Detection of genetically modified organisms

Submitted to Dr.P.K.Dhaka

By kamini singh Ph.D Ag.Biotechnology Id.No. 1962/11

INTRODUCTION The need to monitor and verify the presence and the amount of GMOs in agricultural crops and in products derived thereof has generated a demand for analytical methods capable of detecting,Identifying and quantifying either the DNA introduced or the protein(s) expressed in transgenic plants, because these components are considered as the fundamental constituents.Several laboratories have developed therefore, methods either based on DNA detection using the polymerase chain reaction (PCR) technique, or on protein detection using enzyme linked Immunosorbent assays (ELISA). Genetically modified organisms (GMOs) entered the European food market in 1996. The first product to appear on UK supermarket shelves was a genetically modified tomato puree. This product was clearly labelled and therefore anticipated the European Commissions Novel Food Regulation (EC) No 258/97 (European Commission, 1997) established in 1997, under which products containing GMOs must be labelled if they differ substantially from their conventional counterpart, either by composition, nutritional value or nutritional effects for the intended use of the food. Since two other products - Round-up Ready soybeans and BT-176 maize - were already authorised for marketing within Europe before the Novel Foods Regulation came into force, a specific labeling regulation was established in 1998 (EC) No 1139/98 (European Commission, 1998). This regulation requires labelling if transgenic DNA or newly expressed proteins can be found. For this purpose, qualitative methods for detection of GMOs are required. It is likewise important to investigate whether the GMO found is authorised or not; consequently, specific methods for identification of GMOs are needed. The detection of genetically modified organisms in food or feed is possible by biochemical means. It can either be qualitative, showing which genetically modified organism (GMO) is present, or quantitative, measuring in which amount a certain GMO is present. Being able to detect a GMO is an important part of food safety, as without detection methods the traceability of GMOs would rely solely on documentation.

Technique for detection of genetically modified organisms

1) Polymerase chain reaction (PCR) The polymerase chain reaction (PCR) is a biochemistry and molecular biology technique for isolating and exponentially amplifying a fragment of DNA, via enzymatic replication, without using a living organism. It enables the detection of specific strands of DNA by making millions of copies of a target genetic sequence. The target sequence is essentially photocopied at an exponential rate, and simple visualization techniques can make the millions of copies easy to see. The method works by pairing the targeted genetic sequence with custom designed complementary bits of DNA called primers. In the presence of the target sequence, the primers match with it and trigger a chain reaction. DNA replication enzymes use the primers as docking points and start doubling the target sequences. The process is repeated over and over again by sequential heating and cooling until doubling and redoubling has multiplied the target sequence several million-fold. The millions of identical fragments are then purified in a slab of gel, dyed, and can be seen with UV light.It is not prone to contamination.

a. Quantitative detection Quantitative PCR (Q-PCR) is used to measure the quantity of a PCR product (preferably real-time, QRT-PCR). It is the method of choice to quantitatively measure amounts of transgene DNA in a food or feed sample. Q-PCR is commonly used to determine whether a DNA sequence is present in a sample and the number of its copies in the sample. The method with currently the highest level of accuracy is quantitative real-time PCR. QRT-PCR methods use fluorescent dyes, such as Sybr Green, or fluorophore-containing DNA probes, such as TaqMan, to measure the amount of amplified product in real time. If the targeted genetic sequence is unique to a certain GMO, a positive PCR test proves that the GMO is present in the sample.

b. Qualitative detection Whether or not a GMO is present in a sample can be tested by Q-PCR, but also by multiplex PCR. Multiplex PCR uses multiple, unique primer sets within a single PCR reaction to produce amplicons of varying sizes specific to different DNA sequences, i.e. different transgenes. By targeting multiple genes at once, additional information may be gained from a single test run that otherwise would require several times the reagents and more time to perform. Annealing temperatures for each of the primer sets must be optimized to work correctly within a single reaction, and amplicon sizes, i.e., their base pair length, should be different enough to form distinct bands when visualized by gel electrophoresis. 2. Event-specific vs. construct-specific detection When producers, importers or authorities test a sample for the unintended presence of GMOs, they usually do not know, which GMO to expect. While EU authorities prefer an event-specific approach to this problem, US authorities rely on construct-specific test schemes.
a. Event-specific detection

An event-specific detection searches for the presence of a DNA sequence unique to a certain GMO, usually the junction between the transgene and the organism's original DNA. This approach is ideal to precisely identify a GMO, yet highly similar GMOs will pass completely unnoticed. Event-specific detection is PCR-based.
b. Construct-specific detection

The construct-specific detection methods can either be DNA or protein based. DNA based detection looks for a part of the foreign DNA inserted in a GMO. For technical reasons, certain DNA sequences are shared by several GMOs. Protein-based methods detect the product of the transgene, for example the Bt toxin. Since different GMOs may produce the same protein, construct-specific detection can test a sample for several GMOs in one step, but is unable to tell precisely, which of the similar GMOs are present. Especially in the USA, protein-based detection is used for the constructspecific approach.

