ciencia agroecológica que
debería iluminar la relación entre las plantas cultivadas y su medio ambiente.

Wilsie (1962),analizó los principios de adaptación de cultivos y su distribución en relación


a factores del hábitat, e hizo un intento para formalizar el cuerpo de relaciones implícitas
en sistemas de cultivos. Chang (1968) prosiguió con la línea propuesta por Wilsie, pero
se centró en un grado aún mayor en los aspectos ecofisiológicos.

Desde comienzos de los años 70, ha habido una expansión enorme en la literatura
agronómica con un enfoque agroecológico, incluyendo obras tales como las de Dalton
(1975), Netting (1974) van Dyne (1969), Spedding (1975), Cox y Atkins (1979), Richards
P. (1984), Vandermeer (1981), Edens y Koenig (1981), Edens y Haynes (1982), Altieri y
Letourneau (1982), Gliessman et al. (1981), Conway (1985), Hart (1979), Lowrance et al.
(1984) y Bayliss-Smith (1982).

A fines de la década del 70 y a comienzos de la del 80 un componente social cada vez


mayor comenzó a aparecer en la literatura agrícola, en gran parte como resultado del
estudio sobre el desarrollo rural en los Estados Unidos (Buttel, 1980).

La contextualización social unida al análisis agronómico ha generado evaluaciones


complejas de la agricultura, especialmente en el caso del desarrollo regional (Altieri y
Anderson 1986, Brush 1977, Richards P. 1984 y 1986, Kurin 1983, Bartlett 1984, Hecht
1985, Blaikie 1984).

Los entomólogos en sus intentos de desarrollar sistemas de manejo integrado de plagas,


han hecho contribuciones valiosas al desarrollo de una perspectiva ecológica para la
protección de las plantas. La teoría y la práctica del control biológico de plagas se basa
exclusivamente en principios ecológicos (Huffaker y Messenger 1976).

El manejo ecológico de plagas se centra en primer lugar en enfoques que contrastan la


estructura y el funcionamiento de los sistemas agrícolas con aquellas de sistemas
naturales relativamente no perturbados, o sistemas agrícolas más complejos (Southwood
y Way 1970, Price y Waldbauer 1975, Levins y Wilson 1979, Risch 1981 y Risch et al.
1983).

Browning y Frey (1969) han argumentado que los enfoques de manejo de plagas
deberían hacer hincapié en el desarrollo de agroecosistemas que emularan la sucesión
natural lo más posible, debido a que estos sistemas más maduros son a menudo más
estables que los sistemas consistentes en una estructura sencilla de monocultivos.

227
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
228

Enfoque Metodológico

Una gran cantidad de métodos de análisis agroecológico se están desarrollando en la


actualidad en todo el mundo. Se podría considerar que se utilizan principalmente cuatro
enfoques metodológicos:

1. Descripción Analítica. Se están realizando muchos estudios que miden y describen


cuidadosamente los sistemas agrícolas y miden propiedades específicas tales como la
diversidad de plantas, la acumulación de biomasa, la retención de nutrientes y el
rendimiento.

Por ejemplo, el Centro Internacional de Agroforestería (ICRAF) ha estado desarrollando


una base internacional de datos de los diferentes tipos de sistemas de agroforestería y
los está correlacionando con una variedad de parámetros medio ambientales para
desarrollar modelos regionales de cultivos mixtos (Nair 1984, Huxley 1983).

Este tipo de información es valiosa para ampliar nuestra comprensión de los tipos de
sistemas existentes, de los componentes que habitualmente se encuentran ensamblados
y en qué contexto ambiental. Este es el primer paso necesario. Los estudios
representativos de este tipo de pensamiento son numerosos e incluyen a Ewel 1986,
Alcorn 1984, Marten 1986, Denevent et al. 1984 y Posey 1985.

El análisis Comparativo.

La investigación comparativa generalmente involucra la comparación de un monocultivo


u otro sistema de cultivo con un agroecosistema tradicional de mayor complejidad. Los
estudios comparativos de este tipo involucran un análisis de la productividad de cultivos
específicos, de la dinámica de las plagas o del estatus de los nutrientes en cuanto están
relacionados con factores tales como la diversidad de los campos de cultivo, la
frecuencia de las malezas, la población de insectos y los patrones de reciclaje de
nutrientes.

Varios estudios de este tipo se han llevado a cabo en América Latina, Africa y Asia (Uhl y
Murphy 1981, Marten 1986 y Woodmansee 1984). Dichos proyectos usan metodologías
científicas de tipo estándar para iluminar la dinámica de sistemas locales de cultivos
mixtos específicos, comparándolos con los monocultivos. Estos datos a menudo son
útiles pero la heterogeneidad de los sistemas locales puede oscurecer la comprensión de
cómo éstos funcionan.

Comparación Experimental.

Para establecer la dinámica y para reducir el número de variables, muchos


investigadores desarrollan una versión simplificada del sistema nativo en el cual las
variables pueden ser controladas más de cerca. Por ejemplo, el rendimiento de un cultivo

228
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
229

mixto de maíz, poroto y calabaza puede ser comparado al del cultivo simple de cada una
de estas especies.

Sistemas Agrícolas Normativos.

Estos se construyen a menudo con modelos teóricos específicos en mente. Un


ecosistema natural puede ser ilimitado, o un sistema agrícola nativo podría ser
reconstituido con mucho esfuerzo. Este enfoque está siendo evaluado en forma
experimental por varios investigadores en Costa rica. Ellos están desarrollando sistemas
de cultivos que emulan las secuencias sucesionales por medio del uso de cultivos que
son botánica y morfológicamente semejante a las plantas que naturalmente ocurren en
varias etapas sucesionales (Hart 1979, Ewel 1986).

Aún cuando la agronomía ha sido sin lugar a dudas la disciplina materna de la


agroecología, ésta recibió una fuerte influencia del surgimiento del ambientalismo y de la
expansión de los estudios ecológicos. El estudio del medio ambiente fue necesario para
proporcionar el marco filosófico en el cual el valor de las tecnologías alternativas y el
proyecto normativo de la agroecología pudieran apoyarse.

Los estudios ecológicos fueron críticos en la expansión de los paradigmas por medio de
los cuales cuestiones agrícolas pudieran desarrollarse, y de las destrezas técnicas para
analizarlos.

Ambientalismo

Importancia de este movimiento.

El movimiento ambiental de los años 60 - 70 ha hecho una gran contribución intelectual a


la agroecología. Debido a que los asuntos del ambientalismo coincidían con la
agroecología, ellos infundieron al discurso agroecológico una actitud crítica de la
agronomía orientada hacia la producción, e hicieron crecer la sensibilidad hacia un gran
número de asuntos relacionados con los recursos.

La versión de los años 60 del movimiento ambiental se originó como consecuencia de


una preocupación con los problemas de contaminación. Estos eran analizados en
función tanto de los fracasos tecnológicos como de las presiones de la población. La
perspectiva Maltusiana ganó una fuerza especial a mediados de la década del 60 por
medio de obras tales como "La Bomba Poblacional" de Paul Ehrlich (1966) y "La
Tragedia de los Comunes" de Garret Hardin (1968).

Estos autores dieron como principal causa de la degradación ambiental y del


agotamiento de recursos al crecimiento de la población. Este punto de vista fue
técnicamente ampliado por la publicación de "Los Límites del Crecimiento" del Club de

229
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
230

Roma, el que utilizó simulaciones computarizadas de las tendencias globales dela


población, del uso de recursos y la contaminación, para generar argumentos para el
futuro, los que generalmente eran desastrosos.

Esta posición ha sido criticada desde perspectivas metodológicas y epistemológicas


(Simon y Kahn 1985).

Mientras que "Los Límites del Crecimiento" desarrolló un modelo generalizado de la


"crisis ambiental", dos volúmenes seminales posteriores contenían una relación especial
al pensamiento agroecológico, porque en ellos se perfilaban visiones de una sociedad
alternativa. Estos fueron "Ante-proyecto de la Supervivencia" (El ecologista, 1972) y "Lo
Pequeño es Hermoso" (Schumacher, 1973).

Estos trabajos incorporaban ideas sobre la organización social, la estructura económica


y valores culturales y las convertían en una visión exhaustiva más o menos utópica.
"Ante-proyecto de la Supervivencia" argumentaba a favor de la descentralización de
empresas de pequeña envergadura y acentuaba las actividades humanas que
involucrarían un mínimo de disrupción ecológica y un máximo de conservación de
energía y materiales.

El santo y seña era autosuficiencia y sustentabilidad. El libro de Schumacher acentuaba


una evaluación radical de la racionalidad económica ("Economía Budista"), un modelo
descentralizado de la sociedad humana ("dos millones de aldeas") y una tecnología
apropiada. El significado especial de "Lo Pequeño es Hermoso" era que estas ideas se
ampliaron para alcanzar el Tercer Mundo.

Problemas Agrícolas. Los asuntos ambientales en su relación con la agricultura fueron


claramente señalados por Carson en su libro "Primavera Silenciosa" (1964), el que
planteaba interrogantes sobre los impactos secundarios de las substancias tóxicas,
especialmente de los insecticidas, en el ambiente. Parte de la respuesta a estos
problemas fue el desarrollo de enfoques de manejo de plagas para la protección de los
cultivos, basados enteramente en su teoría y práctica en los principios ecológicos
(Huffaker y Messenger 1976).

El impacto tóxico de los productos agro-químicos era sólo una de las interrogantes
ambientales, debido a que el uso excesivo de los recursos energéticos también se
estaba convirtiendo en un asunto cada vez más importante. Era necesario evaluar los
costos energéticos de sistemas de producción específicos: especialmente a comienzos
de la década del 70 cuando los precios del petróleo se fueron a las nubes.

El clásico de Pimentel y Pimentel (1979) demostró que en la agricultura americana cada


kilo-caloría derivado del maíz se "obtenía" a un enorme costo energético de energía
externa. Los sistemas de producción norteamericanos fueron por lo tanto comparados
con otros varios tipos de agricultura, los que eran de menor producción por área de

230
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
231

unidad (en términos de kilo-calorías por cada hectárea) pero mucho más eficientes en
términos de rendimiento por unidad de energía invertida.

