Develop and Demonstrate Fundamental Basis For Selectors To Improve Activated Sludge Settleability

Wastewater Treatment and Reuse
Develop and Demonstrate Fundamental Basis for Selectors to Improve Activated Sludge Settleability Phase II Lab Investigation
Co-published by
01CTS4a
DEVELOP AND DEMONSTRATE FUNDAMENTAL BASIS FOR SELECTORS TO IMPROVE ACTIVATED SLUDGE SETTLEABILITY
PHASE II LAB INVESTIGATION
by: H. David Stensel Gang Xin University of Washington
2008
The Water Environment Research Foundation, a not-for-profit organization, funds and manages water quality research for its subscribers through a diverse public-private partnership between municipal utilities, corporations, academia, industry, and the federal government. WERF subscribers include municipal and regional water and wastewater utilities, industrial corporations, environmental engineering firms, and others that share a commitment to cost-effective water quality solutions. WERF is dedicated to advancing science and technology addressing water quality issues as they impact water resources, the atmosphere, the lands, and quality of life. For more information, contact: Water Environment Research Foundation 635 Slaters Lane, Suite 300 Alexandria, VA 22314-1177 Tel: (703) 684-2470 Fax: (703) 299-0742 www.werf.org werf@werf.org This report was co-published by the following organizations. For non-subscriber sales information, contact: IWA Publishing Alliance House, 12 Caxton Street London SW1H 0QS, United Kingdom Tel: +44 (0) 20 7654 5500 Fax: +44 (0) 20 7654 5555 www.iwapublishing.com publications@iwap.co.uk Copyright 2008 by the Water Environment Research Foundation. All rights reserved. Permission to copy must be obtained from the Water Environment Research Foundation. Library of Congress Catalog Card Number: 2007935011 Printed in the United States of America IWAP ISBN: 1-84339-793-5 This report was prepared by the organization(s) named below as an account of work sponsored by the Water Environment Research Foundation (WERF). Neither WERF, members of WERF, the organization(s) named below, nor any person acting on their behalf: (a) makes any warranty, express or implied, with respect to the use of any information, apparatus, method, or process disclosed in this report or that such use may not infringe on privately owned rights; or (b) assumes any liabilities with respect to the use of, or for damages resulting from the use of, any information, apparatus, method, or process disclosed in this report. University of Washington This document was reviewed by a panel of independent experts selected by WERF. Mention of trade names or commercial products does not constitute WERF endorsement or recommendations for use. Similarly, omission of products or trade names indicates nothing concerning WERF's positions regarding product effectiveness or applicability.
ii
ACKNOWLEDGMENTS
Funds from the University of Washington Nielsen Professorship for support of this work are also appreciated.
Report Preparation
Principal Investigator: H. David Stensel, Ph.D., P.E., BCEE University of Washington Project Team: Donald Gray, Ph.D., P.E., BCEE Vince De Lange, P.E. East Bay Municipal Utility District Gang Xin University of Washington
Project Subcommitee
Glen T. Daigger, Ph.D., P.E., DEE, Chair CH2M HILL Orris E. Albertson, Ph.D.
Enviro Enterprises Inc. M. Truett Garrett, Jr., Sc.D., P.E.

PBS&J Tung Nguyen Sydney Water Corporation
Water Environment Research Foundation Staff:

Director of Research: Program Director: Daniel M. Woltering, Ph.D. Amit Pramanik, Ph.D., BCEEM
Develop and Demonstrate Fundamental Basis for Selectors to Improve Activated Sludge Settleability
iii
ABSTRACT AND BENEFITS

Abstract: This study compared sludge settling characteristics, filamentous microorganism populations, and microbial community fingerprinting in three different anoxic selector configurations: single-stage, 4-stage, and an anoxic-aerobic sequencing batch reactor (SBR) fed with both rbCOD (acetate) and sbCOD (dextrin). The total volume of the anoxic single-stage and 4-stage selectors were equal and the systems were operated at nominal SRTs of 5 days at 200C. The rbCOD was removed in all selectors with faster removal rates in the staged and SBR anoxic zones. Nostocoida limicola II, and Type 1851 filamentous bacteria were observed in all systems and were due to sbCOD degradation. The diluted sludge volume index (DSVI) values decreased with increased selector staging: S1 to S4 to SBR. A greater amount of dextrin removal in the staged- versus single-stage selector resulted in improved DSVI control for the continuous-flow systems. For the SBR system the improved DSVI was related to both the plug flow kinetics in the anoxic selector operating phase and the plug flow kinetics in the aerobic phase. These results suggest that staged anoxic and aerobic zones can provide better sludge settleability control for activated sludge systems fed sbCOD that can be used by filamentous organisms.
Benefits: Demonstrates that less volume is needed to remove rbCOD in staged versus single-stage anoxic selectors. Demonstrates that a greater amount of sbCOD is removed in staged anoxic selectors with the same volume as a single stage selector. Demonstrates that staged anoxic selectors and SBRs with anoxic selectors zones can result in improved DSVIs over single-staged selectors when treating rbCOD and sbCOD. Demonstrates that SVI control may depend on sbCOD as well as rbCOD Indicates the advantage a properly designed sequencing batch reactor can have for SVI control Shows the potential for using a new molecular method, an automated ribosomal intergenic spacer analysis (ARISA), for characterizing activated sludge system microbial populations Keywords: Anoxic selector, staged selector, dilute sludge volume index, filamentous bacteria, Nostocoida limicola II, Type 1851, anaerobic selector, sequencing batch reactor, acetate, dextrin, ARISA
iv
TABLE OF CONTENTS
Acknowledgments.......................................................................................................................... iii Abstract and Benefits..................................................................................................................... iv List of Tables ................................................................................................................................ vii List of Figures ................................................................................................................................ ix List of Acronyms .............................................................................................................................x Executive Summary ...................................................................................................................ES-1 1.0 Project Background and Objectives............................................................................. 1-1 1.1 Project Background.............................................................................................. 1-1 1.2 Objectives ............................................................................................................ 1-2 Project Approach ........................................................................................................... 2-1 2.1 Description of Test Reactors................................................................................ 2-1 2.1.1 Continuous Flow Activated Sludge Systems........................................... 2-1 2.1.2 Sequencing Batch Reactor (SBR)............................................................ 2-3 2.1.3 Anaerobic Selector System ...................................................................... 2-5 2.1.4 Nitrate Uptake Rate (NUR) and Oxygen Uptake Rate (OUR) Tests Reactor............................................................................................ 2-5 2.1.5 Dextrin Degradation Kinetics Test Reactor............................................. 2-5 2.2 Synthetic Wastewater Composition..................................................................... 2-6 2.2.1 Synthetic Wastewater Composition Used During the Phase of Anoxic Selector Study .......................................................................................... 2-6 2.2.2 Synthetic Feed for Anaerobic Selector Study.......................................... 2-8 2.2.3 Synthetic Feed for OUR, NUR, and Dextrin Degradation Kinetics Tests ... 2-8 2.3 Operating Conditions ......................................................................................... 2-10 2.3.1 Phase I - Start Up of System and Anoxic Selector Additions............... 2-10 2.3.2 Phase I Operation Continue Anoxic Selector Operation .................... 2-11 2.3.3 Phase II Operation Verification of Phase I Results and SBR Addition... 2-12 2.3.4 Phase III Operation Reduce Starch in Feed and Switch Anoxic Selectors .................................................................................... 2-13 2.3.5 Phase IV Operation Mainly Acetate for Feed COD ........................... 2-14 2.3.6 Phase V Anaerobic Selector Operation............................................... 2-14 2.4 Sampling Location, Frequency, and Analyses................................................... 2-14 2.5 Analytical Methods............................................................................................ 2-16 2.5.1 DO, pH, and Temperature...................................................................... 2-16 2.5.2 Total and Volatile Suspended Solids ..................................................... 2-16 2.5.3 Diluted Sludge Volume Index (DSVI) .................................................. 2-16 2.5.4 Soluble COD.......................................................................................... 2-16 2.5.5 Readily Biodegradable COD (rbCOD).................................................. 2-17 2.5.6 Nitrate, Nitrite, and Ammonia Analyses................................................ 2-17 2.5.7 Reactive Phosphorus.............................................................................. 2-18 2.5.8 Starch and Dextrin ................................................................................. 2-18
2.0
2.6 2.7 2.8
2.5.9 Acetate ................................................................................................... 2-18 2.5.10 Poly-3-hydroxybutyrate (PHB).............................................................. 2-18 2.5.11 Filamentous Organism Identification and Abundance Index ................ 2-19 Batch Tests for Oxygen Uptake Rate (OUR) and Nitrogen Uptake Rate (NUR) .. 2-21 SRT Control ....................................................................................................... 2-22 Microbial Community Characteristics Using Automated Ribosomal Intergenic Spacer Analysis (ARISA)................................................................. 2-22 2.81 Sample Collection and DNA Extraction................................................ 2-22 2.8.2 ARISA Analysis..................................................................................... 2-23
3.0
Results ............................................................................................................................. 3-1 3.1 Phase I Start Up Results....................................................................................... 3-1 3.2 Phase I Operation Results .................................................................................... 3-3 3.3 Phase II Operation Results................................................................................... 3-8 3.4 Phase III Operation Results ............................................................................... 3-12 3.4.1 Substrate Removal Batch Kinetics Tests ............................................... 3-15 3.4.2 Microscopic Observations ..................................................................... 3-18 3.4.3 Bacterial Community Fingerprinting..................................................... 3-20 3.5 Phase IV Operating Results ............................................................................... 3-24 3.6 Phase V Anaerobic Selector Results.................................................................. 3-25 Discussion........................................................................................................................ 4-1 Conclusions..................................................................................................................... 5-1
4.0 5.0
Appendix A................................................................................................................................. A-1 Appendix B ..................................................................................................................................B-1 Appendix C ..................................................................................................................................C-1 References....................................................................................................................................R-1
vi
LIST OF TABLES
2-1 2-2 2-3 2-4 2-5 2-6 2-7 2-8 2-9 3-1 3-2 3-3 3-4 3-5 3-6 3-7 3-8 3-9 3-10 3-11 3-12 3-13 3-14 3-15 SBR Sequential Operating Phases and Status of SBR Components................................ 2-4 DS-13 Synthetic Feed Formula for Phase II Laboratory Study....................................... 2-7 COD Fraction of Different Carbon Sources in the Synthetic Feed Formula................... 2-8 Feed Composition Used for Anaerobic Selector ............................................................. 2-9 Synthetic Feed Composition Used in OUR, NUR, and Dextrin Kinetics Tests ............ 2-10 Operating Parameters for the SBR System.................................................................... 2-12 Sampling Location, Frequency, and Analyses for Continuous Flow and SBR Systems.... 2-15 Summary of Analytical Methods Used .......................................................................... 2-16 Subjective Scoring of Filamentous Abundance............................................................. 2-21 Summary of Selector Performance on Biodegradable COD (bCOD) Removal.............. 3-3 NOx-N Concentrations in the Last Stage of the Anoxic Selectors for Phase I Operation .... 3-7 Measured Influent Total COD Concentration for Lab Systems in Phase I Operating..... 3-8 Average Values of Important Operating and Performance Parameters and COD Profiles in the Three Systems During Day 172-216 ...................................................... 3-13 NOx-N Concentrations in the Last Stage of the Selectors............................................. 3-14 Batch Test Results for NUR .......................................................................................... 3-16 Batch Test Results for OUR. ......................................................................................... 3-16 Profiles of COD, Acetate, Dextrin, and PHB for S1 and S4 on Day 185...................... 3-18 Calculated Bray-Curtis Similarity Between ARISA Profiles for S1(S1), S4(S4), and SBR Samples........................................................................................................... 3-21 Relative Peak Area (%) for the Clones Close to Known Filamentous Organisms........ 3-24 Summary of Changes of Feed Components and Operational Conditions ..................... 3-26 Selector Zone Effluent sCOD Concentrations (mg/L) for S1 and S4 Based on Grab Samples)................................................................................................................ 3-27 Phosphorus Removal and Anaerobic Contact Zone Phosphorus Release Concentration Normalized to the Influent Flow for Anaerobic Selector S4 ......................................... 3-28 Phosphorus Removal and Anaerobic Contact Zone Phosphorus Release Concentration Normalized to the Influent Flow for Anaerobic Selector S1 ......................................... 3-28 Summary of Changes of Feed Components and Operational Conditions for S1 and S4 Anaerobic Selector Systems .......................................................................................... 3-29
vii
3-16 3-17 3-18 4-1
P and COD Data for S1 (mg/L), CODr/Pr is COD Removed Across Selector Divided by P Removed Across System ......................................................................... 3-30 P and COD Data for S4 (mg/L), CODr/Pr is COD Removed Across Selector Divided by P Removed Across System ......................................................................... 3-31 Identification of Filamentous Bacteria in the S1 and S4 Anaerobic Selectors .............. 3-32 Summary of Selector Study Major Operating Conditions and Changes and Trends in DSVI Values for Each Operating Phase .......................................................................... 4-3
viii
LIST OF FIGURES
2-1 2-2 2-3 2-4 2-5 3-1 3-2 3-3 3-4 3-5 3-6 3-7 3-8 3-9 3-10 3-11 3-12 3-13 3-14 3-15 3-16 3-17 3-18 3-19 3-20 3-21 3-22 Sketch of the Continuous Flow Systems Used in Evaluation of One-stage and Four-stage Anoxic Selectors ............................................................................................ 2-2 Clarifier Picture Showing Bottom Stirrer Mechanism, Inlet, and Outlets....................... 2-4 Sketch of Sequencing Batch Reactor (SBR) System....................................................... 2-5 Schematic of Single- and Four-stage Anaerobic Selectors.............................................. 2-6 Flow Chart of the Molecular Work................................................................................ 2-22 DSVI Versus Time for Aerobic-only Reactor (RC) and Single- and Four-stage Selector Reactors (S1 and S4) During Phase I Start Up .................................................. 3-2 DSVI vs. Date for Control Reactor (Rc) with No Anoxic Selector................................. 3-4 DSVI Versus Operating Day for Single- and four-stage Anoxic Selectors for Phase I ........................................................................................................................ 3-5 Wet Mount of CMAS Mixed Liquor at 100X Magnification on Day 104 ...................... 3-6 Wet Mount of S1 Mixed Liquor at 100X Magnification on Day 104 ............................. 3-6 Wet Mount of S4 Mixed Liquor at 100X Magnification on Day 104 ............................. 3-7 DSVI Values Versus Day of Operation From Start Up for Phase II Operation .............. 3-9 Influent COD Concentration for S1 and S4 Since Start Up........................................... 3-11 Wet Mount of SBR Mixed Liquor at 100X Magnification on Day 168........................ 3-11 Wet Mount of S1 Mixed Liquor at 100X Magnification on Day 168 ........................... 3-12 Wet Mount of S4 Mixed Liquor at 100X Magnification on Day 168 ........................... 3-12 DSVI vs. Time in S1, S4, and SBR After Combining Mixed Liquor of S1 and S4 on Day 172......................................................................................................... 3-15 DSVI in S1 Before and After Addition of Dextrin in the Feed.................................... 3-15 Result of Dextrin Kinetics Test Under Anoxic Conditions ........................................... 3-17 Wet Mount of SBR Mixed Liquor at 100X Magnification on Day 202........................ 3-19 Wet Mount of S1 Mixed Liquor at 100X Magnification on Day 202.......................... 3-19 Wet Mount of S4 Mixed Liquor at 100X Magnification on Day 202.......................... 3-20 Shannon-Weaver Diversity Index of ARISA Profiles ................................................... 3-21 Calculated Bray-Curtis Similarity Between Same-day ARISA profiles for S1(S1), S4(S4), and SBR Samples ............................................................................................ 3-22 Phylogenic Tree Showing Relation Among 16S Genes of Bacterial Cl ones and Their Associated ARISA Fragment Lengths........................................................................... 3-23 Phase IV DSVI Values Versus Time ............................................................................. 3-25 DSVI for S1 and S4 ....................................................................................................... 3-31
ix
LIST OF ACRONYMS
ARISA CMAS COD DNA DO DSVI EBPR GAOs HRT ICZ IR LCFAs MLSS MLVSS NH4 NO2 NO3 NUR OUR PAOs RAS rbCOD Rc S1 S4 sbCOD SCFAs sCOD SBR SRT SVI TSS VSS Automated ribosomal intergenic spacer analysis Completely mixed activated sludge Chemical oxygen demand Deoxyribose nucleic acid Dissolved oxygen Diluted sludge volume index Enhanced biological phosphorus removal Glycogen accumulating organisms Hydraulic retention time Initial contact zone Internal recycle Long chain fatty acids Mixed liquor suspended solids Mixed liquor volatile suspended solids Ammonia Nitrite Nitrate Nitrate uptake rate Oxygen uptake rate Phosphorus accumulating organisms Return activated sludge Readily biodegradable COD Aerobic only control reactor Single-stage anoxic selector system Four-stage anoxic selector system Slowly biodegradable COD Short chain fatty acids Soluble COD Sequencing batch reactor Solids retention time Sludge volume index Total suspended solids Volatile suspended solids
EXECUTIVE SUMMARY
This report provides the results of a laboratory investigation to evaluate the effect of multiple-staged anoxic or anaerobic selector configuration versus a single-stage selector design to control the growth of filamentous organisms in activated sludge, and thus sludge settleability characteristics, which are important for secondary clarifier design and performance. Inefficient solids separation in secondary clarifiers caused by high sludge blankets, a process commonly referred to as sludge bulking, is often related to a high concentration of filamentous organisms in activated sludge treatment. One approach to prevent this problem is addition of a selector reactor prior to the aeration tank to favor floc-forming organisms. Three types of selectors have been used and are termed aerobic, anoxic, and anaerobic selectors. Anoxic selectors are mixed, but not aerated, and the main electron acceptors are nitrate and nitrite. Nitrate is supplied to the anoxic selector by internal recycle of mixed liquor from the aerobic zone and by the return activated sludge from the clarifier. This type of selector provides nitrogen removal as well as sludge bulking control. Anaerobic selectors have minimal input of oxygen and NO3/NO2 and the main mechanism to provide energy for rbCOD uptake is related to stored polyphosphates in unique phosphorus accumulating organisms (PAOs). This type of selector provides enhanced phosphorus removal as well as sludge bulking control. These are referred to as metabolic selectors, based on the concept that floc forming organisms are able to consume influent readily biodegradable organic material measured as chemical oxygen demand (rbCOD) faster than filamentous organisms with nitrate/nitrite as the electron acceptor and that for anaerobic conditions filamentous bacteria are not able to produce and use stored polyphosphates. These types of selectors have been shown to improve sludge settling (lower sludge volume index). The primary objective of this research was to compare dilute sludge volume index (DSVI) control in equally-sized single- and multi-stage anoxic and anaerobic selectors relative to a control aerobic reactor without a selector, using a synthetic wastewater feed containing both readily biodegradable and slowly biodegradable substrates. A further objective was to compare filamentous microorganism populations and microbial community composition for the different systems by an automated ribosomal intergenic spacer analysis (ARISA) (Fisher and Triplett, 1999) method. Bench-scale reactors, fed a synthetic wastewater, were designed and operated to evaluate the effect of using a four-stage versus a single-stage design for systems with anoxic and anaerobic selectors. These were followed by a completely mixed (CMAS) aerobic zone operated at a five-day SRT and 20-22oC temperature. External clarifiers were used for solids settling and sludge return to the initial zone of the selector or aerobic zone. Initially, three aerobic CMAS systems were operated with no selectors to confirm that poor settling with high diluted sludge volume indices (DSVIs) would occur without the selectors. Then one CMAS aerobic only system was operated for comparison to sludge settleability performance and filamentous population for the single- and four-stage selector systems. The CMAS was eventually replaced with a sequencing batch reactor (SBR) with both anoxic and aerobic effective plug flow kinetics as that provided more useful information for comparison to the continuous flow selector systems.
ES-1
For the last 2.5 months of the 11-month laboratory operation, the single- and four-stage anaerobic selector systems were operated and compared for sludge settleability and filamentous population. These used a different synthetic feed composition and were seeded with mixed liquor from a full-scale system that had an anaerobic selector for enhanced biological phosphorus removal (EBPR). Anoxic selectors were clearly shown to improve sludge settling (DSVI values) over a completely-mixed aerobic activated sludge system and the DSVI was improved with greater staging. A four-stage anoxic selector improved DSVI values more than a single-stage anoxic selector and an SBR anoxic contact time (with plug flow kinetics) improved DSVI values over the four-stage selector. The rbCOD (mainly acetate) was almost completely removed in either type of selector and a lower hydraulic retention time was necessary for complete removal of rbCOD with increased staging. In spite of the anoxic selector conditions all three systems showed an abundant level of filamentous growth mainly dominated by N. Limicola II and Type 1851. For the synthetic wastewater used in the laboratory studies, the slowly biodegradable substrate (dextrin) was found to affect the DSVI values for the different systems. Less dextrin was removed in the single-stage anoxic selector system than for the four-stage anoxic selector system, resulting in more dextrin removal in the CMAS aerobic zone and a higher DSVI value. Dextrin removal in the CMAS aerobic zone occurs at a very low bulk liquid concentration, which favors filamentous growth according to classic filamentous growth kinetic theory. On the other hand, the SBR system had a substrate gradient in both the anoxic and aerobic zones to encourage greater dextrin removal in the anoxic zone and to limit the amount of dextrin removed at low bulk liquid concentrations in the aerobic zone. Though the SBR system also had an abundant level of N. Limicola II, the filamentous growth was mainly within the floc. A hypothesis presented to explain the filamentous growth characteristics in the SBR is the substrate gradient in the aerobic phase promoted diffusion of dextrin into the floc where filamentous growth was encouraged by a low available substrate concentration from the relatively slow dextrin hydrolysis rate. Thus, staging in both the anoxic and aerobic zones was helpful to control filamentous growth related to sbCOD in the synthetic wastewater used in this study. The DSVI values for the single- and four-stage anaerobic selectors were good, but general comparisons between the two systems was not possible due to the short operating time for this portion of the selector study. At the beginning of the anaerobic selector study, with seed from an EBPR facility, the phosphorus removal characteristics and sludge settling followed expected trends. However within a time period equal to 3-4 SRTs, the phosphorus removal deteriorated and the anaerobic selector zone never removed the soluble COD to a minimal concentration as expected. These results were contrary to results seen in other investigations using the same feed composition but in an SBR instead of a continuous-flow system with an external clarifier as for this study. The ARISA method showed promise for an efficient means of characterizing activated sludge bacteria populations. It identified many of the filaments in the system indicated by light microscopy methods and showed their abundances semi-quantitatively. It also showed that the bacteria population for the four-stage anoxic selector was closer to that in the SBR system versus the single-stage anoxic selector system.
ES-2
CHAPTER 1.0
PROJECT BACKGROUND AND OBJECTIVES