3. Shortcomings of current detection methods Currently, it is highly unlikely that the presence of unexpected or even unknown GMOs will be detected, since either the DNA sequence of the transgene or its product, the protein, must be known for detection. In addition, even testing for known GMOs is timeconsuming and costly, as current reliable detection methods can test for only one GMO at a time. Therefore, research programmes such as Co-Extra are developing improved and alternative testing methods, for example DNA microarrays. 4. Alternative detection methods a. Improving PCR based detection Improving PCR based detection of GMOs is a further goal of the European research programme Co-Extra. Research is now underway to develop multiplex PCR methods that can simultaneously detect many different transgenic lines. Another major challenge is the increasing prevalence of transgenic crops with stacked traits. This refers to transgenic cultivars derived from crosses between transgenic parent lines, combining the transgenic traits of both parents. One GM maize variety now awaiting a decision by the European Commission, MON863 x MON810 x NK603, has three stacked traits. It is resistant to an herbicide and to two different kinds of insect pests. Some combined testing methods could give results that would triple the actual GM content of a sample containing this GMO. b. Detecting unknown GMOs Almost all transgenic plants contain a few common building blocks that make unknown GMOs easier to find. Even though detecting a novel gene in a GMO can be like finding a needle in a haystack, the fact that the needles are usually similar makes it much easier. To trigger gene expression, scientists couple the gene they want to add with what is known as a transcription promoter. The high-performing 35S promoter is a common feature to many GMOs. In addition, the stop signal for gene transcription in most GMOs is often the same: the NOS terminator. Researchers now compile a set of genetic sequences characteristic of GMOs. After genetic elements characteristic of

GMOs are selected, methods and tools are developed for detecting them in test samples. Approaches being considered include microarrays and anchor PCR profiling.
c. Near infrared fluorescence (NIR)

Near infrared fluorescence (NIR) detection is a method that can reveal what kinds of chemicals are present in a sample based on their physical properties. By hitting a sample with near infrared light, chemical bonds in the sample vibrate and re-release the light energy at a wavelength characteristic for a specific molecule or chemical bond. It is not yet known if the differences between GMOs and conventional plants are large enough to detect with NIR imaging. Although the technique would require advanced machinery and data processing tools, a non-chemical approach could have some advantages such as lower costs and enhanced speed and mobility.

5.) A microarray-based detection system for genetically Modified (GM) food ingredients Microarrays, also known as DNA chips, allow the analysis of multiple sequence targets in one single assay. Being a highly adaptable tool, it can evolve together with the increasing number of GMOs emerging in the food and feed markets. The main advantages of DNA microarray technology are miniaturization, high sensitivity and screening throughput.DNA microarray approaches have been developed to be used in combination with multiplex PCRs: a multiplex DNA array-based PCR allowing quantification of transgenic maize in food and feed (Rudi et al.,2003); a ligation detection reaction coupled with an universal array technology allows the detection of the Bt176 transgenic maize (Bordoni et al.,2004) or five transgenic events (Bordoni et al.,2005); and recently, a peptide nucleic acid array approach was developed for the detection of five transgenic events and two plant species (Germini et al., 2005). These methods used fluorescent probes, which require costly material and are photosensitive, thus limiting the common use of microarrays for GM detection.

A control test was also developed to allow the detection of possible false positive results such as those arising from the presence of P-35S elements from a possible plant infection with CaMV. A CaMV-specific assay already described was used as a contamination control (Ferna ndez et al., 2005). Selectivity of the assay was confirmed by the analysis of 100 ng of genomic DNA extracted from rapeseed leaves infected by CaMV. A 20 lL of PCR were loaded on the biochips .Two capture probes (CaMV(a) and CaMV(b)) were initially tested.CaMV(b) capture probe giving the most intensive signal was kept on the final design of the microarray. CaMV using the GMOchip. The DNA of CaMV infected-rapeseed leaves was extracted (0.1 lg) and amplified by PCR and 20 lL of the amplicon solution were hybridized to the GMOchip. Two capture probes (CaMV(a) and CaMV(b)) were initially tested. CaMV(b) capture probe giving the most intensive signal was kept on the final design of the microarray

6.) Electrochemiluminescence method Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. Electrochemiluminescence (ECL), where light-emitting species are produced by reactions between electrogenerated intermediates, has become an important and powerful analytical tool in recent years. An ECL reaction using tri-propylamine (TPA) and tris (2,2-bipyridyl) ruthenium (II) (TBR) has been demonstrated to be a highly sensitive detection method for quantifying amplified DNA .

