Cell Biol. Int.

(2012) 36, 601610 (Printed in Great Britain)

Short Communication

Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines
Najmeh Tehranian*, Houri Sepehri1* Parvin Mehdipour{, Firouzeh Biramijamal1, Arash Hossein-Nezhad",I, Abdolfattah , SarrafnejadI and Ebrahim Hajizadeh**
* Animal Biology Department, School of Biology, University College of Sciences, University of Tehran, PO Box 1415, Tehran, Islamic Republic of Iran
Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, PO Box 1417613151, Tehran, Islamic Republic of Iran National Institute of Genetic Engineering and Biotechnology, PO Box 14965/161, Tehran, Islamic Republic of Iran " Bio and Nanotechnology group, Endocrinology and Metabolism Research Center, Shariati Hospital, Tehran University of Medical Sciences, PO Box 14965/161, Tehran, Islamic Republic of Iran I Department of Pathology, School of Public Health, Tehran University of Medical Sciences, PO Box 1417613151, Tehran, Islamic Republic of Iran **Department of Biostatistics, Faculty of Medical Sciences, Tarbiat Modares University, PO Box 14115-111, Tehran, Islamic Republic of Iran
1 {

Abstract
The effect of PectaSol on Dox (Doxorubicin) cytotoxicity in terms of apoptosis and cell cycle changes in PCa (prostate cancer) cell lines (DU-145 and LNCaP) has been investigated. Combination of PectaSol and Dox resulted in a viability of 29.4 and 32.6% (P,0.001) in DU-145 and LNCaP cells. The IC50 values decreased 1.5-fold and 1.3-fold in the DU-145 and LNCaP cells respectively. In the DU-145 cells, combination of PectaSol and Dox resulted in a reduction in p27 gene and protein expression (P,0.001). In LNCaP cells, this combination increased p53, p27 and Bcl-2 expression. Treatment with both drugs in DU-145 cells led to an increase in sub-G1 arrest (54.6% compared with 12.2% in Dox). In LNCaP cells, combination of the drugs led to an increased in G2/M arrest (61.7% compared with 53.6% in Dox). Based on these findings, progressive cytotoxicity effect of Dox and PectaSol together rapidly induce cell death in DU-145 through apoptosis and in LNCaP cells through cell cycle arrest (G2/M arrest).
Keywords: Doxorubicin (Dox); gene expression; PectaSol; prostate cancer (PCa) cell lines (DU-145; LNCaP); protein expression; viability

1. Introduction
PectaSol MCP (modified citrus pectin), a complex water-soluble indigestible polysaccharide obtained from the peel and pulp of citrus fruits and modified by means of high pH treatment, which was invented by Isaac Eliaz and uses as a dietary supplement has emerged as one of the most promising anti-metastatic drugs (Glinsky and Raz, 2009) that decreases PSA (Pisum sativum agglutinin) in prostatic cancer patients (Guess et al., 2003; Elsadek et al., 2011). PCa (prostate cancer) is the worlds most common malignancy and the second leading cause of death from cancer (Sanches et al., 2009). It is an androgen-dependent tumour, and therefore hormone ablation therapy is often used as a primary treatment option for symptomatic advanced patients, but 20% of patients are refractory to treatment. Furthermore patients who exhibit an initial therapeutic response will relapse within 3 years with androgen-independent carcinoma that is rapidly fatal (Nehme et al., 2001). Cytotoxic chemotherapy is currently used to control and treat PCa. Dox (Doxorubicin) has broad spectrum therapeutic activity against various types of cancers, including PCa. It induces apoptosis in LNCaP (androgen-dependent; Kang et al., 2005) and DU-145 (androgen-independent; Tyagi et al., 2002) cell lines (Wu et al., 2002). Treatment with high doses of Dox causes .40% of LNCaP cells to have fragmented DNA in a dose-dependent
1

manner. Also Dox in low doses activates the G1 checkpoint via a p53 pathway (Collins et al., 2006). Chemotherapy or irradiation primarily act by triggering apoptosis in cancer cells (Opel et al., 2008), and Dox induces apoptosis by a p53-dependent (Wang et al., 2004). The Bcl-2 family plays a critical role in the regulation of apoptosis by functioning as promoters (e.g. Bax) or inhibitors (Bcl-2 or Bcl-xL) of cell death (Mantena et al., 2006). The knockdown of anti-apoptotic genes [Bcl-2, Bcl-xL and XIAP (Xlinked inhibitor of apoptosis)] should enhance chemosensitivity to the Dox (Kim et al., 2009), and therefore the effects of combining Dox and PectaSol on the expression of p53, p21, p27, Bax and Bcl-2 genes were examined. The use of Dox in patients with PCa is limited because concentrations required to kill cancerous cells cannot be attained without systemic toxicity, including severe immunosuppression and cardiomyopathy (Tyagi et al., 2002). There has been intense public and scientific interest in finding other approaches to controlling and treating PCa, resulting in the use of natural substances and/or combination chemotherapy (Tyagi et al., 2002; Rabi et al., 2009). Combination therapy draws on PectaSol MCP with its high anticancer effects and low toxicity to normal tissues, as well as dietary supplements and anticancer drugs (Johnson et al., 2007). The exact mechanism by which MCP produces its effects has not been established, but is probably mediated via the regulation of cell cycle arrest and apoptosis (Glinsky and Raz, 2009). However, the molecular signalling

