You are on page 1of 140

1

UNIVERSIDAD NACIONAL AUTNOMA DE MXICO


ESCUELA NACIONAL COLEGIO DE CIENCIAS Y HUMANIDADES
PLANTEL SUR




GUA DE ESTUDIO PARA EL EXAMEN EXTRAORDINARIO
DE BIOLOGA I




Autores:

Coria lvarez Irma
Flores Rosas Eduardo
Garduo Ambriz Cecilia
Gmez Ramrez Esperanza
Ortega Rangel Victoria
Ramos Reyes Maricela
Rivera Valladares Hctor Mario
Sosa Castillo Araceli
Toro Badillo Silvia

Coordinador: Hctor Mario Rivera Valladares
2
ndice
Presentacin--------------------------------------------------------------------------------------( 4 )

Primera Unidad. Cul es la unidad estructural y funcional de los sistemas vivos?

Tema I. La clula como unidad de los sistemas vivos
Formulacin de la teora celular y sus aportaciones.---------------------------------( 5 )
Molculas presentes en las clulas: Funcin de carbohidratos,
lpidos, protenas y cidos nucleicos.-----------------------------------------------------( 9 )
Estructuras celulares y sus funciones.--------------------------------------------------( 20 )
Semejanzas y diferencias entre clulas
Procariota y eucariotas.---------------------------------------------------------------------( 24 )

Segunda Unidad. Cmo se lleva a cabo la regulacin, conservacin y
reproduccin de los sistemas vivos?

Tema I. Procesos de regulacin
Concepto e importancia de la homeostasis.-------------------------------------------( 29 )
Funcin de los componentes de la membrana en el
transporte, comunicacin y reconocimiento celular.----------------------------------( 31 )
Transporte de materiales a travs de la membrana celular:
Procesos pasivos y activos.-----------------------------------------------------------------( 44 )

Tema II. Procesos de conservacin.
Concepto e importancia del metabolismo: Anabolismo
y catabolismo como procesos bioenergticos.-----------------------------------------( 51 )
Fotosntesis: Aspectos generales de la fase luminosa,
la fase obscura, e importancia.--------------------------------------------------------------( 54 )
Respiracin: Aspectos generales de la gluclisis, ciclo de Krebs,
Cadena de transporte de electrones, e importancia.----------------------------------( 61 )
Fermentacin: Aspectos generales e importancia.-----------------------------------( 69 )
Replicacin del ADN: Aspectos generales e importancia.--------------------------( 73 )
Sntesis de protenas: Aspectos generales de la transcripcin
y traduccin del ADN, e importancia.-----------------------------------------------------( 79 )
3
Tema III. Procesos de reproduccin
Fases del ciclo celular.--------------------------------------------------------------------( 84 )
Mitosis: Fases e importancia.-----------------------------------------------------------( 85 )
Meiosis: Fases e importancia en la reproduccin
y variabilidad biolgica.---------------------------------------------------------------------( 88 )
Aspectos generales de la reproduccin asexual y sexual,
importancia biolgica.-----------------------------------------------------------------------( 92 )

Tercera Unidad. Cmo se transmite y modifica la informacin gentica en los
sistemas vivos?

Tema I. Mecanismos de la herencia.
Herencia mendeliana.--------------------------------------------------------------------( 101 )
Herencia no mendeliana: Dominancia incompleta,
alelos mltiples y herencia ligada al sexo.-------------------------------------------( 108 )
Conceptos de gen y genoma.-----------------------------------------------------------( 113 )
Concepto de mutacin. Importancia de las mutaciones
como mecanismo de variabilidad biolgica.-----------------------------------------( 117 )

Tema II. La ingeniera gentica y sus aplicaciones.
Aspectos generales de la Tecnologa del ADN recombinante.-----------------( 124 )
Aplicaciones e implicaciones de la manipulacin gentica:
Organismos transgnicos, terapia gnica.--------------------------------------------( 131 )
Implicaciones bioticas del Proyecto Genoma Humano
y de la clonacin de organismos.-------------------------------------------------------( 136 )








4

PRESENTACIN


La presente gua fue elaborada con la finalidad de proporcionar al alumno una
orientacin que le permita realizar una preparacin adecuada para la presentacin
del examen extraordinario, para adquirir los aprendizajes indicados en el programa
para cada Unidad y las temticas correspondientes.

El alumno debe tomar en cuenta que esta gua no es un libro de texto, si bien, en
ella se desarrollan todos los temas del programa en el mismo orden y con la
suficiente profundidad para entender la temtica, es imposible cubrir todos los
aspectos que normalmente se abordan en un curso, en el cual, tanto el profesor
como los alumnos contribuyen con informacin variada para cada tema y en el que
se puede profundizar con preguntas, discusin, ejemplos, pelculas, investigaciones
y otros recursos didcticos que permiten lograr de mejor manera los aprendizajes
indicativos.

La presente gua es un orientador que desarrolla todos los temas de manera
sintetizada, pero que ubica bien al alumno en la temtica, explica el tema, da
algunos ejemplos, e indica su importancia biolgica, econmica y social, segn el
caso. La estructura de la presente gua, facilita el autoaprendizaje e
independientemente del desarrollo de los temas, sugiere diversas actividades de
aprendizaje (lecturas complementarias, ejercicios, elaboracin de glosario etc.)
adems de contar con cuestionarios de autoevaluacin.

Para un mejor resultado al presentar el examen extraordinario, te sugerimos que
primero revises de manera general toda la gua, para que conozcas los propsitos
de cada Unidad, los aprendizajes a lograr y la extensin de cada tema. Esto ltimo,
con la finalidad de que organices y distribuyas tu tiempo adecuadamente (no
profundices mucho en algunos temas y dejes de lado otros, ya que el examen toma
en cuenta todos los temas del programa). Aunque la gua puede ser utilizada
individualmente, lo mejor es trabajarla en equipos de discusin con otros
compaeros, as como acudir a las asesoras que especialmente se organizan con
profesores de la materia.

Recuerda que el resultado del examen extraordinario depende de una preparacin
adecuada y con el tiempo suficiente.



Febrero de 2012



5
PRIMERA UNIDAD

CUL ES LA UNIDAD ESTRUCTURAL Y FUNCIONAL DE LOS SISTEMAS
VIVOS?

Presentacin.
Esta primera unidad explica que tienen en comn todos los sistemas vivos y porque
la clula es considerada como la unidad estructural y funcional de los mismos, a
travs de una revisin del complejo proceso de construccin de la teora celular,
para seguir con el estudio de las molculas orgnicas (biomolculas) que
constituyen a los seres vivos y que participan en las funciones metablicas,
continuando con el conocimiento de las principales estructuras (organelos) que
permiten a la clula realizar todas sus funciones, finalizando con un anlisis de las
diferencias en la organizacin y funcionalidad entre clulas procariotas y eucariotas.

PROPSITO: Al finalizar la unidad, el alumno identificar los componentes celulares
y su importancia, a travs del anlisis de la teora celular y las explicaciones sobre
su organizacin y funcionamiento, para que reconozca a la clula como la unidad
estructural y funcional de los sistemas vivos.

Tema I. La clula como unidad de los sistemas vivos.

Formulacin de la teora celular y sus aportaciones. (Eduardo F. Flores Rosas).

Aprendizaje: Explica cmo se construy la teora celular considerando el contexto
social y la etapa histrica en que se formul.

La teora celular es uno de los principios unificadores de la biologa, pues llev a
comprender que el desarrollo de los seres vivos es un proceso de transformacin a
partir de modificaciones celulares. La construccin de la teora celular fue el
resultado de mltiples trabajos de investigacin realizados a lo largo de casi dos
siglos.
El concepto de clula fue propuesto por el naturalista Robert Hooke, publicado en
1665 en su libro Micrographia, al examinar cortes muy delgados de corcho, a travs
de un microscopio compuesto, observando pequeas celdas que dividen al corcho
en compartimentos limitados por paredes rgidas, debido al parecido que les
encontr con las pequeas cavidades polidricas de un panal (celdilla en latn se
escribe cellula); pero Hooke no supo explicar lo que estas celdillas significaban como
componentes de los seres vivos.

En la misma poca de R. Hooke, un comerciante en telas y naturalista aficionado
llamado Anton van Leeuwenhoek, construy microscopios simples con un poder
de amplificacin mayor a 200 veces, lo que le permiti observar los ms diversos
objetos y describir diferentes animlculos (animales pequeos) vivos en agua de
pantanos y charcas (bacterias, levaduras, protozoarios), en la sangre (glbulos
rojos) y en el esperma (espermatozoides).

6
Sin embargo, no era suficiente tener instrumentos o tcnicas que permitieran
observar las estructuras microscpicas para poder entenderlas y explicarlas, ya que
tambin es necesario contar con marcos conceptuales que permitan interpretarlas.
Por eso, el uso del microscopio quedo relegado, desde mediados del siglo XVII
hasta principios del siglo XIX, a los salones de juego de la aristocracia y fueron muy
pocos los naturalistas que se dedicaron a la investigacin microscpica. Este desdn
se debi principalmente a problemas tcnicos, los microscopios eran muchas veces
fabricados por los propios investigadores, pero pocos tuvieron la habilidad de
Leeuwenhoek, y todava fueron menos los que tuvieron una gran motivacin para
impulsarlos a vencer las mltiples dificultades que se presentan en la construccin
del conocimiento.

Si bien, durante el siglo XVIII se lograron corregir algunas de las aberraciones
pticas que presentaban las lentes del microscopio mejorando su poder de
resolucin, el conocimiento sobre la estructura, funcin y origen de las clulas no
se profundiz debido principalmente a las corrientes filosficas que dominaban en
esa poca: creacionismo, vitalismo y fijismo. Estas corrientes filosficas y su
aparato de control (la inquisicin) no favorecieron la investigacin cientfica. De tal
manera, que entre los siglos XVI al XVIII, slo se promovi el inters por conocer y
coleccionar organismos. Por lo que los estudios descriptivos de zoologa y botnica
se multiplicaron y se escribieron diversas Historias Naturales, debido a la gran
variedad de animales y vegetales que llegaron a Europa procedentes de las
colonias de frica, Amrica y Asia.

Para el siglo XIX, el perfeccionamiento del microscopio y de las tcnicas de
preparacin del material biolgico (fijacin, corte, tincin, montaje) permiti estudios
ms detallados de la clula y, adems, realizar observaciones objetivas, esto es,
repetibles. Aunado a lo anterior, el firme establecimiento de una filosofa basada en
el razonamiento del conocimiento (Ilustracin) y los estudios sobre evolucin
biolgica (teora de la Seleccin Natural), buscaron eliminar la ignorancia y la
supersticin. Dentro de los grandes avances se tienen los estudios realizados por
Henri Dutrochet (botnico francs), en 1824, que postula la teora globulista, la cual
propone la unidad estructural utricular o globular de vegetales y animales; Robert
Brown (botnico escoses), en 1831, descubre una estructura circular en el interior
de las clulas a la que denomina ncleo. Mientras que en 1835 el suizo Gabriel
Valentn describe el nuclolo y para 1839 el mdico checo Jan Purkinje introduce el
trmino protoplasma para nombrar al material intracelular. Estos y otros
descubrimientos permitieron a dos naturalistas alemanes:
M. Schleiden y T. Schwann proponer la teora celular.

El botnico Matthias Schleiden perfeccion tcnicas histolgicas para vegetales
mientras que el zologo Theodor Schwann hizo lo mismo pero en tejidos animales,
lo anterior les permiti establecer, en 1838 y 1839, los primeros postulados de la
teora celular: la unidad estructural y funcional de los seres vivos son las clulas.
Aproximadamente 20 aos despus, en 1855, Rudolph Virchow complet la teora
celular al realizar estudios sobre reproduccin celular, y postular que las clulas
provienen de otras clulas.



7
A partir de estos postulados, en la actualidad la teora celular establece cuatro
principios:

- Unidad morfolgica. Todos los sistemas vivos estn constituidos de clulas.

- Unidad fisiolgica. La clula es capaz de realizar todos los procesos metablicos
necesarios para vivir.

- Unidad de origen. Toda clula proviene de otra clula preexistente.

- Unidad gentica. La clula contiene el material hereditario (toda la informacin
para la sntesis de sus estructuras y el control de su funcionamiento y es capaz de
trasmitirla a sus descendientes).


Actividades de aprendizaje.

1. Elabora un cuadro cronolgico donde se indique la aportacin metodolgica y
conceptual de los investigadores ms relevantes, que contribuyeron en la
construccin de la teora celular.
2. Investiga en qu consisten: Creacionismo, Vitalismo, Fijismo, Colonialismo,
Ilustracin y teora de la Seleccin Natural; para que te ubiques en el contexto
histrico-social y el pensamiento dominante de la poca.
3. Explica con tus propias palabras, los cuatro principios de unidad de la teora
celular.
4. Busca las diferencias entre microscopio simple y compuesto.
5. Explica en qu consisten los poderes de resolucin y amplificacin del
microscopio.


Cuestionario de autoevaluacin.

1. Es la aportacin conceptual de Robert Hooke.

a) Define la pared celular.
b) Define a la clula.
c) Define el ncleo.
d) Define el citoplasma.
e) Define el cloroplasto.

2. Es la aportacin conceptual de Rudolf Virchow.

a) Todas las plantas estn formadas por clulas.
b) Todos los animales estn formadas por clulas.
c) Toda clula proviene de otra clula preexistente.
d) Todas las clulas poseen ncleo.
e) Todos los seres vivos estn formadas por glbulos.



8
3. Es la aportacin conceptual de Mathias Schleiden.

a) Todas las plantas estn formadas por clulas.
b) Todos los animales estn formadas por clulas.
c) Toda clula proviene de otra clula preexistente.
d) Todas las clulas poseen ncleo.
e) Todos los seres vivos estn formadas por glbulos.

4. Postulado que corresponde a la teora celular.

a) Todas las clulas son procariotas y eucariotas.
b) Todos los seres vivos evolucionan.
c) Todos los seres vivos estn constituidos por una o varias clulas.
d) Todas las clulas presentan membrana.
e) Todos los seres vivos se dividen en vegetales y animales.

5. La palabra clula significa
a) pared rgida.
b) panal de abeja.
c) celda pequea.
d) celda vaca.
e) corcho.

Respuestas.

1. B
2. C
3. A
4. C
5. C

Bibliografa.

Audersik, T. et al. 2001. La vida en la tierra. 6 ed. Prentice Hall. Mxico
Campbell, N. et al. 2001. Biologa. 3 ed. Prentice Hall. Mxico.
Curtis, H y Barnes, R. 2004. Biologa. 6 ed. Medica-Panamericana. Espaa.
Solomon, E. et al. 2001. Biologa. 5 ed. McGraw Hill-Interamericana. Mxico.













9
Molculas presentes en las clulas: Funcin de carbohidratos, lpidos,
protenas y cidos nucleicos. (Cecilia Garduo Ambriz).

Aprendizaje: Valora la importancia de las biomolculas en el funcionamiento de las
clulas.

Aunque en la actualidad se conocen ms de 100 elementos qumicos, solo 6 de ellos
constituyen el 99% de los tejidos vivos. Estos elementos son el CHONPS y en su
origen se asociaron a travs de enlaces covalentes para formar las llamadas
biomolculas. La Bioqumica es la rama de la Biologa que se encarga de estudiar
las molculas que constituyen a los seres vivos.

Las molculas orgnicas estn formadas bsicamente de carbono; los llamados
elementos esenciales de la materia viva son C, H, O, N, P, S, Ca, K, Na, Cl y Mg.
Adems existen otros elementos que se encuentran en mnimas cantidades pero
son indispensables para los seres vivos: el Zn, Mn, Cu, F, Y, Mo y Co, que tambin
se conocen como elementos traza. En el ser humano el CHONPS forma el 97.9 %
de su composicin.

En cuanto a la clula, el agua es su principal componente y ocupa del 75 al 85% de
la misma; los minerales son el 1% de su composicin y el resto lo constituyen las
molculas orgnicas o biomolculas que son los glcidos o cabohidratos, los lpidos,
las protenas y los cidos nucleicos. Los glcidos ocupan el 1% de la clula, los
lpidos entre el 2 y 3% y las protenas entre el 10 y 20%. En peso seco, el 50% de
una clula es protena.

Las protenas, tambin se conocen como polipptidos o prtidos, son las
biomolculas ms abundantes en los seres vivos y estn formadas casi
exclusivamente por CHON. Estos elementos a su vez forman molculas ms
complejas llamadas aminocidos que son las unidades que constituyen a las
protenas. Los aminocidos se caracterizan por tener en su estructura un grupo
amino (-NH
2
) y un grupo cido o carboxilo (-COOH) unidos a un carbono.













Existen 20 aminocidos que requiere el organismo para formar todas las protenas
que necesitamos; el organismo puede sintetizar la mayora de estos aminocidos;
solo 9 de ellos se tienen que obtener forzosamente de los alimentos ya que no se
pueden sintetizar, estos aminocidos se conocen como aminocidos esenciales.

Figura 1 Esquema general
de un aminocido
10
Los aminocidos se unen entre s a travs de enlaces peptdicos que se forman por
la atraccin del grupo amino de un aminocido y el grupo cido del otro,
desprendindose una molcula de agua, por esta razn las protenas se conocen
tambin como polipptidos (Figura 2)




















Figura 2. Enlace peptdico.

Cada protena se forma de diferentes combinaciones de cientos de molculas de
aminocidos. Tenemos ms de 60,000 protenas diferentes. Cada tipo celular
contiene protenas especficas. Las protenas son importantes para la clula porque
forman parte de su estructura y adems intervienen en su funcionamiento, ya que
las enzimas son protenas especializadas. Las enzimas catalizan todas las
reacciones del organismo y algunas hormonas regulan diversas funciones como por
ejemplo la insulina que interviene en el metabolismo de los carbohidratos; otras
protenas tienen funciones especficas como la hemoglobina que se encarga de
transportar oxgeno en la sangre.

Por su estructura las protenas se clasifican en primarias, secundarias, terciarias y
cuaternarias. Pueden ser cadenas sencillas de pocas unidades de aminocidos o
tener estructuras sumamente complejas como la hemoglobina, cuya frmula
sintetizada es C
3032
H
4816
O
870
S
8
Fe
4
.

Por su funcin biolgica las protenas se clasifican en:

Estructurales, como el colgeno, la seda o la cubierta de un virus.
Reguladoras, como las enzimas y hormonas.
Contrctiles, como la actina y la miosina que expanden y contraen los
msculos.
De transporte, como la hemoglobina que llevan 0
2
y alimento a las clulas.
Aminocido
1
Aminocido
2
Unin peptdica
Dipptido Agua
11
De almacenamiento de energa y materia prima, como las de los huevos de
aves y reptiles.
De defensa, como las que forman los anticuerpos.
De membrana, como los transportadores de la membrana celular.
Catalizadoras, como las enzimas, por ejemplo, la lactasa que rompe la lactosa
o azcar de la leche.
Txicas, que son protenas secretadas por microorganismos como la toxina de
la difteria.
Los glcidos, tambin llamados carbohidratos o azcares, son la principal fuente de
energa del cuerpo humano (60 a 70%), y de casi todas las formas de vida. En la
mayora de estas biomolculas, por cada tomo de carbono hay dos de hidrgeno y
uno de oxgeno. Son derivados aldehdicos o cetnicos de alcoholes polivalentes y
pueden tener estructuras sencillas o complejas. Como ejemplos de glcidos
tenemos a los azcares comunes, los almidones y la celulosa. Adems de
almacenar energa los glcidos forman parte de las estructuras celulares, como los
que se encuentran en las paredes de la clula.

Los glcidos o carbohidratos se agrupan en tres categoras:

Monosacridos, que son azcares simples de 1 a 10 tomos de carbono. Las
triosas tienen 3 carbonos y un ejemplo es el gliceraldehido; las tetrosas tienen
4 carbonos; las pentosas tienen 5 y entre ellas estn la ribosa y la
desoxirribosa, azcares fundamentales del ARN y ADN respectivamente; las
hexosas tienen 6 carbonos y entre ellas est la glucosa, principal producto de
la fotosntesis, y la fructuosa, azcar importante en el metabolismo.
Disacridos y oligosacridos, que se forman por la unin de dos o ms
monosacridos a travs de un enlace llamado glucosdico o puente de
oxgeno, en el que hay prdida de una molcula de agua. La sacarosa o
azcar de caa es la forma ms comn de disacrido y se compone de una
glucosa y una fructuosa (Figura 3), la trehalosa de los insectos se forma de
dos glucosas y la lactosa o azcar de la leche est formada por la unin de
una glucosa y una galactosa. Estas molculas se rompen por accin del agua
liberando mucha energa. El azcar ms dulce es la fructuosa, la sacarosa
tiene dulzura intermedia.


Figura 3. La sacarosa.







12
Polisacridos, que provienen de la unin de cientos o miles de molculas de
monosacridos (monmeros). Su frmula general es (C
6
H
12
O
5
) x, donde x
tiene un valor igual o mayor de 10. Difieren entre s en constitucin, peso
molecular, tipo de enlace glucosdico, ramificacin y propiedades. Por su
funcin se dividen en los que tienen capacidad estructural y que sirven de
proteccin o de soporte mecnico y los que tienen capacidad nutricional o
metablica.
Son polisacridos estructurales la celulosa de las clulas vegetales (2500 a
3000 molculas de glucosa), la quitina o exoesqueleto de los artrpodos, los
mucopolisacridos o azcares sulfatados que se encuentran en cartlagos,
pulmones y vlvulas cardiacas y las mucoprotenas que son azcares
asociados a protenas presentes en los grupos sanguneos.

Son polisacridos metablicos los que sirven de reserva de energa como los
almidones de las plantas y el glucgeno o almidn de los animales que tiene
hasta 30,000 molculas de glucosa (Figura 4).













En cuanto a la eficiencia metablica, los glcidos o carbohidratos proporcionan alta
energa y alta eficiencia metablica. En caso de no utilizarse se almacenan como
grasas.

Los lpidos son un grupo heterogneo de compuestos que incluyen los aceites y las
grasas. Las grasas son slidas a temperatura ambiente y en ellas predominan los
cidos grasos saturados; su temperatura de fusin es mayor a la de la temperatura
ambiente. Los aceites son lquidos a temperatura ambiente, debido a que su
temperatura de fusin es inferior a la de la temperatura ambiental y en ellos
predominan los cidos grasos insaturados.

Los lpidos se componen de CHO en una relacin de dos tomos de H por uno de C
y tienen menos O que los carbohidratos. Son insolubles en agua y solubles en
disolventes orgnicos como el benceno, el ter y el cloroformo. Son esteres que
proceden de la unin de alcoholes y cidos grasos (Figura 5).





Figura 4. Estructura del
glucgeno.
13







Figura 5. Formacin de una grasa
Los lpidos son componentes de nuestros tejidos, son fuente de energa y sirven de
amortiguamiento y proteccin. A 10
0
C, la glicerina y los cidos grasos digeridos por
nuestro organismo se absorben directamente por el torrente sanguneo y a mas de
10
0
C,

penetran al sistema linftico y ello ocurre con las
2
/
3
partes de las grasas que
consumimos. La bilis emulsifica las grasas. La hibernacin es un proceso que
consiste en la utilizacin de las grasas almacenadas en los tejidos animales durante
el verano, a fin de obtener agua y energa para sobrevivir en el invierno, mientras el
metabolismo del animal baja y ste duerme.

Los lpidos se dividen en grasas simples y complejas. Las simples, neutras o
triglicridos son tristeres de alcoholes y cidos grasos (Figura 6), son molculas
altamente energticas y son lquidas a temperatura ambiente. Los cidos grasos
pueden tener de 2 a 24 tomos de carbono, poseer ligaduras sencillas o dobles y
varan de un tipo de grasa a otro. Pueden ser saturados como el cido palmtico
(C
14
H
28
O
2
), aceite similar al de olivo o girasol, o insaturados como el cido oleico
(C
17
H
33
COOH) cuyo uso previene enfermedades del corazn (Figura 7). Otros
ejemplos de cidos grasos son el cido butrico de la mantequilla y el cido cprico
que es componente del sudor y del cebo. Los cidos grasos tambin son elementos
estructurales de las membranas celulares y de la mielina que recubre las fibras
nerviosas.






Figura 6. Estructura de una grasa.




Figura 6. Estructura de una grasa

14















Figura 7. cidos grasos saturados e insaturados.

Las grasas complejas incluyen a los cridos como la cera de las abejas y el esperma
de ballena; a los esteroideos como las hormonas sexuales y el colesterol; a los
fosfolpidos, importantes componentes de la membrana celular; a los glucolpidos,
que son lpidos unidos a azcares y a las vitaminas liposolubles como la A, D, E y K.
Los fosfolpidos tienen en su composicin adems de CHO, fsforo y nitrgeno. Son
molculas polares; una parte de la molcula es hidrofbica y la otra se compone de
glicerol, fosfato y una base nitrogenada como la colina (Figura 8). Su estructura es
similar a la de las grasas solo que un cido graso ha sido sustituido por un PO
4
.

Son
ejemplos de fosfolpidos las lecitinas que se encuentran en la yema de huevo y las
cefalinas que se encuentran en el cerebro y los msculos.







Figura 8. Estructura general de un fosfolpido.

Los esteroides son molculas formadas por 4 anillos contiguos. Son grasas
liposolubles cuya estructura se relaciona con el colesterol (Figura 9). Difieren entre

Acido oleico
15
ellos por los radicales que se adhieren a sus anillos. Entre sus funciones estn la
regulacin del desarrollo sexual (progesterona y testosterona), intervenir en el
metabolismo y formar la vitamina D. El colesterol es fundamental para la membrana
celular y para formar otros esteroides.











Figura 9. Estructura del colesterol.

En cuanto a la eficiencia metablica de los lpidos, sta es de 10 a 12% menor que
la de los glcidos ya que a pesar tener ms energa almacenada resulta ms difcil
su digestin y el cuerpo prefiere almacenarlos debajo de la piel, en el tejido adiposo.


Los cidos nucleicos son las biomolculas responsables de la diversidad del
mundo vivo ya que en ellas est escrito el cdigo de la vida. El ADN o cido
desoxirribonucleico controla las funciones vitales, transmite las caractersticas
hereditarias de padres a hijos y se encarga de sintetizar, con ayuda del ARN o cido
ribonucleico, las protenas (estructurales, enzimas y hormonas).

cidos nucleicos. Los cidos nucleicos estn formados por unidades llamadas
nucletidos. Los nucletidos estn formados por un azcar de 5 carbonos, un cido
fosfrico y una base nitrogenada (Figura 10).




Figura 10. Estructura bsica de un
nucletido.





16










Los azcares de estas molculas tienen 5 carbonos (pentosas) y son la
desoxirribosa (ADN) y la ribosa (ARN). Las bases nitrogenadas son de dos tipos:
pricas o purinas (Adenina y Guanina) y pirimdicas o pirimidinas (Citosina y Timina
para el ADN y para el ARN la Timina se cambia por Uracilo), como se ve a
continuacin.














La estructura bsica del ADN fue explicada en 1953 a travs del modelo que James
Watson y Francis Crick elaboraron para esta compleja molcula y que la describe
como una doble hlice formada por dos cadenas complementarias de nucletidos,
plegadas en espiral en el espacio. Los nucletidos de cada cadena se unen entre s
a travs del azcar de un nucletido con el fosfato del otro. Las cadenas se aparean
a travs de puentes de hidrgeno que se forman entre sus bases, la Adenina se une
con la Timina y la Citosina con la Guanina (Figura 11).

17



Figura 11.Estructura del ADN.







El ARN est formado por una sola cadena de nucletidos y en la misma la Timina se
sustituye por el Uracilo, segn se muestra en la Figura 12.








Figura 12. Estructura del ARN.
El ADN se encuentra bsicamente en el ncleo de la clula, y en las mitocondrias y
los cloroplastos. El ADN forma los genes o unidades hereditarias.

El ARN se localiza en el ncleo aunque en los ribosomas tambin hay ARN; de
acuerdo a su funcin en la sntesis de protenas el ARN puede ser mensajero, de
transferencia o ribosomal.