TPA and TBR are oxidized at approximately the same voltage on the anode surface. After deprotonation, TPA chemically reacts with TBR and results in an electron transfer. The resulted TBR molecule relaxes to its ground state by emitting a photon. TPA decomposes to dipropyl amine and is therefore consumed in this reaction. TBR, on the other hand, is recycled. Since both reactants are produced at the anode, luminescence occurs there. Compared with other detection techniques, the ECL has some advantages: no radioisotopes are used; detection limits are extremely low; the dynamic range for quantification extends over six orders of magnitude; the labels are extremely stable compared with those of most other chemiluminescence (CL) systems; and the measurement is simple and rapid, requiring only a few seconds . PCR amplifications for capsicums, tomatoes and Arabidopsis thalianas were performed according to the IUPAC method that had been used for GMOsdetection. Almost all GM capsicums, tomatoes and Arabidopsis thalianas contain the cauliflower mosaic virus promoter (P-CaMV35S) and nopaline synthase terminator (T-NOS) . We designed two pairs of primers to amplify a 195 bp fragment in the PCaMV35S and a 180 bp fragment in the T-NOS. So, the fragments would be amplified from GMOs instead of non-GMOs through PCR. After the PCR amplifications, the products would hybridize with a pair of Oligonucleotide probes. They are designed to hybridize with the 35S or NOS-PCR products. Non-specific amplified products could not hybridize with the probes. One of the probes was labeled by biotin, but another was labeled by TBR. The biotin-labeled DNA was linked on to the surface of streptavidincoupled beads through the highly selective biotinstreptavidin linkage. The unlinked DNA fragments were washed away. The TBR-labeled probe would emit light on the anode surface. The light would be recorded as an ECL signal, which reflects the quantity of the hybridized PCR products. Finally, we could confirm whether GM

components existed.

7.) GMO detection using a bioluminescent real time reporter (BART) of loop mediated isothermal amplification (LAMP)
Several nucleic acid amplification techniques (NAATs) are available for the detection of GM contamination in plants and food of which the polymerase chain reaction (PCR) is by far the most widely used. However PCR requires rapid thermo-cycling to denature the target DNA strands, prior to and during amplification , which imposes specific equipment requirements. Since the discovery of DNA polymerases with strand displacement activity, novel amplification methods have been developed which operate under isothermal conditions (iNAAT) and propagate the initial target sequence by promoting strand displacement using enzymes or modified oligonucleotides. Loop-mediated isothermal amplification (LAMP) is a sensitive, rapid and specific nucleic acid amplification technology. It is characterized by the use of 4 different primers,specifically designed to recognize 6 distinct regions on the target DNA template, and proceeds at a constant temperature driven by invasion and strand displacement . Amplification and detection of target genes can be completed in a single step at a constant temperature, by incubating DNA template, primers and a strand displacement DNA polymerase. It provides high amplification efficiency, with replication of the original template copy 109-1010 times during a 1560 min reaction .The primer pairs used in LAMP are given specific designations; LAMP primers that generate hairpin loops, the outer displacement primers, and LOOP primers that accelerate the reaction by amplifying from the hairpin previously created by the LAMP primers. A recently described bioluminescence real time assay [BART] allows the quantitative analysis of iNAATs, in real time. The biochemistry of BART is based on the Enzymatic Luminometric Inorganic pyrophosphate Detection Assay, or ELIDA . Unlike previous applications of the ELIDA assay (most notably Pyro-sequencingTM), BART allows dynamic changes in pyrophosphate levels to be monitored continuously in real-time over extended periods at 60C for up to 2 hours. During a BART reaction, the level of light output increases to a peak whose timing under the same assay conditions reflects the initial concentration of the targeted DNA. Hence quantification of BART reactions utilizes the time to peak light output and is not dependent on absolute light

intensity produced, which greatly simplifies data interpretation and the hardware requirements, as well as making assays robust to turbidity and suspended solids . Here we demonstrate the use of LAMP-BART to detect GM events at low copy number levels in samples derived from maize, which has a large genome size and hence a relatively high proportion of non-target DNA. We show that LAMP-BART tolerates crude plant extracts without significant inhibition and examine the characteristics of the sample matrix that impact upon the quantitative nature of this technique and demonstrate its suitability in fieldable systems.

