Professional Documents
Culture Documents
Abstract
Conde MCM, Nedel F, Campos VF, Smith AJ, No r JE, Demarco FF, Tarquinio SB. Odontoblast RNA stability in
different temperature-based protocols for tooth storage. International Endodontic Journal, 45, 266272, 2012.
Aim To evaluate the effect of four tooth storage temperature-based methods on quality of RNA obtained from cells retrieved from human dental pulps and human pre-dentine. Methodology RNA was isolated from dental pulp tissue and from cells retrieved by scraping the predentine of freshly extracted human third molars (n = 15) using TRIzol reagent. Teeth were randomly assigned to the following temperature conditions: immediate RNA isolation after tooth extraction, liquid nitrogen (24 h), )80 C (24 h), 20 C (24 h) and
4 C (6 h). RNA integrity was checked by the density of 28S and 18S ribosomal RNA. RT-PCR was used to analyse the expression of odontoblast makers (DSPP, DMP1 and MEPE) and the housekeeping gene GAPDH. Results All experimental conditions evaluated preserved RNA integrity. The three odontoblastic markers were amplied from the pulp tissue and from the cells associated with pre-dentine. Conclusion The four storage options allowed RNA isolation for RT-PCR analysis. These ndings may facilitate the use of clinically derived human dental pulp and odontoblasts for endodontic research. Keywords: dental pulp, dentin, extracellular matrix proteins, odontoblast, RNA stability.
Received 18 May 2011; accepted 23 September 2011
Introduction
Recent advances in molecular and cellular biology have led to new perspectives in pulp regeneration research (Nor 2006, Demarco et al. 2011). Evidence has shown that the dental pulps of both permanent and primary teeth contain a highly proliferative and multilineage subpopulation of cells named dental pulp stem cells (DPSC) and stem cells from human exfoliated deciduous teeth (SHED), respectively (Gronthos et al.
Correspondence: Sandra B. C. Tarquinio, Post-Graduate Program of Dentistry, Federal University of Pelotas, Rua Gonc alves Chaves, 4575o Andar, Pelotas, RS 96015-560, Brazil (e-mail: sbtarquinio@gmail.com).
2000, Miura et al. 2003, Nedel et al. 2009). These cells are capable of differentiating into a variety of cell types, including odontoblasts (Gronthos et al. 2002). When a tooth is subjected to deep cavity preparation, severe carious lesions or trauma, destruction of the odontoblast layer may occur (Mjor 2009), attracting these multipotent progenitor stem cells to the injury site. Thereafter, these cells differentiate into odontoblast-like cells, replacing the necrotic odontoblasts, and are responsible for reparative dentine matrix deposition (Smith et al. 2008). In dentistry, the future goal is to repair the tooth structure damaged by deep caries lesions or trauma, based on regenerative endodontic procedures (Demarco et al. 2011). However, the translation of regenerative
266
endodontics to the clinic requires better understanding of specic cellular signals required for the differentiation of stem cells into odontoblasts (Smith et al. 2008). Odontoblasts are characterized by expression of specic extracellular matrix components, including dentine sialoprotein (DSP) and dentine phosphoprotein (DPP), two highly phosphorylated non-collagenous proteins secreted by odontoblasts and codied by DSPP gene (MacDougall et al. 1997). DSPP mRNA is up-regulated in a time-dependent manner when DPSCs are cultured in odontogenic induction medium (Demarco et al. 2010). Dentine matrix protein 1 (DMP1) has calcium-binding properties and has been implicated in hydroxyapatite nucleation processes (Qin et al. 2007). DMP1 has also been reported to induce DPSC differentiation into odontoblast-like cells (Narayanan et al. 2001, Almushayt et al. 2006). Matrix extracellular phosphoglycoprotein (MEPE) is a SIBLING protein related to bone metabolism (Petersen et al. 2000), and a MEPE fragment called dentonin, detected in dental tissues, can also promote DPSC differentiation into odontoblast-like cells (Liu et al. 2004). Thus, a deep molecular knowledge of odontoblast behaviour is crucial to the development of new therapies for pulp regeneration (Liu et al. 2004). Gene expression studies require the isolation of highquality RNA (Lader 2003, Ginsberg 2005). For