Journal of Microbiological Methods 61 (2005) 235 243 www.elsevier.

com/locate/jmicmeth

Development of a strain-specific assay for detection of viable Lactobacillus sp. HOFG1 after application to cattle feed
Joseph F. Flint, Esther R. Angert*
Department of Microbiology, Cornell University, Wing Hall Ithaca, NY 14853, United States Received 30 October 2004; received in revised form 3 December 2004; accepted 3 December 2004 Available online 6 January 2005

Abstract A strain-specific assay was developed for the detection of viable Lactobacillus on cattle feed. The DNA sequences of the 16S rRNA gene and four different 16S/23S rRNA intergenic spacer regions (ISR) from Lactobacillus sp. HOFG1 were determined. Based on these sequences, a strain-specific primer was designed for the amplification of one of the ISRs. When combined with a Lactobacillus group primer, the polymerase chain reaction (PCR) assay detected only Lactobacillus sp. HOFG1 and not other closely related L. animalis or L. murinus strains. The feed assay uses a combination of enrichment culturing and PCR to detect and enumerate viable Lactobacillus sp. HOFG1 after its application onto cattle feed. The high degree of primer specificity and use of selective culturing allows for the detection of viable Lactobacillus which is useful in tracking bacteria applied to complex feed mixtures that contain a high background of endogenous bacteria. D 2004 Elsevier B.V. All rights reserved.
Keywords: Intergenic spacer region; Lactobacillus; L. animalis; Probiotic animal feed

1. Introduction Studies have shown that feed supplemented with certain probiotic bacteria can significantly reduce the numbers of enteropathogenic bacteria found in cattle rumen and feces (Brashears et al., 2003; Gilliland and Speck, 1977; Zhoa et al., 1998). Other benefits attributed to the use of microbial additives in livestock feed include increased feed efficiency, live weight
* Corresponding author. Tel.: +1 607 254 4778; fax: +1 607 255 3904. E-mail address: era23@cornell.edu (E.R. Angert). 0167-7012/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.mimet.2004.12.002

gain and disease resistance in livestock (Gilliland et al., 1980; Gusils et al., 1999). Lactic acid bacteria, which include the genus Lactobacillus, are the most prevalently administered probiotic bacteria (Brashears et al., 2003; Charteris et al., 1997; Reid and Friendship, 2002). The genus Lactobacillus is a taxonomically complex group of microorganisms. Although 16S ribosomal RNA gene sequence comparisons are used to determine phylogenetic relationships among Lactobacillus species (Dewhirst et al., 1999; Kullen et al., 2000; Sui et al., 2002), often the discriminating power of the 16S/23S rRNA gene intergenic spacer region (ISR) is required for the identification of

236

J.F. Flint, E.R. Angert / Journal of Microbiological Methods 61 (2005) 235243

Lactobacillus species and strains (Berthier and Erlich, 1998; Blaiotto et al., 2002; Song et al., 2000; Tannock et al., 1999; Tilsala-Timisjarvi and Alatossava, 1997). It is important to examine the fate of applied probiotic bacteria to monitor the application process and assess efficacy of the product. Often, probiotic strains used as feed additives are isolated from intestinal or fecal contents and the beneficial properties associated with the probiotic are strain specific (Brashears et al., 2003; Reid and Friendship, 2002). Therefore, a diagnostic marker specific to the probiotic strain of interest is necessary to discriminate it from the other endogenous bacteria found within a host or in the environment. Many different molecular identification techniques such as pulsed-field gel electrophoresis (PFGE), random amplified polymorphic DNA (RAPD) and ribotyping can be used to discriminate species and strains of lactobacilli (Castellanos et al., 1996; Rodtong and Tannock, 1993; Roy et al., 2000; Tilsala-Timisjarvi and Alatossava, 1998; Ventura and Zink, 2002). However, these procedures are not appropriate for probiotic monitoring purposes because they rely upon isolating large numbers of individual cultures to identify and enumerate the probiotic strain. Other molecular methods, such as denaturing gradient gel electrophoresis (DGGE) and fluorescent in situ hybridizations (FISH), could be employed (Satokari et al., 2003). However, DGGE detection can be problematic, requires abundant targets and is not quantitative (Ercolini, 2004). FISH analyses are quantitative but require access to a fluorescent microscope and are confounded by the presence of autofluorescent materials, such as what would be found in cattle feed. We report here a rapid and simple procedure that is able to detect a specific potential probiotic strain, Lactobacillus sp. HOFG1, after its application to cattle feed. Lactobacillus sp. HOFG1 is one of several strains selected for study because of its ability to out compete Escherichia coli O157:H7 when inoculated in equal numbers in broth culture. The detection protocol utilizes naturally occurring genetic variation found within the ISR and incorporates enrichment culturing and polymerase chain reaction (PCR) procedures to assay for the presence of viable probiotics after application to cattle feed. The assay proved to be robust, semi-quantitative and applicable in a commercial feedlot setting.