1.1 Project Background
High sludge blankets and less efficient solids removal in secondary clarifiers, commonly referred to as bulking sludge, has been related to poor thickening characteristics, and in many cases a high level of filamentous organisms in activated sludge treatment. Tomlinson (1982) demonstrated that single-stage, complete mix activated sludge (CMAS) reactor systems are most susceptible to filamentous bulking problems. One approach used to prevent the problem is the addition of a selector reactor before the aeration tank, which is designed to provide conditions that favor substrate uptake by the floc-forming organisms instead of filamentous organisms. Chudoba et al. (1973) was the first to demonstrate the selector concept in a system with a multistaged selector that had a high F/M ratio in the initial contact zone (ICZ). The generally accepted fundamental basis for a selector operation is that it removes dissolved, readily biodegradable COD (rbCOD) prior to the aeration zone, where filamentous organisms can thrive on that type of substrate. The most common selector types are anoxic or anaerobic. In anoxic selectors, none or little oxygen is provided and the main electron acceptor for energy production is nitrate (NO3-N) and or nitrite (NO2-N). Nitrate is supplied to the anoxic selector by internal recycle of mixed liquor from the aerobic treatment zone and in the return activated sludge from the clarifier. This type of selector provides nitrogen removal as well as sludge bulking control. Anaerobic selectors have minimal input of oxygen and NO3/NO2 and the main mechanism to provide energy for rbCOD uptake is related to stored polyphosphates in unique phosphorus accumulating organisms (PAOs). This type of selector provides enhanced phosphorus removal as well as sludge bulking control. These are referred to as metabolic selectors, based on the concept that floc forming organisms are able to consume rbCOD faster than filamentous organisms with nitrate/nitrite as the electron acceptor and that for anaerobic conditions filamentous bacteria are not able to produce and use stored polyphosphates. These types of selectors has been shown to improve sludge settling (lower sludge volume indexes (SVI)) (Jenkins et al., 2004). However, it has been reported that anoxic selectors may not successfully control all filamentous organisms, including Microthrix parvicella, Type 0041, Type 0675, Nostocoida limicola I, II, III, and Type 1851 (Eikelboom et al., 1998; Gabb et al., 1991; Jenkins et al., 2004). There have been reports showing that properly designed completely mixed, single-staged, anoxic selectors were able to improve sludge settleability in full-scale activated sludge systems (Marten and Daigger, 1997). Albertson (1987) argued that bulking sludge occurs in many systems with anoxic selectors, because the anoxic and aerobic zones in these systems are single completely mixed reactors, and suggested that bulking is better controlled by compartmentalization of both anoxic and aerobic zones. He (1992, 2002) recommended a
1-1
cascade design with three stages at 25, 25, and 50% of the total selector volume, and provided target loading rates of 5.0-6.0, 2.5-3.0, and 1.3-1.5 kg sCOD/kg MLSS-d in each stage, respectively. Recent studies in Netherlands showed that well settling sludge could be achieved in full-scale anoxic-aerobic systems by implementing well-controlled strictly anoxic plug-flow selectors (Kruit et al., 2002). Bench-scale studies of factors affection filamentous bulking in systems with anoxic selectors has been done by researchers using synthetic wastewater. A study using sequencing batch reactors (SBRs) with acetate as the sole carbon source in an anoxic feed period followed by aeration, showed that the only factor that led to worse sludge settling characteristics was the presence of microaerophilic conditions in the anoxic period (Martins et al., 2004). When longchain fatty acids were fed into a continuous activated sludge system, Mamais et al. (1998) found that the anoxic selector had little effect on control of M. parvicella. Dionisi et al. (2002) indicated, that a leakage of only a small amount of feed COD (7%) from the anoxic phase led to severe filamentous bulking caused primarily by N. limicola II in SBRs fed with both low molecular substrates and high molecular substrates (starch and oleic acid). If the main role of the selector for filamentous control is to remove rbCOD, it is logical to expect that either multiple or single-staged selectors can be equally effective if properly sized. Theoretically multiple-staged selectors should require a smaller volume due to the effect of a substrate gradient on substrate uptake kinetics. However, it is not know if the higher substrate concentration in the ICZ of the multiple-staged selector can result in the selection of a different and better settling bacteria population amongst the floc-forming bacteria. In contrast to a singlestage anoxic selector, substrate storage can occur with rapid substrate uptake in the first stage of a multiple-staged anoxic selector. For an anaerobic selector the benefits of staging on sludge settleability are not as promising as there are no electron acceptor sources to provide an alternative substrate removal mechanism, such as storage by non-PAOs or rapid oxidation. The mechanism, whether single staged or multiple-staged is substrate uptake and storage by PAOs and possibly glycogen accumulating organisms (GAOs). If a staged anaerobic selector has some effect on the relative growth of PAOs versus GAOs, then different sludge settling characteristics may be possible. Though most selectors are designed with the aim of removing soluble, readily degradable COD, there is some concern that the more slowly degradable particulate degradable COD may play a role in sludge settling characteristics. A survey of European wastewater treatment plants concluded that particulate substrate in the influent played a critical role in filamentous bulking in biological nutrient removal systems (Eikelboom et al., 1998). Therefore, understanding how slowly biodegradable substrates degrade under anoxic and perhaps anaerobic conditions is also crucial for filamentous bulking control in biological nitrogen removal activated sludge systems.
1.2
Objectives
The primary objective of the Phase 2 Laboratory Investigation was to compare dilute sludge volume index (DSVI) control in equally-sized single- and multi-stage anoxic and anaerobic selectors relative to a control aerobic reactor without a selector, using a synthetic wastewater feed containing both readily biodegradable and slowly biodegradable substrates. A
1-2
further objective was to compare filamentous microorganism populations and microbial community composition for the different systems by an automated ribosomal intergenic spacer analysis (ARISA) (Fisher and Triplett, 1999) method.
1-3
1-4
CHAPTER 2.0
PROJECT APPROACH
Bench-scale reactors, fed a synthetic wastewater, were designed and operated to evaluate the effect of using a four-stage versus a single-stage design for systems with anoxic and anaerobic selectors. These were followed by a completely mixed (CMAS) aerobic zone operated at a 5-day SRT and 20-22oC temperature. External clarifiers were used for solids settling and sludge return to the initial zone of the selector or aerobic zone. Initially, three aerobic CMAS systems were operated with no selectors to confirm that poor settling with high diluted sludge volume indices (DSVIs) would occur without the selectors. Then one CMAS aerobic only system was operated for comparison to sludge settleability performance and filamentous population for the single- and four-stage selector systems. The CMAS was eventually replaced with a sequencing batch reactor (SBR) with both anoxic and aerobic effective plug flow kinetics as that provided more useful information for comparison to the continuous flow selector systems. For the last 2.5 months of the 11-month laboratory operation, the single- and four-stage anaerobic selector systems were operated and compared for sludge settleability and filamentous population. These used a different synthetic feed composition and were seeded with mixed liquor from a full-scale system that had an anaerobic selector for enhanced biological phosphorus removal (EBPR). During a portion of the study on the anoxic selector design, molecular methods were used to extract and evaluate DNA for the biological growth and thus provide a general comparison of the populations selected. This chapter describes the laboratory reactor designs, different synthetic feed composition used, various operating conditions, sampling program, and analytical methods.
2.1
Description of Test Reactors
The continuous-flow anoxic and anaerobic selector systems, feed systems, and external clarifier design are described, as well as the SBR system design.
2.1.1 Continuous Flow Activated Sludge Systems

At the beginning of the Phase II laboratory investigation three continuous-flow bench scale activated sludge systems with external clarifiers and the following reactor configurations were operated in parallel. Single-stage aerobic-only system Single-stage anoxic/single-stage aerobic system Four-stage anoxic/single-stage aerobic system
2-1
Schematics of the three continuous flow systems are shown in Figure 2-1. The aeration reactor was fabricated of acrylic plastic with a 14.6-cm diameter and 33.0-cm height. A 0.64 cm ( inch) diameter effluent port controlled the operating volume at 4.3 liters. Aeration was provided by Aquarium air pumps at about 27 mL/min to a fine bubble ceramic stone diffuser.
Reactor System 1 - Control
Feed Pump Motor Air Pump Effluent
Aeration Zone
Feed Magnetic Stirrer
Clarifier
Reactor System 2 Four-stage Anoxic Selector

Feed Pump
RAS Pump
Anoxic Selector
Motor Air Pump
0.25V
0.25V
0.25V
0.25V
Aeration Zone
Effluent
Feed Internal Recycle Pump Magnetic Stirrer
Clarifier
RAS Pump
Reactor System 3 - Single-Stage Anoxic Selector

Feed Pump Motor
Anoxic Selector Aeration Zone

1.0V Feed Internal Recycle Pump Magnetic Stirrer
Air Pump Effluent
Clarifier
RAS Pump
Figure 2-1. Sketch of the Continuous Flow Systems Used in Evaluation of Single-stage and Four-stage Anoxic Selectors.
The total liquid volumes for the single-stage and four-stage anoxic reactors were equal at 850 mL. The single-stage anoxic reactor was made of a 7.0-cm diameter cylindrical plastic at 27.9 cm high. Each cell of the four-stage anoxic selector reactor was of equal volume, with
2-2
dimensions of 3.8 cm by 3.8 cm and 19.1-cm high. The anoxic cells were arranged in a cascade design, with a higher liquid elevation for successive upstream cells, to prevent backmixing of mixed liquor from the downstream cells. A plastic base of decreasing height was located below each cell to create the elevation differences. A notch on the wall between each cell provided an exit port from the upstream cell. The single-stage anoxic reactor was mixed with a stir bar and magnetic stirrer, while nitrogen sparging was used to mix the four-staged anoxic reactor cells because of their small size and compactness. Nitrogen was sparged through a tube at the bottom corner of each cell. The single stage anoxic reactor was also sparged with nitrogen to assure that no oxygen transfer was occurring from the headspace. Both anoxic selectors were covered with plastic sheets to provide a positive atmosphere with nitrogen. Nitrogen gas was supplied from a compressed nitrogen gas cylinder. A 0.64 cm ( inch) diameter connection and Tygon tubing were used to transfer flow from the last selector cell to the aerated CMAS by gravity flow. For reactor systems 2 and 3 with anoxic selectors, mixed liquor was continuously recycled from the aeration zone to the first cell of the anoxic selectors by a peristaltic pump. A separate feed pump was also available to supply nitrate directly to the anoxic selectors. A peristaltic pump also provided a continuous recycle of settled solids from the clarifiers to the aeration zone and anoxic selector zones, respectively. Clear glass bottles served as common feed containers for the three activated sludge systems. One (feed 1) contained the concentrated organic feed components and most of inorganic feed components, and the other (feed 2) contained the concentrated phosphorus and nitrogen feed components. The containers were cleaned with bleach every two days to eliminate biological growth. Tap water was used to dilute the feed flow and provide the total desired flow rate for the three activated sludge systems. Peristaltic pumps with three common heads was used to pump feed 1, feed 2 and tap water to the three activated sludge systems. The nominal flow rate to each system for feeds 1 and 2, and tap water were 1.4 mL/min and 5.6 mL/min, respectively. At the beginning of the study, a steep slope, cone-bottom clarifier was used. However, it was found that the decreasing area of the cone bottom clarifier created solids flux limitations and the clarifiers were modified to a cylindrical design using acrylic 10-cm plastic cylinders as shown in Figure 2-2. The bottom of the cylinder was cleaned by two rubber scrapers attached on horizontal wires that were connected to a shaded pole driven by a constant speed, 1-rpm motor. Mixed liquor from the aeration zone entered the clarifier through the Tygon tubing that was fixed in the center of the cylinder at about a 10-cm depth. The effluent weirs were constructed from a PVC 2.5 cm (1 inch) diameter tubes cut in half down the center. The two edges of each tube were cut into zigzag equilateral triangles with a height of 0.6 cm ( inch). Then the tube, with one end blocked, was laid at the top of the clarifier to serve as the effluent weir and collection channel. Tygon tubing provided a conduit for flow from the clarifier effluent channel to an effluent collection container for each system. Settled sludge could flow A 1.3-cm diameter opening was provided at the bottom of the clarifier with a connection to Tygon tubing and peristaltic pump for activated sludge recycle.
2.1.2 Sequencing Batch Reactor (SBR)

An SBR system operation was started in the fourth month of the experimental program and was operated in an anoxic/aerobic sequence, with anoxic conditions during feeding and for a short time after. The SBR system is shown in Figure 2-3 and had the same dimensions as the aeration basins for the continuous flow systems described above. Feed was provided from the
Develop and Demonstrate Fundamental Basis for Selectors to Improve Activated Sludge Settleability 2-3
feed 1, feed 2 and tap water containers by three peristaltic pumps dedicated to the SBR operation. A separate peristaltic pump was used to withdraw effluent after the SBR settling phase. The inlet end of the effluent tubing was fixed at a predetermined height inside the cylinder to assure that the desired effluent withdrawal volume was not exceeded. An Aquarium air pump provided air to a fine bubble ceramic stone diffuser to supply oxygen. An additional diffuser stone was added to the SBR and was connected to tubing from a nitrogen cylinder source. A solenoid valve, normally in the closed position, could be opened by the controller to provide nitrogen sparging to the reactor during the anoxic period. A magnetic stirrer and stirring bar inside the reactor was used for mixing. The electrical source for all pumps, stirrer and solenoid valve was connected to an electronic Chrontrol timer, which was programmed to provide specified on/off times of these SBR operating components.
Figure 2-2. Clarifier Picture Showing Bottom Stirrer Mechanism, Inlet, and Outlets.
The SBR cycle steps were fill and anoxic mixing, anoxic mixing, aeration, settling, effluent decanting, and idle. These steps are indicated in Table 2-1 below along with the on/off mode of the SBR components.
Table 2-1. SBR Sequential Operating Phases and Status of SBR Components.
SBR operating phase Operating Feed/Anoxic Mix Anoxic components Mix Feed pumps ON OFF Mixer ON ON Nitrogen solenoid ON ON Air pump OFF OFF Decant pump OFF OFF
Aeration OFF ON OFF ON OFF
Settle OFF OFF OFF OFF OFF
Decant Effluent OFF OFF OFF OFF ON
Idle OFF OFF OFF OFF OFF
2-4
Pump Timer Air pump Pump

FEED Feed
To effluent container
Magnetic stirrer
Figure 2-3. Sketch of Sequencing Batch Reactor (SBR) System.
2.1.3 Anaerobic Selector System

Figure 2-4 provides a schematic of the two anaerobic selector systems operated in parallel. The total volume of both selector zones was equal at 0.852 L. The aerobic volume was the same as that used in the anoxic selector operation at 4.3 L. The anaerobic selectors were also mixed and sparged with nitrogen in the same was as the anoxic selectors.
2.1.4 Nitrate Uptake Rate (NUR) and Oxygen Uptake Rate (OUR) Tests Reactor
A 1-liter polypropylene beaker was used for OUR batch tests. Compressed oxygen gas was manually controlled and supplied through Tygon tubing to a fine-bubble ceramic diffuser stone. A magnetic stirrer and 5-cm stirrer bar were used for mixing. A Yellow Springs Instrument (YSI) DO meter and probe were used to monitor the DO concentration versus time during the OUR test. A 1-liter small-mouth glass flask was used for NUR batch tests. The activated sludge added to the class was mixed with a magnetic stirrer and 5-cm stirrer bar. The flask was covered with aluminum foil and nitrogen gas was sparged into the liquid through a fine bubble ceramic stone to assure a nitrogen headspace and no oxygen entering the liquid.
2.1.5 Dextrin Degradation Kinetics Test Reactor

A similar reactor, as used for the NUR tests, was used for dextrin degradation kinetics tests to determine the dextrin degradation rate under anoxic conditions with the exception that the reactor liquid volume was 0.4 L instead of 1.0 L.
2-5
Reactor System 1 Four-stage Anaerobic Selector

Feed Pump
Anaerobic Selector
Motor Air Pump
0.25V
0.25V
0.25V
0.25V
Aeration Zone
Effluent
Feed Magnetic Stirrer
Clarifier
RAS Pump
Reactor System 2 - Single-Stage Anaerobic Selector

Feed Pump Motor
Anaerobic Selector
Air Pump Effluent
Aeration Zone
1.0V Feed Magnetic Stirrer
Clarifier
RAS Pump
Figure 2-4. Schematic of Single- and Four-stage Anaerobic Selectors.
2.2
Synthetic Wastewater Composition
A synthetic wastewater, termed DS-13 based on earlier work by Gabb (1988) was used to feed the continuous flow reactors. The wastewater constituents were selected to represent various types of components in domestic wastewater, including really degradable compounds, complex carbohydrates, organic nitrogen and fats and oils. This section describes the initial wastewater composition used and modifications to it as the experiments progressed. In addition, the feed substrates used for batch tests are also described.
2.2.1 Synthetic Wastewater Composition Used During the Phase of Anoxic Selector Study
Table 2-2 shows the DS-13 synthetic feed composition used at the beginning of the anoxic study phase. The feed components are sorted into eight sub-groups; 1) soluble short-chain organic compounds, 2) organic nitrogen, 3) fats and oils, 4) complex carbohydrates, 5) macro-
2-6
inorganic minerals, 6) phosphorus, 7) vitamins, and 8) micro-inorganic minerals. Separate concentrated stock solutions were prepared for each subgroup, consisting of the compounds and de-ionized water. Synthetic feed was made daily from the eight stock solutions. The target total COD concentration in the combined feed solutions plus tap water was 600 mg/L and the COD fractions for the different carbon sources are summarized in Table 2-3.
Table 2-2. DS-13 Synthetic Feed Formula for Phase II Laboratory Study. Constituent mg/L Constituent mg/L I. Soluble short-chain organic compounds VI. Macro-inorganic nutrients Lactose 21.4 NH4Cl 233.0 sodium acetate 318.8 MgCl26H2O 220.0 sodium succinate 2.4 CaCl22H2O 54.4 lactic acid (liquid) * 0.006 Na2S2O35H2O 15.1 tri-sodium citrate 7.3 VII. Vitamins (13 mL added to 1 L of feed) ethanol (liquid) * 0.003 pantothenic acid 140 butanol (liquid) * 0.001 niacin 140 Glucose 46.9 biotin 7 Maltose 0.9 cyanocobalamin (vit B12) 7 glycerol (liquid) * 1.5 folic acid 7 II. Organic Nitrogen pyridoxine 140 Casein 18.8 p-aminobenzoic acid 140 Peptone 35.0 cocarboxylate 140 Yeast 35.0 inositol 140 Gelatin 27.5 thiamine 140 Methionine 1.3 riboflavin 140 III. Fats and oils choline chloride 140 stearic acid 2.6 VIII. Micro-inorganic (2 mL added to 1 L of feed) palmitic acid 6.6 FeSO4 7 H2O 515.3 tween 20 (lauric) 1.1 ZnSO4 7 H2O 158.1 tween 40 (palmitic) 3.5 MnSO4 150 tween 60 (stearic) 2.2 CuSO4 5 H2O 27.6 tween 80 (oleic) 36.5 CoCl2 6 H2O 28.1 mineral oil 2.2 Na2MoO4 2 H2O 16.1 IV. Complex carbohydrates H3BO3 24.7 Starch 60 KI 24.9 Agar 10 NiCl2 6 H2O 11 Dextrin 40 Al2(SO4)3 18H2O 67.5 V. Phosphorus Na2EDTA 3432.8 K2HPO4 150 IX. Alkalinity KH2PO4 150 NaHCO3 420 Note: * The unit is mL/L for liquid.
Changes to the feed composition were made during the course of the study for two main reasons in most cases. First, certain components were removed, based on the assumption that they were affecting the selection of certain filamentous organisms. Second, the influent ammonia or nitrate concentrations were changed to provide preferred levels of ammonia oxidation and alkalinity consumption in the aerobic zone and sufficient nitrate for anoxic removal of degradable COD in the anoxic zone. These changes will be described within the description of the different operating phases for the study.
2-7
2.2.2 Synthetic Feed for Anaerobic Selector Study

Table 2-4 summarizes the feed composition used for the anaerobic selector. It was selected based on successful enhanced biological phosphorus removal performance in previous bench-scale work.
Table 2-3 COD Fraction of Different Carbon Sources in the Synthetic Feed Formula.
Synthetic feed organic components Total COD Fraction
Soluble shortchain organic compounds 40
Organic Nitrogen 20
Fats and oils 20
Complex carbohydrates 20
2.2.3 Synthetic Feed for OUR, NUR, and Dextrin Degradation Kinetics Tests
For the OUR and NUR batch tests, the main organic compound fed was sodium acetate. For dextrin degradation kinetics test, no other carbon sources were included in the feed. Nutrients were also added to assure that biological growth or activity was not limited. The synthetic feed composition used in those batch tests is listed in Table 2-5.
2-8
Table 2-4. Feed Composition Used for Anaerobic Selector. Constituent (X) mgX/L mg/L as COD I. Soluble short-chain organic compounds 1 sodium acetate.3H2O 360 0.47 169.2 30.4 39.7 0.6 totCOD III. Macro inorganic nutrients 1 2 3 4 NH4Cl MgCl2 6H2O CaCl2 2H2O KCl 57.3 249 185 57 0.26 0.12 0.27 0.52 0.75 29.8 0.6 199.6 mg/L as N, Mg, Ca or K 15 44.9 74.8 44.2
II. Organic Nitrogen 1 2 Peptone Yeast
IV. Trace element solution (2 mL added to 1 L of feed) 1 2 3 4 5 6 7 8 9 10 11 FeSO4 7H2O ZnSO4 7H2O CuSO4 5H2O CoCl2 6H2O Na2MoO4 2H2O H3BO3 KI NiCl2 6H2O Al2(SO4)3 18H2O MnCl4 4H2O Na2EDTA 515.3 158.1 27.6 28.1 16.1 24.7 24.9 11 67.5 141.5 3432.8 mg/L as P 75 75 0.18 0.23 13.4 17.1 mg/L as CaCO3 420 0.6 252.0
V. Phosphorus K2HPO4 KH2PO4 VI. Alkalinity NaHCO3
2-9
Table 2-5. Synthetic Feed Composition Used in OUR, NUR, and Dextrin Kinetics Tests.
Constituent Sodium acetate Dextrin NaNO3a NH4Cl MgCl26H2O CaCl22H2O Na2S2O35H2O K2HPO4 KH2PO4 Vitamins (see Table 2-2) Micro-inorganic nutrients (see Table 2-2) Ally-thioureab
mg/L Varied Varied Varied 233.0 220.0 54.4 15.1 150 150 13 mL added to 1 L of feed 2 mL added to 1 L of feed 20
Note: a. Used in NUR and dextrin degradation kinetics tests; b. Used in OUR tests only.
2.3
Operating Conditions
The operating temperature selected through out the study was 20oC, and initially the reactors were maintained in a walk-in environmental chamber set at 20oC. However the environmental chamber compressor failed in the early part of the study, and it was necessary to operate the reactors under laboratory ambient conditions, which was normally 20-22oC. For warm weather conditions, which caused the laboratory temperatures to rise above 22oC, additional steps for temperature control were taken. A plastic curtain was constructed around all the reactors with air temperature control provided by a dedicated air conditioner. The operating solids retention time (SRT) that was normally used was 5.0 days, based on the aeration volume. The nominal combined feed flowrate was 12 L/day, resulting in an aerobic hydraulic retention time (HRT) of 8.6 hours and anoxic zone HRT of 1.7 hours. Regular cleaning of the feed lines was done weekly by pumping 20% bleach through the lines for 30 min. was done to prevent growth of filamentous growth and thus seeding the test reactors with filamentous organisms. Previous work by Gabb et al. (1989) showed that the feed lines could be a significant source of Sphaerotilus natans filamentous organisms in laboratory activated sludge systems fed synthetic wastewater. Reactors and final clarifier inside walls were brushed one to two times per day to prevent biofilm growth and solids accumulation.
2.3.1 Phase I - Start Up of System and Anoxic Selector Additions

