Jour'nal..oj~~ r a ! . . V ! r o !

o g y

.!1.996!, 3.7!..!.569-.!. 575.....Pr!nted.in ~Great.Br!!a!n............................................................................................................................

Construction of recombinant myxoma viruses expressing foreign genes from different intergenic sites without associated attenuation
R o n a l d J. J a c k s o n , D i a n a F. H a l l a n d P e t e r J. Kerr Cooperative Research Centre for Biological Control of Vertebrate Pest Populations CSIRO Division of Wildlife and Ecology, PO Box 84, Lyneham, Canberra, ACT 2602, Australia

Two myxoma virus transient dominant selection vectors were constructed and used to generate recombinant viruses expressing single and double foreign gene insertions from intergenic sites. The intergenic insertion sites were located between the myxoma virus genes M J2 (thymidine kinase) and MJ2a, and MA24 (~-subunit RNA polymerase) and MA27 (fusion protein) located approximately 60 and 113 kb from the left-end of the viral genome, respectively. Recombinant myxoma viruses expressing the IocZ gene from either intergenic insertion site retained wild-type virulence. However, expression of the gus gene reduced the virulence of the recombinant viruses in vivo. Northern blot analysis

indicated that the major late mRNAs encoding the viral RNA polymerase subunit and fusion protein are both of discrete size. Insertion of a foreign gene under the control of a synthetic late promoter between the MA24 and MA27 genes results in a specific-sized major late transcript for the inserted foreign gene. The MA27 gene transcripts directed by these recombinant viruses are heterogeneous in size, implying the typical pattern of poxvirus late transcription by random 3'-termination prior to polyadenylation. The transcription studies suggest signals located downstream of the insertion site direct 3'-processing of late transcripts irrespective of the gene immediately upstream.

Introduction

A major goal for the programme being conducted by the Cooperative Research Centre for Biological Control of Vertebrate Pest Populations is the construction of recombinant myxoma virus (MYXV) expressing species specific reproductive vaccines for biological control of wild rabbits in Australia (Holland & Jackson, 1994). We have previously described the construction of the recombinant MYXV Lu13Z, expressing the E. coli IacZ gene, using the intergenic insertion vector pUrTK13 (Jackson & Bults, 1992 b). Transcription of the thymidine kinase (TK) gene early mRNA by Lu13Z virus was abnormal due to interference with anti-sense RNA transcribed from the inserted vaccinia virus (VACV) F16L early promoter. The VACV F16L promoter overlaps, and is in the opposite orientation to, the P l l late promoter contained on the VACV
Authorfor correspondence:RonaldJ. Jackson.
Fax + 61 6 242 9242. e-mail R3ackson@dwe.csiro.au The sequence data reported have been deposited with the EMBL database, accession numbers Z19600 and X94182.

DNA fragment inserted into pUrTK13. Disruption' of TK expression can severely affect the virulence of poxviruses (Buller et al., 1985 ; Kochneva et al., 1994). Virulence of MYXV is important for its transmission by arthropod vectors and therefore important for the ability of the virus to persist in the wild (Fenner & Ratcliffe, 1965). Any future construction of recombinant MYXVs as biological control agents will require that the virulence of the viruses is not compromised by the DNA manipulations so that they can compete and persist against wild-type viruses in the field. In this manuscript we describe the identification and transcriptional analysis of the MYXV genes encoding the flsubunit RNA polymerase (MA24; rpo132) and fusion protein (MA27) and the manipulation of the viral DNA sequence to create an intergenic insertion site for foreign genes. We describe the development of a MYXV vector system which incorporates a synthetic poxvirus late promoter for expression of foreign genes while maintaining the wild-type virulence phenotype. We use two manipulated intergenic insertion sites for the construction of a recombinant MYXV expressing the E. coli lacZ (fl-galactosidase) and gus (UidA; fl-glucuronidase)
156~.