2. Materials and methods 2.1. Bacterial strains and growth conditions Lactobacillus acidophilus ATCC 4356T, L. murinus ATCC 35020T and L. animalis ATCC 35046T were purchased from the American Type Culture Collection (ATCC). L. murinus strain ASF361 was purchased from Taconic (Germantown, NY) (Dewhirst et al., 1999). Lactobacillus sp. strain HOFG1 is one of several strains originally isolated from calf intestinal tract contents that are being evaluated as potential commercial probiotics. L. acidophilus 4356T was used as a reference standard throughout the study because of its taxonomic similarity to Lactobacillus sp. HOFG1 (Kandler and Weiss, 1986) and its wellcharacterized properties. All strains were maintained in anaerobically prepared MRS broth (DIFCO) (DeMan et al., 1960) at 37 8C. For the detection assays, bacteria were enriched in LBS broth (Becton Dickinson, Cockeysville, MD) (Rogosa et al., 1951) or LBS agar plates at 37 8C. 2.2. Genomic DNA isolation from Lactobacillus cultures Cells were lysed using bead beating as previously described (Hugenholtz et al., 1998) with the following modifications. The cell pellet, from 10 ml overnight culture, was washed once with 10 ml STE buffer (150 mM NaCl; 100 mM Tris, pH 8.0; 50 mM EDTA) and resuspended in 0.6 ml of 2 Buffer A (200 mM Tris, pH 8.0; 50 mM EDTA; 200 mM NaCl; 2 mM sodium citrate; 10 mM CaCl2; 0.1 mg ml1 polyadenosine). Cells were then added to a 2.0 ml microcentrifuge tube containing 0.3 g glass beads (450600 Am diameter, Sigma), 0.3 g silica beads (100 Am diameter, Biospec Products), 150 Al phenol and 75 Al of 10% (w/v) sodium dodecyl sulfate (SDS) stock solution. The microcentrifuge tube was reciprocated for 3 min at medium speed on a Mini Beadbeater-8 (Biospec Products, Bartlesville, OK). The cell lysate was centrifuged at 15,000g on a microcentrifuge (Eppendorf) for 6 min. The aqueous phase was removed to a fresh tube and the DNA was extracted twice with two volumes phenol/chloroform/isoamyl alcohol 25:24:1, pH 8.0 (Amresco). The DNA was precipitated, suspended in 10 mM Tris (pH 8.0) and stored at 20 8C.

J.F. Flint, E.R. Angert / Journal of Microbiological Methods 61 (2005) 235243

237

2.3. Polymerase chain reactions and DNA sequencing The 16S rRNA gene and the 16S23S ISR were amplified using primers targeting conserved sequences within the 16S and 23S rRNA genes (Table 1). Primers 27f and 1492r were used to amplify almost the entire 16S rRNA gene. The primer combination of 1407f with 242r was used to amplify the 16S23S ISR. All polymerase chain reactions were performed in 25 Al reaction volumes containing 1X Hotstart Taq Master Mix (Qiagen), 50 ng of each primer and 50 ng of purified genomic DNA. For diagnostic assays, genomic DNA was replaced with 1 Al of broth culture or a portion of a colony picked with a sterile toothpick and amplifications were performed using the HOFG1sp and LU-3Vr primer combination. Temperature cycling conditions for PCR were as follows: an initial heating of 95 8C for 15 min, followed by 25 cycles of: 92 8C for 30 s, 55 8C for 30 s, 72 8C for 1 min, and terminating with a 10-min final incubation of 72 8C. Gradient temperature PCR was used to optimize primer-annealing temperatures to ensure a high degree of primer specificity during assays. PCR products (7.5 Al aliquots) were analyzed by agarose gel electrophoresis. The DNA sequence of the 16S rRNA gene from Lactobacillus sp. HOFG1 was determined directly from PCR amplified products using primers to conserved regions of the rRNA gene (Lane, 1991). PCR products of the ISR were cloned using the TOPO TA Cloning Kit for Sequencing (Invitrogen) according to the protocol provided by the manufacturer. Colonies were screened for the presence of an insert
Table 1 Oligonucleotide primers used in this study Primer 27f (16S) 1492r (16S) 1407f (16S) 242r (23S) HOFG1sp LU-3Vr Oligonucleotide Sequence (5V3V) AGAGTTTGATCCTGGCTCAG GGTTACCTTGTTACGACTT TGYACACACCGCCCGTC KTTCGCTCGCCRCTAC CCTGCACTTTATCTATCG AACGCGGTGTTCTCGGTT Reference (Lane, 1991) (Lane, 1991) (Lane, 1991) (Lane, 1991) This study (Song et al., 2000)