To whom correspondence should be addressed (email hsepehri@khayam.ut.ac.ir). Abbreviations: Dox, Doxorubicin; MCP, modified citrus pectin; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide; PTEN, phosphatase and tensin homologue deleted on chromosome 10; RT-PCR, real-time PCR. Volume 36 (7) N pages 601610 N doi:10.1042/CBI20110309 N www.cellbiolint.org

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

601

Effect of Doxorubicin and PectaSol on prostate cancer cell lines

involved in combination of Dox and PectaSol-mediated antitumour activity has not been fully explored. Our strategy has been to explore and understand the mechanisms of action of combined Dox and PectaSol treatment. Genetic targeting or pharmacological manipulation of the cyclin-dependent kinase inhibitors, p27 and p21, and its major regulator, p53, which are important regulators of cell cycle progression, and the ratio of Bax/Bcl-2 that is in favour of apoptosis, might provide better strategies. Targeting the expression of p53, p21, p27, Bax and Bcl-2 is shown here to be a useful approach for investigating cell cycle arrest and apoptosis.

2.3. Measurement of expression of p53, p21, p27, Bcl-2 and Bax genes by RT-PCR (real-time PCR) in DU-145 and LNCaP cell lines
To determine gene expression, cDNA was generated. Total RNA was reverse transcribed using Revert Aid First Strand cDNA Synthesis Kit (Fermentas). One microgram of total RNA was reversibly transcribed to cDNA in a reaction condition of 0.2 mg/ml Oligo (dt)18 primer, 4 ml 56 reaction buffer, 20 mg/ml RibolockTM RNase inhibitor, 10 mM dNTP mix, 200 mg/ml MuLV reverse transcriptase in 20 ml and incubated for 5 min at 65uC, 60 min at 42uC and the reaction stopped by incubating for 5 min at 70uC. To confirm cDNA, each cDNA was tested by PCR using Taq DNA Polymerase master Mix Red (Amplicon). PCR was carried out in 20 ml containing 50 ng of the resulting cDNA, 20 pmol/ml of sense and antisense b-actin primer, 10 ml of 26 Master Mix Red (0.5 unit/ml Taq polymerase, 1.5 mM MgCl2, 150 mM Tris/HCl, 40 mM (NH4)2S04, 0.2% Tween 20 and 0.4 mM dNTP). The reactions were subjected to 30 cycles of 94uC for 20 s (denaturation), 65uC for 10 s (annealing) and 72uC for 30 s (extension), followed by 10 min at 72uC (final extension).

2. Materials and methods

2.1. Cell lines and reagents
Human PCa DU-145 and LNCaP cells obtained from [NCBI (National Cell Bank of I.R. Iran] were grown in RPMI 1640 medium supplemented with 10% heat inactivated FBS (fetal bovine serum), L-glutamine 1%, penicillin 100 units/ml streptomycin 100 mg/ml, and antibiotics at 37uC in a 5% CO2 in air atmosphere at 9095% humidity. A 10 mg stock solution of PectaSol was obtained from EcoNugenics, Inc. (Santa Rosa, CA), whereas Dox was obtained from (EBEWE Pharma Gmbh Nfg). Antibodies to P53 and P27 were purchased from Santa Cruz Biotechnology. The stock solutions were brought to their final concentrations by dilution in medium immediately before use.

2.4. Real-time PCR

To quantify p53, p21, p27, Bcl-2, Bax and b-actin genes by quantitative RT-PCR, approximately 50 ng of their cDNAs was treated with 26 MaximaTM SYBR Green/ROX qPCR (quantitative PCR) Master Mix (Fermentas) and 10 mM of each primer in 20 ml. These reactions were performed on a Step-One-PlusTM real-time (ABI Applied Biosystems). All assay efficiencies were monitored using a standard curve. The resulting CTs (computed tomographies) were normalized to the b-actin housekeeping gene. All samples were analysed independently at least 3 times for each gene. Primers sequences for the reactions are given in Table 1.

2.2. Measurement of cell growth inhibition by MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2Htetrazolium bromide] assay

DU-145 and LNCaP cells were seeded at 16105 cells per well in 96-well microtitre culture plates. The cells were maintained in the exponential growth phase after an overnight incubation by removing the medium with a pipette and replacing it with a fresh medium containing different concentrations of PectaSol (0.5, 1, 3 and 5 mg/ml), Dox (10.25, 50, 100, 250 and 500 nM) or a combination of both. The cells were cultured for 24, 48 and 72 h. At each point, cell viability was determined by measuring MTT absorbance dye; SigmaAldrich) at 570 nm by a multi-well spectrophotometer. The required concentration necessary to produce 50% cell growth inhibition (IC50) was determined by interpolation from dose-response curves. The control wells were untreated cells that only received fresh medium.
Table 1 Primer sequences mRNA target Bcl2 Bax p53 P21 P27 bactin Forward (5) primers 59GCCTTCTTTGAGTTCGG39 59GCATCGGGGACGAACTGG39 59GGCCCACTTCACCGTACTAA39 59GACACCACTGGAGGGTGACT39 59TCTACTGCGTGGCTTGTCAG39 59GCAAGCAGGAGTATGACGAG39

