Environmental Microbiology (2008) 10(7), 1668–1680 doi:10.1111/j.1462-2920.2008.01583.

Characterizing the regulation of the Pu promoter in

Acinetobacter baylyi ADP1

Wei E. Huang,1*† Andrew C. Singer,1 Introduction

Andrew J. Spiers,1 Gail M. Preston2 and
Metagenomics is a promising approach to address the
Andrew S. Whiteley1**
1
challenge of recovering novel xenobiotic-degrading
Molecular Microbial Ecology, CEH-Oxford, Mansfield
enzymes from unculturable microorganisms (Schloss
Road, Oxford OX1 3SR, UK.
2
and Handelsman, 2003; Handelsman, 2004). Functional
Department of Plant Sciences, University of Oxford,
metagenomics requires cloning DNA into a culturable
South Parks Road, Oxford OX1 3RB, UK.
organism for functional study (Uchiyama et al., 2005).
One important metagenomic strategy is substrate-
Summary induced gene expression screening (SIGEX), which is
based on the model that an inducible regulatory protein
Effective gene trapping and screening requires
activates a promoter of an operon fused with a reporter
sensory and regulatory compatibility of both host and
gene, and that substrate-dependent induction can be
exogenous systems. The naturally competent bacte-
used to identify DNA fragments that contain genes
rium Acinetobacter baylyi ADP1 is able to efficiently
involved in catabolism of a specific substrate (Uchiyama
take up and integrate exogenous DNA into the
et al., 2005). However, for SIGEX to be successful,
chromosome, making it an attractive host system for
it is critical that the surrogate host reproduces the
a wide range of metagenomic applications. To test
same substrate-inducible gene regulation as the source
the ability of A. baylyi ADP1 to express the XylR-
bacterium. SIGEX has successfully been used to isolate
regulated Pu promoter from Pseudomonas putida
metagenomic DNA fragments containing benzoate- and
mt-2, we have constructed and examined an A. baylyi
naphthalene-inducible promoters from contaminated
ADP1 strain, ADPWH-Pu-lux-xylR. The Pu promoter
groundwater, with Escherichia coli as a host. However,
in ADPWH-Pu-lux-xylR was specifically induced by
E. coli is not always an ideal host for gene regulation
toluene, m-, p- and o-xylene. The substrate-induced
systems originating from other taxonomic groups. For
Pu promoter was highly dependent on the growth
example, E. coli cannot properly express DmpR, the
medium: it was repressed in rich media until station-
phenol degradation regulatory protein from Pseudomonas
ary phase, but was immediately induced in minimal
sp. CF600 (Bernardo et al., 2006). Similarly, genes
medium with glucose as the sole carbon source
expressed in E. coli may not reproduce the regulatory
(MMG). However, the Pu promoter was repressed in
characteristics observed in the source strain. For
MMG when it was supplemented with 5 g l-1 yeast
example, the Pu promoter of Pseudomonas putida mt-2 is
extract. Further investigation showed that the Pu
significantly repressed in its natural genetic background
promoter in MMG was repressed by 0.5 g l-1 aspartic
during exponential growth, even in the presence of
acid or asparagine, but not repressed by glutamine.
toluene or xylenes (Marques et al., 1994; Cases et al.,
Changing the carbon/nitrogen ratios by addition of
1996), while in E. coli the Pu promoter is immediately
ammonia did not significantly affect the Pu promoter
induced in response to inducing substrates, irrespective
activity but addition of nitrate did. These results show
of growth phase (Abril et al., 1989; Willardson et al.,
that A. baylyi ADP1 reproduced characteristics of the
1998).
XylR-regulated Pu promoter observed in its original
Acinetobacter baylyi ADP1 (previously Acinetobacter
host. It demonstrates that A. baylyi could provide an
sp. ADP1) is a nutritionally versatile chemo-heterotroph,
excellent genetic host for a wide range of functional
occupying a wide range of habitats (water and soil) and
metagenomic applications.
lifestyles (Young et al., 2005). Analyses of the 16S rRNA
Received 29 September, 2007; accepted 26 January, 2008. For gene and the A. baylyi ADP1 genome and proteome
correspondence. *E-mail w.huang@sheffield.ac.uk; Tel. (+44) 114 suggest that A. baylyi ADP1 is closely related to the order
2225796; Fax (+44) 114 2225701; or **E-mail aswhi@ceh.ac.uk; Pseudomonadales (Barbe et al., 2004; Young et al., 2005;
Tel. (+44) 114 2225796; Fax (+44) 114 2225701. †Present address:
Kroto Research Institute, University of Sheffield, Broad Lane, S3 Vaneechoutte et al., 2006). Acinetobacter baylyi ADP1
7HQ, UK. has many characteristics that make it an ideal genetic
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd

host for a wide range of metagenomic applications. First,
A. baylyi ADP1 is naturally competent and can take up
either naked or plasmid DNA making it a suitable alter-
native to E. coli for genetic engineering (Palmen and
Hellingwerf, 1997; Barbe et al., 2004; Metzgar et al.,
2004). The DNA transformation efficiency of ADP1 can
reach 10-2 (de Vries et al., 2003), which is more efficient
than calcium chloride-treated E. coli (Palmen and Helling-
werf, 1997; Barbe et al., 2004; Metzgar et al., 2004).
Second, A. baylyi ADP1 can easily perform multigene
trappings which may overcome the in cis transcription
limitation associated with single trapping in SIGEX. Third,
A. baylyi ADP1 is able to express a wide range of
heterologous genes (Kok et al., 1999; Melnikov and
Youngman, 1999; Huang et al., 2005; Young et al., 2005),
implying that the gene expression and protein folding in
A. baylyi ADP1 may be highly robust. Finally, it is pro-
posed that A. baylyi ADP1 should have similar regulation
machinery to the bacteria present in natural water and
soils, which makes it an ideal host to reconstruct complex
regulatory processes involving complex regulators and
signal chemicals.
In this study, we cloned the RpoN (s54)-dependent
Pu–XylR regulatory system into the chromosome of
A. baylyi ADP1, as a foundation for future studies involv-
ing multigene cloning and acclimatization of exogenous
DNA. For this purpose, we have fused the Pu promoter
with a bioluminescence reporter operon luxCDABE. The
corresponding regulatory gene xylR from the TOL plasmid
of P. putida mt-2 was inserted into an adjacent location in
the chromosome. We examined the effects of inducers,
carbon sources and amino acids on activation of the Pu
promoter. We confirmed that the Pu promoter–XylR regu-
latory system not only functioned in A. baylyi ADP1, but
also reproduced the expression characteristics observed
in its original host – P. putida mt-2. We also revealed that
the repression of the Pu promoter can be caused by
aspartic acid or asparagine, but not glutamine, although
all these three amino acids are involved in bacterial nitro-
gen metabolism. Our results support the proposition that
A. baylyi ADP1 could be a useful alternative host for func-
tional metagenomics.
Results and discussion
Construction of A. baylyi ADPWH-Pu-lux-xylR
To investigate the behaviour of the Pu promoter–XylR
regulatory system in A. baylyi ADP1, we constructed a
bioluminescence reporter mutant strain, ADPWH-Pu-lux-
xylR, in which luxCDABE was fused with the Pu promoter
and regulated by XylR expressed in trans.
First, Pu-luxCDABE (6163 bp) was inserted into the
salAR operon of the salA mutant A. baylyi ADPW67
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
Characterizing the regulation of the Pu promoter 1669
(Jones et al., 2000) by homologous recombination of
plasmid pSalAR_Pu_lux to generate A. baylyi ADPWH-
Pu-lux (Fig. 1). Plasmid pSalAR_Pu_lux contains frag-
ments of the salA and salR genes cloned either side of
Pu-luxCDABE, and is derived from pGEM-T [Promega,
UK (Huang et al., 2005)], which belongs to a family of
cloning vectors that have been shown not to replicate in
strain A. baylyi ADP1 (Young and Ornston, 2001). Recom-
bination of pSalAR_Pu_lux with the mutated salA gene of
A. baylyi ADPW67 results in replacement of the disrupted
salA gene with a functional gene, and transformants could
be identified on the basis of their ability to grow on 2.5 mM
salicylate as sole carbon source (SAA). The frequency
of the gene transformation was 6.1 ⫾ 0.7 ¥ 10-6. Poly-
merase chain reaction (PCR) amplification and DNA
sequencing using the primer pairs salA_flank_for
and luxC_rev, and salAR_rev and luxE_fwd (Fig. 1 and
Table 2), confirmed the presence of the Pu promoter and
luxCDABE cassette in the chromosome of ADPWH-
Pu-lux (Fig. 1). We have previously shown that the salA
promoter is strong enough to transcribe large inserts
between salA and salR (Huang et al., 2005), and this was
confirmed here as ADPWH-Pu-lux was able to grow on
salicylate agar (SAA; data not shown) and displayed
salicylate-induced bioluminescence, indicating that salA
and salR were functional and expressed (Figs S1A
and S2A).
Second, xylR-Km was inserted into the salA gene of
ADPWH-Pu-lux to create A. baylyi ADPWH-Pu-lux-xylR
by using plasmid pSalA_Km_xylR as a donor and
ADPWH-Pu-lux as a recipient (Fig. 1). Plasmid pSalA_
Km_xylR contains a xylR-terminator-Km cassette flanked
by two homologous fragments of salA (Fig. 1). The trans-
formants were selected on Luria–Bertani (LB) agar with
10 mg ml-1 kanamycin. The transformation frequency was
7.7 ⫾ 0.3 ¥ 10-6. The insertion of the xylR-terminator-Km
cassette completely prevented read-through from the
salA promoter, and A. baylyi ADPWH-Pu-lux-xylR dis-
played no expression of luxCDABE in the presence of
salicylate (Fig. S2B). Unlike the eukaryotic luc reporter
(Willardson et al., 1998), the bacterial reporter operon
luxCDABE provides self-sufficient bioluminescence
expression without addition of the substrate (e.g. luciferin)
for the reaction. The luxCDABE reporter acts as a more
sensitive reporter of gene expression than lacZ in
A. baylyi ADP1, and permits detection of gene expression
over a wider range, which allows the unambiguous detec-
tion of promoter activity (Siehler et al., 2007).
Pu expression in A. baylyi ADPWH-Pu-lux-xylR is
induced by toluene and xylene
Exposure of ADPWH-Pu-lux-xylR colonies grown on LB
agar plates to toluene, m-, p- or o-xylene vapours
1670 W. E. Huang et al.

Fig. 1. Outline of construction of the A. baylyi ADPWH-Pu-lux-xylR bioluminescence reporter. ADPWH-Pu-lux was produced by integrating the
suicide plasmid pSalAR_Pu_lux containing Pu promoter-luxCDABE flanked on either side by salA and partial salR sequences, into ADPW67
and replacement of the kanamycin (Km) resistance cassette in salA. The resulting Km-sensitive strain ADPWH-Pu-lux can grow on SAA plates
as it now contains an uninterrupted copy of salA. The suicide plasmid pSalA_Km_xylR containing a Km resistance gene, terminator and xylR
gene flanked on either side of partial salA (salA1 and salA2), was then integrated into ADPWH_Pu_lux to give the Km-resistant strain
ADPWH-Pu-lux-xylR. The terminator sequence was included between the xylR and Km genes to prevent transcriptional read-through of
luxCDABE from the salA promoter without activation of the Pu promoter. The correct insertion of each of these chromosomal cassettes was
confirmed by colony-PCR and sequencing. DNA length is not shown to scale.

© 2008 The Authors

Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
 Characterizing the regulation of the Pu promoter 1671

100000 ity and sensitivity, ADPWH-Pu-lux-xylR could be a useful

m-xylene soil and rhizosphere-based biosensor for toluene and
p-xylene xylene.
Relative bioluminescence

10000 o-xylene
toluene
1000
100
10
0 0.5 5 50
Inducer concentration (µM)
Fig. 2. Sensitivity of A. baylyi ADPWH_Pu_lux_xylR to toluene and
xylenes (P < 0.05). Bioluminescence was measured at OD600 = 0.8
in LB medium. The error bars represent standard error for three
bioluminescence readings from three replicate samples.
(generated by placing a filter tip dipped in substrate on the
agar plate) resulted in strong bioluminescence while
un-induced colonies remained dark (Fig. S1B). However,
no bioluminescence was observed after exposure to
phenol, benzene, naphthalene, sodium salicylate (sodium
2-hydroxybenzoate), 3-hydroxybenzate, 4-hydroxyben-
zate, benzoate or catechol (data not shown), which indi-
cates that the Pu promoter–XylR regulatory system in
A. baylyi ADPWH-Pu-lux-xylR specifically responds to
toluene and xylenes, as observed in P. putida mt-2. These
results provide further evidence that salicylate dependent
expression of luxCDABE was blocked by introduction of
the xylR-terminator-Km construct, and confirm that the
xylR-terminator-Km construct did not prevent toluene/
xylenes dependent expression of the luxCDABE cassette.
ADPWH-Pu-lux, which does not contain xylR in the chro-
mosome, cannot be induced by toluene or xylene (Fig.
S2), which confirms that induction of lux expression in
ADPWH-Pu-lux-xylR is mediated by XylR, rather than a
native xylR-like regulator. This is supported by BLASTP
and Pfam domain analyses of the genome sequence of
A. baylyi ADP1, which show that this strain does not
contain any regulatory proteins that display significant
similarity to XylR.
ADPWH-Pu-lux-xylR is not only highly specific but also
highly sensitive, capable of detecting toluene or xylenes
as low as 0.5 mM in liquid cultures grown to late log
phase (Fig. 2). The bioluminescence became stronger as
toluene/xylene concentration increased within the range
0.5–500 mM (Fig. 2), showing that ADPWH-Pu-lux-xylR
can be used to quantify XylR-dependent regulation of Pu
promoter expression. Acinetobacter ADPWH-Pu-lux-xylR
cannot metabolize toluene and toluene more or less has
inhibit effect on cells growth. Because of its high specific-
Pu promoter activation in A. baylyi ADPWH-Pu-lux-xylR
is growth medium dependent
The Pu promoter–XylR regulatory system is RpoN (s54)
dependent (Cases and de Lorenzo, 2005). The results
described above confirm that the RpoN (s54) protein of
A. baylyi ADP1 can substitute for the function of the
P. putida RpoN and allows the XylR and the Pu promoter
to function well in ADPWH-Pu-lux-xylR, in a similar way to
500 its original host P. putida. XylR and growth medium-
dependent regulation of the Pu promoter in Pseudo-
monas has been well documented (Marques et al., 1994;
Cases et al., 1996) (for review, please see Cases and
de Lorenzo, 2005), so experiments were performed to
test whether growth medium-dependent regulation of Pu
expression in ADPWH-Pu-lux-xylR was also similar to
regulation in P. putida. As in its original host P. putida
mt-2, the XylR-regulated Pu promoter in A. baylyi
ADPWH-Pu-lux-xylR was repressed during exponential
growth phase when bacteria were grown in rich medium
such as LB, in spite of the presence of toluene or xylenes,
and induced in stationary phase (Fig. 3A). This phenom-
enon is classically referred to as ‘exponential silencing’
(Cases et al., 1996). However, the Pu promoter in
A. baylyi ADPWH-Pu-lux-xylR was immediately activated
regardless of growth phase when bacteria were grown
in minimal medium-glucose (MMG) in the presence of
toluene or xylene (Fig. 3B), which is in good agreement
with observations of Pu-dependent mRNA expression in
P. putida (Marques et al., 1994). Interestingly, addition of
5 g l-1 yeast extract to MMG medium repressed the Pu
promoter in ADPWH-Pu-lux-xylR during the first 7 h of
growth (Fig. 4). Collectively, these experiments show that
the activation of Pu promoter in A. baylyi ADPWH-Pu-lux-
xylR can be affected by the growth medium. The Pu
promoter’s immediate activation in minimal medium but
significant delay in the presence of yeast extract suggests
the repression of Pu promoter could be related to some
chemicals in yeast extract.
Aspartic acid and asparagine but not glutamine
represses Pu promoter activity in ADPWH-Pu-lux-xylR
Rich media such as LB and MMG supplemented with
yeast extract contain more complex chemical compounds
than minimal medium such as MMG, including high
concentrations of amino acids. Therefore, the delay of Pu
promoter activation in LB and MMG with yeast extract
may be associated with global regulatory mechanisms
linked to amino acid metabolism, as proposed by
Marques and colleagues (1994). As the Pu promoter is

© 2008 The Authors

Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
1672 W. E. Huang et al.

20000 2 20000 2
LB
1.6
LB A1 1.6 LB+m-xylene A2
18000 LB+toluene 18000

OD600
1.2
1.2
OD600
16000 16000 0.8

0.8 0.4

Relative Bioluminescence
14000 14000 0
Relative Bioluminescence

0.4
0 10 20 30
12000 12000 Time (h)
0
0 10 20 30
10000 Time (h)
10000

8000 8000

LB-Biolum
6000 LB-Biolum 6000
LB+m-xylene-Biolum
LB+toluene-Biolum
4000 4000

2000 2000

0 0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Time (h) Time (h)

20000 MM+glu
2 MM+glu
B1 20000 B2 2 MM+glu+m-xylene
MM+glu+toluene
1.6 1.6
18000

OD600
18000 1.2
OD600

1.2
16000 0.8
0.8 16000
0.4
0.4
Relative Bioluminescence

0
Relative Bioluminescence

14000 14000 0 10 20 30
0 Time (h)
0 10 20 30
12000 12000
Time (h)

10000 10000

8000 8000

6000 6000

4000 4000
MM+glu-Biolum
MM+glu-Biolum MM+glu+m-xylene-Biolum
2000 2000
MM+glu+toluene-Biolum

0 0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Time (h) Time (h)

Fig. 3. Pu promoter activity in A. baylyi ADPWH-Pu-lux-xylR is dependent on the growth media (P < 0.05). In LB (rich medium), the Pu
promoter was only induced after 10–15 h even in the presence of toluene (A1), m-xylene (A2), p-xylene (A3) or o-xylene (A4). However, in
MMG (minimal medium), Pu promoter was induced immediately in the presence of toluene (B1), m-xylene (B2), p-xylene (B3) or o-xylene
(B4). MM, minimal medium.

RpoN (s54) dependent and rpoN expression is known to estimated individual amino acid concentration in yeast
be repressed by high nitrogen availability in P. putida extract. The addition of aspartic acid (3.76 mM) or aspar-
(Cases and de Lorenzo, 2005), three amino acids: aspar- agine (3.78 mM) to MMG fully repressed the Pu promoter
tic acid, asparagine and glutamine, which are associated for 23 h, the period of observation (Fig. 4). In contrast, the
with bacterial nitrogen metabolism, were tested for their addition of glutamine (3.42 mM) to MMG immediately
effects on Pu promoter repression. Minimal medium- activated and enhanced Pu promoter activity (Fig. 4).
glucose was supplemented with 0.5 g l-1 aspartic acid, However, despite these differences, ADPWH-Pu-lux-xylR
asparagine or glutamine, which is equivalent to the displayed similar growth characteristics in MMG supple-

© 2008 The Authors

Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
 Characterizing the regulation of the Pu promoter 1673
2 LB
20000 1.6 LB+o-xylene
20000 2 A3 A4

OD600
LB 1.2
18000 1.6 LB+p-xylene 18000
0.8

OD600
1.2 16000 0.4
16000

Relative Bioluminescence
0.8 0
Relative bioluminescence

14000 14000 0 10 20 30
0.4 Time (h)
12000 12000
0
0 10 20 30
10000 10000
Time (h)

8000 8000

6000 LB-Biolum 6000 LB-Biolum

LB+o-xylene-Biolum
LB+p-xylene-Biolum
4000 4000

2000 2000

0 0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Time (h) Time (h)

MM+glu
20000 MM+glu+p-xylene 20000 MM+glu
2

1.6
B4 2 MM+glu+o-xylene
18000 18000 1.6
B3

OD600
OD600

1.2
1.2
16000 0.8 16000
Relative Bioluminescence 0.8
0.4 0.4
14000 0 14000 0
Relative Bioluminescence

0 10 20 30 0 10 20 30
Time (h)
Time (h)
12000 12000

10000 10000

8000 8000

6000 6000

4000 4000
MM+glu-Biolum
MM+glu-Biolum
2000 2000 MM+glu+o-xylene-Biolum
MM+glu+p-xylene

0 0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Time (h) Time (h)

Fig. 3. cont.

mented with glutamine, aspartic acid or asparagine nitrogen status (Arcondeguy et al., 2001). The main
(Fig. 4). Cell densities in MMG supplemented with amino pathway for glutamine assimilation in Acinetobacter is
acids were twice higher than in MMG-only medium, likely to involve conversion of glutamine to glutamate
indicating that ADPWH-Pu-lux-xylR could use glutamine, and then to the TCA cycle intermediate oxoglutarate. In
aspartic acid and asparagine as nitrogen and carbon contrast, asparagine is converted to aspartate and then
sources. This shows that the Pu promoter can be to fumarate, the TCA cycle intermediate immediately
repressed or induced in response to the presence and downstream of succinate. All three amino acids can be
metabolism of a single, specific amino acid, as suggested used to generate energy via the TCA cycle, but only
for the Pu promoter–XylR regulatory system in P. putida glutamine metabolism also acts to signal high nitrogen
(Marques et al., 1994). status, which could help to explain why asparagine and
Glutamine is an important metabolite in bacterial aspartate both act as repressors of Pu expression, but
physiology (Forchhammer, 2007) and an indicator of glutamine does not.

© 2008 The Authors

Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
1674 W. E. Huang et al.
MM+Glu
MM+Glu+YE+m-xylene
MM+Glu+Aspartic acid+m-xylene
MM+Glu+Asparagine+m-xylene
60000
MM+Glu+Glutamine+m-xylene
MM+Glu Fig. 4. Regulation of Pu promoter activity by
MM+Glu+YE+m-xylene single amino acids (P < 0.05). Acinetobacter
MM+Glu+Aspartic acid+m-xylene baylyi ADPWH-Pu-lux-xylR was incubated in
MM+Glu+Asparagine+m-xylene MMG (30 mM glucose as sole carbon
2 MM+Glu+Glutamine+m-xylene source), and MMG supplemented with either
5 g l-1 yeast extract (YE), 0.5 g l-1 aspartic
1.6 acid, 0.5 g l-1 asparagine or 0.5 g l-1
glutamine. m-xylene was added to all media
at a final concentration of 500 mM as an
1.2

OD600
inducing substrate. Bacteria grew at similar
0.8 rates in media supplemented with YE or
50000 amino acids (inset). The Pu promoter was
0.4
immediately induced and expressed at an
increased level in MMG-glutamine, but
expression was delayed 7 h in YE. Pu
Relative bioluminescence

0
40000 0 10 20 30 promoter activity was significantly inhibited in
Time (h) MMG-aspartate and MMG-asparagine. MM,
minimal medium.

30000

20000

10000

0
0 5 10 15 20 25 30
Time (h)

Carbon source effect on Pu activity of activity in P. putida (Cases et al., 1999). Acinetobacter
ADPWH_Pu_lux_xylR baylyi ADP1 lacks a glucose PTS system and oxidizes
glucose to gluconate in the periplasm (Barbe et al., 2004;
When multiple carbon sources are available, bacteria
Young et al., 2005), and this characteristic of glucose
preferentially use economically favourable substrates
(Holtel et al., 1994). Bacteria achieve this regulation
through carbon catabolite repression (CCR) (Stulke 20000
and Hillen, 1999). In the presence of preferred carbon 18000 Succinate
sources (typically glucose), bacteria will repress the 16000 Glucose
Relative bioluminescence

machinery needed for the assimilation of other less LB

14000
labile carbon sources (Holtel et al., 1994; Ramos et al.,
1997; Stulke and Hillen, 1999; Bruckner and Titgemeyer, 12000
2002). Carbon catabolite repression by glucose and 10000
succinate has been reported to limit Pu promoter activity
8000
in both E. coli and P. putida (Holtel et al., 1994; Duetz
et al., 1996). In the presence of 500 mM toluene, m-, p- 6000
or o-xylene, ADPWH-Pu-lux-xylR both MMS (minimal 4000
medium with 30 mM succinate) and LB gave similar
2000
levels of Pu expression, but glucose did not repress Pu
activity but enhanced it. Pu activity in MMG was two- to 0
fourfold higher than in MMS and LB media (Fig. 5). This control T500 M500 P500 O500
indicates that succinate, but not glucose, exerts carbon Treatments
catabolite repression on Pu–xylR expression in ADPWH-
Fig. 5. The effect of glucose and succinate on Pu promoter activity
Pu-lux-xylR, and is in good agreement with Dal and in A. baylyi ADPWH-Pu-lux-xylR (P < 0.05). Pu activity is expressed
Gerischer’s observations (Dal et al., 2002; Siehler et al., as a function of relative bioluminescence. Pu activity in LB, glucose
2007). (30 mM) or succinate (30 mM) minimal medium in the presence of
500 mM of toluene (T500), m-xylene (M500), p-xylene (P500) or
The phosphotransferase (PTS) system protein PstN o-xylene (O500). Controls were media without inducer.
(IIANtr) is required for glucose repression of Pu promoter Bioluminescence was measured at OD600 = 0.8.

© 2008 The Authors

Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

assimilation might explain the lack of glucose-induced
catabolite repression in ADPWH-Pu-lux-xylR. Velazquez
and colleagues (2004) have proposed that the Entner–
Doudoroff catabolites 6-phosphogluconate (6-PG) and
2-dehydro-3-deoxyphosphogluconate (KDPG) are signal
molecules for Pu promoter repression in P. putida. Acine-
tobacter baylyi ADP1 lacks both a G6P dehydrogenase
and 6-phosphogluconolactonase required to produce
these catabolites from G6P (Barbe et al., 2004). ADPWH-
Pu-lux-xylR was found to be able to grow on 6-PG as the
sole carbon source; it indicates 6-PG can be transported
into the cells as carbon source. However, the addition of
6-PG ranging from 0.1 to 300 mM in LB media had no
effect on Pu promoter activity (data not shown). It sug-
gests that KDPG instead of 6-PG should be a repression
signal of Pu promoter activity in Acinetobacter baylyi
ADP1, which is in good agreement with the observation of
the XylR-regulated Pu promoter in P. putida KT2440 host
by del Castillo (del Castillo and Ramos, 2007).
The effect of carbon/nitrogen ratio on Pu
promoter activity
Carbon metabolism is controlled by carbon-derived
signals and the availability of nitrogen and other nutrients
(Commichau et al., 2006). We examined Pu promoter
activity in MMG supplemented with varying concentra-
tions of ammonia or nitrate, and containing m-xylene as
an inducing substrate. Expression of the Pu promoter
increased in media with a high carbon/nitrogen ratio with
nitrate as a nitrogen source, but showed no significant
change in media with ammonia as a nitrogen source
(Fig. 6). XylR activates Pu expression by activating the
alternate sigma factor RpoN, which also regulates genes
involved in nitrogen assimilation. In P. putida, rpoN
expression is modulated by nitrogen availability (Cases
and de Lorenzo, 2005), so it is possible that nitrogen
modulates Pu expression as a result of the effect of nitro-
gen on the activity and expression of RpoN.
In conclusion, this study has shown that the substrate,
nutrient and growth-dependent properties of the Pu
promoter–XylR system can be reconstituted in a surro-
gate host, A. baylyi ADP1, which accurately mimics the
regulatory and physiological characteristics of bacterial
species commonly found in natural habitats such as soils
and groundwater. Acinetobacter baylyi ADP1 is likely to
provide a better genetic host than E. coli, at least in this
case, for functional metagenomic approaches such as
SIGEX, as E. coli can show non-specific compound
induction and non-characteristic regulation (Willardson
et al., 1998), particularly when expressing plasmid-borne
genes. The chromosomal integration strategy described
in this study can easily be adapted to screen libraries of
DNA fragments containing putative regulator–promoter
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
Characterizing the regulation of the Pu promoter 1675
pairs in the presence and absence of inducing sub-
strates, thereby isolating novel degradative and reg-
ulatory genes from both culturable and unculturable
bacteria.
Experimental procedures
Bacterial strains and media
The bacterial strains and plasmids used in this study are
listed in Table 1. Acinetobacter baylyi ADP1 and its
mutants were incubated at 28°C or 30°C, and E. coli at
37°C. All chemicals were obtained from Sigma-Aldrich
and were analytical grade reagents. Luria–Bertani
medium or minimal medium (Huang et al., 2005) was
used for the cultivation of bacteria as appropriate. Minimal
medium-glucose and MMS were prepared by the addition
of 30 mM glucose or succinate to minimal medium.
Salicylate agar was prepared using 2.5 mM salicylate
as a sole carbon source in minimal medium with 1.4%
Noble agar (Marine BioProduct, Canada). Amino acid-
supplemented media were prepared by adding 5 g l-1
yeast extract (YE), 0.5 g l-1 aspartic acid, 0.5 g l-1 aspar-
agine or 0.5 g l-1 glutamine to MMG. Benzene, benz-
oates, catechol, naphthalene, phenol, toluene, m-xylene,
p-xylene, o-xylene, 2-hydroxybenzoic acid (salicylic acid),
3-hyroxybenzoic and 4-hydroxybenzoic were also added
to plates or cultures for induction or growth tests. Ampi-
cillin (Amp) at 100 mg ml-1 and 50 mg ml-1 kanamycin (Km)
was used for E. coli, and 10 mg ml-1 Km for A. baylyi ADP1
or its mutants when required.
Gene transformation
Preparation of competent A. baylyi ADP1 cells was per-
formed as described previously (Palmen et al., 1993;
Huang et al., 2005). Briefly, ADPW67 or ADP1_Pu_lux
was grown in 5 ml of LB at 30°C with shaking at 200 r.p.m.
overnight. Two hundred microlitres of culture was then
diluted into 5 ml of fresh LB medium and incubated for 2 h
to make the cells competent. Cells were harvested by
3000 r.p.m. centrifugation and re-suspended in 0.5 ml of
fresh LB. Two micrograms of intact plasmid DNA was
added to the 0.5 ml competent cells (109 cells ml-1) and
incubated for 2 h at 30°C. The cells were then plated on
selective media to obtain the appropriate transformants.
Molecular techniques materials
Escherichia coli JM109 (Promega, UK) was used for
plasmid cloning and preparation according to the manu-
facturer’s instructions. All oligonucleotide primers were
obtained from MWG Biotech (http://www.mwg-biotech.
com/) and are listed in Table 2. QIAquick gel extraction kit
(Qiagen, UK) was used to purify DNA from agarose
1676 W. E. Huang et al.

A. NH4+ Fig. 6. The effect of carbon/nitrogen (C/N)

ratio on Pu promoter activity in A. baylyi
2 C/N=1
20000 ADPWH-Pu-lux-xylR.
C/N=4
C/N=1 C/N=6 A. Varying the carbon/nitrogen ratio by
1.6
C/N=8 providing ammonia as sole nitrogen source
18000 C/N=4
C/N=10 and varying ammonia concentration has no
1.2

OD600
C/N=6 significant effect on Pu activity in A. baylyi
16000 C/N=8 0.8 ADPWH-Pu-lux-xylR (P > 0.1).
C/N=10 B. Varying the carbon/nitrogen ratio by
0.4 providing nitrate as sole nitrogen source and
Relative Bioluminescence

14000 varying nitrate concentration has a significant

0 effect on Pu activity (P < 0.05). Higher
12000 0 10 20 30 carbon/nitrogen ratio induced stronger Pu
Time (h)
activity; lower carbon/nitrogen ratio led to
reduced Pu activity.
10000 In both (A) and (B), varying the carbon/
nitrogen ratio had little effect on cell growth
8000 (inset) (P > 0.05).

6000

4000

2000

0
0 5 10 15 20 25 30
Time (h)

B. NO3-
2 C/N=1
20000 C/N=1 C/N=4
1.6 C/N=6
C/N=4 C/N=8
OD600

1.2 C/N=10
18000 C/N=6
C/N=8 0.8
C/N=10 0.4
16000
0
0 10 20 30
14000 Time (h)
Relative Bioluminescence

12000

10000

8000

6000

4000

2000

0
0 5 10 15 20 25 30
Time (h)

© 2008 The Authors

Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
 Characterizing the regulation of the Pu promoter 1677
Table 1. Strains and plasmids used in this study.

Bacteria and plasmids Description Reference

Acinetobacter baylyi strains

ADP1(BD413) Wild type Juni and Janik (1969)
ADPW67 SalA::Kmr, Km gene inserted into ClaI site of salA Jones et al. (2000)
ADPWH-Pu-lux 320 bp Pu promoter and luxCDABE (~5.8 kb) gene inserted into an EcoRI site This study
created between salA and salR, obtained by transformation of ADPW67 and
pSalAR_lux
ADPWH-Pu-lux-xylR xylR gene inserted into an EcoRI site created in salA, obtained by transformation This study
of ADP1_pu_lux6 and pSalA_xylR_Km
Escherichia coli strains
JM109 High-efficiency competent cells Promega
Plasmids
pGEM-T Ampr, T7 and SP6 promoters, lacZ, vector Promega
pRMJ2 Source plasmid for Km gene (1654 bp) Jones and Williams (2003)
pSB417 luxCDABE source plasmid, luxCDABE from Photorhabdus (Xenorhabdus) Winson et al. (1998)
luminescens ATCC2999 (Hb strain)
pMC2 Source of Pu promoter Inouye et al. (1983)
pTS174 Source of xylR and its native promoter Inouye et al. (1983)
pSalAR_lux luxCDABE (5846 bp) gene from pSB417 by EcoRI and inserted into an EcoRI site Huang et al. (2005)
created between salA and salR of pSalAR_BE
pSalAR_ Pu_ lux Pu promoter inserted into the EcoRI site of pSalAR_lux This study
pSalA_BE SalA (1791 bp) gene cloned into pGEM-T, with EcoRI and BamHI restriction sites This study
created by overlap extension PCR
pSalAR_Km Km gene (1654 bp) gene from pRMJ2 inserted between the EcoRI and BamHI This study
sites of pSalA_BE
pSalA_Km_xylR xylR with its native promoter from pxylR inserted into the EcoRI site of pSalA_Km This study

gels for cloning or sequencing as the manufacturer’s in-
structions. Plasmid construction and chromosomal in-
sertions were confirmed by PCR and DNA sequencing.
Polymerase chain reaction was carried out using a
Sigma PCR kit. For colony-PCR, single-colony material
re-suspended in 50 ml of PCR reaction mixture was used
as DNA template material.
Plasmid construction
Constructing pSalAR_Pu_lux. The 320 bp Pu promoter
fragment was excised from pMC2 by EcoRI and ligated
with partially EcoRI-digested pSalAR_lux (Huang et al.,
2005) (Fig. 1). Escherichia coli JM109 competent cells
(Promega, UK) were transformed with the ligation mixture,
and then spread on LB Amp for selection. Sixteen colo-
nies were investigated by colony-PCR (Sigma PCR kit)
using primers salA_end_for and luxC_rev (Table 2), with
an initial denaturation at 95°C for 5 min, followed by 35
cycles of 94°C for 1 min, 58°C for 1 min and 72°C for
1 min, and a final extension at 72°C for 10 min. After
amplification, 10 ml of PCR product was examined by
agarose-ethidium bromide gel electrophoresis. The PCR
fragments from four clones were purified from the gel
(QIAquick gel extraction kit, Qiagen) and confirmed by
DNA sequencing. A clone containing a plasmid in which
the Pu promoter sequence was in the same orientation as
luxCDABE was selected and designated as pSalAR_Pu_
lux (Fig. 1).
Constructing pSalA_Km_xylR
• Overlap extension PCR to create restriction cut sites.
EcoRI and BamHI restriction sites were created within the
salA gene by overlap extension PCR (OEP) as previously
described (Huang et al., 2005). Two salA fragments,

Table 2. Oligonucleotide primers used in this study.

Primers Sequence (5′ → 3′) Note

salA_flank_for CCAGCTGATCAGTTGTAGAATG Outside salA gene

salA_EB_for GATGCTATTTTAGGGAGAATTCCACGGATCCAGTGTAAGT Created EcoRI and BamHI sites
salA_EB_rev ACTTACACTGGATCCGTGGAATTCTCCCTAAAATAGCATC Created EcoRI and BamHI sites
salA_revH AACAGGTTGTATTGCTGCTCGC The site between salA and salR
luxC_rev GAGAGTCATTCAATATTGGCAGG Internal to luxC gene
salAR_rev GACCTGAGTATGCCCGGTAG Internal to salA and salR
luxE_for TGGTTTACCAGTAGCGGCACG Internal to luxE gene
xylR1_for TGGATTTCAGTTAATCAATTGGT Forward flanking xylR
xylR_rev CTATCGGCCCATTGCTTTCAC Reverse flanking xylR

© 2008 The Authors

Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
1678 W. E. Huang et al.
salA1 (907 bp) and salA2 (924 bp), were separately
amplified by PCR using a colony of ADP1 as DNA
template and the primer pairs salA_flank_for–salA_BE_
rev and salA_BE_fwd–salA_revH (Table 2). Polymerase
chain reaction amplifications were performed with an
initial denaturation at 95°C for 5 min, followed by 35
cycles of 94°C for 1 min, 58°C for 1 min and 72°C for
1 min, and a final extension at 72°C for 10 min. The
PCR products were isolated from an agarose gel using
QIAquick gel extraction kit (Qiagen, UK). To fuse the two
salA fragments, a PCR amplification (using the same
reaction conditions as above, except an extension time
at 72°C for 2 min) was carried out using 1 ml of diluted
(1:100) salA1 and salA2 fragments as DNA templates
and primers salA_flank_for and salA_revH (Table 2). The
resultant PCR product of the OEP salA fragment contains
EcoRI and BamHI restriction sites. It was isolated from an
agarose gel (QIAquick gel extraction kit, Qiagen) and
then cloned into pGEM-T (Promega) to give pSalA_BE
(Fig. 1).
• Construction of pSalA_Km_xylR. The kanamycin gene
(1472 bp) was excised from pRMJ2 (Jones and Williams,
2003) by EcoRI and BamHI and ligated into EcoRI–
BamHI-digested pSalA_BE to create pSalA_Km (Fig. 1).
The xylR gene fragment (2399 bp) was excised from
pTS174 by EcoRI and ligated into EcoRI-digested
pSalA_Km to create pSalA_Km_xylR (Fig. 1). Colony-
PCR and sequencing was performed to confirm that xylR
had been correctly inserted using primer pairs xylR1_for
and xylR_rev (Table 2). The PCR condition was: initial
denaturation at 95°C for 5 min, followed by 35 cycles of
94°C for 1 min, 50°C for 1 min and 72°C for 2 min, and a
final extension at 72°C for 10 min.
Construction of ADP1 mutants
The construction of ADPWH-Pu-lux-xylR is outlined in
Fig. 1. pSalAR_pu_lux was integrated into A. baylyi
ADPW67 by homologous recombination and selection
on SAA to give ADPWH-Pu-lux. Acinetobacter baylyi
ADPW67 has a kanamycin gene inserted into the salA
gene and cannot grow on SAA plates with salicylate as a
sole carbon source. The integration of pSalAR_pu_lux by
double-cross-over homologous recombination replaced
the disrupted salA gene with a functional copy of the gene
and therefore enabled the transformants ADPWH-Pu-lux
to grow on SAA. To confirm the presence of the Pu pro-
moter and luxCDABE cassette, colony-PCR reactions
were performed using the primer pairs salA_flank_for and
luxC_rev, and salAR_rev and luxE_fwd (Table 2), and the
PCR products were sequenced.
pSalA_Km_xylR was similarly integrated into ADPWH-
Pu-lux, with selection for Km resistance to give ADPWH-
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
Pu-lux-xylR. The presence of xylR was confirmed by
colony-PCR using the primer pair xylR1_for and xylR_rev
(Table 2). Failure to grow on SAA was used to confirm
homologous recombination of ADPWH-Pu-lux-xylR.
Nucleotide sequencing and sequence analysis
All DNA samples (PCR products or plasmids) were
sequenced using dye terminator sequencing on an
Applied Biosystems 3730 DNA analyser. DNA sequences
were aligned and edited using BioEdit (Tom Hall, Depart-
ment of Microbiology, North Carolina State University) to
confirm correct insertions. The plasmid pSalAR_Km_xylR
has been fully sequenced and submitted to the National
Center for Biotechnology Information (NCBI) and the
accession number is DQ202262.
Acinetobacter baylyi ADPWH_Pu_lux and
ADPWH_Pu_lux_xylR induction
All experiments were carried out in triplicate and bio-
luminescence assay was measured in triplicate, and
means ⫾ standard error are presented. The T-test was
performed using Excel (Microsoft Software) for statistical
analysis. Pu promoter activity was monitored by measur-
ing relative bioluminescence (bioluminescence divided by
OD600). For each measurement, at each time point 100 ml
of samples were analysed in triplicate in clear-bottomed
black 96-well optical microplates (Nalge Nunc Interna-
tional, USA). OD600 and bioluminescence were measured
using a Synergy HT Multi-Detection Microplate Reader
(Bio-Tek, UK).
Different inducers. A single colony of A. baylyi
ADPWH_Pu_lux_xylR was inoculated in 5 ml of LB liquid
medium placed in a 30 ml glass universal tube, and incu-
bated at 28°C overnight. The cells were re-inoculated into
a fresh medium after a 1:25 dilution. Inducers were pre-
added into media as appropriate. Toluene, p-, o- or
m-xylenes, phenol, benzene, naphthalene, 2-hydroxyben-
zoic (salicylic acid), 3-hyroxybenzoic, 4-hydroxybenzoic,
benzoate or catechol were separately added into LB as
inducer, respectively, with final concentration of 500 mM.
Samples were incubated at 28°C with shaking at 150 r.
p.m. OD600 and bioluminescence were measured over a
period up to 27 h.
Induction on solid media. Bacteria were incubated on LB
agar plates with inducers at 28°C. For salicylate assays
salicylate was added to LB agar to a final concentration
of 2.5 mM. For toluene and xylene assays toluene or
xylene vapour was used to induce the XylR-regulated
Pu promoter. Three microlitres of toluene or xylene was
loaded into a filtered tip, which was placed onto LB agar.
© 2008 The Authors

Bioluminescent plates were imaged in the dark using a
Versa-Doc Imaging System (Bio-Rad Laboratories, Herts,
UK). Images were captured using the ‘high sensitive
chemiluminescent’ setting for 30 s with a Nikon 50 mm
lens at f1.4.
Carbon and nitrogen source effects. Acinetobacter sp.
ADPWH_Pu_lux_xylR was inoculated into MMG, MMS
and LB to compare the effect of carbon source on Pu
activity. Ammonia chloride, sodium nitrate and glucose
were added into nitrogen-free minimal medium (MMN,
minimal medium without ammonium chloride) to make
media with carbon/nitrogen ratios of 1, 4, 6, 8 and 10. The
inducers toluene, p-, o- and m-xylene were separately
added to a final concentration of 500 mM. Cultures were
incubated at 28°C with 150 r.p.m. shaking.
Acknowledgements
We thank Professor Peter Williams of University of Wales,
Bangor, for providing A. baylyi ADPW67.
References
Abril, M.A., Michan, C., Timmis, K.N., and Ramos, J.L. (1989)
Regulator and enzyme specificities of the Tol plasmid-
encoded upper pathway for degradation of aromatic-
hydrocarbons and expansion of the substrate range of the
pathway. J Bacteriol 171: 6782–6790.
Arcondeguy, T., Jack, R., and Merrick, M. (2001) P-II signal
transduction proteins, pivotal players in microbial nitrogen
control. Microbiol Mol Biol Rev 65: 80–105.
Barbe, V., Vallenet, D., Fonknechten, N., Kreimeyer, A.,
Oztas, S., Labarre, L., et al. (2004) Unique features
revealed by the genome sequence of Acinetobacter sp.
ADP1, a versatile and naturally transformation competent
bacterium. Nucleic Acids Res 32: 5766–5779.
Bernardo, L.M.D., Johansson, L.U.M., Solera, D., Skarfstad,
E., and Shingler, V. (2006) The guanosine tetraphosph-
ate (ppGpp) alarmone, DksA and promoter affinity for
RNA polymerase in regulation of sigma(54)-dependent
transcription. Mol Microbiol 60: 749–764.
Bruckner, R., and Titgemeyer, F. (2002) Carbon catabolite
repression in bacteria: choice of the carbon source and
autoregulatory limitation of sugar utilization. FEMS Micro-
biol Lett 209: 141–148.
Cases, I., and de Lorenzo, V. (2005) Promoters in the envi-
ronment: transcriptional regulation in its natural context.
Nat Rev Microbiol 3: 105–118.
Cases, I., deLorenzo, V., and PerezMartin, J. (1996) In-
volvement of sigma(54) in exponential silencing of the
Pseudomonas putida TOL plasmid Pu promoter. Mol
Microbiol 19: 7–17.
Cases, I., Perez-Martin, J., and de Lorenzo, V. (1999) The
IIA(Ntr) (PtsN) protein of Pseudomonas putida mediates
the C source inhibition of the sigma(54)-dependent Pu
promoter of the TOL plasmid. J Biol Chem 274: 15562–
15568.
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
Characterizing the regulation of the Pu promoter 1679
del Castillo, T., and Ramos, J.L. (2007) Simultaneous
catabolite repression between glucose and toluene
metabolism in Pseudomonas putida is channeled through
different signaling pathways. J Bacteriol 189: 6602–6610.
Commichau, F.M., Forchhammer, K., and Stulke, J. (2006)
Regulatory links between carbon and nitrogen metabolism.
Curr Opin Microbiol 9: 167–172.
Dal, S., Steiner, I., and Gerischer, U. (2002) Multiple operons
connected with catabolism of aromatic compounds in
Acinetobacter sp. strain ADP1 are under carbon catabolite
repression. J Mol Microbiol Biotechnol 4: 389–404.
Duetz, W.A., Marques, S., Wind, B., Ramos, J.L., and
vanAndel, J.G. (1996) Catabolite repression of the toluene
degradation pathway in Pseudomonas putida harboring
pWWO under various conditions of nutrient limitation in
chemostat culture. Appl Environ Microbiol 62: 601–606.
Forchhammer, K. (2007) Glutamine signalling in bacteria.
Front Biosci 12: 358–370.
Handelsman, J. (2004) Metagenomics: application of genom-
ics to uncultured microorganisms. Microbiol Mol Biol Rev
68: 669–684.
Holtel, A., Marques, S., Mohler, I., Jakubzik, U., and Timmis,
K.N. (1994) Carbon source-dependent inhibition of
Xyl operon expression of the Pseudomonas-Putida Tol
plasmid. J Bacteriol 176: 1773–1776.
Huang, W.E., Wang, H., Huang, L.F., Zheng, H.J., Singer,
A.C., Thompson, I.P., and Whiteley, A.S. (2005) Chromo-
somally located gene fusions constructed in Acinetobacter
sp. ADP1 for the environmental detection of salicylate.
Environ Microbiol 7: 1339–1348.
Inouye, S., Nakazawa, A., and Nakazawa, T. (1983)
Molecular-cloning of regulatory gene XylR and operator-
promoter regions of the XylABC and XylDEGF operons of
the Tol plasmid. J Bacteriol 155: 1192–1199.
Jones, R.M., and Williams, P.A. (2003) Mutational analysis
of the critical bases involved in activation of the AreR-
regulated sigma(54)-dependent promoter in Acinetobacter
sp. strain ADP1. Appl Environ Microbiol 69: 5627–5635.
Jones, R.M., Pagmantidis, V., and Williams, P.A. (2000) sal
genes determining the catabolism of salicylate esters are
part of a supraoperonic cluster of catabolic genes in Acine-
tobacter sp. strain ADP1. J Bacteriol 182: 2018–2025.
Juni, E., and Janik, A. (1969) Transformation of Acineto-
bacter calcoaceticus (Bacterium anitratum). J Bacteriol 98:
281–288.
Kok, R.G., Young, D.M., and Ornston, L.N. (1999) Phenotypic
expression of PCR-generated random mutations in a
Pseudomonas putida gene after its introduction into an
Acinetobacter chromosome by natural transformation.
Appl Environ Microbiol 65: 1675–1680.
