Professional Documents
Culture Documents
Equipment
Computers with Internet access Engineering notebook
Procedure
As the primary investigators on this case you will need to document and report a variety of information including: Patient symptoms PCR data Entomology micrographs Shotgun sequencing
The following approach to the data analysis will aid you in your work: a. Highlight or underline important components of the case history that appear integral to reaching a conclusion or diagnosis (i.e., lab data and risk factors such as recent vacations, careers, or lifestyle).
Project Lead The Way, Inc. Copyright 2010 PLTWTM - BE Unit 3 Lesson 3.1 Activity 3.1.2 Rapid Pathogen Identification Page 1
b. Generate a list of appropriate species that relate to situation being studied and produce symptoms or diseases similar to what has been presented in the case history. c. Begin to reduce the list by eliminating candidates from it by using the information from the case history. Review each candidate with your fellow scientists until you reach an agreement. d. Once the responsible organism has been identified, then determine a treatment strategy, for other at-risk individuals, and approaches to halting the progression of infection, making sure they are feasible. Scenario: It is a hot and humid July in Washington, D.C. The presidential race is heating up, outpacing the local mercury. The GOP campaign headquarters, located just off the Potomac River and surrounded by several large meditation ponds, is especially feeling the heat. With millions of dollars fueling the GOP machine, the mood of the re-election team has been confident. However, panic is setting in at GOP campaign headquarters as an unknown illness appears to be affecting the staff. With several campaign staffers affected and the impending presidential election in the not so distant future, the campaign-medical liaison, Dr. Shrub, decides to bring in a team of crack shot scientists. The first team contacted is the High School Forensic Investigation Emergency National Defense Squad (HS-FIENDS). Immediately, the HS-FIENDS scramble and depart on their Biocom jet, which doubles as a mobile laboratory. Initial reports from Dr. Shrub are somewhat confusing. Day 1 March 22, 2004 Republican HQ Joel A 21-year-old male intern who is on summer break from Penn State where he is a broad jumper on the track team has reported a 24-hour history of painful urination. The young man reports urethral discharge (in his underpants and on the head of his penis). Urine appears clear, although many white blood cells are present. The young man gives a history of heterosexual activity with five partners over the past 6 months. He said that all his partners were clean. Lupita A 44-year-old Mexican-American media relations advisor with a keen interest in preColumbian artifacts reports a 3-day-old high fever. She also has severe joint pains, with a head and backache. She reports infrequent eye pain, nausea, and vomiting.
Project Lead The Way, Inc. Copyright 2010 PLTWTM - BE Unit 3 Lesson 3.1 Activity 3.1.2 Rapid Pathogen Identification Page 2
Felix A 33-old male volunteer in the mailroom, who works as textile worker in a fur store in the evenings was admitted into the Georgetown Hospital emergency room suffering from breathing difficulties and coughing spasmodically. Dr. Shrub was called and he ordered a chest x-ray which revealed widening of the mediastinum and pleural effusions. Lymph glands in the upper arm were swollen. He also observed vesicular lesions and black, necrotic skin tissue on his hands. Dr. Shrub is overwhelmed, but it appears that he is doing decent background work on the patients. Yet, there are still a lot of unknowns in this campaign HQ. Day 2 March 23 Joel He still has burning urination. Dr. Shrub requested a Chlamydia and gonorrhea screen on Joel. He will have PCR samples run. Team HS-FIENDS guessed these STDs could be likely since many women are asymptomatic. Lupita Her high fever continues and so do her severe joint pains, and headaches and backaches. She reports infrequent, eye pain, nausea and vomiting. Felix The vesicular lesions are increasing as well as the black, necrotic skin tissue on his hands. Mail samples are screened for possible powder. Samples of mail are taken to test for bioterrorist agents. New patients: Lionel A 30-year old African-American male works as a pressroom assistant at GOP HQ. He enjoys doing tai chi by the ponds after work. He has been home sick for 4 days with a high fever and severe joint pains, with head and backache. Lionel just called in to tell that his condition has worsened. He also reports frequent nausea and vomiting, and soreness around his eyes. Naomi A 28-year old Chinese-American female coordinates public opinion surveys for the campaign and will meet with hundreds of field officers a week who are roaming the streets of D.C. while conducting public opinion surveys. She has complained of
Project Lead The Way, Inc. Copyright 2010 PLTWTM - BE Unit 3 Lesson 3.1 Activity 3.1.2 Rapid Pathogen Identification Page 3
headaches and neck pain. She enjoys meditating by the ponds before and after work.