2.5. Measurement of p53 and p27 protein expression

The cell lines were cultured at 16105 cells in 96-well plates. The DU-145 and LNCaP cells were treated after overnight culture with IC50 concentrations of Dox, 250 and 290 nM, and PectaSol 3 at 4 mg/ml alone or together for 48 h. At each time-point, the cells were incubated for 2 h at 4uC with primary antibody against p53 and p27 in a 1:200 dilution (Dako and Santa Cruz Biotechnology). The cells were thereafter washed once in PBS and incubated with secondary FITC-linked antibody for 45 min at room temperature in

Reverse (3) primers 59GGGTGATGCAAGCTCC39 59GTCCCAAAGTAGGAGAGGA39 59GTGGTTTCAAGGCCAGATGT39 59CAGGTCCACATGGTCTTCCT39 59C1TGTATTTGGAGGCAGAGCA39 59CAAATAAAGCCATGCCAATC39

Amplicon size (bp) 286 306 156 172 240 144

602 www.cellbiolint.org N Volume 36 (7) N pages 601610

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

Cell Biol. Int. (2012) 36, 601610

Table 2

Effects of Dox and PectaSol on the viability of the DU145 and LNCaP cell lines after 48 h treatment Cell lines DU145 Therapeutic agents Dox PectaSol LNCaP Dox PectaSol Dose 10 nM 500 nM 0.5 mg/ml 5 mg/ml 10 nM 500 nM 1 mg/ml 10 mg/ml % Viability 76.25 23.67 77.25 24.67 85.42 32.53 78.25 34.92 IC50 250 nM 3 mg/ml 290 nM 4 mg/ml P value 0.001 0.001 0.001 0.001 0.001 0.001 0.003

the dark. Finally, the cells were washed with PBS and fixed in paraformaldehyde. Fluorescence was measured by FACScan equipment (Becton Dickinson). p53 and p27 were detected by flow cytometry using the Flow Max programme.

2.6. Cell cycle analysis

DU-145 and LNCaP cells were treated with PectaSol and Dox either alone or in combination for 48 h. After treatment the cells were trypsinized and treated with blocking solution (PBS ethanol: 70%) and incubated at 4uC for 2 h in the dark. The cells were incubated in PI Master Mix (40 ml/ml PI, 950 ml/ml PBS and 10 ml/ml RNase) at 37uC for 0.5 h in dark. Cell cycle distribution was analysed by flow cytometry analysis of the Flow Max program.

2.7. Statistical analysis

Statistical evaluation of the data was performed using the parametric test of one-way ANOVA. P,0.05 was considered statistically significant. All the experiments were repeated at least three times, and the results are presented as meansS.D. with SPSS 13 software.

Table 2). Similar effects were obtained with Dox (10500 nM), ranging from 76.2523.67% (P,0.001) after 48 h (optimum condition; Table 2). IC50 values were calculated from the cell proliferation plots. Cytotoxicity increased in a time- and dose-dependent manner for each agent. Greater cytotoxicity was observed at 48 h for each agent, and the IC50 values of PectaSol and Dox in the DU-145 cell lines were 3 mg/ml and 250 nM respectively (Table 2). The cell growth suppressing effects of the PectaSol and Dox combination in DU-145 cells by increasing concentrations of both drugs at 48 h. In the first combination experiment, 100 and 250 nM of Dox (for 48 h) were added in combination with 3 mg/ml (added for the last 24 h), and treatment with combination of 250 nM of Dox with 3 mg/ml resulted in a 29.4% viability of the DU-145 cells by comparison with Dox alone 47.0% (Table 3 and Figure 1). IC50 values decreased 1.5-fold in the DU-145 cells (Table 3). In the second combination, 250 nM Dox and 3 mg/ml PectaSol (IC50 dose) used together (for 48 h), the viability was 28.6% (P,0.001; Table 3).

3.2. Effects of PectaSol and Dox alone or in combination on LNCaP cell-growth inhibition
The treatment of the LNCaP cells with PectaSol (110 mg/ml) resulted in a significant reduction in proliferation/viability of LNCaP cells ranging from 78.25 to 34.92% (P,0.001) after 48 h (optimum condition) treatment. Treatment of the LNCaP cells with Dox (10500 nM) showed decrease viability ranging from 85.42 to 32.53% (P,0.001) after 48 h (optimum condition; Table 2). The respective IC50 values of PectaSol and Dox in LNCaP cells were 4 mg/ml and 290 nM (Table 2).

