Journal of Agricultural and Veterinary Sciences, Qassim University, Vol. 2, No. 2, pp.

67-76 (January 2010/Muharram 1431H)

67




Bacterial Contamination of Hatcheries

Al-khalaf, A.N.**, Akeila, M.A.*.;Al-Dubaib, M.A.**; Azzam,A.H.***;
El-Shafey, A.A.*; and Draz, A.A.**

*Dept. of Microbiology, Faculty of Veterinary Medicine, Alexandria University
**Dept. of Veterinary Medicine, College of Agriculture and Veterinary Medicine, Qassim University
***Animal Health Research Institute, Dokki

(Received 13/1/2007; accepted for publication 12/7/2009)


Abstract. A total of 850 swabs from egg shell surfaces (230), egg room (80), setter (115), hatcheries (115), unhatched eggs (liver, heart,
yolk of dead in shell embryos) (160) and newly hatched chicks (150) were examined microbiologically. The following bacteria were isolated
and identified: Escherichia coli, Salmonella species, Klebsiella pneumoniae, Proteus vulgaris, Pseudomonas aeruginosa, Staphylococcus
aureus, Citobacter diversus and Enterobacter cloacae. The serological typing of E. coli isolates (n = 88) from hatchery showed 19 were
O126:B7 (21.6%), 13 were O111:B4 (14.8%), 11 were O26:B7 (12.5%), 11 were O119:B14 (12.5%), 8 were O125:B15 (9.1%), 8 were
O55:B5 (9.1%) and 18 were untypable strains (20.5%). The recovered 11 salmonella isolates were S. pullorum (5) (45.5%), S. typhimurium
(2) (18.2%), S. anatum (1) (9.1%) and untypable strains (3) (27.3%). The polymerase chain reaction (PCR) was used for the confirmation of
E. coli and S. pullorum isolates. The antibiotic sensitivity tests showed that E. coli isolates were highly sensitive to enrofloxacin and colistin
sulphate. Salmonella isolates were sensitive to chloramphenicol, colistin sulphate, neomycin and enrofloxcain. Both P. vulgaris and K.
pneumoniae were sensitive to chloramphenicol and enrofloxcain. Pseudomonas aeruginosa isolates were sensitive to enrofloxcain.
Staphylococcus aureus isolates were highly sensitive to amoxicillin.
Keywords: Bacteriology, Hatcheries, Chicks.

Al-khalaf, A.N., et al
68
Introduction
Numerous bacterial pathogens that contaminate hatcheries have been isolated from egg shell, egg content as well
as from dead in shell chicken embryos. They included Salmonella spp., Escherichia coli spp., Klebsiella spp.,
Proteus spp. and Pseudomonas spp. (Cox et al.,1990; Cason et al., 1994; El-Atrebe and Badr, 1993; Shawabkeh
and Tarazi, 1993; Abd El-Latif, 1995; Ibraheem and Abd El-Lateif, 1997; Walker et al., 2001; Northcutt, et al.,
2004 and Kim et al., 2007). In addition, E. coli O-groups were isolated from diseased and dead chicks suffering
from colisepticemia, yolk sac infection or omphalitis (Dwivedi, 1979; Burkanova, 1980; Azzam, 1983; El Said,
1987; Zahdeh, 1987; Nafie, et al., 1989, Khalid, 1990; Mukhopadhyaya and Mishra, 1992 and Osman, 1992;
Giovanardi et al., 2005).
Roy et al. (2002) reported that 92 Salmonella isolates from poultry, poultry products, environment and
hatcheries were sero-grouped with polyvalent somatic antisera and Polymerase chain reaction (PCR). Jerod et
al. (2003) used polymerase chain reaction for the detection of four genes linked to avian E. coli virulence.
This study was designed to isolate and identify bacterial pathogens that contaminate egg shell surface,
egg room, setter, hatchery, unhatched egg (dead in shell embryo) and newly hatched chicks. Escherichia coli and
S. pullorum isolates were serotyped and confirmed by PCR. The sensitivity of these isolates against
antimicrobial agents was determined.