0001-3893 1996 SGM

Iiiiiiiiiiiiiiiiiiiii iii!iiii ii@ii

iiiiii
prepared using cloned DNA fragments in the pGEM series vectors and the Riboprobe Gemini If kit (Promega). Virulence assays. Animal studies were done in accordance with the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes. Domestic rabbits were bred in the CSIRO Division of Wildlife and Ecology animal facility. Animals for testing were housed in individual cages in a controlled environment room. All animals were over 4 months old. For virulence assays of Lu, Lu14L/acZ, Lu243gus and Lu14LlacZ/243gus, 1000 p.f.u, of each virus was inoculated intradermally into each of two rabbits. Animals were examined twice daily following inoculation and clinical signs recorded. Moribund and severely distressed animals were euthanased. Lu2431acZ was assayed by inoculation of 100 p.f.u, of virus intradermally into six domestic rabbits. Animals were examined as above and once clinical signs were apparent they were injected twice daily with the analgesic buphrenorphine (0"03 mg/kg).

genes from different intergenic locations using the transient dominant selection method.

Methods
Cells and virus. MYXV strain Lausanne (Lu) was grown on rabbit RK13 ceils using procedures described in Jackson & Bults (1992b). Methods for the generation of recombinant viruses using transient dominant selection of the E. coligpt gene were essentially as described by Falkner & Moss (1990). Plaques containing recombinant viruses expressing the E. call ]acZ or gus genes were detected by overlaying the infected cell monolayers with I x MEM without phenol red (GIBCOBRL; 2 x concentration) containing 0"7% (w/v) agar, 300 gg/ml X-Gal and/or 150gg/ml salmon-glc (Biosynth AG). Under this medium, plaques containing viruses expressing ~-gaiactosidase stain blue (X-Ga|), those expressing fl-glucuronidase stain pink (salmon-glc) and viruses expressing both enzymes stain pink with purple centres.

DNA sequencing and plasmid construction. The procedures used to determine the DNA sequence of a selected region of the MYXV EcoRI-G1 fragment were as described previously (Jackson & Bults, 1992 a). Complementary oIigonucleotides for the DNA sequence AGGATCAGCTTTTTTTTTTTTTTTTTTGGCATATAAATAG encoding a synthetic late promoter (underlined) (Davison & Moss, 1990) were synthesized and annealed. The MYXV vector pUrTKI3 (Jackson & Bults, I992b) was digested with XbaI and EcoRI to excise the VACV DNA fragment containing both the PII and PI6L promoters, followed by treatment with Klenow fragment DNA polymerase to fill-in the recessed 3'-ends. The annealed oligonucleotides were blunt-end ligated into the prepared plasmid so that the inserted synthetic late promoter was in the correct sense with the intergenic multiple cloning site. These manipulations generated the transient dominant selection vector pUrTK14L. The vector pGPT.Sgpt was constructed by sub-cloning the EcoRIApa[ fragment, containing the VACV P7.5 early/late promoter and E. coli gpt gene, from pGpt07/14 (Boyle & Coupar, 1988) between the respective sites in pGEM-7Z(f--). This vector can be used to construct transient dominant selection vectors by insertion of poxvirus sequences into the remaining multiple cloning site. The 1"1 kb XbaI-HindIII fragment corresponding to the right-end of the MYXV HindIII-C fragment was treated with Klenow fragment DNA polymerase to fill-in the recessed 3'-ends followed by ligation between the EcoRI and NsiI sites (both sites treated with Klenow DNA polymerase) of pGP7.Sgpt in the orientation which destroyed all the restriction endonuclease sites used for the construction. The complementary oligonucleotides for the sequence G ACG CCG ACA TTT TTA TGA AGCTTGTCTAGA were annealed and ligated into the HindlI site located six codons from the end of the MA24 gene creating intergenic XbaI and HindIII sites. The XbaI-HindlII fragment of pUrTK14L containing the synthetic late promoter and multiple cloning site was then inserted between the new restriction sites to generate the transient dominant selection vector pMA243. The 3 kb BamHI lacZ gene cassette from pGH101 (Herman et aI., 1986) and lhe I'9 kb SmaI-BamH]gus gene cassette from pCGP37 (a gift from D. DaU, CSIRO Division of Entomology, Canberra, Australia) were separately ligated into the multiple cloning sites of pUrTK14L and pMA243 in-sense with the synthetic late promoter, generating pUrTK14L/acZ, pMA243/acZ and pMA243gus. Viral mRNA preparation and Northern blot analysis. Early and late MYXV mRNAs were prepared as described previously (Jackson & Bults, 1992 a). Poly(A)+ RNA was isolated from the infected cells using the PolyATract System 1000 (Promega). Northern blots were prepared and hybridized using a2P-labelled RNA 'run-off' anti-sense probes