3. Results
3.1. Effects of PectaSol and Dox alone or in combination on DU-145 cell-growth inhibition
Treatment of DU-145 cells with PectaSol (0.55 mg/ml) resulted in a significant reduction in proliferation and viability, ranging from 77.25 to 24.67% (P,0.001) after 48 h (optimum condition;
Table 3

Effects of combination of Doxorubicin and PectaSol on viability of DU145 and LNCaP cell lines after 48 h treatment Dox+Pectasol treatment with Dox for first 24 h before adding PectaSol for second 24 h. Dox/Pectasolsimultaneous treatment with Dox and PectaSol together. Cell lines DU145 Therapeutic agents Dox PectaSol Dox+PectaSol Dox/PectaSol Dox PectaSol Dox+PectaSol Dox/PectaSol 100 250 3 100 250 250 100 290 4 100 290 290 Dose nM nM mg/ml nM+3 mg/ml nM+3 mg/ml nM/3 mg/ml nM nM mg/ml nM+4 mg/ml nM+4 mg/ml nM/4 mg/ml % Viability 55.02 47.04 49.08 47.24 29.36 28.6 62 52.25 53.21 52.50 32.50 31.6 % IC50 decrease P value 0.001 0.001 0.001 1.5 fold

LNCaP

0.001 0.001 0.001 1.3 fold

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

Volume 36 (7) N pages 601610 N www.cellbiolint.org

603

Effect of Doxorubicin and PectaSol on prostate cancer cell lines

Dox alone (P,0.001; Figure 3 and Table 4). This shows that a combined treatment compared with Dox alone down-regulated p27 expression. This combination had no effect on p21 expression (Figure 3).

3.4. Effects of PectaSol and Dox on Bcl-2 and Bax and Bax/Bcl-2 gene expressions in DU-145 cells
The proteins of the Bcl-2 family play critical roles in the regulation of apoptosis by functioning as promoters (e.g. Bax) or inhibitors (Bcl-2 or Bcl-xL) of cell death process (Mantena et al., 2006). As the levels of combination of Dox and PectaSol decreased the viability of DU-145 cells compared with either agent alone, the mechanisms underlying Dox/PectaSol decrease in viability is probably through apoptosis. RT-PCR was used to detect Bcl-2 and Bax after Dox and PectaSol in combination. This had no effect on the ratio of Bax/Bcl-2 compared with Dox alone, which indicates that decreased viability probably relates to other pathways of cell death (Figure 3, Table 4).

MTT analysis for DU-145 cell line after 48 h treatment with PectaSol, Dox or a combination of both drugs Determination of viability measured by MTT in DU-145 cell line after in vitro treatment with PectaSol or Dox either alone or in combination. *P,0.05 compared with control, "P,0.05 compared with 250 nM Dox+3 mg/ml PectaSol. IC50 of Dox is 250 nM and that of PectaSol is 3 mg/ml in the DU-145 cell line.

Figure 1

In the first combination experiment, 100 and 290 nM of Dox for 48 h in combination with 4 mg/ml PectaSol (added for the last 24 h) was done, and treatment with combination of 290 nM of Dox with 4 mg/ml resulted in 32.6% viability of the LNCaP cells by comparison with Dox alone, 52.5%, (Table 3 and Figure 2). The IC50 values decreased 1.3-fold in the LNCaP cells (Table 3). In the second combination, 290 nM Dox and 4 mg/ml PectaSol treatment of LNCaP cells were added for 48 h. Viability was 31.6% (P,0.001; Table 3).

3.5. Effects of PectaSol and Dox on p53, p27, p21 gene expression in LNCaP cells
A 290 nM/4 mg/ml combination of Dox and PectaSol significantly increased the expression level of wild-type p53 in LNCaP cells (P,0.05; Figure 4 and Table 4). An increase in p27 was found in cells given a combination of both agents compared with PectaSol and Dox alone (P,0.001). In these androgen-dependent PCa cells, a combination of Dox and PectaSol had significant effect on the level of p27 expression compared with either agent alone or untreated controls (Figure 4 and Table 4).

3.3. Effects of PectaSol and Dox on p53, p27 and p21 gene expressions in DU-145 cells
In these experiments, the DU-145 cells were exposed to 250 nM Dox (IC50) in the absence and presence of 3 mg/ml PectaSol for 48 h (IC50). RT-PCR showed that in the DU-145 cells, PectaSol and Dox had no effect on the expression level of mutant p53 (Figure 3, Table 4). RT-PCR demonstrated a significant decrease in the level of p27 in the DU-145 cells exposed to both agents compared with

3.6. Effects of PectaSol and Dox on Bcl-2, Bax and Bax/Bcl-2 gene expression in LNCaP cells
RT-PCR used to detect Bcl-2 and Bax in the cells treated with Dox or PectaSol or in combination showed that of the two together Dox and PectaSol had no effect on the ratio of Bax/Bcl-2 in comparison with Dox alone, which may indicate a decrease in viability due to other pathways of cell death (Figure 4 and Table 4).

3.7. Effects of PectaSol and Dox alone or in combination on p53 and p27 protein expression in DU-145 and LNCaP cell lines
p53 and p27 expression in DU-145 and LNCaP were assessed in cells exposed to 250 and 290 nM Dox (IC50 dose) in the absence and presence of 3 and 4 mg/ml PectaSol for 48 h (IC50 dose). PectaSol and Dox had no effect on the expression level of p53 protein (P,0.05; data not shown) (Figure 5). In contrast with the above-mentioned lack of effects on Dox and MCP (PectaSol), possible augmented effects of their combination on the DU-145 and LNCaP cells were thereafter examined with regard to p27 expression in response to either agent or in combination. Flow cytometry clearly demonstrated a significant decrease in the level of p27 in the DU-145 cells exposed to a combination of both agents as compared with

MTT analysis for LNCaP cell line after 48 h treatment with PectaSol, Dox or a combination of both drugs Determination of viability evaluated by MTT in LNCaP cell line after in vitro treatment with PectaSol or Dox either alone or in combination. *P,0.05 compared with untreated cells (control). IC50 value of Dox is 290 nM and that of PectaSol 4 mg/ml in the LNCaP cell line.