Ponds
Dr. Shrub suggests that it may be worth while to take water samples from the Potomac River and the meditation ponds to test for infectious agents. What should you look for? DAY 3 March 24 The following information is found in database searches. Use the nucleotide BLAST page, Use Blastn or search for short, nearly exact matches. Refer to the following URL: National Center for Biotechnology Information. (n.d.) BLAST. Retrieved October 18, 2006 from http://www.ncbi.nlm.nih.gov/BLAST/ You can make your search faster by restricting the database searched to only viral sequences. Select Viruses [ORGN] in the Option section of the page. If you do not receive hits, try increasing the Expect value; to, 10000.You might also take a look at the Program selection guide, linked on the Blast page. Follow-up on Patients: Joel The PCR screens for Chlamydia and gonorrhoeae showed negative for Chlamydia and positive for Neisseria gonorrhoeae. This matches the asymptomatic partners for Joel. Now only sequence information is required to confirm the PCR. It would be wise to start treating Joel. What should he be given? Lupita Her high fever continues and so do her severe joint pains, and headaches and backaches. She reports frequent eye pain, nausea, and vomiting. This 362-nucleotide sequence was produced by sequencing a sample of Lupitas lymph using universal primers (4 nucleotides). 1 gaagtccggc cttccgagag ctagctgtcc gccgcggccc ccgcacgccg ggcagccgtc 61 cctcgccgcc tcgggcgcgc caccatgggg ccccggctca gcgtctggct gctgctgctg 121 cccgccgccc ttctgctcca cgaggagcac agccgggccg ctgcgaaggg tggctgtgct
Project Lead The Way, Inc. Copyright 2010 PLTWTM - BE Unit 3 Lesson 3.1 Activity 3.1.2 Rapid Pathogen Identification Page 4
181 ggctctggct gtggcaaatg tgactgccat ggagtgaagg gacaaaaggg tgaaagaggc 241 ctcccggggt tacaaggtgt cattgggttt cctggaatgc aaggacctga ggggccacag 301 ggaccaccag gacaaaaggg tgatactgga gaaccaggac tacctggaac aaaagggaca 361 ag Felix Samples of his lesions were taken and universal primers were used to sequence. The following 119-nucleotide sequence was generated: 1 TTCCCTTCAA CTTGAAGCAC TTTCTTTATC AATTGAATCC CAAACCAAAA TCCCTCTCCT 61 ACTCAAGCGT AACAATTTAT GAGTATAAGA ATATTTTCCA CCCTTCAATG TAATGTAAA The powder found in the mail was negative for amplification (PCR) and sequencing. It was found to be of non-biological origin. Lionel His fever has resided somewhat after receiving Tylenol from Dr. Shrub. However, his frontal headache continues and he now has rash on his torso that is rapidly expanding. Naomi Her joint pain and aches continue. She is allergic to Tylenol but has taken some ibuprofen which has reduced her fever. A rash just appeared on her arm.
Ponds
Water samples were taken from the pond closest to GOP HQ. Sequencing with universal primers revealed two sequences. The first was 348 nucleotides: 1 atggaaggga aacgtgccct cctgtggctg ctactgattg ctgcagcggc ctttcaattg 61 tccgcccagc actggtcgca cggactcagt ccaggtggca agagggaagc tcacactctg 121 tcagaagtga tggaaggtct accaaagagg agtgcatcgc tttgtgggag tgaatacagg 181 gacggttccc catataaaag gccagataga cttgaacaac tgcttaatct gatggaggga 241 gaaaatgtag cttatgactg aacaacaaaa aatgaacaga ttcaataaaa cactgcagtg 301 tcttctaaat aaaaaaaaaa aaaaaaaaaa aaaaaaaa The second shotgun sequence was 180 nucleotides: 1 aaaactgaat tagctaaatt attagctaaa caattatttg gttcagaaaa agaattaata 61 agatttgata tgagtgaata tatggaaaaa cattcaattt caagattaat tggttcacct 121 ccaggttata taggttattc agaaggagga caattaacag aacaagtttt taaaaaacct DAY 4 March 25
Project Lead The Way, Inc. Copyright 2010 PLTWTM - BE Unit 3 Lesson 3.1 Activity 3.1.2 Rapid Pathogen Identification Page 5
Lupita Lupitas sequencing sample yesterday was just a human collagen gene. This is of no help. Her high fever continues and so do her severe joint pains, with headaches and backaches. She reports a large rash on her chest and arms. After hearing about the focus on the water in the meditation ponds with Plasmodium (nice find!), she lets on about a recent addition she added to the water. She had recently purchased some Inca artifacts from Peru from eBay-Peru in late January, 2004. The Peruvian dealer also sent some Inca holy water from Lambayeque to bless the arrival of the artifacts to their new home. Knowing that this was sacred water, Lupita poured it into the nearest meditation pond in order to cleanse the republican campaign. Felix Felix was infected with Bacillus anthracis, which most likely came from the fur business and not the mailroom. (Good job). He is already responding to his heavy doses of Ciprofloxin that was prescribed. Lionel His fever, headache, and rash continue. He also has some bleeding of the gums and nose. It is starting to look critical. This 362-nucleotide sequence was produced by sequencing a sample Lionels rashpustule using universal primers (4 nucleotides). 1 gaattctggt tgatcctacc agtaatatac gcttgtctca aaggttaagc catgcatgtc 61 taagtacaaa cagatttaat gtgaaaccgc ataaggctca gtataacagc tataatttac 121 aagatcattt aactagttac ttggataact gtggaaaatc tagagctaat acatgcaaaa 181 tgcaggaacc tcgcggaacc tgtgcaatta ttagtcaaac caatcgtcct ccgtgacgct 241 ggagttgaaa tctggataat tttgttgatc gtatggtctc gcaccgacga cagatctttc 301 aaatatctgc cctatcaact attgatggta gtatagagga ctaccatggt tgcaacgggt 361 a Naomi Her joint pain and aches continue. Her rash just spread to her legs.
Project Lead The Way, Inc. Copyright 2010 PLTWTM - BE Unit 3 Lesson 3.1 Activity 3.1.2 Rapid Pathogen Identification Page 6
This 120-nucleotide sequence was produced by sequencing a sample Naomis lymph using universal primers (4 nucleotides). 1 ataggagtcgtcatcacatggataggaatgaattcacgcagcacctcactgtctgtgtcactagtattag 61 gggagtcgtgacattgtatttgggagttatggtgcaggccgatagtggttgcgttgtgagttggaaaaa
Ponds
More water samples were taken from the pond closest to GOP HQ. Sequencing with universal primers revealed two sequences. The first was 129 nucleotides: 1 tttctgttta gtttcattac agatctggac atcctgtccc ttctagcttc atcagcttag 61 tagtctaagt agctcaagaa atcccgataa atcctttcct tccctgttac aaatgtatta 121 actaacctt The second shotgun sequence was 249 nucleotides: 1 cacgttgaac gcatattgca catcgtacta ccagtacgat gtacacattt ttgagtgcct 61 atatttatcc attcaactat acgcgccgcc cgcgcgcgta tgcgtagtga tgttttcccg 121 ccttcagtgc gcggtaaaac attgaagata gtcagacgtg gtggtgacac accgcggttg 181 atgaatacat cccactatgg cgcgctcgct cgccttgtgt tgtattccat cattcactaa 241 ctaactccct DAY 5 FINAL REPORT March 30th Instructions: Trace path of infection for each patient. Draw out a flow chart (Outbreak style) and label unknown or speculative pathways with question marks. Make sure this is done for each patient. This information will hopefully reduce the risk of future infection. For each patient, write out the primary evidence that brought you to your conclusion. It is important to rule out false positives in this line of investigation. Generally, you want multiple criteria confirmed before making your diagnosis. Be sure to answer the following questions: Is everyone treated? Are they going to be ok? Can this be prevented in the future? Final Report Identify pathogen and path of infection for each patient. Evidence for pathogen identification. Recommendation for prevention of similar scenarios.
Project Lead The Way, Inc. Copyright 2010 PLTWTM - BE Unit 3 Lesson 3.1 Activity 3.1.2 Rapid Pathogen Identification Page 7
Conclusion
1. What techniques are necessary to attain an uncontaminated DNA sequence that can be compared to known data genetic bases by a forensic scientists or a pathologist?
4. What is more definitive in pathogen identification: clinical information or sequence data? Defend your answer.
5. What variables must be considered when engineering a computer program to sleuth an outbreak scenario?
Project Lead The Way, Inc. Copyright 2010 PLTWTM - BE Unit 3 Lesson 3.1 Activity 3.1.2 Rapid Pathogen Identification Page 8