by PCR amplification using vector-specific primers. Clones with insert sizes that corresponded to the four identified ISRs were selected for sequence analysis. Plasmid DNA was prepared using the RPM Kit (QBIOgene). All DNA sequencing reactions employed Big Dye Terminator chemistry with AmpliTaq-FS DNA polymerase (Applied Biosystems) and were performed at the Cornell University BioResource Center. Sequences were determined using an Applied Biosystems Automated 3730 DNA Analyzer. The DNA sequences were compared with sequences in the GenBank database using BLAST (Altschul et al., 1990). DNA sequences from other close relatives were aligned using ClustalX software and phylogenetic analyses were performed with the Phylip software package using maximum likelihood and neighbor joining methods (Felsenstein, 1993). DNA sequences were deposited in GenBank under accession numbers: 16S rRNA gene, AY522567; ISR 1, AY526615; ISR 2, AY526616; ISR 3, AY526613 and ISR 4, AY526614. 2.4. Pulsed-field gel electrophoresis (PFGE) A 10-ml aliquot of an overnight culture was harvested by centrifugation at 4000g, washed once with STE buffer and then suspended in 1.0 ml of the same buffer. A 0.2-ml aliquot of the cell suspension was added to 0.8 ml of STE buffer and thoroughly mixed with an equal volume of 2.0% (w/v) lowmelting-point agarose (SeaPlaque GTG, FMC BioProducts, Rockland, ME). Cell suspensions were dispensed into a plug mold and allowed to solidify at 4 8C. Cells within the agarose plugs were lysed overnight at 37 8C with a treatment of lysozyme (1 mg ml1) in lysis buffer (50 mM Tris, 10 mM EDTA; pH 7.5), followed by an overnight treatment at 50 8C with proteinase K (100 Ag ml1) in fresh lysis buffer. Agarose plugs were incubated for 1 h at room temperature in TE (10 mM Tris, 1 mM EDTA; pH 8.0) containing 1.0 mM phenylmethylsulfonyl fluoride (PMSF) followed by three 20 min washes in TE. Agarose plugs were then incubated overnight with 40 units of restriction endonuclease. The restriction endonucleases used in this study were Sma I, EcoR I, Hind III and BssH II. Pulsed-field gel electrophoresis of a 1.0% (w/v) agarose gel was carried out with a CHEF DR II apparatus (BioRad, UK) with a

Y=C or T, R=A or G, K=G or T. The 16S rRNA gene and 16S23S rRNA ISR were amplified using 27f with 1492r, and 1407f with 242r, respectively. The primer combination of HOFG1sp with LU-3Vr was used in the HOFG1 strain-specific assay.

238

J.F. Flint, E.R. Angert / Journal of Microbiological Methods 61 (2005) 235243

running temperature of 14 8C at 6V (cm2)1 with pulse times of 126 s for 24 h. Genomic digest patterns were visualized by staining with ethidium bromide. 2.5. Lactobacillus sp. HOFG1 detection assays Two methods were performed for the detection of Lactobacillus sp. HOFG1 from the same inoculated feed samples using either broth or solid media for the initial enrichment culture. A 5.0 g portion of inoculated cattle feed was mixed with 45 ml of sterile H2O and shaken vigorously. A ten-fold dilution series was then created in culture tubes containing 10 ml sterile H2O. In triplicate, an aliquot of 0.5 ml from each dilution was inoculated into 4.5 ml of LBS broth medium and incubated overnight. After incubation, each tube was tested for the presence of HOFG1 with the strain-specific PCR assay. Applied Lactobacillus sp. HOFG1 numbers were estimated based upon the number of tubes that tested positive. Additionally, dilutions were spread on solid LBS medium and incubated overnight in an anaerobic chamber. Individual colonies were assayed with strain-specific PCR as described above. To determine the sensitivity of the assay, seven feed samples were inoculated with different amounts

of HOFG1 and evaluated. Lactobacillus sp. HOFG1 lyophilate was suspended in sterile H2O to a concentration of 109 cells ml1. A ten-fold dilution series was made from this suspension. The series was used to inoculate feed samples and also used for plate counts to confirm viable cell numbers. Each of the seven 5.0 g portions of feed was placed in a sterile plastic container and inoculated with 1 ml of cell suspension (ranging from 106 cells ml1 to 100 cell ml1). The feed was mixed well and allowed to stand at room temperature for 10 min. Sterile H2O was added to each sample, to a total volume of 50 ml, and the sample was shaken vigorously. The feed suspension was allowed to settle briefly. A 0.5-ml aliquot of supernatant was added to 4.5 ml LBS broth. Next, 0.5 ml of supernatant was removed and added to 4.5 ml of sterile H2O. Ten-fold dilution series, to 108, were made from each sample by transferring 0.5 ml into 4.5 ml sterile H2O. These series were used to inoculate tubes of growth medium (in triplicate) by adding 0.5 ml to 4.5 ml LBS broth. The inoculated culture tubes were incubated 24 h at 37 8C and PCR assayed as described above. Most probable number estimates based on assay results were compared with plate counts determined from the feed inoculum.

Fig. 1. Phylogenetic tree constructed from 16S rRNA gene sequence comparisons demonstrating the relationship of Lactobacillus sp. HOFG1 to other closely related lactobacilli. Bootstrap values based on 100 replicates are provided at branch nodes. GenBank accession numbers follow species name in parenthesis.

J.F. Flint, E.R. Angert / Journal of Microbiological Methods 61 (2005) 235243

239

2.6. Field testing of the assay Lactobacillus sp. HOFG1 lyophilate was suspended in water and applied by spraying feed on a conveyor and in the feed mixer. After application of the strain, ten grab samples were taken from a 1600-lb feed bunk. The combined samples were mixed manually, and 250 g of this sample was then added

to 2250 ml of water and shaken vigorously. The Lactobacillus sp. HOFG1 assay was performed as described above. Media inoculations were completed within 4 h of inoculation of the feed. Throughout the assay, sterile water was used for recovery of Lactobacillus sp. HOFG1 and for dilution series. Plate counts were used to determine the survival rate of HOFG1 in water and phosphate

Fig. 2. DNA sequence alignment of the four complete intergenic spacer regions (ISR) from Lactobacillus sp. HOFG1. Conserved nucleotides are shaded in grey. Primer locations are identified with bracketed arrows and underlined. The 3V end of the 16S rRNA gene and tRNA genes are identified with bracketed arrows. 23S rRNA gene is not shown.

240

J.F. Flint, E.R. Angert / Journal of Microbiological Methods 61 (2005) 235243

buffered saline (PBS) over time. When the cell suspension was plated immediately, no difference was observed in recovered colony forming units from the water or the PBS suspensions. After holding the cell suspensions for 4 h at room temperature, approximately 77% of the cells in PBS were recoverable while approximately 39% of the cells survived in water.

and contained both the tRNAIle and the tRNAAla genes. A third ISR (304 bp) contained the tRNAAla gene. The fourth ISR (202 bp) contained no apparent tRNA gene. 3.3. Design and validation of Lactobacillus sp. HOFG1-specific PCR primers An alignment of the four different ISR DNA sequences determined from Lactobacillus sp. HOFG1 revealed several regions of variation that were targeted for specific primer design (Fig. 2). When the designed HOFG1sp primer (Table 1) was used in conjunction with the reverse complement of the LU3V bGroup IVQ Lactobacillus primer (Song et al., 2000), a single 221 bp product, specific only to Lactobacillus sp. HOFG1, was produced (Fig. 3). No PCR products were produced when this primer combination was used in PCR with genomic DNA isolated from the three closest known relatives of Lactobacillus sp. HOFG1, even at very low annealing temperatures (40 8C). The PCR-based assay was found to be extremely sensitive and able to detect very small amounts of Lactobacillus sp. HOFG1 genomic DNA. To obtain the level of sensitivity we required for testing feed samples, we first developed a nested-PCR approach (data not shown). The assay was so sensitive that