Figure 2

604 www.cellbiolint.org N Volume 36 (7) N pages 601610

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

Cell Biol. Int. (2012) 36, 601610

Figure 3

Effect of PectaSol and Dox on gene expression of DU-145 cell line after 48 h Determination of gene (p21, p27, p53, Bax and Bcl-2) expression in DU-145 cells after in vitro treatment with PectaSol or Dox alone or in combination. *P,0.05 compared with control, P,0.05 compared with PectaSol, +P,0.05 compared with Dox, #P,0.05 compared with PectaSol/Dox.

Dox alone (P,0.001) and an increase in the level of p27 in the DU-145 cells exposed to a combination of both agents compared with PectaSol alone (P50.002) (Figure 6). These results showed that a combination of Dox and PectaSol, in comparison with Dox alone, down-regulates P27 expression probably through the inhibition of Gal-3 anti-anoikis effect. In androgen-dependent PCa (LNCaP), a combination of Dox and PectaSol had no significant effect on the levels of P27 expression when compared with any other agent alone or untreated control (data not shown).

3.8. Effects of PectaSol and Dox alone or in combination on cell cycle progression on the DU-145 cell line
PectaSol treatment showed sub-G1 arrest (47.0% compared with 17.3% in control; Figure 7A), whereas Dox caused G2/M arrest (20.5% compared with 8.7% in the control; Figure 7D) after 48 h of treatment. Interestingly, PectaSol treatment after Dox-induced sub-G1 arrest (45.3%) compared to that caused by Dox alone (12.2%; Figure 7A). Similarly, treatment of PectaSol-treated cells

Table 4

Means of p53, p21, p27, Bcl2 and Bax gene expression in DU145 and LNCaP cell lines after 48 h treatment DU145 cell line Dose Control Gene P53 P21 P27 Bcl2 Bax Bax/Bcl2 15161026 12961026 10961026 15961026 17161026 10861026 250 nM Dox 15461026 15961026 20661026 20861026 22561026 10861026 3 mg/ml PectaSol 16261026 12461026 12161026 18861026 18861026 11361026 250 nM+ 3 mg/ml 14361026 14061026 15161026 16161026 19461026 12961026 Control 23061026 18261026 23261026 20561026 21661026 11261026 290 nM* Dox 15961026 14361026 16761026 15261026 16661026 10961026 4 mg/ml{ PectaSol 18861026 16361026 16861026 16461026 20961026 12661026 290 nM+ 4 mg/ml 23861026 15961026 25561026 23161026 21461026 9261026 LNCaP cell line

Genes which involved in cell cycle Genes which involved in apoptosis

* IC50 value of Doxorubicin is different between two cell line. { IC50 value of PectaSol is different between two cell line.

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

Volume 36 (7) N pages 601610 N www.cellbiolint.org

605

Effect of Doxorubicin and PectaSol on prostate cancer cell lines

Figure 4

Effect of PectaSol and Dox on gene expression in the LNCaP cell line after 48 h Determination of gene (p21, p27, p53, Bax and Bcl-2) expression in LNCaP cells after in vitro treatment with either drug alone or in combination. *P,0.05 compared with control, #P,0.05 compared with PectaSol/Dox.

with Dox led to a further increase in sub-G1 arrest (54.6%) compared to that caused by Dox alone (12.2%; Figure 7A). In contrast, when cells were simultaneously treated with both agents for 48 h, a much stronger G1 arrest (35.5%) was evident at the expense of both the sub-G1 and G2/M populations (Figure 7B). These results suggest that a combination of PectaSol and Dox causes a very strong sub-G1 arrest compared with these agents alone, and that DU-145 cell growth inhibition in the combination could be, in part, attributable to a stronger arrest in cell cycle progression at the sub-G1.

further increase in S arrest (24.1%) due to Dox alone (6.4%; Figure 8C).

4. Discussion
PectaSol synergizes with Dox in the treatment of prostate carcinoma DU-145 and LNCaP cells by decreasing the viability and proliferation of cells. Combination of PectaSol and Dox led to a concentrationdependent decrease of 1.3- and 1.5-fold in the IC50 value of in LNCaP and DU-145 cells respectively. Dox side-effects, such as immunosuppression and cardiomyopathy, which severely increases in a dose-dependent manner, as well as development of primary or secondary drug resistance in tumour cells, limit their clinical success in cancer chemotherapy. In this regard, combination chemotherapy has received more attention for the purpose of finding compounds with a known mechanism of action that could increase the therapeutic index and decrease effective dose of clinical anticancer drugs (Tyagi et al., 2002). Other studies show that PectaSol MCP can affect the rate-limiting steps in cancer metastasis, has anti-adhesion properties and also increases apoptosis of tumour cells by sensitizing them to this drug (Glinsky and Raz, 2009) and reducing Dox IC50 by 10.7-fold in human ASA (angiosarcoma) and HAS (hemangiosarcoma) respectively (Johnson et al., 2007).