Material and Methods
Collection of samples:
A total of 850 swabs were collected from egg shell surface (230), egg room (80), setter (115), hatcheries (115),
160 from unhatched eggs (liver, heart, yolk of dead in shell embryos) and 150 from newly hatched chicks (liver,
heart, yolk). The swabs were put in sterile test tubes containing nutrient broth. The surface of hatchery rooms
were swabbed by rubbing the sterile nutrient broth moistened swabs on the corners and wall joints. The surface
of unhatched eggs was disinfected using 70% ethyl alcohol and flamed. The egg shell was broken and the
unhatched embryo was removed with sterile forceps and put in sterile Petri dish and opened to expose the
internal organs. With sterile dry swabs, impression smears were made from the yolk, liver and heart and put in
sterile test tubes containing nutrient broth. Samples were transferred in ice-box immediately to the laboratory for
bacteriological examination.
Bacterial isolation:
Under strict aseptic precautions, the bacteriological samples were inoculated into nutrient and selenite F broth
and incubated aerobically at 37 C for 24-48 hours. Subculturing was carried out by inoculating the following
media: nutrient agar, blood agar, mannitol salt agar, MacConkey
,
s agar and incubated aerobically at 37 C for 48
hrs (Cruickshank et al., 1975).
Identification of bacterial isolates:
The bacterial isolates were identified by studying their cultural, morphological and biochemical characteristics
according to Cruickshank et al. (1975), and Finegold and Martin (1982).
Serological identification:
Serological identification of Salmonella was carried by slide agglutination technique according to Edward and
Ewing (1972). Serological identification of E.coli was carried out using slide agglutination technique
(Behringwork A.C. Morburg, Germany) according to Sojka (1985).

Amplification of Salmonella pullorum and Escherichia coli 0126 by polymerase chain reaction (PCR):
Two primers were used for Salmonella pullorum, the first 19bp and the second 18bp, while for Escherichia coli
0126 were 20pb and 21pb (supplied by Minneapolis, Minnesota bio products, USA)
Primers Size Sequence (5 3)
Salmonella pullorum 1 19bp TTTGGCGGATGAGACGCGA
Salmonella pullorum 2 18bp TTATCGCATCAGCGGCGT
Escherichia coli (0126) 1 20bp GGACCCCATGTAAGCTAACC
Escherichia coli (0126) 2 21bp TCGGCCACTTGGAGTCCTTAC

Equal amounts of each of the four deoxynucleotide triphosphates (dNTPs) (dATP, dCTP, dGTP, dTTP) were
included in the reaction. The most common thermo stable polymeras (Taq DNA polymerase) was purified from
thermus aquaticus. Detection of these micro-organisms by PCR was performed in 100 l reaction solution
containing 10 l of 10 x PCR reaction buffer (10 MM Tris-Hcl PH 8.5, 500 MM Kcl, 4MM Mg cl2), 1.25 l of
Bacterial Contamination of Hatcheries

69
each dATP, dCTP, dGTP and dTTP, 20 MM of each primer, 5 l of DNA Taq polymerase and 500 ng of the
investigated samples or control. The reaction was subjected to thermal cycling program consisting of: a single
initial denaturation at 95
o
C for 4 minutes, followed by 40 cycles of denaturation at 94
o
C for 1 minute, annealing
at 63
o
C for 1 minute, extension at 72
o
C for 7 minutes, at the end of amplification an a liquot (5 l) of the
product was electro phorized in 1.5% agarose gel for 1 hour at 70 volet, the gel was stained with ethidium
bromide and visualized under U.V transilluminator, for Salmonella pullorum, lane 1 & 2 represent positive and
negative control samples, while lane 3 & 4 represent Salmonella pullorum and Salmonella typhimurium
respectively, for E. coli 0126, lane 1 & 2 represent positive and negative control samples, while lane 3, 4, 5, 7
represent other E. coli serotypes 0111, 0119, 055 and untypable E. coli respectively, lane 6 represent positive E.
coli 0126.

Antibiotic sensitivity tests:
Sensitivity of bacterial isolates (E. coli, S. spp., P. vulgaris, K. pneumoniae, P. aeruginosa and, Staph. aureus)
against different antibiotics was carried out according to Blair et al. (1970).