Results and Discussion

DNA sequencing
The MYXV genome is approximately 163 kb in length and a restriction map for a limited number of enzymes has been determined (Russell & Robbins, 1989). Unfortunately, the published restriction map is in the opposite orientation to the nucleotide sequence of VACV (Goebel et al., 1990), the prototype of the family Poxviridae. A restriction map of the MYXV genome in the corrected orientation is shown in Fig. 1. The D N A sequence (EMBL ZI9600 and X94182) determined is of a region located approximately 113 kb from the left-end of the MYXV genome corresponding to the 1"1 kb XbaI-HindllI fragment from the right-end of the HindlII-C fragment plus the adjacent 0"6 kb HindIII-M fragment. The MYXV D N A sequence encodes three open reading frames (ORFs), MA24 (partial), M A 2 7 and MA28, named to correspond to the related ORFs of the VACV Copenhagen strain (Goebel et al., 1990). The protein sequences encoded by these ORFs were compared to the SWISSPROT database using the FASTA program (Pearson & Lipman, I988) with default parameters. The MA24 gene encodes the second largest (~) subunit of the poxvirus R N A polymerase with amino acid similarity to the Capripoxvirus sheeppox virus (SPPV) HM1 (score: 1106; 86"0% identity over a 242 aa overlap), VACV A24 (rpoi32) (score: 1046; 79"8 % over 242 aa) and numerous other Orthopoxvirus, eukaryotic and prokaryotic RNA polymerase subunits. The MA27 gene encodes a protein related to the SPPV HM2 (score: 295; 42"4 % over 125 aa), VACV A27 (score: 90; 54"5% over 33 aa) and Parapoxvirus orf (ORFV) 1OK (score: 9 I ; 26"7% over 75 aa), the so-called membrane fusion proteins. The MA28 ORF encodes a protein of unknown function related to the SPPV HM3 (score: 545; 64"3 % over 140 aa), VACV A28 (score: 412; 52"4% over 147 aa) and the Amsacta moorei entomopoxvirus G4R ORF (score: 200; 2 7"1% over 140 aa) (Goebel et a]., 1990; Gershon et al., 1989; Nasse et al., 1991; Hall & Moyer, 1991). The VACV 14 kDa fusion protein is present in the membrane of intracellular mature virions (IMV) where it is

;7C

JiiiiiJiJ i i i
SacI I... ML5 ~ DraI I .... DraI i ..... TK DraI i .... MJ2a
l

i ii]i]i]i]i]iiiiiii;i]i]i

SalI XbaI .L. . . . MA24

HindII . .l ....

HindIII i . . . . . . MA28

HindIII I

MA27

EcoRI
III
TX J

o.o
I II
QiU

,
I I
C D2

oo.o,
I
A GI

,
I
B

,
II
V2 G2

, SO.O
I
H

~
I

i III
J XT

II
O Z DI

II
M VI E

I
K

I
P

I
L N

I III11 I
Q2 $ Y R W

BamHI
II II I
E

I
H

II
TI

I
D

II
ZI F

I
C

Illl
Pl XW
I

I
Q

I
G T2

I
M L

I
P2

I
R O

[
A

Ill I

I II
J

I
N

I
B

II
VU3

I
K

III
SAA

AASCC K

YUI T3 U2

HindIII I II
J L D

I
H K

I
G

I
A

I
I

I
C

tl
M F

I
B

II
L J

SalI
IIII
WV[ KI

I
HI

I
B

I
P

I
D R!

I
iF

I II
S GI

i Ili ii

li i

I
A

I Ill I
T V'I C

ii
X E

I
d

iii
O

III i
U H2

I
02

I IIII
KI VIW

Q V 2 R V3 L

l M ! M 2 R 2 K2

Fig. 1. Restriction map of ivlYXV for the enzymes EcoRI, BamHI, Hindlll and Sail. Shown above the sequence are the relative locations of the thymidine kinase (Jackson & Bults, 1992a), fl-subunit RNA polymerase and 'fusion' 3rotein genes.