3. Results and discussion 3.1. Lactobacillus species and strain comparisons The sequence of the 16S rRNA gene of Lactobacillus sp. HOFG1 was determined. DNA sequence comparisons of the nearly complete 16S rRNA genes of the Lactobacillus species used in this study suggest that Lactobacillus sp. HOFG1 is very closely related to L. animalis or L. murinus (Fig. 1). The DNA sequence of the 16S rRNA gene from Lactobacillus sp. HOFG1 is 99.7% identical to that of L. animalis, possessing only 4 nucleotide differences over 1445 nucleotides compared, and is 99.6% identical to L. murinus. Since the level of 16S rRNA sequence variation between Lactobacillus sp. HOFG1 and L. animalis is comparable to the amount of sequence diversity seen in rRNA operons found within an individual bacterium (Moszer et al., 1995; Shimizu et al., 2001; Acinas et al., 2004), we used PFGE to confirm that Lactobacillus sp. HOFG1 is different from other characterized strains found in the L. animalis/L. murinus group. The genomic DNA restriction patterns, resolved using PFGE, for each strain were unique, indicating that they are different bacteria (data not shown). 3.2. 16S23S ISR amplification and sequence analysis The high identity between the 16S rRNA gene sequences of the Lactobacillus strains used in this study precluded the use of this gene for the design of a strain-specific PCR primer to identify Lactobacillus sp. HOFG1. Four different ISRs from Lactobacillus sp. HOFG1 were cloned and DNA sequence determined. The total number of rRNA operons in the HOFG1 genome was not ascertained. Two of the cloned ISRs were of similar length (383 and 399 bp),

Fig. 3. Agarose gel electrophoresis of PCR products using a primer combination HOFG1sp and LU-3Vr, designed to detect Lactobacillus sp. HOFG1. (1) Lactobacillus sp. HOFG1, (2) L. murinus ASF361, (3) L. murinus ATCC 35020T and (4) L. animalis ATCC 35046T. Lanes marked bMQ are DNA size standards of Hae III digested fX174 phage DNA.

J.F. Flint, E.R. Angert / Journal of Microbiological Methods 61 (2005) 235243

241

Lactobacillus sp. HOFG1 DNA was occasionally detected in negative controls, presumable due to low-level contamination of HOFG1 lyophilate or genomic DNA in the laboratory. Since we were interested in using this assay in laboratories that also handle Lactobacillus sp. HOFG1, and we were primarily interested in detecting only viable cells, we explored using an initial culture enrichment step prior to the PCR assay. We found that direct tests on enrichment cultures or colonies eliminated the need to use nested PCR, which in turn eliminated false positive results. The assay successfully detected HOFG1 applied to a number of different forms of cattle feed including standard dairy ration, flaked corn and hay. No PCR products were obtained from enrichments derived from feed in which Lactobacillus sp. HOFG1 was not applied. Assays were performed on feed samples mixed in the laboratory containing different numbers of applied HOFG1 to examine the sensitivity of the assay. We were able to detect Lactobacillus sp. HOFG1 at 102 cells g1 of feed. Lactobacillus sp.

HOFG1 was consistently detected to within an order of the applied amount (Fig. 4). Although Lactobacillus sp. HOFG1 produces distinct colonies on LBS plates, we found that enumeration based on colony morphology alone leads to over-estimation of actual strain numbers. Examining individual colonies with the PCR assay was an effective means to discriminate the HOFG1 colonies from background. However, selecting large numbers of colonies is time-consuming. 3.4. Field application of the Lactobacillus sp. HOFG1 assay Our goal was to design a primer that could rapidly identify the potential probiotic Lactobacillus sp. HOFG1 among a background of uncharacterized and potentially related bacteria that could be found in cattle feedlots. We found that the short generation time of Lactobacillus sp. HOFG1 and use of selective media generates sufficient numbers of bacteria in a broth culture enrichment for PCR-based assay of

Fig. 4. Agarose gel electrophoresis of PCR products from an inoculation series to determine the sensitivity of the detection assay for Lactobacillus sp. HOFG1 applied to cattle feed. The numbers applied to feed are as follows: (A) 106 cells g1 feed, (B) 105 cells g1 feed, (C) 104 cells g1 feed, (D) 103 cells g1 feed, (E) 102 cells g1 feed, (F) 101 cells g1 feed. Cells were recovered from each feed sample and every dilution from feed was used to inoculate growth media in triplicate. G contains positive and negative controls for assay. Lanes marked bMQ are DNA size standards of Hae III digested fX174 phage DNA. No PCR products were seen in assays with 100 cells g1 feed and higher dilutions performed on 106 and 105 cells g1 feed (data not shown).

242

J.F. Flint, E.R. Angert / Journal of Microbiological Methods 61 (2005) 235243 Brashears, M.M., Jaroni, D., Trimble, J., 2003. Isolation, selection, and characterization of lactic acid bacteria for a competitive exclusion product to reduce shedding of Escherichia coli O157:H7 in cattle. J. Food Prot. 66, 355 363. Castellanos, M.I., Chauvet, A., Deschamps, A., Barreau, C., 1996. PCR methods for identification and specific detection of probiotic lactic acid bacteria. Curr. Microbiol. 33, 100 103. Charteris, W.P., Kelly, P.M., Morelli, L., Collins, J.K., 1997. Selective detection, enumeration and identification of potentially probiotic Lactobacillus and Bifidobacterium species in mixed bacterial populations. Int. J. Food Microbiol. 35, 1 27. DeMan, J.C., Rogosa, M., Sharpe, M.L., 1960. A medium for the cultivation of lactobacilli. J. Appl. Bacteriol. 23, 130 135. Dewhirst, F.E., Chien, C.C., Paster, B.J., Ericson, R.L., Orcutt, R.P., Schauer, D.B., Fox, J.G., 1999. Phylogeny of the defined murine microbiota: altered Schaedler flora. Appl. Environ. Microbiol. 65, 3287 3292. Ercolini, D., 2004. PCR-DGGE fingerprinting: novel strategies for detection of microbes in food. J. Microbiol. Methods 56, 297 314. Felsenstein, J., 1993. Phylip-phylogeny inference package. Cladistics 5, 164 166. Gilliland, S.E., Speck, M.L., 1977. Antagonistic action of Lactobacillus acidophilus toward intestinal and foodborne pathogens in associative cultures. J. Food Prot. 40, 820 823. Gilliland, S.E., Bruce, B.B., Bush, L.J., Staley, T.E., 1980. Comparison of two strains of Lactobacillus acidophilus as dietary adjuncts for young calves. J. Dairy Sci. 63, 964 972. Gusils, C., Gonzalez, S., Oliver, G., 1999. Some probiotic properties of chicken lactobacilli. Can. J. Microbiol. 45, 981 987. Hugenholtz, P., Pitulle, C., Hershberger, K.L., Pace, N.R., 1998. Novel division level bacterial diversity in a Yellowstone hot spring. J. Bacteriol. 180, 366 376. Kandler, O., Weiss, N., 1986. Regular, nonsporing gram-positive rods. In: Sneath, P.H.A., Mair, N.S., Sharpe, M.E., Holt, J.G. (Eds.), Bergeys Manual of Systematic Bacteriology. Williams & Wilkins, Baltimore, MD. Kullen, M.J., Sanozky-Dawes, R.B., Crowell, D.C., Klaenhammer, T.R., 2000. Use of the DNA sequence of variable regions of the 16S rRNA gene for rapid and accurate identification of bacteria in the Lactobacillus acidophilus complex. J. Appl. Microbiol. 89, 511 516. Lane, D.J., 1991. 16S/23S rRNA sequencing. In: Stachebrandt, E., Goodfellow, M. (Eds.), Nucleic Acid Techniques in Bacterial Systematics. Wiley, Chichester, NY. Moszer, I., Glaser, P., Danchin, A., 1995. Subtilist: a relational database for the Bacillus subtilis genome. Microbiology 141, 261 268. Reid, G., Friendship, R., 2002. Alternatives to antibiotic use: probiotics for the gut. Anim. Biotechnol. 13, 97 112. Rodtong, S., Tannock, G.W., 1993. Differentiation of Lactobacillus strains by ribotyping. Appl. Environ. Microbiol. 59, 3480 3484. Rogosa, M., Mitchell, J.A., Wiseman, R.F., 1951. A selective medium for the isolation and enumeration of oral and fecal lactobacilli. J. Bacteriol. 62, 132 133.

viable cells even when Lactobacillus sp. HOFG1 was not numerically dominant (based on plate assays). As with the laboratory inoculations, we found that we could detect HOFG1 numbers to within an order of magnitude of the density of cells applied to the feed. Inoculations of LBS were complete within 4 h of the application of HOFG1 to the feed sample. In a feedlot setting, all of the inoculated feed would be distributed and consumed by cattle well within 4 h. If samples were assayed 24 h after field application, the viable estimates were reduced by at least one order of magnitude from applied numbers. The entire assay, from acquisition of the inoculated feed sample to the analyses of PCR products, can be performed within 24 h. 3.5. Conclusion We have shown here that using a combination of enrichment culture and a strain-specific PCR assay can provide relative estimates of the viable numbers of strain Lactobacillus sp. HOFG1 after its application to cattle feed. The assay is sensitive and able to detect numbers as low as 102 cells g1 of feed with a low to no incidence of false positives in negative controls. We have found the assay useful in quality control to ensure proper application and handling of viable bacteria applied to feed. The assay has identified feed processing procedures that adversely affected the viability of the HOFG1 bacterium (data not shown) and can be used in quality assurance tests.

References
Acinas, S.G., Marcelino, L.A., Klepas-Ceraj, V., Polz, M.F., 2004. Divergence and redundancy of 16S rRNA sequences in genomes with multiple rrn operons. J. Bacteriol. 186, 2629 2635. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403 410. Berthier, F., Erlich, S.D., 1998. Rapid species identification within two groups of closely related lactobacilli using PCR primers that target the 16S/23S rRNA spacer region. FEMS Microbiol. Lett. 161, 97 106. Blaiotto, G., Pepe, O., Mauriello, G., Villani, F., Andolfi, R., Moschetti, G., 2002. 16S23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis, and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis. Syst. Appl. Microbiol. 25, 520 527.

J.F. Flint, E.R. Angert / Journal of Microbiological Methods 61 (2005) 235243 Roy, D., Ward, P., Vincent, D., Mondou, F., 2000. Molecular identification of potentially probiotic lactobacilli. Curr. Microbiol. 40, 40 46. Satokari, R.M., Vaughan, E.E., Smidt, H., Saarela, M., Matto, J., de Vos, W.M., 2003. Molecular approaches for the detection and identification of bifidobacteria and lactobacilli in the human gastrointestinal tract. Syst. Appl. Microbiol. 26, 572 584. Shimizu, T., Ohshima, S., Ohtani, K., Hoshino, K., Honjo, K., Hayashi, H., Shimizu, T., 2001. Sequence heterogeneity of the ten rRNA operons in Clostridium perfringens. Syst. Appl. Microbiol. 24, 149 156. Song, Y.-L., Kato, N., Liu, C.-X., Matsumiya, Y., Kato, H., Watanabe, K., 2000. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using groupand species-specific primers derived from the 16S23S rRNA intergenic spacer region and its flanking 23S rRNA. FEMS Microbiol. Lett. 187, 167 173. Sui, J., Leighton, S., Busta, F., Brady, L., 2002. 16S ribosomal DNA analysis of faecal lactobacilli composition of human subjects consuming a probiotic strain Lactobacillus acidophilus NCFM. J. Appl. Microbiol. 93, 907 912.

243

Tannock, G.W., Tilsala-Timisjarvi, A., Rodtong, S., Ng, J., Munro, K., Alatossava, T., 1999. Identification of Lactobacillus isolates from the gastrointestinal tract, silage, and yoghurt by 16S23S rRNA gene intergenic spacer region sequence comparisons. Appl. Environ. Microbiol. 65, 4264 4267. Tilsala-Timisjarvi, A., Alatossava, T., 1997. Development of oligonucleotide primers from 16S23S rRNA intergenic sequences for identifying different dairy and probiotic lactic acid bacteria. Int. J. Food Microbiol. 35, 49 56. Tilsala-Timisjarvi, A., Alatossava, T., 1998. Strain-specific identification of probiotic Lactobacillus rhamnosus with randomly amplified polymorphic DNA-derived PCR primers. Appl. Environ. Microbiol. 64, 4816 4819. Ventura, M., Zink, R., 2002. Specific identification and molecular typing analysis of Lactobacillus johnsonii by using PCR-based methods and pulsed-field gel electrophoresis. FEMS Microbiol. Lett. 217, 141 154. Zhoa, T., Doyle, M.P., Harmon, B.G., Brown, C.A., Mueller, P.O.E., Parks, A.H., 1998. Reduction of carriage of enterohemorrhagic Escherichia coli O157:H7 in cattle by inoculation with probiotic bacteria. J. Clin. Microbiol. 36, 641 647.