Actividades de aprendizaje.

1. Investiga el significado de los siguientes trminos y elabora un glosario: elemento,
compuesto, grupo funcional, alcohol, aldehdo, cetona, ter, ster, cido orgnico,
amida, amina, radical, puente de hidrgeno, enzima y hormona.
2. Investiga cuales son los 20 aminocidos que requerimos para vivir y seala cules
de ellos son los 9 esenciales.
3. Dibuja con lpiz la estructura de cinco aminocidos y despus nelos para formar
una protena, sealando los enlaces peptdicos.
4. Investiga la estructura primaria, secundaria, terciaria y cuaternaria de las
protenas.

A
U
C
G
18
5. Elabora un listado de las principales hormonas de nuestro organismo y sus
funciones.
6. Dibuja la unin de dos monosacridos, por ejemplo dos glucosas, y seala el
enlace glucosdico.
7. Elabora un modelo de ADN con sus 4 bases nitrogenadas.
8. Investiga el papel de los tres tipos de ARN sealados anteriormente, en la sntesis
de protenas.

Cuestionario de Autoevaluacin.

I. Completa las siguientes frases:
1.- ____ ____ ____ y _____ son los principales elementos de los sistemas vivos.
2.- Del 75 al 85% de la clula est constituido por _____________.
3.- Ms del 50% de las estructuras celulares estn constituidas por
____________________.
4.- De acuerdo a su clasificacin la hemoglobina es una protena ______________
5.- La actina y la miosina son ejemplos de protenas________________________
6.- Las ________________ y las ______________ son importantes grupos de
protenas funcionales que actan en la regulacin y metabolismo de los seres vivos.
7.- Los___________________ son las principales biomolculas que proporcionan
energa a los seres vivos.
8.-La unin de los monosacridos para formar polisacridos se caracteriza por el
enlace___________________________
9.- La celulosa y la quitina son ejemplos de___________________________
10.- Por su fcil aprovechamiento, los ________________ tienen mayor eficiencia
metablica que los _______________________a pesar de tener mucha energa.
11.- El ___________________ es componente fundamental de las membranas
celulares y es muy importante para la formacin de esteroides.
12.- Los __________________ son tristeres de alcoholes y cidos grasos.
13.- La estructura general de un nucletido es ______________, _______________
y _____________________
14..-___________________ y ______________________son las bases pricas y
_________________, ________________ y _________________las pirimdicas.
15.- Los tres tipos de ARN son ______________________, __________________ y
______________________.


II. Coloca en el parntesis la letra que corresponda, sin importar que se repita:
16. Proceden de la unin de unidades llamadas A. Glcidos
Aminocidos, por enlaces peptdicos. ( ) B. Lpidos
17. Son lquidos o slidos y entre los ms complejos C. Protenas
predominan los insaturados. ( ) D. ADN
18.- El enlace glucosdico caracteriza a sus molculas E. ARN
ms complejas. ( )
19. Tiene en su estructura ribosa, fosfato y de sus
bases, la timina se ha sustituido por uracilo ( )
20. Es una cadena sencilla de nucletidos ( )
21. La celulosa y la quitina son ejemplos de ( )
22. Adenina, timina, citosina y guanina son las bases
que lo constituyen ( )
19
23. El colgeno y la hemoglobina son ( )
24. Son esteres que proceden de la unin de alcoholes
y cidos grasos ( )
25. Dirige la sntesis de protenas ( )

Respuestas.
1. C, H, O y N
2. Agua.
3. Protenas.
4. Transportadora.
5. Contrctiles.
6. Enzimas y hormonas.
7. Glcidos.
8. Glucosdico.
9. Polisacridos.
10. Glcidos, lpidos.
11. Colesterol.
12. Triglicridos.
13. Azcar, PO
4
y base nitrogenada.
14. Adenina y guanina, citosina, timina y uracilo.
15. Mensajero, de transferencia y ribosomal.
16. C
17. B
18. A
19. E
20. E
21. A
22. D
23. C
24. B
25. D

Bibliografa.

Alexander P, et al. 1992. Biologa. Prentice Hall. EUA.
Curtis, H y Barnes, R. 2004. Biologa. 6 ed. Medica-Panamericana. Espaa.
Gua Examen Extraordinario. Biologa I. 1996. CCH-Sur. UNAM.
Solomon, E. et al. 2001. Biologa. 5 ed. McGraw Hill-Interamericana.
Mxico.Per
- Una Nueva Propuesta de Enseanza - Aprendizaje Portal de la
*http://diccionariobiologica.blogspot.com/2009/03/aminoacidos.htmlAprendizajz










20
Estructuras celulares y sus funciones. (Esperanza Gmez Ramrez)

Aprendizaje: El alumno relaciona las estructuras celulares con sus funciones.

A continuacin se presenta un cuadro de algunos de las estructuras celulares, su
descripcin y sus funciones.


NOMBRE ESQUEMA DESCRIPCIN FUNCIONES


Ncleo


Estructura delimitada por una
membrana doble, contiene a
los nuclolos y cromosomas

Es el centro de
regulador de la clula,
contiene la informacin
gentica en el ADN.

Nucleolo



Son cuerpos granulares
carentes de membranas y
estn formados por ARN y
protenas

En l se realizan la
sntesis del ARN
ribosmico y el
ensamble de los
ribosomas






Pared celular


Presentes en plantas
superiores, hongos y
bacterias. Es una capa
exterior constituida de
celulosa, o de quitina o de
una variedad de
combinaciones de
carbohidratos y de
aminocidos.
Tiene tres partes
fundamentales: 1) la
sustancia intercelular o
lmina media, 2) la pared
primaria y 3) la pared
secundaria.
Tiene un papel
importante en
actividades como son la
absorcin, la
transpiracin, la
secrecin y las
reacciones de
reconocimiento, Brinda
sostn a la clula
vegetal e incluso puede
evitar que la clula
reviente en los medios
hipotnicos.







Membrana
plasmtica



S. J. Singer y J. L. Nicolson
propusieron el modelo
conocido como el mosaico
fluido, en el cual, como el
modelo anterior se propone
una doble capa de
fosfolpidos con sus
extremos polares orientados
hacia las superficies interna
y externa y sus extremos
apolares hidrofbicos
dirigidos en yuxtaposicin
hacia el centro de la bicapa;
este modelo explica mejor la
naturaleza de las protenas
de la membrana

Es la capa ms
externa de la clula
viva, controla el paso
de materiales hacia el
interior o exterior de
las clulas.
21
a) El retculo
endoplsmico rugoso
tiene ribosomas
adheridos y su funcin
central es la sntesis y
ensamble de protenas.


Retculo
endoplsmico


Rugoso






Liso










Red de membranas internas
plegadas o sacos que
forman compartimientos
interconectados dentro del
citoplasma.
b) El retculo
endoplsmico liso no
tiene ribosomas
adheridos y es el sitio
principal del
metabolismo de
fosfolpidos, esteroides
y cidos grasos.


Ribosomas


Orgnulos compuestos de
ARN y protenas, algunos se
encuentran adheridos al
retculo endoplsmico y otros
libres en el citoplasma.

Sntesis de protenas en
procariontes y
eucariontes.



Complejo de
Golgi



Consiste en una serie de
sacos membranosos
aplanados, que pueden
encontrarse distendidos en
algunas regiones por estar
llenos de productos
celulares.
Funciona como
procesador,
modificador de
protenas, empaque de
protenas secretadas y
clasificador de otras
protenas que se
distribuyen a vacuolas u
otros organelos.


Lisosomas



Vesculas membranosas
formadas por el Complejo de
Golgi, llenas de enzimas
digestivas.
Contienen enzimas que
degradan materiales
ingeridos, secreciones y
desechos celulares




Vacuolas






Son sacos grandes llenos de
lquido sin estructura interna.
Tienen una participacin
importante en el
crecimiento y el
desarrollo de las
plantas. Tambin sirven
como compartimiento
para almacenar
compuestos inorgnicos
en clulas vegetales y
para molculas de
almacenamiento, como
las protenas en las
semillas.
22




Mitocondrias


Organelos intracelulares
esfricos o alargados,
constituidos por una doble
membrana una externa lisa y
una interna que se pliega
formando las llamadas
crestas. En su interior se
encuentra la matriz
mitocondrial. Enzimas y ADN

Sitio donde se lleva a
cabo la respiracin
aerobia. En ella se
realizan las reacciones
de oxido reduccin para
la obtencin de energa.


Cloroplastos


Estructura de doble
membrana que envuelve a
los tilacoides, los cuales
contienen clorofila. Estroma

Organelo en el cual se
lleva a cabo el proceso
de la fotosntesis.





Citoesqueleto


Es una densa red de fibras
proteicas, es en extremo
dinmico y se encuentra en
cambio constante. Su
armazn est constituido por
tres tipos de filamentos que
son los microtbulos,
microfilamentos y filamentos
intermedios.

Le da a la clula la
forma, la capacidad de
moverse, es el soporte
mecnico de la misma,
participa en el
transporte dentro de la
clula y en la divisin
celular.
Citoplasma


Porcin del protoplasma que
est fuera del ncleo,
diversos organelos estn
suspendidos en el
componente lquido del
citoplasma, que por lo
general se denomina citosol

Contiene todos los
organelos celulares,
partculas y sustancias
semilquidas entre la
membrana plasmtica y
el ncleo.


Cilios y

Flagelos




Los cilios son estructuras
filiformes en la superficie de
algunas clulas

Flagelos: Estructuras
semejantes a pelos en la
superficie de las clulas. En
amos casos estn formados
por microtbulos ordenados
en 9 + 2







Mueven a las clulas a
travs de un fluido o
mueven los fluidos por
la superficie celular.
23




Microtbulos




Formados de protena actina
y a veces miosina.



Toman parte en el
movimiento celular o de
materiales


Actividades de aprendizaje.

1. Investiga que otros organelos estn presentes en las clulas procariontes y
eucariontes, descrbelos e incorpralos en el cuadro antes presentado.
2. Realiza dibujos o esquemas de la estructura de cada organelo celular.

Cuestionario de autoevaluacin.

1. Vesculas membranosas en el interior de la clula, que empacan, clasifican
protenas que sern secretadas o enviadas a otros organelos o a la membrana
plasmtica.

A) Retculo endoplsmico liso
B) Retculo endoplsmico rugoso
C) Mitocondria
D) Aparato de Golgi
E) Nucleolo

2. Estructura constituida por lpidos, protenas y carbohidratos cuya funcin principal
es controlar la entrada y salida de sustancias en la clula.

A) Membrana nuclear
B) Cloroplasto
C) Citoplasma
D) Vacuola
E) Membrana celular

3. Organelo celular cuya funcin es la sntesis de protenas

A) Ribosoma
B) Cloroplasto
C) Citoplasma
D) Vacuola
E) Membrana celular



24
4. Estructura celular formada con una membrana externa y otra interna plegada en
forma de crestas y en ella se sintetiza la mayor cantidad de energa celular.

A) Retculo endoplsmico liso
B) Cloroplastos
C) Mitocondria
D) Aparato de Golgi
E) Nucleolo

5. Su funcin principal es la de llevar a cabo la funcin de la fotosntesis.

A) Retculo endoplsmico liso
B) Cloroplastos
C) Mitocondria
D) Aparato de Golgi
E) Nucleolo

Respuestas.
1- D
2- E
3- A
4- C
5- B

Bibliografa.
Audersik, T. y G. Audesirk, 2005. Biologa . La Vida en le Tierra. Ed. Prentice-
Hall Hispanoamericana
Alexander, P., et al. 2002. Biologa. Prentice Hall.
Curtis, H. 2008.Biologa. Ed. Panamericana.
Kimball, J. W. 1986. Biologa. Ed. Addison-Wesley Iberoamericana.
Solomon, B.M. 2002. Biologa. Ed. Mc Graw Hill.


Semejanzas y diferencias entre clulas procariotas y eucariotas.
(Esperanza Gmez Ramrez)

Aprendizaje: Explica las caractersticas de las clulas procariontes y eucariontes.

Se conocen dos tipos bsicos de clulas: las procariontes y eucariontes. Una
diferencia importante entre ambos tipos de clulas es que, el ADN de las
procariontes se localiza en una regin limitada en el citoplasma a la que se
denomina rea nuclear o nucleoide y en el caso de las clulas eucariontes est
contenido por una doble membrana. A pesar que existen diferencias entre ambos
tipos de clulas, poseen caractersticas en comn, por ejemplo, ambas contienen
ADN, tienen capacidad para sintetizar protenas y la mayora utilizan la misma clave
gentica.
25

Clula procarionte. La palabra procarionte significa antes del ncleo, por lo cual
se considera que las antiguas clulas procariontes dieron origen a las clulas
eucariontes que forman los organismos de los Reinos Protista, Fungi, Plantae y
Animalia. Existen dos grupos principales de procariontes: las Arqueobacterias y las
Eubacterias.

Presentan una pared celular que es semirrgida, la cual rodea a la membrana
plasmtica, sirve de soporte a la clula y le da forma; las sustancias disueltas
pueden entrar y salir con libertad a travs de la membrana plasmtica, porque dicha
pared es semipermeable.

La membrana plasmtica est formada aproximadamente por un 40% de lpidos
sencillos y 55% de protenas arregladas en capas. Al igual que la de las clulas
eucariontes, tiene protenas que sirven como transportadoras, receptoras y de
reconocimiento, En algunos sitios la membrana se dobla sobre si misma dando lugar
a estructuras llamadas mesosomas, los cuales se encuentran en el sitio donde se
lleva acabo la divisin celular.

Las clulas procariontes son las mas pequeas y la mayora no mide mas de una
micra de ancho, presentan un citoplasma de poco volumen. Su citoplasma es
continuo y tiene una regin ocupada por una molcula de ADN que forma un
cromosoma circular

El citoplasma carece de organelos rodeados por membranas, contiene ribosomas y
grnulos de almacenamiento de glucgeno, lpidos o compuestos fosfatados. Cada
ribosoma est formado por dos subunidades que contienen cada una de ellas
aproximadamente un 65% de ARN y un 35% de protenas. Las enzimas necesarias
para las actividades metablicas suelen localizarse en el citoplasma. An cuando
carecen de organelos membranosos, en algunas clulas bacterianas la membrana
plasmtica est plegada de manera intrincada hacia dentro, en dichos pliegues
pueden estar adheridas las enzimas necesarias para realizar la respiracin celular y
la fotosntesis.

Dado su tamao y su simplicidad interna, no requieren de un citoesqueleto complejo,
aunque presentan filamentos proteicos similares a la actina (protena contrctil), que
forman una plataforma que ayuda a dar forma a una pared celular ms resistente.

La mayor parte de las clulas procariontes se desplazan por medio de flagelos
giratorios. Los flagelos constan de tres partes: cuerpo basal, gancho y filamento.

Otras proyecciones superficiales incluyen pili (vellosidades), filamentos de protena
que ayudan a la clula a adherirse a diversas superficies o entre ellas.



26

Clula procarionte.


Clula eucarionte. El trmino eucarionte significa ncleo verdadero. Las clulas
eucariontes se caracterizan por contener organelos membranosos altamente
organizados, el ncleo que contiene el material hereditario es el ms notable.

Los organelos separan fsicamente las reacciones qumicas que se realizan en
diferentes momentos y que pueden ser antagnicas, por ejemplo, reacciones de
sntesis y de degradacin. El nmero y la clase de organelos difieren de un tipo de
clula a otra, por ejemplo los cloroplastos solo se encuentran en clulas que llevan
acabo la fotosntesis.

Por otro lado, todas las clulas eucariontes contienen ncleo, mitocondrias y
ribosomas. Diversos protistas, plantas y clulas de hongos presentan una pared
porosa, protectora que rodea a la membrana plasmtica.


Clula eucarionte.

27
Actividades de aprendizaje.

1. Realiza un cuadro comparativo de diferencias y semejanzas entre clulas
procariontes y eucariontes.
2. Recopila dibujos, fotografas y esquemas de diferentes clulas y establece que
organelos estn presentes en ellas.

Cuestionario de autoevaluacin

1. Es una caracterstica de las clulas procariotas

A) Los organelos son membranosos
B) La informacin gentica esta delimitada por el ncleo
C) El material hereditario cercano a la membrana
D) Ausencia de la membrana plasmtica
E) Solo tiene cpsula plasmtica

2. Es una de las caractersticas propias de la clula eucarionte.

A) Los organelos no son membranosos
B) La informacin gentica esta delimitada por una doble membrana.
C) El material hereditario disperso en el citoplasma
D) Ausencia de la membrana plasmtica
E) Solo tiene cpsula plasmtica

3. Son clulas pequeas, la mayora no mide ms de una micra de ancho,
presentan un citoplasma con poco volumen.
A) Protobiontes
B) Eucariontes
C) Procariontes
D) Hongos
E) Protistas
4. Son clulas que se caracterizan por contener organelos membranosos altamente
organizados, el ncleo que contiene el material hereditario es el ms notable.
A) Protobiontes
B) Eucariontes
C) Procariontes
D) Bacterias
E) Protistas

Respuestas.

1. C
2. B
3. C
4. B

28


Bibliografa

Audersik, T. y G. Audesirk, 2005. Biologa . La Vida en le Tierra. Ed.
Prentice-Hall Hispanoamericana
Alexander, P., et al. 2002. Biologa. Prentice Hall.
Curtis, H. 2008.Biologa. Ed. Panamericana.
Kimball, J. W. 1986. Biologa. Ed. Addison-Wesley Iberoamericana.
Solomon, B.M. 2002. Biologa. Ed. Mc Graw Hill.


29
SEGUNDA UNIDAD.

CMO SE LLEVA ACABO LA REGULACIN, CONSERVACIN Y
REPRODUCCIN DE LOS SISTEMAS VIVOS?

Presentacin. Los sistemas vivos estn constituidos por una o varias clulas. Las
clulas son sistemas dinmicos, lo que significa que estn en constante actividad.
Esta actividad se lleva a cabo de forma coordinada y con gran eficacia, y esto, se
debe al aporte continuo de materia y energa. Gracias a esto se pueden llevar a
cabo procesos vitales como la regulacin, la conservacin y la reproduccin.
En esta unidad se estudiaran de forma separada cada uno de estos procesos con la
finalidad de conocer sus principios bsicos y su importancia, pero es importante
hacer notar que se realizan de manera simultnea en la clula.
Para alcanzar nuestro propsito, en el primer tema se relacionar a la membrana
celular con los procesos de regulacin, en el que intervienen algunos mecanismos
homeostticos. A continuacin se vern aspectos generales de algunos procesos de
conservacin, para lo cual se explicar el concepto e importancia del metabolismo
y se estudiaran las diferentes rutas metablicas, y su importancia para la
conservacin de la vida. As el alumno entender que los sistemas vivos tienen la
capacidad de captar, transformar y utilizar la energa y comprender tambin que
los sistemas vivos se perpetan y mantienen debido a la capacidad de replicar el
ADN, de transcribir esa informacin y traducirla en protenas. Al final de la unidad se
estudiaran los procesos y la importancia de los diferentes tipos de reproduccin
que permiten la perpetuacin de la vida.

PROPSITO: Al finalizar la unidad, el alumno explicar los principios bsicos de los
procesos de regulacin, conservacin y reproduccin, a partir de su estudio como un
conjunto de reacciones y eventos integrados, para que comprenda cmo funcionan
y se perpetan los sistemas vivos.


Tema I. PROCESOS DE REGULACIN

Concepto e importancia de la homeostasis. (Victoria Ortega Rangel)

Aprendizaje: Relaciona los componentes de la membrana celular con algunos
procesos de regulacin.

Claude Bernard, mdico francs, sugiri en 1859 que a pesar de que un animal
viviera en un ambiente externo, las clulas de su cuerpo yacan en un ambiente
interno. El ambiente interno es el lquido intersticial, que baa a las clulas del
cuerpo y de la sangre y que repara a las clulas. Bernard llego a la conclusin de
que el ambiente interno permita a los animales habitar en un ambiente externo que
poda variar de forma considerable. Tiempo despus, Walter Cannon, mdico
estadounidense, utilizo el trmino de homeostasis, afirm que exista una interaccin
constante entre los fenmenos que tendan a cambiar el medio interno y los
procesos celulares que actuaban contra esta posibilidad.
30

Un ejemplo para entender lo anterior sera el siguiente, cuando nos encontramos en
un lugar donde la temperatura del medio es de 39
o
C, nuestra temperatura corporal
sigue siendo constante (36.5
o
C), cabe mencionar que esta vara dependiendo de
nuestra edad. La homeostasis (homois = semejante; stasis= estabilidad) es por lo
tanto el conjunto de procesos fisiolgicos denominados mecanismos homeostticos,
que regulan y mantienen el medio interno estable y ocurre en cualquier nivel de
organizacin.

Un organismo vivo es un sistema termodinmico abierto, esto es, hay un constante
flujo de energa y materia entre l y el ambiente, un flujo en equilibrio dinmico, lo
que suele denominarse estado estable.

Para entender la homeostasis se debe definir que es tensin. Se entiende por
tensin a cualquier condicin externa o interna que afecta los procesos normales de
un sistema. Un ejemplo es el que ocurre en las clulas, cuando estn en presencia
de una sustancia txica en el medio ambiente, si hay un descenso de temperatura, si
se agota el alimento, si se limitan sus reservas, etc. se dice que est en tensin.

Los sistemas de regulacin o control debern mantener a la clula o a cualquier
sistema vivo en un estado de equilibrio, anulando o disminuyendo los efectos de la
tensin. Estos elementos deben ser, como mnimo, un receptor, un modulador y un
efector.

Toda clula viva tiene la capacidad de autorregularse. El control de la sntesis de
enzimas, la formacin del producto, la captacin de materia del medio y la liberacin
de energa, son dispositivos usados por las clulas para enfrentar las fluctuaciones
del mundo que las rodea. Los organismos vivos son homeostticos, de otra manera
no podran sobrevivir. Los organismos necesitan consumir energa para mantenerse
estables, slo manifiestan ligeras variaciones en comparacin con el medio externo;
si estas variaciones se intensifican, entonces se altera el equilibrio interno de la
clula, si los mecanismos homeostticos no logran estabilizarla, entonces el
organismo se enferma y si esto se agudiza puede ocasionar la muerte.

Los sistemas contribuyen a la homeostasis, algunos de ellos son, los sistemas
endocrino, respiratorio, nervioso. Estos centros reguladores suelen ser parte de un
sistema de retroalimentacin, que controlan las condiciones homeostticas de los
organismos unicelulares y pluricelulares. Los cambios que se dan en los
organismos a diferentes niveles, son detectados y corregidos. Los cambios estn
dados por los estmulos y los receptores son los encargados de detectar si se
producen alteraciones en un sitio determinado del organismo, para as activar los
mecanismos de retroalimentacin.

Actividades de aprendizaje.
1. Explica brevemente cmo reacciona nuestro cuerpo cundo sudamos, qu
sistemas estn involucrados y cmo lo hacen.
2. Explica con tus palabras cul es la importancia de la homeostasis.

31
Cuestionario de autoevaluacin.
1.- A la conservacin de las condiciones internas normales en una clula u
organismo mediante mecanismos autorreguladores se le conoce
cmo_________________

A) Enzimas
B) Anabolismo
C) Anabolismo
D) Metabolismo
E) Homeostasis

2.- Son los sistemas que estn directamente relacionados con los procesos de
autorregulacin
A) nervioso, endocrino e inmune
B) muscular, mecnico y sexual
C) sexual, hormonal y sensorial
D) cintico, locomotor y circulatorio
E) gentico, digestivo e intestinal

3.- Mdico estadounidense que introdujo el trmino de homeostasis

A) Hugo de Vries
B) August Weissman
C) Walter Cannon
D) Claude Bernard
E) Thomas Morgan

Respuestas: 1. E, 2. A, 3. C


Bibliografa.

Audersik, T. et. al (2008). Biologa. La vida en la Tierra. Pearson-
Educacin. Mxico: 81-84 pag.
Cooper, G. R. H. (2008). La Clula. Marban. Espaa: 58-63 pag.


Funcin de los componentes de la membrana en el transporte,
comunicacin y reconocimiento celular. (Araceli Sosa castillo)

Aprendizaje. Relaciona los componentes de la membrana celular con algunos
procesos de regulacin

Todas las clulas estn delimitadas por la membrana plasmtica, sta es una
estructura celular que separa el medio interno del medio externo, acta como una
barrera selectiva al paso de las molculas y determina la composicin qumica del
citoplasma. La formacin de membranas biolgicas se basa en las propiedades de
los lpidos, se ha encontrado que todas las membranas celulares comparten una
misma organizacin estructural: bicapa de fosfolpidos con protenas intercaladas y
carbohidratos asociados.
32

En la dcada de los 60, se saba que las membranas citoplasmticas estaban
constituidas por protenas y lpidos, pero no era claro cmo estaban organizadas.
Fue hasta la siguiente dcada que los cientficos Jonathan Singer y Garth Nicolson
se enfrentaron al problema de comprender la estructura de la membrana. A travs
de una serie de experimentos, en los que aplicaron los principios de termodinmica,
lograron establecer el modelo de Mosaico fluido, en el cual se plantea que las
protenas globulares (estructura terciaria) estaban insertadas en una bicapa
fosfolipdica (Fig.1).



Figura 1. Modelo de mosaico fluido, propuesto por J. Singer y G. Nicolson (1972)

El Modelo de Singer y Nicolson, publicado en 1972, ha tenido gran impacto en todos
los aspectos de la Biologa Celular, la propuesta de Mosaico fue apoyada en
diversos experimentos y es fundamental para la comprensin de los aspectos del
comportamiento celular, incluyendo fenmenos tan diversos como el metabolismo
energtico, la accin hormonal, la transmisin de informacin entre clulas nerviosas
en la sinapsis.

Lpidos de membrana: Todas las membranas celulares estn constituidas por
fosfolpidos y proporcionan la organizacin estructural bsica. Los fosfolpidos son
molculas anfipticas (presentan una zona hidrfoba y una hidrfila) (Fig. 3),
constituidas de dos cadenas de cido graso hidrfobos (colas) unidos a un grupo
fosfato hidroflico (cabeza). Debido a que las colas son escasamente solubles en
agua, los fosfolpidos forman bicapas espontneamente en soluciones acuosas, los
grupos polares expuestos en ambos lados estn en contacto con el agua, en tanto
que las colas se orientan al interior de la membrana. Las bicapas fosfolipdicas
forman una barrera estable entre dos compartimentos acuosos y representan la
estructura bsica de todas las membranas biolgicas.

La mayora de las membranas celulares contienen aproximadamente un 50 % de
lpidos, no obstante hay una variacin de acuerdo al tipo de clulas en un
organismo y al tipo de organismos. En bacterias, como Echerichia coli, contienen un
80 % de lpidos, en su totalidad representados por la fosfatidiletanolamina. En
mamferos, la membrana plasmtica, est constituida por cuatro fosfolpidos:
fosfatidilcolina, fosfatidilserina, fosfatidiletanolamina y esfingomielina, en conjunto
constituyen entre el 50 % y 60 % del total de los lpidos de membrana. Adems de
33
lpidos, las clulas animales contienen colesterol y glucolpidos, los cuales
representan el 40 % de los lpidos totales.

Las bicapas lipdicas se comportan como fluidos bidimensionales en los que cada
molcula es libre para rotar y moverse en direcciones laterales (Fig 2).



Figura 2. Movilidad de los fosfolpidos en la membrana


La fluidez es una propiedad de las membranas y est determinada por la
composicin lipdica y la temperatura. Al respecto se tienen que las interacciones
entre cadenas ms cortas de cidos grasos son ms dbiles que la interaccin entre
cadenas ms largas. Con cidos grasos cortos, las membranas son menos rgidas
y se mantienen fluidos a temperatura baja.