reported to form disulphide-linked dimers and trimers which are anchored to the membrane via interaction with a 21 kDa protein encoded by ORF A17 (Rodriguez et al., 1987, 1993). The VACV fusion protein is involved in cell-to-cell fusion late in virus infection and is essential for the envelopment of the virus particles by the Golgi membrane and for egress of mature extracellular enveloped virions (Rodriguez et al., 1987; Rodriguez & Smith, 1990). If MYXV 21"5 kDa 'fusion' protein forms homo- or hetero-complexes in the IMV membrane they must be joined non-covalently as the protein is devoid of cysteine residues and would therefore be unable to form disulphide bonds. Transient expression of the MYXV MA27 gene using an SV40 based expression vector failed to induce cell fusion of transfected COS-I cells (data not shown). This result is not unexpected as cell-to-cell fusion with VACV has been shown to involve other viral proteins, notably the major 37 kDa envelope protein encoded by ORF F13 (Blasco & Moss, 1991). In addition, the MYXV fusion protein may need to be associated with the cellular membranes via interaction with other viral proteins such as the uncharacterized equivalent to the A17 gene product. Alignment of the characterized poxvirus fusion protein sequences (Gershon et al., 1989; Goebel et al., 1990; Massung et al., 1994; Meyer et al., 1994; Nass et al., 1991) using the CLUSTALW program (Thompson et al., 1994) indicates that only the C-terminal 30 aa are semiconserved across the genera (data not shown). The SPPV and MYXV proteins are more similar to each other than to viruses belonging to the genera Orthopoxvirus or Parapoxvirus, with the major difference being an insertion in the N-terminal region of the MYXV protein which gives rise to the difference in size from the SPPV 18 kDa protein. Like SPPV, MYXV does not encode DNA sequences related to the A-type inclusion body (ATI) or 'GAT' genes of

the Orthopoxvirus cowpox virus (CPXV) (Patel & Pickup, 1987) in this region of the genome and members of the Capripoxvirus or Leporipoxvirus are not known to form intracellular ATIs. The shared organization and nucleotide similarity of the genes encoded by this region confirm the close phylogenetic relationship between the genera Leporipoxvirus and Capripoxvirus observed previously with regard to the gene organization in genomic regions containing the inverted terminal repeats (Gershon & Black, 1989b) and TK genes (Gershon & Black 1989a; Jackson & Bults, 1992a).

Construction

of vectors

and recombinant

viruses

To allow the construction of recombinant MYXVs which retain the wild-type virulence phenotype, transient dominant selection vectors were constructed with intergenic insertion sites containing synthetic late promoters to direct expression of the inserted foreign genes. To correct the aberrant TK gene early transcription observed with viruses constructed using pUrTK13, the VACV P11/P16L promoter fragment was excised from this vector and replaced with a DNA sequence containing a synthetic late promoter to generate pUrTK14L (Fig. 2a). A second transient dominant selection vector, pMA243, was constructed by the insertion of a synthetic DNA sequence into the end of the MA24 gene to generate an intergenic insertion site (Fig. 2 b). To ensure that the function of the RNA polymerase was not altered, the synthetic DNA sequence contains the same coding information for the terminal six codons as the natural MA24 gene. The synthetic DNA also contained nucleotide redundancies to avoid direct duplication of the DNA sequence which could otherwise result in homologous recombination and deletion of the inserted DNA 57

'M Po

(a)
(b) ApaI

(SalI/HindIII)

M J I pUITKI,L
b ~ uA27

gPt ~
--_.-

FT'q

EcoRl/Hi d l I I ) [ -

I~

pMA243

Ampa ~

I I

1 I

(SacI/EcoRI),

>TK DraI XbaI PL~ TGTTATTTTTTTTAAAGTCTAGAGGATCAGCTTTTTTTTTTTTTTTTTTGGCATAT C Y T T *

>MA24 (HincII) HindIII PstI SalI BamHI CCCCCCGTTACGTTGACGCCGACATTTTTATGAAAGCTTGGCTGCAGGTCGACGGAT P P V T L T P T F L * XbaI

### E c o R I SmaI B a m H I SalI PstI HindIII (DraI) AAATAGAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCACTGGAATTAAAA ####

PMJ2a~

TACTGAAAAAATAAATCGGATATTTACGATTAGGTTGATCGTCTCCGACAGCCACCTC

SmaI EcoRI CCCCGGGAATTCTATTTATATGCCAA~GCTGATCCTCTAGAA TAAATATACGGTTTTTTTTTTTTTTTTTT ### ~PL

:TCCTACGTTTCTGTAACGATTATAGAGCGCCCGTTTGAGCGTCTATCTTCTTAGA
(HincII) L A G T Q A D I K K S "MA27

Fig. 2. MYXVtransient dominant selection vectors showing the nucleotide sequencesof the intergenic insertion sites (o) pUrTKI4L and (b) pMA243. Relevantrestriction sites and transcription initiation sites (#) are indicated.

iiiiiiiiiiiiiiii{i iiii kb 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

ii i iii

iiii iii{!i iiiiiiiiiiiiiiiiiiiiiii ii!iiiiiiiiiiiii 21

18 19 20

7-46 4.40 2.37

1.35

0.24 -

Northern blot [I p.g poly(A) + RNA per lane] of early and late mRNA isolated from MYXV Lu or Lul 4UocZ/243gus infected cells: Lu early (lanes I, 3, 5, 9, 13 and 17); Lu14UacZ/243gusearly (lanes 2, 4, 6, 10, 14 and 18); Lu late (lanes 7, 1 I, 15 and 19) ; Lul 4UocZ1243guslate (lanes 8, 12, 16, 20 and 21 ). Gene probes: TK (lanes I and 2) ; MJ2a (lanes 3 and 4); lacZ (lanes 5 to 8); gus (lanes 9 to 12); MA27 (lanes 13 to 16); MA24 (lanes 17 to 20). Lane 21 is a shorter exposure of lane 12.

Fig. 3.

from the recombinant MYXV genome. A poxvirus early transcription termination signal, TTTTTAT (Yuen & Moss, 1987), was included at the end of the new MA24 gene to maintain transcriptional integrity if the gene was expressed during the early phase of infection. Recombinant MYXVs, Lu14LlacZ and Lu2431acZ, containing single intergenic insertions of the lacZ gene, were constructed using the plasmids pUrTK14L/acZ and pMA243/acZ, respectively. The recombinant virus Lu14L/acZ was used to create a second virus expressing the 8us gene, Lu14LlacZ/243gus, by a subsequent transformation of infected cells with plasmid pMA243gus and selection for transient gpt gene expression. A recombinant virus, Lu243gus, containing an insertion of the gus gene alone was also constructed using pMA243gus.

Transcription studies Early and late mRNA was isolated from RK13 cells infected with wild-type Lu or recombinant virus Lu14LlacZ/243gus. The RNA samples were separately hybridized with probes complementary to the mRNAs for the native viral genes adjacent to the insertion sites and to the inserted foreign genes (Fig. 3). Insertion and late expression of the lacZ gene (Fig. 3, lane 8) positioned between the TK (Fig. 3, lane 2) and MJ2a (Fig. 3, lane 4) genes of MYXV using the vector pUrTK14L had no detrimental effect upon the transcription of either early gene flanking the insertion site. Northern blot analysis of MA24 (Fig. 3, lane 19) and MA27 (Fig. 3, lane 15) gene transcription indicated that both genes are transcribed during the late infection phase. Extended exposure of the autoradiographs did not show hybridization signals to early mRNA species for the MA24 gene (data not shown). This indicates that early transcription of the MYXV MA24 gene (Fig. 3, lane 17), unlike the corresponding CPXV rpo132 gene (Patel & Pickup, 1989), does not occur at