this, protein denaturants, such as guanidinium isothiocyanate (TRIzol family of reagents; Invitrogen, Carlsbad, CA, USA), have been used (Lader 2003) to extract tissues rapidly and minimize the effects of thermo-stable RNAses liberated during cell lysis (Miyamoto et al. 2009). When immediate RNA isolation is impossible, the storage of tissues at )80 C or in liquid nitrogen is effective (McLachlan et al. 2003). However, specialist cold facilities such as )80 C freezers, or even liquid nitrogen, are often inaccessible within many healthcare settings. RNAse-retarding solutions, such as RNAlater, are effective in tissue storage prior to RNA isolation (Mutter et al. 2004). However, to be efcient, RNAse-retarding solutions depend on passive diffusion to reach the cells to provide protection from nuclease action (Lader 2003). For teeth, there is generally poor penetration of solutions, such as RNAlater or chemical xatives, because of the poor permeability of the mineralized tissues, so it is necessary to excise and fragment the dental pulp to allow RNAlater diffusion. Thus, the aim of this study was to evaluate the effects of four different temperature-based protocols for tooth storage prior to RNA isolation from human teeth.
267
Figure 1 Graphic representation of tooth storage protocols, tooth sectioning, pulp removal and pre-dentine scraping.
thoroughly. Then, 200 lL of chloroform (Synth; LabSynth, Diadema, SP, Brazil) was added, and the samples were again vortexed prior to centrifugation (Microcentrifuge 5415 R refrigerated; Eppendorf, Westbury, NY, USA) for 15 min (1300 rmp - revolutions per minute - at 4C). The aqueous phase was transferred to a new tube, and RNA was precipitated with 500 lL of isopropanol (Synth; LabSynth) for 10 min at room temperature and then centrifuged for 10 min (1300 rmp at 4C) for pellet collection. Isopropanol was discarded and the pellet washed with 1 mL of 75% (v/v) ethanol (Synth; LabSynth) before centrifugation for 5 min (1300 rmp at 4C). Ethanol was discarded, and the pellet was dissolved in 20 lL of nuclease-free water (Invitrogen) before storage at )80 C in an ultra-freezer. Total RNA extracted was pooled for each temperature storage condition, to minimize individual patient differences and to provide sufcient RNA for analysis. RNA was quantied using a Qubit kit, a uorescence-based quantitation assay (Invitrogen, Eugene, OR, USA).
Green Safe DNA gel stain (Invitrogen, OR). Total RNA at 200 ng was electrophoresed for each sample. Gel images were imported into TotalLab Phoretix Quant image analysis software (NonLinear Dynamics; Quayside, Newcastle-Upon-Tyne, UK) to calculate the densities of 28S and 18S ribosomal RNA.
RNA integrity
RNA integrity was checked by electrophoresis on a denaturing agarose gel at 1.5% stained with SYBR
268
Table 1 Primer sequences and annealing temperatures used for gene expression analyses
Primer sequence (Genbank) GAPDH DSPP DMP1 MEPE Forward 5 GACCCCTTCATTGACCTCAACT 3 Reverse 5 CACCACCTTCTTGATGTCATC 3 Forward 5 GACCCCTTCATTGACCTCAACT 3 Reverse 5 TGCCATTTGCTGTGATGTTT 3 Forward 5 CAGGAGCACAGGAAAAGGAG 3 Reverse 5 CTGGTGGTATCTTGGGCACT 3 Forward 5 GCAAAAGCACCCATCGTATT 3 Reverse 5 CTGCCCTCTACAAGGCTGAC 3 Annealing temperature (C) 55 50 50 50 Product size (bp) 683 181 213 385
Results
Electrophoresis on a denaturing agarose gel showed the overall quality of RNA obtained from teeth under the conditions evaluated. The bands of 28S and 18S could be seen clearly by agarose gel electrophoresis. The 28S rRNA band was approximately twice as intense as the 18S rRNA band (Fig. 2), showing the relative RNA integrity. The relative effectiveness of the different storage conditions was evaluated after the amplication of representative odontoblast markers and GAPDH. The data obtained in the experiment indicated that the RNA from GAPDH and the odontoblasts markers were amplied in all storage conditions (Fig. 3). These data together showed that it was possible to isolate nondegraded odontoblast RNA. The analysis showed similarities in gene expression for control and experimental conditions, indicating preservation of RNA integrity in all temperaturedependent storage conditions evaluated. Interestingly,
the odontoblast marker gene expression was similar in both pre-dentine and pulp tissue samples.
Discussion
The vision of regenerative endodontics and pulp tissue engineering is opening up exciting opportunities for new treatment modalities in endodontics, based on the cellular and molecular events taking place (Demarco et al. 2011). Laboratory-based in vitro studies are fundamental to the study of these cellular and molecular events, and whilst animal studies have an important role, there is a need to study these events in human-derived tissues (Nor 2006). Both ethical and logistical considerations can constrain the sourcing of human tissues from clinics, and there is a need to maximize opportunities for collection of extracted teeth for use in research. RNAses present in tissues can lead to rapid degeneration of RNA and represent a major shortcoming to be overcome in measuring gene expression (Lader
Figure 2 The 28S and 18S rRNA proles showing RNA integrity (b,d). Gel images were imported into TotalLab Quant image
269
Figure 3 RT-PCR analysis showing gene amplication from human sound dental pulp tissue (b,d). Gel images were imported into
TotalLab Quant image analysis software and the pixel density of amplied products images normalized against GAPDH (a,c). RT, room temperature; LN, liquid nitrogen (24 h); )80: )80 C (24 h); )20: )20 C (24 h); 4: 4 C (6 h).
2003). Rapid freezing of animal tissues by immersion in liquid nitrogen and storage at )80 C is effective in minimizing degradation by RNAses, if a tissue sample cannot be rapidly homogenized by a chaotropic agent (Lader 2003). The results demonstrate that use of simple domestic cooling facilities (4 C fridge or )20 C freezer) for periods of up to 24 h is adequate for storage of tooth specimens for subsequent recovery of RNA of adequate quality for use in PCR gene expression studies. Such facilities are readily available in most clinical healthcare settings and should allow researchers the possibility to maximize the opportunities for collection of extracted teeth for research purposes, including preservation for RNA isolation, thereby avoiding tooth disposal. This circumvents the need for more specialist cool storage facilities, such as )80 C ultra-freezers, or maintaining a supply of liquid nitrogen to store samples until they can be homogenized. Furthermore, in this manner, human tooth disposal can be avoided, which might be used as positive controls in pulp tissue engineering studies (Smith et al. 2008). Mutter et al. (2004) showed that split samples of fresh human tissue yield quantitatively similar RNA expression proles whether processed fresh, frozen or following 2472 h storage in RNALater. However, in order for RNAlater to be effective, large pieces of tissue (like pulp tissue) must be dissected into small pieces and any protective membrane must be removed, because RNAlater enters the tissue through passive diffusion (Lader 2003, Mutter et al. 2004). The dental hard tissues render the tooth mineral impermeable, and conse-
quently, RNAlater is ineffective for RNA preservation from pulp and dentine without prior pulp dissection. In the present study, a temperature-dependent storage method has been described that enables the isolation of intact dental RNA without prior tooth processing. DSPP, DMP1 and MEPE were selected as candidate genes representative of the odontoblast phenotype to verify whether RNA was obtained from odontoblast cells. Whilst DSP has been implicated in regulation of the onset of dentine matrix mineralization, DPP is thought to be involved in mineralized dentine maturation (Yamakoshi 2009). The association of DSPP mutations with dentinogenesis imperfecta types I and II and dentine dysplasia type II (MacDougall et al. 2006) emphasizes the important roles of the genes in dentinogenesis. Mature odontoblasts down-regulate their expression of DSPP (Simon et al. 2009) reecting the temporal pattern of DSPP expression (Goldberg & Smith 2004). In the present study, GAPDH, DSPP, DMP1 and MEPE were amplied in all the conditions. Expression of MEPE in the present specimens is in agreement with previous studies showing its expression in odontoblasts (MacDougall et al. 2002, Wei et al. 2007), although MEPE has been reported to be downregulated when DPSC differentiate into odontoblast-like cells (Liu et al. 2005). The latter observation may reect some differences in pathological versus physiological differentiation of odontoblasts. In the present study, the expression of odontoblast markers and GAPDH was observed, both in pulp and pre-dentinederived tissues. The results emphasize that both tissues can be used as RNA sources as demonstrated by
270
analysis of ribosomal RNA (18S 28S), which showed the RNA integrity in pulp and pre-dentine-derived samples. Earlier studies (McLachlan et al. 2003) have provided a technique whereby odontoblasts can be recovered from teeth after pulpal extirpation either associated with the pulp or the pre-dentine surface according to temperature of tissue treatment. The association of these markers representative of odontoblasts with both pulp and the scraped pre-dentine surfaces in the present study suggests that odontoblasts were recovered in association with both tooth tissue fragments after pulpal extirpation, possibly as a result of the technique used by us to remove pulp tissue for RNA isolation. Whilst all of these data indicate that the storage protocols examined in the present study allow the isolation of RNA for genes representative of odontoblasts, the expression of these genes in other tissues e.g. DSPP and DMP1 in bone (Qin et al. 2002, 2007) highlights the absence of markers that are absolutely specic to odontoblasts and dentine and the need to consider relative expression patterns of a panel of genes when investigating cell phenotype. In summary, this report elucidates the tissue storage conditions that can be used for teeth post-extraction, which allow subsequent isolation of RNA of adequate quality for PCR gene expression studies. Use of these conditions will allow researchers to maximize opportunities for collection of human tooth specimens for a variety of studies.
Conclusion
This report shows tissue storage conditions that allow for gene expression analysis from recently extracted human teeth. Use of these conditions expands the opportunities for collection of human tooth specimens for mechanistic studies of the human dental pulp.
Acknowledgements
This study was supported by a scholarship (BEX 02341) to the rst author and a grant (484329/2007-3) provided by two Brazilian Government Agencies (CAPES and CNPq) to FFD.
References
Almushayt A, Narayanan K, Zaki AE, George A (2006) Dentin matrix protein 1 induces cytodifferentiation of dental pulp stem cells into odontoblasts. Gene Therapy 13, 61120.
Casagrande L, Demarco FF, Zhang Z et al. (2010) Dentinderived BMP-2 and odontoblast differentiation. Journal of Dental Research 89, 6038. Demarco FF, Casagrande L, Zhang Z et al. (2010) Effects of morphogen and scaffold porogen on the differentiation of dental pulp stem cells. Journal of Endodontics 36, 180511. Demarco FF, Conde MC, Cavalcanti BN et al. (2011) Dental pulp tissue engineering. Brazilian Dental Journal 22, 313. Ginsberg SD (2005) RNA amplication strategies for small sample populations. Methods 37, 22937. Goldberg M, Smith AJ (2004) Cells and extracellular matrices of dentin and pulp: a biological basis for repair and tissue engineering. Critical Reviews in Oral Biology & Medicine 15, 1327. Gronthos S, Mankani M, Brahim J, Robey PG, Shi S (2000) Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proceedings of the National Academy of Sciences of the United States of America 97, 1362530. Gronthos S, Brahim J, Li W et al. (2002) Stem cell properties of human dental pulp stem cells. Journal of Dental Research 81, 5315. Lader ES (2003) Methods and reagents for preserving RNA in cell and tissue samples, United States Patent 20030114651A1. Boyds, MD, USA, 2003 Jun 19. Liu H, Li W, Gao C et al. (2004) Dentonin, a fragment of MEPE, enhanced dental pulp stem cell proliferation. Journal of Dental Research 83, 4969. Liu H, Li W, Shi S et al. (2005) MEPE is downregulated as dental pulp stem cells differentiate. Archives of Oral Biology 50, 9238. MacDougall M, Simmons D, Luan X, Gu TT, DuPont BR (1997) Assignment of dentin sialophosphoprotein (DSPP) to the critical DGI2 locus on human chromosome 4 band q21.3 by in situ hybridization. Cytogenetics and Cell Genetics 79, 1212. MacDougall M, Simmons D, Gu TT, Dong J (2002) MEPE/ OF45, a new dentin/bone matrix protein and candidate gene for dentin diseases mapping to chromosome 4q21. Connective Tissue Research 43, 32030. MacDougall M, Dong J, Acevedo AC (2006) Molecular basis of human dentin diseases. American Journal of Medical Genetics Part A 140, 253646. McLachlan JL, Smith AJ, Sloan AJ, Cooper PR (2003) Gene expression analysis in cells of the dentine-pulp complex in healthy and carious teeth. Archives of Oral Biology 48, 273 83. Miura M, Gronthos S, Zhao M et al. (2003) SHED: stem cells from human exfoliated deciduous teeth. Proceedings of the National Academy of Sciences of the United States of America 100, 580712. Miyamoto T, Okano S, Kasai N (2009) Irreversible thermoinactivation of ribonuclease-A by soft-hydrothermal processing. Biotechnology Progress 25, 167885. Mjor IA (2009) Dentin permeability: the basis for understanding pulp reactions and adhesive technology. Brazilian Dental Journal 20, 316.
271
Mutter GL, Zahrieh D, Liu C et al. (2004) Comparison of frozen and RNALater solid tissue storage methods for use in RNA expression microarrays. BMC Genomics 5, 88. Narayanan K, Srinivas R, Ramachandran A et al. (2001) Differentiation of embryonic mesenchymal cells to odontoblast-like cells by overexpression of dentin matrix protein 1. Proceedings of the National Academy of Sciences of the United States of America 98, 451621. Nedel F, Andre Dde A, de Oliveira IO et al. (2009) Stem cells: therapeutic potential in dentistry. Journal of Contemporary Dental Practice 10, 906. Nor JE (2006) Tooth regeneration in operative dentistry. Opererative Dentistry 31, 63342. Petersen DN, Tkalcevic GT, Mansolf AL, Rivera-Gonzalez R, Brown TA (2000) Identication of osteoblast/osteocyte factor 45 (OF45), a bone-specic cDNA encoding an RGDcontaining protein that is highly expressed in osteoblasts and osteocytes. The Journal of Biological Chemistry 275, 3617280.
Qin C, Brunn JC, Cadena E et al. (2002) The expression of dentin sialophosphoprotein gene in bone. Journal of Dental Research 81, 3924. Qin C, DSouza R, Feng JQ (2007) Dentin matrix protein 1 (DMP1): new and important roles for biomineralization and phosphate homeostasis. Journal of Dental Research 86, 113441. Simon S, Smith AJ, Lumley PJ et al. (2009) Molecular characterization of young and mature odontoblasts. Bone 45, 693703. Smith AJ, Lumley PJ, Tomson PL, Cooper PR (2008) Dental regeneration and materials: a partnership. Clinical Oral Investigations 12, 1038. Wei X, Ling J, Wu L, Liu L, Xiao Y (2007) Expression of mineralization markers in dental pulp cells. Journal of Endodontics 33, 7038. Yamakoshi Y (2009) Dentinogenesis and dentin sialophosphoprotein (DSPP). Journal of Oral Biosciences 51, 134.
272