Por otra parte los cidos grasos insaturados incrementan la fluidez de la membrana,
la presencia de dobles enlaces genera flexiones en la cadena de los cidos grasos,
impidiendo que las dos colas se mantengan juntas y se muevan con facilidad. A
mayor cantidad de enlaces dobles en las colas, ms fluida ser la membrana (Fig.3).
Figura 3. Fluidez de la membrana




34
El colesterol desempea un papel importante en la fluidez de la membrana, se
inserta en la bicapa con sus grupos hidroxilos (polares), adyacentes a los grupos
fosfatos (cabeza) de los fosfolpidos (Fig 4).

Los anillos hidrocarbonados del colesterol se mantienen rgidos e interactan con las
cadenas de los cidos grasos de los fosfolpidos, en estas regiones la membrana se
mantiene rgida. Por otra parte, el colesterol establece interacciones con las cadenas
de cidos grasos y a temperatura baja se mantiene la fluidez de la membrana. En
general, el colesterol interfiere en la estructura y funcin de la membrana, hace que
la bicapa sea ms resistente y flexible, a temperaturas elevadas es menos fluida y
menos slida a bajas temperaturas.



Figura 4. Colesterol en la membrana celular

La fluidez y flexibilidad de la membrana es muy importante para el funcionamiento
de la clula. En el caso de las clulas que realizan movimiento, como las amibas, lo
pueden hacer gracias a que cambia su forma, si fueran rgidas se romperan y
moriran.

Protenas de membrana. Estas molculas son fundamentales en la composicin de
las membranas celulares, se encuentran entre el 25 % y 75 % de la masa total. Con
base a la naturaleza de asociacin con los fosfolpidos, las protenas que participan
son de dos tipos: integrales, embebidas directamente dentro de la bicapa lipdica y
perifricas, aquellas que se insertan a la membrana abarcando solo una capa
lipdica o manteniendo interacciones con protenas integrales (Fig. 5).
35




Las protenas integrales tambin son conocidas como protenas transmembrana,
con partes expuestas en ambos lados de la membrana. Generalmente las regiones
de estas protenas que coinciden con la bicapa fosfolipdica son -helicoidales,
constituidas de 20 a 25 aminocidos no polares, cuyos radicales interaccionan con
las cadenas de los cidos grasos de los fosfolpidos. La formacin de regiones con
-hlice neutraliza el carcter polar de los enlaces peptdicos. Tambin existen
otras estructuras proteicas que atraviesan la bicapa lipdica, las regiones que
coinciden con la bicapa forman plegamientos de lminas-, el arreglo que presentan
asemeja a un barril, por lo que son llamadas protenas transmembrana con forma
de Barril- (Fig. 6). Este tipo de protena se ha encontrado en membranas de
bacterias, cloroplastos y mitocondrias.













Fig. 5 Modelo de Mosaico
Fluido de membrana.
36





Las protenas transmembrana son molculas anfipticas, con las regiones
hidroflicas expuestas al medio acuoso a ambos lados de la membrana. Algunas de
estas protenas atraviesan la bicapa solo una vez, otras tienen mltiples regiones
que atraviesan la membrana, es el caso de las acuaporinas que presentan seis
regiones -helicoidales, dos de ellas forman un poro, especficamente para la
entrada de agua (Fig.7). Por otra parte, en la mayora de las membranas plasmtica
en eucariontes, las protenas transmembrana son modificadas con la adicin de
carbohidratos.



Figura 7. Acuaporina. Canal de agua en la membrana






Fig. 6 Protena en forma de
Barril-.
37

En general las protenas de membrana son responsables de muchas funciones
especializadas, pueden actuar como:



1. Anclaje. Protenas como las integrinas
establecen contacto con la matriz
extracelular, por el interior se unen con los
microfilamentos del citoesqueleto.




2. Trasporte pasivo. Muchas protenas de
membrana participan en el trasporte selectivo de
molculas a travs de la membrana. Algunas
forman canales que permiten el paso selectivo de
iones y molculas.




3. Transporte activo. Existen protenas que
actan como bombas que se activan con la
energa liberada del ATP. En la bomba de Na
+
y
K
+
la ATPasa incorpora al interior de la clula dos
K
+
y transporta dos Na
+
al exterior.




4. Enzimtica. Hay protenas de membrana que
catalizan reacciones dentro o a lo largo de la
superficie de la membrana. Estas enzimas se
organizan como una secuencia de reacciones en
serie, como en la respiracin en la membrana
interna de la mitocondria y la fotosntesis en la
membrana del tilacoide del cloroplasto.


5. Transduccin de seales. Algunas protenas
de membrana son receptores, reciben informacin
de otras clulas mediante seales qumicas o
elctricas. Las glndulas endocrinas envan
seales qumicas a otras clulas a travs de
hormonas, las protenas de membrana reciben la
informacin y la trasmite al interior de la clula.





38

6. Reconocimiento celular. Existen
glucoprotenas que actan como sitios de
identificacin reconocidos por otras clulas. En
este caso, los antgenos son protenas
superficiales de las membranas celulares de las
bacterias y las clulas humanas las reconocen
como extraas.



7. Uniones intercelulares. Participan protenas
de membrana que forman uniones entre clulas
adyacentes. La interaccin intercelular se realiza
mediante uniones celulares e involucra la
modificacin de la membrana celular en los sitios
de contacto, en animales se reconocen tres tipos:
adhesivas, estrechas y hendidura.

En la uniones adhesivas existen protenas intercelulares que interaccionan con el
citoesqueleto y protenas membranales que se unen a las clulas adyacentes o a la
matriz extracelular; esto ayuda a mantener la integridad del tejido y a evitar el
exceso de tensin mecnica. En los tejidos sujetos a una excesiva tensin como el
msculo y los epitelios son abundantes en este tipo de uniones.

En las uniones estrechas, las protenas se conectan fuertemente con las clulas
vecinas, se establece un estrecho contacto entre las membranas de las clulas,
impidiendo que los fluidos se filtren en el espacio extracelular, lo cual obliga a iones
y molculas diversas a ingresar en la clula solo a travs de las protenas de
transporte.

Las uniones con hendidura estn constituidas por un cilindro formado por seis
unidades de protena, cada uno de estos se encuentra alineado con otro cilindro de
una clula vecina, de esta forma se construye un canal hidroflico muy delgado que
permite el paso de iones y pequeas molculas entre clulas vecinas, sin tener que
pasar por el espacio extracelular. Estas uniones son abundantes en clulas que
requieren de una comunicacin rpida y eficiente, como las del tejido muscular
cardiaco y las nerviosas.

En las plantas, las clulas intercambian iones y molculas a travs de canales que
atraviesan las paredes, estos canales se conocen como plasmodesmos y permiten
la comunicacin intercelular de manera anloga a las uniones de hendidura.

Carbohidratos de membrana. Participan oligosacridos y polisacridos, funcionan
como sitios de identificacin en el reconocimiento celular y en la interaccin entre
clulas de tejidos de los organismos pluricelulares.






39
Actividad de aprendizaje.

Elabora un mapa conceptual con las siguientes palabras:

Mosaico Fluido Lpidos Medio externo e interno
Protenas Barrera selectiva Fosfolpidos
Membrana Celular Colesterol Integrales
Perifricas cidos grasos Grupo fosfato
Carbohidratos Perifricas Bicapa lipdica
Transmembrana -helicoidales Hidrofbicas
Barril- Interaccin de clulas Organismos pluricelulares
Protenas globulares Hidroflicas Anfipticas
J. Singer y G. Nicolson Plegamiento laminar- 20-25 aminocidos
Reconocimiento celular Apolares Oligosacridos

Recomendaciones

-Utiliza esquema que se presenta a continuacin
-Organiza la informacin en forma jerrquica, de lo general a lo particular
-Algunas palabras se pueden repetir
-Emplea conectores
40



!
"
#
"
$
%
&
'
%
(
#
)
*
"
+
$
,
-
.
/
0
/
1
,
1
$
1
2
$
,
3
4
2
5
1
/
6
,
7
2
$
a
u
t
o
r
e
s

m
o
d
e
l
o

e
s

a
i
s
l
a

p
r
o
p
i
e
d
a
d

p
r
o
p
o
n
e
n

c
o
m
p
o
n
e
n
t
e
s

q
u

m
i
c
a
s

f
a
v
o
r
e
c
e

f
o
r
m
a
d
o

p
a
r
t
i
c
i
p
a
n

a
b
a
r
c
a
n

a
b
a
r
c
a
n

s
o
n

e
s

e
s

41
Cuestionario de autoevaluacin.

Escribe en la lnea la respuesta de las siguientes preguntas:
1. Es la organizacin estructural que comparten todas las membranas celulares
___________________________________________________________________
______
2. Escribe el planteamiento del modelo de Mosaico Fluido, propuesto por Singer y
Nicolson en 1972.
___________________________________________________________________
______
3. El modelo de Mosaico Fluido es fundamental para la comprensin de
prcticamente de todos los aspectos del comportamiento celular, escribe dos de
ellos.
___________________________________________________________________
______
___________________________________________________________________
______
4. En la bicapa de fosfolpidos los grupos polares, representados por los fosfatos,
estn en contacto con:
___________________________________________________________________
_____
5. En mamferos, la membrana plasmtica, est constituida por cuatro fosfolpidos,
escribe el nombre de cada uno de ellos:
___________________________________________________________________
______
6. Adems de fosfolpidos, las membranas citoplasmtica contienen otros lpidos,
escribe Cules son y en qu porcentaje se encuentran?
___________________________________________________________________
______
7. A qu se refiere el comportamiento de la bicapa lipdica como fluidos
bidimensionales?
______________________________________________________
8. Si son cortos los cidos grasos de los fosfolpidos, Cmo es la interaccin entre
ellos en la bicapa?
___________________________________________________________________
______
9. La presencia de enlaces dobles en las cadenas de los cidos grasos genera
flexiones, lo cual favorece:
___________________________________________________________________
______
10. Las protenas integrales se caracterizan por:
___________________________________________________________________
______
11. Las protenas perifricas son aquellas que:
___________________________________________________________________
______
12. Hay protenas integrales con partes expuestas en ambos lados de la membrana,
se conocen como:
___________________________________________________________________
42
13. La regin de una protena que coinciden con la bicapa fosfolipdica presenta una
estructura de 20 a 25 aminocidos apolares denominada:
___________________________________________________________________
______
14. Estructura proteica en forma de Barril-, atraviesa la bicapas lipdicas y se forma
por:
___________________________________________________________________
______
15. Escribe las funciones especializadas de las protenas:
a)
___________________________________________________________________
____
b)
___________________________________________________________________
____
c)
___________________________________________________________________
_____
d)
___________________________________________________________________
____
e)
___________________________________________________________________
____
f)
___________________________________________________________________
____

Respuestas.

1. Bicapa de fosfolpidos con protenas asociadas y carbohidratos asociados
2. Plantea que las protenas globulares (estructura terciaria) estaban insertadas en
una bicapa fosfolipdica
3. a) Metabolismo energtico b) Accin hormonal c) Transmisin de informacin
entre clulas nerviosas en la sinapsis.
4. El agua en ambos lados de la membrana.
5. Fosfatidilcolina, fosfatidilserina, fosfatidiletanolamina y esfingomielina,
6. Colesterol y glucolpidos, representan el 40 % de los lpidos totales.
7. Cada molcula es libre para rotar y moverse en direcciones laterales
8. Dbiles
9. La fluidez.
10. Estar embebidas directamente dentro de la bicapa lipdica
11. Se insertan a la membrana abarcando solo una capa lipdica o manteniendo
interacciones con protenas integrales
12. Protenas transmembrana
13. -helicoidales
14. El plegamiento de lminas-
15. a) Anclaje; b) Transporte; c) Enzimtica; d) Transduccin de seales;
e) Reconocimiento celular; f) Uniones intercelulares; f) Uniones intercelulares

43

Respuestas de la Actividad de aprendizaje






M
e
m
b
r
a
n
a

C
e
l
u
l
a
r

M
o
s
a
l
c
o

u
l
d
o

!
.

S
l
n
g
e
r

C
.

n
l
c
o
l
s
o
n

8
l
c
a
p
a

l
l
p
l
d
l
c
a

M
e
d
l
o


l
n
L
e
r
n
o
-
e
x
L
e
r
n
o

8
a
r
r
e
r
a

s
e
l
e
c
u
v
a

L
l
p
l
d
o

l
o
s
f
o
l
l
p
l
o
s

C
o
l
e
s
L
e
r
o
l

c
l
d
o

g
r
a
s
o

C
r
u
p
o

f
o
s
f
a
L
o

A
n

u
c
o

P
l
d
r
o
f

b
l
c
o

P
l
d
r
o
n
l
l
c
o

l
l
u
l
d
e
z

r
o
L
e
l
n
a
s

e
r
l
f
e
r
l
c
a
s

l
n
L
e
g
r
a
l
e
s

1

c
a
p
a

2

c
a
p
a
s

C
a
r
b
o
h
l
d
r
a
L
o
s

C
l
l
g
o
s
a
c

r
l
d
o
s

8
e
c
o
n
o
c
l
m
l
e
n
L
o

c
e
l
u
l
a
r

M
a
p
a

c
o
n
c
e
p
L
u
a
l

A
C
1
l
v
l
u
A
u

u
L

A

8
L
n
u
l
Z
A
!
L

a
u
t
o
r
e
s

p
a
r
t
i
c
i
p
a
n

m
o
d
e
l
o

e
s

a
i
s
l
a

p
r
o
p
i
e
d
a
d

p
r
o
p
o
n
e
n

c
o
m
p
o
n
e
n
t
e
s

q
u

m
i
c
a
s

f
a
v
o
r
e
c
e

f
o
r
m
a
d
o

p
a
r
t
i
c
i
p
a
n

a
b
a
r
c
a
n

a
b
a
r
c
a
n

e
n

s
o
n

e
s

e
s

44
Bibliografa.

Audersik, T. et. al (2008). Biologa. La vida en la Tierra. Pearson-
Educacin. Mxico: 81-84 pag.
Cooper, G. R. H. (2008). La Clula. Marban. Espaa: 58-63 p.p
Acuaporinas: los canales de agua celulares. M. Echevarria en
Investigacin y Ciencia, diciembre 2006.
Solomon, E. et. al. (2008). Biologa. Mc Graw Hill. Mxico: 1234 p.p



Transporte de materiales a travs de la membrana celular: Procesos pasivos
y activos. (Cecilia Garduo Ambriz).

Aprendizaje: Relaciona los componentes de la membrana celular con algunos
procesos de regulacin.

La membrana celular o plasmtica lleva a cabo funciones indispensables para la
clula, la ms evidente es la servir de barrera fsica entre los medios intra y
extracelular. Las diferencias en la composicin de estos medios se deben a que la
membrana presenta una permeabilidad selectiva y mecanismos de trasporte, con y
sin gasto de energa.

La permeabilidad selectiva vara de acuerdo al tipo de clula. La clula requiere
recibir durante todo el tiempo materiales para llevar a cabo sus procesos vitales y
eliminar materiales de desecho antes de que se acumulen en su interior. La
membrana celular es la encargada de controlar el paso de todas estas sustancias.

La membrana permite el paso de azcares simples, O
2
, H
2
O y CO
2
, pero de otras
molculas no, por ser selectivamente permeable. Las protenas de la membrana
intervienen en el movimiento de sustancias ya que entre ellas hay canales y poros
por los que pasan algunas sustancias. De acuerdo al gasto de energa, el paso de
sustancias a travs de la membrana se divide en:


Procesos Pasivos.

Difusin simple. Es el movimiento de molculas o iones de una regin de
mayor concentracin a una de menor concentracin, o sea a favor del
gradiente de concentracin. El CO
2
y el O
2
pasan por este mecanismo (Figura
1). Tambin se conoce como osmosis cuando es la molcula de agua la que
pasa de una regin de mayor concentracin de este lquido a una de menor
concentracin.

Difusin facilitada. Es el movimiento que se da a favor del gradiente de
concentracin, sin gasto de energa. Se da por la unin transitoria de un
metabolito y una protena transportadora de la membrana (Figura 2).

45

Figuras 1 y 2

Procesos Activos.

Transporte activo. Es el movimiento de materiales a travs de la membrana
utilizando o gastando energa (ATP), pues va en contra del gradiente de
concentracin. La energa se utiliza para rotar el complejo formado por el
metabolito y la protena transportadora. Como ejemplo de este transporte
estn las bombas de iones (NA
+
, K
+
, Ca
++
y hasta H
+
). En la Figura 3. se
muestra el movimiento del Na
+
hacia el interior de la clula, a favor del
gradiente de concentracin, y hacia afuera, por transporte activo (en contra
del gradiente); en el caso del K
+
el movimiento hacia el interior es por
transporte activo y al exterior, a favor del gradiente de concentracin.


Figura3.

46
El transportador de membrana es fijo y al unirse al metabolito cambia su
configuracin, lanzando a la molcula del otro lado y a este cambio se le llama
translocacin. Las protenas de membrana tienen un sitio activo y al llegar una
molcula a la protena transportadora, la clula libera cierta energa la cual hace que
pueda cambiar la configuracin de la molcula transportadora y que gire,
introduciendo molculas como glucosa, aminocidos y algunos iones.










La Figura 4 permite comparar los diferentes tipos de movimiento de sustancias a
travs de la membrana celular.




Existe otro tipo de transporte mediado por vesculas formadas por la
membrana celular, al interior se conoce como endocitosis y hacia el exterior
como exocitosis.

La Endocitosis es el proceso mediante el cual la clula introduce materiales
grandes a la clula, que no pueden pasar a travs de la membrana celular. La
Endocitosis inicia cuando se forma una pequea depresin o invaginacin en
la membrana a la cual son atradas las partculas que se van a introducir,
Figura 4. Paso de sustancias a travs de la membrana
47
sta invaginacin se incrementa hasta formar una bolsa citoplasmtica o
vacuola en la que quedan contenidas las partculas atrapadas y as pasan al
interior de la clula (Figura 5).

Figura 5. Endocitosis.
La Endocitosis puede ser de dos tipos:

a. Pinocitosis. A travs de este proceso pasan molculas pequeas o
gotas de lquidos.

b. Fagocitosis. A travs de este proceso se introducen slidos grandes.
Se observa en organismos unicelulares y clulas animales como los
glbulos blancos o las amibas.


La Exocitosis es el proceso contrario; es la salida de molculas grandes o grupos
de molculas de la clula. Las molculas salen a travs de una vescula ms grande
que la de la Pinocitosis; esta vescula se funde con la membrana y se rompe ah,
liberando su contenido al exterior (Figura 7). El aparato de Golgi participa en estos
Figura 6.
48
procesos formando las vesculas que transportan protenas lisosmicas hacia los
lisosomas y vesculas de secrecin.

Figura 7. Exocitosis.

Actividades de aprendizaje.

1.- Investiga el significado de los siguientes trminos y elabora un glosario:
intracelular, extracelular, permeabilidad, smosis, difusin simple, difusin facilitada,
trasporte pasivo, transporte activo, gradiente de concentracin, metabolito, carrier
(protena), translocacin, endocitosis, invaginacin, endosoma, pinocitosis,
fagocitosis, exocitosis, adherencia.

2. Correlaciona el dibujo con los trminos que se listan en seguida:
____ Transporte activo.
____ Osmosis.
____ Transporte pasivo (Difusin facilitada).
____ Difusin simple.

3. Explica el funcionamiento de la bomba Na-K y menciona su importancia en el
buen funcionamiento de los seres vivos.
49
Cuestionario de Autoevaluacin.

1.-Movimiento de molculas o sustancias a travs de la membrana, sin gasto de
energa y con una unin transitoria del metabolito y protena transportadora de
membrana.

A. Osmorregulacin.
B. Difusin.
C. Translocacin.
D. Transporte pasivo.
E. Transporte activo.

2.-Movimiento de giro de las protenas transportadoras para introducir molculas a la
clula

A. Osmorregulacin.
B. Difusin.
C. Translocacin.
D. Transporte pasivo.
E. Transporte activo.

3.- Movimiento de molculas a travs de la membrana, en contra del gradiente de
concentracin y con gasto de energa (ATP)

A. Osmorregulacin.
B. Difusin.
C. Translocacin.
D. Transporte pasivo.
E. Transporte activo.

4.-Movimiento de molculas o iones a favor del gradiente de concentracin

A. Regulacin.
B. Difusin.
C. Translocacin.
D. Transduccin.
E. Transporte activo.

5.-Expulsin de desechos de la clula

A. Pinocitosis.
B. Fagocitosis.
C. Endocitosis.
D. Exocitosis.
E. Endomitosis.




50
6.- Permite la entrada de partculas slidas grandes a la clula y se observa por
ejemplo en los glbulos blancos.

A. Pinocitosis.
B. Fagocitosis.
C. Ciclosis.
D. Exocitosis.
E. Endomitosis.

7.-Permite introducir lquidos a la clula a travs de la formacin de vesculas

A. Pinocitosis.
B. Fagocitosis.
C. Ciclosis.
D. Exocitosis.
E. Endomitosis.

8.- Es el nombre que se da a las protenas transportadoras de membrana

A. Menier
B. Clatrinas
C. Carrier
D .Fusognicas
E .Actinas

Respuestas:


1. D 5. D
2. C 6. B
3. E 7. A
4. B 8. C

Bibliografa.

Alexander P, et al. 1992. Biologa. Prentice -Hall. EUA.
Curtis H, Barnes N. 2000. Biologa. Panamericana.
Gua Examen Extraordinario. Biologa I. 1996. CCH-Sur. UNAM.
Muiz H, et al. 2000. Biologa. McGraw-Hill. EUA.
Velasco S, et al. 2006. Biologa (2
0
Bachillerato). EDITEX. Espaa. 383 pp.






51
Tema II. Procesos de conservacin.

Concepto e importancia del metabolismo: anabolismo y catabolismo
como procesos bioenergticos. (Eduardo F. Flores Rosas.)

Aprendizaje: comprende que los sistemas vivos se mantienen gracias a su
capacidad de transformar energa.

La compleja organizacin que caracteriza a las clulas se mantiene gracias al aporte
constante de materia y energa proveniente del exterior. Una vez en el interior
celular, los compuestos sern transformados en molculas tiles, a travs de una
serie de reacciones qumicas, que en su conjunto reciben el nombre de
metabolismo.

El conjunto de transformaciones metablicas permite principalmente:

1. Proporcionar los materiales necesarios para que clulas, tejidos y rganos
renueven constantemente sus propias molculas y cumplan todas sus
funciones.
2. Obtener diferentes formas de energa para mantener las funciones de los
sistemas vivos.

Los sistemas vivos realizan una gran variedad de actividades y todas ellas requieren
de energa. El metabolismo celular debe asegurar que la energa fluya
constantemente entre el estado de energa potencial (energa almacenada en los
compuestos orgnicos, energa qumica que se encuentra en los enlaces
moleculares) y el estado de energa cintica (energa del movimiento, energa
mecnica). De tal manera que la energa puede ser almacenada o liberada y
utilizada para desintegrar, sintetizar, reordenar o acumular sustancias, para realizar
trabajo mecnico o electroqumico.

La mayora de las reacciones no ocurre de manera aleatoria, sino que se encuentran
conectadas en rutas o vas metablicas, en las que el producto de una reaccin es el
sustrato para la siguiente y cada una es regulada (catalizada) por una enzima
especfica para cada tipo de transformacin y sustrato.

La generalidad de los procesos metablicos consiste en reacciones de xido-
reduccin (transferencia de electrones). La prdida de un electrn se denomina
oxidacin y la ganancia reduccin, estos procesos son simultneos, ya que para que
ocurra la reduccin debe existir una molcula que libere un electrn.

Una gran cantidad de la energa necesaria (aproximadamente el 90%) para asegurar
el conjunto de reacciones qumicas que constituyen el metabolismo, es
proporcionada por el ATP. El adenosin trifosfato (ATP) es un nucletido formado por
una ribosa, una adenina y tres grupos fosfato. Este nucletido tiene entre sus
tomos enlaces covalentes y la forma en que cede energa es liberando un grupo
fosfato, la transferencia de un grupo fosfato se llama fosforilacin. La hidrlisis del
fosfato terminal del ATP (cede un grupo fosfato) libera energa que sirve para
impulsar las diversas actividades celulares, por ejemplo: contraccin de los
msculos, movimiento de molculas en contra de un gradiente de concentracin
52
(transporte activo), formacin de pptidos (sntesis de protenas), sntesis de cidos
nucleicos, funciones de secrecin y excrecin celular, y prcticamente todas las
reacciones de la clula.

Las clulas emplean permanentemente el ATP, ya sea utilizndolo en reacciones
qumicas endergnicas que consumen energa o recuperndolo en reacciones
exergnicas que liberan energa. Lo anterior, significa que las reacciones
endergnicas se realizan gracias a la energa liberada por las reacciones
exergnicas. La mayor parte del ATP que necesitan los sistemas biolgicos proviene
de la respiracin celular y de la fotosntesis.

El metabolismo tiene dos partes complementarias: anabolismo y catabolismo.
Anabolismo.- proceso mediante el cual se almacena energa al formar (sintetizar,
construir) molculas orgnicas complejas a partir de molculas sencillas: fotosntesis
(H
2
O y CO
2
en molculas orgnicas), sntesis de protenas (unin de aminocidos).
Catabolismo.- proceso mediante el cual se libera energa al degradar molculas
orgnicas complejas en otras ms sencillas: respiracin celular y fermentacin,
protenas en aminocidos, polisacridos en monosacridos.

Actividades de aprendizaje.

1. Investiga en qu consisten los procesos de oxido-reduccin, fosforilacin e
hidrlisis.
2. Investiga en qu consiste el complejo enzima-sustrato.
3. En los siguientes esquemas coloca en las lneas el concepto que corresponda:
anabolismo, catabolismo, (molculas) sencillas, (molcula) compleja, enzima,
sustrato, complejo enzima-sustrato, (biocatlisis de) sntesis, (biocatlisis de)
degradacin, fotosntesis, respiracin celular.

a) Biocatlisis de ______________ o _______________. Ejemplo:
______________

La ___________ se acerca
al __________ (S y S) que
son molculas __________

Se forma el
________________
La _________ se retira de la
nueva molcula __________
y queda lista para actuar de
nuevo.


53
b) Biocatlisis de ______________ o _______________. Ejemplo:
______________


La ____________ se acerca
a una molcula __________
que es el _________ (S y S)

Se forma el
________________
Se separa la molcula
________, formando nuevas
molculas ___________, la
________ se retira y queda
lista para actuar de nuevo.


Cuestionario de autoevaluacin.

1. La compleja funcionalidad celular se mantiene por medio de un conjunto de
reacciones qumicas de sntesis y degradacin conocidas como:

a) Catabolismo.
b) Homeostasis.
c) Metabolismo.
d) Anabolismo.
e) Transformacin.

2. Las rutas metablicas funcionan gracias a que las reacciones qumicas son
catalizadas por:

a) cidos grasos.
b) Carbohidratos.
c) Enzimas.
d) cidos nuclicos.
e) Lpidos.

3. La fotosntesis y la sntesis de protenas son procesos:

a) Catablicos.
b) Homeostticos.
c) De transporte
d) Anablicos.
e) De degradacin

54
4. Son procesos que liberan energa al transformar molculas complejas en
sencillas.

a) Catablicos.
b) Homeostasis.
c).Transporte
d) Anablicos.
e) Sntesis

5. Es la zona de la enzima, responsable de la especificidad.

a) El nucletido.
b) El aminocido.
c) La apoenzima.
d) El sitio activo.
e) La coenzima.

Respuestas
1. C
2. C
3. D
4. A
5. D


Bibliografa.

Audersik, et al. 2001. La vida en la Tierra. 6
a
ed. Prentice Hall. Mxico
Campbell, N. Et al. 2001. Biologa. 3
a
ed. Prentice Hall. Mxico
Curtis, H y Barnes, R. 2004. Biologa. 6
a
ed. Medica-Panamericana. Espaa.
Solomon, E. Et al. 2001. Biologa. 5
a
ed. McGraw Hill-Interamericana. Mxico



Fotosntesis: Aspectos generales de la fase luminosa, la fase obscura, e
importancia. (Esperanza Gmez Ramrez)

Aprendizaje: El alumno explica los aspectos generales de la fotosntesis.
La Fotosntesis es un proceso en la cual los organismos con clorofila, como las
plantas, las algas y algunas bacterias, capturan energa en forma de luz y la
transforman en energa qumica.
Prcticamente toda la energa que consume la vida de la biosfera terrestre la zona
del planeta en la cual hay vida procede de la fotosntesis. La fotosntesis se realiza
en dos etapas: una serie de reacciones que dependen de la luz y otra serie que son
independientes de la luz o de la fijacin del carbono u obscuras. Cada conjunto de
reacciones tiene lugar en una regin distinta del cloroplasto: la luminosa en los
tilacoides y la obscura en el estroma.
55
Durante la fotosntesis, la clula utiliza energa luminosa capturada por la clorofila
para impulsar la sntesis de carbohidratos. Las reacciones globales de la
fotosntesis pueden resumirse en el siguiente esquema:
Luz
6 CO2 +12 H2O C6 H12 O6 +6 O2 +6 H2O
Clorofila

Reacciones dependientes de la luz o fase luminosa.
La fase luminosa de la fotosntesis es una etapa en la que se producen reacciones
qumicas con la ayuda de la luz solar y la clorofila. La clorofila es un compuesto
orgnico, formado por tomos de carbono, de hidrgeno, oxgeno, nitrgeno y un
tomo de magnesio en la zona central de la molcula

Molcula de clorofila.
56

La clorofila y otros pigmentos se ubican en los cloroplastos, dentro de la membrana
tilacoidal, en unidades llamadas fotosistemas. Cada unidad tiene numerosas
molculas de pigmentos que se utilizan como antenas para atrapar la luz. Cuando la
energa lumnosa es absorbida por uno de los pigmentos, se desprenden electrones
que rebotan en el fotosistema hasta llegar al centro de reaccin, la clorofila a.
Existen dos fotosistemas, el fotosistema I que reacciona primero ante la presencia
de luz y el fotosistema II.

La energa luminosa es convertida en energa qumica en las reacciones
fotodependientes y comienza cuando la clorofila captura energa lumnica, la cual
hace que uno de sus electrones se desplace a un estado energtico superior. El
electrn energizado (exitado), se transfiere una molcula aceptora y es sustituido
por un electrn del agua. Cuando esto ocurre, el agua se disocia y se libera oxgeno
molecular. Parte de la energa de los electrones exitados se utiliza para formar ATP
y se reduce la coenzima NADP+ (nicotinamida adenina dinucletido fosfato) a
NADPH + H+.
A medida que los electrones se transfieren a lo largo de la cadena de transporte que
conecta a ambos fotosistemas, pierden energa. Parte de la energa liberada es
utilizada para bombear protones a travs de la membrana tilacoidal, desde el
estroma hacia el espacio interior del tilacoide, lo que produce un gradiente de
protones. La energa de ste gradiente se aprovecha para producir ATP por
quimismosis.
57

Curtis 2008
El ATP y el NADPH + H+ son los productos de la fase luminosa de la fotosntesis, los
cuales son liberados al estroma donde son utilizados en la fase obscura.


Reacciones independientes de la luz o fase obscura o ciclo de Calvin.
El ciclo de Calvin ocurre en el estroma o matriz del cloroplasto. All se encuentran las
enzimas necesarias que catalizarn la conversin de dixido de carbono (CO2) en
glucosa utilizando los protones aportados por la coenzima NADPH ms la energa
del ATP. El dixido de carbono ingresa a travs de los estomas y llega hasta la
molcula aceptora del ciclo, una pentosa llamada ribulosa di fosfato, combinndose
con esta mediante la enzima ribulosa bifosfato carboxilasa oxigenasa o rubisco. El
primer producto estable de la fijacin de CO2 es el cido-3-fosfoglicrico ( PGA), un
compuesto de 3 carbonos. La energa del ATP es utilizada para fosforilar el PGA y
formar cido 1,3 difosfoglicrico, el cual es reducido luego mediante la accin del
NADPH+H+ a gliceraldehido-3-fosfato (PGAL). Una parte del gliceraldehido-3-fosfato
es utilizada en el ciclo para sintetizar glucosa, mientras que el resto se utiliza para
regenerar la ribulosa, que da comienzo a un nuevo ciclo.
58

Curtis 2008
Una gran parte del PGAL se transforma en almidn (carbohidrato de reserva) en el
estroma del cloroplasto. Otra parte del PGAL es exportado al citosol, donde se
transforma en intermediario de la gluclisis. Tambin se obtienen intermediarios de
azcares de gran importancia biolgica, como la sacarosa. Este disacrico es la
principal forma en que los azucares se transportan a travs del floema, desde las
hojas hasta los sitios de la planta donde son requeridos.
Importancia de la fotosntesis.
Los sistemas vivos son productores o dependen de las actividades de ellos. Los
productores son auttrofos y los segundos son hetertrofos. Los auttrofos son
organismos que pueden elaborar molculas orgnicas a partir de materias primas
inorgnicas. La mayora de los productores son fotoauttrofos, organismos con la
capacidad de absorber la energa luminosa y convertirla en energa qumica
almacenada en molculas orgnicas, por el proceso de la fotosntesis.
Los hetertrofos, que son consumidores y descomponedores, no pueden producir
sus propios compuestos orgnicos y, por ello, deben obtenerlos de otros
organismos. Los consumidores viven alimentndose de productores o de otros
hetertrofos que han ingerido productores y los descomponedores viven degradando
materia orgnica resultada de organismos que han muerto.
La fotosntesis no solo sostiene a las plantas y a los otros fotoauttrofos, sino
tambin a la mayora de los hetertrofos que se encuentran en la bisfera. Cada ao
los organismos fotosintticos convierten el dixido de carbono en miles de millones
de toneladas de materia orgnica y la energa almacenada en ellas es el
combustible de las reacciones metablicas que sostiene casi la totalidad de la vida
en el planeta.



59
Actividades de aprendizaje.
1. Investiga cuales son las caractersticas de los fotosistemas I y II.
2. Establece cuales son las longitudes de onda de la luz (colores), que son mejores
para que la fotosntesis se lleva a cabo y porque?
3. Realiza el esquema de la fase luminosa de la fotosntesis estableciendo la
fotofosforilacin cclica y la acclica.
4. Investiga como es el mecanismo de absorcin del CO2 y que clulas lo llevan a
cabo en las plantas.


Cuestionario de autoevaluacin.
1. Las plantas verdes convierten la energa radiante en energa qumica
aprovechndola para la fijacin del:
A) O
2
atmosfrico
B) Carbono
C)ATP
D) NADPH+
E) ADP

2. La mayor parte de la vida de nuestro planeta depende en ltima instancia del
fenmeno de
A) La respiracin
B) La fotosntesis
C) La degradacin
D) La sntesis
E) La digestin

3. En qu parte del cloroplasto se localiza la clorofila

A) Membrana del tilacoide
B) Matriz mitocondrial
C) Membrana externa
D) Espacio intertilacoidal
E) Estroma

4. La fase independiente de la luz se lleva a cabo en:

A) La membrana del tilacoide
B) La matriz mitocondrial
C) La membrana externa
D) El espacio intertilacoidal
E) En el estroma





60
5. El CO2, el NADPH+ H+ y el ATP, son utilizados en las reacciones de:

A) La fotofosforilacin cclica
B) La fotofosforilacin acclica
C) El ciclo de Calvin
D) La quimismosis
E) Ela fijacin del carbono


Respuestas.
1. B 2. B
3. A 4. D
5. C
Bibliografa.
Audersik, et al. 2001. La vida en la Tierra. 6
a
ed. Prentice Hall. Mxico
Campbell, N. Et al. 2001. Biologa. 3
a
ed. Prentice Hall. Mxico
Curtis, H y Barnes, R. 2004. Biologa. 6
a
ed. Medica-Panamericana. Espaa.
Solomon, E. Et al. 2001. Biologa. 5
a
ed. McGraw Hill-Interamericana. Mxico



61
Respiracin: Aspectos generales de la gluclisis, ciclo de krebs, cadena
de transporte de electrones e importancia. (Victoria Ortega Rangel)

Aprendizaje: Explica los aspectos generales de la respiracin aerobia.

Los nutrimentos que consumimos en la alimentacin son absorbidos en el intestino,
a continuacin pasan al torrente sanguneo hasta llegar a todas las clulas. Cada
clula convierte la energa de los enlaces qumicos de los nutrientes, en energa
metablica contenida en la molcula de adenosintrifosfato (ATP), por un proceso
denominado RESPIRACIN CELULAR.

Los organismos llevan a cabo procesos enzimticos intracelulares para transformar
la energa almacenada en los carbohidratos, cidos grasos y protenas, en dixido
de carbono, agua y energa metablica (ATP).

La respiracin celular se puede definir como el conjunto de reacciones por medio de
las cuales la mayora de las clulas obtienen la energa necesaria para llevar a cabo
sus funciones vitales.

Hay dos tipos de procesos respiratorios: el aerobio y anaerobio

Respiracin Aerobia
Va metablica que requiere oxgeno para obtener energa a partir de los
carbohidratos, entre otras biomolculas, y se presenta en clulas eucariotas.
La frmula general es:
C
6
H
12
O
6
+ 6O
2
+6H
2
O 6CO
2
+ 12H
2
O + energa (36 38 ATP)

La energa que se libera de la glucosa es de 686 kcal/mol, en otras palabras, la
molcula de glucosa se degrada totalmente, por lo que sus productos finales no
tienen energa.

Para la obtencin de la energa tienen que ocurrir una serie de reacciones qumicas.
Se lleva a cabo en cuatro pasos: 1) Gluclisis (paso previo en la respiracin aerobia
y en la fermentacin), 2) Formacin del acetilCoA, 3) Ciclo de Krebs o del cido
ctrico y 4) Cadena respiratoria o cadena de transporte de electrones y quimismosis

1. Gluclisis:

La gluclisis ocurre en ausencia de oxgeno y puede proporcionar toda la energa
metablica necesaria para que los organismos anaerobios puedan realizar sus
funciones. En las clulas aerobias, es la primera etapa de la degradacin de la
glucosa.

Las reacciones de la gluclisis dan lugar a la degradacin de la glucosa a piruvato,
con una ganancia neta de 2 molculas de ATP. Las reacciones iniciales de la va
62
consumen energa, usando el ATP para fosforilar la glucosa a glucosa-6-fosfato y
luego la fructuosa-6-fosfato a fructuosa-1, 6-difosfato.

Las reacciones que siguen a la formacin de fructuosa-1, 6-difosfato constituyen la
parte productora de energa. La degradacin de la fructuosa-1, 6-difosfato produce
dos molculas del azcar de tres carbonos gliceraldehdo-3-fosfato, que se oxida a
1,3-difosfato, aqu el fosfato de este compuesto se utiliza en la siguiente reaccin y
promueve la sntesis de ATP a partir de ADP. El producto de esta reaccin, 3-
fosfoglicerato, se convierte entonces en fosfoenolpiruvato, el segundo intermediario
de la alta energa del fosfoenolpiruvato, su conversin a piruvato est acoplada a la
sntesis de ATP. Cada molcula de gliceraldehdo-3-fosfato convertida a piruvato se
acopla de este modo a la generacin de dos molculas de ATP a partir de cada
molcula inicial de glucosa. Puesto que se requieren dos ATP para promover las
reacciones inciales, la ganancia neta de la gluclisis o gliclisis es de dos molculas
de ATP.

Adems de producir ATP, la gliclisis convierte dos molculas de coenzima NAD
+
a
NADH. En esta reaccin, el NAD
+
acta como agente oxidante que acepta
electrones del gliceraldehdo-3-fosfato. El NADH formado debe de ser reciclado
sirviendo como donante de electrones para otras reacciones redox. En condiciones
aerobias el NADH sirve como fuente adicional de energa al donar sus electrones a
la cadena de transporte de electrones, donde se utilizara para reducir al O
2
a H
2
O,
acoplado a la generacin de ATP adicional.

Analiza cuidadosamente el siguiente esquema, en donde se representa en forma
resumida el proceso de la gluclisis.
















63
Gluclisis


Paso
Glucosa
ATP
Hexocinasa 1
ADP
Glucosa 6 fosfato

Fosfoglucosa isomerasa 2

Fructosa 6 fosfato
Fase I ATP
Fosfofructosa cinasa 3
ADP
Fructosa 1, 6 difosfato

Aldolasa 4

Gliceraldehido 3 fosfato (2 molculas)
2NAD
2Pi 5
2NADH
1.3 fosfoglicerato (2 mol.)
2ADP
Fosfogliceril cinasa 6
2ATP
3 fosfoglicerato (2 mol.)

Fosofoglicero mutasa 7

2 fosfoglicerato (2 mol.)
Fase II
Enolasa 8

Fosfoenol piruvato (2 mol.)
2ADP
Pirvico cinasa 9

2ATP
Piruvato (2 mol.)



Figura tomada de: http://academia.cch.unam.mx/biologia3y4

2. Formacin del acetilCoA

El piruvato entonces se transporta a la mitocondria, donde su oxidacin completa a
CO
2
y H
2
O proporciona la mayora del ATP. En el siguiente paso en el metabolismo
del piruvato es su descarboxilacin oxidativa en presencia de la coenzima A (CoA),
64
que funciona como transportador de grupos acetilo en diversas reacciones
metablicas.

Un carbono del piruvato se libera como CO
2
y los dos carbonos restantes se unen a
la CoA para formar acetil-CoA. En este proceso, una molcula de NAD
+
se reduce a
NADH.


http://tsbbenitobios.blogspot.com/2009/10/metabolismo-de-la-glucosa_05.html

El acetil-CoA formado en esta reaccin entra a la matriz mitocondrial en donde se
realizar el ciclo de Krebs o el ciclo del cido ctrico, va central en el metabolismo.

3. Ciclo de Krebs

El grupo acetilo (2C) se combina con el oxalacetato (4C) para producir citrato (6C). A
travs de otras ocho reacciones, dos carbonos del citrato se oxidan completamente
a CO
2
y se regenera el oxalacetato. Durante el ciclo, se forma un enlace de alta
energa en forma de GTP, que se emplea para la sntesis de 1 molcula de ATP.
Adems, cada vuelta del ciclo produce 3 molculas de NADH y 1 molcula de flavin
adenn dinucletido (FADH
2
), que es otro transportador de electrones en reacciones
redox. En este ciclo se obtienen 4 molculas de ATP directamente de cada molcula
de glucosa, dos de la gluclisis y 2 del ciclo del cido ctrico (1 molcula por cada
molcula de piruvato). Adems 10 molculas de NADH (2 de la gluclisis, 2 de la
conversin de piruvato a acetil-CoA, y 6 del ciclo del cido ctrico) y se forman 2
molculas de FADH
2
. El resto de la energa derivada de la degradacin de la
glucosa proviene de la reoxidacin del NADH y FADH
2
, con sus electrones siendo
transferidos a lo largo de la cadena de transporte de electrones a reducir el O
2
al
H
2
O. Analiza cuidadosamente el siguiente esquema.
65


4. Cadena de transporte de electrones y quimismosis (fosforilacin oxidativa)

Durante la fosforilacin oxidativa, los electrones del NADH y FADH
2
se combinan
con O
2
y la energa liberada es utilizada para la sntesis de ATP a partir de ADP. La
transferencia de electrones de NADH a O
2
libera una gran cantidad de energa, de
modo que esta energa pueda convertirse en una forma utilizable, el proceso es
gradual a travs del paso de electrones por una serie de transportadores, que
constituyen la cadena de transporte de electrones.

Los electrones extrados de la gluclisis y del ciclo de Krebs en etapas previas se
transfieren al NADH y FADH
2
y luego una cadena de compuestos aceptores de
electrones. A medida que pasan de un aceptor a otro, parte de la energa se emplea
para bombear hidrogeniones (protones) a travs de la membrana mitocondrial
interna, con lo que se forma un gradiente de protones. En un proceso denominado
quimismosis, la energa de este gradiente se usa para producir ATP.

La transferencia de electrones del NADH al O
2
produce suficiente energa y es
utilizada para la sntesis de aproximadamente tres molculas de ATP. En este
proceso se generan 32 molculas de ATP.

66


http://recursos.cnice.mec.es/biosfera/alumno/2bachillerato/Fisiologia_celular/contenidos5.htm



Actividades de aprendizaje.

1.Esquematiza al organelo encargado de este proceso, sealando los lugares en
donde se lleva cada uno de los procesos de la respiracin aerobia y cuntos ATP se
forman en cada una.
2. Elabora un mapa conceptual de la informacin antes mencionada.
3. Investiga lo siguiente:
Qu se entiende por sntesis en biologa?
Qu significa descarboxilar, deshidrogenizacin y fosforilacin oxidativa?
Qu son las reacciones redox? Explica brevemente.
Cul es la funcin de las coenzimas NAD, FAD, complejos I, II, III y IV, que
intervienen en el transporte de electrones?
Cul es la funcin especfica del oxgeno en la mayor parte de las clulas?
Qu organismos llevan a cabo la respiracin aerobia?
Cul es la importancia de la respiracin aerobia?
Por qu se dice que la respiracin aerobia es la degradacin total de la glucosa?









67
Cuestionario de autoevaluacin.

1. El proceso de desdoblamiento de molculas grandes a molculas ms pequeas
es un aspecto del metabolismo llamado:

A) anabolismo
B) fermentacin
C) catabolismo
D) fosforilacin oxidativa
E) quimismosis

2. Es un proceso qumico en el cual una sustancia acepta electrones.

A) Oxidacin
B) Fosforilacin oxidativa
C) Desaminacin
D) Reduccin
E) Deshidrogenacin

3. La va por la cual la glucosa se degrada a piruvato se denomina.

A) Respiracin aerbia
B) Ciclo del cido ctrico
C) Oxidacin del piruvato
D) Gluclisis
E) Citolisis

4. Antes de que el piruvato entre en el ciclo de Krebs, se descarboxila, produce CO
2
y se combina con CoA, y los electrones se ceden a:

A) NAD
B) FAD
C) ATP
D) ADP
E) C
6
H
12
O
6


5. En el primer paso del ciclo del cido ctrico, la acetilCoA reacciona con el
oxaloacetato y se forma:

A) piruvato
B) citrato
C) NADH
D) ATP
E) CO
2







68
6. El transporte de electrones y la sntesis de ATP estn acoplados con un gradiente
de protones a travs de la membrana mitocondrial interna en el proceso de:

A) quimismosis
B) desaminacin
C) respiracin anaerbia
D) aminacin
E) gluclisis

7. Las reacciones del ciclo de Krebs se llevan a cabo en:

A) el citoplasma celular
B) la matriz mitocondrial
C) las crestas mitocondriales
D) la membrana externa
E) los tilacoides


Respuestas.

1. C 2. D
3. D 4. A
5. B 6. A
7. B

Bibliografa.

Cooper, G. M., Hausman, R. E. La clula. 4ta. Edicin. MARBN LIBROS,
S.L. Espaa. 2008.
Solomon, E. P., et al. BIOLOGA. Quinta edicin. McGraw Hill Interamericana.
Mxico, 2001.
Valdivia, B. et al. BIOLOGA. La vida y sus procesos. Segunda reimpresin.
PUBLICACIONES CULTURAL. Mxico. 2003.



Respiracin anaerobia

La respiracin anaerobia es la reaccin metablica en la que no se necesita oxgeno
como aceptor final de electrones, se utilizan sustancias inorgnicas como son el
nitrato (NO
3
), o sulfato (SO
2
4
). Entre los organismos que podemos encontrar estn
algunos tipos de bacterias que viven en suelos inundados, aguas estancadas o los
intestinos de animales. Los productos finales son el dixido de carbono, una o ms
sustancias inorgnicas reducidas, y ATP. Las bacterias que participan en el ciclo del
nitrgeno son un ejemplo de este tipo de metabolismo.
Otras bacterias especficas, as como algunos hongos, utilizan de manera ordinaria
la fermentacin, una va anaerobia en la que no participa una cadena de transporte
de electrones y a continuacin se explicara.


69

COMPARACIN ENTRE LA RESPIRACIN AEROBIA y ANAEROBIA




Fermentacin: Aspectos generales e importancia (Hctor Rivera)

Aprendizaje: Explica los aspectos generales de la fermentacin

Las primeras clulas, por vivir en un ambiente carente de oxgeno molecular,
tuvieron que obtener su energa por la va anaerbica (sin oxgeno) y esta sigue
siendo la forma ms comn de respiracin para los microorganismos. Las clulas
aerobias, por ser descendientes de clulas anaerbias, utilizan al igual que ellas la
gluclisis (primer paso de la fermentacin) antes de continuar con la respiracin
aerobia.

La obtencin de energa de las clulas se basa en el rompimiento mediante
oxidaciones, de las molculas de alta energa obtenidas de los alimentos (aunque es
necesario aclarar que dichas oxidaciones se realizan con molculas diferentes al
oxgeno). Aqu nos referiremos a la principal fuente de energa para los sistemas
vivos, la glucosa, aunque tambin pueden obtener energa de lpidos y protenas.

Respiracin anaerbia. El termino anaerobio viene del griego an=sin aero=aire,
aqu se refiere al aire como oxgeno. La definicin de respiracin anaerbia es: Ruta
metablica mediante la cual la glucosa es completamente oxidada, usando un
sistema transportador de electrones, lo que implica un aceptor terminal de electrones
diferente al oxgeno.

Fermentacin. La fermentacin es un proceso que se realiza en ausencia de
oxgeno, que al igual que la respiracin aerobia (en presencia de O
2
), es una manera
que tienen ciertas especies de obtener la energa necesaria para realizar sus
funciones vitales.

La fermentacin es una reminiscencia de pocas en las que nuestro planeta tena
una atmsfera reductiva (no oxidante como la actual), y las primeras clulas
obtenan su energa gracias a un metabolismo adaptado a tales condiciones. Desde
el punto de vista metablico, la fermentacin es semejante a la gliclisis anaerobia,
70
con algunas reacciones adicionales al final, que llevan al piruvato a generar otros
productos como el alcohol, el cido lctico, el cido actico o el cido butrico.

La fermentacin alcohlica. Hongos microscpicos unicelulares llamados
levaduras de la especie Saccharomyces cerevisiae, son capaces de transformar a la
glucosa en etanol, obteniendo como ganancia energtica dos molculas de ATP. La
reaccin general es la siguiente:
2 ADP+2Pi 2ATP
C
6
H
12
0
6
2CH
3
-CH
2
-OH + 2CO
2

En 1897, Eduard Buchner descubri que la enzima zimasa, es la responsable de
realizar la fermentacin alcohlica, hecho que le hizo merecedor del Premio Nobel. A
travs de la fermentacin alcohlica es posible generar bebidas con un contenido de
etanol de 12% (aunque se pueden obtener de hasta 20%), pudiendo fermentarse
tanto sustancias dulces como glucosa o sacarosa, como sustancias amilceas
obtenidas de distintos granos. El siguiente cuadro presenta algunos fermentados:


Reactivos Dulces Productos
Uva Vino
Agave Pulque
Manzana Sidra

Reactivos Amilceos Productos
Arroz Sake
Cebada Cerveza

En 1150 Arnau de Vilanova invent el proceso de destilacin, lo que permiti la
posibilidad de generar bebidas con un mayor porcentaje de alcohol. Algunos
destilados son:

Uva Brandy o Coac
Agave Tequila o Mezcal
Cebada Whisky

La fermentacin lctica. Algunas bacterias como diversas especies de
Lactobacillus son responsables de fermentar la lactosa (azcar de la leche) hasta
cido lctico, aunque tambin algunos hongos, protozoos y tejidos musculares
pueden realizarla. Como la lactosa es un disacrido, primero tiene que se rota en
sus componentes (monosacridos) que son la glucosa y galactosa para despus
entrar a la fermentacin. La reaccin general es la siguiente:

2 ADP+2Pi 2ATP
C
6
H
12
0
6
2CH
3
-CHOH-COOH

A travs de la fermentacin lctica pueden obtenerse diversos alimentos como el
yogurt y el kfir.

En casos de trabajo excesivo, el msculo esqueltico es capaz de formar cido
lctico cuando la oxigenacin no es la adecuada, generando la fatiga muscular.
71
Nuestro cuerpo es capaz de regenerar este cido hasta glucosa por un proceso
inverso a la gliclisis anaerobia, llamado gluconeognesis.

La fermentacin actica. Algunas bacterias del gnero Acetobacter, en presencia
de oxgeno, son capaces de degradar el etanol hasta cido actico. La reaccin
general es la siguiente:

2 ADP+2Pi 2ATP
2CH
3
-CH
2
-OH+ O
2
2 CH
3
-COOH + H
2
O

Mediante este proceso, se produce vinagre o tepache. La fermentacin actica fue
un proceso que afect tremendamente la economa de los vitivinicultores en el
pasado, pues con frecuencia el vino se agriaba (la palabra vinagre proviene del latn
vinum acre o vino cido). El emperador Napolen III y los propios vitivinicultores
ofrecieron una recompensa a quien desarrollara un mtodo para evitar esto; tal
recompensa fue ganada por Louis Pasteur, quien desarroll la tcnica denominada
pasteurizacin en su honor, la cual originalmente consiste en elevar la temperatura
del vino hasta 44 C por un corto perodo de tiempo.

Actividades de aprendizaje.

1. Realiza un glosario de trminos del tema
2. Investiga:
a) Por qu se utiliza levadura en la elaboracin de pan.
b) La diferencia entre un fermentado y un destilado.
c) Por qu en la fermentacin alcohlica no se pueden obtener concentraciones
elevadas de alcohol.
d) Por qu el pan no emborracha, si las levaduras que se utilizan en su
elaboracin producen alcohol.
e) Qu es la pasteurizacin.
f) Por qu el vinagre ayuda a conservar los alimentos.


Cuestionario de autoevaluacin.

1. Las primeras clulas, por vivir en ambiente reductor obtenan energa.

A) Aerbicamente
B) Anaerbicamente
C) Utilizando el oxgeno
D) Utilizando el piruvato
E) Mediante la fosforilacin

2. Es la principal fuente de energa para los seres vivos.

A) ADP
B) Lactato
C) Piruvato
D) Glucosa
E) Oxgeno
72
3. Para la fermentacin alcohlica se requiere de:

A) glucosa y levaduras
B) etanol y lactobacilos
C) protenas y levaduras
D) glucosa y lactobacilos
E) cido lctico y levaduras


4. La produccin de alcohol sin microorganismos, se puede realizar en presencia
de la enzima

A) Zimasa
B) Lactasa
C) Catalasa
D) Proteasa
E) Fosforilasa

5. En la fermentacin lctica se produce

A) lactosa
B) lactobacilos
C) cido lctico
D) lactosa y CO
2
E) cido lctico y CO
2


6. El vinagre es producto de la fermentacin

A) lctica
B) actica
C) butrica
D) alcohlica
E) propinica

Respuestas.

1. A
2. D
3. A
4. A
5. C
6. B



Bibliografa.
Audersik, et al. 2001. La vida en la Tierra. 6
a
ed. Prentice Hall. Mxico
Curtis, H y Barnes, R. 2004. Biologa. 6
a
ed. Medica-Panamericana. Espaa.
Solomon, E. Et al. 2001. Biologa. 5
a
ed. McGraw Hill-Interamericana. Mxico


73
Replicacin del ADN: Aspectos generales e importancia.
(Maricela Ramos Reyes)

Aprendizaje esperado: El alumno explica los aspectos generales de la replicacin
de ADN.

Con base en los resultados obtenidos por R. Franklin y R. H. Wilkins utilizando la
difraccin de rayos X por fibras de ADN orientadas, en 1953 la estructura fsica del
ADN fue establecida por J. D. Watson y F. H. C. Crick quienes propusieron que el
ADN es una molcula larga constituida por una doble hlice. La informacin gentica
almacenada en esta molcula puede ser fielmente replicada y transmitida a lo largo
de generaciones.

En los procariontes, organismos carentes de ncleo, el material gentico se
encuentra en el citoplasma, mientras que en los organismos eucariontes, los
caracteres hereditarios estn vinculados a los genes situados en los cromosomas.
Estos a su vez estn localizados en el ncleo celular. La membrana nuclear posee
poros que permiten la transferencia de la informacin gentica del interior del ncleo,
hacia el exterior, el citoplasma, donde esta informacin es utilizada.

El proceso de replicacin del ADN que permite a dos clulas hijas llevar la misma
informacin gentica que la clula madre es un mecanismo enzimtico muy
complejo en el que intervienen un nmero considerable se componentes proteicos.

La apertura de la doble hlice (denominada horquilla o burbuja de replicacin),
necesaria para que la secuencia de bases pueda ser leda y copiada, se lleva cabo
por una serie de protenas que preceden a la ADN polimerasa (Fig.1).



Figura 1. Direccin de movimiento de la horquilla o burbuja de replicacin.

74

La enzima helicasa rompe los puentes de hidrogeno que unen a los pares de bases,
separa las dos hebras de la hlice mientras que, la ADN polimerasa une los
nucletidos de una nueva cadena a lo largo de cada hebra respetando la regla de
emparejamiento de bases. Frente a adenina (A) se introduce una timina (T) en la
nueva cadena que se est produciendo; A es incorporada enfrente de T; citosina (C)
frente a guanina (g); y a su vez G frente a C. De este modo se obtienen dos dobles
hlices hijas idnticas a la doble hlice parental (Fig. 2).

Figura 2. Apareamiento de bases nitrogenadas en la molcula de ADN.

Para que se pueda efectuar el desenrollamiento de la doble hlice es necesario
evitar o suprimir las tensiones que aparecen en el punto de separacin de las dos
cadenas. Este mecanismo es realizado por una serie de enzimas de las cuales
forma parte la girasa. Esta enzima es una topoisomerasa que corta las dos hebras
de la doble hlice, mantiene los dos extremos prximos y finalmente une los
extremos para restablecer la integridad de la doble hlice. Es as que la tensin
generada por el avance de la horquilla de replicacin, es decir por el
desenrollamiento de la doble hlice durante la replicacin es compensada de
antemano por la girasa.

El sistema enzimtico encargado de la replicacin del ADN debe afrontar otro
problema ligado al hecho de que las dos hebras que forman la doble hlice no tienen
la misma orientacin, debido a que la desoxirribosa no es simtrica, y los enlaces
que la unen a los dos fosfatos vecinos no son idnticos. El ltimo nucletido de una
cadena lleva un grupo hidroxilo libre en la posicin 3 donde se produce el
crecimiento de la cadena. El otro extremo de la cadena se designa 5 (nmero del
tomo de carbono de la molcula de azcar que se une al grupo fosfato que
participa en la formacin de un nucletido). Las dos cadenas son antiparalelas. La
ADN polimerasa no es capaz de polimerizar ms que en un solo sentido: une el
fosfato 5 de un nucletido a un grupo hidroxilo (OH) libre en posicin3 de la
desoxirribosa, es decir, funciona en la direccin 53. A medida que la doble hlice
se abre y la replicacin progresa, la ADN polimerasa slo puede copiar de forma
75
continua una de las dos cadenas, aquella cuya orientacin es 35. La operacin
debe realizarse en sentido opuesto al de la progresin de la horquilla de replicacin
en la otra cadena. La sntesis de la cadena complementaria de la cadena orientada
en el sentido 53 se realiza de forma discontinua. Los fragmentos de ADN
obtenidos se denominan fragmentos de Okasaki. Su longitud puede ser de varios
miles de nucletidos en los procariontes, mientras que los eucariontes son ms
cortos (100-200 nucletidos). La ligasa es la enzima que se encarga de unir estos
fragmentos.

La ADN polimerasa no es capaz de iniciar por si sola la sntesis de una nueva
cadena, precisa de un cebador, consistente en un pequeo fragmento de cido
ribonucleico (ARN), el cual es sintetizado por otra enzima, la primasa (Fig. 3).

Figura 3. Enzimas involucradas en el proceso de replicacin del ADN.

Una de las diferencias entre el ADN y la molcula del ARN es que el azcar de
desoxiribosa es sustituida por la ribosa; las bases; adenina, guanina y citosina son
idnticas en ambas molculas; pero la timina del ADN es remplazada por el uracilo
(U) que difiera de la timina por carecer del grupo metilo (Fig. 4). El cebador de ARN
es eliminado por una ribonucleasa.
76

Figura 4. Diferencias entre el ADN y el ARN.

El resultado final de este proceso, es la formacin de dos molculas hijas de ADN de
doble hlice, cada una de las cuales contiene una de las cadenas originales del ADN
progenitor. A este modelo se le conoce como modelo semiconservativo de la
duplicacin del ADN, debido a que la nueva molcula de ADN conserva una de las
hebras de la molcula original (Fig. 5).


Figura 5. Modelo semiconservativo de la replicacin del ADN




77
Actividades de Aprendizaje.

1. Construye un modelo del ADN.
2. Investiga las diferencias del ADN con respecto al ARN.

Cuestionario de autoevaluacin.

1. El modelo de doble hlice del ADN fue propuesto por:

A) R. Franklin y R. H. Wilkins
B) O. T. Avery, C. M. McLeod y M. McCarty
C) J.D. Watson y F. H. C. Crick
D) R. Franklin y M. McCarty
E) C.M. McLeod y F.H.C. Crick

2. La enzima que se encarga de separar la doble hlice del ADN es:

A) Histonas
B) RNA Polimeras
C) Helicasa
D) Proteasa
E) ATPasa

3.Cuantas molculas hijas se originan cada vez que se replica la molcula de ADN:

A) 2
B) 4
C) 6
D) 8
E) 10

4. El proceso de replicacin del ADN es considerado modelo semiconservativo
debido a qu:

A) Cada una de las molculas hijas presentan cadenas nuevas.
B) Las molculas hijas conservan las cadenas originales.
C) Cada una de las molculas hijas conserva una cadena original y una cadena
nueva.
D) Una molcula hija tiene las dos cadenas originales y la otra las dos nuevas.
E) Una molcula hija conserva una cadena original y una nueva la otra molcula hija
conserva las originales.

5. Cuantos nucletidos diferentes tiene la estructura del ADN:

A) 2
B) 4
C) 6
D) 8
E) 10

78
II .Relaciona las dos columnas, anotando en el parntesis la letra que corresponde.

1.- Enzima encargada de romper los puentes a) helicasa
de hidrogeno que unen las bases nitrogenadas: ( ) b) guanina
2. Son bases puricas: ( ) c) girasa
3. Tipo de enlace que permite la unin entre los d) ribosa
elementos que conforman un nucletido: ( ) e) Puente de
hidrogeno
4. El conjunto fosfato- azcar-base se denomina ( ) f) covalente
5. Azcar con un grupo hidroxilo (OH) es: ( ) g) ADN polimerasa
6. Enzima que pega los nucletidos h) timina y citosina
complementarios a la cadena original ( ) i) desoxirribosa
7. Son bases primidicas: ( ) j) nucleotido
8. La base timina es complementaria a la base: ( ) k) adenina
9. Azcar con presencia de dos grupo hidroxilo l) citosina
(OH) es: ( ) m) timina
10. La base guanina es complementaria a la base: ( ) n) adenina y guanina
11. Tipo de enlace que permite el apareamiento
de las bases: ( )
12. En la molcula de ARN el uracilo sustituye
a la base: ( )
13. Enzima encargada del desenrollamiento y evitar
las tensiones de la doble hlice ( )

Respuestas.
I.
1. C
2. C
3. A
4. C
5. B

II.
1. A
2. N
3. F
4. J
5. I
6. G
7. H
8. K
9. D
10. L
11. E
12. M
13. C


Bibliografa.

Claude, H. 1977. Las estructuras del ADN. Mundo Cientfico. 4:742-759.
Incera, F. et al., 2008.Biologa I. Programa actualizado. CCH- Sur. UNAM.
http://www.geosfera.es/monograficos/DNA/Adn/14-11.jpg




79
Sntesis de protenas: Aspectos generales e importancia (Silvia Toro
Badillo)
Aprendizajes: El alumno comprende que los sistemas vivos se perpetan y
mantienen debido a que el ADN tiene la capacidad de replicar su informacin y
transcribirla para que se traduzca en protenas.

El cdigo Morse es una forma de comunicacin que usa secuencias de puntos y
rayas para representar las letras del alfabeto, de esta forma se puede producir un
nmero infinito de mensajes. De igual manera los organismos tenemos nuestro
propio cdigo gentico donde la secuencia de nucletidos del cido
desoxirribonucleico (ADN) representa la informacin.

El trmino genoma describe el total de la informacin gentica que se encuentra en
un organismo y en cada una de sus clulas. En el caso de organismos eucariontes
comprende el ADN del ncleo y mitocondrias; y si son organismos fotosintticos
tambin en el cloroplasto. El orden en que se enlazan los nucletidos que conforman
las hebras del ADN constituye la informacin gentica. Por ejemplo al hacer una
lectura, vemos el orden de cada una de las letras que conforman las palabras, si
cambiamos las letras cambian las palabras, de igual manera, una secuencia de ADN
como GAATTC no ser la misma que TATAGC, aunque ambas sean del mismo
tamao y utilicen las mismas letras.

Existen tres tipos de ARN: el mensajero (ARNm), el de transferencia (ARNt) y el
ribosomal (ARNr). El ARN es un cido nucleico que difiere del ADN en tres
aspectos: 1) se compone de una cadena sencilla de nucletidos en lugar de una
doble cadena, 2) el azcar que lo compone es la ribosa y no una desoxirribosa y 3)
en lugar de la base nitrogenada timina (T) tiene uracilo (U).

Cuando se descubri la estructura del ADN, se logr descifrar y comprender el
cdigo gentico. Se saba que las protenas estn formadas por 20 aminocidos,
pero el ADN slo presenta cuatro tipos de nucletidos, por lo tanto una base no
poda representar un aminocido. Una secuencia de dos bases producira
nicamente 16 aminocidos y no 20, finalmente se demostr que con la secuencia
de tres bases se obtienen 64 combinaciones. Tres bases nitrogenadas se llaman
triplete o codn y representa un aminocido. Se dice que el cdigo gentico es
universal porque es el mismo en todos los organismos lo cual demuestra que
compartimos un ancestro comn. Ver figura 1
80

Figura 1. Cdigo gentico. Est organizado en tripletes o codones: cada aminocido est
determinado por tres nucletidos. Es degenerado porque un mismo aminocido puede estar
determinado por ms de un triplete o codn por ejemplo la prolina y la alanina.

En las clulas eucariontes la transcripcin es el proceso por el cual la informacin
gentica localizada en el ADN nuclear se traslada a travs del ARNm a los
organelos encargados de la sntesis de protenas llamados ribosomas, los cuales se
localizan en el citoplasma. Para iniciar la transcripcin se requiere: 1) Un sitio de
unin para la enzima ARN polimerasa, la cual forma el ARNm a partir de una cadena
molde de ADN. 2) Un capuchn o casquete que impide la destruccin del ARNm,
3) Un triplete ATG que en el ARNm corresponde al codn de inicio AUG. Para
terminar el proceso se requiere alguno de los tres codones de trmino y la
secuencia AATAAA, a la cual se le agregar una cola de poli A que tiene la misma
funcin que el capuchn inicial. Las enzimas generan una hebra de ARNm idntica a
una de las hebras de ADN llamada hebra molde, la cual tiene una direccin 3' - 5'.
Ver figuras 2 y 3.

En el 2001 el Proyecto Genoma Humano public que slo pequeas partes del
genoma, los llamados exones, se transcriben en ARN mensajero (ARNm), el resto
est formado por intrones que son secuencias de ADN altamente repetitivas que no
tienen informacin para codificar protenas y por lo tanto deben ser eliminadas. Ver
figura 3.







81


Figura 2. La enzima ADN
polimerasa genera una hebra de
ARNm idntica a una de las hebras
de ADN llamada hebra molde, la
cual tiene una direccin 3 - 5.
Figura 3. Transcripcin. En esta imagen se
muestra el casquete que impide la
destruccin del ARNm y la cola de poli-A
para terminar el proceso. Antes de que el
ARNm salga del ncleo se eliminan los
intrones y se unen los exones. Este proceso
es conocido como empalme o "splicing"
(del ingls corte y empalme).

En el proceso de traduccin la informacin contenida en el ARNm se traduce en
una secuencia de aminocidos que conforman las protenas. El ARNt lleva los
diferentes 20 aminocidos que se encuentran disueltos en el citoplasma hacia los
ribosomas. La traduccin del cdigo gentico depende de la unin adecuada de
cada tres nucletidos llamados codones del ARNm, con los nucletidos
complementarios de ARNt llamados anticodones. El resultado es la formacin de
una gran variedad de protenas, con un nmero y secuencia de aminocidos
determinados por el orden de los nucletidos del ADN. Ver figura 4


82


Figura 4. Proceso de traduccin. El proceso consta de tres pasos: iniciacin, elongacin y
terminacin. Inicio. Se forma un complejo integrado por las subunidades grande y pequea
del ribosoma, que se unen en el sitio del codn de inicio del ARNm y por el anticodn ARNt.
El ARNt lleva el aminocido metionina. Elongacin. El ribosoma se va deslizando hacia el
extremo 3' del ARNm, se van reconociendo los anticodones del ARNt, y se une los
aminocidos correspondientes. Terminacin, al llegar al codn de terminacin, ciertas
protenas denominadas factores de terminacin se unen a este codn provocando la
liberacin del pptido.

En los procariontes la transcripcin y la traduccin ocurren simultneamente, de tal
manera que conforme se va sintetizando el ARNm los ribosomas se adhieren a l
para efectuar la sntesis de protenas. Ver figura 5


Figura 5. La transcripcin y la traduccin en las clulas procariotas, estn acopladas, es
decir que la traduccin empieza mientras el ARNm est siendo sintetizado. Cada gen
codifica para una protena, sin embargo no todas las clulas de un organismo multicelular
expresan todos los genes que tiene, es decir, una neurona no expresa el gen que codifica
para la queratina, que es la protena mayoritaria del pelo. Adems, los genes no se
expresan todo el tiempo, sino que lo hacen durante cierta etapa del desarrollo, por ejemplo
el feto humano expresa una hemoglobina (protena transportadora de oxgeno en la sangre)
distinta de la que expresa cuando ya ha nacido.

83
Actividades de aprendizaje.

1. Elabora un glosario con los siguientes conceptos: gen, genoma, cdigo gentico,
codn, anticodn, enzima ARN polimerasa y cdigo gentico
2. Explica la funcin de los tres tipos de ARN
3. Explica de manera breve en que consiste la transcripcin y la traduccin
4. Cules son las diferencias del proceso de transcripcin y traduccin en clulas
procariontes y eucariontes?
5. De acuerdo a la siguiente secuencia de nucletidos de la cadena molde del ADN,
realiza la secuencia del ARNm, del ARNt y pega el aminocido correspondiente.
3' TAC AAC AAC GGG TTC CTT CCG ACT 5'

Cuestionario de autoevaluacin.

1. Las diferencias que presentan los nucletidos de ARN con respecto al ADN son:

a) Cadena sencilla, ribosa, uracilo
b) Cadena sencilla, desoxirribosa, timina
c) Doble cadena, desoxirribosa, timina
d) Doble cadena, ribosa, uracilo
e) Cadena sencilla, desoxirribosa, uracilo

2. En las clulas eucariontes de vegetales la informacin gentica se localiza en los
siguientes organelos:
a) Ncleo, mitocondria y lisosomas
b) Ncleo, mitocondria y cloroplasto
c) Vacuolas, mitocondrias y cloroplasto
d) Retculo endoplasmico liso, mitocondrias, cloroplasto
e) Ncleo, aparato de Golgi y lisosomas

3. En una clula eucarionte el proceso de transcripcin y traduccin se realiza en:
a) Vacuolas y ribosomas
b) Lisosomas y ribosomas
c) Ncleo y ribosomas
d) Ncleo y aparato de Golgi
e) Vacuolas y aparato de Golgi


4. Identifica y escribe los diferentes procesos de la siguiente figura.

84


Respuestas de la pregunta 4.

1. Transcripcin del ARNm por la enzima ARN polimeraza
2. Cadena del ARNm con intrones y exones (negro intrones, azul exones)
3. Un capuchn o casquete que impide la destruccin del ARNm
4. Eliminacin de secuencias de ADN altamente repetitivas que no tienen
informacin para codificar protenas y por lo tanto deben ser eliminadas
5. Proceso de transcripcin

Bibliografa

Biggs A, Kapicka, C y Lundgren, L. (2000). Biologa. La dinmica de la vida.
Editorial McGrawHill
Jimnez, L. F. (Coordinador). (2006). Conocimientos Fundamentales de
Biologa. Coleccin conocimientos fundamentales. Editorial Pearson
Educacin.
Curtis, H y Barnes, R. 2004. Biologa. 6
a
ed. Medica-Panamericana. Espaa.



Tema III. Procesos de reproduccin


Fases del ciclo celular. (Irma Coria lvarez)


Aprendizaje. Describe el ciclo celular con una visin global en la que se destaquen
los hechos bsicos que tienen lugar a lo largo del mismo, en especial, los procesos
de divisin celular por mitosis y meiosis.

85
Ciclo celular

El ciclo celular eucaritico consta de dos fases: la interfase y la divisin celular
mittica. En la interfase la clula toma sustancias nutritivas de su medio ambiente,
crece, duplica sus cromosomas y en la divisin celular mittica, es repartida una
copia de cada cromosoma y regularmente alrededor de la mitad del citoplasma, a
cada clula hija. Casi todas las clulas eucariticas pasan la mayor parte de su
tiempo en interfase, preparndose para la divisin celular.

La interfase tiene tres subfases: la G1 es la primera fase de intervalo de crecimiento,
S es la segunda y aqu se lleva a cabo la sntesis de ADN, G2 es la tercera, en
donde tambin hay crecimiento.

La G1 es una fase importante en la vida celular ya que aqu la clula es sensible a
las diversas seales internas y externas que ayudarn a que la clula se divida o no
(en el momento preciso), una vez que la clula inicia el proceso de divisin celular se
realiza todo el ciclo celular. Algunas clulas como por ejemplo las del msculo
cardiaco, del cerebro y ojos parecen haber quedado en la G0 permanentemente, si
stas clulas se daan no se pueden reponer.

Actividades de aprendizaje
Repasa y analiza la figura 1, observe los tiempos para cada fase, mencione 3
funciones que se realicen durante la interfase.


Figura 1


Mitosis: Fases e importancia

La divisin celular mittica comprende dos partes principales: la mitosis (divisin
nuclear) y la citocinesis (divisin citoplasmtica). La mitosis produce dos ncleos,
86
cada uno con una copia de todos los cromosomas que estaban presentes en el
ncleo de la clula progenitora (idntica informacin gentica). Durante la mitosis,
los cromosomas duplicados se condensan y son visibles en forma de estructuras
parecidas a hilos. En las clulas que se dividen por mitosis se formar dos clulas
hijas, cada una con un ncleo y aproximadamente la mitad del citoplasma. Este
proceso se llama citocinesis (movimiento celular en griego). La citocinesis
proporciona a las dos clulas hijas todos los organelos, nutrimentos, enzimas y
dems molculas que necesitan para continuar vivas. Aunque por lo regular la
mitosis y la citocinesis estn acopladas, pueden llevarse a cabo de forma
independiente. Ciertas clulas, entre ellas algunas clulas tumorales, experimentan
mitosis sin citocinesis. Este proceso produce clulas individuales con muchos
ncleos.

Fases de la mitosis

1. Profase, 2. Metafase, 3. Anafase, 4. Telofase. Estas fases no son realmente
acontecimientos independientes, sino que forman un continuo en el que cada fase
se funde con la siguiente.


87

Figura 2
EVENTOS QUE SUCEDEN EN LAS FASES DE MITOSIS


PROFASE
Condensacin del material nuclear hasta
que los cromosomas son visibles,
duplicacin del centrolo.

METAFASE
La membrana nuclear desaparece, los
cromosomas se alinean a lo largo del
ecuador de la clula, se observa el huso
acromtico completo.

ANAFASE
El centrmero se divide y las cromtidas
hermanas se separan dirigindose a los
polos opuestos del huso (ahora son
cromosomas hijos)

TELOFASE
La membrana nuclear comienza a
formarse alrededor de los cromosomas
hijos, los cromosomas se van observando
cada vez menos, el ncleo regresa a la
interfase


Actividades de aprendizaje.
1. Haz tus propios esquemas tratando de recordar los movimientos y posiciones de
los cromosomas durante las fases de la mitosis.
2. Investiga por que es importante el proceso mitosis y explica por que?


88
Meiosis: Fases e importancia en la reproduccin y variabilidad biolgica.
Meiosis es una de las formas de divicin celular. Este proceso se realiza en las
gnadas, para producir gametos. Es un proceso de divisin celular en el cual una
clula diploide (2n) experimenta dos divisiones sucesivas, con la capacidad de
generar cuatro clulas haploides (n). Este proceso se lleva a cabo en dos divisiones
nucleares y citoplasmticas, llamadas primera y segunda divisin meitica o
simplemente meiosis I y meiosis II. Ambas comprenden profase, metafase,
anafase, telofase y citocinesis.
La clave de la reproduccin sexual de los organismos eucariontes es la meiosis, que
es la produccin de ncleos haploides con cromosomas apareados. La palabra
meiosis proviene de una palabra griega que significa disminuir; en concordancia
con este significado, la meiosis reduce el nmero de cromosomas a la mitad. Por
ejemplo cada clula diploide de nuestro organismo contiene 23 pares de
cromosomas; la divisin celular meitica produce gametos (espermatozoides u
vulos) con 23 cromosomas.

La meiosis consta de dos divisiones durante las cuales los cromosomas se replican
una sola vez, se pueden reconocer las etapas: profase, metafase, anafase y
telofase, igual que en la mitosis, pero durante la profase los cromosomas
homlogos, se atraen y se agrupan en parejas formando cromosomas bivalentes, al
final de la profase puede haber intercambio de material gentico (entrecruzamiento)
entre las cromtidas de cromosomas homlogos. Despus de la anafase hay una
segunda divisin que consta de la profase II, metafase II, anafase II y telofase II, la
segunda divisin termina con la formacin de cuatro ncleos haploides que se
convierten en gametos. Observar cuidadosamente los eventos de la Meiosis I en la
figura 3.

Figura 3.
89

EVENTOS QUE SUCEDEN EN LA MEIOSIS I


PROFASE I
Leptteno aparicin de los cromosomas
como estructuras filiformes, los cromosomas
homlogos se duplican, cada cromosoma
homlogo es un par de cromtidas hermanas
Cigteno los cromosomas homlogos sea
aparean por sinapsis, en mitosis no existe
este apareamiento.
Paquteno el apareamiento es completado,
los cromosomas se observan mas gruesos,
los cromosomas homlogos apareados o
bivalentes estn estrechamente entrelazados
Diplteno los bivalentes se abren
longitudinalmente y sus cromtidas son
visibles, la separacin es incompleta y existen
puntos de unin llamados quiasmas, los
cuales pueden variar en nmero es aqu en
hay intercambio de segmentos esto es
conocido como entrecruzamiento
Diacinesis acortamiento de los cromosomas
(enrollamiento e manera apretada)

METAFASE I
Comienza cuando la doble membrana nuclear
desaparece y se forma el huso, cada
bivalente tiene dos centrmeros
independientes acomodados arriba y abajo
del ecuador, los cromosomas homlogos se
alinean en el ecuador en forma independiente

ANAFASE I
Los centrmeros no divididos y las
cromtidas no hermanas de cada bivalente se
separan y desplazan a los polos opuestos de
la clula, las cromtidas hermanas se
mantienen unidas por sus centrmeros

TELOFASE I
E INTERFASE
Se forma nuevamente la doble membrana
nuclear (en algunas especies, esto no
sucede y los cromosomas pasan
directamente a la segunda divisin meitica)













90

EVENTOS QUE SUCEDEN EN LA MEIOSIS II


PROFASE II


METAFASE II
Es igual que en la mitosis, los
cromosomas se dividen solo una vez

ANAFASE II
Es igual que en la mitosis, los
centrmeros se dividen por primera
vez, resultando cuatro clulas o una
ttrada, cada una de stas contiene la
mitad del nmero cromosmico de la
clula en la cual comenz
originalmente la meiosis, se lleva a
cabo la separacin final de los
cromosomas que se comenzaron a
dividir en la etapa anterior
TELOFASE Es igual que en la mitosis




Observe la figura 4 detenidamente y reflexione sobre los diferentes eventos
realizados durante la meiosis II.

Figura 4






91
Actividad de aprendizaje.

1. Observe la figura 3, ponga atencin en las diferentes etapas en que se lleva a
cabo la profase I, a travs de esquemas describa que sucede en cada etapa y
concluya por que sta, es de suma importancia en el proceso meitico.
2. Reflexione especficamente en la etapa de diplteno de la meiosis I, trate de
hacer un esquema, sealando donde se lleva a cabo la sinapsis y cual es su
importancia.
3. Que es disyuncin, en que etapa se realiza, que importancia tiene que se realice.
4. Observe la figura 4 y haga una comparacin con las etapas de mitosis, existe una
diferencia significativa, explique.
5. Es importante reflexionar que la mayor parte de las clulas eucariticas se
reproducen a intervalos regulares para formar nuevas clulas hijas con materiales
nucleares distribuidos en los cromosomas , estos procesos forman parte de una
larga secuencia de eventos conocida como ciclo celular: repeticin alternante de
periodos de crecimiento y reproduccin celular. Las funciones no reproductivas
(interfase) incluyen: crecimiento, incremento de nmero de organelos y produccin
de sustancias para uso intracelular o para secrecin.
6. Investigue y describa eventos sobresalientes de la Interfase.

Cuestionario de autoevaluacin.

1.- En qu etapa de la mitosis se organizan los cromosomas en el plano ecuatorial
de la clula?
2.-Cuntos cromosomas tiene una clula diploide en su ncleo.
3.- Cuando se lleva a cabo la sntesis de ADN
4.- Cual de los enunciados siguientes es el correcto?
A) Todas las mutaciones son dainas.
B) Tanto la mitosis como la meiosis contribuyen a la diversidad gentica
C) El entrecruzamiento ayuda a cada gameto a recibir un conjunto diferente
de alelos en la meiosis.
5- Cuando se aparean los cromosomas homlogos?

Respuestas

1.- Metafase 2.- Dos juegos de cromosomas 3.- Fase S 4.- ( c )
5.- En la Profase I de la meiosis.

Bibliografa
Audersik, Teresa, et al. La vida en la tierra, 6 edicin, Prentice Hall, Mxico,
2003.
Levine, Robert P. Gentica, 2 edicin, Editorial Continental, Mxico, 2003.
Google/Imgenes/Esquemas mitosis
Google/Imgenes/Esquemas meiosis




92
Aspectos generales de reproduccin sexual y sexual. Importancia biolgica.
(Araceli Sosa Castillo)

Aprendizaje. Describe los aspectos generales de la reproduccin sexual y asexual

La reproduccin es un proceso biolgico mediante el cual se forman descendientes
a partir de los progenitores, a nivel de organismos se distinguen dos tipos: Asexual y
Sexual.

En la reproduccin Asexual se forman descendientes de un solo progenitor, ste se
divide, germina o se fragmenta y genera dos o ms descendientes con informacin
gentica similar a los progenitores. Los tipos de reproduccin Asexual ms comn
son: Fisin binaria, Gemacin, Esporulacin y Fragmentacin, a continuacin se
describe cada uno de ellos.






Gemacin: El progenitor emite un brote o protuberancia constituida de citoplasma,
comnmente llamada yema, posteriormente se duplica el material gentico y por
mitosis se reparte equitativamente el material gentico, a diferencia del citoplasma,
que se reparte en forma desigual, la protuberancia o yema recibe menor cantidad,
por lo que la citocinesis no es equitativa (Fig. 2). La yema inicia su fase de
crecimiento y puede separarse de su progenitor e iniciar una vida independiente o
bien permanecer junto a l y ser un miembro ms o menos independiente de la
Replicacin
de
DNA

Segregacin
de
Cromosomas

Citocinesis

Fig. 1 Fisin binaria

Fisin binaria: Es una divisin celular,
en algunos organismos eucarintes como
protozoarios y microalgas, se realiza por
mitosis. En procariontes (bacterias), el
material gentico (DNA) se replica,
posteriormente el citoplama se divide en
dos partes, ms o menos iguales
(cotocinesis equitativa), cada una hereda
una molcula de DNA e inicia su fase de
crecimiento en forma independiente (Fig.
1).
En algunas bacterias, de diferentes
cepas pero de la misma especie,
realizan la conjugacin antes de la fisin
binaria. Se realiza cuando dos
organismos se unen y forman una
coneccin entre sus superfiecies, que es
como un puente por el que se
intercambia el material gentico.
Despus de la conjugacin las clulas se
separan y se reproducen por fisin
binaria en forma independiente, los
descendientes heredan genes de ambos
progenitores.

Progenitor
93
colonia. Esisten organismos, tanto unicelulares como pluricelulares, con
reproduccin por gemacin, como las hidras y levaduras.



Fig. 2 Reproduccin por gemacin

Esporulacin: Implica la formacin de esporas, que son clulas especiales provistas de
cubiertas resistentes que permiten sobrevivir en condiciones desfavorables del medio, como
el calor o el fro. La clula progenitora divide su DNA numerosas veces, ms tarde, cada
molcula es rodeada por membrana y pared celular, finalmente son liberadas al medio
(Fig.3). Algunos animales y plantas se reproducen por medio de esporas, incluyendo
organismos parsitos que durante la fase de crecimiento de su ciclo vital viven a expensas
del husped, en su fase reproductora forman esporas, entre ellos se encuentra el
protozoario Plasmodium, que causa la enfermedad del paludismo.


Fig.3 Reproduccin por esporas

Fragmentacin. En este tipo de reproduccin se considera la capacidad de
regenerar una parte del cuerpo del organismo. El progenitor se divide en varias
piezas, cada una regenera las partes faltantes y forma un individuo completo (Fig.4).
Organismos que se reproducen por fragmentacin son los gusanos planos, las
estrellas de mar pueden regenerar el animal completo con un solo brazo, las
salamandras, lagartijas y cangrejos pueden crecerles una nueva cola o pata si
pierden el original.
94


Fig. 4 Reproduccin por fragmentacin

En plantas la fragmentacin se le conoce como propagacin vegetativa, un nuevo
organismo se desarrolla a partir de un trozo de tallo areo como en los geranios,
subterraneo como el pasto o tubrculos como la papa.

Reproduccin sexual

Los seres vivos realizan esta forma de reproduccin en la que el material gentico
de dos organismos progenitores se combina en la descendencia, cada uno
contribuye con una clula especializada, los gametos o clulas sexuales, que se
originan por meiosis. Para formar un nuevo individuo, los gametos haploides
fusionan sus ncleos y se forma una clula diploide, el zigoto o clula huevo, a este
proceso se le conoce como fecundacin.

Formacin de gametos: En organismos unicelulares, los gametos se forman a
partir de la clula progenitora mediante el proceso de meiosis y diferenciacin. En
organismos pluricelulares, los gametos se forman en estructuras especializadas, en
plantas los rganos reciben el nombre de gametangios, si producen gametos
masculinos se llaman anteridios y los gametos anterozoides; si producen gametos
femeninos el rgano se llama arquegonio y los gametos oosferas.

En animales, los rganos reproductores son las gnadas, si producen gametos
masculinos, el rgano se llama testculo y los gametos espermatozoides; si los
gametos son femeninos el rgano se llama ovario y los gametos vulos. Los
gametos (haploides) se originan de clulas germinales (diploides), el proceso que
realizan es la meiosis y se conoce como gametognesis. Si la produccin es de
espermatozoides, el proceso recibe el nombre de espermatognesis, si son vulos
se llama ovognesis.

95
Espermatognesis. En el testculo, los espermatozoides se producen en los tbulos
seminferos, se encuentran enrollados y ocupan casi todos el volumen de la
gnada. En la pared interna del tbulo seminfero se localizan las espermatogonias,
son clulas diploides que darn origen a los espermatozoides. Antes de iniciar el
proceso de meiosis, las espermatogonias se dividen por mitosis para garantizar un
abasto constante de espermatozoides.

La espermatognesis inica con el crecimiento y diferenciacin de la espermatogonia
para formar espermatocitos primarios, se caracterizan por su gran tamao y por ser
diploides, posteriormente realizan el proceso de meiosis, al finalizar la primera
divisin se originan dos espermatocitos secundarios haploides, cada uno de ellos
realiza la segunda divisin de meiosis y se generan cuatro espermtidas. stas
experimentan una serie de transformaciones para generar a los espermatozoides
(Fig. 5).


Fig. 5 Gametognesis

Las espermatogonias, los espermatocitos y las espermtidas estn rodeadas de
pliegues constituidos por clulas de Sertoli, las cuales regulan el proceso de
espermatogensis y nutren a los espermatozoides. Durante el desarrollo, los
espermatozoides migran a la cavidad central del tbulo Seminfero, del que salen
como espermatozoides maduros (Fig. 6)

96


Fig. 6 Tbulos seminferos

Los espermatozoides son clulas pequeas y mviles, se distinguen tres regiones:
cabeza, regin intermedia (cuello) y flagelo (cola). En la cabeza se localiza el ncleo
haploide, abarca casi todo el espacio celular, por lo que hay una reduccin
considerable de citoplasma; junto al ncleo y el lado opuesto a la regin intermedia,
se encuentra un lisosoma llamado acrosoma. Este organelo especializado contiene
enzimas que disuelven las capas protectoras que rodean al vulo. En la zona
intermedia hay una gran cantidad de mitocondrias, la energa que se obtiene de este
organelo se utiliza para mover al flagelo (Fig.7).


Fig. 7 Espermatozoide humano
Ovognesis. Este proceso de formacin de vulos inicia con el desarrollo de ovogonias,
estas clulas se dividen por mitosis, crecen y se convierten en ovocitos primarios. Estas
clula diploides realizan la primera divisin de meiosis y generan dos clulas: el ovocitos
secundario y un primer corpsculo polar, ambos realizan la segunda divisin de la meiosis.
El primer corpsculo polar genera otros dos corpsculos polares, mientras que el ovocito
secundario genera una ovtida y un corpsculo polar. En total se producen tres corpsculos
polares que en breve degeneran y una ovtida que se transformar en el vulo maduro.
Esta clula se caracteriza por ser inmvil y de gran tamao, en ella se almacenan molculas
de reserva conocidas como vitelo (Fig. 8).
97


Fig. 8 Ovognesis

En algunos organismos como platelmintos, rotferos, tardgrados, crustceos,
insectos, anfibios y reptiles, raramente en algunos peces ocurre un fenmeno
conocido como partenognesis y es una forma de reproduccin que se caracteriza
por la produccin de clulas sexuales femeninas no fecundadas. Este proceso
puede interpretarse como reproduccin asexual monogamtica, por la participacin
de un gameto. El proceso inicia con la segmentacin del vulo sin fecundar, inducido
por factores ambientales, qumicos, descargas elctricas, entre otros.
Los descendientes por partenognesis son llamados partenote y solo porta
cromosomas femeninos. Segn la modalidad de la determinacin del sexo, se puede
limitar a los descendientes a slo uno de ellos, como ocurre en las abejas y otros
insectos himenpteros, donde las hembras son diploides, procedentes de huevos
fecundados, y los machos haploides partenogenticos.
Importancia de la reproduccin. En la reproduccin asexual los progenitores
tienen descendientes semejantes a ellos, a travs de este proceso los progenitores
heredan sus mecanismos de adaptacin a los descendientes. Los organismos con
reproduccin sexual, al combinar su informacin gentica incrementan la variacin,
lo cual es muy importante en el proceso de evolucin.

Bibliografa.

Audersik, T. et. al (2008). Biologa. La vida en la Tierra. Pearson- Educacin.
Mxico: 81-84 pag.
Ville, C. (2003). Biologa. Mc Graw Hill. Mxico: 994 p.p





98
Actividad de aprendizaje.
Elabora el siguiente cuadro comparativo
CARACTERSTICA REPRODUCCIN
ASEXUAL
REPRODUCCIN
SEXUAL
Nmero de progenitores
Informacin gentica
heredada

Tipo de divisin celular
Clulas especializadas
Nivel de complejidad de
los progenitores

Importancia

Cuestionario de autoevaluacin.

Relaciona las siguientes columnas escribiendo el parntesis la letra correspondiente
al enunciado.

1.Tipo de reproduccin en la que solo participa un
progenitor...( ) a) Gemacin
2. El progenitor reparte equitativamente el material
gentico y el citoplasma ..( ) b) Fisin binaria
3. El organismo duplica varias veces el material c) Asexual
gentico, posteriormente es rodeado de
membrana con un poco de citoplasm...( ) d) Fragmentacin
4. El progenitor emite una yema, divide
equitativamente el material gentico y el e) Sexual
citoplasma en forma diferente.( ) f) Esporulacin
5. Tipo de reproduccin en la que los organismos
producen gametos( )
6. Capacidad para regenerar la parte faltante de un
organismo....................................( )

Selecciona la la respuesta correcta
1. Clulas femeninas especializadas en la reproduccin.

a) gametofito
b) esporofito
c) corpsculo polar
d) vulo

99
2. rgano masculino en el que se producen las clulas especializadas de la
reproduccin.

a) ovario
b) testculo
c) gametangios
d) arquegonios

3. Las clulas germinales que originan gametos son:

a) diploides
b) haploides
c) poliploides
d) somticas

4. Los espermatozoides se originan de clulas germinales llamadas:

a) anteridios
b) oosferas
c) espermatogonias
d) espermtidas

5. Los corpsculos polares, a diferencia del vulo tienen:

a) mayor nmero de cromosomas
b) menor nmero de cromosomas
c) mayor cantidad de citoplasma
d) menor cantidad de citoplasma

6. En la fecundacin el vulo fusiona su ncleo con el espermatozoide y se forma
una nueva clula que se conoce como:

a) oosfera
b) gametangio
c) cigoto
d) anterozoide







100
Respuestas.
Actividad de aprendizaje.
CARACTERSTICA REPRODUCCIN
ASEXUAL
REPRODUCCIN
SEXUAL
Nmero de progenitores 1 2
Informacin gentica
heredada
misma variada
Tipo de divisin celular Mitosis Mitosis
Meiosis
Clulas especializadas Ninguna Gametos
Nivel de complejidad de
los progenitores
Unicelulares
Multicelulares
Multicelulares
Importancia Descendientes semejantes
en su informacin gentica
Descendientes
con variacin gentica

I. Relacin de columnas
1. c
2. b
3. a
4. c
5. d
6. c

II.

1. d
2. b
3. a
4. c
5. d
6. c












101
TERCERA UNIDAD.

CMO SE TRANSMITE Y MODIFICA LA INFORMACIN GENTICA EN LOS
SISTEMAS VIVOS?

Presentacin. Durante mucho tiempo se ignor como se transmitan las
caractersticas de padres a hijos y por qu en ocasiones ciertas caractersticas se
perdan en una generacin y aparecan en la siguiente, hasta que Gregorio Mendel
estudiando las plantas de chcharo pudo deducir las leyes que las rigen. Otro
aspecto importante en la herencia gentica fue el poder explicar las anormalidades y
la aparicin de nuevas caractersticas en los individuos desde el punto de vista
cientfico y terminar con mitos populares que atribuan las anormalidades a la
exposicin de la mujer embarazada a la luz de la luna o al mal de ojo entre otros.

En esta Unidad estudiaremos primero los principios generales de la gentica y la
importancia de las variaciones (mutaciones) sobre la variabilidad biolgica, y a
continuacin los aspectos ms recientes de la investigacin gentica (tecnologa del
ADN recombinante, organismos transgnicos, el proyecto genoma humano y terapia
gnica), su importancia para la salud y la economa y los aspectos bioticos de su
aplicacin.


PROPSITO: Al finalizar la Unidad, el alumno identificar los mecanismos de
transmisin y modificacin de la informacin gentica en los sistemas vivos, a travs
del anlisis de distintos patrones hereditarios y del conocimiento del papel de las
mutaciones, para que valore los avances del conocimiento biolgico con relacin a la
manipulacin gentica y sus repercusiones en la sociedad.



Tema I. Mecanismos de la herencia

Herencia mendeliana. (Irma Coria lvarez)

Aprendizajes. Explica diferentes mecanismos hereditarios y resuelve problemas
que involucren la trasmisin de caracteres segn distintos mecanismos hereditarios.

Antes de hacerse monje en el monasterio de Santo Tomas de Brun, Gregor Mendel
probo suerte en diversas actividades, entre ellas la medicina y el magisterio.

A fin de obtener su certificado de maestro, Mendel asisti a la Universidad de Viena
durante 2 aos, donde estudio botnica y matemticas, entre otras materias.

Esta capacitacin prob ser crucial para los experimentos que llevara acabo mas
adelante y que constituyeron los cimientos de la ciencia moderna de la gentica. En
el monasterio de Santo Toms, a mediados del siglo XIX, Mendel desempeaba sus
deberes monsticos y al mismo tiempo llevaba a cabo una serie de experimentos
revolucionarios sobre la herencia con plantas de chicharo (guisantes) comestibles
comunes. No obstante Mendel trabajo sin saber nada acerca de los genes ni los
cromosomas, ser mas fcil seguir sus experimentos despus de echar un breve
102
vistazo a ciertos conceptos genticos modernos. El xito de Mendel consisti en
elegir el organismo idneo para su trabajo, proyect y ejecut correctamente sus
experimentos adems de analizar los datos obtenidos de manera minuciosa. Por
stos acontecimientos se sabe que fue el primer genetista en aplicar el mtodo
cientfico experimental.

Gen. Unidad hereditaria que controla cada carcter en los seres vivos. A nivel
molecular corresponde a una seccin de ADN, que contiene informacin para la
sntesis de una cadena protenica.

Alelo. Cada una de las alternativas para un carcter que puede tener un gen. Por
ejemplo el gen que regula el color de la semilla del guisante, presenta dos alelos,
uno que determina color verde y otro que determina color amarillo. Por regla general
se conocen varias formas allicas de cada gen; el alelo ms extendido de una
poblacin se denomina "alelo normal o salvaje", mientras que los otros ms escasos,
se conocen como "alelos mutados".
Carcter dominante. Alelo que en un heterocigoto impide la expresin del otro alelo
(recesivo) en el mismo locus por ejemplo; AA caracteriza al color rojo, aa caracteriza
al blanco, si se encuentran Aa el color es rojo por ser el carcter dominante.
Carcter recesivo. Alelo que se expresa nicamente en el fenotipo cuando se
encuentra en condicin homocigtica por ejemplo, aa.
Genotipo. Es el conjunto de genes que contiene un organismo heredado de sus
progenitores. En organismos diploides, la mitad de los genes se heredan del padre y
la otra mitad de la madre.
Fenotipo. Es la manifestacin externa del genotipo, es decir, la suma de los
caracteres observables en un individuo. El fenotipo es el resultado de la interaccin
entre el genotipo y el ambiente. El ambiente de un gen lo constituyen los otros
genes, el citoplasma celular y el medio externo donde se desarrolla el individuo.
Locus. Es el lugar que ocupa cada gen a lo largo de un cromosoma (el plural es
loci).
Homocigoto. Individuo que para un gen dado tiene en cada cromosoma homlogo el
mismo tipo de alelo, por ejemplo, AA o aa .
Heterocigoto o hbrido. Individuo que para un gen dado tiene en cada cromosoma
homlogo un alelo distinto, por ejemplo, Aa.

Actividades de aprendizaje.

1. Para ayudar a comprender un poco mejor el tema, investigue y repase el
significado de: cuadro de Punnet, progenitores, gametos, F1, F2, hbridos,
cruza, cruza de monohbridos, cruza de dihbridos y raza pura.


103
Primera ley de Mendel
A esta ley se le llama tambin Ley de la Uniformidad de los hbridos de la primera
generacin (F1) y dice que cuando se cruzan dos variedades de individuos de razas
puras (ambos homocigotos) para un determinado carcter, todos los hbridos de la
primera generacin son iguales en fenotipo y genotipo.

Mendel lleg a esta conclusin trabajando con una variedad pura (AA o aa) de
plantas de guisantes que produca las semillas amarillas (AA) y con otra variedad
que produca las semillas verdes (aa). Al hacer una cruza entre estas plantas,
obtena siempre plantas con semillas amarillas (Aa), como se muestra en el
siguiente esquema:
Para interpretar el esquema recuerde.
P = Progenitores AA = lnea pura dominante (amarilla) aa = lnea pura recesiva
(verde) F
1
= primera generacin o primeros hijos Aa = lnea heterocigota o hbrida.


Fig. 1
100% heterocigotas (Aa amarillas)
Conclusin: en una cruza monohbrida el individuo heterocigoto en la primera
generacin F
1
, se manifiesta el carcter dominante en un 100%.
Interpretacin del experimento: el polen de la planta progenitora aporta a la
descendencia un alelo para el color de la semilla ( el color amarillo), y el vulo de la
otra planta progenitora aporta el otro alelo (el color verde); de los dos alelos,
solamente se manifiesta aqul que es dominante (A), mientras que el recesivo (a)
permanece oculto.
Actividad de aprendizaje.
Obtenga la F
2
haciendo un cuadro de Punnet, seala: progenitores, gametos y
realiza la cruza y describe el fenotipo y genotipo de los individuos obtenidos.
104
Segunda ley de Mendel
A esta ley de tambin se le denomina; de la separacin o disyuncin de los alelos.
Mendel tom plantas procedentes de las semillas de la primera generacin (F
1
) del
experimento anterior y las poliniz entre s. Del cruce obtuvo semillas amarillas y
verdes en una proporcin de 3:1, como se observa en la figura 2. De esta forma el
alelo que determina la coloracin verde de las semillas parecan haber desaparecido
en la primera generacin (F
1
), pero vuelve a manifestarse en esta segunda
generacin (F
2
).
Recuerde lo siguiente para interpretar correctamente la figura 2:
F
1
= son progenitores heterocigotos Aa (amarillos)
F
2
= 1er cuadro AA, 2. Cuadro Aa, 3er cuadro aA y 4 cuadro aa
Ahora describe tu los colores de cada semilla

Fig. 2
Es decir: 3 amarillas (75%) y 1 verde (25%)
Interpretacin del experimento. Los dos alelos distintos para el color de la semilla
presentes en los individuos de la primera generacin, no se mezclaron ni
desaparecieron , simplemente se manifest uno de los dos. Cuando el individuo de
fenotipo amarillo y genotipo Aa, form los gametos (A, a) se separan los alelos, de
tal forma que en cada gameto slo habr uno de los alelos explicando de esta
manera los resultados obtenidos.
Actividades de aprendizaje. observe los siguientes esquemas y realice el ejercicio
solicitado en la parte inferior de los mismos.
105



Tercera ley de Mendel
Conocida tambin como la de la herencia independiente de caracteres, y hace
referencia al caso en que se contemplen dos caracteres distintos. Cada uno de ellos
se transmite siguiendo las leyes anteriores con independencia de la presencia del
otro carcter.
Mendel cruz plantas de guisantes de semillas amarillas y lisas (AABB) con plantas
de semillas verdes y rugosas (aabb) Homocigticas ambas para los dos caracteres.
Las semillas obtenidas en esta cruza eran todas amarillas y lisas, cumplindose as
la primera ley para cada uno de los caracteres considerados, y revelndonos
tambin que los alelos dominantes para esos caracteres
Figura 3. son los que determinan el color amarillo y la forma lisa.
Las plantas obtenidas y que constituyen la F1 son dihbridas (AaBb).
Fig. 3





Figura 3.
Seale: progenitores, gametos y
proporcin fenotpica y genotpica
Seale: progenitores, gametos y compare
con el cuadro anterior y explique la F
2
106
Estas plantas de la F1 se cruzan entre s, teniendo en cuenta los gametos que
formarn cada una de las plantas y que pueden verse en la Fig, 4. Los alelos de los
distintos genes se transmiten con independencia unos de otros, ya que en la
segunda generacin filial F
2
aparecen guisantes amarillos y rugosos y otros que
son verdes y lisos, combinaciones que no se haban dado ni en la generacin
parental (P), ni en la primera generacin (F1), asimismo, los resultados obtenidos
para cada uno de los caractres considerados por separado, responden a la
segunda Ley de Mendel (9:3:3:1)
Actividad de aprendizaje
Obtenga la F2, utilizando los individuos obtenidos en F1 de la Fig 3, seale;
progenitores, gametos, utilice el cuadro de Punnet y describa los individuos
obtenidos, qu proporcin obtiene?
Compare ahora sus datos con el siguiente
cuadro.

Interpretacin del experimento. Los resultados de los experimentos de la tercera ley


refuerzan el concepto de que los genes son independientes entre s, que no se
mezclan ni desaparecen generacin trs generacin. Para esta interpretacin fue
providencial la eleccin de los caracteres, pues estos resultados no se cumplen
siempre, sino solamente en el caso de que los dos caracteres a estudiar estn
regulados por genes que se encuentran en distintos cromosomas. No se cumple
cuando los dos genes considerados se encuentran en un mismo cromosoma, es el
caso de los genes ligados, que se ver en la siguiente seccin.


107
Cuestionario de autoevaluacin.

Resuelva los siguientes problemas:

1.- Un gen dominante (A) determina la textura del pelo de alambre en los perros, su
alelo recesivo (a) produce el pelo liso, utilizando el cuadro de Punnett obtenga F1,
seale: Progenitores, Gametos y caractersticas de los individuos obtenidos, si el
macho es de pelo de alambre homocigoto y la hembra de pelo liso homocigota.

2.- Con las caractersticas del problema anterior y teniendo en cuenta la dominancia
completa, obtenga F2, seale Progenitores 2, Gametos 2, proporcin y descripcin
de los individuos obtenidos.

3.- En los zorros, el color negro-plateado es determinado por un alelo recesivo (n) y
el color rojo por su alelo dominante (N). Determine las proporciones genotpicas
esperadas de los siguientes apareamientos:
a) rojo puro x portador rojo
b) portador rojo x negro plateado
c) rojo puro x negro-plateado

4.- El carcter normal de la pata hendida en el puerco es producido por el genotipo
homocigtico recesivo (mm), la condicin de la pata de mula es generada por el
genotipo dominante (M), el pelaje blanco (N) es gobernado por el alelo dominante en
otro locus y el pelaje negro por su alelo recesivo (n), haga una cruza entre una
hembra blanca con pata de mula y un cerdo negro con pata hendida, obtenga F1 y
utilizando el cuadro de Punnett seale: Progenitores, Gametos y como son los
individuos obtenidos.

5.- Con las caractersticas del problema anterior obtenga F2, seale: Progenitores 2,
Gametos 2, proporcin y descripcin de los individuos obtenidos.

Estrategias de aprendizaje:
Se sugiere hacer los problemas de manera ordenada, sealando y reflexionando
sobre las caractersticas utilizadas, adems e tener en cuenta las proporciones
sugeridas en cada ley.

Respuestas

1.- 100% pelo de alambre/ 100% heterocigotos o hbridos
2.- Fenotipos: 75% pelo de alambre/ 25% pelo liso. Genotipos: 25%homocigotos
dominantes 50% heterocigotos/hbridos 25% homocigotos recesivos
3.- a) 50% rojos puros/ 50% portador rojo, b) 50% portador rojo/ 50% negro-
plateado, c) 100% portador rojo
4.- 100% blancos/pata de mula, 100% dihbridos
5.- Total de individuos obtenidos en F2 16, 9: blancos con pata de mula. 3 blancos
con pata hendida, 3 negros con pata de mula y 1 negro con pata hendida.




108
Bibliografa

Audersik, Teresa, et al. La vida en la tierra, 6 edicin. Prentice Hall, Mxico
2003.
Levine, Robert, P. Gentica, 2. Edicin, Editorial Continental, Mxico 2003.
Google/imgenes/Herencia Mendeliana
Google/imgenes/Mendel y la herencia


Herencia no mendeliana (Victoria Ortega Rangel)

Aprendizaje. Explica los patrones de herencia no mendeliana y resuelve problemas
que involucren la trasmisin de caracteres segn distintos mecanismos hereditarios.

Mendel explic los patrones de la herencia en los casos que una caracterstica est
controlada por un par de alelos (genes) dominantes y recesivos; sin embargo,
existen otras formas hereditarias llamadas patrones de herencia no mendeliana
que no siguen las reglas de los trabajos de Mendel.

Dominancia incompleta

En la dominancia incompleta un alelo del par no es totalmente dominante sobre el
otro alelo (distintas formas de un gen que controlan una caracterstica), de modo que
el heterocigoto o hbrido es de tipo intermedio entre los fenotipos de los dos
homocigotos. Ejemplo: al cruzar una flor llamada don diego de noche de linaje rojo
puro (RR) con otra de linaje blanco puro (BB), todos los fenotipos de los hbridos de
la F
1
ser 100% rosas (RB). Al cruzar dos plantas de la F
1
, los fenotipos sern 25%
rojos (RR), 25% blancos(BB) y 50% rosas (RB)

Actividades de aprendizaje.
Utilizando los datos arriba mencionados, realiza una cruza monohbrida de
lneas puras, para que compruebes los resultados (utiliza el cuadro Punnet).

http://docentes.educacion.navarra.es/~metayosa/3esogenetica10.html
109
PROGENITORES ______ _______

Gametos
F
1
_______ _______
Gametos
F
2

Proporcin
Fenotpica:

Explica con tus palabras, cul es la diferencia entre las leyes de Mendel y la
herencia intermedia.
Codominancia

En la codominancia un par de alelos no idnticos especifica dos fenotipos diferentes,
y ambos se expresan de manera simultnea en los heterocigotos o hbridos.

Un ejemplo de codominancia es lo que ocurre en el ganado bovino de la raza
Shorthorn, en la cual de la cruza de un toro de pelaje rojo (C
R
C
R
) con una vaca
blanca (C
B
C
B
) se producen terneros (C
R
C
B
) de color ruano (mixto). Tendr pelo
color rojo y pelo color blanco.

Actividades de aprendizaje

Utilizando los datos arriba mencionados, realiza la cruza monohbrida, obtn los
fenotipos de la F
1
y F
2

PROGENITORES ______ _______


Gametos
F
1
_______ _______

Gametos
F
2

Proporcin
Fenotpica:










110
Explica con tus palabras, cul es la diferencia entre las leyes de Mendel y la
codominancia.
Alelos Mltiples
En las clulas diploides (2n) de los organismos, existen dos juegos de cromosomas,
uno es de origen paterno y otro materno. A cada par de cromosomas iguales se les
denomina homlogos. Los alelos son genes localizados en el mismo sitio, en un par
de cromosomas homlogos. En el caso de los alelos mltiples, no solo hay dos
alternativas que afectan una caracterstica en una poblacin sino que puede haber
ms alelos. Un ejemplo son los tipos sanguneos, en la poblacin humana esta
caracterstica estn involucrados 3 alelos: I
A
, I
B
y I
O
.

Los alelos A y B presentan una codominancia y, O es el alelo recesivo
En la siguiente tabla se muestra los diferentes tipos sanguneos y los posibles
genotipos.








La determinacin de los grupos sanguneos es til para resolver casos de paternidad
dudosa.

Actividades de aprendizaje.

Cul ser el tipo sanguneo probable de los hijos (F
1
) si los progenitores tienen un
genotipo I
A
I
B
y I
O
I
O
.

Explica con tus palabras, cul es la diferencia entre las leyes de Mendel y los alelos
mltiples.

Herencia Ligada al sexo

Este tipo de herencia fue estudiado por Thomas Morgan al principio de la dcada de
1910, al observar un cultivo silvestre de moscas de la fruta Drosophila
melanogaster.

Los organismos diploides, tienen un par de cromosomas sexuales, en el caso del
sexo femenino tienen dos cromosomas X y en el caso del sexo masculino tienen un
cromosoma X y un cromosoma Y. Pues bien, en la herencia ligada al sexo, las
TIPOS DE
SANGRE
GENOTIPOS POSIBLES
A I
A
I
A
homocigoto I
A
I
O
heterocigoto
B I
B
I
B
homocigoto I
B
I
O
heterocigoto
AB I
A
I
B
heterocigoto, codominancia
O I
O
I
O
homocigoto recesivo
111
caractersticas contenidas en el cromosoma X se expresaran en el sexo masculino
al no tener otro cromosoma X que impida que estas se expresen.

El cromosoma sexual X, puede portar genes recesivos que causan algunas
enfermedades, tales como el daltonismo, la hemofilia y la calvicie entre otras. Estos
genes recesivos tienen mayor posibilidad de expresarse fenotpicamente cuando el
genotipo es homocigoto recesivo.



Este problema tiende a manifestarse con mayor probabilidad en familias que llevan a
cabo matrimonios consanguneos, tal fue el caso de la familia real de la Reina
Victoria


Observa detenidamente el siguiente esquema, identifica las probabilidades
fenotpicas de la F
1
.



112

Tomado de: www.uc.cl/sw educ/educacion/grecia/plano/html/cra/biologia
2medio.hthttp://www.uc.cl/sw

Actividades de aprendizaje.
1. Explica con tus palabras, cul es la diferencia entre las leyes de Mendel y la
herencia ligada al sexo.
2. Investiga los trabajos de Morgan con respecto a la herencia ligada al sexo.
3. Qu entiendes por homocigoto, cromosomas homlogos, fenotipo, genotipo,
hbrido o heterocigoto, F
1
, alelos.

Cuestionario de autoevaluacin.
Relacin de columnas (sobran respuestas)



Respuestas.





Respuestas.

1. G 2. A 3. F 4. C 5. D 6. E


Bibliografa.



1. El individuo heterocigoto o hibrido su
fenotipo es intermedio entre los fenotipos
de los dos padres, por lo que se dice que
los genes presentan una__________( )
2. Condicin en la cual dos alelos de un
locus se expresan simultneamente en el
heterocigoto____________________( )
3. El genotipo posible de una persona con
tipo A sanguneo es ______________( )
4. Cuando una caracterstica es afectada
por ms de un par de alelos se habla de
______________________________( )
5. Cuando se habla de las caractersticas
contenidas en el cromosoma sexual X se
habla de la _____________________( )
6. Los alelos que afectan una caracterstica
se separan durante la formacin de los
gametos, se habla de la___________( )

A) Codominancia
B) I
A
I
B

C) Alelos mltiples
D) Herencia ligada al
sexo
E) Ley de la
segregacin
F) I
A
I
O

G) Dominancia
incompleta
H) Ley de la
distribucin
independiente
I) Herencia de Morgan
113

Bibliografa.

Cooper, G. M., Hausman, R. E. LA CLULA. 4ta. Edicin. MARBN LIBROS,
S.L. Espaa. 2008.
Valdivia, B. et al. BIOLOGA. La vida y sus procesos. Segunda reimpresin.
PUBLICACIONES CULTURAL. Mxico.2003.
Solomon, E. P., et al. BIOLOGA. Quinta edicin. Mc Graw Hill Interamericana.
Mxico, 2001.


Conceptos de gen y genoma. (Hctor Rivera V.)

Aprendizaje. Reconoce que la transmisin de las caracterstica hereditarias permite
la continuidad de los seres vivos.

Gen. Del alemn Gen, trmino cientfico puesto por Wilhelm Ludvig Johannsen
en 1905 y ste proviene de la palabra griega gen. (gnos, gnous)
que significa raza, generacin. La informacin gentica contenida en el cido
desoxirribonucleico (ADN) se encuentra en secuencias lineales de nucletidos que
contienen la informacin necesaria para la sntesis de protenas con una funcin
especfica, y a esto es a lo que comnmente se le llama gen. Cada gen tiene una
secuencia de nucletidos que codifican para una sola protena, la cual estar
formada por una secuencia especfica de aminocidos (ver sntesis de protenas en
caso de tener dudas).

Como ya habrs visto en temas anteriores, la informacin gentica en los
organismos procariontes se encuentra en un solo cromosoma, y en los plsmidos
(fragmento pequeo de ADN circular presente en bacterias, que se replica
independientemente del cromosoma bacteriano). En las clulas eucariontes se
encuentran siempre en pares de cromosomas, uno se recibe por va materna y el
otro por va paterna. Pero es necesario hacer la aclaracin que en algunos virus, en
vez de tener ADN, son portadores de su informacin gentica en molculas de cido
ribonucleico (ARN). A este tipo de virus se les conoce como retrovirus. As, cada
gen tiene informacin para la formacin de protenas, pero tambin pueden codificar
para elaborar los ARN mensajero, ribosomal y de transferencia.
El gen es definido como unidades discretas que determinan una caracterstica
heredable (las que constan de unidades o partes separadas unas de otras, como
los rboles de un monte, los soldados de un ejrcito, los granos de una espiga. Etc.,)
contenidas en los cromosomas. De esta forma cada gen es una unidad
independiente de informacin. En las clulas eucariontes los cromosomas se
encuentran en pares, por tal razn se tiene un par de genes para cada caracterstica
(no necesariamente la misma, ya que sabemos que cada gen puede tener diversas
alternativas llamadas alelos). Estos genes normalmente tienen una posicin dentro
de un cromosoma y a esta posicin se le llama locus (plural loci). A continuacin
presentamos un esquema de un cromosoma duplicado (con sus dos cromtidas)
indicando la posicin de algunos de sus genes y a la derecha se muestran algunos
loci.
114

Tomado de: www.ferato.com/Wiki/index.php/Gen
Genoma. Del griego gen: generar, que genera, y oma: accin. Trmino acuado
por el alemn Hans Winkler en 1920, usando las contracciones de las palabras gene
y cromosomas. En el caso de las clulas eucariontes, el genoma es: La totalidad
del ADN contenido en una clula, que incluye al ADN de los cromosomas dentro del
ncleo y al ADN de las mitocondrias (y de los cloroplastos en el caso de clulas
vegetales). En el caso de las clulas procariontes, ser la totalidad del ADN de su
cromosoma, ms el contenido en el o los plsmidos , ya que no tienen mitocondrias,
ncleo ni cloroplastos. Por lo tanto, el genoma es la dotacin hereditaria de cada
organismo, incluyendo a todos los sistemas vivos y a los virus. En el caso de
algunos virus el material gentico es de ARN y por lo tanto, cuando se habla de su
genoma se habla de su ARN.

Desde luego que cada dotacin gentica contiene la informacin total del individuo
codificada en el ordenamiento de los nucletidos de cada uno de sus genes. En el
caso de los seres humanos, el genoma nuclear tiene seis mil millones de pares de
bases. En el caso de los individuos de reproduccin sexual la informacin es
reordenada y transmitida a los descendientes (recombinacin gentica), por lo que el
genoma de un individuo no es igual al de otros individuos de su misma especie, pero
se sabe que en los humanos la coincidencia es de aproximadamente el 99%,
existiendo slo una pequea fraccin diferente, razn por la cual genticamente no
existen razas en los humanos y se puede encontrar mayor diferencia contrastando la
informacin gentica entre dos individuos de una misma raza que en una
contrastacin interracial.

Para las especies eucariontes se acepta que el genoma es todo el ADN en un
nmero haploide de cromosomas. En 1990 surgi el Proyecto genoma humano con
la intensin de conocer el orden de todos los nucletidos en el genoma humano. La
informacin a la que se le llama secuencia, sera ms o menos de la siguiente
manera:
GCTCAATCTACCGAGATGTAACGATTAATCGATCGAATTACCGACTTCGA
GCACAGTATACCTGGATTCAACGTTAATCGATGCGATTCACCGACTTCGA
GCAATCTAGCCGGATTAAACGTTTAATTCCGATCGATTGACCGACTTCGA

115
Conocida la secuencia se procede a identificar los genes y para que protenas
codifican, con la finalidad de crear mapas de genes, para ubicarlos en sus
respectivos cromosomas, locus y conocer sus funciones.

Otras aplicaciones del conocimiento del genoma es hacer comparaciones entre
especies para conocer su grado de parentesco evolutivo, por ejemplo al comparar el
genoma humano con el de otros primates se ha descubierto que compartimos una
mayor afinidad gentica con chimpancs que con gorilas y orangutanes. Tambin se
puede aplicar el conocimiento del genoma humano para: Diagnstico y prevencin
de enfermedades. En el caso de enfermedades, hacer pronsticos sobre posibilidad
del desarrollo de la enfermedad en personas sanas asintomticos y en sus
descendientes, posibles prevenciones y tratamiento, como la terapia gnica
(introduccin de genes en el ADN de una persona para tratar una enfermedad) y
farmacogenmica (crear frmacos a la medida del enfermo). Tambin tiene
aplicaciones en genmica microbiana, medicina molecular, bioarqueologa,
antropologa, estudio de migraciones, paleogentica, e identificacin de individuos
entre otros.

Ejemplo de mapeo del cromosoma 11 humano. El sndrome de LQT largo produce: arritmia,
prdida del conocimiento (sncope e incluso la muerte sbita).

Actividades de aprendizaje.
Haz un glosario de trminos del tema.

Cuestionario de autoevaluacin.
1. Secuencia lineal de nucletidos que codifican para una protena especfica.
A) Gen
B) Alelo
C) Locus
D) plsmido
E) Cromosoma


116
2. Molcula que contiene la informacin gentica en retrovirus.
A) ARN
B) ADN
C) Plsmido
D) Nucletido
E) Cromosoma

3. Se dice que los genes son unidades ______________________ porque son
independientes unos de otros.
A) variables
B) promedio
C) discretas
D) nominales
E) continuas

4. Dotacin gentica de un organismo.
A) Gen
B) Cariotipo
C) Cromtida
D) Cromosoma
E) Genoma

5. El mapeo de genes permite_______________________________________
A) pronosticar mutaciones.
B) prevenir malformaciones.
C) diagnosticar enfermedades.
D) ubicarlos dentro de un cromosoma.
E) conocer el grado de evolucin de una especie.

Respuestas.
1. A
2. A
3. C
4. E
5. D

Bibliografa.

Cooper, G. M., Hausman, R. E. LA CLULA. 4ta. Edicin. MARBN LIBROS,
S.L. Espaa. 2008.
Valdivia, B. et al. BIOLOGA. La vida y sus procesos. Segunda reimpresin.
PUBLICACIONES CULTURAL. Mxico.2003.
Solomon, E. P., et al. BIOLOGA. Quinta edicin. Mc Graw Hill Interamericana.
Mxico, 2001.


117
Concepto de mutacin. Importancia de las mutaciones como mecanismo
de variabilidad biolgica. (Hctor Rivera V)

Aprendizaje. Relaciona las mutaciones con la variabilidad biolgica.

La palabra mutacin, es de origen latino y viene de mutatus que significa cambio,
ms la terminacin in, que es el resultado de un proceso o accin. En biologa la
mutacin es un cambio heredable en el ADN, que puede alterar la expresin de un
gen. Las mutaciones son la fuente de las diferentes versiones de los genes (alelos)
y por lo tanto de la diversidad de la vida. El resultado de la mutacin puede ser
neutral, benfico, perjudicial, o letal, dependiendo de cmo altere la funcin del gen
bajo ciertas condiciones prevalecientes en un ambiente determinado.

La mutacin puntual se refiere a los cambios en el ordenamiento de los nucletidos
dentro de un gen, lo cual implica tambin, que habr un cambio en el ARNm cuando
se transcriba la informacin, y de esta manera se alteran tambin los codones, que
son los que indican el orden en que se deben ensamblar los aminocidos para la
sntesis de protenas. Al cambiar el orden de los aminocidos que forman a una
protena, la protena cambia y lo ms probable es que cambie en su estructura y
funcin.

Para que se sintetice una determinada protena, se requiere de una secuencia
especfica de bases nitrogenadas del ADN, que indiquen en qu secuencia deben
unirse los aminocidos, Esta secuencia ser nica para dicha protena. S surge un
cambio en el orden o en el nmero de las bases nitrogenadas, podemos esperar
tambin, un posible cambio en la estructura de la protena formada. S el cambio en
la estructura de la protena afecta drsticamente al metabolismo celular, el resultado
puede ser perjudicial e inclusive causar la muerte. En muchas ocasiones los genes
se ven alterados, y el cambio puede ser la sustitucin de una base nitrogenada por
otra en la secuencia del ADN, o , quizs pueda insertarse una base extra o incluso
perderse. A estos pequeos cambios en la secuencia de nucletidos del ADN, se les
conoce como mutacin gnica o puntiforme.

Algunas de estas mutaciones son el resultado de la exposicin a agentes
mutgenos, que son agentes que incrementan el riesgo de alteraciones en el ADN.
Algunos de estos agentes son: la radiacin como; rayos ultravioleta, radiacin
ionizante, o la presencia de agentes qumicos o radicales libres. Pero an en
ausencia de agentes mutgenos puede haber mutaciones espontneas durante la
replicacin, por ejemplo: la adenina puede errneamente aparearse frente a una
citosina, este error puede ser detectado por enzimas de reparacin y corregir el
error. Estas enzimas de reparacin identifican el error, cortan el nucletido incorrecto
y lo reemplazan por un nucletido que tenga la base complementaria correcta, pero
en algunas ocasiones, las enzimas reemplazan el nucletido correcto en lugar del
incorrecto y esto produce una mutacin.




118
T A C T A C T A C
: : : : : : : : :
A T G G C A A T G
Triplete original Triplete errneo La enzima repara el error

o puede ser que la T G C
enzima sustituya al : : :
nucletido original G C A (mutacin)

En algunas ocasiones la mutacin no modifica a la protena, por ejemplo: el triplete
CTC codifica para el aminocido cido glutmico, pero s se modifica el triplete
quedando CTT, el triplete mutante tambin codifica para el mismo aminocido y, por
lo tanto no hay cambio en la protena que se formar. Sin embargo, s se tiene un
triplete AUU, que codifica para el aminocido isoleucina y la mutacin cambia el
uracilo de en medio por una citosina (ACU), ahora, este triplete codifica para el
aminocido treonina, y en la protena aparecer el cambio. Las inserciones o
supresiones de bases nitrogenadas pueden afectar drsticamente un gen, porque
todos los tripletes despus de la insercin o supresin sern mal ledos y la protena
no ser funcional. Otra posibilidad es que la mutacin produzca un codn que
indique terminacin de la cadena de aminocidos y se corte la cadena antes de que
se termine de formar la protena y esto puede afectar gravemente la funcin de la
protena o hacerla no funcional tambin.

Como ocurren miles de millones de replicaciones durante el crecimiento y desarrollo,
existe la posibilidad de que alguna o algunas clulas contengan una mutacin, y si
esta mutacin se efecta en una clula reproductora (gameto), la mutacin puede
ser transferida a los descendientes. Ahora bien, cul puede ser el resultado de la
mutacin en el fenotipo de un individuo?. Esto depender de cmo afecte la
mutacin a la sntesis de protenas.

Algunas mutaciones son dainas. Cada individuo de una especie es una
combinacin de genes que se han seleccionado a lo largo de generaciones
sucesivas y probado en cierto rango de condiciones ambientales. Una mutacin con
efectos drsticos sobre la informacin gentica, puede reducir o anular la
reproductividad o la posibilidad de supervivencia del individuo. A estas ltimas
mutaciones se les conoce como letales, y obviamente no se transmiten a las
siguientes generaciones. Otro tipo de mutaciones son las llamadas neutras, que no
tienen un efecto benfico o perjudicial para quienes las poseen, pero se acumulan
en la informacin gentica. Este tipo de mutaciones pueden tener algn efecto sobre
la tasa de reproduccin o supervivencia a futuro, cuando las condiciones
ambientales cambien, y entonces puedan dar una cierta ventaja adaptativa o
reproductiva a quienes la posean.

La seleccin natural juega un papel importante en la perpetuacin de ciertos genes
(genes benficos) , pero tambin son importantes los mecanismos que los protegen.
Por ejemplo: las ventajas adaptativas que tienen las clulas que presentan genes
que forman enzimas reparadoras de los errores de apareamiento de bases
nitrogenadas. Tales enzimas ayudan a proteger la estabilidad del ADN que tiene que
119
replicarse, y que de hecho se ha replicado innumerables veces desde que
aparecieron los primeros seres vivos.

La seleccin natural ha actuado sobre las mutaciones a lo largo de la historia de la
vida, de manera tal, que ha dirigido la evolucin y diversificacin de los seres vivos.
Slo tenemos que recordar que todos los seres vivos poseemos la misma herencia
qumica. El humano esta constituido de la misma estructura qumica, usando las
mismas bases nitrogenadas que la ballena azul, el ratn domestico, el huitlacoche o
el gusano de maguey por ejemplo. Nuestro ADN se replica de la misma manera que
en ellos, y usamos el mismo cdigo gentico para la formacin de las protenas.
Desde el punto de vista evolutivo, la nica razn por la cual somos humanos, la
ballena un cetceo, o por la que cada ser vivo pertenece a una determinada especie,
es que la seleccin natural a actuado sobre diferentes tipos de mutaciones que han
dado origen a diferentes lneas de descendencia, as la secuencia en los pares de
bases nitrogenadas determinan las caractersticas diferentes entre especies, de los
cuales se desprenden tres conceptos fundamentales: Primero: el ADN es la fuente
original de la informacin hereditaria de todos los seres vivos. Segundo: la mutacin
es la fuente primaria de la diversidad, y tercero: el ambiente y sus cambios son el
campo de prueba de los genes nuevos que aparecen por mutacin.

Mutacin cromosmica. No slo puede haber mutaciones que impliquen el cambio
en la secuencia de nucletidos del ADN, otro tipo de mutaciones implican cambios
en el conjunto de cromosomas, prdida o ganancia de uno o ms cromosomas o de
fragmento de cromosomas. Este tipo de mutaciones si no son deletreas pueden
contribuir en los grandes cambios evolutivos.

Cambio en el nmero de cromosomas. Existen diversas formas de mutacin o de
modificaciones en el genoma de un individuo. Los cambios en el genoma pueden
causar cambios en el nmero de cromosomas. Este tipo de mutacin afecta a la
dotacin cromosmica de un individuo, es decir, los individuos que las presentan
tienen en sus clulas un nmero distinto de cromosomas al que es propio de su
especie. Estos cambios pueden ser en prdida o ganancia de un conjunto o
juego de cromosomas. No son mutaciones que impliquen cambio en el material
gentico, sino en el nmero de cromosomas, el cual suele ser resultado de una
separacin anormal de los cromosomas durante la meiosis, con lo que podemos
encontrarnos individuos con nmero anormal de cromosomas: individuos haploides
(n) triploides (3n), tetraploides (4n), etc.

Otra forma en la que se modifica el nmero de cromosomas es la Prdida o
ganancia de uno o ms cromosomas (Aneuploidia). Estos casos tambin se
producen normalmente durante la meiosis, por no disyuncin (durante el
entrecruzamiento los cromosomas homlogo intercambian informacin y luego se
separan, pero en ocasiones no lo hacen y se van los dos a una clula y la otra no
tendr ninguno de ese par). Esto es lo que causa los llamados sndromes genticos,
que suelen dar origen a individuos poco viables o con esterilidad, o esterilidad
reducida, porque se presentaran dificultades en el apareamiento de los cromosomas
homlogos en la meiosis de sus clulas. Estas mutaciones generalmente no aportan
nuevas variedades o especies por las dificultades antes mencionadas en la
formacin de gametos. En humanos los ejemplo ms conocidos por presentar un
cromosoma de mas son: Sndrome de Down (trisomia del par 21); Sndrome de
120
Edwards (trisomia del par 18); Sndrome de Patau (trisomia 15 o 18) y en
cromosomas sexuales los sndromes de Kinefelter con doble cromosoma X y
Sndrome de triple XXX. En cuanto a la prdida de cromosomas, tenemos al
sndrome de Turner con un solo cromosoma X. Tambin pueden ocurrir mutaciones
cromosmicas que impliquen prdida o ganancia de genes dentro de un cromosoma
o cambios en el ordenamiento de los genes ( figura 1) Ruptura


Ruptura


A B C D E F G
a)

A B C D E
b) Prdida o delecin

A B C D E F G F G
c) Duplicacin


A B C D E G F
d) Inversin


F G M N O P Q R
e) Translocacin


f) Fusin cntrica


A B C D E F G


A B C D P O N M

M N O P Q R


E F G


Fragmentos perdidos
Q R

Figura 1. Cambio en la estructura de los cromosomas.


a) Cromosoma original
b) Prdida: delecin o deficiencia.
c) Adicin: duplicacin.
121
II. Cambio en el ordenamiento de los genes:
d) Inversin: rotacin de un grupo de genes dentro de un cromosoma.
e) Translocacin: intercambio de genes entre cromosomas de pares
distintos
f) Fusin cntrica: fusin de cromosomas de pares distintos.

Cuadro que resume los diferentes tipos de mutacin.



Actividades de aprendizaje.

1. Investiga algunos tipos de mutacin que sean perjudiciales o letales en humanos.
2. Haz una lista de algunas de las condiciones ambientales en las que vive una
poblacin hipottica de conejos. Ahora selecciona una mutacin que sea neutra en
el genotipo de uno de los conejos (un rasgo nuevo) y modifica alguna de las
condiciones ambientales para que la nueva caracterstica le d al conejo una ventaja
adaptativa.
3. Realiza una investigacin sobre agentes mutagnicos.
4. Utilizando una tabla del cdigo gentico, explica si los siguientes cambios
(mutaciones) en una secuencia de ARN cambiaran tambin el orden de los
aminocidos que se uniran para formar una protena.
122
Secuencia original en ARN UUUCUUGAGUGCCAU

Mutacin UUCCUUGAGUGCCAU

a) Qu sucedera? _________________________________________________
_________________________________________________________________

Mutacin UUUCCUGAGUGCCAU

b) Qu sucedera? ___________________________________________________
___________________________________________________________________


Mutacin UUUCUUGAGUGAACAU

c) Qu sucedera? ________________________________________________
_________________________________________________________________


A qu tipo de mutacin corresponden las secuencias modificadas?

Secuencia original UACCGUUGAGUUCAUU

Mutacin UACGUUGAGUUCAUU

d) Respuesta______________________________________________________


Mutacin UACCGUUGAGUUUCAUU


e) Respuesta_______________________________________________________


Explica que pasar con la protena en los dos casos anteriores

f) Respuesta________________________________________________________
___________________________________________________________________
_______________________________________________________________

Respuestas a la actividad de aprendizaje 4.

a) No hay modificacin en la protena, pues los tripletes UUU y UUC codifican para
el mismo aminocido Fenilalanina.
b) CUU codifica para leucina y CCU para prolina, por lo tanto cambia la protena.
c) Es una insercin y puede ser una protena no funcional.
d) Prdida.
e) Adicin
f) En ambos casos la mutacin se correra a lo largo de la molcula y las protenas
no seran funcionales.
123
Cuestionario de autoevaluacin.
1. Son los cambios en el ordenamiento de los nucletidos dentro de un gen.
A) Aneuploida
B) Recombinacin
C) Entrecruzamiento
D) Mutacin puntual
E) Mutacin cromosmica

2. Es una mutacin genmica.
A) Delecin
B) Inversin
C) Poliploida
D) Duplicacin
E) Translocacin

3. Organismos con un solo juego de cromosomas.
A) Haploide
B) Diploide
C) Triploide
D) Tetraploide
E) Poliploide

4. Es el intercambio de genes entre cromosomas de pares distintos.
A) Inversin
B) Recombinacin
C) Entrecruzamiento
D) Translocacin
E) Aneuploida

5. Rotacin de un grupo de genes dentro de un cromosoma.

A) Inversin
B) Recombinacin
C) Entrecruzamiento
D) Translocacin
E) Aneuploida


Respuestas
1. D
2. C
3. A
4. D
5. A




124
Bibliografa.

Audersik, T. et al. 2001. La vida en la tierra. 6 ed. Prentice Hall. Mxico
Campbell, N. et al. 2001. Biologa. 3 ed. Prentice Hall. Mxico.
Curtis, H y Barnes, R. 2004. Biologa. 6 ed. Medica-Panamericana. Espaa.
Solomon, E. et al. 2001. Biologa. 5 ed. McGraw Hill-Interamericana. Mxico.
http://academia.cch.unam.mx/wiki/biologia3y4


Tema II. La ingeniera gentica y sus aplicaciones

Aspectos generales de la tecnologa del ADN recombinante. (Silvia Toro
Badillo)
Aprendizajes:
1. El alumno describe la tecnologa del ADN recombinante y sus aplicaciones.
2. Valora las implicaciones de la manipulacin gentica
3. Valora las implicaciones bioticas de la clonacin de los organismos

En la actualidad los cientficos pueden alterar la herencia gentica de los organismos
al pasar genes de una especie a otra. En un experimento que se realiz en 1986, el
gen para la produccin de la luz en las lucirnagas se insert en los cromosomas de
una planta del tabaco, cuando el gen se activ, la planta brillo!.
La manipulacin del material gentico se inici en 1971, cuando se conoce el papel
de las enzimas de restriccin, las cuales cortan el ADN en sitios especficos. El
procedimiento de cortar en pequeos fragmentos el ADN de un organismo e
insertarlos en otro ser vivo de la misma o diferente especie, se llama ingeniera
gentica o tecnologa del ADN recombinante. Con esta tecnologa, se pueden
introducir en el genoma bacteriano genes manipulados in vitro que producen
diversas sustancias como protenas humanas que no son sintetizadas de manera
natural por las bacterias. Los genes se copian (clonan) y se insertan en un vector
(plsmidos o fragmentos de genomas virales) que posteriormente se propagan en
microorganismos como bacterias, virus o levaduras y finalmente se integran en el
genoma de otros organismos.
Las endonucleasas de restriccin son enzimas bacterianas que reconocen
secuencias cortas de ADN y cortan en puntos especficos llamados "secuencias de
reconocimiento", y los lugares donde cortan se denominan sitios de restriccin.
Estas enzimas protegen a las bacterias destruyendo el ADN ajeno que ingresa a
ellas por medio de virus u otros organismos, pero no degradan su propio ADN.
Las bacterianas fabrican diferentes endonucleasas (ms de 100) y cada una de ellas
corta en sitios especficos el ADN. Por ejemplo, la enzima EcoR1 (bacteria de
Escherichia coli, que reside en el intestino humano), solo corta si encuentra la
secuencia GAATTC. La mayora de las endonucleasas cortan secuencias de ADN
que son palndromos, es decir, secuencia que se leen igual de derecha a izquierda
o de izquierda a derecha, un ejemplo en nuestro lenguaje son: 1881, anilina, anita
lava la tina. Cuando las endonucleasas cortan el ADN se forman extremos
cohesivos, los cuales se pueden pegar por complementariedad de bases a
molculas de ADN de otro organismo formando el ADN recombinante. La unin
125
entre fragmentos de ADN es temporal, debido a que se mantienen unidos por
puentes de hidrgeno, sin embargo, la unin puede volverse permanente utilizando
la enzima ligasa del ADN, la cual cataliza la formacin de enlaces covalentes entre
los nucletidos. Ver figura 1.

A
B

C

Figura 1. En el inciso A se muestra un fragmento de ADN que contiene una secuencia de
reconocimiento de una enzima de restriccin, en este caso se corta el ADN entre las bases
A y G y se producen dos filamentos que se denominan "extremos cohesivos o pegagosos".
En el inciso B se muestra una secuencia de ADN de otra especie que fue cortado con la
misma enzima de restriccin. Se observan extremos de un solo filamento idntico en la
secuencia de bases de los extremos cohesivos de ADN. En C se muestra como se une el
ADN a partir de la unin de las bases complementarias por medio de la enzima ligasa.

Vectores. Una vez que se han aislado los fragmentos de ADN que tienen el gen de
inters por medio de las enzimas de restriccin, el siguiente paso es unirlos a un
vector de clonacin. Los vectores son sistemas que permiten introducir en una clula
hospedadora fragmentos del ADN que se pretende clonar; en esta clula el vector se
replica y expresa. Se pueden utilizar vectores mecnicos o biolgicos. Dentro de los
mecnicos se emplean las micropipetas para integrar genes y la pistola de genes
que dispara balas muy pequeas recubiertas con trozos de ADN en la clula. Los
vectores biolgicos son principalmente plsmidos y virus.
Los plsmidos son pequeas secuencias de ADN circular que se localizan fuera del
ADN cromosmico de bacterias y se caracterizan por tener la capacidad de
replicarse de manera independiente del ADN cromosmico. Los plsmidos no son
necesarios para la viabilidad general de las bacterias, pero pueden contener genes
que contribuyen a su supervivencia en condiciones especiales, como los que
confieren resistencia a antibiticos. Por ejemplo, Escherichia coli, al igual que otras
126
bacterias, cuenta con varias clases de plsmidos, por ejemplo los de tipo R que
portan genes que sintetizan enzimas que destruyen antibiticos como la penicilina y
tetraciclina.

Debido a que los plsmidos pueden portar genes y replicarse en las bacterias, son
utilizados como vectores en la tecnologa del ADN recombinante. Primero se asla el
plsmido de una bacteria y por otro lado se obtiene el ADN que tiene el gen de
inters, por ejemplo el que codifica una protena para uso mdico o un gen vegetal
que da resistencia contra insectos dainos. Los plsmidos y el gen de inters se
fragmentan con la misma enzima de restriccin para que sus puntas pegajosas se
complementen y se unan. El plsmido se cierra y se genera el ADN recombinante.
Despus el ADN recombinante se transfiere a la clula husped, la cual al
prepararse para la divisin celular, copia el ADN recombinante junto con su propio
ADN y hace copias llamadas clones.
Actualmente se utiliza la tcnica de reaccin en cadena de la polimerasa (PCR),
mediante la cual segmentos de ADN pueden multiplicarse (clonarse) en un tubo de
ensayo sin hacer uso de clulas vivas. El ADN se mezcla con la enzima polimerasa
del ADN, el ADN se replica produciendo dos molculas de ADN hijas; estas a su vez
se replican; y el proceso contina. Con la tcnica de PCR se pueden generar
millones de copias de ADN en unas cuantas horas, las suficientes para su anlisis.
Por ejemplo, en investigaciones sobre evolucin, la tcnica ha sido utilizada para
amplificar fragmentos de ADN de antepasados humanos momificados o de mamuts
de 40 000 aos, entre otros.
Los csmidos son plsmidos a los cuales se les han adicionado unos segmentos
del genoma de un bacterifago, que son virus que infectan exclusivamente
bacterias, como el fago . Los fagos se utilizan para introducir el material gentico
recombinante en las bacterias, proceso conocido como transduccin. Adems
presentan un gen de resistencia a un antibitico, que ayuda a la identificacin de
clulas huspedes que contienen los csmidos recombinantes del fago . Ver figura
2.
127

Figura 2.
Los csmidos son plsmidos que contienen ADN de virus y fragmentos del ADN a
introducir o de inters. Los csmidos presentan un borde cohesivo procedente del genoma
del fago lambda (extremo cos) y se empaqueta en el interior de un fago. Se unen los tres
elementos gnicos y se introducen en la clula receptora.

Usos del ADN recombinante
Existen una gran cantidad de aplicaciones de la tecnologa de ADN recombinante,
por ejemplo la produccin de vacunas, vitaminas, terapias gnicas, etc., en plantas
se han mejorado especies hacindolas resistente al ataque de plagas. Sin embargo,
a pesar de los beneficios que se pueden obtener mediante el uso de la
biotecnologa, la produccin de organismos transgnicos ha desencadenado
controversias ante las repercusiones negativas que pueden tener a largo plazo. Por
ejemplo la resistencia a los herbicidas pueda pasar de los cultivos transgnicos a
especies silvestres o cultivadas y producir supermalezas, obligando a los
agricultores a utilizar herbicidas ms fuertes y quizs ms nocivos para el ambiente.

Clonacin. Es el proceso por medio del cual se obtienen copias de forma asexual,
genticamente idnticas de un individuo a partir de la informacin de una sola de sus
clulas.

128
Aunque en la naturaleza se obtienen clones de manera natural, como es el caso de
los gemelos idnticos, la obtencin de clones de individuos con ciertas
caractersticas genticas se puede hacer artificialmente en un laboratorio. Al
principio se clonaron ranas por la facilidad de obtencin y manipulacin de sus
huevos, pero las tcnicas se han ido perfeccionando y en la actualidad ya se pueden
clonar mamferos.

Para la clonacin se pueden seguir dos tcnicas: La primera se llama clonacin por
fisin y se realiza cuando un embrin tiene entre cuatro y ocho clulas, las cuales se
separar unas de otras. En esta etapa las clulas son indiferenciadas y tienen la
capacidad de generar individuos completos, por ello al separarlas, cada una dar
origen a un individuo idntico a las dems. La segunda tcnica se conoce como
clonacin por transplante nuclear y consiste en tomar un vulo y extraerle el ncleo
con la finalidad de que no contenga la informacin gentica, de los padres. A
continuacin se toma una clula adulta ya diferenciada, se le extrae su ncleo y se
implanta en el vulo al cual se le retir la informacin gentica, si es un mamfero se
tiene que poner en un medio de cultivo adecuado para posteriormente implantarlo
en un tero para su desarrollo. Desde luego que el individuo tendr la misma
informacin gentica que el individuo donador.

www.bing.com/images/search?q=clonacin+dolly&view=detail&id=0FB3DF8558AE736B31F
28636DF5EADCD7D394D9A&first=61&FORM=IDFRIR

En ganadera la clonacin se utiliza para obtener copias genticas de individuos de
alta productividad de carne, leche etc., y en humanos principalmente su utilizacin
sera con fines teraputicos. Lo que se quiere es producir clulas humanas clonadas
para ser usadas en la cura de alguna enfermedad. La idea es que si falla algn
rgano en un individuo, se pueda tomar clulas de la epidermis de un individuo
donador para obtener un embrin, del cual se extraen las clulas madre capaces de
forman diversos rganos y transplantarlas al rgano daado para que se formen
nuevas clulas sanas.

129


http://www.google.com.mx/imgres?q=Clonacin+sin+embriones&hl=es&biw=1339&bih=849
&gbv=2&tbm=isch&tbnid=uD34qwITRBoHnM:&imgrefurl=http://www.elpais.com/articulo/soci
edad/Cientificos/Boston/logran/celulas/madre/clonicas/usar/embriones/elpepusoc/20070607
elpepisoc_3/Tes&docid=GN0fKGFpNprwM&w=340&h=250&ei=sN1BTtrnOYKPsQKDltzfCQ
&zoom=1&iact=hc&vpx=206&vpy=107&dur=3764&hovh=192&hovw=262&tx=189&ty=143&p
age=1&tbnh=164&tbnw=223&start=0&ndsp=21&ved=1t:429,r:0,s:0


Actividades de aprendizaje.

Despus de revisar el tema y consultar informacin en libros e Internet, responde las
siguientes preguntas.

1. Cul es la funcin de las enzimas de restriccin en las bacterias?
2. Para que se utilizan las enzimas de restriccin en la tecnologa del ADN
recombinante?
3. Qu es un vector? Y Cules son los vectores biolgicos utilizados en la
tecnologa del ADN recombinante?
4. Qu es un extremo cohesivo pegajoso? Dibuja un ejemplo
5. Explica los aspectos negativos que tiene la aplicacin de la ingeniera gentica
6. Anota en el siguientes esquema la palabra que corresponde: (A) ADN
cromosmico (B) ADN recombinante (C) Vector (D) Enzima
restriccin
(F) Enzima ligasa (G) Clula husped
130


7. En la columna de la derecha coloca el nmero que corresponde de acuerdo la
los pasos bsicos de la ingeniera gentica empleados para transformar un
organismo

1. Combinar un gen con otros elementos necesarios (vector)
para que ste sea funcional en el organismo receptor.

2. Crecer y reproducir el organismo receptor, ahora
modificado genticamente

3. Identificar un carcter deseable en el organismo de origen.
4. Transferir el gen de inters, previamente introducido en el
vector adecuado, al organismo receptor.

5. Encontrar el gen responsable del carcter deseado (gen
de inters), aislarlo y caracterizarlo.


















131
8. A un lado de cada uno de los esquemas (A, B y C) coloca una breve explicacin
del proceso que se esta realizando



9.- Describe las dos tcnicas de clonacin

Bibliografa.
Biggs A, Kapicka, C y Lundgren, L. (2000). Biologa. La dinmica de la vida.
Editorial McGrawHill.
Campbell, N. A., Mitchell, L.G., Reece, J. B. (2001). Biologa Conceptos y
relaciones. Editorial PEARSON Addison Wesley. Tercera edicin.
Jimnez, L. F. (Coordinador). (2006). Conocimientos Fundamentales de
Biologa. Coleccin conocimientos fundamentales. Editorial Pearson
Educacin. Pp. 160-165



Aplicaciones e implicaciones de la manipulacin gentica: Organismos
transgnicos, terapia gnica. (Maricela Ramos)

Aprendizaje: El alumno, valora las implicaciones de la manipulacin gentica.

Organismos transgnicos. Los organismos transgnico son animales, vegetales y
microorganismos cuyo genoma ha sido modificado al introducirle genes de otra
especie. Los genes portadores del carcter que se quiere trasmitir, tienen diversos
orgenes (plantas, bacterias, etc.). En el caso de las plantas el gen introducido le
puede permitir resistencia a parsitos: virus, bacterias, hongos o devoradores
(insectos, gusanos, etc.). Por ejemplo, se sabe que algunos genes de la bacteria
Bacillus thuringiensis al introducirse a plantas, hacen que produzcan toxinas eficaces
contra insectos parsitos, reduciendo el uso de insecticidas que contaminan el
ambiente. El vegetal transformado tambin puede obtener resistencia a un herbicida,
o perder la fertilidad de su polen. Otras caractersticas introducidas pueden permitirle
132
a las plantas transformadas ser resistentes al fro, el hielo, la sequa, los suelos
salados o cargados de metales pesados, que sean capaces de fijar el nitrgeno
atmosfrico e incluso que puedan producir compuestos farmacuticos.
En el caso de las plantas se utilizan principalmente dos tcnicas para la
transferencia de genes. Una es la transgnesis que utiliza vectores procedentes de
bacterias (Agrobacterium tumefaciens y A. rhizogenes), capaces de infectar las
clulas vegetales. Despus de haber aislado el gene de inters, se empieza por
integrarlo en plsmidos, pequeas molculas circulares de ADN, que se encuentran
en estas bacterias para despus insertarlo en los cromosomas de las clulas de la
planta.

La segunda tcnica son los mtodos fisicoqumicos que son: la electroporacin que
es por medio de choques elctricos cortos e intensos aplicados a clulas, o
protoplastos, y el de bioltica que es el bombardeo de clulas con micropartculas
cargadas de ADN por medio de una pistola de genes.

Para obtener animales transgnicos se utilizan dos mtodos. A los ratones y otros
mamferos, se puede inyectar directamente una disolucin que contiene el ADN en
un huevo fecundado, por medio de una aguja, bajo control microscpico. La
inyeccin se hace en uno de los dos ncleos producidos por las clulas sexuales
masculina y femenina, justo antes de que se fusionen. Luego se trasplanta el
embrin al tero de la hembra. Otro mtodo es la transgnesis, que slo se puede
practicar en los ratones y que utiliza clulas embrionarias, estas clulas, puestas en
cultivo in vitro, reciben el ADN ajeno por electroporacin o por el mtodo de
Microinyeccin (fig.1).


Figura 1.Metodo por Microinyeccin.

La utilidad de los animales transgnicos es en tres campos: El primero es que se
utilizan cada vez ms como modelos experimentales de enfermedades humanas
como la hipertensin, la aterosclerosis, la diabetes insulinodependiente etc. El
segundo est dando origen a una industria de medicamentos (introducir genes
productores de insulina en bacterias, por ejemplo), as como la transferencia de
genes humanos a los cerdos, para que produzcan rganos de repuesto para
humanos y utilizarlos en trasplantes adems de disminuir el contenido de colesterol
y de grasas en la carne y los huevos, estimular el crecimiento de los peces de cra,
aumentar la productividad lechera del ganado, mejorar la calidad de lana y cuero.
133
Sin embargo, todava es muy insuficiente el conocimiento de los genes para
transferirlos para alcanzar estos fines.

Terapia gnica

La terapia gnica es una tcnica para tratar enfermedades incurables, aunque su
eficacia est por demostrar y sus consecuencias ticas y jurdicas son un problema.
La terapia gnica consiste en corregir de raz los defectos de funcionamiento del
organismo debido a alteraciones de los genes. Para ello, el nico mtodo
actualmente posible en el hombre consiste en introducir el gen sano en las clulas
enfermas por medio de un sistema de transferencia o por inyeccin directa-

La eficacia de la terapia gnica depende en gran parte del modo de insertar el
transgn en la clula husped. En terapia gnica se utilizan dos estrategias.

La primera consiste en extraer clulas de un paciente, modificarlas in vitro, y con
ayuda de un vector retrovrico, y reimplantarlas en el organismo. En tal caso, el
riesgo de rechazo del trasplante por el sistema inmunitario es nfimo, esta estrategia
se conoce como ex vivo y es la ms practicada (fig. 2).


Figura 2: Estrategia ex vivo.

En la segunda estrategia se puede administrar el gen corrector al propio paciente, in
vivo, y no a clulas en cultivo. El inconveniente es que no se puede controlar la
eficacia de la transferencia del gen. La primera se utiliza sobre todo en la terapia de
cncer; la segunda, en enfermedades como la mucoviscidosis que afectan a clulas
que no es posible extraer y reimplantar fcilmente (fig. 3)
134

Figura 3: Estrategia in vivo.
Hasta la fecha entre los vectores vricos ms utilizados se encuentran los retrovirus,
adenovirus y virus adeno-asociados. Estos vectores vricos han demostrado una
eficacia mayor que los qumicos y los fsicos

En los mtodos qumicos sirven de vehculo el fosfato de calcio, los agregados de
lpidos o liposomas, que consiste en inyectar el fragmento de ADN que contiene el
gen de inters directamente a las clulas o empacado dentro de otras molculas,
como los liposomas.

Los vectores fsico involucran sobre todo los inyectores sin aguja que utilizan alta
presin para insertar ADN en clulas de la piel o en clulas de cultivo, y la
electroporacin que utiliza pulsos elctricos que abren temporalmente agujeros en
las membranas de las clulas, permitiendo insertar el ADN. Los mtodos fsicos aun
son ineficientes en la transformacin y tienen un rango limitado de aplicacin.

Las aplicaciones de la terapia gnica ofrecen nuevas posibilidades para tratar las
enfermedades hasta ahora incurables. Pero no carece de riesgos, como el de
diseminar el gen teraputico por el organismo del paciente y por el ambiente. A fin
de limitar los riesgos biolgicos ligados a los protocolos teraputicos, la comisin de
ingeniera gentica ha establecido medidas de confinamiento de los pacientes
tratados. El acceso a locales, la descontaminacin, el seguimiento del personal, etc.,
sern ms o menos estrictos segn el riesgo supuesto.

Los vectores utilizados para trasferir un gen teraputico a las clulas son
principalmente de origen vrico (adenovirus y retrovirus). Dado que su genoma est
incompleto, el vector vrico no puede reproducirse y queda confinado a las clulas
tratadas. No obstante, si encuentra un virus potencialmente nocivo, puede suponer
un peligro de infeccin. Hay entonces riesgo de diseminacin teraputica. Otros
riesgos dependen de las caractersticas especficas de los vectores. Los adenovirus
pueden desencadenar una respuesta del sistema inmunitario. Los retrovirus, al
insertarse al azar en el genoma de la clula husped, pueden activar un oncogn.
Se trata, sin embargo, de un riesgo muy dbil.

135
La obtencin de organismos transgnicos como el uso de la terapia gnica genera
muchas expectativas y muchas necesidades. Sus repercusiones econmicas, ticas,
morales, y legales son de gran proporcin. Aunque el progreso est a nuestro
alcance ser necesaria la reflexin y el debate sobre estas cuestiones, as como la
regulacin, legislacin y vigilancia, en el desarrollo de la ingeniera gentica actual y
del futuro

Actividades de aprendizaje.

1. Identifica e investiga los trminos desconocidos.
2. Investiga en revistas cientficas y/o libros que hagan referencia sobre los pros y
contras en cuanto a la terapia gnica y organismos transgnicos para as poder
tener una opinin propia.

Cuestionario de autoevaluacin.

1. Los organismos que han sido modificados genticamente con una finalidad
ventajosa para su explotacin econmica, por presentar mayor cantidad de masa
(carne), mayor numero de frutos, mejor color de sus flores, o resistencia a un
enemigo natural, se le conoce como:

A) Organismos resistentes
B) Organismos endobiontes
C) Organismos mejorados
D) Organismos transgnicos
E) Organismos mutantes

2. Una de las posibles desventajas para los ecosistemas al emplear en la agricultura
organismos genticamente modificados, como por ejemplo, una especie vegetal
resistente a ser depredada por cierta especie de insecto, podra:

A) Mejorar la produccin
B) Aumentar las especies resistentes
C) Reducir nmero de insectos
D) Mejorar el ambiente.
E) Incrementar cadenas alimenticias

3. Una de las aplicaciones de la manipulacin gentica es para desarrollar
tratamientos de enfermedades en el humano y recibe el nombre de:

A) Investigacin genmica
B) Investigacin biotecnolgica
C) Terapia cromosmica
D) Terapia gnica
E) Tecnologa de replicacin





136

4. Los vectores utilizados para modificar genticamente un organismo son:

A) Hongos y virus
B) Virus y protozoarios
C) Bateras y virus
D) Bateras y levaduras
E) Protozoarios y bacterias


Respuestas.

1. D
2. B
3. D
4. C
Bibliografa:
Cohen-Haguenauer, O. & Bordignon, C. 1977. Las esperanzas de la
terapia gnica. Mundo Cientfico. 153(15): 17-21.
Habert, P. 1977. La ingeniera gentica probada en los campos. Mundo
Cientfico. 153(15):30-36.
Houdebine, L, M. 1977. El bilogo y el animal transgnico. Mundo
Cientfico. 153(15):37-41.
http://cms7.blogia.com/blogs/c/ci/cie/cienciblog/upload/20090304174613-
microinyeccion.jpg
http://iescarin.educa.aragon.es/estatica/depart/biogeo/varios/BiologiaCurtis/Secci
on%203/19-19b.jpg

Implicaciones bioticas del proyecto genoma humano y de la clonacin
de organismos. (Hctor Rivera V.)

Aprendizaje. Valora las implicaciones bioticas del Proyecto Genoma Humano y de
la clonacin de organismos.

El genoma es el conjunto de secuencias de ADN que caracterizan a un individuo o
una especie.

En el caso de los humanos el genoma est contenido en 23 pares de cromosomas
en clulas diploides, y por lo tanto, el genoma haploide contiene slo un cromosoma
de cada par. La informacin gentica esta contenida a lo largo de la secuencia de
bases nitrogenas y se calcula que una slo cadena de ADN contiene 3,200 millones
de bases. En una clula diploide el nmero de bases ser de 6,400 millones, el cual
contienen toda la informacin gentica de un individuo. Esta informacin esta
organizada en genes y se calcula que pueden ser entre 20,000 y 25,000. Como los
genes se expresan en protenas, estas son las principales molculas con funciones
enzimticas, estructurales y metablicas y por lo tanto el genoma contiene la
informacin necesaria para el desarrollo fsico y adaptativo del ser humano.

137
El objetivo del Proyecto Genoma Humano es elaborar un mapa gentico de nuestra
especie, esto es: determinar la ubicacin (en que cromosoma y en que locus, se
encuentra un determinado gen) y funcin de cada gen.

El Proyecto Genoma Humano se estableci con la intensin de conocer y determinar
la secuencia de pares de bases nitrogenadas que componen el ADN, para entender
como funciona el organismo, utilizar la informacin en el tratamiento y cura de
enfermedades, adquirir conocimientos sobre los factores medioambientales y
genticos que predisponen o dan resistencia a enfermedades y como registro de la
historia evolutiva de nuestra especie, pero slo cerca del 5% del total del genoma
humano est compuesto por genes (exones) capaces de producir protenas - el resto
son remanentes de la historia evolutiva de nuestro genoma que no se expresan.

La investigacin sobre el Genoma Humano, que debera ser neutral, por estar
necesariamente sujeta a financiamientos muy importantes y cuantiosos no slo tiene
intereses puramente cientficos, sino tambin intereses econmicos y desde luego
ticos, pues afectara intereses y derechos particulares de personas y de
comunidades.

Entre los aspectos positivos del proyecto esta la posibilidad de modificar secuencias
de genes. Por ejemplo; Si un individuo es incapaz de elabora enzimas u hormonas,
por razones genticas (secuencia de bases inadecuadas para la elaboracin de
dicha molcula) se puede modificar la secuencia para una buena elaboracin de la
protena y se podra hacer en cualquiera de las muchas enfermedades genticas
identificadas hasta la fecha o para futuras enfermedades. Otro punto importantes a
su favor es la posibilidad de elabora frmacos especficos (farmacogentica) de
acuerdo a la sensibilidad individual a determinado tratamiento, tambin, conociendo
el genoma de una persona se puede anticipar la predisposicin a ciertas
enfermedades para prevenir o retrasar su aparicin o lograr su cura.

En cuanto a la posibilidad de estudiar nuestra historia evolutiva, el Proyecto Genoma
Humano es una herramienta de primera mano, pues incluso nos permite rastrear a
travs de las mutaciones acumuladas el origen tnico de un individuo o de un grupo,
de esta manera se ha hecho el mapa geogrfico del desplazamiento humano a lo
largo del planeta y confirmar la hiptesis Fuera de frica que explica nuestro origen
africano y su dispersin a travs del planeta y no se diga, determinar el grado de
parentesco entre el humano y otros primates. Ya sabemos que nuestro pariente
ms cercano es el chimpanc, pues tenemos una coincidencia gentica cercana al
99%

Un aspecto negativo del conocimiento que se puede obtener del proyecto, implica
tambin dar a conocer la intimidad de personas en su pasado, presente y futuro,
especialmente cuando dicho conocimiento pueda constituir una amenaza para el
orden social, religioso y cultural de las mismas. Uno de los principales problemas
ser las implicaciones en el transplante de rganos, pues puede ser mal visto el
donador o receptor del transplante, por pertenecer alguno de ellos a cierto grupo
tnico. Los prejuicios contra personas enfermas; cuando su enfermedad sea
gentica e incapacitante, puede surgir el deseo de liberarse de la carga econmica,
de tiempo y trabajo que implique su tratamiento, esto sobre todo, cuando esta
138
persona de la cual se conoce su genoma, tenga que contratar un seguro medico,
que se le puede negar o incluso imponer cuotas muy elevadas para asegurarlo,
tambin la informacin sobre el genoma de una persona o una poblacin, puede
generar la idea de tener una poblacin libre de individuos con enfermedades
genticas e intentar eliminarlos, o en ciertos casos, discriminar y no emplear a
personas con carga gentica de enfermedades con la finalidad de evitar permisos,
incapacidades y hospitalizacin.

Por otro lado se ha establecido que el conocimiento del genoma humano en su
estado natural no debe dar lugar a beneficios econmicos (Declaracin Universal
sobre el genoma humano), pero, qu es el genoma humano en su estado natural?
es slo su extraccin? o su inclusin en un medo qumico modifica dicho estado y
permite su patente.

Todo descubrimiento, incluyendo el cientfico, tiene implicaciones que no se pueden
apreciar hasta despus de un tiempo, por lo que debemos estar preparados como
sociedad para enfrentar con conocimiento las implicaciones sobre todo de nuestra
herencia gentica, y para ello, debemos estar informados.

Implicaciones. En la clonacin animal y vegetal las ventajas para obtener
organismos ms productivos es innegable y til, pero no hay que olvidar que una
poblacin genticamente sana es aquella donde abunda la variabilidad gentica,
puesto que si aparece una enfermedad para la cual no hay defensa toda la
poblacin, por tener las mismas caractersticas, corre peligro de desaparecer por la
muerte de todos los individuos, que es el peligro que se corre siempre que se pierde
variabilidad gentica. Adems se han presentado una amplia variedad de
anomalas: envejecimiento prematuro, problemas de corazn y pulmn, riones
deficientes, intestinos bloqueados, sistema inmune debilitado, malformaciones
fsicas entre otros problemas y hasta ahora no se han podido solucionar. En cuanto
a la clonacin humana, los problemas antes mencionados hacen inviable la
clonacin de individuos y, desde el punto de vista tico nos debemos preguntar que
valor tendra el clonar a un individuo slo para satisfacer los caprichos de quien
tenga el dinero para hacerlo. En el aspecto ms importante y factible hasta ahora, la
clonacin con fines teraputicos utilizar las clulas madre de un embrin para
trasplantarlas a un individuo que las necesita, se formaran embriones que nunca
llegaran a formar un individuo, slo se utilizaran algunas clulas y lo dems se
desechara. Por otro lado, al realizar un trasplante de clulas madre hay que
asegurarse de que todas estn diferenciadas en el tejido deseado; si las hubiera sin
diferenciar podran crear un cncer en el receptor.

Actividades de aprendizaje.

1. Haz un glosario de trminos.
2. Busca en Internet informacin sobre el Proyecto Genoma Humano y sus
implicaciones.



Cuestionario de autoevaluacin

139
1. Conjunto de secuencias de ADN que caracterizan a un individuo o especie.

A) Gen
B) Genotipo
C) Genoma
D) Gentica
E) Genmica

2. El genoma haploide esta representado por_______________________________

A) clulas triploides.
B) clulas diploides.
C) clulas tetraploides
D) pares de cromosomas.
E) un cromosoma de cada par.

3. El genoma humano est contenido entre__________________ genes.
A) 10,000 a 15,000
B) 15,000 a 20,000
C) 20,000 a 25,000
D) 25,000 a 30,000
E) 30,000 a 35,000

4. El objetivo del Programa Genoma Humano es determinar ___________________

A) la funcin de los genes.
B) las enfermedades genticas.
C) el nmero de genes de nuestra especie.
D) la ubicacin de los genes dentro de los cromosomas.
E) la ubicacin de los genes dentro de los cromosomas y su funcin.

5. Con los conocimientos del Proyecto Genoma Humano se pueden corregir
defectos genticos mediante___________________________________________

A) la aplicacin de drogas
B) utilizando radiacin ionizante
C) la utilizacin de medicamentos
D) introduciendo virus a las clulas
E) modificando secuencias errneas.

6. Es la obtencin de forma asexual de copias idnticas de individuos.

A) Meiosis
B) Clonacin
C) Ovognesis
D) Regeneracin
E) Espermatognesis

7. Un inconveniente de la clonacin y la obtencin de muchos individuos iguales
genticamente es la obtencin de:
140

A) desordenes fisiolgicos
B) envejecimiento prematuro
C) posibles malformaciones
D) bloqueo de funciones gnicas
E) escasez de variabilidad gentica.


Respuestas

1. C
2. E
3. C
4. E
5. E
6. B
7. E



Bibliografa:

Cohen-Haguenauer, O. & Bordignon, C. 1977. Las esperanzas de la terapia
gnica. Mundo Cientfico. 153(15): 17-21.
Habert, P. 1977. La ingeniera gentica probada en los campos. Mundo
Cientfico. 153(15):30-36.
Houdebine, L, M. 1977. El bilogo y el animal transgnico. Mundo Cientfico.
153(15):37-41.