Results and Discussion
Escherichia coli was isolated from egg shell surface (23), egg room (7), setter (11), hatchery (11),
unhatched eggs (dead in shell embryo) (23) and newly hatched chicks (13) at a rate of 25.96% (Table 1).
Stipkovits, et al. (1970) discussed the importance E. coli in contamination of egg shell and hatchery losses.
Awaad (1972) reported that E. coli could penetrate the egg shell inducing high embryonic mortalities. However,
Enany et al., (1989) reported that E. coli was isolated from dead in shell embryos at a rate of of 17.5%, Abd El-
Latif, (1995) of prevalence 18.6%, Said, (1988) at a rate of of 3.9%, while, Shalaby and Abd El-Hamid (1987)
isolated E. coli in prevalence of 44.5% from hatching eggs. In addition, Abd-El Galil et al., (1984) recorded that
Escherichia coli was isolated from newly hatched chicks at a rate of of 15% and Azmy, (1996) reported a 62%
isolation from the newly hatched chicks.
Salmonella species were isolated from hatchery (3), unhatched eggs (5) and newly hatched chicks (3)
with a prevalence of 3.24% (Table,1). Salmonella species have not been isolated from egg shell surface. These
results disagreed with what was reported by Yordanov, (1966) and Cox et al. (1990). This disagreement might
be due to the fact that eggs were received from farms free of salmonellosis where the owners of the farms follow
good hygienic measures. Barbour and Nabbut (1982) recovered Salmonellae from shell contents and shell
surfaces of hatching eggs with the same prevalence (1.24%) from farm A. They recovered Salmonella from
shells of hatching eggs (2.48%) and hatching egg contents (0.35%) from farm B in Saudi Arabia. However,
Salmonella species could be isolated from dead in shell embryos (Karaman, 1980; Shalaby and Abd El Hamid,
1987; Enany et al., 1989; Abd El-Latif, 1995) with various rates. The fluctuation in the prevalence of salmonella
species isolated from dead in shell embryo may be due to the quality of used eggs and the health status of parent
flocks. Also, Zahdeh, (1982) and Abd El-Galil et al., (1984) isolated Salmonella species from newly hatched
chicks. Chen, et al. (2002) recorded that among hatcheries, 13 to 29% were contaminated with Salmonella spp.
in Taiwan.
Our results showed that K. pneumoniae was isolated from egg shell surface (4), egg room (4), setter (2),
hatchery (3), unhatched eggs (dead in shell embryo) (12) and newly hatched chicks (7) at a rate of 9.44%
(Table,1). Sarakebi, et al. (1981) isolated K. pneumoniae from embryonated chicken eggs with prevalence of
11.16%. Also, Karaman, (1980); El-Atrebe, (1982); Shalaby and Abd El-Hamid, (1987) and Said, (1988)
isolated K. pneumoniae from dead in shell embryos with various prevalences.
Proteus vulgaris, was isolated from egg shell surface (13), egg room (6), setter (9), hatchery (9),
unhatched eggs (dead in shell embryo) (17) and newly hatched chicks (10) with mean prevalence of 18.88%
(Table 1). Ranes and Szaly, (1974), Karaman, (1980), Enany, et al. (1989) and Abd El-Latif, (1995) isolated
proteus species from dead in shell embryos with various prevalences. Also, Shalaby and Abd El-Hamid, (1987)
isolated proteus species (34.5%) from hatching eggs.In addition, Abd El-Gawad, (1989) and Azmy, (1996)
isolated P. vulgaris from newly hatched chicks. The difference in the rate of isolation may be attributed to the
heavy contamination of the eggs after laying and the improper handling and storage of the hatching eggs.
Pseudomonas aeruginosa, was isolated from egg shell surface (14), egg room (6), setter (5), hatchery
(10), unhatched eggs (dead in shell embryo) (13) and newly hatched chicks (10) with prevalence 17.11% (Table
1). Ranes and Szaly (1974) isolated P. aeruginosa from dead in shell embryos with prevalence of 15%. Also, El-
Atreby, (1982) isolated P. aeruginosa from dead in shell embryos at a prevalence of 2.7%. In addition, Karaman,
Al-khalaf, A.N., et al
70
(1980) isolated P. aeruginosa from dead in shell embryo and non fertile eggs in prevalence of 17.2%. Shalaby
and Abd El-Hamid, (1987) isolated it from hatching eggs at a prevalence of 4.9%, while Enany,et al., (1989)
isolated P. aeruginosa from hatching eggs and dead chicken embryos at a prevalence of 1.75%. Moreover,
Azmy, (1996) isolated P. aeruginosa from newly hatched chicks at a prevalence of 8.7%. The prevalence of
isolation differed from locality to another depending on the degree of contamination of water.
Staphylococcus aureus, was isolated from egg shell surface (5), egg room (1), setter (1), hatchery (2),