El alto rendimiento de la agricultura moderna se obtiene a costa de numerosos gastos,


los que incluyen insumos no renovables tales como el combustible de fósiles.
En el Tercer Mundo esta energía a menudo es importante, y cargada a la balanza
internacional de pagos, empeorando la situación de endeudamiento de muchos países
en desarrollo.

Más aún, debido a que la mayor parte de la energía no se utiliza para el cultivo de
alimentos, la ganancia en la producción no se traduce necesariamente en un mejor
abastecimiento de alimentos (Crouch y de Janvry 1980, Graham 1984 y Dewey 1981).

Finalmente, las consecuencias sociales de este modelo tienen impactos complejos y a


menudo extremadamente negativos en la población local, en especial en aquellos que
tienen un acceso limitado a tierras y a créditos. Estos problemas se discuten en detalle
más adelante en este capítulo.

Los problemas de la toxicidad y recursos de la agricultura ensamblaron con los


problemas mayores de la transferencia tecnológica en contextos del Tercer Mundo. "La
Tecnología Descuidada" (editada por Milton y Farvar en 1968) fue una de las primeras
publicaciones que intentó, en gran medida, documentar los efectos de proyectos de
desarrollo y transferencia de tecnologías de zonas templadas, sobre las ecologías y las
sociedades de los países en desarrollo.

Cada vez en mayor número, investigadores de diferentes áreas comenzaron a hacer


comentarios sobre la pobre "adecuación" entre los enfoques que se dan al uso de la
tierra en el Primer Mundo y la realidad del Tercer Mundo. El artículo de Janzen (1973),
sobre agroecosistemas tropicales, fue la primera evaluación ampliamente difundida de
por qué los sistemas agrícolas tropicales podrían comportarse de una forma diferentes a
los de las zonas templadas.

Este trabajo y el de Levins (1973) plantearon un desafío a los investigadores agrícolas,


que los llevó a repensar la ecología de la agricultura tropical.

Al mismo tiempo, el problema filosófico más amplio planteado por el movimiento


ambiental tuvo resonancia en la re-evaluación de las metas del desarrollo agrícola en los
Estados Unidos y en el Tercer Mundo, y en las bases tecnológicas sobre las que serían
llevadas a cabo.

En el mundo desarrollado estas ideas sólo tuvieron un impacto moderado en la


estructura de la agricultura, porque la confiabilidad y disponibilidad de productos
agroquímicos y energéticos aplicados a la agricultura tenía como resultado
transformaciones pequeñas en el patrón de uso de recursos en la agricultura.

231
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
232

En situaciones en las que tanto los campesinos como la nación estaban presionando por
los recursos, donde prevalecían estructuras distributivas regresivas y donde el enfoque
de las zonas templadas no era apropiado a las condiciones ambientales locales, el
enfoque agroecológico parecía de especial relevancia.

La integración de la agronomía y el ambientalismo ensambló con la agroecología, pero


los fundamentos intelectuales para una asociación académica de este tipo eran aún
relativamente débiles. Era necesario un enfoque teórico y técnico más claro,
especialmente en relación con los sistemas tropicales. El desarrollo de la teoría
ecológica tendría una relevancia especial en el desarrollo del pensamiento
agroecológico.

Ecología

Por varias razones los ecológos han tenido una importancia singular en la evolución del
pensamiento agroecológico. En primer lugar, el marco conceptual de la agroecología y
su lenguaje son esencialmente ecológicos. En segundo lugar, los sistemas agrícolas son
en sí mismos interesantes sujetos de investigación, en los cuales los investigadores
tienen mucho mayor habilidad para controlar, probar y manipular los componentes del
sistema, en comparación con los ecosistemas rurales.

Estos pueden proporcionar condiciones de pruebas para un patrón amplio de hipótesis


ecológicas, y de hecho ya han contribuido substancialmente al cuerpo de conocimiento
ecológico (Levins 1973, Risch et al. 1983, Altieri 1987, Uhl et al. 1987).

En tercer lugar, la explosión de investigaciones sobre los sistemas tropicales ha dirigido


la atención al impacto ecológico de la expansión de sistemas de monocultivos en zonas
que se caracterizan por su diversidad y extraordinaria complejidad (Janzen 1973, Uhl
1983, Uhl y Jordan 1984, Hecht 1985).

En cuarto lugar, varios ecólogos han comenzado a dirigir su atención a las dinámicas
ecológicas de los sistemas agrícolas tradicionales (Gliessmann 1982, Altieri y Farrell
1984, Anderson et al. 1987, Marten 1986, Richards 1984 y 1986).

Tres áreas de interés académico han sido especialmente críticas en el desarrollo de los
análisis agroecológicos: el ciclaje de nutrientes, las interacciones de plagas/plantas y la
sucesión ecológica. A modo de ilustración esta sección se concentrará en el ciclaje de
nutrientes.

A comienzos de los años 60 el análisis del ciclaje de nutrientes en los sistemas tropicales
se convirtió en un tópico de interés y fue considerado como un proceso vital del
ecosistema.

232
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
233

Varios estudios, tales como el estudio de Puerto Rico de Odum (1976), la investigación
de Nye y Greenland en 1961 y más adelante la serie de artículos y monografías que
derivaron de trabajos realizados en San Carlos, Venezuela, Catci, Costa Rica y otros
lugares en Asia y Africa han sido la simiente que clarifica los mecanismos de los ciclajes
de nutrientes, tanto en bosques nativos como en áreas que han sido cultivadas (Jordan
1985, Uhl y Jordan 1984, Buschbacker et al. 1987, Uhl et al. 1987).

Los hallazgos ecológicos de esta investigación sobre el ciclaje de nutrientes y que


tuvieron un mayor impacto en el análisis de la agricultura fueron:

• La relación entre la diversidad y las estrategias inter-especies para captar nutrientes.

• La importancia de los rasgos estructurales para aumentar la captación de nutrientes


tanto abajo como encima del suelo.

• La dinámica de los mecanismos fisiológicos en la retención de nutrientes.

• La importancia de relaciones asociativas de plantas con micro-organismos tales como


micorrizas y fijadores simbióticos de nitrógeno.

• La importancia de la biomasa como el lugar de almacenaje de los nutrientes.

Estos hallazgos sugerían que los modelos ecológicos de la agricultura tropical incluirían
una diversidad de especies (o al menos de cultivos) para aprovechar la variedad de
absorción de nutrientes, tanto en términos de diferentes nutrientes como en la absorción
de nutrientes de los diferentes niveles de profundidad del suelo.

La información producida por los estudios ecológicos sobre el ciclaje de nutrientes


también sugería el uso de plantas tales como las leguminosas que con facilidad forman
asociaciones simbióticas, y el uso más extendido de plantas perennes en el sistema de
producción, como un medio para bombear nutrientes de las diferentes capas del suelo y
aumentar así la capacidad total de reciclaje y almacenamiento de nutrientes en el
ecosistema.

No es sorprendente hallar que muchos de estos principios ya estaban siendo aplicados


en numerosos sistemas agrícolas desarrollados por poblaciones locales en los trópicos.

La mayor parte de la literatura ecológica, la comparación entre ecosistemas naturales y


agroecosistemas se han basado en agroecosistemas desarrollados por ecologistas
posteriormente a cierta observación de un ecosistema local más bien que después de
observar sistemas locales verdaderamente desarrollados.

233
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
234

Más aún, la investigación se centró en parámetros tales como la diversidad de semillas,


acumulación de biomasa y almacenaje de nutrientes en sucesión.

Esta investigación nos ha proporcionado cierta comprensión de algunas dinámicas de los


sistemas agrícolas considerados como entidades biológicas, pero hasta qué punto el
manejo (con excepción del llevado a cabo por algunos alumnos relativamente
inexpertos) influye en estos procesos sigue siendo un área casi enteramente inexplorada
(un caso excepcionalmente sobresaliente en este aspecto es el Uhl et al. 1987).

Las limitaciones del enfoque puramente ecológico están siendo cada vez más superadas
a medida que los investigadores comienzan a analizar los sistemas campesinos y
nativos en equipos multi-disciplinarios y desde un perspectiva más holística (Anderson y
Anderson 1983, Hecht et al. 1987, Anderson et al. 1987, Marten 1986, Denevan et al.
1984).

Estos esfuerzos tienen como intención el colocar a la agricultura en un contexto social:


utilizan modelos nativos locales y explicaciones nativas del por qué se realizan ciertas
actividades para el desarrollo de hipótesis que más adelante pueden ser probadas por
medio de modelos agronómicos y científicos. Esta es un área de investigación floreciente
con implicancias tanto teóricas como aplicadas de mucha importancia, y una gran
inspiración para la teoría y práctica de la agroecología.

Sistemas nativos de producción

Otra influencia mayor en el pensamiento agroecológico es aquella que procede de los


esfuerzos de investigación de los antropólogos y los geógrafos dedicados a describir y
analizar las prácticas agrícolas y la lógica de los pueblos nativos y campesinos.
Típicamente, estos estudios se han preocupado del uso de recursos y del manejo de
toda la base de subsistencia, no solamente del predio agrícola, y se han concentrado en
cómo los pueblos locales explican esta base de subsistencia, y en cómo los cambios
sociales y económicos afectan los sistemas de producción.

El análisis científico del conocimiento local han sido un fuerza importante para reevaluar
los supuestos de los modelos coloniales y agrícolas de desarrollo. La obra pionera en
este campo fue la de Audrey Richards (1939) sobre las prácticas de roza, tumba y
quema (sistema citamene) en el Africa Bemba.

El sistema citamene involucra el uso de desechos de árboles como compost en las


prácticas agrícolas de los terrenos montañosos en Africa Central. Este estudio, que
acentúa los resultados de las tecnologías agrícolas y de las explicaciones ecológicas de
los pueblos nativos, contrasta diametralmente con aquella percepción despreciativa de la
agricultura nativa que considera las prácticas locales como desordenadas y de inferior
calidad.