appreciable levels. Interestingly, both the MA24 and MA27 late mRNAs appear to contain major discrete-sized species with a background population of heterogeneous late mRNAs. Insertion of the gus gene between MA24 and MA27 using the vector pMA243 resulted in the generation of a major gus gene mRNA of approximately 2"5 to 3 kb (Fig. 3, lanes i2 and 21). Late RNA transcribed by the recombinant virus contains a heterogeneous population of MA27 late mRNAs (Fig. 3, lane 16) typical of poxvirus late gene expression with no evidence of discrete-sized mRNAs. This suggests that insertion of the gus gene has separated the MA27 gene from a downstream signal involved in processing of the 3'-end of late mRNA. With the LuI4LIacZ/243gus virus, the downstream signal was being used to process the late mRNA encoding the inserted gus gene. Discrete-sized late gene transcripts have also been observed for the cowpox virus rpo132, ATI (Pate] & Pickup, 1987, 1989; Antczak et al., 1992) and the VACV 'ATI' genes (Amegadie et a]., 1992). The rpo132 and ATI genes of the orthopoxviruses have the same head-to-head arrangement and are located in the same genomic location as the MYXV MA24 and MA27 late genes. A 345 bp cowpox virus DNA fragment (AX-element) located downstream of the ATI gene has been shown to direct post-transcriptional cleavage of the 3'-end of ATI late gene transcripts prior to polyadenylation (Antczak et al., 1992). Comparison of the equivalent AX-element regions of Or~hopoxvirus, Capripoxvirus and Leporipoxvirus does not indicate obvious conserved 3'-processing signals due to the highly conserved rpoI32 genes (data not shown). Further characterization of the signals involved in 3'-cleavage of late mRNA requires detailed deletion and mutagenesis studies to identify the RNA sequences involved. The MA28 gene is likely to be transcribed during the late infection phase since it has a TA,NATG consensus late promoter (Rose[ et al., I986; Davison & Moss, i989b) incorporating the methionine initiation codon. Sequences ;7i

liiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiii@iii

iiiiiiiiii

1
~ 4

.~---Lu2431acZ

.~ 3
~26 Z

Lu Lul4LlacZ

~)i .......
i.,.,

Lu14LlacZ/243gus Lu243gus

I.l
.

6 8 10 12 Survival time (days)

9~

14

16

Fig. 4. MYXV virulence assay. Chart showing the survival times of rabbits infected with wild-type and recombinant MYXV. The deaths of individual rabbits infected with Lu (O), LuI4UQcZ (0), Lu243gus (A) and Lu14LlacZ1243gus (A) are indicated.

related to an upstream early promoter (Davison & Moss, 1989a) or downstream early transcription termination signals are not associated with this gene and it is therefore unlikely to be expressed during the early transcription phase.
Virulence studies

Rabbits inoculated with either Lu or Lu14LlacZ had more severe clinical signs until death than rabbits inoculated with either Lu243gus or Lu14LlacZ/243gus. The reduced severity of clinical signs was associated with a prolonged survival time for rabbits injected with constructs containing the gus gene (Fig. 4). For analysis, the survival times were pooled into two groups, those injected with Lu or Lu14LlacZ and those injected with Lu234gus or Lu14LlacZ/243gus. Rabbits infected with viruses not expressing the gus gene had an average survival time (AST) of 10 +_0"7 (SD)days while those infected with virus expressing the gus gene had an AST of 13"5 q- 1"9 days. These values were significantly different (P ( 0"02; Student's t-test). Based on the criteria of Fenner & Marshall (195 7) for virulence of MYXV strains the first group of viruses has a type I virulence ( ( 13 days AST, 99"5 % mortality) and the viruses expressing the gus gene have a type II virulence (13-16 days AST, 99 % mortality). Recombinant viruses Lu234gus and LuI4LlacZ/243gus were independently isolated from fully virulent parental viruses, Lu and Lu14LlacZ respectively. It is possible that the plaque purification resulted in the selection of viruses with random mutations. However, recombinant Lu viruses expressing the ]acZ gene from intergenic sites have been repeatedly isolated which show no reduction in virulence for domestic rabbits (Opgenorth et al., I992; R. Jackson & P. Kerr, unpublished). This suggests that the genetic background of the cell culture adapted Lu virus is very stable. The observed