Marques, S., Holtel, A., Timmis, K.N., and Ramos, J.L. (1994)
Transcriptional induction kinetics from the promoters of the
catabolic pathways of Tol plasmid Pww0 of Pseudomonas
putida for metabolism of aromatics. J Bacteriol 176: 2517–
2524.
Melnikov, A., and Youngman, P.J. (1999) Random mutagen-
esis by recombinational capture of PCR products in Bacil-
lus subtilis and Acinetobacter calcoaceticus. Nucleic Acids
Res 27: 1056–1062.
Metzgar, D., Bacher, J.M., Pezo, V., Reader, J., Doring, V.,
Schimmel, P., et al. (2004) Acinetobacter sp. ADP1: an
1680 W. E. Huang et al.
ideal model organism for genetic analysis and genome
engineering. Nucleic Acids Res 32: 5780–5790.
Palmen, R., and Hellingwerf, K.J. (1997) Uptake and pro-
cessing of DNA by Acinetobacter calcoaceticus – a review.
Gene 192: 179–190.
Palmen, R., Vosman, B., Buijsman, P., Breek, C.K.D., and
Hellingwerf, K.J. (1993) Physiological characterization of
natural transformation in Acinetobacter calcoaceticus.
J Gen Microbiol 139: 295–305.
Ramos, J.L., Marques, S., and Timmis, K.N. (1997)
Transcriptional control of the Pseudomonas tol plasmid
catabolic operons is achieved through an interplay of host
factors and plasmid-encoded regulators. Annu Rev Micro-
biol 51: 341–373.
Schloss, P.D., and Handelsman, J. (2003) Biotechnological
prospects from metagenomics. Curr Opin Biotechnol 14:
303–310.
Siehler, S.Y., Dal, S., Fischer, R., Patz, P., and Gerischer, U.
(2007) Multiple-level regulation of genes for protocat-
echuate degradation in Acinetobacter baylyi includes
cross-regulation. Appl Environ Microbiol 73: 232–242.
Stulke, J., and Hillen, W. (1999) Carbon catabolite repression
in bacteria. Curr Opin Microbiol 2: 195–201.
Uchiyama, T., Abe, T., Ikemura, T., and Watanabe, K. (2005)
Substrate-induced gene-expression screening of environ-
mental metagenome libraries for isolation of catabolic
genes. Nat Biotechnol 23: 88–93.
Vaneechoutte, M., Young, D.M., Ornston, L.N., De Baere, T.,
Nemec, A., Van Der Reijden, T., et al. (2006) Naturally
transformable Acinetobacter sp. strain ADP1 belongs to
the newly described species Acinetobacter baylyi. Appl
Environ Microbiol 72: 932–936.
Velazquez, F., di Bartolo, I., and de Lorenzo, V. (2004)
Genetic evidence that catabolites of the Entner–Doudoroff
pathway signal C source repression of the sigma(54) Pu
promoter of Pseudomonas putida. J Bacteriol 186: 8267–
8275.
de Vries, J., Heine, M., Harms, K., and Wackernagel, W.
(2003) Spread of recombinant DNA by roots and pollen of
transgenic potato plants, identified by highly specific
biomonitoring using natural transformation of an Acineto-
bacter sp. Appl Environ Microbiol 69: 4455–4462.
Willardson, B.M., Wilkins, J.F., Rand, T.A., Schupp, J.M., Hill,
K.K., Keim, P., and Jackson, P.J. (1998) Development and
testing of a bacterial biosensor for toluene-based environ-
mental contaminants. Appl Environ Microbiol 64: 1006–
1012.
Winson, M.K., Swift, S., Hill, P.J., Sims, C.M., Griesmayr, G.,
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680
Bycroft, B.W., et al. (1998) Engineering the luxCDABE
genes from Photorhabdus luminescens to provide a biolu-
minescent reporter for constitutive and promoter probe
plasmids and mini-Tn5 constructs. FEMS Microbiol Lett
163: 193–202.
Young, D.M., and Ornston, L.N. (2001) Functions of the
mismatch repair gene mutS from Acinetobacter sp. strain
ADP1. J Bacteriol 183: 6822–6831.
Young, D.M., Parke, D., and Ornston, L.N. (2005) Opportu-
nities for genetic investigation afforded by Acinetobacter
baylyi, a nutritionally versatile bacterial species that is
highly competent for natural transformation. Annu Rev
Microbiol 59: 519–551.
Supplementary material
The following supplementary material is available for this
article online:
Fig. S1. Induction of Pu expression by chemicals.
A. Bioluminescence produced by A. baylyi ADPWH-Pu-lux
colonies when not induced (A1); induced by 500 mM salicy-
late (A2) or by toluene vapour (A3).
B. Bioluminescence produced by A. baylyi ADPWH-Pu-lux-
xylR colonies when not induced (B1), induced with toluene
(B2), m- (B3), o- (B4) or p-xylene (B5) vapours. Bacteria were
grown on LB agar and incubated for 20 h at 28°C in the
presence of vapour before imaging. Vapours were produced
by placing 3 ml of inducer into a filtered tip in each Petri dish.
The top panel shows plates imaged using visible light, and
the bottom panels show bioluminescence produced by colo-
nies on the same plates imaged in the dark.
Fig. S2. Bioluminescence of A. baylyi ADPWH-Pu-lux was
induced by salicylate (500 mM) but not by m-xylene (500 mM).
P < 0.05. Biolum in the figure represents bioluminescence.
Acinetobacter baylyi ADPWH-Pu-lux immediately expressed
bioluminescence in LB medium with 500 mM salicylate but
did not respond to m-xylene (500 mM), which rules out the
presence of endogenous Pu-activating regulatory proteins in
ADP1.
This material is available as part of the online article from
http://www.blackwell-synergy.com
Please note: Blackwell Publishing are not responsible for
the content or functionality of any supplementary materials
supplied by the authors. Any queries (other than missing
material) should be directed to the correspondence for the
article.
© 2008 The Authors