234
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
235

Otra importante contribución al estudio de sistemas de cultivo nativos fue el trabajo de


Conklin (1956), el que sentó las bases para la re-evaluación de la agricultura itinerante,
basado en dados etnográficos y agronómicos sobre los Hnunoo de las Filipinas.

Este trabajo señala la complejidad ecológica y diversidad de los patrones de agricultura


itinerante y la importancia de los policultivos, la rotación de cultivos y sistemas de
agroforestería, en el marco total de la producción itinerante. Es uno de los estudios más
tempranos y más ampliamente conocidos sobre la estructura y complejidad del cultivo de
roza, tumba y quema, e incorpora mucha intuición ecológica.

Fue de especial importancia el énfasis que Conklin puso en el conocimiento ecológico


nativo y la importancia que le asignó a explotar esta rica fuente de comprensión
etnocientífica. Sin embargo, él hacía hincapié en que el acceso a esta información
requería habilidades tanto etnográficas como científicas.

Investigadores tales como Richards, P. 1984, Bremen y de Wit 1983, Watts 1983, Posey
1984, Denevan et al. 1984, Hecht y Posey 1987, Browkenshaw et al. 1979 y Conklin
1956, entre muchos otros, han estudiado los sistemas nativos de producción y sus
categorías de conocimiento sobre las condiciones ambientales y prácticas agrícolas.

Este cuerpo de investigación se centra en el punto de vista nativo de los sistemas de


producción y los analiza con los métodos científicos occidentales. Todos estos autores
han hecho hincapié en que la organización social y las relaciones sociales de la
producción deberían considerarse tan de cerca como el medio ambiente y los cultivos.
Este acento en la dimensión social de la producción es una base importante para la
comprensión de la lógica de producción de sistemas agrícolas.

Otro resultado importante de gran parte del trabajo sobre los sistemas nativos de
producción es la idea que se necesitan diferentes nociones de eficiencia y racionabilidad
para comprender los sistemas nativos de campesinos.

Por ejemplo, la eficiencia de producción por unidad de labor invertida, más bien que una
simple relación de rendimiento por áreas es básica para la lógica de producción de
muchos cultivadores del Tercer Mundo.

Las prácticas que se centran en evitar riesgos, puede que no sean tan rendidoras a corto
plazo, pero pueden ser preferibles a opciones de uso de tierras altamente productivas
pero que tienen mayores riesgos. La disponibilidad de trabajo, en especial en épocas
importantes como es la de las cosechas, puede también influir en los tipos de sistemas
agrícolas favorecidos.

Este tipo de investigación ha influido en el desarrollo de los argumentos contrarios a


aquellos que atribuían el fracaso de la transferencia de tecnología agrícola a ignorancia e
indolencia.

235
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
236

Este enfoque, con el acento en los factores humanos de los sistemas agrícolas, también
ponía más atención en las estrategias de los campesinos de diferentes estratos sociales,
y cada vez más en el rol de la mujer en la agricultura y el manejo de recursos (Deere
1982, Moock 1986).

El análisis etno-agrícola ha contribuido mucho a la expansión de las herramientas


conceptuales y prácticas de la agroecología. El enfoque (marco étnico) basado en la
explicación de una cultura dada ha sugerido relaciones que los marcos "étnicos" (es
decir marcos externos, generalmente referidos a modelos occidentales de expansión) no
capturan fácilmente, al basarse en los métodos de la ciencia occidental.

Más aún, esta investigación ha explayado el concepto de lo que puede con provecho ser
llamado agricultura, debido a que muchos grupos están involucrados en la manipulación
de ecosistemas forestales a través del manejo de la sucesión y la reforestación actual
(Posey 1985, Anderson et al. 1987, Alcorn 1984).

Aún más, la agricultura desarrollada localmente incorpora numerosos cultivos cuyo


germoplasma es esencial para el "desarrollo" de programas de mejoramiento genético
como el de la yuca y porotos, y también incluye numerosas plantas con un potencial de
uso más amplio en ambientes difíciles.

Finalmente, dicho trabajo valora los logros científicos de cientos de años de cultivo de
plantas y trabajo agronómico llevado a cabo por las poblaciones locales.

El estudio de sistemas agrícolas nativos ha proporcionado gran parte de la materia prima


para el desarrollo de hipótesis y sistemas de producción alternativos para la
agroecología.

Cada vez es más amplio el estudio de la agricultura nativa realizado por equipos multi-
disciplinarios para documentar las prácticas y se han desarrollado categorías de
clasificación para analizar los procesos biológicos dentro de los sistemas agrícolas y
para evaluar aspectos de las fuerzas sociales que influyen en la agricultura. El estudio de
sistemas nativos ha sido seminal en el desarrollo del pensamiento agroecológico.

Estudios del desarrollo

El estudio del desarrollo rural del Tercer Mundo también ha sido una gran contribución a
la evolución del pensamiento agroecológico. El análisis rural ha ayudado a clasificar la
lógica de las estrategias locales de producción en comunidades que están sufriendo
grandes transformaciones, a medida que las áreas rurales se integran a economías
regionales, nacionales y globales.

Los estudios sobre el desarrollo rural han documentado la relación que existe entre los
factores socioeconómicos y la estructura y organización social de la agricultura. Existen

236
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
237

varios temas de investigación sobre el desarrollo, que han sido de especial importancia
para la agroecología, incluyendo el impacto de las tecnologías inducidas desde afuera, el
cambio de cultivos, los efectos de la expansión de mercados, las implicancias de los
cambios de relaciones sociales y la transformación en las estructuras de tenencia de
tierras y de acceso a los recursos económicos.

Todos estos procesos están íntimamente ligados. Cómo ellos afectan los
agroecosistemas regionales es el resultado de complejos procesos históricos y políticos.

La investigación de la Revolución Verde fue importante para la evolución del


pensamiento agroecológico porque los estudios sobre el impacto de esta tecnología
fueron un instrumento que arrojó luz sobre los tipos de prejuicios que predominaban ene
l pensamiento agrícola y de desarrollo.

Esta investigación también tuvo como resultado el primer análisis verdaderamente


interdisciplinario de cuestiones de tenencia de tierras y del cambio tecnológico en la
agricultura desde un punto de vista ecológico, social y económico; todo esto realizado
por un amplio espectro de analistas.

La extraordinaria aceleración del proceso de estratificación social del campesino que se


asocia a la Revolución Verde indicaba inmediatamente que ésta no era una tecnología
neutra en sus objetivos y resultados, sino más bien que podría transformar
dramáticamente la base de la vida rural de un gran número de personas.

Como lo hizo notar Perelman en 1977, los más beneficiados por dichas tecnologías
fueron los consumidores urbanos. La estrategia de la Revolución Verde se desarrolló
cuando los problemas de la pobreza y el hambre eran considerados principalmente como
problemas de producción.

Este diagnóstico implicó varias estrategias que se centraban en áreas agrícolas en las
que rápidamente podrían llevarse a cabo aumentos de producción, suelos de mejor
calidad y tierras de riego entre granjeros con bienes materiales y de capital
substanciales.

Tuvo éxito en términos de elevar la producción: en el fondo era parte de una política de
apostar conscientemente al más fuerte (Chambers y Ghildyal 1985, Pearce 1980). Es
ahora generalmente reconocido que solamente el aumento agregado de la producción
de alimentos no soluciona el problema del hambre y la pobreza rural, aunque sí puede
reducir los costos de alimentos para los sectores urbanos (Sen 1981, Watts 1983).

Las consecuencias de la Revolución Verde en las áreas rurales fueron tales que
sirvieron para marginalizar a gran parte de la población rural.

237
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
238

En primer lugar, centró sus beneficios en los grupos que eran ricos en recursos,
acelerando así la diferencia entre ellos y los otros habitantes rurales, por lo que la
desigualdad rural a menudo aumentó.

En segundo lugar, socavó muchas formas de acceso a la tierra y a los recursos, tales
como los cultivos de mediería, el arriendo de mano de obra y el acceso a medios de
riego y tierras de pastoreo. Esto redujo la diversidad de estrategias de subsistencia
disponibles a las familias rurales y, por lo tanto, aumentó la dependencia del predio
agrícola.

El estrechamiento de la base genética de la agricultura aumentó los riesgos porque los


cultivos se hicieron más vulnerables a plagas y enfermedades y a los caprichos del
clima. En el caso de arrozales inundados o regados, la contaminación generada por el
uso de pesticidas y herbicidas a menudo minó una importante fuente local de proteínas:
el pescado.

El análisis de la Revolución Verde hecho desde el punto de vista de diferentes


disciplinas, contribuyó al primer análisis holístico de las estrategias de desarrollo
agrícola/rurales. Fue la primera evaluación ampliamente difundida que incorporó críticas
ecológicas, tecnológicas y sociales.

Este tipo de enfoque y de análisis ha sido el prototipo de varios estudios posteriores


sobre la agroecología, y el progenitor de la investigación sobre sistemas de labranza.

Es hoy ampliamente reconocido que las tecnologías de la Revolución Verde pueden ser
aplicadas en áreas limitadas y ha habido peticiones de varios analistas del desarrollo
rural en el sentido de re-dirigir la investigación agrícola en la dirección de campesinos de
bajos recursos.

En el mundo existen por lo menos un billón de campesinos de recursos, ingresos y flujos


de producción muy limitados, quienes trabajan en un contexto agrícola de extrema
marginalidad. Los enfoques que hacen hincapié en paquetes de tecnologías
generalmente requieren de recursos a los cuales la mayoría de los campesinos del
mundo no tienen acceso (Tabla 2).

Muchos analistas del desarrollo rural reconocen hoy las limitaciones para la agricultura
de los enfoques tipo Revolución Verde que enfatizan agricultura a gran escala, pero
estos modelos agrícolas han dominado de una forma sorprendente los proyectos de
desarrollo agrícola del Tercer Mundo.