reduction in virulence of these viruses was most likely due to either the physical presence of the gus gene inserted between MA24 and MA27 or expression of the fl-glucuronidase enzyme. It is possible that separation of the MA27 gene from its 3' late RNA processing signals may be detrimental to transcription, stability or translation of the MA27 mRNA. Alternatively, high-level expression of the fl-glucuronidase could be detrimental to either virion morphogenesis or infected-cell viability. Either instance could result in a reduction of the number of infectious particles produced, resulting in a delay in the onset of the disease and therefore a reduced relative virulence. The virus Lu243tacZ was constructed to confirm that the reduced virulence of viruses containing the gus gene was not the result of foreign DNA insertion between MA24 and MA27. The Lu2431acZ virus retains type I virulence with an AST of 10"7 +__ days (Fig. 4). It would appear that separation 0"7 of the MA27 from the 3' post-transcriptional cleavage signals had little detrimental effect upon the virulence of this virus, presumably because this did not alter either the overall rate of mRNA synthesis or translation of the 'fusion' protein. However, it is not possible to exclude the possibility that the IacZ gene could contain cryptic 3' late RNA processing signals and therefore the MA27 transcripts may be processed conserving the virulence phenotype. We have previously shown that a recombinant MYXV expressing the highly immunogenic influenza virus haemagglutinin protein can induce high serum and moderate mucosal antibody titres to the foreign antigen following infection of rabbits (Kerr & Jackson, 1995). Using the vectors described here it should be possible to construct recombinant MYXVs expressing reproductive antigens which retain wild4ype phenotype as long as the expressed antigens have innocuous biological activity when expressed by the virus. We thank Lyn Hinds, Michael Holland and Tony Robinson for critcially reading the manuscript, and Brenda Shepherd for maintenance of the laboratory rabbits.
References Amegadzie, B. Y., Sisler, J. R. & Moss, B. (1992). Frame-shiftmutations

within the vaccinia virus A-type inclusion protein gene. Virology 186, 777-782.
Antczak, J. B., Patel, D. D., Ray~C. A., Ink, B. S. & Pickup, D. J. (1992).

Site-specific RNA cleavage generates the 3' end of a poxvirus late mRNA. Proceedings of the National Academy of Sciences, USA 89, 12033-12037. Blasco, R. & Moss, B. (1991 ). Extracellularvacciniavirus formationand cell-to-cell virus transmission are prevented by deletion of the gene encoding the 37000-dalton outer envelope protein. Journal of Virology 65, 5910-5920. Boyle, D. B. & Coupar, B. E. H. (1988). A dominant selectable marker for constructionof recombinant poxviruses. Gene65, I23-I28.
Buller, R. M. k., Smith, G. L., Cremer, K., Notkins, A. L. & Moss, B.
(1985). Decreased viruIence of recombinant vaccinia virus expression

57,~

i!i!iiiiiiiil;@iiiiiiiiiiiil i iiii i!iiiii;!iiiiiiiiiiiiiiiiiiii!ii!iiiiii!iiiiiiiiiiiii ii ii

vectors is associated with a thymidine kinase-negative phenotype. Nature 317, 813-815. Davison, A. J. & Moss, B. 0 9 8 9 o ) . Structure of vaccinia virus early promoters. Journal of Molecular Biology 210, 749-769. Davison, A.J. & Moss, B. (1989b). Structure of vaccinia virus late promoters. Journal of Molecular Biology 210, 771-784. Davison, A. J. & Moss, B. (1990). New vaccinia virus recombination plasmids incorporating a synthetic late promoter for high level expression of foreign proteins. Nucleic Acids Research i8, 4285-4286. Falkner, F.G. & Moss, B. (1990}. Transient dominant selection of recombinant vaccinia viruses. Journal of Virology 64, 3108-3111.

Meyer, H., Osterrieder, N. & Czerny, C. P. (1994). Identification of binding sites for neutralizing monodonal antibodies on the I4-kDa fusion protein of orthopox viruses. Virology 200, 778-783. Massung, R. F., Liu, L.-I., Qi, J., Knight, J. C., Yuran, T. E., Kerlavage, A. R., Parsons, J. M., Venter, J. C. & Esposito, J. J. (1994). Analysis of the complete genome of smallpox variola major virus strain Bangladesh1975. Virology 201, 215-240. Nasse, M., Nicholson, B. H., Fraser, K. M., Mercer, A. A. & Robinson,
A.J. (1991). An off virus sequence showing homology to the 14K 'fusion' protein of vaccinia virus. ]ournaI of General Virology 72, I177-I181.

Fenner, F. & Marshall, I. D. (1957). A comparison of the virulence for European rabbits (Oryctolagus cunicuIus) of strains of myxoma virus recovered in the field in Australia, Europe and America. Journalof Hygiene 55, 149-191.
Fenner, F. & Ratcliffe, F. N. (1965). Myxomatosis. Cambridge: Cambridge University Press. Gershon, P. D. & Black, D. N. (1989 o). The nucleotide sequence around the capripoxvirus thymidine kinase gene reveals a gene shared specifically with leporipoxvirus. Journal of General Virology 70, 525-533. Gershon, P. D. & Black, D. N. (1989b). A capripoxvirus pseudogene whose only intact homologs are in other poxvirus genomes. Virology 172, 350--354.