BART analysis
All LAMP-BART coupled amplifications were performed on dedicated instruments that simultaneously control temperature and quantify bioluminescence during a given assay. Two variations of the hardware were used; a static thermally controlled machine, equipped with a charged coupled device camera (http://www.lumora.co.uk), that has no theoretical limit of sample numbers or configurations; and a portable device (19; photodiode quantification PDQ; http://www.lumora.co.uk), that quantifies light using photo-diodes, which is presently limited to the analysis of 16 samples. All LAMP-BART reactions were performed in suitable nuclease free plastic tubes under molecular grade mineral oil, at 60C for 90 min.

RT-PCR analysis
Each 25 l PCR reaction was performed using the JumpStart SYBR Green ready mix (Sigma) supplemented with 5 pmol of respective primers (a dedicated pair for each target; Reaction mixtures were denatured for 2 min at 94C (to disassociate the polymerase from its protective antibody). Each cycle was: 94C for 30 s, 50C for 30 s, 72C for 30s, for 40 cycles. Amplification and analysis was performed using an ABI Prism 7000 sequence detection system (Applied Biosystems). Results were processed using Applied Biosystems SDS 2.312 software.

Primer design and synthesis

Previously published LAMP primers were used to target the cauliflower mosaic virus 35 S promoter (CaMV 35 S-p; GenBank: X79465), and the Agrobacterium tumefaciens nopaline synthetase gene terminator (NOS-t; GenBank: V00087; 41), while the LAMP

primers used to target Zea mays alcohol dehydrogenase reference gene (ADH1;GenBank: NM_001111939) were designed according to http://loopamp.eiken.co.jp/e/lamp/primer.html. .

Details of the primers used in the LAMP-BART and RT-PCR amplifications

Primer Type Displacement Displacement LAMP Orientation sense antisense sense Target (5base) ADH1 (7) ADH1 (287) ADH1 (116) Primer Sequence (5-3) CTTTGGATCGATTGGTTTC CCCAAAATTACTCAACG GTGATCAAGTGCAAA GGTCTTTTCATAAACCAAG

LOOP LOOP Displacement LAMP

sense antisense sense antisense

ADH1 (68) ADH1 (136) CaMV-35 S-p (7214) NOS-t (1947)

CGCCTTGTTTCTCCTCTGTC CCAAATCATCCACTCCGAGAC AGGAAGGGTCTTGCG CATGCTTAACGTAAT TCAACAGTTTTTGAATCCTGTTGCCGGTC

PCR PCR PCR PCR

sense antisense sense antisense

ADH1 (1297) ADH1 (1369) CaMV-35 S-p (7133) CaMV-35 S-p (7215)

AATTTTGGGGAAAGCTTCGT TTCACCACGATTGCAGGATA GATTCCATTGCCCAGCTATC CAACGATGGCCTTTCCTTTA

Underscored bases of the LAMP primers are additional foreign nucleotides, introduced to link different homology segments (CAMV-35 S-p LAMP primers contain four linker bases, while the other LAMP primers only contain 3 linker bases)

References Guy Kiddle, Patrick Hardinge,Neil Buttigieg,Olga Gandelman,Clint Pereira GMO detection using a bioluminescent real time reporter (BART) of loop mediated isothermal amplification (LAMP) suitable for field use BMC Biotechnology 2012, 12:15. Serge Leimanis1, Malcolm Burns4, Shirin Bruderer5, Thomas Glouden1, Neil Harris4, Othmar Kaeppeli5,Patrick Philipp6, Maria Pla2, Pere Puigdome`nech2, Marc Vaitilingom7, Yves Bertheau3and Jose Remacle A microarray-based detection system for genetically modified (GM) food ingredients Plant Molecular Biology (2006) 61:123139 _ Springer 2006 DOI 10.1007/s11103-0056173-4 Jinfeng Liu, Da Xing , Xingyan Shen, Debin Zhu, Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms Analytica Chimica Acta 537 (2005) 119123 Nelson Marmiroli & Elena Maestri & Mariolina Gull & Alessio Malcevschi & Clelia Peano & Roberta Bordoni & Gianluca De Bellis, Methods for detection of GMOs in food and feed Anal Bioanal Chem (2008) 392:369384 DOI 10.1007/s00216-008-2303-6. Arne Holst-Jensen Sissel B. Rnning Astrid Lvseth Knut G. Berdal PCR technology for screening and quantification of genetically modified organisms (GMOs) Anal Bioanal Chem (2003) 375 : 985993 DOI 10.1007/s00216-0031767-7