3.9. Effects of PectaSol and Dox alone or in combination on cell cycle progression in LNCaP cells
PectaSol treatment produced sub-G1 arrest (21.7% compared with 6.4% in control), whereas Dox caused G2/M arrest (53.6% compared with 38.2% in control) after 48 h of treatment. Treatment of PectaSol-treated cells with Dox led to a further increase in sub-G1 arrest (16.3%) to that caused by Dox alone (5.1%; Figure 8A). However, treatment of Dox-treated cells with PectaSol led to a stronger G1 and S arrest (18.2% compared with 8.3% in Dox alone: Figure 8B: 1.7% compared with 6.4% in Dox alone; Figure 8C respectively) was evident. When cells were simultaneously treated with both agents for 48 h, this led to a

606 www.cellbiolint.org N Volume 36 (7) N pages 601610

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

Cell Biol. Int. (2012) 36, 601610

Figure 5

Effect of PectaSol and Dox on p53 protein expression in DU-145 and LNCaP cell lines Determination of protein p53 expression in DU-145 and LNCaP cell lines after in vitro treatment with PectaSol or Dox either alone or in combination. P,0.05 compared with PectaSol.

To characterize the combined effects of PectaSol and Dox on apoptosis and cell cycle progression, the cyclin-dependent kinase inhibitors p27, p21, Bcl-2 and Bax genes and the major regulator, p53, which are important regulators of apoptosis and cell cycle progression genes were measured.

have shown in p53-negative cells that Dox was more cytotoxic (faster and intensity).

4.2. DU-145
Not only were the observations similar to LNCaP, but also expression of p53 was decreased, which probably is due to other pathways than p53 being involved, such as MAPK (mitogen-activated protein kinase) and PTEN (phosphatase and tensin homologue deleted on chromosome 10)/Akt (also known as protein kinase B) signalling pathways of central importance for a particular tumour cell line to readily undergo apoptosis or not, namely Ras. The results of the profiling of DU-145 and PC-3 support the notion that an intact PTENAkt pathway (as found in DU-145 and 22RV1 cells) and the presence of active p38 are responsible for the high sensitivity to apoptosis; and that neither the androgen receptor nor the p53 status is of primary importance for the differences observed with respect to apoptosis induction (Iben et al., 2006). Manna et al. (2010) reported that the basal expression of Fas was greater in p53negative cells compared with p53-positive cells and overexpression of Ras decreased the amount of Fas in p53-negative cells. In another study, it was reported that UNG (Uracil DNA glycosylase) inhibition in DU-145 cells resulted in elevated p21, although mutant p53 and Bax levels remained unchanged (Pulukuri et al., 2009). Another point is that in DU-145, unlike LNCaP, the expression of Bcl-2 was decreased and Bax increased, which is an

4.1. LNCaP
In LNCaP cells, PectaSol plus Dox therapy increased p53, p27 and Bcl-2 gene expression levels. Yan and Katz (2010) found Bim (BH3-only), a pro-apoptotic gene downstream similar to Bax (Multidomain) a pro-apoptotic gene in our study decreased. Therefore, it seems the increase in gene expression of p53 and consequently increase in gene expression levels of genes related to p53 involved in apoptosis was not equivalent to an increase in the cytotoxic effect of Dox and does not justify the overlap with the MTT results. However, this activates the apoptosis pathways related to p53. The expression of other genes involved in apoptosis clearly need to be investigated. Genes other than p53 increasing the cytotoxic effect of Dox in combination with PectaSol, such as FasL by enhancing AP-1 (activator protein 1) DNA binding, increase cell death compared with overexpression of Ras that decreased the amount of Fas, thereby decreasing Dox-mediated aggressive cell death (Wang et al., 2004). Increased cytotoxicity caused by Dox combination therapy might not be mediated by inhibition of Bcl-2 expression and probably other pathways including p53 are involved. Since other pathways than p53 can be involved, Manna et al. (2010)

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

Volume 36 (7) N pages 601610 N www.cellbiolint.org

607

Effect of Doxorubicin and PectaSol on prostate cancer cell lines

Figure 6

Effect of PectaSol and Dox p27 protein expression in DU-145 and LNCaP cell lines Determination of protein p27 expression in DU-145 and LNCaP cell lines after in vitro treatment with PectaSol or Dox either alone or in combination. *P,0.05 compared with untreated cells (control), P,0.05 compared with PectaSol, #P,0.05 compared with PectaSol/Dox.