Opgenorth, A., Graham, K., Nation, N., Strayer, D. & McFadden, G. (1992). Deletion analysis of two tandemly arranged virulence genes in myxoma virus, MIIL and myxoma growth factor. Journal of Virology 66, 4720--4731.
Patel, D. D. & Pickup, D. J. (1987). Messenger RNAs of a stronglyexpressed late gene of cowpox virus contain 5'-terminal poly(A) sequences. EMBO Journal 6, 3787-3794. Patel, D. D. & Pickup, D. J. (1989). The second-largest subunit of the poxvirus RNA polymerase is similar to the corresponding subunits of procaryotic and eucaryotic RNA polymerases. Journal of Virology 63, 1076--1086. Pearson, W. R. & Lipman, D. L. (1988). Improved tools for biological sequence comparison. Proceedingsof the NationalAcademy of Sciences, USA 85, 2444-2448. Rodriguez, J. F. & Smith, G. L. (1990). IPTG-dependent vaccinia virus: identification of virus protein enabling virion envelopment by Golgi membrane and egress. Nucleic Acids Research 18, 5347-5351.

Gershon, P. D., Ansell, D. M. & Black, D. N. (1989). A comparison of the genome organization of capripoxvirus with that of the orthopoxviruses. Journal of Virology 63, 4703-4708. Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P. & Paoletti, E. (1990). The complete DNA sequence of vaccinia virus. Virology 179, 247-266.
Hall, R. L. & Moyer, R. W. (1991 ). Identification, cloning, and sequencing of a fragment of Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three vaccinia virus-related open reading frames. Journal of Virology 65, 6516-6527. Herman, G. E., O'Brien, W. E. & Beaudel, A. L. (1985). An E. coli ~galactosidase cassette suitable for study of eukaryotic expression. Nucleic Acids Research 14, 7130. Holland, H.K. & Jackson, R.J. (1994). Virus-vectored immunocontraception for control of wild rabbits: identification of target antigens and construction of recombinant viruses. Reproduction Fertility and Development 6, 631-642. Jackson, R. I. & Bults, H. G. (1992o). The myxoma virus thymidine kinase gene: sequence and transcriptional mapping. Journal of General Virology 73, 323-328. Jackson, R.J. & BuRs, H.G. (1992b). A myxoma virus intergenic transient dominant selection vector. Journal of General Virology 73, 3241-3245. Kerr, P. J. & Jackson, R. I. (1995). Myxoma virus as a vaccine vector for rabbits: antibody levels to influenza virus haemagglutinin presented by a recombinant myxoma virus. Vaccine 13, 1722-1726.

Rodriguez, D., Rodriguez, J. & Esteban, M. (1993). The vaccinia virus 14-kilodalton fusion protein forms a stable complex with the processed protein encoded by the vaccinia virus A17L gene. Journal of Virology 67,

3435-3440.
Rodriguez, J. F., Paez, E. & Esteban, M. (1987). A 14 000-M,. envelope protein of vaccinia virus is involved in cell fusion and forms covalently linked trimers. Journal of Virology 6I, 395-404. Rosel, J.L., Earl, P.L., Weir, J. P. & Moss, B. (1986). Conserved TAAATG sequence at the transcriptional and translational initiation sites of vaccinia virus late genes deduced by structural and functional analysis of HindlII H genome fragment. Journal of Virology 60, 436-449.
Russell, R. J. & Robbins, S. J. (1989). Cloning and molecular characterization of the myxoma virus genome. Virology 170, 147-159.

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. NucleicAcids Research 22, 4673-4680.
Yuen, U & Moss, B. (1987). Oligonudeotide sequence signalling transcriptional termination of vaccinia virus early genes. Proceedingsof the National Academy of Sciences, USA 84, 6417--6421.

Kochneva, G. V., Urmanov, I. H., Ryabchikova, E. I., Streltsov, V. V. & Serpinsky, O. I. (1994). Fine mechanisms of ectromelia virus thymidine kinase-negative mutants avirulence. Virus Research 34, 49-61.

Received 19 January 1996; Accepted 26 February 1996

;7!