unhatched eggs (dead in shell embryo) (6) and newly hatched chicks (5) at a prevalence 5.89% (Table,1).
However, Enany, et al., (1989) could isolated Staph. aureus from dead in shell embryos at a prevalence of
3.3%. Also, Staph. aureus was isolated from newly hatched by Abd El-Galil, et al., (1984) and Azmy, (1996) at
a prevalence of 14.7 and 15% respectively. Staph. aureus contamination is very important cause of arthritis in
chicks and early chick mortalities (Abd El-Latif, 1995).
Moreover, Citrobacter diversus and Enterobacter cloacae were isolated from egg shell surface (7&12),
egg room (1&3), setter (1&4), hatchery (4&10), unhatched eggs (dead in shell embryo) (6&8) and newly
hatched chicks (4&6) at a rate of 6.78% and 12.68% respectively (Table,1).
The serological typing of E. coli isolates from hatchery revealed that out of 88 isolates of E. coli, 19
were O126:B7 (21.6%), 13 were O111:B4 (14.8%), 11 were O26:B7 (12.5%), 11 were O119:B14 (12.5%), 8
were O125:B15 (9.1%), 8 were O55:B5 (9.1%) and 18 were untypable isolates (20.5%) (Table 2). These results
were similar to those reported by Sojka and Carnaghan, (1961) who isolated E. coli O55 from hatching eggs.
Awaad, (1972) isolated E. coli O86, O126, O26 and O127 from baby chicks. Also, Said, (1988) recovered E.
coli O26, O55 from hatcheries.
The prevalent strains of E. coli in this work were O126 and O111. These results agree with those
recorded by Abd El-Latif (1995) but disagreed with that reported by El-Atrebe, (1982) who mentioned that the
prevalent strains of E. coli were O78 and O125. Also, Abd El-Galil, et al. (1984) reported that the most prevalent
serotypes of E. coli were O125, O78, O11 and O55. In addition, Shalaby and Abd El-Hamid (1987) found that
the most prevalent serotypes were O78, O128 and O114. This difference in serotypes of isolated E. coli might be
due to the locality and to the environmental condition of isolation.
The obtained data revealed that the recovered 11 salmonella isolates were S. pullorum (5) (45.5%), S.
typhimurium (2) (18.2%), S. anatum (1) (9.1%) and untypable strains (3) (27.3%) (Table,3). These results agree
with those of Abd El-Latif (1995) who reported that the most prevalent Salmonella species from dead in shell
embryo were S. pullorum (38.9%) and S. typhimurium (22.2%). Also, Abd El-Galil et al., (1984) identified
Salmonella isolated from baby chicks as S. pullorum and S. typhimurium and proved it to be responsible for early
chicks mortality. Moreover, Byrd et al. (1999) isolated a total of 11 different Salmonella serotypes from
hatcheries, with S. heidelberg (9/30) and S. kentucky (6/30) accounting for 50% of the total isolations.
Humphrey, et al. (1991) indicated that the S. pullorum and S. typhimurium affected the hatchability of fertile
eggs. Desai, et al. (2005) mentioned that S. pullorum was responsible for severe economic losses to the poultry
industry in many parts of the world. They developed a rapid allele-specific polymorphism chain reaction (PCR)
method based on nucleotide polymorphism in ribs gene sequence for the serotype-specific detection of S.
pullorum and its differentiation from closely related S. gallinarum.
The PCR reconfirmed the results of somatic serogrouping with polyvalent antisera of the isolated
Salmonella spp. PCR has several advantages over the slide agglutination test with polyvalent antisera.
Serogrouping results were not good if poor quality antisera were used and serogrouping was not possible when
Salmonella isolates lack O antigen (rough isolates) as mentioned by Roy et al. (2002).
The PCR reconfirmed the results of somatic serogrouping with Escherichia coli. Similar results were
described by Jerod et al. (2003).
The results of antibiotic sensitivity against Escherichia coli isolates revealed that E. coli isolates were
highly sensitive to enrofloxacin and colistin sulphate (Table 4). The result were similar to that obtained by
Azmy, (1996). Salmonella species isolates were sensitive to chloramphenicol, colistin sulphate, neomycin and
enrofloxcain (Table 4). Both P. vulgaris and K. pneumoniae were sensitive to chloramphenicol and enrofloxcain
(Table 4). This result is similar to that reported by Sarakbi et al. (1981) and Said (1988). Pseudomonas
aeruginosa isolates were sensitive to enrofloxcain (Table 4), similar results were obtained by Walker et al.
(2001) who mentioned that P. aeruginosa isolated from chicks with omphalitis was resistant to a variety of
antibiotics but all isolates were sensitive to enrofloxcain. Staph. aureus isolates were highly sensitive to
amoxicillin (Table 4), similar results were obtained by Said (1988).