indicator of more pronounced effects of these two therapies on the Bcl-2 and Bax pathways compared with LNCaP cells. However, since the cytotoxic effects of combination therapy is greater, it is probable that other pathways are also involved in apoptosis. Servida et al. (2011) showed that mimicking Smac can induce apoptosis in tumour cells. Evaluation of other genes in future studies is required. Our findings suggest that the effects of combination of Dox and PectaSol on p53 and p27 proteins and their genes in DU-145 cells are similar. The effect of Dox on the expression of p27 and p53 proteins differ between cell types, so in MCF-7 cells, it decreased p27 protein expression, whereas it up-regulated p53 and p21 levels. In contrast, in MDA-MB-231 cells, p27 levels were unaffected by Dox treatment (Bar-On et al., 2007). Our results showed that the combination of both drugs had no effect on expression of p53, but resulted in a reduction in p27. Mutational inactivation of p53 is frequently observed in various human cancers (Wang et al., 2004). Other studies reported that Dox triggers different pathways involved in cell death, such as the activation of serine proteases, which occurs in parallel and upstream of caspase activation (Grassilli et al., 2004). In DU-145 and LNCaP cells, Dox causes G2/M arrest, whereas PectaSol treatment showed sub-G1 arrest. PectaSol seems to strongly synergize in its therapeutic effect with Dox in advanced human PCa DU-145 cells by inducing more apoptosis (sub-G1 arrest) and in LNCaP cells via G2/M arrest. Dox causes G2/M arrest in DU-145 cells (Tyagi et al., 2002) and another study showed that Dox induced G2/M arrest in MDA-MB-231

cells, but both G1/S and G2/M arrest in MCF-7 cells (Bar-On et al., 2007). Pectin is capable of inducing apoptosis in androgen-responsive (LNCaP) and androgen-independent (LNCaP C4-2) human PCa cells (Jackson et al., 2007). MCP also can increase the apoptotic response of tumour cells to chemotherapy (Yan and Katz, 2010). Our findings show that the combination effects of PectaSol and Dox in DU-145 cells on cycle progression is not related to p53 and p27 genes and their protein expression; however, it is associated with p53 and p27 gene expression in LNCaP cells. p53 and p27 are important regulators of cell cycle progression, but several other factors can induce arrest independent of p53 (Manna et al., 2010). Therefore, PectaSol synergy in combination with Dox chemotherapy and its related effects on cyclindependent kinase inhibitor function leads to the suggestion that modulation of checkpoint regulators may contribute to the latters cytotoxicity (Bar-On et al., 2007).

5. Conclusion
PectaSol effectively enhances the effects of Dox and may be useful anticancer agent for PCa, as shown in the cell lines, LNCaP and DU-145. In LNCaP cells, the combination of PectaSol and Dox can inhibit growth and cause apoptosis partially through the activation

608 www.cellbiolint.org N Volume 36 (7) N pages 601610

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

Cell Biol. Int. (2012) 36, 601610

Figure 8

Figure 7

Effect of PectaSol and Dox alone and in combination on cell cycle progression of DU-145 cell line Cells were treated with either media alone, 250 nM Dox, 3 mg/ml PectaSol (pect), 250 nM Dox and 24 h later with 3 mg/ml Pectasol, 3 mg/ml Pect and 250 nM Dox24 h later; or a combination of both 250 nM Dox and 3 mg/ml Pect for 48 h. At the end of treatments, cells were harvested and stained with PI for flow cytometry. The percentage of cells in sub-G1 (A), G1 (B), S (C), or G2/M (D) phases represent means of three independent samples at each treatment, which were reproducible in three independent experiments.

Effects of PectaSol and Dox alone and in combination on cell cycle progression in the LNCaP cell line Cells were treated with either media alone (control), 290 nM Dox, 4 mg/ml Pectasol, 290 nM Dox and 4 mg/ml Pectasol 24 h later, 4 mg/ml Pect and 290 nM Dox 24 h later, or a combination of both for 48 h. At the end of treatments, cells were harvested and stained with PI for flow cytometry. The data shown for the percentage of cells in sub-G1 (A), G1 (B), S (C), or G2/M (D) phases are means of three independent samples in each treatment, which were reproducible in three independent experiments.

of p53 signal pathway and p27 expression, as well as G2/M arrest in cell cycle progression. However, this combination had no effect on expression of p53 and p27 in DU-145, in which other pathways than p53 may be involved in induction of apoptosis (sub-G1

arrest). The findings demonstrated that PectaSol can synergistically enhance Dox toxicity in vitro independent of androgen dependency. The data can support the role of this dietary carbohydrate compound as a chemotherapeutic supplement that could be given at relatively low doses of Dox, indicating that it is worthwhile undertaking further clinical and basic science investigations.

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

Volume 36 (7) N pages 601610 N www.cellbiolint.org

609

Effect of Doxorubicin and PectaSol on prostate cancer cell lines

Author contribution
Najmeh Tehranian is the main author. Houri Sepehri and Parvin Mehdipour are the first and second supervisors. Firouzeh Biramijamal and Arash Hossein-Nezad are the first and second advisors. All other authors are collaborators.

Acknowledgments
We acknowledge the contribution of Ladan Delph, Ziba Maghboli, Maryam Mobiny and Hossain Asgarian for their assistance.

Funding
This study was supported by a research grant from the Science Faculty of Tehran University.