Three completely mixed activated sludge (CMAS) systems (4.3 L aeration volume each) without anoxic selectors were started on October 21, 2005. Activated sludge from the Camus, WA. WWTP was used to seed the reactors, as it contained an abundant level of Thiothrix sp... Only 25% of the DS-13 formula feed COD used in the first day, and the COD was increased to 50%, 75%, and 100% from October 22-24 and kept at 100% (12 L/day, 600 mg/L COD) afterwards. SRT control was initiated on October 30th with a target of 5 days.
2-10
Due to the floating sludge in the clarifiers that was likely related to denitrifying bacteria activity, the ammonia concentration in the feed was reduced from 60 mg/L to 30 mg/L on November 1. A single-stage and four-stage anoxic selector (S1 and S4, respectively) were added in front of two of the aerobic systems on November 11th. Operation of the third aeration-only system (Rc) was continued as a control. The internal recycle (IR) ratio for the anoxic selector systems was set at 2.5 times the influent flow rate and was reduced to 1.5 times of the influent flow rate on February 9th. Returned activated sludge (RAS) was set at 1.5 times the influent flow rate. Due to the excessive filamentous bacteria growth and very high diluted sludge volume index (DSVI) value, there was significant solids loss in the clarifier effluent by the fourth week. Chlorination was applied to Rc on November 15th by addition of 5% sodium hypochlorite directly into the aeration reactor at an application rate of 5 kg Cl2/1000 kg MLSS. However, the daily chlorine dose had to be increased to 20 kg Cl2/1000 kg MLSS to impact the filaments. No chlorine was added to the anoxic selector systems (S1 and S4) but their DSVI decreased. Some feed composition changes are made in early November (2nd and 3rd weeks). The yeast extract was removed from one of the feed containers because it encouraged biological growth in the container. Due to the earlier reduction in the feed NH4-N concentration there was insufficient to nitrate to satisfy the electron acceptor demand of the degradable COD being fed to the anoxic zone for S1 and S4. Thus, sodium nitrate was added to the feed on November 14th (30-80 mg/L as N) to assure that COD removal in the selector was not limited by NO3-N.
2.3.2 Phase I Operation Continue Anoxic Selector Operation

The Phase I operating period from December 1, 2005 to February 6, 2006 (Day 41 to Day 107)is defined as the operating condition after the startup and reaching a steady state operating period in excess of 3 SRTs for the single- and four-stage anoxic selector systems (S1 and S4, respectively). On February 6th the mixed liquor of the two selector systems were combined, split and added to the two systems, and the single- and four-stage-selector operations were restarted. Operation of the control system (Rc), without the selector continued but with frequent chlorine dosing to control the DSVI. After the first week in January some operating problems were experienced was system S1. On Day 78, the line from the aerobic reactor to the clarifier became clogged and solids were lost. On Days 81 to 83, the nitrate feed pump had problems and insufficient nitrate was available in the selector zone. Acetate fed batch tests were done under aerobic and anoxic condition with CMAS, S1 and S4 mixed liquors. On January 5th, the batch tests were done for each mixed liquor from the three systems under anoxic conditions and the oxidized nitrogen, ammonia, and soluble COD concentrations were followed with time. On January 19th an aerobic batch test was done with the CMAS mixed liquor and the oxygen uptake rate and soluble COD concentrations were followed with time. On January 25th aerobic batch tests were done for S1 and S4 mixed liquors.
2-11
2.3.3 Phase II Operation Verification of Phase I Results and SBR Addition

The start date for Phase II was February 6, 2006 (Day 108) and the operating period ended on April 11, 2006 (Day 172). For Phase II operational changes were made from Phase I to further evaluate the differences between the sludge settleability between the S1 and S4 reactors. Three changes were made. First, the feed container arrangement was modified. Instead of pumping to each system with a multiple head pumps from the same containers for Feed 1 and Feed 2, respectively, each pump head was assigned to a specific feed container for Feed 1 and Feed 2 for the respective bench-scale system. The feed was prepared in the same container and poured into the individual container so that the individual containers all had the same feed mixture. The advantage for this modification was that the daily feed volume from Feed 1 and Feed 2 supplied to each bench-scale system could be checked daily to assure that they all received the appropriate amount of individual feed components and thus assure that the systems were getting the same feed composition. The second change was to switch the anoxic selector units so that the physical arrangement was the same as before in terms of the other components, including the clarifier, recycle lines, etc., but the one with the four-stage selector now had a single-staged selector and vice versa. The third change was to combine the mixed liquors from the to anoxic selector systems and to then split these mixed liquors between the two systems for a new start in Phase II. In this way, all system started with the same mixed liquor characteristics. Also in Phase II on February 16, 2006 (Day 118) a sequencing batch reactor (SBR) system was set up to compare a system with a higher degree of anoxic and aerobic effective staging to the anoxic selectors. The SBR operating parameters are listed in Table 2-6. The same feed was used for the SBR system.
Table 2-6. Operating Parameters for the SBR System.
Seed Volume, L Flow rate, L/day Cycle number per day Feeding time, min
S1 and S4 mixed liquor 4.3 12 6 4
Anoxic period, min Aerobic period, min Settling time, min Decanting time, min N2 gas before feeding, min
30 165 35 5 5
Because of the concern about having much higher DSVI values than expected for a selector operation, a number of feed composition changes were also made during Phase II. According to Andreasen and Nielson (1997), N. limicola seems to depend on long-chain fatty acids and glucose for growth. For simplifying the feed and focusing on effects of complex carbohydrates on selector performance, long-chain fatty acids were eliminated from the feed on February 16th (Day 118). A further adjustment to the feed composition was done on March 3rd ( Day 133). The new feed formula contained 60% short-chain fatty acids (as total COD), 30% complex carbohydrates (60% starch and 40% dextrin), and 10% organic nitrogen.
2-12
A new feeding arrangement was applied on February 28th (Day 130). The nitrate and phosphate was combined into one feed container and everything else in the other feed container to prevent S1 and S4 getting different proportions of the carbon sources. Nitrate concentration in the feed was also adjusted at the same time when carbon sources in the feed were changed to make sure that the nitrate concentration did not get too high in the effluent, which at times caused floating sludge in the clarifiers. On Day 133 the feed was changed to provide more COD from short chain fatty acids (SCFAs) and complex carbohydrates to make up for the COD reduction from removing the LCFAs. The feed component changes were to increase the SCFAs from 50% to 60% as total COD, and complex carbohydrates from 25% to 30% of the total COD, and decrease the organic nitrogen from 25% to 10% of the total COD.
2.3.4 Phase III Operation Reduce Starch in Feed and Switch Anoxic Selectors
Phase III operation, which was from April 11th (Day 172) to May 25th (Day 216) was intended to evaluate the anoxic selector performance at a reduced starch concentration in the feed. Due to the problems caused by starch in the feed line, the feed starch concentration was reduced from 18% to 5% as total COD and dextrin was raised from 12% to 25% of the total COD. Dextrin is hydrolysis product of starch and degradation of dextrin in activated sludge under aerobic or anoxic conditions is faster than degradation of starch, but about 4-5 times slower than acetate degradation based on the OUR and NUR batch tests. Mixed liquors of S1 and S4 were also combined and then split evenly back to the two systems on April 11th (Day 172). After these changes, the DSVI for S1 increased and was significantly higher than that for S4. To determine if the reason for the higher DSVI for the single stage selector was due only to the selector configuration, the selectors were switched between each system on April 26th (Day 187) after operating for 3 SRTs. All other operating conditions remained the same. After the switch, the system which previously had a single-stage selector and was designated S1 is now designated as S4 to account for its new operation with a four-stage selector. Similarly the previous four-stage selector system, S4, is now designated as the S1 system. On April 28th (Day 189), a solids blockage in the outlet of the single-staged selector caused solids to overflow from the selector volume, but these solids were recovered in a tray which had been placed underneath the selector. To avoid this problem further, a continuouslyrunning emergency peristaltic pump was set up at the end of each selector zone. The pump intake elevation was placed at point where mixed liquor would be pumped to the downstream aerobic zone should the selector liquid depth increase due to blockage of the selector outlet tube. On April 18th (Day 179) and May 7th (Day 198), the feed system tap water supply was accidentally turned off (both were weekend days for which a student helper was tending the systems). This reduced the flowrate to the systems by 67% and the mistake was found and corrected within one day. However, it appeared to affect the system mixed liquor characteristics as indicated by a drop in the DSVI values in days following these events. A block was placed behind the tap water faucet handle to prevent complete closure to prevent this problem again.
2-13
In order to check whether complex carbohydrates caused elevated DSVIs in the SBR, dextrin and starch were removed from the feed on April 22nd (Day 183), and the rbCOD content (mainly acetate and glucose) was increased to meet a 500 mg/L COD influent concentration. In order to check whether glucose or its dimers caused elevated DSVIs in the SBR, glucose and the small amount of maltose, and lactose added were removed from the feed on May 15th (Day 206) and the acetate concentration was increased to meet a 500 mg/L COD influent concentration. During this phase the ARISA analysis was done to characterize the biomass populations in the S1, S4 and SBR systems.
2.3.5 Phase IV Operation Mainly Acetate for Feed COD
On May 25th (Day 216), all carbohydrates (including glucose and dextrin) except acetate, were removed in the feed for S1 and S4, and the acetate concentration as COD was increased from 300 mg COD/L to 450 mg COD/L. After increasing the feed acetate concentration a viscous sludge was observed in all the three systems, which caused the DSVI value to increase. On June 8th (Day 230), the influent COD (90% as acetate) was reduced by 40% in an attempt to decrease hydrous bulking. On June 20th (Day 242), the anoxic selector experiment was stopped.
2.3.6 Phase V Anaerobic Selector Operation

An anaerobic/aerobic (A/O) systems (section 2.1.3), with a single- and four-stage selector zones (S1 and S4) were set up on June 22nd and seeded with mixed liquor from the Kalispell, Montana wastewater treatment facility. The Kalispell facility is a biological nitrogen and phosphorus removal plant with good enhance biological phosphorus removal (EBPR). Initially, the same feed composition as used for the anoxic selector study was used, but with the COD strength only at 1/3rd (COD = 100 mg/L). The influent and recycle flow rates was set at 12 L/day for each system. The SRT was set at 5-days and the operating temperature was 20-22oC. During June 23rd-25th, the influent COD was gradually increased to 200 mg/L and nutrients in the feed were also increased proportionally. However, a high soluble COD concentration was observed in the S1 and S4 selectors, and so the influent COD wasnt increased again. At that time it was decided to use a feed composition that had been used in previous lab studies with good EBPR. This composition was given in Table 2-4.
2.4
Sampling Location, Frequency, and Analyses
The sampling locations, frequencies, and analyses for the continuous flow and SBR systems are summarized in Table 2-8, respectively. The sampling and analyses program included monitoring certain parameters to control the operating conditions such as SRT and flow rates, performance parameters to observe COD and nitrogen removal, and mixed liquor characterization parameters to observe changes in filamentous bacteria population and sludge settling characteristics. For each activated sludge system the effluent was collected daily in individual effluent collection containers. The daily volume collected in these containers was used to determine the average flow rates to the reactors. In addition, daily flow rates for feed 1 and 2 were also individually tracked by recording daily the initial and remaining volumes in the feed containers. From these data, the peristaltic pump feed rates could be checked and adjusted as necessary.
2-14
For pH measurements, the pH probe was inserted into the reactor mixed liquor or into a container containing a collected influent sample. A Yellow Springs Instrument (YSI) dissolved oxygen (DO) probe was suspended in aerobic zone reactor for DO concentration measurements. For diluted sludge volume index measurements (DSVI), a selected amount of mixed liquor was withdrawn from the aeration basin and mixed with an appropriate volume of effluent from the same system. After the DSVI measurement, the supernatant was poured off and the settled sludge was returned to the aeration tank. For measurement of all dissolved constituents, samples were withdrawn directly from the top of the reactor vessel using disposable syringes or volumetric pipettes and filtered when necessary. For sCOD, soluble phosphorus, ammonia, nitrite, and nitrate determinations, a 0.45 m surfactant-free cellulose acetate (SFCA) filter (Corning, Germany) was used with the disposal syringes. Blank tests with DI water showed no sCOD contribution from the filters. If the samples were not analyzed immediately, they were stored at 4oC before analysis. Daily measurements of suspended solid (TSS) concentrations in the mixed liquor and effluent were necessary to determine the amount of sludge wasting for SRT control. The influent rbCOD measurement was based on applying the floc-filtration method with filtered COD analyses for both influent and effluent samples.
Table 2-7. Sampling Location, Frequency, and Analyses for Continuous Flow and SBR Systems.
Measurements Flow rate pH Dissolved oxygen TSS/VSS sCOD rbCOD NO3-N NO2-N NH3-N Diluted sludge volume index Reactive phosphorus Microscopic identification
Influent P W P W W
Sample location Mixed liquor D W D W W D
Effluent D D W W W W P
P W
Legend: D daily, W weekly, P periodically.
2-15
2.5
Analytical Methods
Table 2-8 summarizes the analytical method used for each parameter measured during this study. The methods are described in more detail in the following sections.
2.5.1 DO, pH, and Temperature

Dissolved oxygen concentration was measured with a YSI model 58 DO meter and YSI model 5750 BOD bottle probe calibrated using the water-saturated air method. A Beckman 11 pH meter equipped with a Corning general purpose combination probe was used to measure pH. Temperature was recorded from a thermometer with 0.2oC temperature divisions.
Parameter pH DO TSS/VSS DSVI COD rbCOD Table 2-8. Summary of Analytical Methods Used. Method Parameter Probe Reactive phosphorus Probe NO3-N Standard methods NO2-N Unstirred NH3-N Hach reagents Temperature Floc-filtration Dextrin Gas chromatography Method Ion chromatography Ion chromatography Hach reagents or IC Hach reagents Thermometer Spectrophotography
Poly-3hydroxybutyrate
2.5.2 Total and Volatile Suspended Solids

Total suspended solids (TSS) and volatile suspended solids (VSS) were measured according to Standard Methods (APHA, 1995) sections 2540D and 2540E, respectively. TSS was calculated as the difference in weight (after cooling in a desiccator) of a Whatman GF/C 47-mm diameter glass fiber filter (1.2 m particle retention) before filtering a given volume of sample and after drying the filter and suspended material in an oven at 105oC for at least 1 hour. To determine VSS, the filter containing the dried sample was ignited at 550oC for at least 15 min and again cooled in a desiccator. The weight difference between drying and igniting gave the VSS.
2.5.3 Diluted Sludge Volume Index (DSVI)

This procedure involves dilution of the mixed liquor until the resulting 30-minute settled volume is between 150 - 250 mL/L in a 1-L graduated cylinder. No stirring was used during the settling time. The DSVI calculation considers the dilution factor, which is the ratio of the total volume (1 L) to the dilution water volume in liters. The MLSS concentration in the following equation (Eq. 2-1) is the aeration tank MLSS concentration before dilution.
DSVI, mL / g =
Sludge volume after 30 min settling, mL / L Dilution factor) (MLSS, g / L)
(2-1)
2.5.4 Soluble COD

Soluble COD was measured with the Hach digestion/absorbance procedure after filtering the samples with a 0.45 m SFCA filter. Two mL of sample were transferred by pipette into a Hach COD reagent vial, digested at 150oC for two hours in a Hach reactor Model 16500-10.
2-16
After allowed to cool to the touch, the vial absorbance was read on a Hach Model DR/4000 Spectrophotometer at a 420 nm wavelength. A preset standard curve in the spectrophotometer was used to determine the COD concentration of samples. A linear standard curve that included 25, 50, 75, 100, and 125 mg/L COD in duplicate was used to check the accuracy of the preset standard curve. The correlation of greater than 99% with the standard solution curve was obtained.
2.5.5 Readily Biodegradable COD (rbCOD)

The rbCOD concentration of influent samples was determined using the Floc-filtration method by Mamais et al. (1993). Both influent and effluent samples were subject to the flocfiltration treatment and sCOD analysis. The rbCOD was the difference between the influent and effluent sCOD concentrations. The floc-filtration procedure is given as follows: A 100-mL sample was taken and 1 mL of 100 mg/L ZnSO4 solution was added to it along with a necessary volume of 2 mM NaOH solution to raise the pH to 10.5. The mixture was slowly mix for 20 minutes to allow flocculation to occur and then settled for 30 min. The supernatant was filtered with a 0.45 m SFCA filter and the filtrate analyzed for its sCOD concentration.
2.5.6 Nitrate, Nitrite, and Ammonia Analyses

Ammonia nitrogen (NH4-N) was determined with an adaptation of the Salicylate Method using Hach reagents. Samples were filtered through 0.45 m SFCA filters and 0.1 mL of each filtered sample was transferred by pipette to a high range (0-50 mg/L NH4-N) reagent vial with 5 mL liquid volume. A reagent vial was also filled to a 0.1 mL volume with DI water as the blank sample. The contents of an ammonia salicylate and an ammonia cyanurate reagent powder pillow were added to the vial, which was then quickly shaken. A reaction time period of 20 min was used for color development. The absorbance of the sample was read on a Hach Model DR/4000 spectrophotometer at a 655 nm wavelength. A preset standard curve in the spectrophotometer was used to determine the NH4-N concentration. A linear standard curve that included 10, 20, 30, 40, and 50 mg/L NH4-N in duplicate was used to check the accuracy of the preset standard curve. A correlation of greater than 99% with the standard solution curve was obtained. Nitrate nitrogen (NO3-N) was determined with the Chromotropic acid method using Hach nitrate high range (0-30 mg/L NO3-N) reagent vials. One mL of each sample was pipetted into a Hach reagent vial, which was filled to a liquid volume of 10 mL. A pillow of NitraVer X reagent B was added to the vial, which was then quickly mixed. After a 5-min reaction period, the absorbance was determined at a 410 nm wavelength using the Hach DR/4000 spectrophotometer. A preset standard curve in the spectrophotometer was used to determine the NO3-N concentration. A linear standard curve that included 5, 10, 15, 20, and 30 mg/L NO3-N in duplicate was used to check the accuracy of the preset standard curve. The correlation of greater than 99% with the standard solution curve was obtained. Nitrite nitrogen (NO2-N) was determined by the Diazotization method using Hach nitrite low range (0-0.3 mg/L NO2-N) reagent vials. Samples were filtered through a 0.45 m SFCA filter and diluted to a concentration in the range of 0-0.3 mg NO2-N/L. A 10.0 mL filtered sample was pipetted to a 25-mL sample cell. A Hach NitriVer 3 reagent powder pillow was
added to the sample cell, which was then quickly shaken, and followed by a 20-min reaction period. The absorbance of the sample was then read on the Hach DR/4000 spectrophotometer at a 507 nm wavelength. A preset standard curve in the spectrophotometer was used to determine the NO2-N concentration. For filtered samples obtained from NUR tests, nitrate-nitrogen and nitrite-nitrogen were analyzed by an ion chromatography (DIONEX model DX120, IonpacARC4 column, eluent 3.5 mM Na2CO3/1 mM NaHCO3).
2.5.7 Reactive Phosphorus

Reactive phosphorus was determined by an ion chromatography (DIONEX model DX120, IonpacARC4 column, eluent 3.5 mM Na2CO3/1 mM NaHCO3).
2.5.8 Starch and Dextrin

Starch and dextrin were determined by a starch-iodine complex formation (SIC) method. The method described in San Pedro et al. (1994) was modified as follows: To prepare iodine stock solution, 11 g KI and 5.5 g I2 crystals were dissolved into 250 mL of water and then the solution was stored in a brown bottle without light. The test iodine solution was prepared by dissolving 4 g KI in water, adding 1 mL of stock solution and DI water to a final volume of 100 mL. The test solution was freshly prepared for every analysis. For the analysis, 1 mL sample (supernatant recovered from sample extraction) was mixed with 1 mL test iodine solution at 20oC. After 5 min of color development, the absorbance was measured by a Hach Model DR/4000 spectrophotometer at a 550 nm wavelength and then compared with a calibration curve for starch or dextrin. For the extraction of starch and dextrin from mixed liquor samples, 2 mL of mixed liquor samples were boiled at 100oC for 12 min and then were sonicated for 4 min in a water bath at a power setting of 150 W. The samples were then centrifuged at 10000 rpm for 4 min to separate cell debris. A series of starch and dextrin solutions with known concentrations were done to check the recovery of the extraction procedure.
2.5.9 Acetate
Acetate was determined with a gas chromatography equipped with a flame ionization detector according to previously described by Conklin et al. (2006).
2.5.10 Poly-3-hydroxybutyrate (PHB)

PHB content in mixed liquor was determined by a gas chromatography equipped with a flame ionization detector. Activated sludge samples (5-15 mL) were centrifuged at 5000 rpm for 10 min. After centrifugation the sludge pellets were frozen under -80oC and lyophilized by a freeze-drying unit at -50oC overnight. Lyophilized sludge was weighed, and then combined with a 3 mL butanol and HCl mixture (4:1) and 2mL of chloroform. The mixture was heated at 100oC in a water bath for 2 hours, during which PHB was hydrolyzed and converted to 3hydroxybutyric acid butyl-ester. After cooling, the digested sample was mixed with 5 mL of DI water to provide phase separation of acid and cell debris. The organic phase (lower layer in the mixture) was used for GC-FID analysis.
2-18
A gas chromatography (GC) equipped with a (10-m long, 0.53-mm ID, and 1.2-m film thickness) AT-WAX column (Alltech, KY) and a flame ionization detector (FID) was used for measuring 3-hydroxybutyric acid butyl-ester. The temperature program for the column started at 60oC, held for 3min, ramped at 5oC per minute to 90oC, then ramped at 15oC per minute to 200oC, and then held at 200oC for 10 minutes. A series of PHB with known concentrations were extracted and analyzed in the GC with mixed liquor samples to create standard curves,
2.5.11 Filamentous Organism Identification and Abundance Index