Bacterial Contamination of Hatcheries

71

References

Abd El-Galil, Y.; El-Bakry, M.; And Ammar, A. "Bacterial causes of early chicks mortalities in Sharkia
Governorate". Proceeding of 17 World Poultry Congress Helsinki, (1984) 557.
Abd El-Latif, M.M. "Bacterial causes of lowering fertility, hatchability and early embryonic deaths in balady
hatcheries in Dakahlia Governorate". M.V.Sc. Thesis (Microbiology), Fac. Vet. Med. Zagazig University,
(1995).
Abd El-Gawad, A.A. "Some studies on proteus infection in chickens". M.V.Sc. Thesis, Poul. Dis., Fac. Vet.
Med. Assiut Unversity, (1989).
Awaad, M.H.H. "Studies on coli septicaemia in baladi chicken". M.V.Sc. Thesis, Poultry Diseases, Fac. Vet.
Med. Cairo University, (1972).
Azmy, E.M. "Study on some bacterial causes of the early chick mortalities in Sharkia provinc". M.V.Sc. Thesis,
Poultry Diseases, Fac. Vet. Med., Zagazig University, (1996).
Azzam, A.H. "Studies on coli septicaemia in poultry in Dakahlia province". M.V.Sc. Thesis, Fac. Vet. Med.
Assiut Unversity, (1983).
Barbour, E.K. and Nabbut, N.H. (1982): Isolation of salmonella and some potential pathogens from two
chicken breeding farms in Saudi Arabia. Avian Dis. 26(2): 234-44.
Blair, J.E.; Lennete, E.H.; and Truand, T.P. (1970): "Manual of clinical microbiology Am. Society for
microbiology". Betchesda, USA,.
Burkanova, K.K. (1970): "Properties of E.coli strains isolated from diseased fowls". Vet. Moscow, USSR 10:
66-68.
Byrd, J.A.; DeLoach, J.R.; Corrier, D.E.; Nisbet, D.J.; and Stanker, L.H. (1999): Evaluation of Salmonella
serotype distributions from commercial broiler hatcheries and grower houses". Avian Dis. 43(1): 39-47.
Cason, J.A.; Cox, N.A.; and Bailey, J.S. (1994): Transmission of Salmonella typhimurium during hatching of
broiler chicks". Avian Diseases, 38 (3): 563.
Chen, S.J., Lee, T.E., Wang, E.M., Cho, T.J.; and Wang, C.H. (2002): Monitoring the hygiene of chicken
hatcheries in Taiwan during 1999-2001. J. Microbiol Immunol Infect. 35 (4) (2002): 236-42.
Cox, N.A.; Bailey, J.S.; Mauldin, J.M.; and Blankership, L.C. (1990): Presence and impact of salmonella,
contamination in commercial broiler hatcheries. Poult. Sci 69: 1606.
Cruickshank, R., Dugiud, J.P.; and Swain, R.H. (1975): "Medical Microbiology". 12
th
Edit., Vol. II.
Churchill Livingstone, Edinburgh, London and New York.
Desai, R., Devedra H., Shall, Smriti shringi, Mi-Jin Lee, ying-Huali, Mae-Rim Cho, Jin-Ho park, Seong-
Kug Eo, John-Hwa Lee; and Joon-Seok chae (2005): An Allele- specific assay for the rapid and