Mientras los resultados de las estaciones experimentales de investigación se veían


extremadamente promisorios, el bajo grado de adopción por campesinos y de
reproducción exacta de los modelos en los campos, ha ocasionado grandes dificultades
en muchos proyectos.

238
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
239

El enfoque de transferencia de tecnologías tendía a acelerar las diferencias,


exacerbando muchas situaciones políticas difíciles o las tecnologías sólo eran
parcialmente adoptadas y en muchos casos no adoptadas del todo (Scott 1978 y 1986).

Varias eran las explicaciones para la baja transferencia de tecnologías, incluyendo la


idea que los campesinos eran ignorantes y que era necesario enseñarles a cultivar. Otro
set de explicaciones se centró en las exigencias a nivel de granja, tales como la falta de
créditos que limitaban la posibilidad de los campesinos de adoptar estas tecnologías.

En el primer caso se considera que la falla está en el campesino; en el segundo se culpa


a problemas de infraestructura de diferentes tipos. Nunca se criticó a la tecnología
misma.

Varios investigadores de terreno y practicantes del desarrollo se han sentido frustrados


por estas explicaciones y un número cada vez mayor han señalado que las tecnologías
en si requieren de una reevaluación sustancial.

Ellos han argumentado que la decisión del campesino de adoptar o no una tecnología es
la verdadera prueba de su calidad. A menudo a este enfoque se le ha llamado "el
campesino primero y último" o "el campesino vuele al campesino" o "la revolución
agrícola nativa".

Según dicen Rhoades y Booth (1982) "la filosofía básica en la que se apoya este modelo
es que la investigación y el desarrollo agrícola deben comenzar y terminar en el
campesino. La investigación agrícola aplicada no puede comenzar aisladamente en un
centro de experimentación o con un comité de planificación que está lejos del contacto
con la realidad campesina.

En la práctica esto significa obtener información acerca del campesino y comprensión de


la percepción que el campesino tiene del problema y la aceptación de la evaluación que
el campesino hace de la solución propuesta".

Este enfoque requiere una participación mucho mayor de parte del campesino en el
diseño y la implementación de programas de desarrollo rural (Chambers 1984, Richards
P. 1984, Gow y Van Sant 1983, Midgley 1986).

Una consecuencia de esta posición ha sido reconocer el gran conocimiento que el


campesino tiene de la entomología, botánica, suelos y agronomía, los que pueden servir
como puntos de partida para la investigación. En este caso también, la agroecología ha
sido identificada como una valiosa herramienta analítica asimismo como un enfoque
normativo para la investigación.

239
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
240

La agroecología encaja bien con los asuntos tecnológicos que requieren prácticas
agrícolas más sensibles al medio ambiente y a menudo encuentra congruencias del
desarrollo tanto ambiental como participativo con perspectivas filosóficas.

La diversidad de preocupaciones y de cuerpos de pensamientos que han influido en el


desarrollo de la agroecología son verdaderamente amplios. Sin embargo, esta es la
extensión de los asuntos que inciden en la agricultura. Es por esta razón que ahora
vemos agroecólogos con un entrenamiento mucho más rico que el encontrado
corrientemente entre los alumnos de ciencias agrarias centrados en una disciplina, como
asimismo muchos más equipos multidisciplinarios trabajando en estos asuntos en el
campo.

Aunque es una disciplina en pañales, y hasta el momento ha planteado más problemas


que soluciones, la agroecología indudablemente ha ampliado el discurso agrícola.

Tabla
El contraste en condiciones físicas y socioeconómicas de campesinos
ricos en recursos versus aquellos pobres en recursos
(Modificada de Chambers y Ghildyal 1985)

Campesinos
Estaciones Campesinos
pobres en
experimentales ricos en recursos
recursos
ondulada o
Topografía plana o terrazas plana o terrazas
laderas
delgados, no
Suelos profundos, pocas profundos, pocas
fértiles serias
dificultades dificultades
dificultades
Deficiencas de
rara, solucionable ocasional bastante común
nutrientes
Riesgos (fuego,
pocos y
des- lizamientos, irrelevantes comunes
controlables
etc.)
generalmente
frecuentemente, en rara, poco
Irrigación disponible, de fácil
completo control confiable
control
grande o pequeña,
Tamaño de la
grande, adyacente mediana- mente irregular no
Unidad
adyacente adyacente

240
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
241

controladas con controladas con


Enfermedades,
agroquímicos, mano agroquímicos, control cultural
plagas, maleza
de obra mano de obra

Acceso a
fertilizantes, bajo, no
ilimitado confiable alto, confiable
semillas confiable
mejoradas

Semillas alta calidad alta calidad semillas propias

poco acceso con


Créditos ilimitados buen acceso escasez
temporal

familia, escasez
sin dificultad de mano de obra
Trabajo en temporadas
obtener contratada
críticas

Precios irrelevantes bajos Altos

Prioridad para la
producción de irrelevante baja alta
alimentos

BIBLIOGRAFIA

• Alcorn, J.B. 1984, Huastec Mayan Ethnobotany. Austin. Unv. Texas Press.

• Altieri, M.A. and M.K. Anderson, 1986. An ecological basis for the development of
alternative agricultural system for small farmers in the Third World. Amer. J. Alter. Agric.
1:30-38.

• Altieri M.A. and J.G. Farrel 1984. Traditional Farming systems of south central Chile,
with special emphasis on agroforestry. Agrofor. Syst. 2:3-18.

• Altieri, M.A. and D.K. Letourneau 1982. Vegetation management and biological control

241
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
242

in agroecosystems. Crop Prot. 1:405-430.

• Altieri, M.A. 1987. Agroecology: The scientific basis of alternativo agriculture. Westview
Press Boulder.

• Anderson, A. and S. Anderson. 1983. People and the Palm Forest. Washington. U.S.
MAB Publ.

• Anderson, A., A. Gely, J. Strudwick, G. Sobel and M. Pinto. 1987. Un sistema


agroforestal na varzea do Estuario Amazónico. Acta Amazónica (in press).

• Azzi, G. 1956. Agricultural Ecology. London-Constable.

• Bartlett, K. 1984. Agricultural Choice and Change. New York: Academic Press.

• Bayliss-Smith, T.P. 1982. The Ecology of Agricultural Systems. London-Cambridge


Univ. Press.

• Blaikie, P. 1984. The Political Economy of Soil Erosion. New York: Methuen.

• Bremen, H. and C.T. de Witt. 1983 Rangeland productivity and exploitation in the Sahel.
Science 221 (4618): 1341-1348.

• Brokenshaw, D., D. Warren and O. Wener. 1979. Indigenous Knoeledge Systems in


Development. Washington: Univ. Press of America.

• Browning, J.A. and K.J. Frey. 1969. Multiline curltivars as a means of disease control.
Annu. Rev. Phytopathol. 7;355-382.

• Brush, S. 1977. Mountain, Field and Family, Philadelphia: Univ. Penn.

• Buschbacker, R., C. Uhl, E. Serrao. 1987. Abandoned pastures in Amazonia. II. Nutrient
stocks. In: Soil and Vegetation. J. Ecol. (in press).

• Buttel, F.H. 1980. Agriculture, environment and social change: some emergent issues.
In: The Rural Sociology of the Advanced Societies. F.H. Buttel and H. Newby, eds. New
Yersey: Allenheld, Osmun and Co. Pp. 453-488.

• Carson, R. 1964. The Silent Spring. New York: Fawcett.

• Chambers, R. 1983. Rural Development: Putting the Last First. London: Longman.

• Chambers, R. and B.P. Ghildyal. 1985. Agricultural Research for resource-poor farmers:
the farmer first and last. Agricultural Admi. 20:1-30.

242
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
243

• Chang, J.H. 1968. Climate and Agriculture. Chicago: Aldine Pub. Co.

• Conklin, H.C. 1956. Hananoo Agriculture. Rome: FAO

• Conklin, H.C. 1972. Folk Classification, a Topically Arranged Bibliography. New Have.
Yale Univ. Dep. Anth.

• Conway, G.R. 1985. Agroecosystem analysis. Agri. Adm.20:1-30.

• Cox, G.W. and M.D. Atkins, 1979. Agricultural Ecology. San Francisco: W.H. Freeman
and Sons.

• Crouch, L. and A. de Janvry. 1980. The class bias of agricultural growth. Food Policy 3-
13.

• Dalton, G.E. 1975. Study of Agricultural Systems. London: Applied Sciences.

• Deere. C.D. 1982. Women and the sexual division of labor in Peru. Economic
Development and Cultural Change. 30:795-811.

• Denevan. W., J. Tracy, and J.B. Alcorn. 1984. Indigenous agroforestry in the Peruvian
Amazon: Examples of Bora Indian swidden fallows. Interciencia 96:346-357.

• Dewey, K. 1981. Nutritional consequences of the transformation from subsistence to


commercial agriculture. Hum. Ecol. 9(2): 151-187.

• Edens, T.C. and D.L.Haynes. 1982. Closed System agriculture: resource contraints,
management options and design alternatives. Ann. Rev. Phytopathol. 20:363-395.

• Edens, T.C. and H.E. Koenig. 1981. Agroecosystem management in a resource-limited


world. BioScience 30:697-710.
• Ehrlich, P. 1966. The Population Bom. New York. Ballantine.

• Ellen, R. 1982. Environment, Subsistence and System. New York: Cambridge Univ.
Press.

• Ewell J.J. 1986. Designing agricultural ecosystems for the humid tropics. Ann. Rev.
Ecol. And Systematics 17:245-271.

• Geertz, C. 1962. Agricultural Involution. Berkeley: Univ. Calif. Press.

243
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
244

• Ginzburg, C. 1983. The Night Beetles: Withcraft and Agrarian Cults in the Sixteenth and
Seventeenth Centuries. London: Routledge and Kegan Paul.

• Gliessman, S.R. 1982. The agroecosystem: an integrative focus for the study of
agriculture (un publ.man.).

• Gliessman, S.R., E.R. García and A.M. Amador. 1981. The ecological basis for the
application of traditional agricultural technology in the management of tropical agro-
ecosystems. Agro-ecosystems 7:173-185.