Activated sludge samples were routinely examined to characterizing the filamentous organisms and floc characteristics using a phase contrast light microscope (Olympus Model BH 2 binocular phase contrast microscope). A micrometer with a smallest unit of 0.01 mm was used to measure diameter and length of microorganisms. The filamentous identification procedure used was according to the manuals by Jenkins et al. (2004) and Eikelboom (2000). The procedure is described in the following. One drop of a mixed liquor sample grabbed from the activated sludge system aeration tank was placed on a clean 25-mm75-mm microscope slide by a disposable needle syringe. Then a 22-mm22-mm (No.1) glass cover slip was gently placed over the sample. The liquid expelled from the sides of the cover slip was cleaned with a tissue. The wet mount sample was then examined under phase contrast illumination at 100 magnification for the following characteristics: Floc size, which was classified as small ( 50 m), medium (150-500 m), or large ( 500 m) Filamentous abundance Filament effect on floc structure, which was divided into three categories: little or none, bridging, or open floc structure Floc characteristic, which was divided into firm, weak, round, irregular, compact, or diffuse The floc features, such as free cells in suspension, Zoogloeas, spirochaetes, and inorganic/organic particles also were examined The magnification was then increased to 200 and 400 in order to obtain more information to support the observation under 100 magnification and to locate typical flocs for further identification under 1000 magnification. To determine the types and abundances of the filamentous organisms, a drop of immersion oil was applied on the top of the cover slip and the sample was observed at 1000 magnification. The following characteristics were used to identify a filamentous organism: existence of branching motility filament shape location attached bacteria existence of sheath existence of cell septa
filament cell shape and size (width and length) existence of sulfur deposits sulfur oxidation test reaction existence of other granules using Gram-staining reaction and Neisser-staining reaction
All measured sizes were done by the micrometer. The procedures of the sulfur oxidation test, Gram staining, and Neisser staining were done according to Jenkins et al. (2004). The procedure is summarized as follows: Gram staining: All Gram staining chemicals were obtained from Sigma Chemicals. An air-dried sample was stained for 1 min with Crystal Violet solution, rinsed 1 sec in DI water, stained for 1 min with Iodine solution, rinsed well in DI water, decolorized with a mixture of ethanol and acetone until no more purple dye ran off the slide, immediately rinsed with DI water, stained for 1 min with Safranin, and rinsed well again with DI water. The decolorization step is critical to the success of the Gram staining, and may take only 4-5 sec to slightly longer depending on the thickness of the sample smear. Under 1000 magnification with oil immersion with direct illumination, blue-violet was positive and red was negative. Neisser staining: An air-dried sample was stained for 30 sec with Methylene Blue solution and then rinsed for 1 sec with DI water. It was then stained with Bismark Brown for 1 min and rinsed well with DI water. Under 1000 magnification with oil immersion with direct illumination, blue-violet was positive and yellow-brown was negative. The Methylene Blue solutions was made by mixing two parts of solution A and with one part of solution B. Solution A consisted of 0.1g Methylene Blue, 5 mL 95% ethanol, and 5 mL glacial acetic acid to a final volume of 100 mL with DI water. Solution B consisted of 3.3 mL Crystal Violet (10% w/v in 95% ethanol) and 6.7 mL 95% ethanol to a volume of 100 mL with DI water. The Bismark Brown solution consisted of 333 mg Bismark Brown in 100 mL DI water. All important details during the identification process were recorded by a digital camera. Filamentous abundance index was scored according to the method described in Jenkins manual as shown in Table 2-9.
2-20
Table 2-9. Subjective Scoring of Filamentous Abundance.
Numerical value 0 1
2 3 4 5 6
a
Abundancea Explanation None No filaments observed Few Filaments present, but only observed in an occasional floc Some Filaments commonly observed, but not present in all flocs Common Filaments observed in all flocs, but at low density (1-5 filaments per floc) Very Filaments observed in all flocs at medium density (5-20 common per floc) Abundant Filaments observed in all flocs at high density (>20 per floc) Excessive Filaments observed in all flocs (more filaments than floc and/or filaments growing in high abundance in bulk solution)
Note: If an intermediate scale is used, such as some-to-common or 2.5, it means filaments present in some flocs in some level, but also presents in some flocs in common level.
2.6
Batch Tests for Oxygen Uptake Rate (OUR) and Nitrogen Uptake Rate (NUR)
For OUR tests, a 500 mL volume of mixed liquor was obtained from the activated sludge aeration tank and aerated for 1 hour to obtain an endogenous respiration level before starting the OUR test. Then a 500 mL volume of a pre-selected substrate type (acetate, dextrin, or starch) was added at an appropriate concentration and the DO concentration was measured with a YSI probe and meter and recorded at one-minute intervals. When the DO concentration dropped to about 2.0 mg/L, vigorous aeration or pure oxygen sparging was applied to rapidly increase the DO concentration to about 8.0 mg/L. The pH during the test was 7.0 to 8.0. The test was continued (typically 1.5-2 hours) until the OUR approached a constant value, which was close to its original endogenous respiration OUR. The linear change in the DO concentration versus time during the mix-only time was the OUR in mg/L-hr. This value was divided by the reactor MLSS concentration to obtain the specific oxygen uptake rate (SOUR) in mg O2/g VSS-hr. For NUR tests, a 500 mL volume of mixed liquor was obtained from the activated sludge aeration tank and placed in the 1.0 L test flask. Nitrogen gas sparging was used throughout the tests to keep oxygen out of the mixed liquor. Sodium nitrate was added to the mixed liquor before the substrate addition. A 500 mL volume of an organic substrate solution as described on section 2.4 (acetate or dextrin) was added at an appropriate concentration to the mixed liquor after 1 hour of purging with nitrogen gas. Samples were taken and filtered through a 0.45 m filter at 20 or 30 minutes interval and analyzed for NO3-N concentration. The linear decrease in the NO3-N concentration with time was the NUR in mg NO3-N/L-hr. The pH during the test was 7.0 to 8.0.
2-21
2.7
SRT Control
MLSS and effluent TSS concentrations were measured daily to determine the amount of mixed liquor to waste daily for SRT control. The required daily waste sludge volume was determined according to the following equation:
Daily waste sludge volume, L / d =
where: V Q SRT MLSS TSS eff
(2-2) MLSS ( SRT ) = volume of aeration basin, L = daily flow rate, L/day = target solids retention time, days = mixed liquor suspended solids concentration, mg/L = effluent suspended solids concentration, mg/L
MLSS (V ) TSS eff (Q ) SRT
2.8
Microbial Community Characteristics Using Automated Ribosomal Intergenic Spacer Analysis (ARISA)
A microbial community fingerprinting method was applied to evaluate bacteria population changes as a function of the anoxic selector designs. The method used is termed an automated ribosomal intergenic spacer analysis (ARISA) and is described in the following. Figure 2-5 provides a map of the microbial analysis procedure.
Sample collection
DNA extraction
PCR 1406F/23SR
Fragment analysis
(ARISA profiles)
PCR 8F/23SR
Cloning
Plasmid prep
Fragment analysis
PCR 1406F/23SR
PCR M13F/M13R
(Spacer length ID of clone )

Sequencing with 8F
(Specie ID of clone)
Figure 2-5. Flow Chart of the Molecular Work.
2.8.1 Sample Collection and DNA Extraction

Mixed liquor samples were collected from the aeration tanks of the two anoxic selector systems (S1 and S4, and during the aeration operation of the SBR. A 1 mL portion of the mixed liquor sample was centrifuged at 10,000 g for 10 minutes and the cell pellet was stored at -80oC for further processing.
2-22
DNA was extracted according to the UltraCleanTM Microbial DNA Isolation Kit protocol (MOBIO, CA).
2.8.2 ARISA Analysis

PCR was performed using a 5 end 6-FAM labeled version of the Universal primer 1406F (5-TGYACACACCGCCCGT) and the Bacterial-domain specific primer 23SR (5GGGTTBCCCCATTCRG). The 20 L reaction mixtures contained final concentrations of PCR buffer (Fermentas Inc, Ontario, Canada), 1.25 mM MgCl2 (Fermentas), 250 mM of each dNTP (Fermentas), 100 nM of each primer, 30 ng/ L BSA, 5 U of Taq polymerase (Fermentas) and 200 ng of template DNA. The reaction mixture was held at 95oC for 5 min, followed by 20 cycles of amplification at 95oC for 45 s, 55oC for 30 s, and 72oC for 120 s, with a final step of 72oC for 10 min in a thermal cycler. One microliter diluted PCR product was mixed with 0.5 L mixture of DNA internal size standards (150, 200, 250, 300, 400, 500, 600, 610, 700, 800, 900, 1100, 1300, 1500, and 1800 bp, BioVentures, Murfreesboro, Tennessee) and 15.5 L of formamide. Fragments were discriminated using an ABI 3100 16-cappillary genetic analyzer (Applied Biosystems, Foster City, California) with the POP-4 polymer. ARISA profiles were analyzed with DAx software (Van Mierlo Inc., Netherlands). A cutoff of 0.1% of the total peak area was used to exclude baseline noise.
Clone library construction and analysis: Clone libraries were constructed from S1 and SBR samples. PCR reactions were firstly performed using the Universal primer 8F (5AGAGTTTGATCCTGGCTCAG) and the primer 23SR. The reaction mixture was the same as the ARISA PCR, and the mixture was held at 94oC for 10 min followed by 20 cycles of amplification at 94oC for 40 s, 50oC for 60 s and 72oC for 180 s, with a final step of 72oC for 7 min. PCR products were ligated into the pCR4-TOPO vector following the manufacturer's instructions (Invitrogen, Carlsbad, California). The vectors were then transformed into One Shot TOP10 competent cells, also from Invitrogen.
Clone plasmids were harvested using an alkaline-lysis method previously described by Fry et al. (1994). The plasmid inserts were amplified using vector primers (M13F: 5GTAAAACGACGGCCAG and M13R: 5-CAGGAAACAGCTATGAC) and purified using the UltraClean PCR Clean-up Kit (MOBIO). ARISA profiles were then obtained for the clones. 16S rDNA sequences of the clones were determined by the Biochemistry DNA Sequencing Facility in University of Washington using the primer 8F. Sequences were screened using BLAST ((Altschul et al. 1990), http://www.ncbi.nih.gov/BLAST/). Alignment was done using MegAlign software (DNASTAR, Madison, MI). A phylogenetic tree was constructed using a neighbor-joining distance matrix.
Statistics methods: Similarity was calculated using the Bray-Curtis similarity index (Hruby 1987) (Spellerberg 1991):
2-23
(2-3) + n 2i ) where n1i and n2i are the numbers of the i-th species in samples 1 and 2 respectively.
similarity =
2 min(n 1i , n 2i )
(n
1i
Data were log transformed (log(n+1)) prior to similarity calculations. Diversity of ARISA profiles was calculated using the Shannon-Weaver diversity index (Shannon 1949) (Hill 2003): H = p i log(p i )
i =0 n
(2-4)
where p is the relative abundance (%) of each species i. Linear regression between abundance of each clone and DSVI value was calculated using the Pearson correlation index in Excel (Microsoft, Redmond, Washington).
2-24
CHAPTER 3.0
RESULTS
This chapter presents the performance results for the different operating phases, with emphasis on following the DSVI values and filamentous population characteristics. The phases are Phase I-start up through Phase V, with Phase V being the only operating phase to study single- versus four-staged anaerobic selectors. A summary of weekly microscopic observations on filamentous organism type and abundance is provided in Appendix A. Appendix B provides weekly averages of data collected in the influent COD NH4-N and NO3-N concentrations, aerobic reactor MLSS/MLVSS concentrations, SRT, DSVI, temperature, pH, and DO concentration, and effluent TSS, NH4-N, NO3-N, NO2-N and soluble COD (sCOD) concentrations. The startup date was October 21, 2005 and this was designated as week 1 of the operation and data reporting. Weekly average data are reported as respective weeks from this first week.
3.1
Phase I Start Up Results
In accordance with the Phase II investigation project plan, three aerobic systems without selectors were initially operated. The DSVIs in the three systems were only around 100 mL/g at start up, and gradually increased to 300 mL/g in two weeks, and sharply increased to above 1000 mL/g during the third week (Figure 3-1). With chlorination to Rc starting on Nov. 14th, the DSVI decreased from above 2000 mL/g to 400 mL/g and the chlorination was stopped on November 29. The anoxic selector systems (S1 and S4) were started on Nov. 11th and the DSVIs for both systems decreased without chlorine addition. Initially the high DSVI caused excessive solids loss from the S1 and S4 clarifiers. The effluent liquid was filtered with solids return to into aeration tank during November 15-17 to maintain MLSS and SRT. With continued improvement in DSVI improved the S1 and S4 clarifier operation improved so that the normal SRT control was possible by November 18 and 19 for S1 and S4, respectively. The DSVIs kept decreasing during weeks 4-6 and reached 350 mL/g in S1 and 300 mL/g in S4 on December 1. In the first week, Thiothrix sp. was dominant but Sphaerotilus natans were observed as common. In the second week, the dominant specie has shifted to S. natans and meantime Microthrix parvicella was identified as secondary dominant specie at a common-very common level. This may have been due to foam trapping in the aerobic reactors. Foam wasting is being used to help control this problem. Besides S. natans and M. parvicella, Nostocoida limicola III (few-some) was also identified in the third week. The Thiothrix sp. population had declined to a some level before the anoxic selector addition.
3-1
5000
Aerobic only, R
c
1 stage anoxic selector -R1
4000
4-stage anoxic selector, R-4
DSVI, mL/g
3000
Selectors added
Start Chlorination on Rc
2000
1000
0 10/27 11/2 11/8 11/14 Date

Figure 3-1. DSVI Versus Time for Aerobic-Only Reactor (RC) and Single- and Four-Stage Selector Reactors (S1 and S4) During Phase I Start Up. Chlorination was Started on Rc on 11/14/2005. Selector Operation Began on 11/11/2005.
11/20
11/26
In RC, S. natans and M. parvicella were the primary and secondary dominant species during weeks 4-6. Due to the chlorination, S. natans appeared very weak under the microscope and empty sheaths and broken filaments were ubiquitous. The S. natans population decreased from an excessive level to an abundant level on November 30. With the selectors, S. natans were still the dominant specie during weeks 4-6 but the population had decreased from an excessive level to an abundant level in S1 and to a very common level in S4. The secondary dominant specie shifted from M. parvicella to N. limicola III in S1and S4. The performance data in Appendix B shows complete nitrification with high effluent nitrate concentrations for all reactors. Biodegradable COD removal rates across the selectors were analyzed and the results are summarized in Table 3-1. On November 16, less than 50% of biodegradable COD was removed in the selectors, but the removal rates increased to 85% on November 21 and then slightly decreased to 77-80% on November 28.
3-2
Table 3-1. Summary of Selector Performance on Biodegradable COD (bCOD) Removal. Feed Flow Rate = 12 L/d. Flowrate Through Selector Including Recycles was 54 L/d. Date System Infl tCOD, mg/L Effl sCOD, mg/L bCOD in*, mg/L bCOD rem , mg/day Selector s soluble COD bCOD out of selector**, mg/d Selector bCOD removal effi ***, %
602 105.3 496.7 5960 Rc 590 82.5 507.5 6090 152 3753 38 S1 637 107.3 529.7 6356 210 171 168 168 3277.8 48 S4 667 91.3 575.7 6908 Rc 630 82.5 547.5 6570 100.8 988.2 85 11/21 S1 621 103.2 517.8 6214 153.4 118 116.6 120.6 939.6 85 S4 666 70.8 595.2 7142 Rc 621 54.1 566.9 6803 79.4 1366.2 80 11/28 S1 611 62.9 548.1 6577 131.2 89.4 89.0 90.8 1506.6 77 S4 Note: * Biodegradable COD = influent tCOD effluent sCOD ** Mass of bsCOD out of selector = flow rate in selector*(last stage selector sCOD effluent COD) *** bCOD removal rate in selector = (mass flow of bCOD mass of bsCOD out of selector)/mass flow of bCOD
11/16
3.2
Phase I Operation Results
Phase I is taken as the operating period following start up after December 1 and before the S1 and S4 system mixed liquors were combined split and restarted on February 6, 2006. Figure 3-2 below shows that the control system without the selector (system Rc) had extremely high SVIs that could only be controlled by periodic chlorine addition. The dominant filamentous bacteria was S. natans before January 12th, but Thiothrix sp. became dominant during January 12th-20th instead of S. natans. After January 27th, S. natans became dominant again. On February 7th the operation of Rc was terminated as it was well established that the system produced extreme DSVI values. The DSVI values for S1 and S4 are shown in Figure 3-3. The time axis in this case is given as the day of operation from the system start up date of October 21, 2005.
3-3
5000 Rc 4000
DSVI, mL/g
3000
2000
1000
0 11/10 11/30 12/20 Date

Figure 3-2. DSVI vs. Date for Control Reactor (Rc) with No Anoxic Selector. (Chlorination on CMAS on 11/17-11/30, 12/9, 12/11, 12/16, 12/18, 12/20, 12/21, 12/25, 12/29, 12/30, 1/4, 1/7, 1/11, 1/17, 1/18, 1/19, 1/27, and 1/30).
1/9
1/29
After December 1 (Day 41) the DSVI values between S1 and S4 diverged with the values increasing for S1 from 350 to 450 and then dropping to about 200 mL/g near Day 72, while the DSVI for S4 steadily decreased to 130 mL/g on Day 72. . After that significant unexpected operational upsets occurred for the S1 system. On Day 78, theS1 aerobic reactor outlet line was clogged causing overflow of mixed liquor from the selector reactor. On Days 81-84, the S1 anoxic reactor received none or inadequate nitrate due to a pump failure and then tubing failure. The lack of nitrate dramatically affected the selector performance with the DSVI in S1 jumping from 393 mL/g on Day 80 to 533 mL/g on Day 84 and peaking at 596 mL/g on Day 86. .During this time the DSVI for S4 remained in the 140 mL/g range. With the nitrate feed restored, the S1 DSVI returned to near its former level by 91 to 424 mL/g. The S4 waste sludge was added to S1, from Day 91 to Day 104 in an attempt to see if seeding from S4 would improve the DSVI for S1. Before adding the daily S4 waste sludge the S1 waste sludge volume was double the normal amount so the net effect was the same SRT. This had little impact, as the S1 DSVI only decreased to 372 mL/g on Day 104. The increase in the DSVI values for both systems on day 105 is unexplained as there was no known upset or change in operation.
3-4
600 500 400 300 200 100 0 40 1 S1 S4
DSVI, mL/g
50
60 70 80 90 Day from start up
100
110
Figure 3-3. DSVI Versus Operating Day for Single- and Four-Stage Anoxic Selectors for Phase I. Days are From Start Up Date of Experimental Systems. 1-Failure of Nitrate Feed Pump in System S1.
In S1, a Thiothrix sp. population gradually increased and became dominant at a very common level on Day 83 although a N. limicola population was still at a very common level. In the later days of January (Days 97-101), Thiothrix sp. and N. limicola continued characterizing the flocs in S1. In S4, N. limicola was the dominant specie at a very common level throughout Days 70-101 and was followed by Thiothrix sp. or Type 021N at a some-common level. Figures 3-4 through 3-6 compare microscopic observations for Rc, S1 and S4. The greater filamentous organism extension from the floc, higher filamentous organism density, and greater bridging of floc by filaments appear to correlate well with higher DSVIs for Rc, S1 and S4, respectively.
3-5
Figure 3-4. Wet Mount of CMAS Mixed Liquor at 100X Magnification on Day 104.
Figure 3-5. Wet Mount of S1 Mixed Liquor at 100X Magnification on Day 104.
3-6
The average performance results shown in Appendix B. summarize the main operating parameters of the three systems during the Phase I operation. For Days 70-105 (weeks 10-15), the MLSS concentrations of S1 and S4 were close and the F/Ms based on the first stage volumes of the selectors were 3.9 g sCOD/g MLSS-d and 17.4 g sCOD/g MLSS-d for S1 and S4, respectively, which were close to the designed values of 3.8 g sCOD/g MLSS-d and 15 g sCOD/g MLSS-d. Table 3-2 shows that there was sufficient nitrate/nitrite in the selector reactors so as to not limit the COD uptake.
Table 3-2. NOx-N Concentrations in the Last Stage of the Anoxic Selectors for Phase I Operation.
Week 7 8 9 10 11 12 13 14 15
S1 28.0 23.3 6.1 3.3 3.1 6.7 16.6 24.3 11.0
Anoxic Selector System S4 22.7 18.8 0.7 0.6 0.6 0.6 4.8 15.1 4.0
Table C-1 in Appendix C summarizes the biodegradable soluble COD (bsCOD) removal profiles for the two anoxic selector systems in Phase I. The mass of bsCOD out of the selectors was calculated by multiplying the flow rate through the selector and the COD difference between soluble COD of the last stage of the selectors and effluent soluble COD. The bsCOD out of the selector should include unconsumed rbCOD from the feed, hydrolysis products from the slowly biodegradation component in the feed, and soluble portions of complex carbohydrates. The rbCOD was determined by the floc-filtration method (Section 2.5.5). For selector floc-filtration
COD measurements, the mixed liquor in the last stage of the selectors was first filtered through a paper towel. From the COD profile in Table C-1, about 22-30% rbCOD leaked out of S1 selector and 10-34% rbCOD leaked out of S4 selector. It was reasoned that the differences in the DSVI performance between the single- and four-stage selector systems was due to either the staging effect in the multiple-stage system or to other differences in the operating conditions for the two systems. One concern was whether the systems were receiving similar ratios of the feed constituents as that depended on the multiple head pumps providing similar flow rates. Results of weekly influent grab samples suggest that the feed COD concentrations to S1 and S4 were similar (Table 3-3).
Table 3-3. Measured Influent total COD Concentration for Lab Systems in Phase I Operating.
Week 7 8 9 10 12 13 14 15
Rc 609 584 620 641 616 661 732 586
Bench-Scale Systems S1 500 521 561 522 478 526 476 495
S4 513 542 590 545 525 519 494 553
However, changes were made in the feed system (described in Section 2.3.3) and the mixed liquors for S1 and S4 were combined and split and the operation was again repeated. This is designated as the Phase II operation.
3.3
Phase II Operation Results
Figure 3-7 shows the DSVI values from of S1, S4, and SBR for Phase II (Day 108 to Day 172. After combining the mixed liquors, the DSVIs in S1 and S4 were around 350 mL/g and both gradually increased to 700 mL/g and 450 mL/g respectively.
3-8
800 700 600 DSVI, mL/g 500 400 300 200 S1 S4 SBR
b a
c ef d g
100 0 100
110
120
130 140 150 Day from start up
160
170
Figure 3-7. DSVI Values Versus Day of Operation from Start Up for Phase II Operation. Operation changes and problems: a-Long chain fatty acids were eliminated from the feed. b-Components changed in the feed: short-chain fatty acids (from 50% to 60% as total COD), complex carbohydrates (from 25% to 30%), and organic nitrogen (from 25% to 10%); c-No nitrate fed to S1 for 12 hours, d-Sludge leaked from internal recycle tubing for S4, e- accumulated starch in feed line blocked organic feed to S1 for about 8 hours, f-S1 organic feed line blocked again by starch for about 5 hours, g-S1 Clarifier underflow outlet was partially blocked sludge accumulated.
After the removal of LCFAs from the feed on Day 118, the DSVI values in S1 and S4 did not drop, but instead slightly increased to 770 mL/g and to 480 mL/g respectively. After about 10 days following removal of the LCFAs the DSVIs in S1 and S4 started dropping (Day 128) and reached 340 mL/g and 310 mL/g on Day 133, respectively (note that a 12-hour period with no nitrate feed period occurred in S4 on Day 130). After the feed compositions was changed to increase the SCFAs and starch concentrations both anoxic selectors systems had increases in DSVI values, with much higher increases for S1, going back up to 680 mL/g and dropping to about 500 mL/g, compared to a range of about 380 mL/g for S4. Nitrate feeding was interrupted for S4 for about 12 hours on February 28th (Day 130) and S1 was not fed with nitrate for about 12 hours on March 6th (Day 136) due to feed pump problems. Following these upsets the DSVI increased in both cases, but the increase was much more dramatic in S1 thanS4. After Day 150, the S1 DSVI values began to decline and reached 300 mL/g on Day 160. At that time the S4 DSVI value was 220 mL/g. Subsequently, a series of operating upsets
occurred in the systems (more so for S1), over a 10-day period, such that a comparison of the two anoxic selectors performance after Day 160 is not reasonable. On Day 162 and 167 the organic feed line for S1 was blocked with a sticky coating from the feed starch and S1 did receive sufficient COD to the anoxic zone, which increased the nitrate concentration to the clarifier. That caused floating sludge problems in the clarifier and a loss of mixed liquor solids. The DSVI values for the SBR continued to drop after its startup on Day 119 of Phase II and fell to 120 mL/g on Day 133 and slowly dropped to under 100 mL/g between Day 150 and Day 160. The DSVI value began increasing on Day 154 and reached 160 mL/g on Day 172, which was still below that for S1 and S4. The increase may have been related to the increased starch concentration in the feed. Figure 3-8 shows influent total COD and soluble COD for the two systems since the selector additions. It shows that differences of influent total COD between S1 and S4 were small before Day 133, at the time when the starch concentration was increased. The differences then were mainly due to a greater tap water flow for S1 than for S4. After the feed composition change on Day 133 there was a much greater difference in influent total COD concentrations, although there was little difference in the influent soluble COD concentrations. This suggests that S4 was receiving more insoluble starch than S1. High populations of N. limicola, Type 021N, and Type 1851 existed in S1 and S4 sludge throughout Phase II. In S1, N. limicola was the dominant filament before Day 126 and was identified as the secondary dominant specie following Type 021N after Day 126. Both filaments were in a very common level throughout Day 108 to 170 and at the end of Phase II N. limicola was the dominant specie in S1. In S4, Type 021N started replacing N. limicola as the dominant specie after Day 140 and both filaments were in common-very common or very common levels before Day 140. By the end of Phase II Type 1851 was the dominant filament in S4. For the SBR, the populations of all the filamentous species declined after start up. .N. limicola was the dominant specie at an abundant level and Type 021N was the secondary dominant specie in a very common level right after the startup. On Day 140 to Day 172, N. limicola was still dominant but in a common-very common level and followed by Type 021N at a few-some level.
3-10
800
700
0.8
600 COD, mg/L 0.6 500 0.4 400 tCOD-S1 300 sCOD-S1 tCOD-S4 sCOD-S4 200 Nov/11
sCOD/tCOD ratio
Increased starch/dextrin concentration in the feed on March 2nd
0.2 s/t-S1 s/t-S4 0
Dec/9
Jan/6
Feb/3 Date
Mar/3
Mar/31
Figure 3-8. Influent COD Concentration for S1 and S4 Since Start Up.
Photomicrographs of the mixed liquor samples from the SBR, S1, and S4 reactors are shown in Figures 3-9 to 3-11. The SBR shows significant filamentous growth, but not as much filament extension from the floc as for S1 and S4.
Figure 3-9. Wet Mount of SBR Mixed Liquor at 100X Magnification on Day 168.
3-11
Figure 3-10.Wet Mount of S1 Mixed Liquor at 100X Magnification on Day 168.
3.4
Phase III Operation Results
The mixed liquors of S1 and S4 were combined and then equally split between the two systems on Day 172. Average values for key operating and performance parameters in the S1, S4, and SBR systems during Day 172-216 are listed in Table 3-4. With an average 5-day SRT, the MLSS concentrations in S1 and S4 averaged 1923 mg/L and 1789 mg/L, respectively, which were lower than the SBR MLSS concentration of 2484 mg/L. The higher SBR MLSS concentration may have been due to it having a higher feed strength and/or a shorter aeration period of only about 16 hours/day, due to time for settling and decanting.
3-12
Table 3-4. Average Values of Important Operating and Performance Parameters and COD Profiles in the Three Systems During Day 172-216 (standard deviations are included in parentheses).
S1 sCOD, mg/L(n=4) Influent Selector 1st stage 2nd stage 3rd stage 4th stage Effluent Acetate, mgCOD/L (n=2) Influent Selector 1st stage 2nd stage 3rd stage 4th stage Effluent MLSS, mg/L (n=39) 1st stage Selector F/M, g sCOD/g MLSS-day, (n=4) SRT, day (n=39) pH (n=42) Selector 1st stage 2nd stage 3rd stage 4th stage Aeration tank 490 (56.4) 46 (2.1)
S4 501 (47.6) 74 (11.3) 48 (4.8) 44 (1.4) 42 (2.9) 17 (5.6) 262 (13.6) 52 (4.2) 16 (9.3) 3 (3.6) 2 (2.7) 0 1789 (155) 12.7 (2.52) 5.0 (0.2) 7.8 (0.13) 8.0 (0.11) 8.0 (0.14) 8.1 (0.15) 8.0 (0.10)
SBR 494 (24.1) -
19 (2.2) 289 (17.6) 3 (0.1)
24 (5.0) 251 (17.5) 3 (1.8)
0 1923 (168) 3.0 (0.63) 5.0 (0.0) 8.0 (0.19)
0 2484 (190) 4.9 (0.3)
7.9 (0.10)
8.2 (0.27)
The high pH in the three systems was likely due to alkalinity from the feed nitrate addition relative to the alkalinity consumed from nitrification due to the limited ammonia feed concentration. The aeration tanks DO concentrations were always above 4 mg/L. The COD removal efficiencies were above 95%, with more than 98% acetate removal in the anoxic phase in the three systems. This indicates that the most of the available COD that leaked into the aeration zones was high molecular weigh substrates, which included soluble COD (8-9% of the influent COD) detected in the last stage of the selectors and the adsorbed substrates on the flocs. Table 3-5 below shows that there was sufficient nitrate/nitrite electron acceptor in the selector anoxic reactors during the Phase III operation.
3-13
Table 3-5 NOx-N Concentrations in the Last Stage of the Selectors, mg/L
Week 16 17 18 19 20 21 22 23 24 25 26 27 28 29
S1 9.0 ND 8.7 6.5 9.5 5.6 1.3 9.7 1.9 1.2 ND 3.3 3.6 7.7
S4 12.5 ND 12.1 9.7 6.6 6.1 2.7 18.2 0.9 4.0 ND 3.5 14.0 14.9
From Day 172 to Day 187 (Figure 3-12), lower DSVIs occurred with increased selector staging: S1 to S4 to SBR. For eliminating possible differences between S1 and S4 systems other than the selector staging, the single-stage selector was switched with the four-stage selector on Day 187 and other operations (feed pumps, air pumps, and clarifiers) were kept unchanged. After the switching, the DSVIs of the four-stage selector system (S4') again dropped below that for the single-stage selector (S1'). Both systems showed a slight increase in SVI after the tap water feed failure incident on Day 198, but then the DSVI values continued to decline. The DSVI of the SBR continued to stay below that for S4. The SBR DSVI values started to increase at the beginning of the Phase III operation, and reached 180 mL/g on Day 182. Dextrin and starch were removed from the feed on Day 183, and the SVI continued to increase over the next two days to reach 225 mL/g on Day 185 and remained at that level for a week. On Day 192, the DSVI value for the SBR started dropping and reached 150 mL/g on Day 199, but increased again and reached 200 mL/g on Day 206. Following the removal of glucose from the SBR feed, the DSVI value decreased down to 121 mL/g on Day 216. By Day 199 the DSVI value of the four-stage selector dropped below that for the single-stage selector and remained lower for the rest of Phase III. Further tests were done with the S1 system to evaluate the effect of the slowly degradable substrate. After Day 217, the dextrin slowly biodegradable COD (sbCOD) was removed from the feed ,and by day 262 the DSVI dropped to 90 mL/g, similar to the SBR without sbCOD (data not shown). But then with dextrin added in the feed on day 297, the DSVI of S1 again gradually increased to 180 mL/g (Figure 3-13). These results suggest that the filamentous population growth and its impact on DSVI was related to the availability of sbCOD. If the staged-anoxic selector systems, which had lower DSVIs, could remove more sbCOD than a single-staged anoxic system in the anoxic zone, then the higher DSVIs could be related to more sbCOD entering the aerobic zone.
3-14
500
b
450 400 DSVI, mL/g 350 300 250 200 150 100 170 180 190 Day 200 210
SBR S1 S4 S1' S4'
Figure 3-12. DSVI vs. Time in S1, S4, and SBR After Combining Mixed Liquor of S1 and S4 on Day 172 (April 11th, 2006) (S1 and S4 Represented S1 and S4 After the Selector Switch). a. Starch and Dextrin were Removed in the SBR Feed and rbCOD was Increased on Day 182; b. S1 and S4 Selectors were Switched on Day 187; c. Glucose, Lactose, and Maltose were Removed in the SBR Feed on Day 205; d. Dextrin, Starch, Glucose, Lactose, and Maltose were Removed in the S1 and S4 Feed on Day 216.
200
150
DSVI, mL/g
100
a
50
0 267 273 279 285 291 Day 297 303 309 315
Figure 3-13. DSVI in S1 Before and After Addition of Dextrin in the Feed. a. Start Adding Dextrin in the Feed From 25 mg/L on Day 297 to 100 mg/L on Day 304; Other Organic Components were Kept Unchanged.
3.4.1 Substrate Removal Batch Kinetics Tests

Results from batch kinetics tests in Table 3-6 indicate that under anoxic conditions, acetate uptake rates was 4-6 times faster than dextrin uptake rates. The uptake rates of starch
were very slow and at the same level with the endogenous respiration, which agrees with the endogenous respiration rates reported previously (Dueholm et al., 2001). There is no statistical difference between NUR using S1 mixed liquor and those using S4 mixed liquor (p=0.89). Observed yields, including cell synthesis and storage, for acetate were 57% with mixed liquors from either S1 or S4. The adsorption/desorption processes involved in the consumption of dextrin and starch make it complicated to accurately calculate observed yield. Under aerobic conditions (Table 3-7), acetate uptake rates were 10 times higher than dextrin uptake rates. OUR with starch was not measurable since it was at the same level with the endogenous respiration. No trend was observed for acetate uptake rates under different floc loading rates or with different mixed liquors. Observed yields for acetate were in a range of 6472% for the OUR tests. After subtracting the endogenous respiration rates, uptake rates of acetate under anoxic conditions were similar to those under aerobic conditions, while uptake rates of dextrin were found to be 80% higher under anoxic conditions.
Table 3-6. Batch Test Results for NUR (Standard Deviations are Included in Parentheses).
S1 Floc loading, gCOD/gVSS 0.11 0.22 0.18 0.24 NUR, mgO2/gVSS-h 58.3 53.6 17.2 5.9 6.6 (3.6) Floc loading, gCOD/gVSS 0.13 0.19 0.18 0.24 -
S4 NUR, mgO2/gVSS-h 62.6 53.2 13.2 5.0 5.6 (3.3)
Acetate Dextrin Starch Endogenous
Table 3-7. Batch Test Results for OUR.
S1 OUR, Floc mgO2/gVSS loading, -h gCOD/gVS S 0.08 42.6 Acetate 0.17 48.4 Dextrin ND Starch ND ND not determined Floc loading, gCOD/gVS S 0.08 0.18 0.20 0.20
S4 OUR, mgO2/gVSS -h 65.7 59.2 5.4 0
SBR Floc loading, gCOD/gVS S 0.15 OUR, mgO2/gVSS -h 56.5 ND ND ND
Dextrin degradation kinetics was determined by batch tests under anoxic conditions. The test results show that degradation of dextrin followed a first-order kinetics model (Figure 3-14) under low floc loadings (<0.5 gCOD/gVSS). Linear curve fit for the first 5 data points in Figure 3-14 yield the following equation:
Y = 1.24(hr -1)X 0.18 (R =0.99)
2
(3-1)
3-16
where Y is the removal rate of dextrin under anoxic condition (g COD/g VSS-hr); X is the floc loading rate (g COD/g VSS). The trendline did not cross the coordinate root (0,0) because of dextrin residue in the testing mixed liquor obtained from S1 aeration tank. The first-order kinetics model was applied to the three anoxic selector systems to estimate the dextrin concentration at the beginning of the aerobic stage for the SBR or entering the aerobic reactor for the continuous flow systems. With an influent dextrin concentration of 150 mg COD/L and considering dilution by recycle streams (neglecting dextrin residue), the initial concentration in the single stage and four stage selectors is about 38 mg/L. Based on a 1.7hour selector HRT (nominal HRT of 0.43 hour), the effluent dextrin concentration from the single stage and four-stage selectors would be about 25 and 23 mg COD/L, normalized to the influent flow rate. For the SBR system, the dextrin concentration right after feeding the same influent concentration as the continuous flow systems is about 70 mg COD/L, accounting for the dilution effect of the SBR volume present before the feed volume of 2 L. By the end of the 0.5hour anoxic contact time the dextrin concentration is estimated at about 38 mg COD/L. Thus this analysis shows that the amount of dextrin to be removed in the aerobic phase is greater for S1 (66%), then S4 (61%) and then the SBR (54%).
Initial removal rate of dextrin, g COD/g VSS-h 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 y = 1.24x - 0.18 R = 0.99
2
0.0
0.50
1.0
1.5
2.0
2.5
Floc loading, g COD/g VSS
Figure 3-14. Result of Dextrin Kinetics Test Under Anoxic Conditions.
Profile testing results shown in Table 3-8 provide a useful understanding about the amount and type of feed COD entering the aerobic zone after the anoxic single- or four-stage selectors. The acetate concentration measurements were very similar between the S1 anoxic zone and S4 last anoxic zone effluents and aeration tank mixed liquor, suggesting that most of the acetate was removed in the selectors and that the values shown are more likely at the acetate concentration measurement limitations. There was only a small difference in rbCOD effluent concentrations from the two anoxic selectors. On the other hand, a significant amount of dextrin enters the aeration zone and a comparison of the measured dextrin COD concentrations to the
selector effluent soluble COD concentrations suggest that most of the dextrin is sorbed on to the solid phase. The four-stage selector was more effective at dextrin removal in the anoxic zone than the single-stage selector, as expected based on the kinetic testing results shown above. These results suggest that dextrin may play a significant role on the filamentous population in the test systems.
Table 3-8 Profiles of COD, Acetate, Dextrin, and PHB for S1 and S4 on Day 185. (All Data are Averages of Duplicate Samples Except Dextrin/Starch Concentrations).
Location Influent-total Influentfiltered rbCOD Selector (1st zone) 2nd zone 3rd zone 4th zone Selector rbCOD in the last zone Aeration tank RAS Effluent
COD 417 430 285.9 43.55
S1 (mgCOD/L) Acetate Dextrin 136.2 190.7 55.0
PHB
(% of dry weight)
COD 442 435.5 309.5
S4 (mgCOD/L) Acetate Dextrin 120.2 179.1 64.0
PHB
(% of dry weight)
9.1
83.8
4.18
63.2 42.4 43.5 40.15
26.4 8.3 8.5 8.3
94.4 64.8 68.9 60.7
4.91 4.78 4.58 4.26
6.8 28.3 16.7 7.9 63.2 95.2 2.73 2.19
5.7 40.9 13.3 7.8 45.1 106.7 2.88 2.54
3.4.2 Microscopic Observations

Microscopic observation showed that the prevailing filamentous species were N. limicola II and Type 1851 in S1(S1), S4(S4), and SBR during Day 172-216 (Appendix A). The abundant levels of both filaments were between very common to abundant in the three systems. The N. limicola II observed was irregularly curved, 100-200 m in length, and present within flocs or opening floc structure. Both Gram and Neisser staining were positive for the specie. Type 1851 in the systems was smoothly curved, typically >200 m in length, and present within flocs. They were easy to identify due to forming bundles by intertwined filaments. Gram staining was variable and Neisser stain was negative for Type 1851. Although the SBR DSVI values were always lower than those in S1 and S4 (Figure 3-11), it had a very abundant filamentous population. Figures 3-15 to 3-17 are photomicrographs of mixed liquor samples from the SBR, S1 and S4 systems, respectively. The amount of filament length extending from the floc is higher for S1, than S4 and then the SBR system, which correlates well with higher DSVI values for S1 versus S4 versus the SBR systems. Thus, even though the SBR system had an abundant level of
3-18
filaments, it was not too detrimental to the sludge settling properties as measured by the DSVI, which is most likely due to the fact that filament extension from the floc was less.
Figure 3-15. Wet Mount of SBR Mixed Liquor at 100X Magnification on Day 202.
3-19
3.4.3 Bacterial Community Fingerprinting

In total, there were 108 peaks identified with a cutoff of 0.1% in 18 ARISA profiles that were generated from 3 reactors for 4 selected days. Diversity of ARISA profiles from SBR decreased while those from S1 and S4 increased during Days 174-216 as shown by the ShannonWeaver indices (Figure 3-18). Table 3-9 shows the averaged Bray-Curtis similarities between ARISA profiles. Variability generated by the steps of DNA extraction, ARISA PCR, and fragment analysis was examined and shown as the standard deviations in Table 3-0. The small standard deviation values indicate good replica ability of ARISA. The similarities for the samples collected on the same day in the three reactors were pulled out from Table 3-9 and shown in Figure 3-19. Two days after mixing the communities together, the ARISA profiles for S1 and S4 remained 85% similar. Without feed adjustment during the period, similarity between S1 and S4 decreased with time. ARISA profiles for S4 were more similar to SBR than were the S1 profiles at all three sampling times (p=0.1).
3-20
-3
Shannon-Weaver diversity index
-2.5
S1 S4 SBR
-2
-1.5
-1
-0.5
Day 174
Day 185 Sampling time
Day 216
Figure 3-18. Shannon-Weaver Diversity Index of ARISA Profiles. Table 3-9. Calculated Bray-Curtis Similarity Between ARISA Profiles for S1(S1), S4(S4), and SBR Samples. (Standard Deviations are Included in Parentheses)
S1 Day 174 S1 Day 174 S4 Day 174 SBR Day 174 S1 Day 185 S4 Day 185 SBR Day 185 S1 Day 216 S4 Day 216 SBR Day 216 SBR Day 230 85 (6) 44 (1) 60 (1) 62 (4) 40 (5) 55 (3) 51 (4) 49 (4) 30 (2)
S4 Day 174 47 (0) 59 (2) 61 (5) 40 (1) 49 (1) 47 (0) 48 (1) 30 (-)
SBR Day 174
S1 Day 185
S4 Day 185
SBR Day 185
S1 Day 216
S4 Day 216
SBR Day 216
38 (1) 43 (0) 43 (1) 41 (1) 56 (1) 44 (3) 49 (0)
73 (7) 44 (3) 60 (4) 60 (7) 50 (4) 30 (2)
54 (2) 56 (5) 64 (1) 54 (3) 34 (5)
39 (5) 51 (1) 49 (1) 31 (0)
69 (6) 49 (2) 46 (3)
54 (3) 52 (0)
31 (3)
3-21
100
80 Similarity, %
Day 174 Day 185 Day 216
60
40
20
S1' vs SBR
Figure 3-19. Calculated Bray-Curtis Similarity Between Same-Day ARISA Profiles for S1(S1), S4(S4), and SBR Samples.
Among the 108 peaks, 23 of them from 38 clones were identified by 16S rDNA sequencing. The identified peaks corresponded to an average of 68% (12%) of total ARISA peak area. A phylogenic tree was constructed using a neighbor-joining distance matrix with the sequences of the 38 clones and sequences obtained from the GeneBank (Figure 3-19). We used ARISA fragment length instead of ITS length because of the presence of sometimes substantial length variation within the 16S and 23S rDNA regions (Brown et al., 2005). Of the 108 peaks, four were shared in all ARISA profiles, and these were 403 bp (Flexibacteraceae), 607 bp (Flexibacteraceae), 761 bp (Rhodocyclus spp.), and 876 bp (Rhodocyclaceae). The shortest ARISA fragment in the samples was 403 bp (Flexibacteraceae), and the longest fragment was 1361 bp, and the longest identified fragment was 1168 bp (Cytophagales). The largest ARISA peak was associated with Rhodocyclus spp. (fragment length: 761 bp) in S1 on Day 174, Day 185, and Day 216, but in S4 only on Day 174 and Day 185. Conversely, Rhodocyclaceae (fragment length: 876 bp) was dominant in both S4 and SBR on Day 216.
3-22
S4' vs SBR
S4 vs SBR
S4 vs SBR
S1 vs SBR
S1 vs SBR
S1' vs S4'
S1 vs S4
S1 vs S4
EF051165 Archaea 79 AB079638 Kouleothrix aurantiaca Abundance 52 AB079646 Green non-sulfur bacterium 97 GX18 (508) 0.2-6.1 100 GX45 (525) 0.5-7.9 AY063760 Eikelboom Type 1851 GX27 (670) 0.1-0.5 37 UCRDNA16S Nostocoida limicola II X85212 Nostocoida limicola II 30 88 GX47 (613) 0.6-8.1 DQ007321 Tetrasphaera jenkinsii 100 DQ007319 Tetrasphaera jenkinsii Y14597 Nostocoida limicola II Y14597 Nostocoida limicola II GX36 (613) 0.6-8.1 100 GX25 (613) 0.6-8.1 AF408957 Tetrasphaera sp. 51 GX31 (774) 99 0.5-1.1 99 GX22 (774) 0.5-1.1 100 AB117709 Uncultured alpha proteobacterium AF234739 Uncultured alpha proteobacteria GX34 (845) 41 0.6-6.0 90 L79962 Thiothrix fructosivorans 100 DQ413122 Uncultured Thiothrix sp. 99 AF148516 Thiothrix sp. L79965 Thiothrix sp. 68 AB042819 Thiothrix sp. 100 GX19 (854) 0.2-2.7 61 60 GX46 (845) 0.6-6.0 100 GX49 (876) 47 1.7-26.8 AF072924 Uncultured Rhodocyclaceae 98 76 AY691423 Rhodocyclus sp. D16209 Rhodocyclus tenius 50 93 AY823971 Unclutured beta proteobacterium 92 GX8 (761) 2.5-40.1 99 GX13 (761) 2.5-40.1 99 GX14 (761) 2.5-40.1 76 85 DQ211381 Uncultured gamma proteobacterium GX15 (816) <0.1 100 GX29 (787) 0.1-0.2 AF368181 Uncultured Acidobacterium group bacterium AJ619064 Uncultured Acidobacteria bacterium 100 44 GX28 (564) 0.2-9.4 100 GX39 (712) 0.3-9.8 GX26 (564) 0.2-9.4 GX11 (685) 66 0.3-10.1 51 46 GX23 (685) 0.3-10.1 19 GX40 (555) 1.4-10.6 GX16 (555) 1.4-10.6 84 GX9 (686) 1.6-12.5 100 GX12 (685) 0.3-10.1 100 AY491639 Uncultured Leadbetterella sp. AY854022 Leadbetterella byssophila GX41 (555) 1.4-10.6 DQ376571 Uncultured Leadbetterella sp. 100 GX30 (403) 0.5-6.8 GX33 (403) 99 0.5-6.8 GX10 (403) 96 60 0.5-6.8 GX20 (403) 0.5-6.8 53 AB185013 Uncultured Leadbetterella sp. 82 40 GX42 (608) 0.5-5.4 M62786 Runella slithyformis 100 DQ413105 Uncultured Runella sp. 98 X85209 Uncultured Runella sp. 85 DQ372985 Runella sp. 100 GX37 (461) 100 0.1-1.4 GX43 (681) 0.3-0.9 DQ207362 Dyadobacter sp. 80 73 AF314419 Uncultured Flexibacter sp. GX21 (1167) 0.1-7.2 100 GX35 (805) 0.1-14.5 100 GX44 (805) 0.1-14.5 100 GX48 (805) 0.1-14.5 AY947955 Uncultured Bacteroidetes bacterium AY509319 Uncultured Bacteroidetes bacterium
Chloroflexi
Actinobacteria
Alpha proteobacteria
Gamma proteobacteria
Beta proteobacteria
Gamma proteobacteria Acidobacteria
Bacteroidetes
Figure 3-20 . Phylogenetic Tree Showing Relation Among 16S Genes of Bacterial Clones and Their Associated ARISA Fragment Lengths (Shown in Parentheses). Relative Abundance Ranges of Fragments (%) are Shown After Fragment Lengths. Clones from S1; Clones from SBR. The Tree was Constructed Using a Neighbor-Joining Distance Matrix. Bootstrap Values (100 tree interactions) are Indicated at the Nodes.
3-23
Eight clones were identified as close relatives of the filamentous organisms, Type 1851, N. limicola II, and Thiothrix spp.. These findings do match the types of the filamentous organisms identified by microscopy. The peaks areas contributed by these filamentous organisms are listed in Table 3-10. The contribution by the clones was relatively small (no more than 11%) compared to the relatively high DSVI and the microscopic observation. The observation agrees with another study on that small filamentous population can significantly impact SVI (Kaewpipat and Grady, 2002). Some ARISA data match what was observed under the microscope, for example, high population of Type 1851 and N. limicola II in SBR on Day 185. However, some ARISA data dont match the microscopic observation. For instance, abundant N. limicola II was observed under microscope for SBR on Day 174, but no identified peaks in the ARISA profiles from the same day sample showed evidences of existence of the filament. There are two possible reasons. One could be that only small portion of the peaks in the ARISA profiles were identified (23 out of 108), and some peaks that significantly contributed to the community was not identified, for instance, a peak (1008 bp) contributed 22.6% of the total peak area in the profile from SBR on Day 174 is still not identified. Alternatively, as the bulk of the microbial world remains uncategorized, there remains the possibility that an as yet unidentified filamentous organisms contributed to the results observed in this study.
Table 3-10. Relative Peak Area (%) for the Clones Close to Known Filamentous Organisms.
Clone name Closest (fragment relation length, bp) 18 (508) Type 1851 45 (525) Type 1851 25,36,47 (613) N. limicola II 27 (670) N. limicola II 19 (854) Thiothrix spp. 34 (845) Thiothrix spp. DSVI (mL/g) ND not detected.
S1 Day 174 0.5 0.5 ND ND 2.6 ND 290
S4 Day 174 0.2 ND ND ND 0.8 ND 262
SBR Day 174 ND ND ND ND ND ND 151
S1 Day 185 4.2 5.8 0.6 ND 2.6 ND 389
S4 Day 185 4.4 5.6 0.8 0.5 1.5 ND 235
SBR Day 185 2.8 3.9 8.0 ND ND 1.3 224
S1 Day 216 2.3 3.6 0.9 0.2 0.6 0.2 282
S4 Day 216 4.5 6.6 1.6 0.1 2.4 1.0 210
SBR Day 216 0.5 0.9 3.4 ND ND 5.7 121
SBR Day 230 ND ND ND ND 0.2 0.6 166
3.5
Phase IV Operating Results
At the beginning of Phase IV the DSVI value increased for both anoxic selector systems with the highest increase for S4 (Figure 3-20). At that time the NO3-N concentration in the selector effluent was minimal, suggesting that there was insufficient electron acceptor in the selector and acetate may have leaked into the aerobic zone to encourage filamentous organism growth. Figure 3-20 shows DSVIs for S1 and S4 ascended due to complete nitrate consumption in the selectors and leakage of acetate into the aeration tanks. On Day 221 the S4 system DSVI value was greater than that for the S1 system. After increasing the feed NO3-N and NH4-N concentrations, the S4 system DSVI value declined to 270 mL/g on Day 227. However, the S1 system DSVI value did not declined but increased to 400 mL/g on Day 230. After Day 230 the DSVI values for both systems increased. Hydrous bulking, based on microscopic observation, was diagnosed as the reason for the DSVI increase, and the influent COD (90% as acetate) was reduced by 40% after Day 230. However,
3-24
the DSVI values continued to climb and did drop appreciably by Day 242, when the anoxic selector study operation was terminated.
600 500 400 300 200 100 0 215 S1 S4 SBR
DSVI, mL/g
220
225 230 235 Day from start
240
245
Figure 3-21. Phase IV DSVI Values Versus Time.
After the removal of glucose, lactose, and maltose in the feed, the SBR DSVI values started declined to 120 mL/g on Day 217, stayed near that level for 9 days, and started increasing on Day 227. Hydrous bulking was also diagnosed as the reason for this DSVI increase. After the reduction of acetate COD in the feed, the DSVIs declined and reached 130 mL/g on Day 240. After removal of carbohydrates in the S1 and S4 systems feed, the Type 1851 filamentous population dropped to a common level in both systems, but due to the leakage of acetate through the selectors during the weekend after the feed change, Thiothrix sp. was identified at a common level in both systems on Day 223. In the SBR, N. limicola was the dominant and only filamentous specie observed during this period. The population dropped to a common-very common level after the removal of glucose and its dimers.
3.6
Phase V Anaerobic Selector Results
Though the system was seeded with activated sludge from an EBPR system with good phosphorus removal, the phosphorus removal in the lab system was not good and a number of operating changes were made in attempts to improve performance with the limited time left for
the Phase II investigation. The operating changes from June 27 to July 14 are summarized in Table 3-11.
Table 3-11. Summary of Changes of Feed Components and Operational Conditions.
No. 1 2 3 4
Date 6/27 6/27 7/7 7/7
5 6 7 8 9
7/10 7/13 7/13 7/14 7/14
Description Start using new feed recipe listed in Table 1. Increase NH4-N in the feed from 10 mg/L to 15 mg/L Start manually adding yeast abstract to aeration tank daily. Two third of activated sludge in S1 and S4 was replaced by Kalispell seed. Change SRT of S1 and S4 from 5 days to 6 days Remove peptone in the feed and add 14 mg/L casamino acid in the feed. Start adding 14 mg/L MgSO4 in the feed Raise FeSO47H2O in the feed from 1 mg/L to 5 mg/L. Restart S1 and S4 with Seattle King County South treatment plant seed
The same feed recipe as used at the end of the anoxic selector was used but at a lower initial COD concentration (acetate COD = 100 mg/L and peptone at 15% of the total COD) and with no influent NO3-N and a lower NH4-N concentration to minimize the NO3-N concentration in the return sludge to the anaerobic zone. An effluent NO3-N concentration goal of less than 5 mg/l was set. The initial feed acetate concentration was kept low at about 100 mg/L to match the expected acetate utilization capability of the Kalispell mixed liquor phosphorus accumulating organisms (PAOs). Previous work has shown that if the acetate fed to an EBPR system is too high, glycogen accumulating organisms (GAOs) can develop at high levels over the preferred PAOs. The plan was to increase the acetate concentration by about 25% every two days. From June 23rd- June 25th, the influent COD was gradually increased to 200 mg/L. The peptone and ammonia feed concentrations were also increased proportionately, but there was a possibility that the system nitrogen was not sufficiently increased with the COD feed increase on June 25th. One measure of acclimation and an increase in PAO activity is the soluble COD removal across the selector. For a well-operated system, just about all the acetate fed to the anaerobic selector zone should be removed. Soluble COD (sCOD) analyses of the S1 and S4 selector effluent on June 27th suggested poor acetate removal efficiency in the selector zones. The basis for this is that the sCOD concentrations were 55 and 66 mg/L for S4 and S1, respectively, compared to system effluent sCOD concentrations typically in the range of 15-25 mg/L. Based on these results that suggest incomplete acetate consumption, the feed sCOD concentration was no longer increased and the feed was changed to the composition given in the methods section in Table 2-4. However the selector effluent sCOD concentration still remained higher than expected for good EBPR performance (Table 3-12) with poor acetate removal for all samples for S1 and good on about of the samples for S4. The phosphorus removal and related EBPR operating characteristics are summarized in Table 3-13 and 3-14 for systems S4 and S1, respectively. Two barometers of good phosphorus removal efficiency are the COD removed to phosphorus (P) removed ratio and the anaerobic zone P release concentration. The P release concentrations shown in the table are normalized to
3-26
the influent flow rate. An efficient and well-performing laboratory EBPR system, fed primarily acetate for COD, is expected to have a COD/P removal ratio of between 10 and 20. In these analyses the COD removal is taken as the COD removed across the anaerobic selector zone. The results for S4 in Table 3-13 show a COD/P of 20-40 and a steady decline in the P release concentration. The P removal was variable from 4.3 to 10.0 mg/L from July 3 to July 12th. In addition as shown above there were periods of incomplete COD removal in the selector. For S1 (Table 3-12), the COD/P ratio is very good, but as mentioned above the COD removal across the selector is well below what is expected. By July 12th the phosphorus removal and phosphorus release in the anaerobic zone also appeared to be declining.
Table 3-12. Selector Zone Effluent sCOD Concentrations (mg/L) for S1 and S4 Based on Grab Samples.
Date (2006) 6-27 6-28 6-29 7-3 7-4 7-6 7-7 7-8 7-9 7-10 7-11 7-12
S1 66 48 68 79 77 72 56 55 55 62 47 57
S4 55 26 56 39 37 62 57 30 36 33 24 28
Better performance was expected but the cause for the lower than expected performance and decline in the P release concentration was not known. Because of the short time remaining for the study and the need to obtain a good EBPR operation, the system synthetic feed composition was periodically modified as shown above in Table 3-9. Casamino acid replaced peptone and the influent magnesium concentration was increased on July 13th. On July 14th the influent iron concentration was increased. The latter changes were made to avoid possible deficiency of trace minerals or macro inorganic. On July 10th, the target SRT was raised to 6 days in S1 and S4. Unfortunately, after these changes the soluble COD concentration in the two selectors were still high and on July 14th the system was reseeded with sludge from the King County Renton, WA wastewater treatment A/O activated sludge system. On July 15th batch P release and uptake tests showed that this sludge has little EBPR capacity and a new seed sludge source was requested from the Kalispell plant and arrived for reseeding on July 20th.
3-27
Table 3-13. Phosphorus Removal and Anaerobic Contact Zone Phosphorus Release Concentration Normalized to the Influent Flow for Anaerobic Selector S4.
Date 23-Jun 27-Jun 28-Jun 29-Jun 3-Jul 6-Jul 8-Jul 10-Jul 11-Jul 12-Jul
Infl. P mg/L 14.8 26.3 29.7 27 30.3 32.1 35.2 36.8 34.4 30.6
Effl. P mg/L 9.2 17.5 24.4 25 25.9 27.7 25.2 32 26.9 26.3
P removal mg/L 5.6 8.8 5.3 2.0 4.4 4.4 10.0 4.8 7.5 4.3
CODr/Pr ratio 9 25 41 21 14 30 24 36
Anaerobic P release mg/L 2.8 2.75 16.1 32.8 18.8 5.8 0.2 6.6 8.7 1.5
Table 3-14. Phosphorus Removal and Anaerobic Contact Zone Phosphorus Release Concentration Normalized to the Influent Flow for Anaerobic Selector S1.
Infl. P Effl. P P removal Date mg/L mg/L mg/L CODr/Pr ratio 22-Jun 13.75 8.0 5.8 24-Jun 27.4 21.4 6.0 27-Jun 25.25 21.5 3.8 18.2 28-Jun 29.4 23.6 5.8 13.1 29-Jun 23.7 22.4 1.3 3-Jul 29.9 26.0 3.9 26.5 6-Jul 30.3 21.8 8.5 3.6 8-Jul 33.0 23.5 9.5 9.3 11-Jul 31.7 26.6 5.1 16.0 12-Jul 31.5 27.9 3.6 14.2 the DSVI values were increasing in the two systems.
Anaerobic P release mg/L 10.3 10.8 21.3 16.8 16.1 26.1 21.1 25.7 22.3 14.0
Table 3-15 lists the changes for the feed composition and operating condition for the two anaerobic-aerobic (A/O) systems from 7/20 to 8/23. After the reseeding, the DSVI for S4 started increasing again on 7/31. The synthetic feed was further adjusted from 8/3-8/8: macro inorganic composition (K+, Ca2+, Mg2+) were reduced by half, phosphorus concentration was reduced from 30 mg/L to 20 mg/L, and deionized water was used for diluting the feed instead of using tap water. The DSVI for S4 was 229 mL/g on 8/8. In view of the limited time for the project and the concern for the deterioration of S4 performance the reactor was reseeded with the same Kalispell sludge on 8/8 that was used for the 7/20 reseeding (the Kalispell sludge was stored under 4oC). However, the phosphorus removal performance did not improve after the adjustments.
3-28
Typical HRTs designed for the anaerobic phase in an anaerobic-aerobic system range from 30 to 45 mins. The HRT for our systems was 90 min, which raised some concern about the possibility of secondary P release, which could reduce P removal performance. Thus, in an attempt to improve the phosphorus removal efficiency we reduced the selector volume on 8/11 to 3/4 of the original volume and further to 1/2 of the original volume on 8/14. However, the P performance did not improve after reducing the selector volume. On 8/23, the two A/O systems were shut down as the systems did not show any signs of sufficient enhanced (EBPR.
Table 3-15. Summary of Changes of Feed Components and Operational Condition for S1 and S4 Anaerobic Selector Systems.
No. 1 2
Date 7/20 8/3
3 4 5 6 7 8 9
8/5 8/8 8/8 8/8 8/11 8/14 8/23
Description Reseed two systems with Kalispell sludge Reduce macro inorganic (K+, Ca2+, Mg2+) by half Reduce P concentration from 30 to 20 mg/L in the feed and adjust macro inorganic proportionally Start using deionized water instead of tap water for diluting the feed Add half strength vitamins to the two A/O systems Reseed S4 with Kalispell sludge Reduce selector volumes to 3/4 of the original Reduce selector volumes to 1/2 of the original Stop operating the two anaerobic selector systems
Table 3-16 summarizes the soluble COD removal and P removal performance for selector S1 from the reseeding on 7/20 to 8/20. The selector soluble COD concentration ranged from about 33 mg/L to 55 mg/L on the last day before reseeding on 8/8. On 8/6 there was no P removal, and the cause for this process change was unknown. Following that change the COD removed to P removed ratio increased from a range of 5-11 mg/mg, which is considered very good for EBPR systems to 13 and 26 mg/mg. Thus, with concern that EBPR was declining the system was reseeded. Following the reseeding, the COD/P removal ratio was very good ranging from 4-9 mg/mg, but the soluble COD removal in the selector was still much less than expected with only about 25% removal. The phosphorus and COD removal performance is evaluated in a similar way for the four-stage anaerobic selector system. Based on two sampling profiles most of the soluble COD removed was taken up by the second cell of the four-stage selector. Table 3-17 summarizes the phosphorus removal and selector COD removed to P removed ratio. The amount of phosphorus removal steadily declined following the start up and seeding on July 20th to the reseeding event on August 8th. The COD/P removal ratio was variable and relatively high, except for August 3rd, before reseeding. After reseeding on August 8th, the amount of phosphorus removal steadily declined until terminating the operation on August 20th. Again, the cause of the deteriorating EBPR was unknown as the same feed composition had been used successfully in previous bench-scale biological phosphorus removal studies. The only difference was that the previous work was done with an SBR instead of a continuous flow system.
Date 7-21 7-22 7-24 7-26 7-28 7-30 8-1 8-3 8-4 8-6 8-7 8-8 8-10 8-11 8-12 8-13 8-14 8-15 8-16 8-17 8-20
Table 3-16. P and COD Data for S1 (mg/L), CODr/Pr is COD Removed Across Selector Divided by P Removed Across System. Sel COD is Soluble COD in S1 Anaerobic Zone. P Release is P Concentration Released in Anaerobic Zone Normalized to Influent Flowrate. Inf P Sel P Eff P P release P rem Sel COD CODr/Pr 19.9 5.9 33 30.3 34.4 16.6 21.9 13.7 35 5.0 31.8 32.5 18.7 14.5 13.1 34 5.3 30.6 31.5 18.2 14.2 12.4 18 8.2 35.9 37.4 23.6 15.3 12.3 34 5.7 34.5 38.7 21.8 21.1 12.7 29 6.3 31.7 39.1 25.6 20.9 6.1 52 5.6 34.8 43.2 28.1 23.5 6.7 32 11.0 34.5 47 29.1 30.4 5.4 52 6.3 21.1 33.7 23.1 23.2 -2 38 23.2 29 21 13.8 2.2 55 12.7 22.6 31.8 21.3 19.7 1.3 52 26.2 23.9 30.5 21 16.1 2.9 51 12.4 24.2 32.3 19.8 20.6 4.4 58 5.0 24.2 31.2 18.8 19.4 5.4 49 7.4 22.9 31.2 20.1 19.4 2.8 58 7.9 23 42.6 20.7 41.5 2.3 23.3 31.7 19.8 20.3 3.5 57 6.9 23.6 29.5 17.4 18 6.2 58 3.5 22.4 31.3 20.8 19.4 1.6 53 20.0 20.5 26.9 20.8 12.5 -0.3 49
Figure 3-21 shows that the DSVI values were similar (at 150 to 200 mL/g) for both the single- and four-stage anaerobic selectors. After August 14th the DSVI values increased rapidly up to over 1000 mL/g by August 20th. This may have been due to a S. natan growth as note in Table 3-18 below.
3-30
Table 3-17. P and COD data for S4 (mg/L), CODr/Pr is COD Removed Across Selector Divided by P Removed Across System. Sel COD is Soluble COD in S4 Anaerobic Zone. P Release is P Concentration Released in Anaerobic Zone Normalized to Influent Flow Rate.
Date
7-21 7-22 7-24 7-25 7-26 7-28 7-30 8-1 8-3 8-6 8-7 8-8 8-9 8-10 8-11 8-12 8-13 8-14 8-15 8-16 8-17 8-20
Inf P
27.8 29.1 27.9 27.9 26.1 26.1 28.7 32.9 19.6 20.7 19.6 19.6 20.7 20.6 21.1 19.5 20.2 21 19.9 20.7 20.4
Sel P
10.3 31.5 27.4
Eff P
20.2 24.2 23.7 23.4 24.4 24.4 28.5 28.6 23.8 20.4 19.9 8.9 12.6 15.1 14.9 15.3 15.9 17.3 15.2 17.9 19.2
P release
15 6.9 5 1.1 10.1 8.9 10.6 9.7 11.6 10.3 14.5 10.9 14.9 5.5 14.4 47 27.3 18.1 12.1 17.4 12.8
P rem
7.6 4.9 4.2 4.5 1.7 1.7 0.2 4.3 0.3 10.7 8.1 5.5 6.2 4.2 4.3 3.7 4.7 2.8 1.2
Sel COD
24 14
CODr/Pr
11.8 22.4 16.7
33.9 34.4 27.5 25.7 27 19.7 24.1 20.6
34 53 45 41 56 50 42 36
350.0 7.4 186.7 3.6 6.7 12.0
1400 1200 1000 DSVI, mg/L 800 600 400 200 0 27-Jul 2-Aug 8-Aug Date 14-Aug 20-Aug
a b c d e f
S1 S4
Figure 3-22. DSVI for S1 and S4. a. Reseed S1 and S4 with Kalispell Sludge on 7/20; b. Reduce Macro Inorganic (K+, Ca2+, Mg2+) by Half on 8/3; c. Reduce Phosphorus Concentration From 30 to 20 mg/L on 8/5; d. Starting Using Deionized H2O Instead of Tap Water and Start Adding Half Strength Vitamins to A/O Systems and Reseed S4 With Kalispell Sludge; e. Reduce Selector Volume to 3/4 of the Original for S1 and S4; f. Reduce Selector Volume to 1/2 of the Original for S1 and S4.
3-31
The weekly filamentous identification is summarized in Table 3-18. On July 26th, in both systems the filamentous abundance was few and the dominant specie was Type 021N. Two weeks later, the filamentous abundance in S4 and S1 reached a common-very common level. On August 23rd, a high population of filamentous bacteria was identified and the dominant specie switched to S. natans in both reactors.
Sel S1 7/26 8/2 8/8 8/23 S4 7/26 8/2 8/8 8/23 Few Some Common-very common Very common 021N 021N 021N S.natans Some Some Common Very common 0041 S.natans 021N Few Common Common Few Few-some Some Very commonabundant 021N 021N 021N S.natans Few-some Few-some Some Very common S.natans 021N Some Common Date Table 3-18. Identification of Filamentous Bacteria in the S1 and S4 Anaerobic Selectors. Filamentous Dominant Abundance 2nd dominant Abundance abundance (100X) specie (1000X) specie (1000X)
3-32
CHAPTER 4.0
DISCUSSION
The key research objective for this study was to determine if a four-stage-anoxic selector in would improve sludge settleability, as measured by the diluted sludge volume index (DSVI) test, over a single-staged anoxic selector in continuous-flow activated sludge treatment. Three parallel bench-scale activated sludge systems with external clarifiers were operated at 20-22oC with a 5-day target SRT; single-stage anoxic selector followed by a CMAS aeration tank, fourstage anoxic selector followed by a CMAS aeration tank, and a CMAS aeration tank with no selector. An internal recycle pump provided nitrified mixed liquor from the aeration tank to the anoxic zone at a flow rate equal to 1.5 times the influent flow rate. The volume of all the aeration tanks were equal at 4.3 L and the influent flow rate to the experimental systems was 12 L/day for an HRT of 8.6 hours. The total volume of the single- and four-stage- anoxic selectors were equal at 0.85 L and was 16.5% of the total anoxic and aeration volume. Eventually the CMAS aeration tank was replaced with an SBR system, as the CMAS system consistently exhibited DSVI values in excess of 1000 mL/g and its operation could only be controlled with chlorine addition to prevent excessive solids loss in the clarifier. In the latter part of the study (2.5 months out of a total operating time of 10.5 months) the same selector designs were changed to anaerobic selectors by eliminating the internal recycle and controlling the ammonia addition in the synthetic feed to minimize the nitrate concentration in the return sludge flow. A synthetic feed was used through the study and for the anoxic selector portion the major portions of the organic carbon consisted of about 35% acetate, and 20% long chain fatty acids, and 20% starch and dextrin. Higher than expected DSVI values were observed with the selector operation and the synthetic feed composition was periodically modified as shown in Table 4-1 below to remove the possibility of having the elevated DSVI caused by a particular type of feed substrate, such as long chain fatty acids. The starch was removed because it caused problems in the feed lines, and was replaced with more dextrin to provide a significant slowly biodegradable COD (sbCOD) component. For the anaerobic selector portion of the study, a synthetic feed from previous bench-scale studies on enhanced biological phosphorus removal with anaerobic selectors was used. Two counter hypotheses were proposed that refuted or supported advantages for staged anoxic selector designs to improve DSVI values. The first was that staging an anoxic selector would not affect the DSVI value, because an anoxic selector is basically a metabolic selector with nitrate as the main electron acceptor, which would regardless of the selector configuration favor floc-formers over filamentous organisms, because the floc-formers can use nitrate (and thus more organic substrate for growth) at a much faster rate than filamentous organisms. For this case, the only benefit of staging would be to reduce the overall selector volume and detention time required for maximum uptake of the critical substrate that could encourage filamentous growth in the downstream CMAS aerobic zone. Because filamentous growth in the
non-selector aerobic zone is generally considered to be from readily biodegradable substrate COD (rbCOD), acetate was initially the key substrate of interest in this study to follow the selector performance and effect on filamentous growth. The hypothesis that supported the use of a staged selector was that a staged-selector would have a substrate concentration gradient (high concentration in first stage and declining concentrations in succeeding stages), which would maximize the removal of readily biodegradable substrate and perhaps select for a different flocforming population with improved settling characteristics over the single-stage anoxic selector floc-forming population. This reasoning was supported by the fact that a higher acetate concentration should exist in the highly-loaded first stage of the anoxic selector, which might promote organisms that are capable of rapid acetate uptake and storage versus bacteria with a constant rate of assimilation and oxidation for the single-stage selector. Another benefit posed for the staged anoxic selector was that it could provide more complete removal of rbCOD under variable loading conditions due to the staging kinetic advantage. This study was only done at constant flow and loading conditions, so that aspect was not investigated. Similar counter hypotheses were proposed for the anaerobic selector, but because the anaerobic selector mechanism definitely involves acetate uptake and storage and is carried out by a smaller more select group of bacteria (phosphorus accumulating organisms), the metabolic selector basis seemed to have a much stronger footing. The argument for a staged selector to better handle variable acetate loads also seemed valid but could not be tested in this work. The general trends in the sludge settleability (DSVI values) are summarized in Table 4-1 for different operating phases. All three test systems were originally operated as CMAS aerobic reactors without a selector and all three exhibited equal and excessive filamentous growth with DSVI values above 1000 mL/g. Once the anoxic selectors were added the DSVI values dropped and the system without the selector could only be controlled with chlorine addition. Operating Phases I-III are most important for evaluating the anoxic selectors. In Phase IV, the results were affected by hydrous bulking. The DSVI values shown for Phases I-III indicate that sludge settleability was consistently better in systems with more anoxic staging, single to 4 stage (S1 to S4) and 4 stage to infinite stages (S4 to SBR). In Phases II and III, the anoxic selectors were switched and after time the DSVI for S4 dropped to a level well below S1. The SBR had SVIs that were well below that for S4. Acetate was almost completely removed in the anoxic selectors and was removed in a shorter detention time as expected for the four-stage selector. Table 3-3 showed that the acetate concentration was minimal by the third stage of the four-stage anoxic selector and Table 3-7 showed that it was minimal by the second stage of the four-stage selector. Thus, as expected the multiple-staged anoxic selector could remove the rbCOD in a shorter HRT. But in spite of almost complete acetate removal the selector systems had much higher than expected DSVI values. This suggests that the rbCOD (mainly acetate) was not a factor in determining the sludge settleability for these systems and instead the DSVI was related to the sbCOD, which by Phase III was mainly dextrin.
4-2
Table 4-1. Summary of Selector Study Major Operating Conditions and Changes and Trends in DSVI Values for Each Operating Phase.
Representative DSVIs*, mL/g Operating Phase Phase I Startup Phase I Phase II Selector Type Anoxic Anoxic Anoxic Feed % Acetate 35 35 55 Major Feed Change Major Operating Change S1 300-350 350-400 300-500 S4 300-350 150-200 220-359 SBR
Removed LCFAs
Phase III
Anoxic
55
Phase IV Phase V
Anoxic Anaerobic
90 85
Reduced starch, raised dextrin to 25% of COD Removed dextrin
-Combined and split S1 and S4 mixed liquor -switched selectors -started SBR Switched selectors
100-120
280-300
220-250
120-200
350-500 Seed with EBPR system mixed liquor 150-200
320-380 150-200
150-200 -
Note: Changes in feeding system design not included in the table * The DSVIs represent performance for a number of days that were representative of the operating phase.
4-3
A higher DSVI value was observed for the systems fed more dextrin to the aerobic zone. Evaluation of dextrin anoxic degradation kinetics indicated that more dextrin was removed in the anoxic zone for systems with increased staging in the anoxic selector zone. With less anoxic zone staging, more dextrin was fed to the aerobic zone. Thus, more dextrin was fed to and removed in the aerobic zone of systems S1 versus S4 and S4 versus the SBR. Classic filamentous kinetic selection theory would support a higher DSVI for S1 versus S4 on the basis that the dextrin is consumed by filamentous bacteria in the aerobic zone. Dextrin uptake is favored by filaments in the CMAS, long HRT aerobic zones due to the low dextrin concentration that would exist in the bulk liquid. Due to their higher surface-to-volume ratio and ability for growth extension outside the flocs, the filamentous organisms had a decided advantage for dextrin uptake at low concentrations under aerobic conditions over the floc-formers. Most of the floc formers are inside the floc, which in this case receives minimal substrate by diffusion of the low bulk liquid dextrin concentration into the floc. Similarly, the lower DSVI for the SBR may also have been related to less dextrin being fed to its aerobic phase compared to that for S4. Though this explanation is appealing and is compatible with many selector mechanistic models, it may be too simple to fully explain the abundant filamentous growth still observed in the SBR. An abundant level of N. limicola II was observed in all three systems and it was difficult from microscopic observations to say that there was a lower filamentous level in the SBR system. However, one clear distinction was that there was much less filamentous growth extending from the floc in the SBR system than in the S1 and S4 systems. So this raises two questions: why was the filamentous population so abundant in the SBR and why was there much less filamentous bacteria extension from the flocs in the SBR? High removals of acetate (97%) and dextrin (predicted as 46 %) in the anoxic phase of the SBR could not limit the abundant growth of N. limicola II. A similar result was obtained by Dionisi et al. (2002) when operating anoxic/aerobic SBRs fed with a mixture of several soluble substrates (acetate, ethanol, glucose, glutamic acid, peptone, Tween 80, starch, yeast extract). N. limicola II and Haliscomenobacter hydrossis were identified to be the prevailing filamentous organisms in their systems. They implicated that a small amount (18%) of the overall COD removal in the aerobic zone supported a high abundance of filamentous organisms. In this study, abundant growth of N. limicola II in the SBR was also due to over 50% of the feed dextrin (about 20% of total influent COD) being removed in the aerobic phase. The SBR system can be seen as an ideal plug flow anoxic selector followed by an ideal plug flow aeration basin, which would result in a dextrin substrate concentration gradient with time in the SBR aeration period. Thus, with only a smaller portion of substrate taken up a low substrate concentration, the classic kinetics selection theory (Chudoba et al., 1973) based on the assumption that filamentous organisms have an advantage for growth due to their higher specific growth rates (lower affinity constant) over floc-formers only under only low substrate conditions would predict only minimal filamentous growth for the SBR system. However, this is based on rbCOD removal and the mechanisms for rbCOD uptake are different and kinetically limited by the hydrolysis process. In this study, dextrin uptake rates were 4-6 and 10 times lower than acetate uptake rates under anoxic and aerobic conditions, respectively. Dextrin uptake rates followed first-order kinetics under low floc loading conditions. It is assumed dextrin removal involves first a hydrolysis step at the bacteria surface and that bacteria within the flocs that are capable of dextrin hydrolysis would have an advantage for dextrin uptake regardless of their
4-4
morphology once substrates diffuse into the flocs. Some filamentous organisms, such as M. parvicella, N. limicola II, and Type 1851, have been shown to have the capacity to hydrolyze sbCOD under aerobic conditions (Schade and Lemmer, 2005 and 2006). In contrast to the completely mixed aerobic zones in S1 and S4, a dextrin concentration gradient existed in the SBR aerobic phase due to the SBR plug flow kinetics and thus more dextrin could diffused into the flocs with less dextrin degraded in the bulk solution. Therefore, growth of filamentous bacteria mainly occurred inside the flocs, which would agree with the observations of minimal filamentous floc extension and lower DSVIs for the SBR versus S4. In this analysis there was not sufficient information to consider the relative dextrin kinetics between the filaments and the floc formers and thus the effect of the higher substrate gradient on the relative growth of floc formers could not be estimated. Recently a new technology, enzyme-labeled fluorescent (ELF), was employed to investigate hydrolysis of slowly bridgeable substrate in activated sludge systems, and with ELF Schade and Lemmer (2005) observed intensive lipid enzyme activity on the surface of M. parvicella, which confirmed the observation that M. parvicella was able to take up long-chain fatty acid in anoxic selectors (Andreasen and Nielsen, 1998; Slijkhuis, 1983). Although they did not include glucosidase (the enzyme for hydrolysis of starch and dextrin) in their enzyme list for a scum bacteria study, Schade and Lemmer (2006) did show the activity of N. limicola II and Type 1851 for phosphatase, esterase, and -glucuronidase. All these come to one implication: certain filamentous organisms, including N. limicola II and Type 1851, can compete for slowly biodegradable substrates with floc-formers under anoxic conditions. Though their work did not include dextrin, it raises the possibility that the population of N. limicola II observed this study could have been active under anoxic conditions. The higher substrate gradient favored more growth within the floc versus more growth outside the floc to cause a higher DSVI value. Whether filamentous organisms can compete for substrates with floc-formers under anoxic conditions has not been fully resolved. The anoxic selector was initially categorized as a metabolic selector since only floc-forming bacteria were considered to be able to denitrify. Later some filamentous organisms were found to be denitrifiers, such as M. parvicella (Tandoi et al., 1998), Sphaeotilus natans (Pellegrin et al., 1999), Thiothrix (Williams and Unz, 1985), Type 021N (Williams and Unz, 1985), and Type 1851 (Kohno et al., 2002), but the denitrification rate for these filamentous organisms tested so far (Thiothrix spp. and Type 021N) were much lower than those for floc-forming organisms (Dionisi et al., 2002; Shao and Jenkins, 1989). The kinetics results of dextrin degradation in this study agreed with results reported by a Japanese group in a series of studies of hydrolysis of starch (Sanpedro et al., 1994; Mino et al., 1995; Goel et al., 1998). They reported that hydrolysis of starch followed the saturation kinetics with respect to starch concentration. However, the NUR and OUR tests in this study suggest higher uptake rates of dextrin under anoxic conditions, which does not agree with the finding by Goel et al. (1998) that the hydrolytic rates under different electron acceptor conditions were more similar to each other. Since contacting higher dextrin concentration in anoxic phase than in aerobic phase, the hydrolytic enzymes might have adapted to be more active under anoxic conditions. Further investigation is needed to confirm this observation. The sludge settleability characteristics, as measured by the DSVI, were good and similar for the single- and four-stage anaerobic selectors, but general comparisons between the two
4-5
systems is not possible due to the short operating time for this selector study. At the beginning of the anaerobic selector study with seed from an EBPR facility the phosphorus removal characteristics and sludge settling followed expected trends. However within a time period equal to 3-4 SRTs, the phosphorus removal deteriorated and the anaerobic selector zone never removed the soluble COD to a minimal concentration as expected. These results were contrary to results seen in other investigations using the same feed composition but in an SBR instead of a continuous-flow system with an external clarifier as for this study. As the first application to an engineering system, ARISA, accompanied with 16S rDNA sequencing identification, was shown to be an effective tool for investigating microbial community in activated sludge systems. While ARISA is considered semi-quantitative, a consistent trend between cell counts and ARISA peak sizes has previously been demonstrated (Brown et al., 2005). Since ITS has greater genetic variability than 16S rDNA (Tyson et al., 2004), ARISA profile analysis may provide finer scale taxonomic resolution than 16S-based methods, such as terminal restriction fragment length polymorphism (tRFLP) and denaturing gradient gel electrophoresis (DGGE). This study demonstrated the robustness of ARISA by producing highly similar profiles for replicate DNA extraction, PCR, and ARISA analysis samples in agreement with previous observation (Fisher and Triplett, 1999; Brown et al., 2005; Danovaro et al., 2006). Once a suitable database for ITS sequence (or length) has been established for activated sludge systems, fine scale resolution of clone phylogenetic affiliation will be more easily established, potentially with a single ARISA reaction. Thus, direct comparison of microbial communities using ARISA data among different full- or bench-scale activated sludge systems may become possible if a common primer set is applied. The ARISA method identified many of the filaments in the system indicated by light microscopy methods and indicated their abundances semi-quantitatively. It also showed that the bacteria population for the four-stage anoxic selector was closer to that in the SBR system versus the single-stage anoxic selector system ARISA data need to be cautiously interpreted and more experience is needed with this promising molecular technique. Besides experimental biases introduced by sample DNA extraction and PCR amplification, ITS data itself may mislead the data interpretation. On one hand, single organism may contribute multiple ARISA peaks. For example, Escherichia coli strain K-12 has two different sizes of ITS (Martinez et al., 1996). In this study, clones of GX 26 and GX 39 were identified to be the same specie (identical partial 16S rDNA sequences), but the clones had different ARISA fragment lengths (564 bp and 712 bp), demonstrating how multiple gene copy numbers can result in multiple peaks representing the same organism. On the other hand, different organisms can also have the same size ARISA fragment, a phenomenon not observed in this study
4-6
CHAPTER 5.0
CONCLUSIONS
The following conclusions can be drawn from this investigation: 1. Adequately designed multiple- or single-stage anoxic selectors can remove most of the influent wastewater rbCOD to control sludge bulking due to filamentous growth on these substrates in a completely mixed aerobic zone following the selector. 2. A multiple-staged anoxic selector will require less volume than a single-stage anoxic selector for removal of rbCOD for filamentous bulking control. 3. Filamentous growth and higher DSVIs can occur due to uptake of sbCOD, such as dextrin in this study, in an aerobic zone following an anoxic selector zone. 4. Plug flow or more staging conditions in an aerobic zone after a selector would be preferred over a single completely-mixed aerobic zone to control DSVI values affected by removal of sbCOD. 5. An advantage of staging in an aerobic zone is that more sbCOD may be removed inside the floc due to diffusion to minimize filamentous growth and extension outside the floc and thus yielding lower DSVI values. 6. ARISA is a suitable technique for investigating microbial community in activated sludge systems and can provide a rapid, robust, inexpensive way to compare microbial communities in full- and bench-scale wastewater treatment systems.
5-1
5-2
REFERENCES
Albertson, O.E. 1987. The Control of Bulking Sludges - from the Early Innovators to Current Practice. Journal Water Pollution Control Federation, 59 (4), 172-182. Albertson, O.E. 1991. Bulking sludge control progress, practice and problems. Water Science and Technology 23(4-6): 835-846. Albertson, O.E. 2002. Technology Assessments: Activated Sludge Bioselector Processes. Water Environment Research Foundation, 601 Wythe Street, Alexandria, VA. Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman. 1990. Basic Local Alignment Search Tool. Journal of Molecular Biology, 215(3), 403-410. Andreasen, K. and P.H. Nielsen, 1997. In situ characterization of substrate uptake by Microthrix parvicella using microautoradiography. Water Science and Technology, 37 (4-5), 19-26. APHA (1995) Standard Methods for the Examination of Water and Wastewater, 19th ed. Brown, M.V., M.S. Schwalbach, I. Hewson, and J.A.Fuhrman. 2005. Coupling 16S-ITS rDNA clone libraries and automated ribosomal intergenic spacer analysis to show marine microbial diversity: development and application to a time series. Environmental Microbiology, 7(9), 14661479. Chudoba, J., P. Grau, and V. Ottova. 1973. Control of activated sludge filamentous bulking - II. selection of microorganisms by means of a selector. Water Research 7(10): 1398-1406. Conklin, A., H.D. Stensel, and J. Ferguson. 2006. Growth kinetics and competition between Methanosarcina and Methanosaeta in mesophilic anaerobic digestion. Water Environment Research, 78 (5), 486-496. Danovaro, R., G.M. Luna, A. Dell'Anno, and B. Pietrangeli. 2006. Comparison of two fingerprinting techniques, terminal restriction fragment length polymorphism and automated ribosomal intergenic spacer analysis, for determination of bacterial diversity in aquatic environments. Applied and Environmental Microbiology, 72 (9), 5982-5989. Dionisi, D., C. Levantesi, V. Renzi, V. Tandoi, and M. Majone. 2002. PHA storage from several substrates by different morphological types in an anoxic/aerobic SBR. Water Science and Technology, 46(1-2), 337-344. Dueholm, T.E., K.H. Andreasen, and P.H. Nielsen. 2001. Transformation of lipids in activated sludge. Water Science and Technology, 43 (1), 165-172.
R-1
Eikelboom, D.H., A. Andreadakis, and K. Andreasen. (1998). Survey of filamentous populations in nutrient removal plants in four European countries. Water Science and Technology, 37(4-5), 281-289. Eikelboom, D.H. 2000. Process Control of Activated Sludge Plants by Microscopic Investigation. IWA Publishing, London Fisher, M.M. and E.W. Triplett. 1999. Automated approach for ribosomal intergenic spacer analysis of microbial diversity and its application to freshwater bacterial communities. Applied and Environmental Microbiology, 65 (10), 4630-4636 Gabb, D.M.D. 1988. Filamentous bulking in long mean cell residence time activated sludge processes. Ph.D. Dissertation, University of California, Berkeley. Gabb, D.M.D., G.A. Ekama, D. Jenkins, and G.V.R. Marais. 1989. Incidence of Sphaerotilus natans in laboratory scale activated-sludge systems. Water Science and Technology 21(4-5): 2941. Gabb, D.M.D., Still, D.A., Ekama, G.A., Jenkins, D., and G.V.R., Marais. (1991). The Selector Effect on Filamentous Bulking in Long Sludge Age Activated-Sludge Systems. Water Science and Technology, 23(4-6), 867-877. Goel, R., Mino, T., Satoh, H., and Matsuo, T. (1998). Comparison of hydrolytic enzyme systems in pure culture and activated sludge under different electron acceptor conditions. Water Science and Technology, 37(4-5), 335-343. Hill, T., K.A. Walsh, J.A. Harris, and B.F. Moffett. 2003. Using ecological diversity measures with bacterial communities. FEMS Microbiology ecology, 43(1), 1-11 Hruby, T. 1987. Using similarity measures in benthic impact assessments. Environmental monitoring and assessment, 8, 163-180. Jenkins, D., M.G. Richard, and G.T. Daigger. 2004. Manual on the Causes and Control of Activated Sludge Bulking, Foaming, and Other Solids Separation Problems. Lewis Publishers, Michigan. Kaewpipat, K. and C.P.L. Grady. 2002. Microbial population dynamics in laboratory-scale activated sludge reactors. Water Science and Technology, 46 (1-2), 19-27. Kohno, T.; K. Sei, and K. Mori. 2002. Characterization of type 1851 organism isolated from activated sludge samples. Water Science and Technology, 46 (1-2), 111-114. Kruit, J., J. Hulsbeek, and A. Visser. 2002. Bulking sludge solved?! Water Science and Technology, 46(1-2), 457-464.
R-2
Mamais, D., D. Jenkins, and P. Pitt. 1993. A rapid physical-chemical method for the determination of readily biodegradable soluble COD in municipal wastewater. Water Research 27 (1), 195-197. Mamais, D., A. Andreadakis, C. Noutsopoulos, and C. Kalergis. 1998. Causes of, and control strategies for, Microthrix parvicella bulking and foaming in nutrient removal activated sludge systems. Water Science and Technology, 37 (4-5), 9-17 Marten, W.L. and G. T. Daigger. 1997. Full-scale evaluation of factors affecting the performance of anoxic selectors. Water Environment Research, 69(7), 1272-1281. Martinez, G.J., A. Murcia, A.I. Anton, and V.F. Rodriguez. 1996. Comparison of the small 16S to 23S intergenic spacer region (ISR) of the rRNA operons of some Escherichia coli strains of the ECOR collection and E-coli K-12. Journal of Bacteriology, 178 (21), 6374-6377. Martins, A.M.P., J.J. Heijnen, and M.C.M. van Loosdrecht. (2003). Effect of feeding pattern and storage on the sludge settleability under aerobic conditions. Water Research, 37(11), 2555-2570. Martins, A.M.P., J.J. Heijnen., and M.C.M. van Loosdrecht. 2004. Bulking sludge in biological nutrient removal systems. Biotechnology and Bioengineering, 86 (2), 125-135. Mino, T., D.C. Sanpedro, and T. Matsuo. (1995). Estimation of the Rate of Slowly Biodegradable Cod (Sbcod) Hydrolysis under Anaerobic, Anoxic and Aerobic Conditions by Experiments Using Starch as Model Substrate. Water Science and Technology, 31(2), 95-103. Pellegrin, V., S. Juretschko, M. Wagner, and G. Cottenceau. 1999. Morphological and biochemical properties of a Sphaerotilus sp. isolated from paper mill slimes. Applied and Environmental Microbiology, 65 (1), 156-162. Sanpedro, D.C., T. Mino, and T. Matsuo. 1994. Evaluation of the rate of hydrolysis of slowly biodegradable COD (SBCOD) using starch as substrate under anaerobic, anoxic, and aerobic conditions. Water Science and Technology, 30, (11), p191-199. Schade, M. and H. Lemmer. (2005). Lipase activities in activated sludge and scum - Comparison of new and conventional techniques. Acta Hydrochimica Et Hydrobiologica, 33(3), 210-215. Schade, M. and H. Lemmer. (2006). In situ enzyme activities of filamentous scum bacteria in municipal activated sludge wastewater treatment plants. Acta Hydrochimica Et Hydrobiologica, 34(5), 480-490. Schloter, M., M. Lebuhn, T. Heulin, and A. Hartmann. 2000. Ecology and evolution of bacterial microdiversity. Fems Microbiology Reviews, 24(5), 647-660. Shannon, C. a. W., W. 1949. The mathematical theory of communication, University of Illinois Press, Urbana, Illinois.
R-3
Shao, Y.J. and D. Jenkins. 1989. The Use of Anoxic Selectors for the Control of Low F/M Activated-Sludge Bulking. Water Science and Technology, 21(6-7), 609-619. Slijkhuis, H. 1983. Microthrix-Parvicella, a Filamentous Bacterium Isolated from ActivatedSludge - Cultivation in a Chemically Defined Medium. Applied and Environmental Microbiology, 46 (4), 832-839. Spellerberg, I. 1991. Monitoring ecological change, Cambridge university press, Cambridge. Tampus, M.V., A.M.P. Martins, and M.C.M. van Loosdrecht, 2004. The effect of anoxic selectors on sludge bulking. Water Science and Technology, 50 (6), 261-268. Tandoi, V., S. Rossetti, L.L. Blackall, and M. Majone. 1998. Some physiological properties of an Italian isolate of "Microthrix parvicella". Water Science and Technology, 37(4-5), 1-8. Tomlinson, E.J. 1982. The emergence of the bulking problem and the current situation in the UK. In Bulking of Activated Sludge: Preventive and Remedial Methods, eds. B. Chambers and J. Tomlinson. Chap. 1: 17-23. Chichester: Ellis Horward Publish Tyson, G.W., J. Chapman, P. Hugenholtz, E.E. Allen, R.J. Ram, P.M. Richardson, V.V. Solovyev, E.M. Rubin, D.S. Rokhsar, and J.F. Banfield, 2004. Community structure and metabolism through reconstruction of microbial genomes from the environment. Nature, 428 (6978), 37-43. Williams, T.M. and R.F. Unz. 1985. Filamentous Sulfur Bacteria of Activated-Sludge Characterization of Thiothrix, Beggiatoa, and Eikelboom Type-021n Strains. Applied and Environmental Microbiology, 49(4), 887-898.
R-4
APPENDIX A
SUMMARY OF WEEKLY MICROSCOPIC OBSERVATIONS OF FILAMENTOUS POPULATION TYPE AND ABUNDANCE IN LABORATORY REACTORS
Table A-1. Summary of Filamentous Abundance and Identification for First 15 Weeks. (The First Column on Filament Abundance is Based on Total Mixed Liquor, While the Others Pertain to the Individual Type of Filament Observed at 1000X) Reactor Rc 1 2 3 4 5 6 7* 8 9 10 11 12 13 14 15 S1 1 2 3 4 5 Very common Very common Abundant Excessive Abundant Thiothrix sp. S. natans S. natans S. natans S. natans Very common Very common Very common abundant Excessive Abundant S. natans M. parvicella M. parvicella M. parvicella M. parvicella Common Common - very common Common - very common Common Very common Very common Very common Very common abundant Excessive Excessive Abundant Abundant Abundant Abundant Abundant Abundant Abundant Abundant Excessive Excessive Thiothrix sp. S. natans S. natans S. natans S. natans S. natans S. natans S. natans S. natans S. natans S. natans Thiothrix sp. Thiothrix sp. S. natans S. natans Very common Very common Common-very common Excessive Excessive Abundant Abundant Abundant Abundant Abundant Abundant Abundant Abundant Abundant Abundant S. natans M. parvicella M. parvicella M. parvicella M. parvicella M. parvicella N. limicola III Type 021N N. limicola III N. limicola III Type 021N S. natans Thiothrix sp. Thiothrix sp. Common Common - very common Common - very common Some Common Common - very common Some Some Some Some-common Common Common Very common Common Week Filamentous abundance (100X) Dominant specie Abundance (1000X) 2nd dominant specie Abundance (1000X)
A-1
6 7* 8 9 10 11 12 13 14 15 S4 1 2 3 4 5 6 7* 8 9 10 11 12
Very common Very common Very common Very common Very common Very common Very commonVery common Very common Very common Very common Very common Abundant Excessive Abundant Common Common - very common Common - very common Common Common Common Some
S. natans Type 021N N. limicola III N. limicola III N. limicola III N. limicola III Thiothrix sp. N. limicola III Thiothrix sp. Thiothrix Thiothrix sp. S. natans S. natans S. natans S. natans S. natans Type 021N N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III
Abundant Very common Very common Very common Very common Abundant Very commonabundant Abundant Very common Very common Very common Very common Abundant Excessive Very common Very common Common - very common Very common
N. limicola III S. natans Type 021N Type 021N Thiothrix sp. Type 1851 N. limicola III Type 021N N. limicola III N. limicola III S. natans M. parvicella M. parvicella M. parvicella M. parvicella N. limicola III
Common - very common Some-common Common - very common Common - very common Common - very common Common-very common Very common Very common Very common Very common Common Common - very common Common - very common Abundant Very common Common - very common
Type 021N
Common
Very common Type 021N Common Very common Thiothrix sp. Common Abundant Type 1851 Common Very commonThiothrix sp. Some-common abundant 13 Common N. limicola III Very common Type 021N Common 14 Some-common N. limicola III Very common Thiothrix sp. Some 15 N. limicola III Very common Type 021N Some - Common Common Note: Week 1:10/22-10/28; Week 2: 10/29-11/4; Week 3: 11/5-11/11; Week 4: 11/12-11/18; Week 5: 11/19-11/25; Week 6: 11/26-12/02; Week 7: 12/03-12/09; Week 8: 12/10-12/16; Week 9: 12/17-12/23; Week 10: 12/24-12/30, Week 11: 12/31-1/6, Week 12: 1/7-1/13, Week 13: 1/14-1/20, Week 14: 1/21-1/27, Week15: 1/18-2/2. Filamentous abundances were identified without cell stains.
A-2
Table A-2. Summary of Filamentous Abundance and Identification for Weeks 17-32. (The First Column on Filament Abundance is Based on Total Mixed Liquor, While the Others Pertain to the Individual Type of Filament Observed at 1000X) Reactor SBR 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 S1
16 Very common Abundant N. limicola III N. limicola III Very commonabundant Very common Type 021N Type 021N Very common Very common Very common Common-very common Some-common Some N. limicola III N. limicola III N. limicola III N. limicola III Abundant Very common Common-very common Common-very common Type 021N Type 1851 Type 1851 Type 021N Very common Common-very common Some Few-some
Week
Filamentous abundance (100X)
Dominant specie
Abundance (1000X)
2nd dominant specie
Abundance (1000X)
ND
Few Some Very common Common-very common Very common Very common Very common Very common Very common Common Common
ND
N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III
ND
Common-very common Very common Excessive Abundant Excessive Excessive Abundant Abundant Very common Common-very common Common-very common
ND
ND
17
A-3
Reactor
Week 18 19 20 21 22 23 24
25 26 27 28
Table A-2. Summary of Filamentous Abundance and Identification for Weeks 17-32. Continued. Filamentous Dominant Abundance 2nd dominant specie Abundance (1000X) abundance (100X) specie (1000X)
Abundant Common-very common Very common Type 021N Type 021N Type 021N Very commonabundant Very common Very common N. limicola III N. limicola III N. limicola III Very common Common-very common Very common
ND
Very common Very common Common-very common Very common Very common Very common Very common Very common Abundant Very common Very common Common-very common
ND
Type 1851 Type 021N N. limicola III N. limicola III N. limicola III Type 1851 Type 1851 Type 1851 Type 1851 Type 1851 N. limicola III
ND
Very common Very common Very common Very common Very common Very common abundant Very common abundant Very common abundant Very common Very common Common-very common
ND
Type 021N N. limicola III Type 1851 Type 1851 Type 1851 N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III Type 1851
ND
Very common Common-very common Common-very common Very common Common-very common Very common Very common Very common Very common Very common Common
S1
29 30 31 32
S4
A-4
A-5
16
17 18 19 20 21 Reactor Week 22 23
24 25 26 27 28 29
Very common Very common Common-very common Common-very common Common-very common
N. limicola III N. limicola III N. limicola III N. limicola III Type 021N
Very commonabundant Abundant Very common Very common Very common
Type 021N Type 021N Type 021N Type 021N N. limicola III
Very common Common-very common Common-very common Common-very common Very common
ND Filamentous abundance (100X)

Common-very common Common-very common Very common Very common Very common Very common Common-very common Common-very common Common-very common Common-very common Common-very common
ND Dominant specie
Type 1851 Type 021N Type 1851 N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III N. limicola III
ND ND Table A-2 Continued. Abundance 2nd dominant specie (1000X)

Very common Very common Very common Very common Abundant Abundant Very common Very common Very common Very common Common-very common N. limicola III N. limicola III N. limicola III Type 1851 Type 1851 Type 1851 Type 1851 Type 1851 Type 1851 Type 1851 Type 1851
ND Abundance (1000X)
Very common Common-very common Common-very common Common-Very common Common Very common Common-Very common Common-Very common Common-Very common Common-Very common Common
S4
30 31 32
A-6
WASTEWATER UTILITY Alabama

Montgomery Water Works & Sanitary Sewer Board
Sunnyvale, City of Union Sanitary District West Valley Sanitation District
Des Moines, City of Iowa City
New York
New York City Department of Environmental Protection
Kansas
Johnson County Wastewater Unified Government of Wyandotte County/ Kansas City, City of
Colorado
Aurora, City of Boulder, City of Greeley, City of Littleton/Englewood Water Pollution Control Plant Metro Wastewater Reclamation District, Denver
North Carolina
Charlotte/Mecklenburg Utilities Durham, City of Metropolitan Sewerage District of Buncombe County Orange Water & Sewer Authority University of North Carolina, Chapel Hill
Alaska
Anchorage Water & Wastewater Utility
Arizona
Glendale, City of, Utilities Department Mesa, City of Peoria, City of Phoenix Water Services Dept. Pima County Wastewater Management Safford, City of
Kentucky
Louisville & Jefferson County Metropolitan Sewer District Sanitation District No. 1
Connecticut
Greater New Haven WPCA Stamford, City of
Louisiana
Sewerage & Water Board of New Orleans
Ohio
Akron, City of Butler County Department of Environmental Services Columbus, City of Metropolitan Sewer District of Greater Cincinnati Northeast Ohio Regional Sewer District Summit, County of
District of Columbia
District of Columbia Water & Sewer Authority
Maine
Bangor, City of Portland Water District
Arkansas
Little Rock Wastewater Utility
Florida
Broward, County of Fort Lauderdale, City of Jacksonville Electric Authority (JEA) Miami-Dade Water & Sewer Authority Orange County Utilities Department Reedy Creek Improvement District Seminole County Environmental Services St. Petersburg, City of Tallahassee, City of Tampa, City of Toho Water Authority West Palm Beach, City of
Maryland
Anne Arundel County Bureau of Utility Operations Howard County Bureau of Utilities Washington Suburban Sanitary Commission
C a l i f o rn i a
Central Contra Costa Sanitary District Corona, City of Crestline Sanitation District Delta Diablo Sanitation District Dublin San Ramon Services District East Bay Dischargers Authority East Bay Municipal Utility District Eastern Municipal Water District El Dorado Irrigation District Fairfield-Suisun Sewer District Fresno Department of Public Utilities Inland Empire Utilities Agency Irvine Ranch Water District Las Virgenes Municipal Water District Livermore, City of Los Angeles, City of Los Angeles County, Sanitation Districts of Napa Sanitation District Orange County Sanitation District Palo Alto, City of Riverside, City of Sacramento Regional County Sanitation District San Diego Metropolitan Wastewater Department, City of San Francisco, City & County of San Jose, City of Santa Barbara, City of Santa Cruz, City of Santa Rosa, City of South Bayside System Authority South Coast Water District South Orange County Wastewater Authority Stege Sanitary District
Oklahoma
Oklahoma City Water & Wastewater Utility Department Tulsa, City of
Massachusetts
Boston Water & Sewer Commission Massachusetts Water Resources Authority (MWRA) Upper Blackstone Water Pollution Abatement District
O re g o n
Albany, City of Clean Water Services Eugene, City of Gresham, City of Portland, City of Bureau of Environmental Services Water Environment Services
Michigan
Ann Arbor, City of Detroit, City of Holland Board of Public Works Saginaw, City of Wayne County Department of Environment Wyoming, City of
Georgia
Atlanta Department of Watershed Management Augusta, City of Clayton County Water Authority Cobb County Water System Columbus Water Works Fulton County Gwinnett County Department of Public Utilities Savannah, City of
Pennsylvania
Hemlock Municipal Sewer Cooperative (HMSC) Philadelphia, City of University Area Joint Authority
Minnesota
Rochester, City of Western Lake Superior Sanitary District
South Carolina
Charleston Water System Mount Pleasant Waterworks & Sewer Commission S p a rtanburg Water
Missouri
Independence, City of Kansas City Missouri Water Services Department Little Blue Valley Sewer District Metropolitan St. Louis Sewer District
Hawaii
Honolulu, City & County of
Tennessee
Cleveland Utilities Knoxville Utilities Board Murfreesboro Water & Sewer Department Nashville Metro Water Services
Idaho
Boise, City of
Illinois
Greater Peoria Sanitary District Kankakee River Metropolitan Agency Metropolitan Water Reclamation District of Greater Chicago Wheaton Sanitary District
Nebraska
Lincoln Public Works and Utilities Department
Texas
Austin, City of Dallas Water Utilities Denton, City of El Paso Water Utilities Fort Worth, City of Houston, City of San Antonio Water System Trinity River Authority
Nevada
Henderson, City of Las Vegas, City of Reno, City of
New Jersey
Bergen County Utilities Authority Ocean County Utilities Authority Passaic Valley Sewerage Commissioners
Iowa
Ames, City of Cedar Rapids Wastewater Facility
Utah
Salt Lake City Corporation
Vi rg i n i a
Alexandria Sanitation Authority Arlington, County of Fairfax County Hampton Roads Sanitation District Hanover, County of Henrico, County of Hopewell Regional Wastewater Treatment Facility Loudoun Water Lynchburg Regional WWTP Prince William County Service Authority Richmond, City of Rivanna Water & Sewer Authority
San Francisco, City & County of Santa Rosa, City of Sunnyvale, City of
Colorado
Aurora, City of Boulder, City of
Florida
Orlando, City of
Georgia
Griffin, City of
Iowa
Cedar Rapids Wastewater Facility Des Moines, City of
Kansas
Overland Park, City of
Kentucky Maine
Louisville & Jefferson County Metropolitan Sewer District Portland Water District
W shington a
Everett, City of King County Department of Natural Resources Seattle Public Utilities Sunnyside, Port of Yakima, City of
North Carolina
Charlotte, City of, Stormwater Services
Wisconsin
Green Bay Metro Sewerage District Kenosha Water Utility Madison Metropolitan Sewerage District Milwaukee Metropolitan Sewerage District Racine, City of Sheboygan Regional Wastewater Treatment Wausau Water Works
Pennsylvania
Philadelphia, City of
Tennessee
Chattanooga Stormwater Management
Texas
Harris County Flood Control District, Texas
Washington
Bellevue Utilities Department Seattle Public Utilities
Australia
ACTEW (Ecowise) South Australian Water Corporation South East Water Limited Sydney Water Corporation Water Corporation of Western Australia
STATE
Arkansas Department of Environmental Quality Connecticut Department of Environmental Protection Kansas Department of Health & Environment Kentucky Department of Environmental Protection New England Interstate Water Pollution Control Commission (NEIWPCC) Ohio River Valley Sanitation Commission Urban Drainage & Flood Control District, CO
Canada
Edmonton, City of/Edmonton Waste Management Centre of Excellence Lethbridge, City of Regina, City of, Saskatchewan Toronto, City of, Ontario Winnipeg, City of, Manitoba
CORPORATE
ADS Environmental Services Advanced Data Mining International Alan Plummer & Associates Alpine Technology Inc. Aqua-Aerobic Systems Inc. AquateamNorwegian Water Technology Centre A/S ARCADIS Associated Engineering
New Zealand
Watercare Services Limited
STORMWATER UTILITY California

Fresno Metropolitan Flood Control District Los Angeles, City of, Department of Public Works Monterey, City of
Black & Veatch Blue Water Technologies, Inc. Boyle Engineering Corporation Brown & Caldwell Burgess & Niple, Ltd. Burns & McDonnell CABE Associates Inc. The Cadmus Group Camp Dresser & McKee Inc. Carollo Engineers Inc. Carpenter Environmental Associates Inc. Carter & Burgess, Inc. CET Engineering Services CH2M HILL CRA Infrastructure & Engineering CONTECH Stormwater Solutions D&B/Guarino Engineers, LLC Damon S. Williams Associates, LLC Earth Tech Inc. Ecovation EMA Inc. Environmental Operating Solutions, Inc. Environ/The ADVENT Group, Inc. Fay, Spofford, & Thorndike Inc. Freese & Nichols, Inc. ftn Associates Inc. Gannett Fleming Inc. Garden & Associates, Ltd. Geosyntec Consultants GHD Golder Associates Ltd. Greeley and Hansen LLC Hazen & Sawyer, P.C. HDR Engineering Inc. HNTB Corporation Hydromantis Inc. HydroQual Inc. Infilco Degremont Inc. Jacques Whitford NAWE, Inc. Jason Consultants LLC Inc. Jordan, Jones, & Goulding Inc. KCI Technologies Inc. Kelly & Weaver, P.C. Kennedy/Jenks Consultants KMK Consultants Komline Sanderson Engineering Corporation Larry Walker Associates Limno-Tech Inc. The Low Impact Development Center Inc. Malcolm Pirnie Inc. Material Matters McKim & Creed Metcalf & Eddy Inc. Monteco Corporation MPR Engineering Corporation, Inc. MWH
OBrien & Gere Engineers Inc. Odor & Corrosion Technology Consultants Inc. Original Engineering Consultants, Ltd. Paradigm Environmental Technologies, Inc. Parametrix Inc. Parsons Post, Buckley, Schuh & Jernigan Praxair, Inc. Ring Industrial Group RMC Water & Environment Ross & Associates Ltd. SAIC Siemens Water Technologies The Soap & Detergent Association Smith & Loveless, Inc. Stantec Consulting Inc. Stearns & Wheler, LLC Stone Environmental Inc. Stratus Consulting Inc. Synagro Technologies Inc. Tetra Tech Inc. Trojan Technologies Inc. Trussell Technologies, Inc. URS Corporation Westin Engineering Inc. Weston Solutions Inc. Woodard & Curran Zoeller Pump Company
INDUSTRY
American Electric Power American Water Anglian Water Services, Ltd. ChevronTexaco Energy Research & Technology Company The Coca-Cola Company Dow Chemical Company DuPont Company Eastman Chemical Company Eli Lilly & Company Merck & Company Inc. Procter & Gamble Company Suez Environnment United Utilities North West (UUNW) United Water Services LLC
Note: List as of 4/10/08
WERF Board of Directors

Chair Dennis M. Diemer, P.E. East Bay Municipal Utility District Vice-Chair Alan H. Vicory, Jr., P.E., DEE Ohio River Valley Water Sanitation Commission Secretary William J. Bertera Water Environment Federation Treasurer James M. Tarpy, J.D. Metro Water Services Patricia J. Anderson City of St. Petersburg, Florida Mary E. Buzby, Ph.D. Merck & Company Inc. Mohamed F. Dahab, Ph.D. University of Nebraska, Lincoln William P. Dee Malcolm Pirnie, Inc. Charles N. Haas, Ph.D. Drexel University Jerry N. Johnson District of Columbia Water & Sewer Authority Peter J. Ruffier City of Eugene, Oregon Jeff Taylor City of Houston, Texas R. Rhodes Trussell, Ph.D. Trussell Technologies Inc. Rebecca F. West Spartanburg Water Joseph E. Zuback Siemens Water Technologies Corporation Executive Director Glenn Reinhardt
WERF Research Council

Chair Peter J. Ruffier City of Eugene, Oregon Vice-Chair Karen L. Pallansch Alexandria Sanitation Authority Christine F. Andersen, P.E. City of Long Beach, California John B. Barber, Ph.D. Eastman Chemical Company William L. Cairns, Ph.D. Trojan Technologies Inc. Glen T. Daigger, Ph.D. CH2M HILL Robbin W. Finch Boise City Public Works Ephraim S. King U.S. EPA Mary A. Lappin, P.E. Kansas City, Missouri Water Services Department Keith J. Linn Northeast Ohio Regional Sewer District Brian G. Marengo, P.E. CH2M HILL Drew C. McAvoy, Ph.D. The Procter & Gamble Company Steven M. Rogowski, P.E. Metro Wastewater Reclamation District of Denver Beverley M. Stinson, Ph.D. Metcalf & Eddy Susan J. Sullivan New England Interstate Water Pollution Control Commission Michael W. Sweeney, Ph.D. EMA Inc. George Tchobanoglous, Ph.D. Tchobanoglous Consulting
WERF
Product Order Form
As a benefit of joining the Water Environment Research Foundation, subscribers are entitled to receive one complimentary copy of all final reports and other products. Additional copies are available at cost (usually $10). To order your complimentary copy of a report, please write free in the unit price column. WERF keeps track of all orders. If the charge differs from what is shown here, we will call to confirm the total before processing.
________________________________________________________________________________________________
Name Organization Title
________________________________________________________________________________________________ ________________________________________________________________________________________________
Address
________________________________________________________________________________________________
City Phone State Fax Zip Code Country Email
________________________________________________________________________________________________ Stock # Product Quantity Unit Price To t a l
Method of Payment:
(All orders must be prepaid.)
Postage & Handling VA Residents Add 5% Sales Tax Canadian Residents Add 7% GST TOTAL
q C h e ck or Money Order Enclosed q Visa q Mastercard q A m e rican Express ______________________________________________________

Account No. Signature Exp. Date
______________________________________________________
S h ip p in g & Ha n dli n g:
Amount of Order
Up to but not more than:
To Order (Subscribers Only):

Canada & Mexico
Add: $9.50 9.50 9.50 18.00 18.00 18.00 24.00 35.00 40.00
Add 20% of order
United States
Add:
All Others
Add:
50% of amount 40% of amount
on to www.we 7 LogPublications. rf.org and click on o e: (703) 684-2470 ( Phx:n(703) 299-0742 Fa WERF Attn: Subscriber Services 635 Slaters Lane Alexandria, VA 22314-1177
$20.00 30.00 40.00 50.00 60.00 80.00 100.00 150.00 200.00

More than $200.00
$7.50* 8.00 8.50 9.00 10.00 11.00 13.00 15.00 18.00

Add 20% of order
To Order (Non-Subscribers):
Non-subscribers may be able to order WERF publications either through WEF (www.wef.org) or IWAP (www.iwapublishing.com).Visit WERFs website at www.werf.org for details.
* m i n i mum amount for all orders Note: Please make checks payable to the Water Environment Research Foundation.
Water Environment Research Foundation 635 Slaters Lane, Suite 300 Alexandria, VA 22314-1177 Phone: 703-684-2470 Fax: 703-299-0742 Email: werf@werf.org www.werf.org WERF Stock No. 01CTS4ARP
Co-published by
IWA Publishing Alliance House, 12 Caxton Street London SW1H 0QS United Kingdom Phone: +44 (0)20 7654 5500 Fax: +44 (0)20 7654 5555 Email: publications@iwap.co.uk Web: www.iwapublishing.com IWAP ISBN: 1-84339-793-5
June 08

Develop and Demonstrate Fundamental Basis For Selectors To Improve Activated Sludge Settleability

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Develop and Demonstrate Fundamental Basis For Selectors To Improve Activated Sludge Settleability

Uploaded by

Copyright:

Available Formats

Wastewater Treatment and Reuse

Enviro Enterprises Inc. M. Truett Garrett, Jr., Sc.D., P.E.

Water Environment Research Foundation Staff:

ABSTRACT AND BENEFITS

2.6 2.7 2.8

3-16 3-17 3-18 4-1

PROJECT BACKGROUND AND OBJECTIVES

Description of Test Reactors

2.1.1 Continuous Flow Activated Sludge Systems

Reactor System 2 Four-stage Anoxic Selector

Motor Air Pump

Feed Internal Recycle Pump Magnetic Stirrer

Reactor System 3 - Single-Stage Anoxic Selector

Anoxic Selector Aeration Zone

Air Pump Effluent

2.1.2 Sequencing Batch Reactor (SBR)

Aeration OFF ON OFF ON OFF

Settle OFF OFF OFF OFF OFF

Decant Effluent OFF OFF OFF OFF ON

Idle OFF OFF OFF OFF OFF

Pump Timer Air pump Pump

Figure 2-3. Sketch of Sequencing Batch Reactor (SBR) System.

2.1.3 Anaerobic Selector System

2.1.5 Dextrin Degradation Kinetics Test Reactor

Reactor System 1 Four-stage Anaerobic Selector

Motor Air Pump

Feed Magnetic Stirrer

Reactor System 2 - Single-Stage Anaerobic Selector

Air Pump Effluent

Figure 2-4. Schematic of Single- and Four-stage Anaerobic Selectors.

Synthetic Wastewater Composition

2.2.2 Synthetic Feed for Anaerobic Selector Study

Synthetic feed organic components Total COD Fraction

Soluble shortchain organic compounds 40

Fats and oils 20

II. Organic Nitrogen 1 2 Peptone Yeast

V. Phosphorus K2HPO4 KH2PO4 VI. Alkalinity NaHCO3

2.3.1 Phase I - Start Up of System and Anoxic Selector Additions

2.3.2 Phase I Operation Continue Anoxic Selector Operation

2.3.3 Phase II Operation Verification of Phase I Results and SBR Addition

S1 and S4 mixed liquor 4.3 12 6 4

2.3.5 Phase IV Operation Mainly Acetate for Feed COD

2.3.6 Phase V Anaerobic Selector Operation

Sampling Location, Frequency, and Analyses

Sample location Mixed liquor D W D W W D

Legend: D daily, W weekly, P periodically.

2.5.1 DO, pH, and Temperature

2.5.2 Total and Volatile Suspended Solids

2.5.3 Diluted Sludge Volume Index (DSVI)

Sludge volume after 30 min settling, mL / L Dilution factor) (MLSS, g / L)

2.5.4 Soluble COD

2.5.5 Readily Biodegradable COD (rbCOD)

2.5.6 Nitrate, Nitrite, and Ammonia Analyses

2.5.7 Reactive Phosphorus

2.5.8 Starch and Dextrin

2.5.10 Poly-3-hydroxybutyrate (PHB)

2.5.11 Filamentous Organism Identification and Abundance Index

Table 2-9. Subjective Scoring of Filamentous Abundance.

where: V Q SRT MLSS TSS eff

MLSS (V ) TSS eff (Q ) SRT

(Spacer length ID of clone )

Figure 2-5. Flow Chart of the Molecular Work.