serotype-specific detection of Salmonella pullorum. Avian Dis. 49: 558.
Dwivedi, P. (1979): Colibacillosis in poultry. Indian Vet. J. 56(8): 629.
Edward, P.R. and Ewing, E.H. (1964): "Identification of Enterobacteriacae". 2
nd
Ed. Burgers comp., Minnea
polis, Minnesota.
El-Atrebe, S.K. (1982): "Studies of the microbial etiology of dead in shell in native hatcheries". Ph. D. Thesis
(Microbiology), Fac. Vet. Med., Assiut Univ.
El-Atrebe, S.K. and Badr, M.G. (1993): Bacterial spoilage of hens eggs. J. Egypt. Vet. Med. Ass. 53(4): 609.
El-Said, K.M. (1987): "Studies on drug medication in poultry". M.V.Sc. Thesis, Pharmacology, Fac. Vet. Med.,
Cairo University.
Enany,M.; Abd El-Galil, Y.; and El-Seedy, F. (1989): Microbial causes of early embryonic death of fertile hen
eggs in Sharkia Governorate. J. Egypt. Vet. Med. Ass. 49 (1-2): 721.
Finegold, S.M. and Martin, W.J. (1982): "Bailey and Scotts, Diagnostic Microbiology". 6
th
Ed. The C.V.
Mosby Company, St. Louis, Toranto, London,.
Giovanardi, D.; Campagnari, E.; Ruffoni, L.S.; Pesente, P.; Ortali, G.; and Furlattini, V. (2005): Avian
pathogenic Escherichia coli transmission from broiler breeders to their progeny in an integrated poultry
production chain. Avian Pathol. 34(4): 313-8.
Humphrey, T.J.; Whitehead, A.; Gawler, A.H.L.; Henley, A.; and Rose, B. (1991): Number of Salmonella
enteritidis in the content of naturally contaminated hens egg. Epidemiology and infection, 33 (4): 609.
Ibraheem, O.K. and Abd El-Latif, A. (1997): Studies on some bacterial agents isolated from dead in shell
chicken embryos and baby chicks in Sharkia province. J. Egypt. Vet. Med. Ass. 57 (1): 747.
Al-khalaf, A.N., et al
72
Jerod, A.S., Shelley M.H., Catherine, W.G., Richard, E.W., Pepelope, S.G. and Lisa, K.N. (2003):
Characterizing avian E.coli isolates with Multiplex polymerase chain reaction". Avian Diseases, 46 (4):
1441.
Karaman, R.A. (1980): "Studies on some bacterial diseases of poultry causing high mortality in balady
hatcheries in Monofia province". M.V.Sc. Thesis, Poultry Diseases, Fac. Vet. Med., Cairo Univ.
Khalid, A.M. (1990): Studies on natural and experimental E.coli infection in chickens. J. Egypt. Vet. Med. Ass.
50 (3): 379.
Kim, A.; Lee, Y.J.; Kang; M.S.; Kwag, S.I.; and Cho, J.K. (2007): Dissemination and tracking of Salmonella
spp. in integrated broiler operation J Vet Sci. 8(2): 155-61.
Mukhopadhyaya, B.N. and Mishra, S.K. (1992): Incidence of colibacillosis in chicks in some poultry pockets
of West Bengal. Indian J. of Poult. Science 27 (2): 103.
Nafie, E.K., El-Rehawy, M., Ibrahim, A.A., Kamel, S., Mousa, S. and Bahy, E. (1989): Studies on E .coli in
poultry (most prevalent serotypes). Assiut Vet. Med. 21 (41): 52.
Northcutt, J.K., Jones, D.R., Ingram, K.D., Hinton, A.J. and Musgrove, M.T. (2004): Air borne
microorganisms in commercial shell egg processing facilities. International Journal of Poultry Science,
3(3): 195.
Osman, M.M. (1992): Studies on bacterial causes of early poultry mortality in Sharkia Governorate". M.V.Sc.
Thesis (Microbiology), Fac. Vet. Med., Zagazig University.
Ranes, I. and Szaly, G. (1974): Bacteriological examination of chicken embryos that died during incubation.
Magyar allatatar lapja, 29: 153.
Roy P, Dhillon, A.S., Lauerman, L.H., Schaberg, D.M., Bandli, D. and Johnson S. (2002): Results of
salmonella isolation from poultry products, poultry, poultry environment, and other characteristics". Avian
Diseases: 46(1): 17.
Said, A.M. (1988): "Bacterial agents responsible for hatching problems in native hatcheries in upper Egypt".
Ph.D. Thesis, Poultry Disease, Fac. Vet. Med., Assuit Univ..
Sarakbi, T.M., Bassiouni, H.A. and Awaad, M.H. (1981): A study on chicken klebsiellosis. J. Egypt. Vet.
Med. Ass., 41: 59.
Shalaby, N.A. and Abd El-Hamid, H.S. (1987): Microbial agents responsible for embryonic mortalities in
hatcheries in Gharbia province". Zagazig Vet. J. XV (2): 165.
Shawabkeh, K. and Tarazi, Y. (1993): I- The bacterial flora of dead in shell embryos and environments of
hatcheries in Jorden". II- The pathogenicity of isolated strains". Drast Series B, Pure and Applied Science
20(1): 11.
Sojka, M.J. (1985): "Bacteria in domestic animals and poultry". Farnham Royal Commonwelth. Agricultural
Bureaux.
Sojka, W.J. and Carnaghan, R.B. (1961): E. coli infection in poultry. Res. Vet. Science, 2: 430.
Stipkovits, L., Solyom, F. and Schuschka, A. (1970): I- Escherichia coli infection of hen. II- The importance
of egg shell contamination in hatching losses. World Vet. Cong. Poult. Ass. Belgrade, P. 245..
Walker S.E., Sander, J.E.; Cline, J.L. and Helton, J.S. (2001): Characterization of Pseudomonas aeroginosa
isolates associated with mortality in broiler chicks. Avian Diseases, 46 (4): 1045.
Yordanov, H. (1966): Salmonellosis in chicks caused by S. muenster. Vet. Med. Nauki, Sof. 3: 47.
Zahdeh, A.A. (1987): Studies on the problem of omphalitis in baby Chicks. I- The role of E. coli 78:k80". J.
Egyptian Vet. Med. Ass., 47 (1/2): 511.



Bacterial Contamination of Hatcheries

73






* ** * *** *** *

+ ,... ... _.,,. ,.., .. ,.: _.,,. ,.. . ++ . ,..<., ... _.,,. ,.. ,.: .,,.,,,,<,. +++
.. ,,,- -. .,< .,..,

) _ .... . . . _ .... _,, . . (

. ) ( ) ( ) ( ) (
) ( ) ( .

. : ) O126:B7 (
, ) O111:B4 ( , ) O26:B7 ( , ) O119:B14 ( ,
) O125:B15 ( , ) O55:B5 ( , , .
: ) , ( ) , ( ) , ( , .
) PCR ( .
.
.
. .
Al-khalaf, A.N., et al
74
Table (1). Bacterial isolates from egg shell surface, egg setter, hatchery unhatched egg (dead in shell embryo) and newly hatched
chick.
Recovery
Sites
E. coli Salmonella
spp.
Klebsiella
pneum.
Proteus
vulgaris
Pseudomonas
Aeroginosa
Staph.
aureus
Citrobacter
diversus
Enterobact.
cloacae
Total
isolates
Egg shell

23 - 4 13 14 5 7 12 78
Egg room

7 - 4 6 6 1 1 3 28
Setter

11 - 2 9 5 1 1 4 33
Hatchery

11 3 3 9 10 2 4 10 52
Unhatched
eggs

23 5 12 17 13 6 6 8 90
Newly
hatched
chicks

13 3 7 10 10 5 4 6 58
Total

88 11 32 64 58 20 23 43 339
Prevalence of
bacterial
isolates
25.96% 3.24 % 9.44% 18.88% 17.11% 5.89% 6.78% 12.68%


Table (2). Serogroups of Escherichia coli isolates.
Bacterial isolate

Number of isolates Serotypes %


Escherichia coli




88
19 O126: B7
13 O111: B4
11 O26 : B7
11 O119: B14
8 O125: B15
8 O55 : B5
18 Untypable
21.6%
14.8%
12.5%
12.5%
9.1%
9.1%
20.5%

Table (3). Serogroups of Salmonella isolates.
Antigenic structure
H. antigen
Total No.
of suspected
isolates

No. of
Isolates

Group
No.
O. antigen
Phase I Phase II

Kind of strain

11
5
2
1
3
D1
B
E1
-
9,12
1,4,5,12
3,10
-
-
i
e,h
-

-
1,2
1,6
-
Salmonella pullorum
Salmonella typhimurium
Salmonella anatum
Untypable

Bacterial Contamination of Hatcheries

75
Marker Lane 1 Lane 2 Lane 3 Lane 4

Fig. (2). Agarose gel electrophoresis resolving the amplification of Salmonella pullorum by PCR, DNA size marker, positive and
negative control samples (lane 1&2 respectively). A band sizing 810 bp is shown in samples (positive lane 3) while lane 4 is negative.

Marker Lane 1 Lane 2 Lane3 Lane 4 Lane 5 Lane 6 Lane 7

Fig. (3). Agarose gel electrophoresis resolving the amplification of E.coli O126, DNA size marker, positive and negative control
samples(lane 1&2 respectively), samples in lanes (3,4,5 and 7) were negative while sample in lane 6 was positive.

810 pb
280 pb
Al-khalaf, A.N., et al
76


Table (4). Antibiotic sensitivity of bacterial isolates.
Escherichia
coli
Salmonella
spp.
Proteus
vulgaris
Klebsiella
pneumoniae
Pseudomonas
aeruginosa
Staphylococcus
aureus
Antibiotic
S T % S T % S T % S T % S T % S T %
Amoxicillin 13 4
0
32.5 4 11 36.4 8 15 53.
3
6 15 40 5 15 33.
3
14 15 93.3
Chloramphen
icol
29 4
0
72.5 10 11 91 13 15 86.
7
12 15 80 4 15 26.
7
9 15 60
Colistin
sulphate
34 4
0
85.0 9 11 81.8 13 15 86.
7
11 15 73.
3
7 15 46.
7
8 15 53..3
Erythromycin 13 4
0
32.5 6 11 54..5 12 15 80 11 15 73.
3
8 15 53.
3
11 15 73..3
Gentamycin 32 4
0
80 7 11 63.6 14 15 93.
3
13 15 86.
7
10 15 66.
7
10 15 66.7
Oxytetracycli
n
27 4
0
67.5 6 11 54..5 14 15 86.
7
12 15 80 5 15 33.
3
11 15 73..3
Nalidixic acid 32 4
0
80 5 11 45..5 12 15 80 12 15 80 4 15 26.
7
4 15 26.7
Neomycin 34 4
0
85 9 11 81.8 11 15 73.
3
10 15 66.
7
9 15 60 4 15 26.7
Enrofloxacin 37 4
0
92.
5
9 11 81.8 14 15 93.
3
13 15 86.
7
12 15 80 8 15 53..3
Streptomycin 21 4
0
52.
5
6 11 54..5 12 15 80 12 15 80 10 15 66.
7
12 15 80
S = sensitive.
T = total number of tested isolates.
% = activity prevalence of each antibiotic.