• Glover, N. And J. Beer. 1986. Nutrient cycling in two traditional central American
agroforestry systems. Agrofor. Syst. 4:77-87.

• Gow, D. and J. Van Sant. 1983. Beyond the rethoric of participation. World
Development. 11(5):427-446.

• Graham, D. 1984. Undermining Rural Development with Cheap Credit. Boulder:


Westview Press.

• Hardin, G. 1968. The tragedy of the commons. Science 162:1243-1248.

• Hart, R.D. 1979. Agroecosistemas: conceptos básicos. Costa Rica: CATIE.

• Hecht, S.B. 1985. Environment, development and politics: capital accumulation and the
livestock sector in eastern Amazonia. World Development 13(6):663-684.

• Hecht, S.B. and D. Posey, 1987. Preliminary analysis of Kayapo soil management.
Human Ecol. (in press).

• Hecht, S.B., A. Anderson and P. May. 1987. The subsidy from nature: palms, shifting
cultivation and rural development. Human Organiz. (in press).

• Huffaker, C.B. and P.S.Messenger. 1976. Theory and Practice of Biological control.
New York: Academic Press.

• Huxley, P.A. 1983. Plant Research and Agroforestry. Nairobi: ICRAF.

• Irvine, D. 1987. Successional processes. In: Indigenous Land Management Among


Native Amazonians. New York: New York Botanical Garden.

• Janzen, D.H. 1973. Tropical agroecosystems. Science 182:1212-1219.

• Jordan, C. 1985. Nutrient Cycling in Tropical Forests. New York: John Wiley and Sons.

244
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
245

• Klages, K.H.W. 1928. Crop ecology and ecological crop geography in the agronomic
curriculum. J. An. Soc. Agron. 10:336-353.

• Klages, K.H.W. 1942. Ecological Crop Geography. New York: Mac Millan.

• Kuhn, T. 1979. The Relationship Between History and History of Science. In:
Interpretive Social Science. R. Rabinow and W. Sullivan, eds. Berkeley: Univ. Calif.
Press.

• Kurin, R. 1983. Indigenous agronomics and agricultural development ion the Indus
basin. Human Organiza. 42(4):283-294.

• Levins, R. 1973. Fundamental and applied research in agriculture. Science 181:523-


524.

• Levins, R. and M. Wilson. 1979. Ecological theory and pest management. Ann. Rev.
Entomol. 25:7-19.

• Locuks, O.L. 1977. Emergence of research on agro-ecosystems. Ann. Rev. Eco.Sys.


8:173-192.

• Lowrance, R., B.R. Skinner and G.S. House. 1984. Agricultural Ecosystems. New York:
Wiley Interscience.

• Marte, G.G. 1986. Traditional Agriculture in Southeast Asia: A Human Ecology


Perspective. Boulder Westview Press.

• Merchant, C. 1980. The Death of Nature. Berkeley: Univ. Calif. Press.


• Midgeley, J. 1986. Community Participation, Social Development and the State. New
York: Methuen.
• Milton, J. And T. Farvar. 1968. The Careless Technology. St. Louis: Wash.Univ.Press.
• Moock, J. 1986. Understanding Africa's Rural Households and Farming Systems.
Boulder: Westview Press.

• Nair, P.K.R. 1984. Soil Productivity Aspects of Agroforestry. Nairobi: ICRAF.

• Netting, R.Mc. 1974. Cultural Ecology. California: Cummings.

• Nye, P.H. and D.J. Greenland. 1961. The Soil under Shifting Cultivation. England:
Comm.Agri.Bur.

• Odum, E. 1984. Roperties of agroecosystems. In: Agricultural Ecosystems. Lowrance et


al. Eds. New York: Willew Intersci.

245
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
246

• Palmer, R. and N. Parsons. 1977. The Roots of Rural poverty in Central and Southers
Africa. Berkeley: Univ.Calif.Press.

• Papadakis, J. 1938. Compendium of Crop Ecology. Buenos Aires, Argentina:


Papadakis.

• Perelman, M. 1977. Farming for Profit in a Hungry World. New Jersey: Allanheld,
Osmun and Co.Pub.Inc.

• Pimentel, D. and M. Pimentel, 1979. Food, Energy and Society. London: Edward
Arnold.

• Price. P.W. and G.P. Waldbauer. 1975. Ecological aspects of pest management. I:
Introduction to Insect Pest Management. R.L. Metcalf and W.H. Luckman, eds. New
York: Wiley-Interscience, pp. 37-73.

• Rhoades, R. and R. Booth. 1982. Farmer back to farmer: a model for generating
agricultural technology. Agri. Admin. 11(2):127-137.

• Richards, A. 1939. Land Labor and Diet in Northern Rhodesia. London: Routledge and
Kegan Paul.

• Richards, P. 1984. Indigenous Agricultural Revolution. Boulder: Westview Press.

• Richards, P. 1986. Coping with hunger: Hazard and Experiment in African Rice
Farming. Boulder: Westview Press.

• Risch, S.J. 1981. Insect herbivore abundance in tropical monocultures and polycultures:
an experiment testo of two hypotheses. Ecology 62:1325-1340.

• Risch, S.J., D. Andow and M.A. Altieri. 1983. Agroecosystem diversity and pest control:
data, tentative conclusions and new research directions. Env. Entomol. 12:625-629

• Schumacher, R. 1973. Small is Beatiful. London: Abacus.

• Scott, J. 1978. The Moral Economy of the Peasant. Madison: Univ. Wiscon.

• Scott, J. 1986. Weapons of the Weak: Everyday Forms of Peasant Resistence. New
Haven: Yale Press.

• Sen, A. 1981. Poverty and Famines. New York: Oxford Press.

• Simon, J. And H. Kahn. 1985. The Resourceful Earth. New York: Oxford Press.

246
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
247

• Southwood, T.R.E. and M.J. Way. 1970. Ecological background to pest management.
In: Concepts of Pest Management. R.L. Rabb and F.E. Guthrie, eds. North Carolina:
North Carolina State University, pp. 6-28.

• Spedding, C.R.W. 1975. The Biology of Agricultural Systems. London: Academic Press.
• Tischler, W. 1965. Agrookologie. Jene: Eustan Fisher.

• Uhl, C. 1983. Nutrient uptake and nutrient-retention related characteristics of common


successional species in the ypper Rio Negro region of the Amazon basin. (unpublished
man).

• Uhl, C. and P. Murphy. 1981. A comparison of productivities and energy values between
slash and burn agriculture and secondary succession in the upper Rio Negro region of
the Amazon basin. Agroecosystems 7:63-83.

• Uhl, C. and C. Jordan. 1984. Vegetation and nutrient dynamics during the first five years
of succession following forest cutting and burning in the Rio Negro region of Amazonia.
Ecology 65:1476-1490.

• Uhl, C., R. Buschbacker and A. Serrao. 1987. Abandoned pastures in Amazonia. I.


Patterns of plant succession. J.Ecol. (in press).

• Van Dyne, G.M. 1969. The Ecosystem Concept in Natural Resource Management. New
York: Academic Press.

• Vandermeer, J. 1981. The interference production principle: an ecological theory for


agriculture. BioScience 31:361-364.

• Wasserstrom, R. 1982. Land and Labor in Chiapas. Berkeley: Univ. California Press.

• Watts, M. 1983. Silent Violence. Berkeley: Univ. Calif. Press.

• Wilsie, C.P. 1962. Crop Adaptation and Distribution. San Francisco: W.H. Freeman Co.

• Wolf, E. 1982. Europe and the People Without History. Berkeley; Univ. California Press.

247
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
248

Lección 45

Teorías evolucionistas

El concepto sobre el origen de la vida se ha expresado históricamente desde dos


grandes corrientes: la evolutiva o de transformación de los seres vivos, controvertida por
el fijismo, corriente que sostenía que los seres vivos habían sido creados de forma
definitiva y acabada y no presentaban cambios.

Algunos de los defensores del fijismo fueron: Carl Von Linneo quien planteó que las
especies habían sido creadas de manera separada e independiente; y George Cuvier
quien propuso la Teoría creacionista, que decía, que los seres vivos eran inalterables e
inmutables desde su creación y que debido a constantes catástrofes naturales, como son
los diluvios, terremotos, sequías algunas especies desaparecían y otras supervivían.

Las teorías Evolucionistas explican el origen de las especies.

Teoría Lamarkista

La primera teoría que explica la evolución es la Lamarkista propuesta por Jean Baptiste
de Lamark basada en el desarrollo espontáneo y en la herencia de los caracteres
adquiridos

Lamark sostenía que al producirse cambios en el medio ambiente los seres vivos debían
generar modificaciones (desarrollo, atrofia, o desaparición) de sus órganos para lograr
adaptarse y sobrevivir y estas modificaciones luego eran heredadas por sus
descendientes. Por ejemplo, el alargamiento del cuello de las jirafas era un carácter
adquirido que se explicaba por los persistentes esfuerzos adaptativos de las jirafas para
alcanzar las hojas de los árboles.

Teoría Darwinista

Propuesta por Charles Darwin, explica el origen de las especies por medio de la
selección natural, la variabilidad y la supervivencia del más apto. Darwin Planteó que:

• Las especies cambian continuamente, con el tiempo unas se extinguen y aparecen


otras nuevas.

Darwin observó que las especies experimentan de manera espontánea, cambios


estructurales a lo largo de generaciones suscesivas

• Los cambios se producen gradual y continuamente.

248
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
249

• Los organismos descienden de un antepasado único, es decir, que los organismos


semejantes están emparentados.

• La evolución es resultado de un proceso de selección natural. En una primera fase de


la evolución se produce variabilidad en cada generación y en una fase posterior se
produce selección natural o lucha por la supervivencia, donde los más aptos sobreviven
y los más débiles desaparecen.

• Los más aptos sobrevivirán y transmitirán a su descendencia las características de


fortaleza.

La teoría de Darwin y su plantamiento sobre la supervivencia de los más aptos dió origen
al funcionalismo que afirma que las características de los organismos vivos desarrollan
funciones útiles.Darwin observó que si los cambios producen efectos favorables que
permiten a los individuos reproducirse con mayor éxito, estos cambios eran herdados por
sus descendientes quienes a su vez pueden producir más descendencia.

http://www.natureduca.com/bio_teorias_evol.htm

Darwin afirma en su obra El origen de las especies que el hombre de hecho no produce
variabilidad; lo único que hace es exponer intencionadamente seres orgánicos a nuevas
condiciones de vida, y luego la Naturaleza actúa sobre la organización, y causa la
variabilidad. Pero el hombre puede seleccionar y selecciona las variaciones que la
Naturaleza le da, y de este modo las acumula de cualquier modo que desee. Adapta así
animales y plantas a su propio beneficio o placer. Puede hacerlo metódicamente o puede
hacerlo inconscientemente, preservando los individuos que le son más útiles de
momento, sin pensar en alterar la raza. No hay motivo aparente para que los principios
que han actuado con tanta eficacia en la domesticación no hayan actuado en la
Naturaleza. Nacen más individuos de los que pueden sobrevivir. La ventaja más ligera
en un ser, de cualquier edad o en cualquier estación, sobre los demás seres con los
cuales entra en competición, o una adaptación mejor, por mínima que sea, a las
condiciones físicas que le rodean, cambiará el equilibrio en su favor.

En resumen, Darwin afirmaba que la evolución es un proceso de selección natural en la


cual, en una primera etapa se produce la mutación, recombinación y acontecimientos al
azar (producción de la variabilidad genética), para en una segunda etapa quedar
regulada esa variabilidad mediante la selección natural, y en la cual la selección artificial
generada por el hombre no produce variabilidad.

Teoría Neodarwinista

La Teoría Neodarwinista o Teoría Sintética de la evolución tiene su origen en la


interpretación de la teoría Darwinista fundamentada en la genética.

249
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
250

Esta teoría Esta teoría se ha construido paulatinamente por científicos tales como G. G.
Simpson, Dobzhanski, Ernst Mayr, Thomas Henry Huxley, Dobzhansky, Alvaro Abeliuk
Fischer, Sewall Wright, y otros.

Según esta teoría los fenómenos evolutivos se explican básicamente por medio de las
mutaciones y la producción de nuevas especies por reproducción sexual, mecanismos
que darían origen a las variaciones, preservadas luego por acción de la selección natural
de los portadores de dotación genética más favorable para hacer frente a las presiones
ecológicas; estos portadores tienen una probabilidad de supervivencia y de procreación
más alta que el resto de la población.

Evolución del hombre

Chiquitos pero muy hábiles

Los australopitécidos de hace tres y cuatro millones de años eran bastante pequeños
cuando llegaban a adultos. Medían no mas de 1.20 m y no pesaban más de 40 kilos. Su
cerebro era también pequeño, alrededor de 400 cm3 (la manera como se mide la
capacidad del cráneo es calculando el volumen; esto puede hacerse bastante fácilmente
con cráneos fósiles). Es decir, un australopitécido tenía alrededor de 10 cm3 de cerebro
por kilogramo de peso.

Hace alrededor de 25 años se encontró en la barranca de Olduvai, en África Oriental un


cráneo fosilizado de hace aproximadamente 1 750 000 años. Perteneció a un homínido
que caminaba erguido y que tenía un cerebro de 800 cm3 para sus ¡40 kilos de peso!
Esto significa que comparado con los australopitécidos este homínido tenía dos veces
más de capacidad craneana (el hombre actual tiene un cerebro bastante mayor, de
aproximadamente 1 350 cm3, que para los 60-70 kilos de peso promedio es también el
doble que el de los australopitécidos).

Posteriormente, en 1972 se descubrieron otros restos de estos homínidos en el lago


Turkana, África, y se comprobó en forma definitiva que el tamaño del cerebro constituía
la mayor diferencia con los australopitécidos. Además de restos de huesos, en esos
lugares también se han encontrado pedazos de las herramientas que construyeron estos
homínidos, que, aunque de tamaño pequeño, demuestran que tenían un cerebro
relativamente grande. Es por esto que se les ha llamado Homo habilis, siendo, además,
de los primeros homínidos que aparecieron en el registro fósil a los que ya se les puede
llamar hombres. Estos aparecieron hace dos millones de años.

Cuando los arqueólogos buscan restos del pasado encuentran, además de huesos,
muchas otras cosas que les hablan de la organización social y los hábitos de los
homínidos que vivieron entonces. En el lago Turkana, en África, se ha descubierto uno
de los sitios más interesantes en este aspecto. Del cuidadoso análisis de la basura
dejada en un campamento usado por Homo habilis se ha podido entender el tipo de

250
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
251

alimentación y la utilidad que las diferentes herramientas tenían para aquéllos. A partir
de esta información se ha podido saber que sus actividades incluían la recolección de
frutos y la caza. El hombre entonces cazaba en grupos y muy probablemente distribuía
la comida que, unos cazando y otros recolectando, diferentes miembros de la comunidad
obtenían. Así pues, la vida en comunidades donde se repartían las actividades ya existía
hace dos millones de años.

El homo erectus

Entre hace dos millones de años y un millón de años nuestro registro de homínidos
vuelve a ser pobre. De no encontrar australopitécidos se ha concluido que se
extinguieron en ese periodo de tiempo. Los únicos homínidos que quedaron desde
entonces pertenecen al género Homo. A su vez, el Homo habilis también desaparece del
registro fósil, pero de hace un millón de años se han descubierto una gran cantidad de
fósiles que pertenecían a homínidos que usaban herramientas (por lo que se les
considera del género Homo), además de que ya conocían el fuego, puesto que en las
cuevas que se han excavado hay restos calcinados y quemados de huesos, piedras y
pedazos de madera.

El descubrimiento de los primeros restos de estos homínidos, que son llamados Homo
erectus en la actualidad, lo llevó a cabo en Java un investigador holandés llamado E.
Dubois en 1891. En ese entonces se le llamó Pitecanthropus (hombre-mono) erectus y
muy pocas personas creyeron en la validez de ese descubrimiento. Se argumentaba que
seguramente los restos pertenecieron a un hombre enfermo y con deformaciones.

En general los restos de Homo erectus se han encontrado dentro de sedimentos de


entre 800 000 y 300 000 años. Los lugares donde se les ha hallado incluyen sobre todo
Asia (China), África (Argelia, Tanzania y Sudáfrica) y Europa (Checoslovaquia y
Hungría). De éstos sólo en Hungría y en China se han encontrado restos que
comprueban que ya usaba el fuego.

El tamaño del cráneo de Homo erectus, aunque grande (aproximadamente 1 000 cm3)
no es tan grande como el del hombre actual. El uso del fuego le permitió sobrevivir en
zonas en las que antes no se podía vivir por las bajas temperaturas. Esto amplió el área
de distribución con respecto a la que tenían los australopitécidos o a los Homo habilis.

La conciencia de uno mismo

El registro fósil vuelve de nuevo a ser muy escaso entre hace 250 y 100 000 años. En
ese periodo el Homo erectus desaparece del registro fósil, pero aparece otro Homo en
varias zonas de Europa, el cercano Oriente y la Unión Soviética. En Europa se incluyen
el valle de Neander, Alemania y varios sitios en Francia. En muchas de ellas se han
encontrado restos que evidencian una cultura en donde ¡ya se enterraba a los muertos!
Estos tienen una antigüedad de entre 100 y 40 000 años. Eran hombres de una estatura

251
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
252

promedio de 1.63 m y tenían una capacidad craneana aproximadamente 15% mayor que
la del hombre moderno. Este hombre ha sido llamado Homo neandertalensis o también
Homo sapiens neandertalensis. En el primer caso se le considera una especie diferente
a la del hombre (Homo sapiens) mientras que en el segundo se le considera sólo una
subespecie de éste. Hasta donde sabemos, lo único que lo distingue de aquél es su
aparente incapacidad de utilizar símbolos para comunicarse.

Un aspecto del ser humano que está ausente en los animales es la conciencia que
tenemos de nuestra existencia como individuos. Esto mismo supone que tenemos
conciencia de nuestra muerte y de lo que ella implica. Es quizá esto lo que ha generado
en la humanidad la presencia de rituales entre los que se incluye el de enterrar a
nuestros muertos.

¿El hombre moderno heredero de quién?

El hombre de Neandertal seguramente ya tenía una conciencia similar, ya que se han


hallado tumbas que incluyen, por ejemplo, hachas, huesos de otros animales, semillas y
flores con las que se hacía de los entierros rituales muy particulares.

Por ejemplo, de la caverna de Shanidar, en Iraq, de donde se han desenterrado varios


restos neandertalensis, se ha podido concluir que además de enterrar a sus muertos
ponían flores dentro de las tumbas. Esto se ha descifrado porque se han encontrado
granos de polen de varias especies de plantas en grandes cantidades dentro de ellas.
Los hombres, entonces, han honrado a sus muertos con flores desde hace
aproximadamente 100 000 años.

El que el hombre haga rituales mortuorios no solamente se expresa enterrando a sus


muertos. Los cadáveres pueden ser colocados en lechos construidos de ramas y hojas
en el exterior o incluso cremados. Esto puede haber sucedido pero jamás lo sabremos,
puesto que de estas dos costumbres, por razones obvias, no quedan restos en la
actualidad.

¿HIJOS DE NEANDERTAL?

Hay tres teorías acerca de la manera como apareció el hombre moderno y su relación
con el hombre de Neandertal. La primera propone que el hombre de Neandertal se
extinguió y de otra línea de descendencia dentro del género Homo se originó el Homo
sapiens. La segunda sugiere que el hombre de Cro-Magnon (primer fósil con las
características del hombre moderno) reemplazó al hombre de Neandertal porque estaba
más adaptado al medio ambiente. La tercera, que se considera en la actualidad la más
probable, supone que la línea de descendencia del hombre de Neandertal, que era muy
diverso (Figura 20), evolucionó transformándolo en lo que ahora es el hombre moderno

252
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
253

EVALUACIÓN

Autoevaluación 1

Preguntas Abiertas

1. Enumere los postulados de la teoría celular


2. ¿Las células pueden moverse por sí mismas? ¿Qué mecanismo utilizan?

Pregunta de selección múltiple con única respuesta

3. La ósmosis es un mecanismo de transporte de sustancias a la célula y consiste


en el:

a. Movimiento de sustancias a través de la membrana, desde la solución de mayor


concentración hacia la solución de menor concentración.

b. Movimiento de solvente (agua) desde la parte más concentrada hacia la menos


concentrada.

c. Movimiento de iones y moléculas en contra del gradiente de concentración y con


consumo de energía.

d. Transporte de líquidos al interior de la célula mediante movimientos citoplasmáticos


que engloban estas vesículas de líquido.

e. Transporte de partículas sólidas al interior de la célula, a través de movimientos del


borde del citoplasma y que engloban las partículas.

4. La mitósis como un proceso asexual para la reproducción celular ocurre


continuamente. Los principales pasos son interfase, profase, metafase, anafase y
telofase. En la etapa de interfase de la división mitótica sucede lo siguiente

a. Aparición de cromosomas largos y filamentosos.

b. Formación de cromátides

c. Duplicación del ácido desoxirribonucleico (ADN)

d. Alineamiento de cromosomas en el plano ecuatorial

e. Separación de los cromátides de cada cromosoma.

253
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
254

Pregunta de selección múltiple con múltiple respuesta

En este tipo de preguntas usted encuentra un enunciado para el cual debe seleccionar
dos (2) de las opciones propuestas. Seleccione las respuestas correctas de acuerdo con
el siguiente cuadro

Si 1 y 2 son correctas, marque a


Si 2 y 3 son correctas, marque b
Si 3 y 4 son correctas, marque c
Si 2 y 4 son correctas, marque d
Si 1 y 3 son correctas, marque e

5. Las células de acuerdo con su grado de complejidad en su organización y por


su ubicación dentro de la escala biológica se pueden dividir en: eucarióticas y
procarióticas, son características de las células ecuarióticas

1. Presencia de membrana nuclear que delimita el núcleo del citoplasma.

2. Presencia de ADN en una región nuclear diferenciada pero no delimitada por una
membrana.

3. Presencia de organelos con morfología y función especializada para cada uno.

4. Ausencia de membranas que separen los organelos entre sí.

Completación

6. Las células poseen una estructura altamente organizada, tienen capacidad de


autorregulación, de responder ante diferentes estímulos, de respiración, de
movimiento, de digestión, de reproducción, de comunicación. Diga cuál es la
principal función de cada uno de estos organelos:

Estructura Función
Ribosoma

Núcleo

Mitocondria
Lisosoma

254
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
255

Retículo endoplasmático

Información de retorno autoevaluación1

Autoevaluación 2

Preguntas Abiertas

1. Defina Homeostasis
2. ¿Cuál es la función de los ganglios linfáticos?

Pregunta de selección múltiple con única respuesta

3. El conjunto de reacciones químicas que ocurren al interior de las células y que


le proporcionan a los seres vivos la materia y energía indispensable para
desarrollar sus actividades vitales. Se denomina:

a. Osmosis
b. Respiración
c. Metabolismo
d. Anabolismo
e. Catabolismo.

4. El tejido que permite a la planta realizar la fotosíntesis se denomina:

a. Xilema.
b. Parénquima
c. Meristemático
d. Floema
e. Colénquima

Pregunta de selección múltiple con múltiple respuesta

En este tipo de preguntas usted encuentra un enunciado para el cual debe seleccionar
dos (2) de las opciones propuestas. Seleccione las respuestas correctas de acuerdo con
el siguiente cuadro:

Si 1 y 2 son correctas, marque a


Si 2 y 3 son correctas, marque b
Si 3 y 4 son correctas, marque c

255
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
256

Si 2 y 4 son correctas, marque d


Si 1 y 3 son correctas, marque e

5. Las principales funciones del tejido nervioso son:

1. Servir de sostén al organismo y permitirle el movimiento


2. Detectar, transmitir, analizar y dar respuesta a las variaciones internas y externas.
3. Coordinar el funcionamiento de las funciones del organismo.
4. Transportar y excretar metabolitos

6. Las sales biliares deben su coloración a pigmentos como la bilirrubina. Entre las
opciones dadas seleccione dónde son producidas y que función cumplen:

1. Se producen en el hígado
2. Emulsifican las grasas
3. Desdoblan las proteínas
4. Se producen en la vesícula biliar.

Completación

7. Los componentes del sistema circulatorio enunciados tiene como función:

Estructura Función
Capilares
Corazón
Leucocitos o glóbulos blancos
Glóbulos rojos o eritrocitos
Plaquetas

Información de retorno autoevaluación2

Autoevaluación 3

Preguntas abiertas

Desarrolle cuadros de Punnet para resolver los siguientes problemas y explique los
resultados de genotipo y fenotipo heredados en la F1.

1. En los gatos el color negro del pelo es dominante frente al color blanco.
Si se cruza una gata homocigota recesiva con un gato heterocigoto y tiene una
camada de cuatro gatitos:

256
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
257

a. ¿Cuál es el genotipo de los padres?


b. ¿Cuál es el fenotipo de los padres?
c. ¿Cuál es el genotipo de la descendencia en la F1?
d. ¿Cuál es el fenotipo de los gatitos y en qué porcentajes?

2. ¿Cuáles son las funciones del ADN?

Pregunta de selección múltiple con única respuesta

3. Un individuo es homocigótico para un carácter cuando

a) Tiene dos alelos iguales


b) Tiene dos alelos diferentes
c) Tiene un alelo dominante y uno recesivo
d) No tiene alelos para ese carácter

información retorno autoevaluación 3

Autoevaluación 4

Preguntas Abiertas

1. Mencione cinco posibles usos de las bacterias.


2. ¿A qué nos referimos cuando hablamos de microorganismos?

Pregunta de selección múltiple con única respuesta

3. Los diferentes grupos de protozoos se clasifican con base en su

a. Habitat.

b. Movilidad.

c. Reproducción.

d. Tamaño.

4. Las bacterias son microorganismos que habitan en el aire, suelo, agua y cuerpo
de otros organismos. Las bacterias se caracterizan por

a. Ser procarióticas, unicelulares, carentes de pared celular

b. Ser eucarióticas, pluricelulares, carentes de pared celular

257
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
258

c. Ser procarióticas, unicelulares, con pared celular

d. Ser eucarióticas, unicelulares, carentes de pared celular

Pregunta de selección múltiple con múltiple respuesta

En este tipo de preguntas usted encuentra un enunciado para el cual debe seleccionar
dos (2) de las opciones propuestas. Seleccione las respuestas correctas de acuerdo con
el siguiente cuadro

Si 1 y 2 son correctas, marque a


Si 2 y 3 son correctas, marque b
Si 3 y 4 son correctas, marque c
Si 2 y 4 son correctas, marque d
Si 1 y 3 son correctas, marque e

5. Los virus como agentes infecciosos se caracterizan por:

1. Poseer un solo tipo de ácido nucleico


2. Tener el material y mecanismo para su reproducción.
3. Se reproducen en células vivas
1. Tener ARN y ADN conjuntamente.

información de retorno autoevaluación 4

Autoevaluación 5

Señala si son verdaderas o falsas las siguientes afirmaciones

1. Los productores primarios en el ecosistema son los organismos autotrófos

2. El biotopo es el conjunto de los elementos no vivos que forman parte del ecosistema

3. La mayor parte de la biomasa de la biosfera se concentra en los productores


primarios.

4. En el ecosistema los herbívoros son los productores primarios.

5. El factor que suele limitar la productividad del ecosistema es, casi siempre, la energía
luminosa disponible.

Pregunta de selección múltiple con única respuesta

258
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
259

6. Al estudiar los ecosistemas interesa más el conocimiento de las relaciones entre


los elementos, que el cómo son estos elementos. La característica más importante
de los ecosistemas es su

a. Estabilidad dinámica
b. Composición química
c. Relación con los individuos
d. Fuente de energía
e. Equilibrio estático

7. En la naturaleza el problema de desechos se soluciona por la acción de:

a. Organismos autótrofos
b. Organismos heterótrofos
c. Condiciones climáticas
d. Descomponedores

8. Entre las especies se pueden establecer relaciones de competencia, aunque en


muchas ocasiones, para lograr determinados fines se recurre a compromisos con
otras especies que se manifiestan en asociaciones del tipo de una simbiosis.

La relación que se establece entre ciertos pájaros que se posan sobre el lomo de
vacas y picotean garrapatas, beneficiándose así las aves porque se alimentan;
mientras las vacas se liberan de los molestos parásitos, se denomina:

a. Parasitismo
b. Comensalismo
c. Amensalismo
d. Mutualismo
e. Depredación

9. En los ecosistemas se presentan flujos de energía, ciclos de la materia y


relaciones alimentarias. El flujo de energía en el ecosistema es:

a. Cíclico y genera organización del sistema


b. Lineal y genera organización del sistema
c. Cíclico y permite el reciclaje continuo
d. Lineal y permite el reciclaje continuo

Preguntas abiertas

259
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
260

10. ¿Cómo se relacionan los factores bióticos y abióticos?

11. ¿Por qué los seres vivos prefieren un habitat y evitan otros?

Información de retorno autoevaluación 5

Autoevaluación 6

Preguntas abiertas

1. ¿Por qué es importante la clasificación de los organismos?

2. ¿Cuáles son las 7 categorías principales en el sistema de clasificación?

3. De las siguientes especies identifica las del mismo género: Avena sativa, Canis lupus,
Zea maiz, Avena cayuse, Felis domestica, Viola papilonacea, Viola rostrata.

4. Diga en qué especies hay mayor afinidad : entre las especies que pertenecen al
mismo filo y distinta clase o entre aquellas que pertenecen al mismo reino y distinto filo

Pregunta de selección múltiple con única respuesta

5. Según el sistema de clasificación de Whittaker a qué reino pertenecen los


organismos con las siguientes características: unicelulares, eucarióticos, su
nutrición puede ser en algunos absortiva, ingestiva, en otros fotosintética, pueden
ser inmóviles o desplazarse por medio de flagelos, su reproducción se puede
realizar por procesos asexuales o por procesos sexuales

a) Protista
b) Hongos
c) Plantas
d) Animales
e) Mónera

6. Existen muchos métodos de clasificación, según la manera en que evalúan


ciertos caracteres. Entre ellos: el tradicional , la fenética, la cladística. En el
método cladístico los organismos se agrupan en especies teniendo en cuenta:

a) La similitud de carácteres morfológicos y el parentesco filogenético


b) Exclusivamente en función de su articulación a grupos monofiléticos.
c) El número de carácteres que tienen en común y su cuantificación.
d) Los caracteres morfológicos y no morfológicos y la variabilidad.

260
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
261

Información de retorno autoevaluación 6

Información de Retorno Autoevaluación 1

Preguntas Abiertas

1. La célula es la unidad básica estructural de todos los seres vivos, todos los
organismos están formados por células.

La célula es la unidad funcional de todos los organismos. Todo el funcionamiento del


organismo depende de las funciones que ocurren al interior de la célula, respiración,
reproducción, digestión, crecimiento entre otras.

Todas las células se originan por la división de células preexistentes (en otras palabras,
a través de la reproducción). Cada célula contiene material genético que se transmite
durante este proceso.

2. La célula si puede desplazarse por sí misma mediante: seudópodos, cilios o flagelos.

Pregunta de selección múltiple con única respuesta

3) b.
4) c.

Pregunta de selección múltiple con múltiple respuesta

5) 1 y 3 = e

Completación

6.

Estructura Función
Ribosoma Síntesis de proteínas
Crecimiento y reproducción celular,
almacenamiento y organización de
Núcleo
los genes, transmisión de la
información genética.
Producción de energía -ATP- por
Mitocondria oxidación de los alimentos o
respiración celular
Lisosoma Digestión celular (hidrólisis de

261
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
262

macromoléculas), destrucción de
microorganismos nocivos para la
célula, digestión de organelos
defectuosos
Retículo Transportar materiales dentro de la
endoplasmático célula

Información de Retorno Autoevaluación 2

Preguntas Abiertas

1. La Homeostasis es la capacidad de todos los seres vivos de mantener constante las


condiciones físicas y químicas de su medio interno.

2. Filtrar la linfa, destruir y eliminar de ella las sustancias tóxicas y los microorganismos
infecciosos antes de su circulación por el torrente sanguíneo.

Pregunta de selección múltiple con única respuesta

3.) c

4.) b

Pregunta de selección múltiple con múltiple respuesta

5.) 2 y 3 = b
6.) 1 y 2= a

Completación

7.

Estructura Función
Capilares Intercambio de gases y
nutrientes
Corazón Bombear toda la sangre hacia el
torrente sanguíneo

262
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
263

Leucocitos o Defensa
glóbulos blancos
Glóbulos rojos o Transporte de oxígeno
eritrocitos
Plaquetas Participar en la coagulación de
la sangre

Información de retorno 3

Pregunta abierta

a. El genotipo de la gata es nn por ser homocigota recesiva


El genotipo del gato es Nn por ser heterocigoto

b. El fenotipo de la madre será blanco (para que este se manifieste tiene que ser
homocigoto), el fenotipo del padre es negro

c. La camada de cuatro gatitos será el resultado Nn x nn

N n
n Nn nn
n Nn nn

Entonces el genotipo de la descendencia es 50% heterocigoto Nn y 50% homocigoto nn

d. El fenotipo de la camada es de 50% negros y 50% blancos.

2. Funciones del ADN

• Almacenamiento codificado de la información genética que determina las


características futuras de la célula y de los organismos que se desarrollen a partir
de dicha información.
• Replicación de si mismo o sea elaboración de una copia idéntica del ADN.
• Transferencia mediante el ARN (ácido Ribonucleico) de la información genética a
las moléculas que realizan la síntesis de proteínas por intermedio de los
aminoácidos que son las unidades que forman las proteínas.

Selección múltiple con única respuesta

a. Cuando tiene dos alelos iguales.

263
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
264

Información de retorno 4

Preguntas abiertas

1. Las bacterias son útiles:

• Para fijar nitrógeno atmosférico que es tomado por las plantas y luego trasferido a
los animales.
• En la descomposición de materia orgánica muerta ayudando de esta manera a la
fertilización del suelo
• En la producción de algunos antibióticos
• En la producción de determinadas enzimas
• En la elaboración de productos lácteos como: queso, yogur , mantequilla
• En la producción de vinagre
• En la depuración de aguas residuales
• En el curtido de cueros
• La Echerichia coli ha sido manipulada genéticamente para producir insulina

2. Los microorganismos son organismos unicelulares generalmente microscópicos que


se dividen en: virus; bacterias; protozoos, algunas algas y hongos.

Pregunta de selección múltiple con única respuesta

3.) b.

4.) c.

Pregunta de selección múltiple con múltiple respuesta

5.) 1 y 3 = e

Información de retorno 5

Preguntas falso o verdadero

1) V
2) F
3) V
4) F
5) V

264
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
265

Pregunta de selección múltiple con única respuesta

6.) a.
7.) d.
8.) d
9.) b.

Preguntas Abiertas

10. Los factores bióticos y abióticos se interrelacionan para constituir un ecosistema,


donde cada uno depende del otro, modificándose y transformándose mutuamente a
través de la actividad de los seres vivos y las condiciones ambientales para producir un
sistema estable en el cual el intercambio de sustancias entre los organismos vivos y los
elementos inertes es de tipo circular.

11. Porque cada especie vegetal o animal o microorganismo tienen un requerimiento


óptimo para los diversos factores abióticos en el que pueden desarrollar mejor sus
funciones, igualmente con los demás seres vivientes tiene interrelaciones que le
permiten asegurar su alimentación, territorio, protección, reproducción

La distribución geográfica de una especie puede estar determinada por el grado en el


cual sus requerimientos son cumplidos por los factores abióticos presentes.

Cada especie tiene: un óptimo, un rango de tolerancia, un límite de tolerancia con


respecto a cada factor abiótico.

Información de retorno 6

Preguntas abiertas

1. Para poder entender su origen, su evolución y las relaciones de parentesco entre sí.

1. Reino, Filo, Clase, Orden, Familia , Género, Especie.

3. Avena sativa, y Avena cayuse,

Viola papilonacea, y Viola rostrata

4. Hay mayor afinidad entre las especies que pertenecen al mismo filo y distinta clase.

Pregunta de selección múltiple con única respuesta

265
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
266

5.) a
6.) b

GLOSARIO

Glosario Disciplinar

Biotipo: Poblaciones con el mismo genotipo.

Estructura: En las ciencias biológicas, la estructura se refiere a la organización de los


seres vivos como un conjunto de células, organelos, órganos, y sistemas histológico-
orgánicos, como soporte físico para la manifestación de las actividades de la vida según
la expresión genética heredada.

Función: Capacidad de actuar propia de los seres vivos y de sus órganos.

Diversidad: abundancia relativa de las especies presentes en regiones biogeográficas y


en nichos ecológicos específicos.

Genética: Parte de la biología que trata de la herencia y de lo relacionado con ella.


Estudio científico de cómo se transmiten los caracteres físicos, bioquímicos y de
comportamiento de padres a hijos.

Evolución: Desarrollo de los organismos, por medio del cual pasan gradualmente de un
estado a otro, descendencia con modificaciones, proceso por el que todos los seres
vivos de la Tierra han divergido, por descendencia directa, a partir de un origen único
que existió hace más de 3.000 millones de años.

La palabra evolución tiene cuatro significados que suelen confundirse y deberían


mantenerse separados y distintos: 1) el proceso general del cambio en poblaciones y
especies, considerado un hecho científico establecido; 2) el «progreso» inevitable desde
formas de vida inferiores a otras superiores, un concepto que ha quedado desacreditado;
3) la historia concreta del «arbusto ramificado» de la vida y el origen de grupos diversos
o filogenias, interpretado a partir del registro fósil y los estudios bioquímicos, y 4) el
mecanismo, o «motor», de la evolución, para el que Darwin y Wallace propusieron la
«selección natural», pero que en la actualidad está siendo estudiado y modificado por la
investigación de Richard Milner.

Interacciones ecológicas de organismos vivos: se refieren a las influencias mutuas,


benéficas o perjudiciales que pueden presentarse entre organismos que comparten un

266
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD
ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA
CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA
267

mismo nicho ecológico y su impacto sobre el entorno ambiental.

Genoma: conjunto de todos los genes de un organismo, de todo el patrimonio genético


almacenado en el conjunto de su ADN o de sus cromosomas.

Gestión sostenible: Se entiende por gestión sostenible la que permite el crecimiento


económico, la elevación de la calidad de vida y el bienestar social sin agotar la base de
los recursos naturales renovables en que se sustenta, ni deteriorar el medio ambiente o
el derecho de las generaciones futuras a utilizarlo para la satisfacción de sus propias
necesidades.

Glosario Pedagógico

Competencia cognitiva o básica: Hace referencia a la capacidad de identificar conceptos,


analizarlos, reconceptualizarlos e incorporarlos a la estructura cognitiva del estudiante.

Competencia metacognitiva o compleja: Se relaciona con la capacidad de reflexionar


sobre el proceso de construcción conceptual. En otras palabras se refiere a conocer
cómo se logra aprender y cómo se pueden cualificar las estrategias y métodos para
potenciar el conocimiento.

Competencia transversal o paracognitiva: Se refiere a la capacidad de integrar los


conocimientos y las experiencias en enfoques alternativos de saberes funcionales para
nuevos contextos.

Operaciones metacognitivas: Son operaciones mentales de las que el estudiante es


consciente, se relacionan con la selección de procedimientos para aprender, permiten la
autoevaluación, la autorregulación y la reflexión.

267