References
Bar-On O, Shapira M, Hershko DD. Differential effect of doxorubicin treatment on cell cycle arrest and SKP2 expression in breast Cancer cells. Anticancer Drugs 2007;18:111321. Collins L, Zhu T, Guo J, Xiao ZJ, Chen C-Y. Phellinus Linteus sensitises apoptosis induced by doxorubicin in prostate cancer. Br J Cancer 2006;95:2828. Elsadek B, Graeser R, Esser N, Schafer-Obodozie C, Tsurumi C, Abu Ajaj K. In vivo evaluation of a novel albumin-binding prodrug of doxorubicin in an orthotopic mouse model of prostate cancer (LNCaP). Prostate Cancer Prostatic Dis 2011;14:1421. Glinsky VV, Raz A. Modified citrus pectin anti-metastatic properties: one bullet, multiple targets. Carbohydr Res 2009;344:178891. Grassilli E, Ballabeni A, Maellaro E, Del Bello B. Loss of MYC confers resistance to Doxorubicin-induced apoptosis by preventing the activation of multiple serine protease- and caspase-mediated pathways. J Biol Chem 2004;279:2131826. Guess BW, Scholz MC, Strum SB, Lam RY, Johnson HJ. Modified citrus pectin (MCP) increases the prostate-specific antigen doubling time in men with prostate cancer: a phase II pilot study. Prostate Cancer Prostatic Dis 2003;6:3014. Jackson CL, Dreaden TM, Theobald LK, Tran NM, Beal TL, Eid M. Pectin induces apoptosis in human prostatic cancer cells: correlation of apoptotic function with pectin structure. Glycobiology 2007;17:80519. Johnson KD, Glinskii OV, Mossin VV, Turk JR. Galactin-3 as a potential therapeutic target in tumors arising from malignant. Neoplasia 2007;9:66270.

Kang J, Bu J, Hao Y, Chen F. Subtoxic concentration of doxorubicin enhances TRAIL-induced apoptosis in human prostate cancer cell line LNCaP. Prostate Cancer Prostatic Dis 2005;8:2749. Kim DW, Kim KO, Shin MJ, Ha JH. siRNA-based targeting of antiapoptotic genes can reverse chemoresistance in Pglycoprotein expressing chondrosarcoma cells. Mol. Cancer 2009:8:28. Manna SK, Gangadharan C, Edupalli D. Ras puts brake doxorubicin mediated cell death in p53 expressing cells. J. Biol. Chem. 2010;286:733947. Mantena SK, Sharma SD, Katiyar SK. Berberine, a natural product, induces G1-phase cell cycle arrest and caspase-3-dependent apoptosis in human prostate carcinoma cells. Mol Cancer Ther 2006;5:296308. Neheme A, Varadarajan P, Sellakumar G, Gerhold M, Niedner H, Zhang Q et al. Modulation of docetaxel induced apoptosis and cell cycle arrest by all-trans retinoic acid in prostate cancer cells. Br J Cancer 2001;84:15711576. Opel D, Westhoff M, Bender A, Braun V, Debatin K, Fulda V. Phosphatidylinositol 3-kinase inhibition broadly sensitizes glioblastoma cells to death receptor and drug induced apoptosis. Am Assoc Cancer Res 2008;68:627180. Pulukuri S, Knost J, Estes N, Rao JS. Small interfering RNA (siRNA)directed knockdown of uracil DNA glycosylase induces apoptosis and sensitizes human prostate cancer cells to genotoxic stres. Mol Cancer Res 2009;7:128593. Rabi T, Bishayee A. d-Limonene sensitizes docetaxel-induced cytotoxicity in human prostate cancer cells: generation of reactive oxygen species and induction of apoptosis. J. Carcinog. 2009:89. Sanches C, Mendoza P, Contreras HR, Vergara J. Expression of resistance proteins in prostate cancer is related with cell sensitivity to chemotherapeutic drugs. Prostate 2009;69:144859. Servida F, Lecis D, Scavullo C. Novel second mitochondria-derived activator of caspases (Smac) mimetic compounds sensitize human leukemic cell lines to conventional chemotherapeutic drug-induced and death receptor-mediated apoptosis. Invest New Drugs 2011;29:126475. Tyagi AK, Singh RP, Agrawal C, Chan DCF, Agrawal R. Silibinin strongly synergizes human prostate carcinoma DU-145 cells to doxorubicin-induced growth inhibition, G2-M Arrest, and apoptosis. Clin Cancer Res 2002;8:35129. Wu XX, Kakehi Y, Mizutani Y, Kamoto T, Kinoshita H, Isogawa Y. Doxorubicin enhances TRAIL-induced apoptosis in prostate cancer. Int J Oncol 2002;20:94954. Wang S, Konorev EA, Kotamraju S, Joseph J, Kalivendi S, Kalyanaraman B. Doxorubicin induces apoptosis in normal and tumor cells via distinctly different mechanisms. J Biol Chem 2004;279:2553543. Yan J, Katz A. PectaSol-C modified citrus pectin induces apoptosis and inhibition of proliferation in human and mouse androgen-dependent and -independent prostate cancer cells. Integr Cancer Ther 2010;9:197203.

Received 25 May 2011/ 19 September 2011; accepted 4 January 2012 Published as Immediate Publication 4 January 2012, doi 10.1042/CBI20110309

610 www.cellbiolint.org N Volume 36 (7) N pages 601610

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology