Universidade de Aveiro Departamento de Biologia 2011

Maria Ftima da Fonseca

Carbapenemases de Serratia fonticola UTAD54 Carbapenemases of Serratia fonticola UTAD54

Universidade de Aveiro Departamento de Biologia 2011

Maria Ftima da Fonseca

Carbapenemases de Serratia fonticola UTAD54

Dissertao apresentada Universidade de Aveiro para cumprimento dos requisitos necessrios obteno do grau de Doutor em Bioqumica, realizada sob a orientao cientfica do Prof. Doutor Antnio Carlos Matias Correia, Professor Catedrtico do Departamento de Biologia da Universidade de Aveiro e do Prof. Doutor James Spencer, Professor do Department of Cellular and Molecular Medicine da Universidade de Bristol (UK).

Apoio financeiro do POPH-QREN, comparticipado pelo FSE, atravs da Bolsa de Doutoramento da FCT com a referncia SFRH/BD/30490/2006

To my husband for his endless love and care.

o jri
Presidente Prof. Doutor Jos Carlos da Silva Neves
professor Catedrtico do Departamento de Electrnica da Universidade de Aveiro

Prof. Doutor Jean-Denis Docquier

professore Aggregato do Dipartimento di Biotecnologie da Universidade de Siena

Prof. Doutor Francisco Manuel Lemos Amado

professor Associado do Departamento de Qumica da Universidade de Aveiro

Prof. Doutora Ana Cristina de Fraga Esteves

professora Auxiliar Convidada do Departamento de Biologia da Universidade de Aveiro

Doutor Joo Morais-Cabral

investigador Principal do Instituto de Biologia Molecular e Celular da Universidade do Porto

Prof. Doutora Maria Jos Flix Saavedra

professora Associada com Agregao do Departamento de Cincias Veterinrias da Universidade de Trs-os-Montes e Alto Douro

Prof. Doutor James Spencer

professor da School of Cellular and Molecular Medicine da Universidade de Bristol

Prof. Doutor Antnio Carlos Matias Correia

professor Catedrtico do Departamento de Biologia da Universidade de Aveiro

agradecimentos

I feel this is the last part of a long but, at the same time, remarkable journey. This project was developed in the Department of Biology at University of Aveiro and in the School of Cellular and Molecular Medicine at University of Bristol. I wish to thank both Institutions and their staff for providing me access to their facilities, and FCT for funding this work (PhD grant SFRH/BD/30490/2006). During these years I have met and worked with numerous people and therefore there are many to thank for valuable help and support. I am deeply grateful to my supervisors, Dr. Antnio Correia and Dr. James Spencer who offered me the opportunity to work in this project. I would like to thank Dr. Antnio Correia for his encouragement, constant enthusiasm and guidance, and Dr. James Spencer for introducing me the field of protein crystallography, his extensive knowledge and valuable advice, as well as his careful reading of this dissertation. In addition, I enjoyed their kindness and patience; they never quit believing in my ability to accomplish this task, even when I doubted it myself. Also important, I thank their friendship. I would like to acknowledge my colleagues and friends in the lab during the years, for the wonderful atmosphere lived there and for supporting me whenever I needed. I am particularly indebted to Isabel who helped in many ways and shared her knowledge of molecular biology, and to Cristina, who introduced me the amazing protein world, for helpful discussions and suggestions. I am as well thankful to my colleagues and friends from D60 and C-floor in Bristol, for their generous help and support in the lab, and Alex, Zoe and Aisha for the great moments outside the lab. Further, I wish to express my gratitude to all the collaborators of this project and co-authors of my manuscripts for their great assistance and skilful comments that greatly contributed to the improvement of this work. I would like to thank Chris Arthur (University of Bristol), and Bart Samyn and Pablo Moerman (Ghent University) for performing mass spectrometry and protein sequencing experiments, and Beth Bromley (University of Bristol) for assisting me with the CD measurements. Also my friends who have accompanied me throughout the years were important to my success ... Thank you all! I will never forget Madams coffee break; it was revitalizing and helped keeping me sane (as possible). The most special thanks is to my family for their unconditional love, kindness and encouragement during the years of my study, and particularly to my husband Fernando for his endless love, enduring support and understanding through all the time of my absence and the preparation of this dissertation.

palavras-chave

Beta-lactamases, mecanismos de resistncia a antibiticos, antibiticos lactmicos, carbapenemos, metalo--lactamases, carbapenemases.

resumo

As carbapenemases, sernicas e metalo--lactamases (MBLs), formam um grupo cada vez mais importante de -lactamases capazes de tornar as bactrias resistentes a antibiticos -lactmicos, incluindo carbapenemos utilizados como antibiticos de ltimo recurso no tratamento de infeces causadas por bactrias multirresistentes. De modo a compreender melhor a relao estrutura-funo deste grupo de enzimas, prosseguimos com a caracterizao bioqumica e estrutural das carbapenemases SFC-1 e Sfh-I especficas de Serratia fonticola UTAD54, uma estirpe ambiental isolada previamente de guas de consumo no tratadas no Nordeste de Portugal. Ambas as -lactamases foram sobre-expressas em Escherichia coli e purificadas por cromatografia lquida. A SFC-1 recombinante, uma carbapenemase sernica, hidrolisa eficientemente antibiticos -lactmicos de todas as classes e exibe, comparativamente a enzimas relacionadas (ex. KPC), uma maior eficincia contra a ceftazidima e uma menor susceptibilidade aos inibidores convencionais das -lactamases. As estruturas do cristal da SFC-1 nativa e de complexos de mutantes, obtidos por mutagnese dirigida, com o meropenemo no hidrolisado e na forma de acetilenzima foram determinados por substituio molecular utilizando cristalografia de raios-X. A estrutura da SFC-1 contm todas as caractersticas conservadas do centro activo das carbapenemases de classe A. Nas estruturas dos mutantes o meropenemo aparece orientado no centro activo por Thr236 e Thr238, posicionando-o prximo da Ser130 para a transferncia do proto. Nas enzimas de classe A inibidas por carbapenemos, a interaco com a Arg244 impe uma orientao diferente do meropenemo ligado, prejudicando a transferncia do proto. Estas constituem as primeiras estruturas de uma carbapenemase de classe A com um carbapenemo no centro activo e revelam que estas enzimas alteram a orientao do meropenemo ligado para promover a catlise, sem alterao significativa da estrutura geral. A Sfh-I, tal como as outras MBLs da subclasse B2, apresenta um perfil de substratos reduzido, que inclui maioritariamente os carbapenemos. A Sfh-I hidrolisa imipenemo e -1 meropenemo com um kcat de 51 e 109 s e um KM de 79 e 215 M, respectivamente. A Sfh-I liga um equivalente de zinco, como demonstrado por espectrometria de massa. Contrariamente a enzimas da subclasse B2 previamente caracterizadas, a Sfh-I hidrolisa a cefepima, mostrando que a SfhI uma MBL da subclasse B2 com propriedades nicas. Por espectroscopia de fluorescncia mostrou-se que a Sfh-I capaz de ligar at 3 equivalentes de zinco (Kd2 = 95 M; Kd3 = 2.3 mM). A estrutura do cristal da Sfh-I, determinada por substituio molecular utilizando a CphA como modelo, a primeira para uma MBL da subclasse B2 no ligada. Esta estrutura revela a disposio das molculas de gua no centro activo corroborando um mecanismo cataltico para as MBLs da subclasse B2 no qual a His118, em vez do Asp120 proposto anteriormente, activa a molcula de gua nucleoflica.

keywords

Beta-lactamases, antibiotic resistance mechanisms, -lactam antibiotics, carbapenems, metallo--lactamases, carbapenemases.

abstract

Carbapenemases, both serine and metallo--lactamases (MBLs) constitute an increasingly important group of -lactamases that render bacteria resistant to lactam-containing antibiotics, including carbapenems used as last resort antibiotics in treatment of multidrug resistant bacteria. In order to better understand the structure-function relationship among this group of enzymes we pursued the biochemical and structural characterization of SFC-1 and Sfh-I both carbapenemases specific to Serratia fonticola UTAD54, an environmental strain previously isolated from untreated drinking waters in Northeast Portugal. Both -lactamases were over-expressed in Escherichia coli and purified by liquid chromatography. Recombinant SFC-1, a serine carbapenemase, efficiently hydrolyses -lactams of all classes and exhibits, as compared to related enzymes (e.g. KPC), an increased activity towards ceftazidime but a decreased sensitivity to conventional -lactamase inhibitors. Crystal structures of wild-type SFC-1 and of complexes of site-directed mutants with the meropenem in unhydrolysed and acylenzyme intermediate forms were solved by molecular replacement using Xray crystallography. Wild-type SFC-1 has all the conserved features of the class A carbapenemases active site. In the mutants structures meropenem is shown to be oriented in the active site by Thr236 and Thr238, placing it close to Ser130 for proton transfer. In the carbapenem-inhibited class A enzymes interaction with Arg244 imposes a different orientation on bound meropenem, impairing proton transfer. These first structures of a class A carbapenemase with bound carbapenem reveal that these enzymes change the orientation of bound meropenem to promote catalysis, without gross distortion of overall structure. Sfh-I, like other subclass B2 MBLs, has a narrow substrate profile which mostly include carbapenems. Sfh-I hydrolyses imipenem and meropenem with a kcat of -1 51 and 109 s and KM of 79 and 215 M, respectively. Purified Sfh-I binds one equivalent of zinc, as shown by mass spectrometry. Unlike previously characterised subclass B2 enzymes, Sfh-I hydrolyzes cefepime showing that Sfh-I is a subclass B2 MBL with unique properties. Fluorescence spectroscopy shows that Sfh-I is able to bind up to 3 zinc equivalents (Kd2 = 95 M; Kd3 = 2.3 mM). The Sfh-I crystal structure, solved by molecular replacement using CphA as search model, is the first of an unliganded B2 MBL. This structure reveals the disposition of water molecules in the active site supporting a catalytic mechanism for subclass B2 MBLs in which His118, rather than the previously proposed Asp120, activates the nucleophilic water molecule.

CONTENTS
CHAPTER 1: GENERAL INTRODUCTION
1.1 1.2 Antimicrobial agents and bacterial resistance ....................................................................... 3 -lactam antibiotics ................................................................................................................ 5 Mechanism of action ...................................................................................................... 7 Resistance mechanisms................................................................................................ 10 Target alteration....................................................................................................... 11 Decreased permeability ........................................................................................... 12 Active efflux .............................................................................................................. 13

1.2.1 1.2.2 1.2.2.1 1.2.2.2 1.2.2.3 1.3

-lactamases ........................................................................................................................ 15 Classification................................................................................................................. 16 Serine -lactamases ..................................................................................................... 18 Structure and mechanism of class A -lactamases ...................................................... 20 Evolution of class A -lactamases ................................................................................ 25 Metallo--lactamases ................................................................................................... 28

1.3.1 1.3.2 1.3.3 1.3.4 1.3.5 1.4

Carbapenemases .................................................................................................................. 29 Oxacillinases ................................................................................................................. 30 Class A carbapenemases .............................................................................................. 31 Tertiary structure ..................................................................................................... 33 Metallo- -lactamases .................................................................................................. 35 Classification ............................................................................................................ 36 Structure of MBLs .................................................................................................... 37 Catalytic mechanism ............................................................................................... 40

1.4.1 1.4.2 1.4.2.1 1.4.3 1.4.3.1 1.4.3.2 1.4.3.3

CHAPTER 2: SCOPE OF THIS DISSERTATION

2.1 2.2. Serratia fonticola UTAD54.................................................................................................... 47 Goals ..................................................................................................................................... 48

CHAPTER 3: BIOCHEMICAL CHARACTERISATION OF RECOMBINANT SFC-1

3.1 3.2 Introduction ......................................................................................................................... 51 Materials and methods ........................................................................................................ 52 Bacterial strains and plasmid ....................................................................................... 52 Antimicrobial agents .................................................................................................... 52 Plasmid construction .................................................................................................... 53 Detection of -Lactamase activity by SDS-PAGE .......................................................... 54 Optimization of the expression of recombinant SFC-1 ................................................ 54 Over-expression and purification of SFC-1................................................................... 55 IEF analysis ................................................................................................................... 55 N-terminal sequencing ................................................................................................. 56 Mass spectrometry....................................................................................................... 56 Determination of kinetic parameters........................................................................... 56

3.2.1 3.2.2 3.2.3 3.2.4 3.2.5 3.2.6 3.2.7 3.2.8 3.2.9 3.2.10 3.3

Results and discussion.......................................................................................................... 57 Over-expression of SFC-1 in E. coli ............................................................................... 57 Purification and biochemical properties of SFC-1 ........................................................ 58 Kinetic properties of SFC-1 ........................................................................................... 61

3.3.1 3.3.2 3.3.3 3.4

Concluding remarks.............................................................................................................. 66

CHAPTER 4: CRYSTALLOGRAPHIC STRUCTURE OF SFC-1: INSIGHTS INTO CARBAPENEMASE ACTIVITY IN CLASS A -LACTAMASES
4.1 4.2 Introduction ......................................................................................................................... 69 Materials and methods ........................................................................................................ 70 Mutagenesis of SFC-1 ................................................................................................... 70 Protein expression and purification ............................................................................. 71 -Lactamase crystallisation .......................................................................................... 72 X-ray diffraction data collection and crystallographic refinement .............................. 74

4.2.1 4.2.2 4.2.3 4.2.3 4.3

Results and discussion.......................................................................................................... 75 Structure of the SFC-1 carbapenemase........................................................................ 75 The SFC-1 S70A-meropenem complex structure ......................................................... 82 The SFC-1 E166A-meropenem acylenzyme structure .................................................. 84

4.3.1 4.3.2 4.3.3

4.3.4

Concluding remarks...................................................................................................... 89

CHAPTER 5: OVER-EXPRESSION, PURIFICATION AND BIOCHEMICAL CHARACTERISATION OF Sfh-I

5.1 5.2 Introduction ......................................................................................................................... 93 Materials and methods ........................................................................................................ 94 Antimicrobial agents and reagents .............................................................................. 94 Cloning and over-expression of Sfh-I ........................................................................... 94 -lactamase production and purification..................................................................... 96 Determination of kinetic parameters........................................................................... 97 Time- and concentration-dependence of Sfh-I inhibition by cephalothin ................... 98 Inactivation of Sfh-I by hydrolysed antibiotics ............................................................. 98 Mass spectrometry....................................................................................................... 99 Zinc binding .................................................................................................................. 99 Zinc concentration dependence of Sfh-I activity........................................................ 100

5.2.1 5.2.2 5.2.3 5.2.4 5.2.5 5.2.6 5.2.7 5.2.8 5.2.9 5.3

Results and Discussion ....................................................................................................... 101 Over-expression and purification of Sfh-I .................................................................. 101 Sfh-I is isolated as a monozinc enzyme ...................................................................... 104 Kinetic parameters of Sfh-I ......................................................................................... 105 Inhibition of Sfh-I by cephalothin ............................................................................... 108 The effect of excess Zn2+ ............................................................................................ 109 Concluding remarks.................................................................................................... 113

5.3.1 5.3.2 5.3.3 5.3.4 5.3.5 5.3.6

CHAPTER 6: STRUCTURAL CHARACTERISATION OF Sfh-I: EVIDENCE FOR CATALYTIC MECHANISM IN SUBCLASS B2 MBLs
6.1 6.2 Introduction ....................................................................................................................... 117 Materials and methods ...................................................................................................... 119 Purification and crystallisation ................................................................................... 119 Data collection and crystallographic refinement ....................................................... 120 Circular Dichroism (CD) .............................................................................................. 122 Accession numbers..................................................................................................... 123

6.2.1 6.2.2 6.2.3 6.2.4

6.3

Results and Discussion ....................................................................................................... 124 Sfh-I overall structure ................................................................................................. 124 Active site ................................................................................................................... 128 Implications for catalytic mechanism......................................................................... 129 Proposed catalytic mechanism................................................................................... 131 Concluding remarks.................................................................................................... 133

6.3.1 6.3.2 6.3.3 6.3.4 6.3.4

CHAPTER 7: GENERAL DISCUSSION

7.1 7.2 7.3 Antibiotic resistance the problem ................................................................................... 137 Antibiotic resistance as a whole ......................................................................................... 138 Study of carbapenemases from S. fonticola UTAD54 ........................................................ 139 SFC-1, an Ambler class A carbapenemase .................................................................. 140 Sfh-I, a subclass B2 metallo--lactamase ................................................................... 143

7.3.1 7.3.2 7.4 7.5

Conclusions ........................................................................................................................ 145 Future studies..................................................................................................................... 146

CHAPTER 8: REFERENCES .................................................................................................. 151

PUBLICATIONS

Most results of the work here presented have been published (or waiting for publication) in the following articles:

Fonseca F., Sarmento A. C., Henriques I., Samyn B., van Beeumen J., Domingues P., Domingues M. R., Saavedra M. J., and Correia A. (2007) Biochemical characterization of SFC-1, a class A carbapenem-hydrolyzing -lactamase. Antimicrobial Agents and Chemotherapy. 51: 4512-4514.

Fonseca F., Correia A., and Spencer J. High resolution crystal structures of SFC-1 and acyl-intermediate in complex with meropenem: structural basis for carbapenemase activity in class A -lactamases (manuscript in preparation).

Fonseca F., Arthur C. J., Bromley E. C. H., Samyn B., Moerman P., Saavedra M. J., Correia A, and Spencer J. Biochemical characterization of Sfh-I, the subclass B2 metallo--lactamase from Serratia fonticola UTAD54. Antimicrobial Agents and Chemotherapy (accepted for publication).

Fonseca F., Bromley E. C. H., Saavedra M. J., Correia A., and Spencer J. Crystal structure of Serratia fonticola Sfh-I: activation of the nucleophile in the catalytic mechanism of mono-zinc metallo--lactamases. Journal of Molecular Biology (in press).

LIST OF FIGURES

Figure 1.1 The core structures of -lactam antibiotics.

Page 6

Figure 1.2 Schematic representation of peptidoglycan cross-linking in Gram-negative bacteria. Page 8

Figure 1.3 Structural similarities between penicillin G (A) and D-alanyl-D-alanine (B). Page 9

Figure

1.4

A)

Stereoview

of

the

active

site

of

Streptomyces

R61

DD-

carboxypeptidase/transpeptidase acylated by a cephalosporin. B) A schematic of interactions shown in A). Page 10

Figure 1.5 -lactamase attack on penicillin with formation of inactive penicilloic acid. Page 15

Figure 1.6 Schematic reaction mechanism for a -lactam substrate and a serine lactamase. Page 19

Figure 1.7 Overall structure of the class A -lactamase TEM-1 with conserved motifs of class A -lactamases shown in different colours. Page 21

Figure 1.8 Proposed reaction mechanism for a penicillin -lactam substrate and a class A serine -lactamase in which Glu166 participates in activating a water molecule for both acylation and deacylation. Page 24

Figure 1.9 Superposition of a class A carbapenemase (KPC-2) and a non-carbapenemase (TEM-1). Page 33

Figure 1.10 Metallo--lactamases overall fold with a representative of each subclass: IMP-1 from P. aeruginosa (B1), CphA from A. hydrophila (B2) and L1 from S. maltophilia (B3). Page 38

Figure 1.11 Metallo--lactamase active sites from the three subclasses: IMP-1 (B1), CphA (B2) and L1 (B3). Page 39

Figure 1.12 Schematic representation of the proposed reaction mechanism of B2 MBL CphA involving two water molecules (Wat). Page 42

Figure 3.1 Influence of temperature and IPTG induction on the production of the SFC-1 -lactamase. Page 58

Figure 3.2 SDS-polyacrylamide gel of crude extract and of purified SFC-1 -lactamase from E. coli BL21 (DE3)(pMF13). Page 59

Figure 3.3 IEF patterns of crude extracts and purified SFC-1.

Page 60

Figure 3.4 Q-TOF mass spectrogram of purified SFC-1, showing two forms of the carbapenem-hydrolysing -lactamase. Page 61

Figure 4.1 A, SFC-1 crystals growing in 0.2 M sodium acetate with different concentrations of PEG3350 (w/v); B and C, SFC-1 S70A and E166A mutant crystals after seeding, respectively. Page 75

Figure 4.2 Overall fold of class A carbapenemases. A) Ribbon secondary structure representation of the SFC-1 structure; B) Superposition of SFC-1 structure with serine carbapenemases NMC-A and KPC-2. Page 78

Figure 4.3 Stereoview of the SFC-1 active site with labelled conserved residues shown as sticks models. Page 79

Figure 4.4 Superposition of the C trace of class A carbapenemases (SFC-1, NMC-A, SME-1, KPC-2) and carbapenem-inhibited enzymes (SHV-1, CTX-M-16, TEM-1). Page 81

Figure 4.5 Binding of unhydrolysed meropenem in SFC-1 active site. A) Wild-type SFC-1; B) SFC-1 S70A mutant showing bound meropenem (carbon atoms in gray). Page 83 Figure 4.6 A) Binding of unhydrolysed meropenem in the active site of SFC-1 S70A, shown for comparison; B) Binding and interactions of hydrolysed meropenem and catalytic water molecule (Wat1) in the active site of SFC-1 E166A. Page 85

Figure 4.7 A) Superposition of SFC-1 E166A: meropenem and SHV-1: meropenem; B) Superposition of SFC-1 E166A: meropenem and TEM-1: imipenem. Page 87

Figure 5.1 Analysis of recombinant Sfh-Iv2 expression in E. coli BL21 (DE3) by SDSPAGE. A) total protein from induced cultures grown in different culture media; B) soluble and insoluble fractions of induced E. coli BL21 (DE3) host cells containing the pSfh-Iv2 plasmid. Page 101

Figure 5.2 Analysis of recombinant Sfh-Iv3 (v3) and Sfh-Iv4 (v4) expression in E. coli BL21 (DE3) by SDS-PAGE. A) soluble fraction from induced (I) and uninduced (NI) cultures grown in LB media at 25C; B) As described in A) except cells were grown up to 21h after induction. Page 102

Figure 5.3 Optimised purification of recombinant Sfh-Iv3. A) and C) Chromatograms obtained from an extract of culture of E. coli BL21 (DE3) cells containing the pSfh-Iv3 plasmid; B) and D) Analysis of the purification by SDS-PAGE. Page 103

Figure 5.4 Electrospray mass spectra of purified Sfh-I showing molecular mass of 26 136 Da (A) and binding of one zinc equivalent (Mr = 65) per protein molecule under nondenaturing conditions (B). Page 105

Figure 5.5 Effect of cephalothin on Sfh-I activity. A) Activity of Sfh-I after incubation with
cephalothin. B) Hydrolysis of cephalothin.

Page 109

Figure 5.6 Variation in fluorescence emission intensity of Sfh-I (1 M) as a function of the concentration of added zinc monitored at 341 nm. Page 110

Figure 5.7 Effect of added zinc on k cat /k cat0 (ratio of k cat at a given zinc concentration to k cat0 determined in the absence of excess zinc) for hydrolysis of nitrocefin and imipenem. Page 111

Figure 5.8 Effect of additional zinc on Sfh-I. Far-UV circular dichroism spectra of Sfh-I (A) and second derivatives of plots of ellipticity at 220nm against temperature for thermal unfolding of Sfh-I (B) measured in the absence and presence of 1 mM Zn2+. Page 112

Figure 6.1 Crystals of native Sfh-I. A) Individual panels showing the effect of additives on Sfh-I crystallisation in 0.1 M ammonium nitrate, 25% (w/v) PEG3350. B) and C) Native crystals grown in 0.2 M sodium acetate, 27% (w/v) PEG 3350, 3% glycerol and in 0.2 M lithium chloride, 0.1 M Hepes pH 7.0, 28% (w/v) PEG 3350 with additives. Page 124 Figure 6.2 Stereo ribbon diagram of the Sfh-I structure (glycerol complex). The polypeptide chain is colour-ramped from N- (blue) to C- (red) terminus. Zinc ion is rendered as a grey sphere and zinc ligands shown as sticks. Page 125

Figure 6.3 A) Overlay of Sfh-I and A. hydrophila CphA structures. B) Ribbon diagram of Sfh-I structure highlighting positions of residues that differ between Sfh-I and CphA. Page 126

Figure 6.4 Circular dichroism (CD) spectroscopy of Sfh-I and ImiS. A) CD spectra from 8.5 M protein in 20 mM phosphate buffer, pH 7.0 at 20C. B) Thermal unfolding of the metallo--lactamases by stepwise increasing the temperature. Page 127

Figure 6.5 Stereo view of uncomplexed Sfh-I active site.

Page 128

Figure 6.6 A) Active site of VIM-2 showing altered second shell ligands of His118; B) Molecular surfaces of uncomplexed Sfh-I and VIM-2 coloured by electrostatic potential. Page 130

LIST OF TABLES

Table 1.1 Classification and properties of -lactamases.

Page 17

Table 3.1 Purification of the carbapenem-hydrolyzing -lactamase SFC-1 produced by E. coli BL21 (DE3) (pMF13). Page 59

Table 3.2 Kinetic parameters of purified SFC-1 and comparison to other class A carbapenem-hydrolyzing -lactamases. Page 65

Table 4.1 Primers used to generate SFC-1 mutants.

Page 71

Table 4.2 Data collection and Refinement Statistics for Native and SFC-1 mutant complexes structures. Page 76

Table 5.1 Primers used to clone bla Sfh-I .

Page 95

Table 5.2 Kinetic parameters of purified Sfh-I -lactamase and comparison with other B2 metallo--lactamases. Page 107

Table 5.3 Influence of added zinc on k cat and K M values of nitrocefin hydrolysis by Sfh-I. Page 112

Table 6.1 Data Collection Statistics.

Page 121

Table 6.2 Refinement Statistics.

Page 122

ABBREVIATIONS

CD DAP EDTA ESBLs EXAFS GES HEPES HPLC IPTG IRTs KPC LB MBLs MES MIC NAG NAM OD OMPs PBP PCR PDB

Circular dichroism Diaminopimelate Etilenodiaminotetracetic acid Extended spectrum -lactamases Extended X-Ray Absorption Fine Structure Guiana extended spectrum N-(2-hydroxyethyl)-piperazine-N'-2-ethanesulfonic acid High-performance liquid chromatography Isopropyl -D-1-thiogalactopyranoside Inhibitor resistant TEMs Klebsiella pneumoniae carbapenemase Luria-Bertani Metallo--lactamases 2-(N-morpholino)ethanesulfonic acid Minimal inhibitory concentration N-acetylglucosamine N-acetylmuramic acid Optical density Outer membrane proteins Penicillin binding protein Polimerase chain reaction Protein Data Bank

PEG pI PTH QMMM r.m.s.d. RND Rpm SDS SDS-PAGE TEM TEMED Tris WT

poly (ethylene glycol) Isoelectric point Phenylthiohydantoin Quantum mechanics molecular mechanics Root mean square deviation Resistance nodulation division Rotations per minute Sodium dodecyl sulfate Sodium dodecyl sulfate polyacrylamide gel electrophoresis Temoniera -lactamase n, n, n, n- Tetramethylethylenediamine tris(hydroxymethyl)aminomethane Wild-type

1. General Introduction

General Introduction
____________________________________________________________________________________________________________________________________________________

1.1

Antimicrobial agents and bacterial resistance

Antibiotics, compounds that are literally against life, are typically

antibacterial drugs that interfere with some structure or process that is essential to bacterial growth or survival without harming the eukaryotic host that harbours the bacterial infection (WALSH, 2000). Introduced in human therapy for more than 60 years, antibiotics constitute one of the most important medical inventions, reducing human morbidity and mortality. Antibiotics display differing modes of action. They are considered to be bactericides if they effectively kill bacteria or bacteriostatic if the ability of the bacterium to grow is impaired. There are several classes of antimicrobials available to clinicians. These compounds can target vital microbial processes such as cell wall biosynthesis (e.g. -lactam antibiotics and glycopeptides such as vancomycin), protein synthesis (e.g. aminoglycosides, tetracyclines, macrolides) and bacterial DNA replication and repair (e.g. fluoroquinolones, rifampicin) (LEVY and MARSHALL, 2004; WALSH, 2000). Antimicrobials have been successfully employed for therapy of bacterial infections for more than six decades, leading to a rise in average life expectancy in the last century. However their use is now threatened by the emergence of resistant pathogenic strains. Antibiotic resistance is now well recognized as a major problem in the treatment of infections in hospitals and, with increasing and alarming frequency, in the community (LEVY and MARSHALL, 2004; LIVERMORE, 2007). Antibiotic resistance confers an advantage for bacterial survival. Resistant bacteria are selected by exposure to antibiotics as a product of Darwinian selection: resistant strains are selected while susceptible strains are inhibited or eliminated (SYKES, 2010). In order to survive an organism has to be intrinsically resistant or acquire resistance after the introduction of drugs in the bacterial environment (LEVY and MARSHALL, 2004; MAZEL and DAVIES, 1999). Intrinsic resistance means that each member of an entire bacterial group (genus or species) is resistant without any additional genetic alteration. For example, in Gram-negative bacteria the presence of a relatively impermeable outer membrane is a barrier to antibiotics such as glycopeptides and macrolides, making these bacteria intrinsically resistant to these drugs (WRIGHT and BEGLEY, 2007). Also mycoplasma bacteria, lacking a cell wall, are intrinsically resistant to -lactam antibiotics as well as other antibiotics targeting the cell wall components (BEBEAR and PEREYRE, 2005). On the other hand,

Chapter 1
____________________________________________________________________________________________________________________________________________________

resistance to antibiotics can result from selection of spontaneous mutations that lead to activation or modification of chromosomal determinants or from acquisition of resistance genes localized on mobile genetic elements (FROST et al., 2005) such as transposons, plasmids (BENNETT, 2008), and ISCR elements (TOLEMAN et al., 2006), which can be exchanged among bacteria of a wide range of genera. Although they are not considered to be mobile genetic elements, integrons (HALL and COLLIS, 1998) also play an important role in the transfer and dissemination of resistance genes and are most often associated with mobile genetic elements (MOURA et al., 2010). The rapid generation time of bacteria allows them to evolve quickly, becoming resistant to antimicrobials within a short time of their introduction (SYKES, 2010; WRIGHT and BEGLEY, 2007). Although used in human therapy, antimicrobial drugs are also used inappropriately in animal husbandry for prophylaxis, chemotherapy and growth promotion (COLLIGNON, 2004; WEGENER, 2003; WITTE, 1998). The ultimate fate of these drugs is the soil and aquatic environments (ALLEN et al., 2010; XI et al., 2009) where bacteria can exchange their genetic material through horizontal gene transfer (FROST et al., 2005). Selective pressure can promote the transmission of resistant traits to pathogenic bacteria and ultimately to humans via the food chain (QIN et al., 2006; RHODES et al., 2000). Antibiotic use by humans plays an important role in selection and evolution of resistance in pathogenic bacteria. However antibiotic resistance genes are likely to have originated in natural microbial communities (DAVIES, 1994). Indeed, many antibiotics are produced by environmental strains (NAGARAJAN et al., 1971; SYKES et al., 1981) so it is possible that these organisms could be the origin of antibiotic resistance genes, used to protect themselves from the antimicrobials they produce (PANG et al., 1994; TAHLAN et al., 2007). Recent studies by DCosta and collaborators (2006) and Dantas and colleagues (2008) have demonstrated that soil bacteria are both antibiotic producers that are resistant to antimicrobials, and sources of resistance determinants. Moreover the antibiotics tested included not only older compounds but also some that have been just recently approved and resistance was observed to all antibiotics in these strains of soil bacteria (D'COSTA et al., 2006). Also evidence shows that bacterial multidrug efflux pumps are common in environmental bacteria, where their primary functions are not associated with

General Introduction
____________________________________________________________________________________________________________________________________________________

antibiotic resistance but rather detoxification of the cell, virulence, cell homeostasis and intercellular signal trafficking (LIN et al., 2006; MARTINEZ et al., 2009). Relatively few studies are available concerning the role(s) of antibiotic resistance genes in the environment. However, it is clear that natural environments constitute important reservoirs of antibiotic resistance microorganisms and resistance genetic determinants (ALLEN et al., 2010; D'COSTA et al., 2006; SAAVEDRA et al., 2003). Once available, resistance genes are picked up from these reservoirs and propagated into pathogenic microbes upon use of antimicrobial agents either in medicine or agriculture posing a serious problem in human therapy (MARTINEZ, 2009). For example, the genes encoding CTX-M -lactamases, enzymes that compromise the activity of clinically important antibiotics and constitute a major clinical problem (CANTON and COQUE, 2006), have been shown to originate from environmental Kluyvera species that are not recognized as antibiotic producers (POIREL et al., 2002).

1.2

-lactam antibiotics
The first antibiotic was penicillin, discovered accidentally from a mould

culture of Penicillium by Alexander Fleming in 1928 (FLEMING, 1929). This discovery revolutionized the treatment of infectious diseases and marks the start of modern medicine. Florey and Chain developed the purification method (CHAIN et al., 1940) and used it to treat bacterial infections during the Second World War, regarded as a magic bullet. Penicillin was first used in patients in 1942. Alexander Fleming, Howard Florey and Boris Chain were awarded the Nobel Prize of Medicine and Physiology in 1945 for the discovery and application of penicillin. Further studies on this important molecule by Dorothy Hodgkin led to the determination of the structure of penicillin using X-ray crystallography (HODGKIN, 1949) and identified the -lactam ring as the key functional group. The -lactams remain a cornerstone of antimicrobial chemotherapy. -lactam antibiotics comprise natural or semi synthetic compounds that can be divided into four main groups based on their structure: penicillins, cephalosporins, monobactams and carbapenems (Figure 1.1). These antibiotics possess, as a common feature, a highly reactive -lactam ring constituted by three carbon atoms and one nitrogen, but differ in the presence of additional rings to

Chapter 1
____________________________________________________________________________________________________________________________________________________

which the -lactam ring may be fused (DEMAIN and ELANDER, 1999). For example, -lactam ring is fused to a five-membered thiazolidine ring in the penicillins but to a six-membered dihydrothiazine ring in the cephalosporins. Monobactams have no additional ring. Carbapenems have a -lactam ring fused to a ring that is similar to that of penicillins but is unsaturated and the sulphur atom is substituted by a carbon. Different antibiotics within the same group are distinguished by the nature of one or more side chains (DEMAIN and ELANDER, 1999). Carbapenem antibiotics were originally developed from thienamycin, a natural product identified in culture filtrates of Streptomyces cattleya (BIRNBAUM et al., 1985). The thienamycin molecule was chemically unstable and was never used for therapy. However, its structural scaffold was used to produce similar drugs with adequate properties for chemotherapy. Imipenem, meropenem, ertapenem, and doripenem are the carbapenems approved for human use so far (BAUGHMAN, 2009). The carbapenems exhibit the broadest spectrum of activity among the -lactam antimicrobials, providing safe and efficacious therapies in the treatment of serious infections, caused by multidrug-resistant Gram-positive, Gram-negative, and anaerobic pathogens (BAUGHMAN, 2009; MANDELL, 2009).

Figure 1.1 The core structures of -lactam antibiotics with the numbering scheme shown.

The discovery and subsequent development of -lactam antibiotics was very important both for drug development and medicine. Today several hundred -lactam

General Introduction
____________________________________________________________________________________________________________________________________________________

molecules structurally different from the four subclasses are available and most of them are prescribed for medical use. The antibacterial effect of all -lactam antibiotics is dependent on their ability to cross the cellular membrane, the affinity of the antibiotic to target proteins and the stability to bacterial degradation (KOTRA and MOBASHERY, 1999). The -lactams are among the most safe and efficient of all antibiotics. These drugs are also characterised by an absence of secondary effects in eukaryotes. Due to these characteristics and their relatively low cost and ease of delivery, -lactam antibiotics are the most important antimicrobial agents in the treatment of bacterial infections, accounting for over 50% of antibiotic prescriptions in many countries (MOLSTAD et al., 2002; THERRIEN and LEVESQUE, 2000). Antimicrobial agents from the -lactam class are still the first choice for treatment of infections in critically ill patients caused by multidrug resistant Gramnegative bacteria where other options may be limited. Among these organisms are Pseudomonas aeruginosa, Acinetobacter baumannii, and the Enterobacteriacea, all of which may be responsible for a wide range of infections, particularly hospital acquired infections of immunocompromised patients (LIVERMORE, D., 2009; PELEG and HOOPER, 2010). In particular, the spread of resistance to other antibiotic classes, including cephalosporins, means that carbapenems are increasingly used routinely for these infections, rather than being in held in reserve in case of failure of other treatments (MASTERTON, 2009).

1.2.1 Mechanism of action

-lactam antibiotics exert their bactericidal activity primarily by inactivation of bacterial cell wall synthesis. The cell wall is a protective layer located externally to the cytoplasmic membrane and composed of an inner layer of peptidoglycan that is surrounded by an outer membrane in Gram-negative bacteria. Peptidoglycan is the main component of the bacterial cell wall. It is a complex polymer composed of peptide chains and sugars that are linked by covalent bonds and is responsible for bacterial cell wall strength and resistance to osmotic pressure from cytoplasm (SCHLEIFER and KANDLER, 1972; WALSH, 2000).

Chapter 1
____________________________________________________________________________________________________________________________________________________

The basic repeating unit is a disaccharide consisting of alternating residues of N-acetylglucosamine (NAG) and N-acetylmuramic acid (NAM) (Figure 1.2). A five amino-acid stem peptide chain of variable sequence, according to bacterial species, is terminated by a D-alanine, D-alanine moiety and attached to each NAM unit. It normally contains L-alanine, D-glutamic acid, mesodiaminopimelic acid (which may be substituted by other amino acids including L-lysine in Gram positive bacteria), and two residues of D-alanine (VOLLMER et al., 2008). The peptidoglycan polymer is constructed using two kinds of covalent bonds: 1-4 glycosidic bonds link the sugar rings while the amino acid side chains are joined by peptide bonds. These peptide bonds are formed in the final transpeptidation step of cell wall synthesis which results in the cross-linking of the peptide chains of two neighbouring sugar strands by peptide bridges to form a three-dimensional network. This reaction is catalyzed by a series of transpeptidase enzymes that are also known as penicillin binding proteins (PBPs) due to their ability to bind to penicillin molecules (JEAN-MARIE, 1997; MACHEBOEUF et al., 2006).

Figure 1.2 Schematic representation of peptidoglycan cross-linking in Gram-negative bacteria.

General Introduction
____________________________________________________________________________________________________________________________________________________

Tipper and Strominger (1965) suggested that the nucleus of -lactam antibiotics mimics the terminal of D-alanyl-D-alanine of the linear stem peptide (Figure 1.3) and inhibits transpeptidation by reacting with the substrate binding site of PBPs. PBPs are active-site serine enzymes that catalyse the transpeptidation reaction via a covalent acylenzyme intermediate. In the initial step an acylenzyme complex is formed by reaction of the active site serine hydroxyl with the terminal DAla-D-Ala, leading to cleavage of the last D-Ala residue. This is followed by a second reaction, involving the transfer of the acylenzyme to an amino group of a neighbouring chain, cross-linking individual peptidoglycan strands to establish a unifying network (TIPPER and STROMINGER, 1965). Cross-linking of the glycan strands generally occurs between the carboxyl group of D-Ala at position 4 and the amino group of the diamino acid at position 3, either directly in Gram-negative bacteria (Figure 1.2) or through a short peptide bridge (Gram-positive bacteria) (VOLLMER et al., 2008).

Figure 1.3 Structural similarities between penicillin G (A) and D-alanyl-D-alanine (B).

-lactam antibiotics bind to PBPs, promoting the formation of an acylenzyme complex with the PBP by acylating the essential serine residue of the active site (Figure 1.4) (LEE et al., 2001). Once acylated by a -lactam, the PBP deacylates very slowly, leading to irreversible inhibition of PBP catalysis and rendering them unable to catalyse the transpeptidation reaction (FISHER and MOBASHERY, 2009). This causes an incomplete biosynthesis of bacterial cell wall that triggers peptidoglycan autolysin action, resulting in osmotic lysis and ultimately cell death (BAYLES, 2000). However, the specific details of how this occurs are not yet known. The high specificity and absence of secondary effects is thus explained as molecules similar to peptidoglycan precursors do not exist in eukaryotic cells (MACHEBOEUF et al., 2006).

Chapter 1
____________________________________________________________________________________________________________________________________________________

Figure

1.4

A.

Stereoview

of

the

active

site

of

Streptomyces

R61

DD-

carboxypeptidase/transpeptidase acylated by a cephalosporin. The ligand is rendered as ball and stick with CPK atom colours. Hydrogen bonds between the enzyme and the ligand are shown as dotted white lines. Residues labeled in red are conserved among PBPs and -lactamases. B. A schematic of interactions shown in A; the cephalosporin backbone (red) mimics the terminal acylD-Ala-D-Ala portion of the peptide branch of the first strand of the peptidoglycan. The cephalosporin acylates the active site serine of the transpeptidase, as would the peptide from the first strand of peptidoglycan, concomitant with the departure of the terminal D-Ala. The -lactam nitrogen and its adjacent carbon and carboxylate collectively serve as a substitute for the departing D-Ala. The acyl-enzyme species depicts the first enzyme-bound peptidoglycan strand (shown in red) poised to receive the amine of DAP from the second strand of peptidoglycan (shown in green). Figure and legend were adapted from Lee et al., (2001).

1.2.2 Resistance mechanisms

In order to exert their antimicrobial action, antimicrobial compounds must enter the cell, accumulate to inhibitory concentrations, and interact with their targets. Antibiotic resistance can arise from alterations to any of these processes, through a number of changes in the cell. Bacteria have developed escape strategies against all antimicrobials drugs and -lactams are no exception. Resistance to these agents is common to Gram-positive and Gram-negative bacteria and is mediated by four mechanisms: alteration of the target (i.e. PBPs) (LAMBERT, 2005), reduction of the entry of the antibiotic to the cell by decreased permeability and/or efflux mechanisms (KUMAR and SCHWEIZER, 2005; POOLE, 2007) and inactivation of the antibiotic by hydrolytic enzymes before it can reach the target (FISHER et al., 2005).

10

General Introduction
____________________________________________________________________________________________________________________________________________________

In Gram-negative bacteria a synergy between resistance mechanisms is frequently used not only to increase but also to broaden resistance profile. The most commonly observed combinations are a reduction in outer membrane permeability together with active efflux and -lactamase expression (BONOMO and SZABO, 2006; QUALE et al., 2006).

The subject of this dissertation is the study of -lactamases; therefore just a brief overview of other resistance mechanisms to -lactams will be presented, while -lactamases will be covered in more detail.

1.2.2.1 Target alteration

Resistance to -lactam antibiotics due to PBP alteration occurs either by mutations in the chromosomal genes that code for PBPs or acquisition of supplementary genes that code for new PBPs with reduced affinity for the antibiotics (GEORGOPAPADAKOU, 1993). In Streptococcus pneumoniae resistance to -lactams occurs almost entirely from modified versions of their own PBPs, mainly 2X, 2B, and 1A, that are poorly acylated by -lactams (GREBE and HAKENBECK, 1996; SMITH et al., 2005). The altered proteins from penicillin-resistant isolates are encoded by mosaic genes that have arisen by interspecies recombination events (HAKENBECK et al., 2001; LAIBLE et al., 1991). Resistance to penicillin and methicillin in Staphylococcus aureus has been known for a long time. Resistance to penicillin, reported soon after its introduction as a therapeutic agent, is due to expression of the penicillinase PC1 (RICHMOND, 1963). More importantly, shortly after the clinical use of methicillin, a semi-synthetic penicillin introduced to restore -lactam activity, methicillin-resistant S. aureus (MRSA) strains were identified (Barber, 1961). Methicillin-resistance is mediated by the acquisition of an altered PBP, encoded by the mecA gene that is designated as PBP2a or PBP2 (DE LENCASTRE et al., 1994; HARTMAN and TOMASZ, 1984), and shows reduced affinity for all -lactams (FUDA et al., 2005). PBP alteration is an important resistance mechanism to -lactam antibiotics in Gram-positive cocci such as S. aureus and S. pneumoniae but is observed less frequently in Gram-negative bacteria (GEORGOPAPADAKOU, 1993). However, in

11

Chapter 1
____________________________________________________________________________________________________________________________________________________

Neisseria gonorrhoeae, the causative agent of gonorrhoea, the production of modified PBP2 plays a major role in resistance to these agents, including extended-spectrum cephalosporins (OCHIAI et al., 2007; OHNISHI et al., 2010). Recently, it has been reported that modification of native PBPs also accounts for -lactam resistance in other Gram-negative multi-resistant species such as A. baumannii (RUSSO et al., 2009) and P. aeruginosa (ZAMORANO et al., 2010).

1.2.2.2 Decreased permeability

As stated above, Gram-negative bacteria have an impermeable outer membrane surrounding the peptidoglycan layer. This membrane functions as a barrier, preventing the access of several toxic compounds to the cell interior. Therefore, the transport of nutrients and other substances, including -lactam antibiotics, across the outer membrane is achieved by water-filled channel-forming proteins known as porins (NIKAIDO, 2003). Resistance to -lactams among Gram-negative bacteria can be attained by altered (reduced) permeability through change in porin copy number or selectivity. This mechanism is often combined with active efflux to enable bacteria acquire high level resistance to many antibiotics (KUMAR and SCHWEIZER, 2005). One of the mechanisms responsible for carbapenem resistance in important human oportunistic pathogens such as Klebsiella pneumoniae, P. aeruginosa and A. baumannii is the loss of specific porins which generally occurs in combination with other resistance mechanisms. In K. pneumoniae for example, it has been reported that resistance to carbapenems can arise via combination of AmpC or ESBLs enzymes that display very low carbapenemase activity, together with loss of the porins OmpK35 and/or OmpK36 (CHIA et al., 2010; SONG et al., 2009). Recently Garca-Fernndez and co-workers (2010) described an ertapenem-resistant K. pneumoniae isolate that did not produce the OmpK35 porin due to a nonsense mutation, but expressed an altered OmpK36 along with the ESBLs SHV-12 and CTXM-15. Although this clone remained susceptible to meropenem and imipenem, the loss of OmpK36 expression in two isolates of the same clone converted these to an imipenem and meropenem-resistant phenotype (GARCIA-FERNANDEZ et al., 2010). P. aeruginosa also contains specific porins involved in antibiotic resistance. Apart from the expression of carbapenemases (LIVERMORE and WOODFORD, 2006), carbapenem resistance in P. aeruginosa is attributed to an interplay between low

12

General Introduction
____________________________________________________________________________________________________________________________________________________

permeability, activity of the efflux pump MexAB-OprM and an inducible or derepressed chromosomal AmpC -lactamase (QUALE et al., 2006). In these bacteria derepressed expression of the OprD porin is important to achieve resistance to carbapenems (RODRIGUEZ-MARTINEZ et al., 2009; WANG et al., 2010). In a recent study, the loss of OprD proved to be the main mechanism of resistance to carbapenems (RODRIGUEZ-MARTINEZ et al., 2009). The decreased expression of some OMPs (outer membrane proteins) has also been reported to be associated with antimicrobial resistance in A. baumannii (MUSSI et al., 2005; TOMAS et al., 2005). Although there is not much data available on decreased permeability in A. baumannii, carbapenem resistance has been specifically correlated with loss of porins including CarO (LIMANSKY et al., 2002; MUSSI et al., 2005), and additional OprD-like (DUPONT et al., 2005) and 33- to -36 kDa proteins (TOMAS et al., 2005). In these studies no other mechanism is associated with carbapenem resistance, in contrast to the K. pneumonia and P. aeruginosa described above.

1.2.2.3 Active efflux

-lactam antibiotics must pass through the cell membrane to reach their targets in order to exert their bactericidal action on bacterial cells. Bacteria can become resistant to -lactam antibiotics by reducing the effective intracellular antibiotic concentration by means of increased energy-dependent (or active) efflux, expelling the antimicrobials out of the cell interior (KUMAR and SCHWEIZER, 2005; POOLE, 2007). Efflux pumps are membrane-bound proteins working as transporters of antibiotics (and other toxic substrates) to the outside of the cell. Efflux pumps can be single- or multi-component. Gram-positive bacteria, which have only a cytoplasmic membrane, use single component pumps to transport their substrates, while Gramnegative bacteria use these pumps to export drugs across their inner membranes. By way of contrast, multi-component pumps found in Gram-negative organisms transport molecules across both the inner and the outer membranes and comprise an inner membrane transporter associated with a periplasmic membrane fusion protein component and an outer membrane protein component, thus effluxing substrates across the entire cell envelope (KUMAR and SCHWEIZER, 2005).

13

Chapter 1
____________________________________________________________________________________________________________________________________________________

Efflux systems are divided into five classes according to their number of pump components, energy source used and type of substrate (POOLE, 2007). The RND (resistance-nodulation-division) family of efflux systems accommodates a variety of clinically significant antibiotics, including -lactams, and is therefore one of the most relevant efflux mechanisms of multidrug resistance in Gram-negative bacteria. RND systems are multi-component pumps constituted by the transporter protein in the inner membrane, a periplasmic membrane fusion protein and an outer membrane protein (POOLE, 2007). Such a pump can expel antibiotics from both the cytoplasm and the periplasmic space.

The RND efflux pumps that have been studied in most detail are the MexABOprM from P. aeruginosa and AcrAB-TolC from Escherichia coli. MexAB-OprM from P. aeruginosa is constitutively expressed, accounting for intrinsic resistance of these bacteria, and often confer multidrug resistance due to a broad substrate specificity (LLANES et al., 2004; MASUDA et al., 2000). MexAB-OprM is able to acomodate a wide range of -lactam antibiotics including penems (faropenem), carbapenems (meropenem and panipenem), penicillins (carbenicillin and azlocillin), moxalactam and extended-spectrum cephalosporins (cefepime, cefotaxime, cefoxitin) (LI et al., 1995; MASUDA et al., 2000; OKAMOTO et al., 2001). Additionally this pump also recognizes other clinically relevant antibiotics such as quinolones, macrolides, tetracyclines, and chloramphenicol (MASUDA et al., 2000). Quale and colleagues reported that carbapenem resistance in clinical isolates of P. aeruginosa is achieved by interplay between increased expression of chromosomal AmpC and of efflux systems, and reduced expression of OprD (QUALE et al., 2006). Recent studies also show that the efflux system AcrAB-TolC plays a key role in the -lactam uptake and susceptibility in clinical isolates of K. pneumoniae (PADILLA et al., 2010; PAGES et al., 2009).

14

General Introduction
____________________________________________________________________________________________________________________________________________________

1.3

-lactamases
The most common resistance mechanism to -lactam antibiotics, particularly

among Gram-negative bacteria, is the production of -lactamases (-lactam hydrolases EC.3.5.2.6). -lactamases are efficient enzymes that cleave the amide bond of the four-membered -lactam ring rendering these drugs microbiologically inactive (LIVERMORE, D. M., 2009) (Figure 1.5).

Figure 1.5 -lactamase attack on penicillin with formation of inactive penicilloic acid.

Once expressed -lactamases produced by Gram-positive bacteria are bound to the cytoplasmic membrane or secreted into the extracellular milieu while those produced by Gram-negative organisms are concentrated in the periplasmic space. Many -lactamases are structurally related to PBPs and probably evolved from these enzymes (MASSOVA and MOBASHERY, 1998). The production of penicillinase by E. coli, described even before the widespread clinical use of penicillin, represents the first reported resistance mechanism to -lactam antibiotics (ABRAHAM and CHAIN, 1940). Since then, these enzymes, now known as -lactamases, have been described in Gram-negative, Grampositive and mycobacteria (LIVERMORE, D. M., 2009).

-lactamases are found encoded on the chromosome or on plasmids and are frequently associated with other mobile genetic elements such as transposons and more recently ISCRs (FROST et al., 2005; TOLEMAN et al., 2006). More than 890 lactamases have been described so far and this number continues to grow ((BUSH and JACOBY, 2010), http://www.lahey.org/studies/). The production of lactamases constitutes the most important and widespread antimicrobial resistance mechanism among important human pathogens. The ability of bacteria to acquire lactamases with a broad range of substrate specificities is a major concern, making

15

Chapter 1
____________________________________________________________________________________________________________________________________________________

bacteria resistant to almost all -lactams (QUEENAN and BUSH, 2007). The situation gets even more dramatic with the rapid spread of -lactamase-encoding genes by the transmission by mobile genetic elements (BENNETT, 2008; SYKES, 2010).

Bacteria resistant to new -lactam antibiotics are being selected in a relatively short time after their introduction for chemotherapy. In order to overcome -lactam resistance and restore the antibacterial activity of these antibiotics, several strategies have been employed: the search of new antibiotics from microbial sources, chemical alteration of old or first generation antibiotic structures to obtain new compounds with decreased sensitivity to resistance mechanisms and/or improved pharmacology (e.g. cephalosporins), and the use of -lactamase inhibitors, such as clavulanic acid or sulbactam, in combination with an older antibiotic (e.g amoxicillin, piperacillin) (ABBANAT et al., 2008; CLARDY et al., 2006; DONADIO et al., 2010; DRAWZ and BONOMO, 2010).

1.3.1 Classification

Due to the diversity of enzymatic features of the -lactamases identified so far, several attempts have been made to classify this group of enzymes. These classifications are based on functional and biochemical characteristics such as substrate profile and isoelectric point (RICHMOND and SYKES, 1973; SYKES and MATTHEW, 1976) or on the amino acid sequences of the enzymes (AMBLER, 1980). The Ambler classification initially separated the serine enzymes, designated as class A, from the metallo--lactamases or class B. It was completed with the subsequent inclusion of class C (JAURIN and GRUNDSTROM, 1981) and class D enzymes as their sequences became available (HUOVINEN et al., 1988; OUELLETTE et al., 1987). With the emergence of new -lactamases it was possible to develop a classification system that relates substrate/inhibitor specificity with molecular structure (BUSH, 1989). This classification was later updated (BUSH, 2010; BUSH et al., 1995) and nowadays is the most used classification scheme. Table 1.1 shows the most used classification schemes with representative enzymes of each group.

16

General Introduction
____________________________________________________________________________________________________________________________________________________

Table 1.2 Classification and properties of -lactamases (adapted from Bush et al., 1995). Functional group (Bush et al., 1995) Molecular class Substrate profile Cephalosporins penicillins cephamycins monobactams Penicillins Penicillins cephalosporins Penicillins cephalosporins monobactams Inhibition ACa EDTA Representative enzymes AmpC, CMY variants, FOX, ACT-1, LAT-1, MIR-1, DHAPC1 (Gram-positive bacteria) TEM-1, TEM-2, SHV-1 TEM, SHV, CTX-M and GES/IBC variants, PER-1 2, VEB-1 TEM-30 41, TEM-44 45, TEM-51, 54 PSE-1, PSE-3, PSE-4

2a

2b

2be

2br

Penicillins Penicillins carbenicillins Penicillins cloxacillins Cephalosporins Penicillins cephalosporins carbapenems All -lactams except monobactams

2c

2d

OXA variants Cephalosporinase from

2e

Proteus vulgaris

2f

NMC-A, Sme-1-3, IMI-1, KPCs

BcII, L1, CphA, ImiS, IMP, VIM, SPM-1 Penicillinase from

Unknown

Penicillins

(formerly

Burkholderia

Pseudomonas) cepacia

Clavulanic acid

17

Chapter 1
____________________________________________________________________________________________________________________________________________________

1.3.2 Serine -lactamases

The serine -lactamase group includes enzymes belonging to molecular classes A, C and D. This is a rather heterogeneous group that requires an active-site serine residue to catalyse the opening of the -lactam ring. They are mostly penicillinases and cephalosporinases, including TEM, SHV and CTX-M-type enzymes that do not hydrolyse carbapenems (JACOBY and MUNOZ-PRICE, 2005), although increasing numbers of such enzymes with carbapenemase activity have now been reported (WALTHER-RASMUSSEN and HOIBY, 2007). The interaction between serine -lactamases (and related serine penicillinrecognizing enzymes) and -lactams comprises three steps: non-covalent binding to form a Michaelis complex (k 1 /k 1 ), acylation (k 2 ), and deacylation (k 3 ) (Scheme 1.1) (HERZBERG and MOULT, 1987).

Scheme 1.1

In scheme 1.1 E represents a -lactamase, S the -lactam substrate, ES is the noncovalent Michaelis complex, ES* is the covalent acylenzyme complex, where the antibiotic is covalently bound to the active-site serine residue, and P is the released hydrolysed -lactam. In general, -lactamases efficiently catalyze the deacylation step (high k 3 value) which regenerates the active enzyme (E) and releases a biologically inactive product (P). By contrast, in the PBPs the hydrolysis of the acylenzyme ester bond is slow. Compared with the deacylation rate constant displayed by the -lactamases, the same rate in PBPs is up to six orders of magnitude slower (KNOX et al., 1996).

The reaction mechanism of serine -lactamases consists of two main steps: acylation of an active site serine by the -lactam antibiotic, followed by deacylation and release of the inactive compound (Figure 1.6). The first step involves activation of the serine residue in the active site, the nucleophile, by a general base. Upon activation this serine performs a nucleophilic

18

General Introduction
____________________________________________________________________________________________________________________________________________________

attack on the carbonyl of the -lactam ring creating a tetrahedral intermediate that is stabilized by hydrogen bonding between the carbonyl oxygen and an oxyanion hole formed by the enzyme active site. Protonation of the -lactam nitrogen and cleavage of the C-N bond in the -lactam ring leads to the formation of a covalent acylenzyme intermediate. In the second step, a base-activated water molecule attacks the covalent complex with formation of a tetrahedral deacylation intermediate. Cleavage of this intermediate by hydrolysis of the bond between the serine oxygen and the carbonyl of the -lactam, releases the inactive (hydrolysed) -lactam and the active enzyme.

Figure 1.6 Schematic reaction mechanism for a -lactam substrate and a serine lactamase. The acylation and deacylation transition states of the reaction pathway are shown, where B represents the general base and it is not necessarily the same residue for both acylation and deacylation.

The differences between the catalytic mechanisms of serine -lactamases from molecular classes A, C and D are largely focussed on the identity of the residues used as general base for acylation and deacylation (DRAWZ and BONOMO, 2010; FISHER et al., 2005). In enzymes from molecular class A it is well accepted that Glu166 acts as the general base for the deacylation reaction, while the precise

19

Chapter 1
____________________________________________________________________________________________________________________________________________________

mechanism by which the catalytic Ser70 is activated remains the subject of longterm debate (see discussion in section 1.3.3). Studies of the crystal structure of the C. freundii class C enzyme have suggested that the conserved residue Tyr150 activates the active site Ser64 for nucleophilic attack on the -lactam ring (OEFNER et al., 1990), and is involved in the deacylation step by accepting a proton from the deacylation water (OEFNER et al., 1990). However, recent data indicate that Tyr150 is protonated throughout the reaction coordinate, disfavouring mechanisms that involve a stable tyrosinate as the general base for deacylation (CHEN et al., 2006). These authors propose a role for Tyr150 in coordinate activation of the deacylating water in cooperation with the lactam nitrogen of the substrate itself (substrate-assisted catalysis), although it does not rule out, in itself, the alternative Lys67-Tyr150 coordinate base mechanism. Class D enzymes display the unique feature of activation of their -lactamase activity by CO 2 . In these enzymes Lys70 (the structural equivalent of Lys73 and Lys67 of class A and class C -lactamases, respectively) is N-carboxylated by addition of the lysine side chain amine to CO 2 (GOLEMI et al., 2001; MAVEYRAUD et al., 2000). Structural analysis shows that the resulting carbamate anion forms a hydrogen bond with the nucleophilic Ser67, suggesting that this carboxy-lysine may be the agent that activates the attacking groups, Ser67 and the hydrolytic water, in both the acylation and deacylation reactions, respectively (GOLEMI et al., 2001; MAVEYRAUD et al., 2002; MAVEYRAUD et al., 2000).

From this point, the discussion in this dissertation will focus on the class A and class B -lactamases as these are the most relevant to the work here presented.

1.3.3 Structure and mechanism of class A -lactamases

Among the four Ambler classes of -lactamases, class A enzymes are largely plasmid encoded, the most numerous and widespread among Gram-positive and Gram-negative bacteria. The study of three dimensional structures of several -lactamases from molecular class A showed remarkable similarities with the penicillin-binding proteins (PBPs). The first class A -lactamase crystal structure to be determined was that of PC1 from S. aureus (HERZBERG and MOULT, 1987) followed by the class A -

20

General Introduction
____________________________________________________________________________________________________________________________________________________

lactamases of Streptomyces albus G (DIDEBERG et al., 1987), Bacillus licheniformis 749/C (MOEWS et al., 1990) and E. coli (TEM-1) (JELSCH et al., 1992; JELSCH et al., 1993). By the same time Strynadka and collaborators solved the crystal structure of the TEM-1 mutant Glu166Asn as an acylenzyme complex with benzylpenicillin (STRYNADKA et al., 1992). Since then numerous structures of wild-type, mutants and substrate and inhibitor complexes have been determined for class A lactamases (FISHER et al., 2005). Comparison of these structures revealed that molecular class A -lactamases consist of two structural domains: an all domain consisting of eight helices and an / domain formed by three helices and five sheets. The active site pocket is located at the interface of the two domains (HERZBERG and MOULT, 1987). Along with the similarity in the three dimensional structures, a high degree of similarity is also found in the relative positions of four highly conserved motifs (Figure 1.7).

Figure 1.7 Overall structure of the class A -lactamase TEM-1 (PDB accession 1ZG4) with the two domains labelled. The conserved motifs of class A -lactamases are shown in different colours. The first motif (S70-K73) in the active site is in green; the second motif (S130-N132) is in orange; the third motif (K234-G236) and the omega loop (residues 163 to 178) are shown in blue and magenta, respectively. The catalytic S70, and S130, E166 and N170, some of the residues involved in the catalytic mechanism, are shown as a stick model with grey carbon atoms, red oxygen atoms, and blue nitrogen atoms.

21

Chapter 1
____________________________________________________________________________________________________________________________________________________

The first motif extends from Ser70 to Lys73 (SXXK) (residue numbering according to Ambler et al., (AMBLER et al., 1991)) and includes the critical serine that is activated to undergo acylation. This residue is located near the N-terminus of a helix (Figure 1.7) thus facilitating its activation as a nucleophile (HERZBERG and MOULT, 1987; MOEWS et al., 1990). Replacement of the active-site serine with other residues abolishes enzyme activity, providing evidence that Ser70 is involved in the -lactam hydrolysis (CHEN et al., 1996; DALBADIE-MCFARLAND et al., 1986). Lys73 is located in the same helix and points into the active site, however its role in the catalytic mechanism is still under discussion. Mutagenesis studies have shown experimentally that Lys73 is involved in the acylation reaction (CHEN et al., 1996), probably through stabilization of Ser70 during its deprotonation (CHEN et al., 1996). The second element, situated on a short loop, contains Ser130 to Asn132 (SXN) and forms one side of the active site groove (Figure 1.7). Ser130 is an important residue in the catalytic mechanism and is thought to be required to transfer a proton from its hydroxyl group to the nitrogen atom of the -lactam substrate after formation of the tetrahedral intermediate (LAMOTTE-BRASSEUR et al., 1991). A triad composed of residues Lys234-Thr(Ser)235-Gly236 composes the third motif and forms the opposite wall of the active site cavity (Figure 1.7). Lys234 is considered to be involved in stabilization of Ser130 (in the SXN motif) through hydrogen bonding (MATAGNE et al., 1998). A fourth element, found in class A -lactamases, extends from Glu163 to Asn178 and forms the bottom of the active site cavity (HERZBERG and MOULT, 1987; JELSCH et al., 1993) (Figure 1.7). This element is known as the loop and contains the essential Glu166, involved in deacylation. Involved in a dense hydrogenbonding network, the conserved residues Glu166 and Asn170 are essential to position the conserved deacylating water molecule close to Ser70 (LAMOTTEBRASSEUR et al., 1991). During deacylation Glu166 activates this water molecule that then attacks the carbonyl carbon of the acylenzyme intermediate. Transfer of a proton to the catalytic Ser70 regenerates the enzyme (HERZBERG and MOULT, 1987). The study of Glu166 mutants confirmed the involvement of this residue in substrate hydrolysis (ADACHI et al., 1991; DELAIRE et al., 1991) while the decrease

22

General Introduction
____________________________________________________________________________________________________________________________________________________

in the deacylation rate with the E166A mutant is consistent with Glu166 acting as a general base to activate water in the deacylation step (ESCOBAR et al., 1991). Although the mechanism for deacylation is well established, the identity of the residue involved in the activation of the active serine (Ser70) in the acylation step has been subject of controversy. Two residues, Glu166 and Lys73 have been proposed as candidates to act as the general base in the acylation mechanism, i.e. abstracting the hydroxyl proton of the active serine and increasing its nucleophilicity. Strynadka and co-workers proposed that Lys73 acts as a general base, abstracting a proton from Ser70 and transferring it to the nitrogen atom of the -lactam amide of the substrate via Ser130, assuming that the lysine is unprotonated (STRYNADKA et al., 1992). However, a NMR study suggested that Lys73 is positively charged in the free enzyme, with a pK a value above 10 (Damblon et al. 1996). Also, Lietz and collaborators studied the role of Lys73 in the acylation reaction using the mutant K73A from B. licheniformis -lactamase (LIETZ et al., 2000). According to these authors, a decreased turnover rate and catalytic efficiency was observed, but also a significant shift in pK a to higher pH, consistent with the removal of the positive ammonium group of the lysine from the proximity of Glu166. These data provide indication that Lys73 does not act as the general base in the activation of the serine hydroxyl group but is most likely involved in both acylation and deacylation through electrostatic effects on neighbouring residues (LIETZ et al., 2000).

In an alternative mechanism, Glu166 is proposed to act as the general base in both acylation and deacylation (Figure 1.8), activating Ser70 by way of a water molecule that is situated between the two residues (LAMOTTE-BRASSEUR et al., 1991). Several mutagenesis studies support this hypothesis: with the El66C mutant both acylation and deacylation are decreased by several orders of magnitude (Escobar, 1994); mutants E166N in TEM-1 and E166H in the S. albus G lactamases were shown to form stable acylenzymes with -lactam antibiotics but with a reduced acylation rate when compared to the wild-type enzymes (GUILLAUME et al., 1997). In addition, ultra-high resolution crystal structures of TEM-1 in complex with an acylation transition-state analogue (MINASOV et al., 2002) and of CTX-M-9 (CHEN et al., 2007) together with theoretical simulations of the reaction coordinates (HERMANN et al., 2009) suggest that Glu166 acts through a water molecule to activate Ser70 for nucleophilic attack on the -lactam ring of the substrate.

23

Chapter 1
____________________________________________________________________________________________________________________________________________________

Taken together these studies strongly support the conclusion that Glu166 functions as a general base catalyst in both formation and hydrolysis of the acylenzyme intermediate as originally proposed by Lamotte-Brasseur and collaborators (1991).

Over the course of the reaction pathway, tetrahedral transition-state intermediates are formed in which the -lactam carbonyl oxygen is negatively charged (B and D in Figure 1.8). In order to stabilize this charge, hydrogen-bonding interactions are made with an oxyanion hole formed by the main chain amino groups of Ser70 and Ala237 (HERZBERG and MOULT, 1987; STRYNADKA et al., 1992).

Figure 1.8 Proposed reaction mechanism for a penicillin -lactam substrate and a class A serine -lactamase in which Glu166 participates in activating a water molecule for both acylation and deacylation. Dashed lines represent hydrogen bonds. Following activation of the hydroxyl group, Ser70 performs a nucleophilic attack on the carbonyl group of the -lactam antibiotic (A), resulting in a high-energy acylation intermediate (B). Protonation of the -lactam nitrogen leads to cleavage of the C-N bond and formation of the covalent acyl-enzyme (C), which adopts a lower energy state. Attack by a catalytic water leads to a high-energy deacylation intermediate (D), with

24

General Introduction
____________________________________________________________________________________________________________________________________________________

subsequent hydrolysis of the bond between the -lactam carbonyl and the oxygen of Ser70 (E). Deacylation regenerates the active enzyme and releases the inactive -lactam. Adapted from Drawz and Bonomo (2010).

1.3.4 Evolution of class A -lactamases

Penicillin-resistant staphylococci were observed shortly after the introduction of penicillin, threatening the treatment of infectious diseases (BARBER, 1947). In order to restore penicillin activity, pharmaceutical companies developed new generations of penicillins, including methicillin and oxacillin. Methicillin was introduced to the clinic in 1959, but by 1961 strains of methicillin resistant S. aureus (MRSA) had emerged (JEVONS, 1961) due to the production of altered PBPs as described earlier (see section 1.2.2.1 ). To fight pathogenic bacteria able to produce penicillinases, particularly Gramnegative organisms, new -lactams, aimed at resisting the hydrolytic action of lactamases and further increasing their spectrum of activity, were developed (ABBANAT et al., 2008). Among these -lactamase-stable antibiotics are modified penicillins (e.g. ampicillin), third (e.g. cefotaxime and ceftazidime) and fourth generation cephalosporins (cefepime), cephamycins (cefoxitin), oxacephamycins (moxalactam), monobactams (aztreonam) and carbapenems (e.g. imipenem). Another strategy employed to retain the effectiveness of -lactam antibiotics is the discovery and use of compounds that inactivate the -lactamases (DRAWZ and BONOMO, 2010; FISHER et al., 2005). Clavulanate, a natural product of Streptomyces clavuligerus, was the first inhibitor to be identified (BROWN et al., 1976). Subsequent modifications to its structure lead to the development of two other inhibitors, sulbactam and tazobactam (CARTWRIGHT and COULSON, 1979; ENGLISH et al., 1978). Although they share structural similarity with -lactam antibiotics, generally these inhibitors do not have antimicrobial activity on their own, and are formulated with a -lactam antibiotic (e.g. amoxicillin-clavulanate and ampicillin-sulbactam) to act as shields against -lactamases (DRAWZ and BONOMO, 2010). The three commercially available -lactamase inhibitors described above are directed mainly to class A -lactamases and are usually less effective against other -lactam resistant enzymes (BUYNAK, 2006). Still, bacteria have always evolved to counteract the action of new -lactam drugs and -lactam inhibitor combinations as these are introduced into clinical use (LIVERMORE, D. M., 2009).

25

Chapter 1
____________________________________________________________________________________________________________________________________________________

The plasmid-encoded -lactamases TEM-1, TEM-2 and SHV-1 are the most frequently found -lactamases in clinical isolates of E. coli and Klebsiellae, respectively, and confer resistance to penicillins and first generation cephalosporins. The introduction of third and fourth generation cephalosporins in the early 1980s has driven the evolution of extended-spectrum TEM and SHV -lactamases (ESBLs) that are characterised by the ability to hydrolyse second and third generation cephalosporins and aztreonam, but not cefoxitin or carbapenems (PATERSON and BONOMO, 2005; PEREZ et al., 2007). These ESBLs result from one to four aminoacid substitutions compared with their parent enzymes, usually at positions located close to the active site cavity. The mutations associated with the ESBL activity occur at positions Glu104 (TEM), Ala146 (SHV), Gly156 (SHV), Arg164 (TEM), Leu169 (SHV), Asp179 (SHV and TEM), Arg205 (SHV), Ala237 (TEM), Gly238 (TEM and SHV), and Glu240 (TEM and SHV) (KNOX, 1995; MATAGNE et al., 1998). The most frequent substitutions occurring in both TEM and SHV-derived ESBLS are those of Gly238 for serine and Glu240 for lysine (http://www.lahey.org/studies). Mutagenesis studies on TEM and SHV ESBLs determined that the G238S and E240K mutations were the primary cause for ceftazidime resistance and that an increased catalytic efficiency towards cefotaxime was observed only with G238S mutants (HULETSKY et al., 1993; VENKATACHALAM et al., 1994). Cantu and Palzkill (1998) proposed that a steric conflict with the S238 side chain affects the displacement of the loop and that an intramolecular hydrogen bond between S238 side chain and N170 main chain carbonyl group in the loop is required to stabilize the loop in a new location. This would allow extended-spectrum cephalosporins greater access to the active site cavity and consequently improves the catalytic efficiency of the enzyme for these substrates (CANTU and PALZKILL, 1998). The crystal structure of SHV-2, a naturally occurring G238S mutant of SHV-1, has shown a significant displacement of part of the -sheet strand S3 (residues 234-237), and of the short loop connecting S3 and S4 (residues 238-243), as well as a conformational rotation in the 240241 region in this loop (NUKAGA et al., 2003b). The structure of TEM-52 (E104/M182T/G238S) reports the movement of loop 238-243 with respect to its position in TEM-1, widening the opening of the active site and causing a reorganization of adjacent loops (ORENCIA et al., 2001). Consequently, the carboxylate group of E240 is shown to be removed from the active site and oriented over the strand S3, decreasing the possibility of any interference with substrate side chain (ORENCIA et al., 2001). These structural changes at the -sheet are caused by the insertion of the larger S238 side-chain

26

General Introduction
____________________________________________________________________________________________________________________________________________________

between the strand S3 and the loop. The displacement of strand S3 away from the loop results in an expansion of the -lactam binding site so that it is better able to accommodate the bulky, rigid R1 substituents of the oxyimino cephalosporins, as previously suggested by Huletsky and collaborators (HULETSKY et al., 1993). More recently (since 1995) a new family of plasmid-mediated ESBLs has emerged that preferentially hydrolyse cefotaxime, the CTX-M-type enzymes. CTX-M enzymes are more active against cefotaxime and ceftriaxone than against ceftazidime and are now the most frequently observed ESBLs (BONNET, 2004). These enzymes are not related to TEM or SHV -lactamases but probably originate from chromosome-encoded class A -lactamases from environmental Kluyvera species with an inherited intrinsic ESBL activity (POIREL et al., 2002). In contrast to the enlarged active site observed in the TEM and SHV mutant ESBLs, thought to be responsible for their specificity (NUKAGA et al., 2003b; ORENCIA et al., 2001), CTXM enzymes have small active sites (CHEN et al., 2005). Crystallographic data for CTX-M ESBLs provided insight for understanding the structure-activity relationship in these -lactamases (CHEN et al., 2005; DELMAS et al., 2008). According to these studies, the increased activity against the bulky third-generation cephalosporins, especially ceftazidime, results from an enhanced flexibility of the -sheet strand S3 of the active site. This increased flexibility is correlated with higher ceftazidimase activity, but costs a reduction in enzyme stability. The improved activity towards ceftazidime is related with the substitution Asp240Gly. In CTX-M-16 (Val231Ala/Asp240Gly), an enzyme that is significantly more active against both cefotaxime and ceftazidime compared to the CTX-M-9 (Val231Ala), the substitutions that occur at strand S3 create structural defects, apparently loosening the strand in a coordinated way that is linked to a decreased internal stability (CHEN et al., 2005). This relation between activity and stability is also common in TEM and SHV-ESBLs and IRTs (inhibitor resistant TEMs) (KNOX, 1995). Recently, it was reported that the substrate binding site in CTX-M-16 is not enlarged and that the residue at position 240 is unable to interact with ceftazidime (DELMAS et al., 2008), in clear contrast to the situation observed with TEM and SHV ESBLs (NUKAGA et al., 2003b). Molecular dynamics simulations showed that in CTX-M-16 G240 promotes the coordinated vibration of strand S3 along with the catalytic S70 and residues 167 to 170 located in the loop. These coordinated vibrations improve interactions between residues 237 and 235 and the

27

Chapter 1
____________________________________________________________________________________________________________________________________________________

side chain of ceftazidime, favouring the accommodation of the bulky antibiotic (DELMAS et al., 2008). The ESBLs are mostly plasmid-encoded and thus easily spread through horizontal gene transfer. They are now found worldwide, not only in the hospitals but also in the community. These enzymes are able to hydrolyse -lactam antibiotics from several classes resulting in resistance to penicillins, cephalosporins and aztreonam. Since the 1980s, they have been known to cause nosocomial outbreaks and have been on the increase in recent years (CANTON and COQUE, 2006; PEREZ et al., 2007).

1.3.5 Metallo--lactamases
Not all -lactamases use a serine residue for catalytic activity. The metallo-lactamases (MBLs) or molecular classe B -lactamases are classified in functional group 3 (BUSH and JACOBY, 2010) and constitute a subset of zinc hydrolases with the ability to hydrolyse the amide bond of the -lactam ring of a number of -lactam antibiotics. The metallo--lactamase group includes a small number of enzymes when compared to serine -lactamases, but their numbers are still increasing. The first metallo--lactamase to be described was the BcII enzyme isolated from Bacillus cereus in 1966 (SABATH and ABRAHAM, 1966). For two decades it was the only example of an MBL and was regarded as a biochemical curiosity as B. cereus was not considered to be a serious clinical pathogen. Later these enzymes were described in several species of bacteria that occur naturally, such as Bacteroides fragilis, Chryseobacterium spp., Legionella gormanii, Stenotrophomonas spp., and several species of Aeromonas. In these environmental bacteria MBLs are encoded in the chromosome (QUEENAN and BUSH, 2007). The zinc-dependent enzymes were only regarded as potential threats when found to be transferable (WATANABE et al., 1991). Since 1991 a dramatic increase in acquired and transferable MBLs has been observed among major Gram-negative pathogens, including various Acinetobacter, P. aeruginosa and the Enterobacteriaceae (WALSH et al., 2005). The majority of transferable metallo--lactamases are included in common families: IMP, VIM, GIM, SPM and SIM, members of which are associated with several genetic platforms such as integrons, plasmids, transposons and ISCRs. Some of these are mobile, facilitating the transfer of MBLs among bacteria (WALSH et al., 2005).

28

General Introduction
____________________________________________________________________________________________________________________________________________________

1.4

Carbapenemases
The treatment of infectious diseases by penicillins and cephalosporins is

increasingly challenged by the emergence and dissemination of numerous CTX-M, TEM and SHV mutants with a broad spectrum of activity (PEREZ et al., 2007). Of all -lactams, carbapenems are the least prone to -lactamase activity, being stable against ESBLs and AmpC -lactamases. This -lactamase stability, together with the rapid penetration to the target site and strong PBP affinity, gives carbapenems the broadest spectrum of activity of any -lactams (BONFIGLIO et al., 2002). Unlike most other antibiotics, most carbapenems are effective against clinically-significant, Gramnegative non-fermenters (e.g., P. aeruginosa, Burkholderia cepacia and Acinetobacter spp.) (BETRIU et al., 2010; CASTANHEIRA et al., 2009) and anaerobes (GOLDSTEIN and CITRON, 2009). Moreover, these -lactam compounds also behave as irreversible inhibitors of most serine--lactamases (BEADLE and SHOICHET, 2002; NUKAGA et al., 2003a). As is the case of the other -lactamase inhibitors, carbapenems can give rise to a tetrahedral acylenzyme intermediate that resists deacylation and permanently inactivates the -lactamase (BEADLE and SHOICHET, 2002). Therefore, carbapenems have traditionally been reserved to treat the most serious infections, being considered last resource antibiotics in the hospital, used against bacterial strains that exhibit resistance to other -lactams. However, their clinical use has increased over the last 20 years as the prevalence of resistance to penicillins, cephalosporins, fluoroquinolones and aminoglycosides has increased (BAUGHMAN, 2009). Although carbapenems are susceptible to serine carbapenemases and metallo--lactamases, so far these resistance mechanisms are less common; nevertheless they are increasing worldwide, selected by the treatment of infections caused by ESBL-producing pathogens. Their dissemination severely limits the options for treatment of producing organisms (QUEENAN and BUSH, 2007; WALTHER-RASMUSSEN and HOIBY, 2007). According to Poirel and Nordmann, carbapenemases can be defined as lactamases that significantly hydrolyse at least imipenem and/or meropenem; additionally most of these enzymes are also active against other -lactams such as penicillins, oxyimino-cephalosporins and cephamycins (POIREL and NORDMANN, 2002). Carbapenemases are a diverse group including enzymes from molecular classes A, B and D (QUEENAN and BUSH, 2007).

29

Chapter 1
____________________________________________________________________________________________________________________________________________________

Occasionally overproduction of AmpC enzymes can confer clinically relevant resistance to carbapenems, if this is associated with other resistance mechanisms such as porin loss (MAMMERI et al., 2008).

1.4.1 Oxacillinases
The class D -lactamases are also referred as oxacillinases because they hydrolyse oxacillin and cloxacillin much faster than classical penicillins. A limited number of oxacillinases with weak carbapenemase activity have been described, mainly in A. baumannii (BERTINI et al., 2006; CARRER et al., 2010), but also occur in P. aeruginosa (GIRLICH et al., 2004) and Enterobacteriaceae (GLMEZ et al., 2008; POIREL et al., 2004b). The OXA carbapenemases are very diverse enzymes that can be divided into subgroups such as OXA-23-like, OXA-24-like, OXA-48, OXA-51-like, and OXA-58-like. OXA carbapenemase genes are located on both chromosomes and plasmids (WALTHER-RASMUSSEN and HIBY, 2006). The substrate specificities of the OXA-type carbapenemases are diverse, but generally the enzymes have measurable hydrolytic activity against the penicillins (benzylpenicillin, ampicillin, piperacillin and ticarcillin), some cephalosporins (cefalotin and cefaloridine) and imipenem while the extended-spectrum -lactams, ceftazidime, cefotaxime and aztreonam, are not or only very poorly hydrolysed (WALTHER-RASMUSSEN and HOIBY, 2007). In general, imipenem hydrolysis, which is faster than meropenem hydrolysis, is slow, with the highest k cat values for the OXA-54 and OXA-48 enzymes at 1 s1 and 2 s1, respectively (POIREL et al., 2004a; POIREL et al., 2004b). The K m values for imipenem are also low, ranging from 2 to 20 M, indicating that the OXA enzymes have very high affinity for these substrates (QUEENAN and BUSH, 2007). Class D -lactamases are usually not inhibited by clavulanic acid,

tazobactam, and sulbactam, whereas their activities may be inhibited in vitro by sodium chloride (NaCl) (WALTHER-RASMUSSEN and HOIBY, 2007). Inhibition by NaCl is attributed to the presence of a Tyr residue in the Tyr144-Gly-Asn motif (HERITIER et al., 2003). Most of the OXA-type carbapenemases exhibit low catalytic efficiency for the carbapenems in vitro; however the association with other resistance mechanisms such as reduced permeability (MUSSI et al., 2005; POIREL et al., 2004b) or

30

General Introduction
____________________________________________________________________________________________________________________________________________________

expression of efflux pumps (HERITIER et al., 2005; LEE et al., 2010) usually results in high-level resistance to carbapenems in the resistant strains.

1.4.2 Class A carbapenemases

Class A -lactamases with activity against carbapenems were considered uncommon. These were first described in the 1980s in some Enterobacteriaceae (NORDMANN et al., 1993; YANG et al., 1990). However, they are now widespread as result of the transmission of plasmid-mediated carbapenemases (LIVERMORE, D. M., 2009). The class A carbapenemases belong to functional group 2f, are inhibited, to varying degrees, by -lactamase inhibitors (but not EDTA), and still represent a relatively small group of -lactamases. However, they are increasing in number, due primarily to the increasing identification of the plasmid-mediated enzymes KPC (Klebsiella pneumoniae carbapenemase) and GES (Guiana extended spectrum) (BUSH and JACOBY, 2010). These enzymes have been described in isolates that also have AmpC-type cephalosporinases, thereby broadening their substrate profile to a wide variety of -lactam compounds (RASMUSSEN and BUSH, 1997). As mentioned earlier, carbapenems are able to irreversibly inhibit most class A -lactamases including ESBLs (BEADLE and SHOICHET, 2002; NUKAGA et al., 2003a). However, so far, the mechanism by which class A carbapenemases escape inhibition and hydrolyse these antibiotics remains unclear. The group of class A carbapenem-hydrolysing -lactamases consists of a small number of chromosomal enzymes including NMC-A and IMI-1 from E. cloacae (NORDMANN et al., 1993; RASMUSSEN et al., 1996), Sme-1 to -3 from S. marcescens (enzymes differing by one to two amino acid substitutions) (QUEENAN et al., 2006; QUEENAN et al., 2000; YANG et al., 1990), SFC-1 from S. fonticola (HENRIQUES et al., 2004) and the recently described BIC-1 from P. fluorescens (GIRLICH et al., 2010). In addition, class A carbapenemases also include plasmid-mediated enzymes, the most important being the carbapenemases from K. pneumoniae (KPCs), and some GES -lactamases (POIREL et al., 2001; YIGIT et al., 2001). The chromosomal enzymes NMC-A, Sme and IMI-1 share a similar spectrum of hydrolysis that includes penicillins, early cephalosporins, carbapenems and aztreonam. Imipenem is hydrolysed faster than meropenem and they display, if detected, a very low activity against extended-spectrum cephalosporins. These

31

Chapter 1
____________________________________________________________________________________________________________________________________________________

enzymes are inhibited by the -lactamase inhibitors clavulanic acid, tazobactam and sulbactam (MARIOTTE-BOYER et al., 1996; QUEENAN et al., 2000; RASMUSSEN et al., 1996). The expression of these -lactamases is inducible and regulated by a LysR-type regulator (NAAS et al., 1995; NAAS and NORDMANN, 1994). In two reports IMI-2 has been identified in plasmids associated with transposable elements (AUBRON et al., 2005; YU et al., 2006). The plasmid-mediated class A carbapenemases KPC were first described in Klebsiellae (KPC-1 to KPC-3 differing by one to two point mutations), and were later reported in other members of the Enterobacteriaceae family (QUEENAN and BUSH, 2007; YIGIT et al., 2001). KPC enzymes display a similar hydrolytic profile, exhibiting resistance to carbapenems, penicillins, cephalosporins and aztreonam and inhibition by the -lactamase inhibitors clavulanic acid and tazobactam. Cephamycins and ceftazidime are weakly hydrolysed (WOODFORD et al., 2004; YIGIT et al., 2001; YIGIT et al., 2003). In contrast to most chromosomal carbapenemases, expression of KPC enzymes is not inducible (YIGIT et al., 2001). The KPC family has a great potential for spread due to its location on plasmids. KPC enzymes were recently reported in non-fermenters such as P. aeruginosa (VILLEGAS et al., 2007) and Acinetobacter spp. (ROBLEDO et al., 2010). To date, nine different KPC variants (KPC-2 to -10) have been identified that differ by one or two amino acid substitutions (ROBLEDO et al., 2010). Of great concern is the concomitant occurrence of KPC enzymes with multiple plasmid-mediated enzymes, most often TEM-1 and SHV-11 (GIANI et al., 2009; YANG et al., 2010). More worrisome is the co-expression of KPCs and metallo-carbapenemases (YANG et al., 2010) and additionally common ESBLs such as CTX-M-15 (POURNARAS et al., 2010). This fact, together with their current spread worldwide, makes KPCs a potential threat to the antibiotic-based treatments currently available. The GES family is the most recently reported group of class A

carbapenemases. The first enzyme to be described with carbapenemase activity was GES-2, a point mutant derivative (G170N) of the extended-spectrum -lactamase GES-1 (POIREL et al., 2001). GES-2 is an ESBL with the substrate profile extended to imipenem but with hydrolysis rates lower than those of other carbapenemhydrolyzing class A -lactamases (POIREL et al., 2001). Subsequently, three other variants with similar carbapenemase activity have been described (GES-4, GES-5, and GES-6), displaying the amino acid substitution G170S in the -loop of the catalytic site (VOURLI et al., 2004; WACHINO et al., 2004). The genes encoding GES

32

General Introduction
____________________________________________________________________________________________________________________________________________________

-lactamases were found in the variable region of class 1 integrons carried on selftransferable plasmids from different geographical locations (POIREL et al., 2001; WACHINO et al., 2004).

1.4.2.1

Tertiary structure
Class A carbapenemases comprise a peculiar group of enzymes as they are

very broad spectrum -lactamases able to efficiently hydrolyse not only classical penicillins and cephalosporins but also -lactam substrates that are usually considered resistant to the activity of class A enzymes (QUEENAN and BUSH, 2007; WALTHER-RASMUSSEN and HOIBY, 2007). To date crystal structures of class A carbapenemases have been determined for NMC-A, Sme-1, KPC-2 and GES-2 showing that all share an overall structural organization and catalytic residues similar to those of other class A -lactamases (FRASE et al., 2011; KE et al., 2007; SOUGAKOFF et al., 2002; SWARN et al., 1998) (Figure 1.9A and B).

Figure 1.9 Superposition of a class A carbapenemase (KPC-2, green; PDB accession 2OV5) and a non-carbapenemase (TEM-1, magenta; PDB accession 1ZG4). A) Overall structure with some conserved residues depicted to position the active site. B) Active site of carbapenemase KPC-2 with -lactamase TEM-1 as reference. Hydrogen bonds are shown as dashed lines and the deacylation water as a red sphere (W). C) Change in structure between -sheets strands S3 and S4 (black arrows).

At the structural level, one of the most striking features of class A carbapenemases is the unique disulfide bond between Cys69 and Cys238, located

33

Chapter 1
____________________________________________________________________________________________________________________________________________________

near the active site (Figure 1.9B), and absent in the other class A -lactamases (KE et al., 2007; RAQUET et al., 1997; SOUGAKOFF et al., 2002; SWARN et al., 1998). Homology modelling studies with NMC-A and Sme-1 suggested that this disulfide bridge connects and constrains the two structural domains, significantly modifying the position of the S3 -strand and consequently, the active site geometry (RAQUET et al., 1997). According to these authors, the altered active site geometry allows a better interaction of the -lactam carbonyl of imipenem with the oxyanion hole of Sme-1 than is possible with that of TEM-1 (RAQUET et al., 1997). However, sitedirected mutagenesis experiments have shown that the disulfide bond is required for hydrolysis of all -lactams by Sme-1 and therefore, although important, it does not uniquely provide carbapenemase activity. These data suggest that the disulfide bond is necessary for the structural organization, or to stabilize, the enzyme (MAJIDUDDIN and PALZKILL, 2003; SOUGAKOFF et al., 2002). On the other hand, some GES variants, such as GES-1, have cysteine at positions 69 and 238 but have poor carbapenemase activity while hydrolysing extended-spectrum cephalosporins (WALTHER-RASMUSSEN and HOIBY, 2007). This is evidence that other features are necessary for carbapenem hydrolysis. The structure of NMC-A revealed a number of structural differences in the proximity of the active site in comparison to other class A -lactamases (SWARN et al., 1998). Apart from the disulfide bond discussed above, the conformation adopted by C238 induces a change in conformation of -sheet strand S3 between residues 237 and 240 (Figure 1.9C), potentially increasing the access of substrate to the active site. In addition, positional differences were observed at N132 (Figure 1.9B); this residue is shifted away from strand S3 by 1.0 in NMC-A compared to the acylenzyme complex TEM-1-6-hydroxymethyl penicillanic acid, and provides additional space in the substrate-binding cavity. This modification was proposed to allow the accommodation of the 6-1R-hydroxyethyl substituent of carbapenems (SWARN et al., 1998). In the crystal structure of Sme-1 however, N132 occupies a position that is almost identical to that observed in TEM-1 (SOUGAKOFF et al., 2002). In Sme-1 the most remarkable structural feature is the short distance (1.4 ) separating the side chains of residues S70 and E166 in the active site cleft, compared with NMC-A and TEM-1. This leads to a lack of space to accommodate the catalytic water molecule found in that position in the other class A -lactamases (SOUGAKOFF et al., 2002). The authors hypothesized that a water molecule situated in the oxyanion hole of

34

General Introduction
____________________________________________________________________________________________________________________________________________________

Sme-1 can serve as the deacylating agent of the acylated enzyme (SOUGAKOFF et al., 2002). A Ser237Ala mutation in Sme-1 resulted in a marked decrease in catalytic activity against imipenem and cephalosporin substrates, showing that S237 contributes to the carbapenemase activity (SOUGAKOFF et al., 1999). In another site-directed mutagenesis study of Sme-1, it was possible to recognize that several positions are important for hydrolysis of -lactam antibiotics, but no single position was found to uniquely contribute to carbapenem hydrolysis (MAJIDUDDIN and PALZKILL, 2005). Taken together, these data support the idea that the carbapenemase activity of the group 2f carbapenemases is due to the important conserved residues that contribute together to form an active site that can accommodate and hydrolyse the carbapenems (MAJIDUDDIN and PALZKILL, 2005). The structure of KPC-2 shows several active site alterations that are unique among carbapenemases. A shift of the catalytic S70 residue (Figure 1.9B) renders the active sites of the carbapenemases shallower, likely allowing easier access of the bulkier substrates. Further multiple active site adjustments including shifts in N132 and N170 (Figure 1.9B) are likely to collectively provide additional room to accommodate the -substituents present in carbapenems and cephamycins (KE et al., 2007). Apart from the disulfide bridge, no major structural differences have been observed between class A carbapenemases and non-carbapenemases. Moreover, the structures of the class A carbapenemases solved so far did not provide a precise mechanism for the carbapenem hydrolysis in these enzymes. The structure of a class A carbapenemase complexed with a -lactam molecule would provide useful information to definitely establish the catalytic mechanism of these threatening enzymes.

1.4.3 Metallo- -lactamases

Most of the carbapenemases described so far belong to the metallo-lactamase (MBL) group. These are part of a superfamily of metallo-hydrolases with wide catalytic diversity (including oxydoreductases, glyoxylases, phosphoryl cholinesterase, etc.) (BEBRONE, 2007). The MBLs are unique among -lactamases in requiring divalent cations (usually Zn (II)) in the active site for activity and constitute
35

Chapter 1
____________________________________________________________________________________________________________________________________________________

the only family of -lactamases whose carbapenemase activity is prevalent (QUEENAN and BUSH, 2007). A major characteristic of most MBLs is that they catalyse the hydrolysis of nearly all -lactams used for therapeutic purposes. These enzymes have a very broad spectrum of activity exhibiting high activity towards carbapenems, cephamycins, third-generation cephalosporins and penicillins. Monobactams are the sole -lactam antibiotics to be poorly recognized (FELICI et al., 1993), however MBLs are often identified in isolates that also produce an ESBL able to hydrolyse aztreonam (POURNARAS et al., 2010). Metallo--lactamases are resistant to the clinically available class A -lactamase inhibitors such as clavulanic acid, but are susceptible to chelating agents such as EDTA, dipicolinic acid or 1,10phenanthroline (QUEENAN and BUSH, 2007).

1.4.3.1

Classification
Based on DNA sequence alignments, protein structure, activity profile and

metal ion requirements, MBLs are classified into three subclasses: B1, B2, and B3 (GALLENI et al., 2001; GARAU et al., 2004). Subclass B1 includes several chromosomally encoded enzymes such as BcII from B. cereus (HUSSAIN et al., 1985), CcrA from B. fragilis (RASMUSSEN et al., 1990), BlaB from Elizabethkingia meningoseptica (ROSSOLINI et al., 1998), as well as the plasmid-encoded IMP (WATANABE et al., 1991), VIM (LAURETTI et al., 1999), SPM (TOLEMAN et al., 2002), and GIM (CASTANHEIRA et al., 2004)-type enzymes. The acquired MBL genes located on plasmids are usually embedded in class 1 integrons, which can contain additional gene cassettes, and are easily disseminated among clinical isolates (HU and ZHAO, 2009; TATO et al., 2010). The most recent examples of transferable B1 enzymes are DIM-1 from P. stutzeri (POIREL et al., 2010b) and NDM-1, originally described in a K. pneumoniae isolate (YONG et al., 2009) but rapidly spreading in India, Pakistan, the UK (KUMARASAMY et al., 2010), Australia (POIREL et al., 2010a) and a rapidly growing number of other countries (NORDMANN et al., 2011). The subclass B2 includes the enzymes produced by different Aeromonas species (CphA (MASSIDDA et al., 1991), ImiS (WALSH et al., 1998) and AsbM1 (YANG and BUSH, 1996)) and the Sfh-I -lactamase from S. fonticola (SAAVEDRA et al., 2003). These MBLs are considered as true carbapenemases due to their high

36

General Introduction
____________________________________________________________________________________________________________________________________________________

specificity for hydrolyzing carbapenems, and cannot effectively be detected with the use of nitrocefin (QUEENAN and BUSH, 2007). Subclass B3 includes the MBLs L1 from S. maltophilia (WALSH et al., 1994), GOB from E. meningoseptica (BELLAIS et al., 2000), FEZ-1 from L. gormanii (BOSCHI et al., 2000), THIN-B produced by Janthinobacterium lividum (ROSSOLINI et al., 2001), Mbl1b (SIMM et al., 2001) and CAU-1 (DOCQUIER et al., 2002) from Caulobacter crescentus, and BJP-1 from Bradyrhizobium japonicum (STOCZKO et al., 2006). Most of the organisms cited above are environmental species, of which some can cause opportunistic infections (such as S. maltophilia and L. gormanii) whereas others are not pathogenic. Apart from L1 enzyme from S. maltophilia, reported to exist as a tetramer (CROWDER et al., 1998), all the MBLs are monomeric enzymes. MBLs included in both subclasses B1 and B3 have a broad substrate profile exhibiting high hydrolytic activity for all -lactams except aztreonam (FELICI et al., 1993) and require two bound zinc atoms for full activity; however, these enzymes differ in the amino acids involved in zinc binding in the active site (GALLENI et al., 2001; GARAU et al., 2004). In contrast, the enzymes belonging to subclass B2 behave as strict carbapenemases, efficiently hydrolyzing only carbapenems, and display weak hydrolytic activity towards penicillins and cephalosporins (FELICI et al., 1993; WALSH et al., 1996). Another distinctive feature of this subclass is that these MBLs require only one Zn (II) for its maximal enzymatic activity and are considered to be inactivated by a second Zn (II) (COSTELLO et al., 2006; VALLADARES et al., 1997)

1.4.3.2

Structure of MBLs
The three-dimensional structures of several B1 enzymes (BcII (CARFI et al.,

1995; FABIANE et al., 1998), CcrA (CONCHA et al., 1996), IMP-1 (CONCHA et al., 2000), SPM-1 (MURPHY et al., 2006), VIM-2 (GARCIA-SAEZ et al., 2008) and IND-7 (YAMAGUCHI et al., 2010)), one B2 enzyme (CphA (GARAU et al., 2005)) and a few B3 enzymes (L1 (ULLAH et al., 1998), FEZ-1 (GARCIA-SAEZ et al., 2003) and BJP-1 (DOCQUIER et al., 2010)) have been solved by X-ray crystallography. Despite the generally low degree of sequence similarity between the different subclasses, the MBLs share a similar folding pattern (Figure 1.10).

37

Chapter 1
____________________________________________________________________________________________________________________________________________________

Metallo--lactamases exhibit a common fold, known as the metallo-lactamase fold, which includes a compact core of two sheets sandwiched by five helices on the external faces (CARFI et al., 1995) (Figure 1.10). The active site, containing one or two Zn (II) ions, is located within a shallow groove formed by the interface of the two domains (CARFI et al., 1995). The MBLs have a conserved structural metal-binding sequence, the amino acid sequence H116XH118XD120H196C221H263 and are able to bind up to two metal ions in their active site (CROWDER et al., 2006).

Figure 1.10 Metallo--lactamase overall fold, showing a representative of each subclass: IMP-1 from P. aeruginosa (B1; PDB accession 1DDK), CphA from A. hydrophila (B2; PDB accession 1X8G) and L1 from S. maltophilia (B3; PDB accession 1SML). The helices are coloured red, the sheets are green and loops are yellow. Zinc ions are represented as grey spheres. Non-conserved secondary structural elements among subclasses are labelled and/or shown in cyan.

Although the first structure determined for BcII revealed one zinc ion bound (CARFI et al., 1995), subsequent structures of enzymes from the B1 and B3 subclasses, including BcII, show a dinuclear metal center (FABIANE et al., 1998). In these enzymes, one Zn (II) ion (Zn1) is tetrahedrally coordinated to three histidine ligands, His116, His118, and His196 and a bridging water/hydroxide (Figure 1.11), while the second Zn (II) ion (Zn2) displays a trigonal bipyramidal coordination geometry (CONCHA et al., 1996; FABIANE et al., 1998; ULLAH et al., 1998). In B1

38

General Introduction
____________________________________________________________________________________________________________________________________________________

enzymes the second metal ion-binding site consists of Asp120, Cys221, His263, the bridging water/hydroxide and an additional solvent molecule. In B2 enzymes this site represents the active site species in the mono-zinc form (CRAWFORD et al., 2005; GARAU et al., 2005). The B1 Zn2 ligand Cys221 is substituted by His121 in B3 enzymes affecting the geometry of this site; thus the metal ion is bound to Asp120, His121 and His263, and one or two water molecules. The serine residue present at position 221 in B3 MBLs does not act as a metal ligand (ULLAH et al., 1998) (Figure 1.11). The other exception to the consensus metal-binding site is the single mutation of His116 to Asn116 in the Zn1 binding site among B2 enzymes (GALLENI et al., 2001) (Figure 1.11).

Figure 1.11 Metallo--lactamase active sites from the three subclasses: IMP-1 (B1), CphA (B2) and L1 (B3) (PDB accessions are as in Figure 1.9). Zinc ions (Zn) and water molecules (W) are represented as grey and red spheres, respectively. Coordination bonds are shown as dashed lines. Act (IMP-1, left) represents an acetate molecule that occupies the place of a water molecule.

The structure of B1 MBLs is characterised by a mobile loop or flap spanning residues 61-65 covering the active site (Figure 1.10), believed to be involved in substrate recognition and binding (CONCHA et al., 2000; MOALI et al., 2003). Mutagenesis studies showed that a large percentage of residues in the flap have a limited tolerance for substitutions further supporting the key role of the flap in the structure and function of IMP-1 (MATERON and PALZKILL, 2001). The mobile loop is disordered in the structure of native enzymes but in the presence of an inhibitor, the loop is stabilized (CONCHA et al., 2000; GARCA-SEZ et al., 2003). Deletion of the flap from IMP-1 resulted in a loss of catalytic efficiency dependent on the substrate tested, with almost no effect over carbapenems (MOALI et al., 2003). The structure of

39

Chapter 1
____________________________________________________________________________________________________________________________________________________

SPM-1, however, reveals the lack of the mobile flap, suggesting a different mechanism of -lactam recognition by this enzyme compared with related enzymes (MURPHY et al., 2006). The 61-65 mobile flap is absent in MBLs from subclasses B2 and B3. In CphA, a B2 enzyme, an elongated 3 helix is present (Figure 1.10) and shows a kink about Trp150 that enables 3 to follow the surface curvature of the protein and provide a hydrophobic face that contributes to binding of carbapenem substrates (GARAU et al., 2005). Crystal structures of B3 enzymes showed that there is an elongated loop between residues 150 and 168 extending over the active site (Figure 1.10) which is absent in the better characterised subclass B1 enzymes (GARCIASAEZ et al., 2003; ULLAH et al., 1998). Modelling studies have predicted that two residues of this flexible loop, Ile164 and Phe158, make significant contacts with large hydrophobic substituents of penicillins, cephalosporins, or carbapenems (ULLAH et al., 1998). However, mutagenesis studies revealed that these residues are not essential for tight substrate binding (CARENBAUER et al., 2002). A unique feature is observed in the structure of B3 enzymes: a single intramolecular disulphide bridge links two cysteines, Cys256 and Cys290 in L1 and FEZ-1 (GARCIA-SAEZ et al., 2003; ULLAH et al., 1998) while in the recently solved structure of BJP-1 a single disulphide bridge is also present but in a different region of the structure (between Cys200 and Cys220) (DOCQUIER et al., 2010).

1.4.3.3

Catalytic mechanism
As for serine -lactamases, -lactam hydrolysis in metallo--lactamases

occurs by a nucleophilic attack on the carbonyl group of the -lactam ring, followed by the cleavage of the amide bond and protonation of the bridging nitrogen atom (CROWDER et al., 2006). However, in contrast to serine enzymes, in the MBL mechanism no covalent intermediate is formed. Although the number of metal ions required for hydrolysis, and the role of each metal site in the hydrolysis of -lactams by MBLs, are still under debate, there is a general consensus that the Zn1-bound water molecule, or hydroxide, is the nucleophile for the reaction of mono- and dinuclear B1 and B3 MBLs (CROWDER et al., 2006). The structures of enzyme-product complexes of hydrolysed moxalactam with the subclass B3 MBL L1 (SPENCER et al., 2005) and hydrolysed and rearranged biapenem with the subclass B2 MBL CphA (GARAU et al., 2005) have suggested a

40

General Introduction
____________________________________________________________________________________________________________________________________________________

common role for Zn2 in MBLs. In both cases, the Zn2 site displays strong interactions with the bridging nitrogen of the hydrolysed -lactam ring and the carboxylate moiety of the antibiotic. These studies indicate that Zn2 may be involved in CN bond cleavage by stabilization of the development of negative charge in the lactam nitrogen atom, and may also play a role in substrate binding (LLARRULL et al., 2007; SPENCER et al., 2005). A quantum mechanicalmolecular mechanical (QMMM) reaction modelling report postulates that Zn2 orients a water molecule to act as a proton donor in the rate-determining step (DAL PERARO et al., 2007). Based on the crystal structures and models of -lactams bound to the active site, a catalytic mechanism has been proposed for dinuclear MBLs, such as B1 and B3 enzymes (CONCHA et al., 2000; SPENCER et al., 2005; ULLAH et al., 1998). Following substrate binding, one of the Zn ions, together with enzyme residues, polarizes the -lactam carbonyl for attack by the metal-bridging hydroxyl group that is additionally positioned and oriented by hydrogen bonding to Asp120. This creates an unstable tetrahedral species that undergoes C-N bond cleavage to generate an intermediate in which the -lactam nitrogen is anionic. This species is resolved by proton transfer to the nitrogen followed by product dissociation from the enzyme active site. The source of the proton may be Asp120 or a water molecule (DAL PERARO et al., 2007). The unprotonated anionic intermediate is not necessarily highly populated- while in some cases (such as hydrolysis of the chromogenic cephalosporin nitrocefin by the CcrA or L1 enzymes (MCMANUS-MUNOZ and CROWDER, 1999; SPENCER et al., 2001; WANG, ZHIGANG et al., 1999)) this species accumulates to high levels, in others (e.g. hydrolysis of cephalosporins by BcII (RASIA and VILA, 2004)) it does not and hydrolysis effectively occurs in a single step. A different mechanism, however, has been proposed for the B2 MBL CphA based on the crystal structures of the native enzyme and of a product complex with hydrolysed biapenem (GARAU et al., 2005). Nucleophilic attack is performed by a water molecule that is activated by a general base, His118 or Asp120, and is not coordinated to zinc (GARAU et al., 2005; XU et al., 2006). This water molecule attacks the -lactam carbonyl to generate a tetrahedral intermediate. The single Zn ion (Zn2) is thought to promote C-N bond cleavage by coordination to the -lactam nitrogen as described above for the binuclear enzymes (XU et al., 2006). An incoming solvent molecule that replaces the water used in the nucleophilic attack protonates the amide nitrogen, followed by release of the final product. However, a recently published computational study of the complete reaction mechanism of CphA

41

Chapter 1
____________________________________________________________________________________________________________________________________________________

proposes a single-step mechanism involving two water molecules in the active site (SIMONA et al., 2009). One water molecule (Wat1) performs the nucleophilic attack to the -lactam carbonyl carbon, and another Zn-bound water (Wat2) simultaneously protonates the -lactam nitrogen (Figure 1.12). This work also highlights a role for His118 in the orientation of the catalytic water as well as acting as the general base. Despite significant effort aimed at identifying the general base in the catalytic mechanism of the B2 MBLs, this remains controversial with studies pointing to either Asp120 (XU et al., 2006) or His118 (SIMONA et al., 2009) as the likely candidates.

Figure 1.12 Schematic representation of the proposed reaction mechanism of B2 MBL CphA involving two water molecules (Wat). In the Henry-Michaelis complex, the interaction of the substrate with the zinc ion is mediated by Wat1 and Wat2. Wat1 is activated by a general base (His118 in the scheme) to perform the nucleophilic attack. The zinc-bound Wat2 acts as a proton donor to the lactam nitrogen. Figure and legend were modified from Simona et al., (2009).

Until recently, the identification of the second, inhibitory zinc binding site in B2 enzymes was a matter of debate. Spectroscopic studies of cobalt-substituted ImiS from A. veronii suggested that the inhibitory zinc binds in a site distinct from the active site, involving both His118 and Met146 as ligands (COSTELLO et al., 2006; CRAWFORD et al., 2005). However, a mutagenesis study that aimed to investigate the potential zinc binding sites in CphA indicated that the position of the second zinc is similar to the tri-histidine site (see above) of subclasses B1 and B3 MBLs, with His118 and His196 as potential ligands (BEBRONE et al., 2008). This hypothesis was confirmed by determination of the structure of the dizinc form of CphA (BEBRONE et al., 2009). The structure shows that the first zinc binds in the cysteine site, as previously determined, and that the second zinc occupies a modified histidine site. In

42

General Introduction
____________________________________________________________________________________________________________________________________________________

CphA the second zinc ion is coordinated by His118 and His196 where a sulfate ion and a water molecule complete the metal coordination, with the sulfate ion acting as a bridging species between the two zinc ions (BEBRONE et al., 2009).

43

2. Scope of this dissertation

Scope of this dissertation

____________________________________________________________________________________________________________________________________________________

2.1

Serratia fonticola UTAD54

Currently bacterial resistance to -lactam antibiotics constitutes a very serious threat to the clinical community. Resistance to this class of antibiotics is primarily due to the expression of several serine and metal-containing -lactamases that hydrolyse the amide bond of the -lactam rings, resulting in antibiotic inactivation. Of utmost importance are the carbapenemases, -lactamases that are able to hydrolyse the carbapenems (i.e. imipenem and meropenem), drugs considered to be the last resort agents to treat infections caused by multiresistant pathogens. The study here presented consists of a biochemical characterisation of SFC-1 and Sfh-I, both carbapenemases of Serratia fonticola UTAD54. In this work the threedimensional structures of the two -lactamases were also determined. The strain S. fonticola UTAD54 is an environmental strain that was isolated in 2002 during a study in Northeastern Portugal investigating the susceptibility of bacterial populations of untreated drinking waters to antimicrobial agents, including carbapenems. This new strain was resistant to penicillins, cephalothin, cefuroxime and carbapenems, antibiotics to which other strains of the same species were susceptible (SAAVEDRA et al., 2003). Research upon carbapenem resistance mechanisms in S. fonticola UTAD54 led to the characterisation of a new gene coding for a metallo--lactamase, Sfh-I, that was assigned to subclass B2. However, this -lactamase alone could not explain the complete resistance profile of S. fonticola UTAD54. Further investigation lead to the identification of a new gene coding for a class A -lactamase designated SFC-1 (HENRIQUES et al., 2004). At the primary structure level, SFC-1 has high homology with the class A carbapenemases, the closest relative being KPC-1 (62% identical), a clinically important carbapenemase described in K. pneumoniae and other nosocomial pathogens. As reported for KPC-1, no transcriptional regulator controlling the expression of blaSFC-1 was found. SFC-1 is active against penicillins, cephalothin and aztreonam but has reduced susceptibility to meropenem and imipenem. The activity of SFC-1 is inhibited by -lactamase inhibitors (e.g. clavulanic acid, tazobactam). The hydrolytic profile of SFC-1 is thus typical of the class A carbapenemases already described (HENRIQUES et al., 2004).

47

Chapter 2
____________________________________________________________________________________________________________________________________________________

2.2.

Goals

Compared to other -lactamases, a relatively low number of class A carbapenemases have been identified and characterised. Thus, the first goal of the work here presented was the kinetic characterisation of SFC-1. A further aim was then to investigate the molecular basis of carbapenemase activity in SFC-1, in particular, and by implication of class A carbapenemases in general, by determining the three-dimensional structure of this enzyme. There was considered to be both a lack of structural data on the interactions between -lactamases and -lactams while the mechanism of hydrolysis of carbapenems by class A carbapenemases remains unclear. A further objective of this project was thus to use structures of -lactam complexes to establish a basis for the mechanism and specificity of SFC-1, especially with respect to carbapenem hydrolysis. Given the divergent amino acid sequence of Sfh-I relatively to those of other B2 enzymes (50%), and the generally lower level of characterisation of these enzymes when compared to B1 and B3 MBLs, an initial aim for studies on this Sfh-I was to overexpress the blaSfh-I gene in E. coli to facilitate purification and kinetic characterisation of the recombinant -lactamase. Considering that there is little consensus about the catalytic mechanism of the metallo--lactamases, in particular for subclass B2 enzymes, the final goal of this work was to determine the crystal structure of Sfh-I in order to establish a basis for the mechanism and specificity of this group of enzymes.

48

3. Biochemical characterisation of
recombinant SFC-1 from Serratia fonticola UTAD54

____________________________________________________________________________________________________________________________________________________

Biochemical characterisation of recombinant SFC-1

3.1

Introduction
-lactam antibiotics are among the safest, most efficient and most frequently

prescribed antibacterial agents available (BUSH, 2002; MOLSTAD et al., 2002). The intensive use of stable -lactams in activities such as animal farming and medicine has resulted in the large spread of resistant bacterial strains (WEGENER, 2003; WITTE, 1998). The most efficient and prevalent mechanism of resistance to lactams is the production of -lactamases, which inactivate the antibiotics by hydrolysis of the -lactam ring (FISHER et al., 2005; THOMSON and BONOMO, 2005). Considering that carbapenems are broad spectrum -lactams and are less prone to the hydrolytic action of most of the -lactamases, a serious threat is posed by carbapenem-hydrolysing enzymes (QUEENAN and BUSH, 2007). Although comparatively rare, the frequency of carbapenemase containing-bacterial species has been increasing (QUEENAN and BUSH, 2007; WALTHER-RASMUSSEN and HOIBY, 2007). Previously characterised carbapenem-hydrolysing enzymes were included into Ambler molecular classes A, B and D (POIREL and NORDMANN, 2002; RASMUSSEN and BUSH, 1997). Class A carbapenemases belonging to functional group 2f (WALTHER-RASMUSSEN and HOIBY, 2007) are uncommon and comprise the chromosomally encoded -lactamases NMC-A and IMI-1 from E. cloacae (NORDMANN et al., 1993; RASMUSSEN et al., 1996), Sme-1 to -3 from S. marcescens (QUEENAN et al., 2006; QUEENAN et al., 2000; YANG et al., 1990), SFC-1 from S. fonticola (HENRIQUES et al., 2004) and BIC-1 from P. fluorescens (GIRLICH et al., 2010); and the plasmid mediated enzymes KPC-2 to -3 initially found in K. pneumoniae (SMITH MOLAND et al., 2003; WOODFORD et al., 2004; YIGIT et al., 2001) but later described in other Enterobacteriaceae (BUSH, 2010) and nonfermenters (ROBLEDO et al., 2010; VILLEGAS et al., 2007) performing a total of 9 different variants (KPC-2 to -10). Most of the strains included in the species Serratia fonticola express both a chromosomally encoded extended-spectrum class A -lactamase and a speciesspecific AmpC -lactamase (PEDUZZI et al., 1997; STOCK et al., 2003). Previous studies have shown that S. fonticola UTAD54 additionally expresses a metalloenzyme (Sfh-I) (SAAVEDRA et al., 2003) and a class A carbapenem-hydrolyzing lactamase (SFC-1) (HENRIQUES et al., 2004). Both enzymes are chromosomally

51

____________________________________________________________________________________________________________________________________________________

Chapter 3

encoded and are absent from other S. fonticola strains. The deduced amino acid sequence of SFC-1 displays considerable similarity to those of class A carbapenemases already described and the expression of the blaSFC-1 gene in E. coli confers on the host an antibiotic resistance profile typical of class A carbapenemases (HENRIQUES et al., 2004). In order to further characterise this class A carbapenemase, the gene encoding SFC-1 from S. fonticola UTAD54 was cloned and the protein was overexpressed in E. coli. After purification, the recombinant protein was characterised by kinetic and biochemical techniques.

3.2

Materials and methods

3.2.1 Bacterial strains and plasmid

E. coli XL-2 Blue (Stratagene Inc., La Jolla, CA, USA) and E. coli BL21 (DE3) (Novagen Inc., Madison, WI, USA) were respectively used as hosts for bla SFC-1 cloning and expression experiments. Plasmid pET-26b (Novagen, Inc.) was used as the cloning and expression vector. E. coli bacterial cultures were routinely grown aerobically in LB medium at 37C, unless otherwise specified. Transformed cells were selected for the presence of plasmids using 50 g/ml kanamycin. S. fonticola UTAD54 was grown aerobically in LB medium at 30C.

3.2.2 Antimicrobial agents

Antibiotics were provided as powders by GlaxoSmithKline (ceftazidime), Atral Laboratories (piperacillin), Hoeport Pharmaceutical Products (cefotaxime), Eurobio (ampicillin), Sigma (aztreonam, cephalothin, clavulanic acid, tazobactam), Sequoia Research Products (meropenem) and Merck Sharp & Dohme Co (cefoxitin). Sulbactam and imipenem were kindly provided by Pfizer Inc. and Merck Sharp & Dohme Co, respectively.

52

____________________________________________________________________________________________________________________________________________________

Biochemical characterisation of recombinant SFC-1

3.2.3 Plasmid construction

Genomic DNA was extracted from S. fonticola UTAD54 with the Genomic DNA Purification kit (MBI Fermentas, Vilnius, Lithuania) following the manufacturers recommendations. All restriction enzymes were from Roche (Roche Diagnostics, Meylan, France).

The open reading frame encoding the mature SFC-1 polypeptide without the leader sequence was amplified by PCR using the following primers containing restriction sites (underlined) for BspLu11I and XhoI: SFCexp2_for: 5'-GGA TCC ACA TGT CAC GCA CCG GTC GAC TG-3 SFCexp2_rev: 5'-GTG CTC GAG TTA GAA GCCGAT AGA CTT TCC-3

PCR was carried out in an iCycler Thermal Cycler (Bio-Rad Laboratories, Richmond, CA, USA) using Taq polymerase, nucleotides and buffers purchased from MBI Fermentas (Vilnius, Lithuania). PCR was performed in 50 l mixtures containing 0.5x PCR buffer with (NH4) 2 SO 4 , 0.5x PCR buffer without MgCl 2 , 3 mM MgCl 2 , 200 M deoxynucleoside triphosphates, 15 pmol of each primer, 1 U of Taq polymerase, and 50-100 ng of purified DNA from S. fonticola UTAD54. The temperature profile was as follows: initial denaturation at 94C for 7 min; 30 cycles of denaturation at 94C for 1 min, annealing at 60C for 1 min, and extension at 72C for 1 min; and a final extension at 72C for 10 min. PCR products (5 l) were analysed by electrophoresis on a 1% agarose gel to confirm the 900 bp blaSFC-1 amplification. The remaining PCR product was purified using the Concert Rapid PCR Purification System (Gibco BRL, Eggenstein, Germany). The amplified fragment was digested with BspLu11I and XhoI and ligated with T4 ligase into the NcoI site of the pET-26b vector to produce the recombinant plasmid pMF13. This plasmid expressed SFC-1 as a fusion with the pelB leader sequence from the pET-26b vector. E. coli XL-2 Blue competent cells were transformed and recombinant clones were selected on LB agar plates supplemented with 50 g/ml kanamycin and 5 g/ml aztreonam.

53

____________________________________________________________________________________________________________________________________________________

Chapter 3

Five colonies were picked into 10 ml LB medium supplemented with 50 g/ml kanamycin and grown overnight at 37C. Plasmid DNA was purified using the Concert High Purity Plasmid Miniprep System (Life Technologies Inc., Gaithersburg, MD, USA). The presence of inserts was confirmed by double digestion with BspLu11I and XhoI. The gene was sequenced in the forward direction to verify that bla SFC-1 was inserted in frame. Plasmid pMF13 was then transformed into the expression host E. coli BL21 (DE3).

3.2.4 Detection of -Lactamase activity by SDS-PAGE

Crude cell extracts of the E. coli clone expressing the recombinant enzyme were prepared. Expression of the SFC-1 enzyme was confirmed by SDS-PAGE. lactamase activity was detected by incubation of SDS-PAGE gels with nitrocefin, according to Stock and collaborators (STOCK et al., 2003). After the identification of the -lactamase band, the gel was stained with Coomassie Brilliant Blue (Sigma). The Low Molecular Weight SDS Calibration Kit (GE Healthcare UK Limited, Buckinghamshire, UK) was used to estimate the molecular weight of the protein.

3.2.5 Optimization of the expression of recombinant SFC-1

SFC-1 production was tested in induced and non-induced cultures. Overnight cultures of E. coli BL21 (DE3) transformed with pMF13 were used to inoculate 100 ml LB medium supplemented with kanamycin, and grown at 37C to reach an OD 600nm of 0.6. At that point, the culture was split into 2 x 50 ml cultures: one was induced by addition of 1 mM IPTG and the other served as uninduced control. Different temperatures were tested: 25C, 30C and 37C. Aliquots (1 ml) were sampled at different times (2, 3, 5, 12, 18 and 24 h) and centrifuged (23,000 x g for 122 min at 4C). Cell pellets were suspended in 0.25 ml of 50 mM sodium phosphate (pH 7.0) and frozen overnight at -20C. Cells were disrupted by sonication and the debris was removed by centrifugation (23,000 x g, 15 min, 4C). The crude protein solution was stored at -20C until use. -lactamase activities in cell extracts were determined spectrophotometrically using 100 M aztreonam as substrate ( 318nm = 640 M1cm1; (POIREL et al., 2000)) in 50 mM sodium phosphate (pH 7.0).

54

____________________________________________________________________________________________________________________________________________________

Biochemical characterisation of recombinant SFC-1

3.2.6 Over-expression and purification of SFC-1

Recombinant SFC-1 was purified from an uninduced culture of E. coli BL21 (DE3) (pMF13) grown in 0.5 L of LB medium supplemented with kanamycin at 37C to an OD 600nm of 0.6. The incubation was continued for 12 h at 25C. Cells were harvested by centrifugation (23,000 x g, 5 min, 4C) and resuspended in 5 ml of 10 mM sodium phosphate buffer (pH 7.0). Crude lysates were obtained as described above (section 2.2.5). Clear supernatant containing -lactamase activity was filtered through a 0.2m-pore-size filter and loaded onto a pre-equilibrated S-Sepharose column (Amersham Pharmacia Biotech) with 10 mM sodium phosphate buffer (pH 6.0). The proteins were eluted with a linear gradient of NaCl (0 to 1 M) in the same buffer, at a flow rate of 3 ml/min. The fractions presenting -lactamase activity, measured as initial rate of hydrolysis of 100 M ampicillin ( 232nm = - 1070 M-1 cm-1), were loaded onto a preequilibrated Superdex 75 column (Amersham Pharmacia Biotech) with 10 mM sodium phosphate buffer, pH 7.0. Elution was performed with the same buffer at a flow rate of 1 ml/min, and active fractions were collected. The protein content of each sample was determined with the Pierce BCA protein assay using BSA as standard. The purification yield and the relative molecular mass of SFC-1 were estimated by SDS-PAGE on 12% gels (LAEMMLI, 1970).

3.2.7 IEF analysis

Isoelectric focusing (IEF) of crude -lactamase extracts of S. fonticola UTAD54 and E. coli BL21 (DE3) (pMF13), as well as of purified SFC-1 was performed with commercially prepared polyacrylamide gel plates (pH 3 to 9; Amersham Pharmacia Biotech), on a Phast System apparatus (Amersham Pharmacia Biotech). Focused lactamases were detected by a 1 mM nitrocefin solution (Oxoid, Basingstoke, UK). The pI of SFC-1 was determined by comparison to those of -lactamases TEM-2 (pI 5.6) and SHV-5 (pI 8.2).

55

____________________________________________________________________________________________________________________________________________________

Chapter 3

3.2.8 N-terminal sequencing

Purified enzyme was subjected to electrophoresis in a 15% acrylamide gel (200 V, 1 h). Proteins were electroblotted onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad) for 4h at 100 mA. After transfer the membrane was stained with 0.1% Coomassie Brilliant Blue. SFC-1 bands were excised and N-terminal sequence analysis was performed in the gas-pulsed liquid phase using a model 476A protein sequencer with a micro reaction chamber and an on-line HPLC system for phenylthiohydantoin (PTH) analysis (Applied Biosystems, Foster City, California, USA). Absorbance was monitored at 269 nm. The first 7 residues were determined and compared with the deduced sequence.

3.2.9 Mass spectrometry

The exact mass of the SFC-1 enzyme was determined by electrospray ionization-mass spectrometry (ESI-MS) on a Q-TOF 2 mass spectrometer (Micromass, Manchester, UK). An aliquot (400 g) of the purified enzyme was desalted by overnight dialysis against water and lyophilized. Before injection into the mass spectrometer, the sample was solubilised in 200 l of 0.005% (v/v) trifluoroacetic acid (TFA) in methanol. Data acquisition was carried out with a Micromass MassLynkx 3.4 data system.

3.2.10 Determination of kinetic parameters

Initial hydrolysis rates were measured at 25C in 50 mM sodium phosphate (pH 7.0) on an ULTROSPEC 2000 spectrophotometer (Amersham Pharmacia Biotech). The following antibiotics and inhibitors were used: ampicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, aztreonam, imipenem, meropenem, tazobactam, sulbactam, clavulanic acid and EDTA. The wavelengths and extinction coefficients of -lactams have been described previously (POIREL et al., 2000). Substrates were assayed at different days, with ampicillin included as a reference each day. Kinetic parameters were determined by recording the initial rates at different substrate concentrations and by fitting the experimental data to the Michaelis-Menten equation, using GraphPad Prism (GraphPad Software Inc., La Jolla, USA).

56

____________________________________________________________________________________________________________________________________________________

Biochemical characterisation of recombinant SFC-1

Inhibition was measured after a 10-min pre-incubation of enzyme with inhibitor in phosphate buffer (pH 7.0), using cephalothin (100 M) as the reporter substrate. Fifty percent inhibitory concentrations (IC 50 ) were determined from inhibition graphs of percent control activity versus concentration of inhibitor.

3.3

Results and discussion

3.3.1 Over-expression of SFC-1 in E. coli
Over-expression of the S. fonticola blaSFC-1 gene in E. coli was carried out using

the T7 promoter-based expression vector, pET-26b. SFC-1 is expressed without the leader sequence as a fusion with the pelB leader sequence from the pET-26b vector. The construct was transformed into E. coli BL21 (DE3), expressing T7 RNA polymerase. In order to confirm the expression of the enzyme, separation of proteins by SDS-PAGE was performed. The crude cell extract of E. coli BL21 (DE3) (pMF13) revealed a unique -lactamase band with an apparent molecular weight of around 30.5 kDa after staining with nitrocefin. This result was in agreement with the value of 30.7 kDa predicted for the mature SFC-1 protein (HENRIQUES et al., 2004). Conditions for large-scale production of recombinant SFC-1 were optimised by testing IPTG-induced and non-induced cultures at three different temperatures (37, 30 and 25C). Production of the SFC-1 enzyme is shown to be temperaturedependent (Figure 3.1). Cultures grown at 37C yielded a -lactamase activity of 43 M.min-1.ml-1 when induced with 1 mM of IPTG. Lowering the temperature to 30C and 25C significantly increased the enzyme yield (to 55 and 234 M.min-1.ml-1, respectively). It was also verified that the SFC-1 production was remarkably influenced by IPTG induction. In non-induced cultures the yield was significantly higher with lactamase activities of 333, 420 and 542 M.min-1.ml-1 for the cultures grown at 37, 30 and 25C, respectively. After 24h SFC-1 activity was drastically reduced in the cell fraction. Since highest yields were obtained in uninduced cultures, grown at 25C, these conditions were adopted for larger-scale SFC-1 production and purification.

57

____________________________________________________________________________________________________________________________________________________

Chapter 3

Figure 3.1 Influence of temperature and IPTG induction on the production of the SFC-1 lactamase. Production temperatures include 25C (), 30C () and 37C (). In each case, time is post cell density equal to OD 600nm of 0.6. Cultures to which IPTG (1 mM) was added as inducer (____) and cultures not induced (----) are represented.

3.3.2 Purification and biochemical properties of SFC-1

Recombinant SFC-1 enzyme was purified from a 500 ml culture grown at 25C for 12 h, by means of two chromatographic steps, as described in the Material and methods section 2.2.6. A summary of a typical purification experiment is shown in Table 3.1. The initial SP-Sepharose chromatography step removed the majority of the contaminating proteins. Approximately 25 mg of purified enzyme was obtained per liter of culture using the described methodology. Protein was estimated to be >95% pure by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Figure 3.2) and the overall yield of the purification protocol was 82% (Table 3.1).

58

____________________________________________________________________________________________________________________________________________________

Biochemical characterisation of recombinant SFC-1

Table 3.1 Purification of the carbapenem-hydrolyzing -lactamase SFC-1 produced by E. coli BL21 (DE3) (pMF13).
Purification step Volume (ml) Total protein (mg) Crude extract SP-Sepharose Superdex 75 7.0 15.5 27.0 119.7 16.4 12.7 Specific activity
a

Total activity (mM min-1) 244 208 201

Yield (%)

Purification (fold)

(mM min-1mg-1) 2.0 12.7 15.8

100 85 82

1 6 8

a -lactamase activity of the different fractions was determined with 100 M ampicillin as

substrate.

Figure 3.2 SDS-polyacrylamide gel of crude extract and of purified SFC-1 -lactamase from E. coli BL21 (DE3)(pMF13). Lane M, molecular weight marker; lane 1, crude extract from E. coli BL21 (DE3)(pMF13); lane 2, crude extract 10 fold diluted; lane 3, cation exchange fraction with -lactamase activity; lane 4, purified SFC-1. The gel was stained with Coomassie Brilliant Blue.

59

____________________________________________________________________________________________________________________________________________________

Chapter 3

SDS-PAGE analysis showed that the purified SFC-1 migrates as a single band of approximately 30.5 kDa (Figure 3.2). However, isoelectric focusing revealed two forms of the purified SFC-1, with pIs of 7.6 and 8.2 (Figure 3.3).

Figure 3.3 IEF patterns of crude extracts and purified SFC-1. Lanes 1 and 5, crude extracts from reference strains producing TEM-2 (pI 5.6) and SHV-5 (pI 8.2), respectively; lane 2, purified SFC-1; lane 3, crude extract from S. fonticola UTAD54; lane 4, crude extract from S. fonticola 7882T; lane 6, crude extract from E. coli BL21 (DE3).

Mass spectrometry confirmed the presence of two molecular forms of the SFC1 enzyme, with 30773 and 31083 Da (Figure 3.4). The value of 30773 Da is consistent with the predicted molecular mass of the mature protein (HENRIQUES et al., 2004) and this form seems to be relatively more abundant in the purified product. Truncated forms of -lactamases have been encountered in other bacteria, but those forms share similar hydrolytic properties and inhibitor activities (WALTHER-RASMUSSEN et al., 1999).

60

____________________________________________________________________________________________________________________________________________________

Biochemical characterisation of recombinant SFC-1

Figure 3.4 Q-TOF mass spectrogram of purified SFC-1, showing two forms of the carbapenem-hydrolysing -lactamase.

The N-terminal sequence of the SFC-1 -lactamase produced by E. coli was found to be ASQPPQV, showing that a 26-amino acid leader sequence is removed from the primary translation product during processing to generate the mature SFC1 (HENRIQUES et al., 2004). The mass difference of 310 Da between both forms of the purified protein may indicate the presence of an uncharacterised posttranslational modification.

3.3.3 Kinetic properties of SFC-1

SFC-1 recognizes a variety of -lactams (penicillin, cephalosporin,

monobactam and carbapenem groups) as substrates, as summarized in Table 3.2. The activity against penicillins (ampicillin and piperacillin), narrow spectrumcephalosporins (cephalothin) and aztreonam is very high, while the hydrolytic activities against extended-spectrum cephalosporins (cefotaxime, ceftazidime and

61

____________________________________________________________________________________________________________________________________________________

Chapter 3

cefoxitin) are much lower, a feature shared by other class A carbapenem hydrolyzing -lactamases (MARIOTTE-BOYER et al., 1996; RASMUSSEN et al., 1996; YANG et al., 1990; YIGIT et al., 2001). The highest turnover rates were obtained for cephalothin (k cat , 280 s-1) followed by aztreonam (162 s-1) and ampicillin (155 s-1). Although SFC-1 showed a strong hydrolytic activity against aztreonam revealed by the value of k cat , the enzyme has a relatively low affinity towards this substrate (K m of 484 M) and therefore a low catalytic efficiency was observed when compared to those obtained using penicillins, cephalothin and imipenem as substrates (Table 3.2). The highest catalytic efficiency was observed with cephalothin and penicillins, while extended-spectrum cephalosporins appeared to be poor substrates. SFC-1 had the highest apparent affinity for meropenem and piperacillin (K m , 26 M and 38 M, respectively). Among carbapenems, SFC-1 hydrolysed imipenem with a rate 8 times higher than that of meropenem (k cat , 54 s-1 and 6.5 s-1, respectively). Analysis of the kinetic parameters for SFC-1 shows that this enzyme has a broad substrate profile, similar to that of other carbapenamases of group 2f (MARIOTTE-BOYER et al., 1996; RASMUSSEN et al., 1996; WOODFORD et al., 2004; YANG et al., 1990). However, SFC-1 exhibits catalytic efficiencies and turnover rates for ceftazidime and cefoxitin that are somewhat higher than those reported for IMI and KPC-1 (Table 3.2), the closest enzymes at the amino acid sequence level. The turnover rate for ceftazidime (k cat , 2 s-1) was approximately 300 and 20 times higher than those reported for IMI-1 and KPC-1 (0.0068 s-1 and 0.1 s-1, respectively), resulting in much higher catalytic efficiencies (1730 and 40 times higher, respectively). SFC-1 hydrolysed cefoxitin more efficiently than IMI-1 and KPC-1 (8 and 27 times, respectively). In the SFC-1 (and KPC) sequence(s) the serine residue at position 237 (as found in to Sme-1, NMC-A and IMI-1) is substituted by a threonine. This residue is known to be directly involved in imipenem hydrolysis and was also associated with higher hydrolytic efficiency against cephalosporins (SOUGAKOFF et al., 1999). Yigit and co-workers reported that KPC-1 hydrolysed cefotaxime better than Sme-1, suggesting that Thr237 extends the activity of the enzyme to a broader array of cephalosporins (YIGIT et al., 2001). Also, a site-directed mutagenesis study demonstrated that when random mutations of Sme-1 were selected for cefotaxime resistance only threonine was observed at position 237 (MAJIDUDDIN and

62

____________________________________________________________________________________________________________________________________________________

Biochemical characterisation of recombinant SFC-1

PALZKILL, 2005). A recent study of KPC-2 showed that T237 plays a role in the hydrolysis of carbapenems and selected cephalosporins (PAPP-WALLACE et al., 2010b). In this report, of 19 aminoacid variants at position 237, only the T237S mutation maintains carbapenem resistance in KPC-2. Therefore, in agreement with previous reports, it is possible that threonine at position 237 contributes to the oxyimino-cephalosporinase activity observed in SFC-1. However, site-directed mutagenesis is required to confirm this hypothesis. In addition, a valine found at position 240 may be involved in the increased hydrolytic activity against extended-spectrum cephalosporins displayed by SFC-1. KPC-1 also exhibits a valine at position 240 (YIGIT et al., 2001) that is substituted by an alanine in the other carbapenem-hydrolysing -lactamases. In the ESBLs, lysine or serine have usually been described at this position, suggesting that they are involved in the extension of the substrate profile (HULETSKY et al., 1993; ORENCIA et al., 2001). Interestingly, TEM-149 a -lactamase with ESBL activity which displays, among other substitutions, a valine at position 240 has been recently characterised (PERILLI et al., 2008). TEM-149 hydrolyses cefazolin, cefotaxime, ceftazidime, cefepime, aztreonam, and penicillins. Ceftazidime proved to be a better substrate than cefotaxime that behaved as an overall poor substrate. The authors suggested that the presence of a nonpolar residue, such as valine, at position 240 can facilitate the accommodation of the bulky oximino substituent of ceftazidime (PERILLI et al., 2008). However, to our knowledge, the effect of a valine at this position has never been demonstrated and site-directed mutagenesis would be necessary to determine its precise effect in the specificity of -lactamases. The activity of SFC-1 was inhibited by the class A -lactamase inhibitors clavulanic acid (IC 50 , 73 M), sulbactam (IC 50 , 23 M) and tazobactam (IC 50 , 7 M). In contrast to previously published data for IMI-1 and KPC-1, which are well inhibited by tazobactam (IC 50 , 0.03 M and 0.374 M, respectively; (RASMUSSEN et al., 1996; YIGIT et al., 2001)), SFC-1 was not efficiently inhibited by any of the compounds tested, with IC 50 > 1 M. The weak inhibition displayed by SFC-1 could be hypothetically linked to the Asn276Asp substitution. This is one of the point mutations in TEM enzymes that lead to the inhibitor-resistant phenotype, occurring either alone, as in TEM-84 (LEFLON-GUIBOUT et al., 2000), or in combination with other substitutions (usually at Met69) as in TEM-35 (IRT-4) and TEM-36 (IRT-7) (HENQUELL et al., 1995; ZHOU et al., 1994) (www.lahey.org/studies). Characterisation of an Asn276Asp TEM mutant showed that an asparte at position

63

____________________________________________________________________________________________________________________________________________________

Chapter 3

276 plays a significant role in the resistance to clavulanic acid inhibition (SAVES et al., 1995). According to Saves and co-workers this resistance would be explained by electrostatic interaction of the aspartate with arginine 244, together with the possible displacement of the water molecule involved in the inactivation process. However, a comparison of the amino acid sequence of SFC-1 with those of other class A carbapenemases revealed that these enzymes also have an aspartate at position 276. A recent study by Papp-Wallace et al., (2010a) have shown that, in addition to its role in the hydrolysis of carbapenems and cephalosporins, T237 in the KPC-2 carbapenemase is implicated in the resistance to -lactamase inhibitors. As proved for the class A carbapenemase KPC-2, the weak activity of the inhibitors tested against SFC-1 is most likely associated with threonine found at position 237. As expected, no inhibition was observed when the enzyme was assayed with 10 mM EDTA.

64

Table 3.2 Kinetic parameters of purified SFC-1 and comparison to other class A carbapenem-hydrolysing -lactamases. Substrate or inhibitor Substrates Ampicillin Piperacillin Cephalothin Cefotaxime Ceftazidime Cefoxitin Aztreonam Imipenem Meropenem
a

k cat (s-1) SFC-1 IMI-1 KPC-1

b

K m (M) SFC-1 IMI-1 KPC-1

k cat /K m (mM-1 s-1) SFC-1 IMI-1 KPC-1

155 2 44.7 1 280 2 8.3 0.5 2.1 0.1 4.2 0.2 162 7 54 1 6.5 0.1

190 6.1 120 3.4 0.0068 0.3 51 89 10

110 24 75 14 0.1 0.26 20 12 3

176 17 38 4 129 14 89 16 52 10 77 14.46 484 78 82 5 26 2

780 13 130 190 270 45 93 170 26

130 18 53 160 94 120 310 81 12

881 1190 2171 93.3 40.4 54.5 334.7 659 250

240 470 920 18 0.024 6.7 550 520 380

850 1333 1400 90 1 2 70 150 250

Kinetic values used for IMI-1 and KPC-1 were reported by Rasmussen et al., (1996) and Yigit et al., (2001), respectively. k cat s and K m s for SFC-1 are

means standard deviations.

b

KPC-1 is now KPC-2; KPC-1 designation is not used.

65

Chapter 3
____________________________________________________________________________________________________________________________________________________

3.4

Concluding remarks
The over-expression of bla SFC-1 allowed us to obtain a large quantity of SFC-1

enzyme, enabling effective protein purification. Kinetic studies showed that purified SFC-1 exhibits a remarkably broad substrate range including -lactams of all classes, and exhibits an increased efficiency against ceftazidime when compared to other class A (group 2f) carbapenemases. Moreover, SFC-1 is less inhibited by class A -lactamase inhibitors than other characterised group 2f carbapenemases. These results confirm that SFC-1 is a member of -lactamase group 2f, according to the Bush -lactamase classification (BUSH et al., 1995), with some unusual properties. Tertiary structures for KPC-2, Sme-1 and NMC-A are already available (KE et al., 2007; SOUGAKOFF et al., 2002; SWARN et al., 1998). It would be interesting to generate a crystal structure of the carbapenem-hydrolyzing -lactamase SFC-1 and investigate biochemical/structural relationships of SFC-1 in comparison with these enzymes.

66

4. Crystallographic structure of SFC-1:

insights into carbapenemase activity in class A -lactamases

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

4.1

Introduction
The evolution of narrow spectrum -lactamases (e.g. TEM-1, SHV-1) into so-

called extended-spectrum -lactamases (ESBLs) with the ability to hydrolyse oxyimino cephalosporins (e.g. cefotaxime and ceftazidime) in addition to penicillins and previous generations of cephalosporins (PATERSON and BONOMO, 2005; PEREZ et al., 2007), has resulted in an increased use of carbapenems. Carbapenems were formerly reserved for treatment of severe infections by Gram-negative pathogens (BAUGHMAN, 2009), but are now increasingly viewed as front-line therapy for treatment of nosocomial infections by both Enterobacteriaceae and non-fermenting pathogens (MASTERTON, 2009). This growth in carbapenem use has led to an increase in the incidence of carbapenem-hydrolysing -lactamases of classes A, B and D (QUEENAN and BUSH, 2007; WALTHER-RASMUSSEN and HOIBY, 2007). In the case of the class A serine -lactamases, several such enzymes (e.g. IMI, NMC, KPC and SFC-1) have been identified from environmental and pathogenic organisms. In particular, members of the KPC group are now endemic in Enterobacteriaceae in a number of locations (NORDMANN et al., 2009) where their production results in organisms with reduced or abolished susceptibility to carbapenems and for which there are few other effective treatment options (BUSH, 2010). The situation is further complicated by the ability of many class A carbapenemases to resist the effect of mechanism based inhibitors such as clavulanic acid that are successful against the majority of class A -lactamases (PAPP-WALLACE et al., 2010a). Carbapenems are able to inhibit the majority of class A -lactamases through formation of a stable acylenzyme species that deacylates slowly. Carbapenems readily acylate enzymes such as TEM-1 and SHV-1 via nucleophilic attack of the active site serine, Ser70, upon the scissile -lactam amide bond. However, kinetic (EASTON and KNOWLES, 1982), crystallographic (MAVEYRAUD et al., 1998; NUKAGA et al., 2008) and spectroscopic (KALP and CAREY, 2008) experiments demonstrate that the acylenzyme so formed can partition between two states, a deacylation-competent form in which the acylenzyme carbonyl oxygen occupies the oxyanion hole, and a deacylation-incompetent state in which this oxygen is displaced from the oxyanion hole. Thus two distinct acylenzyme species are observed in crystal

69

Chapter 4
____________________________________________________________________________________________________________________________________________________

structures of complexes of TEM-1 with imipenem (MAVEYRAUD et al., 1998) or SHV1 with meropenem (NUKAGA et al., 2008). In order for class A -lactamases to act as effective carbapenemases it is therefore likely that their interactions with carbapenems will differ substantially from those made by their carbapenem-inhibited counterparts. However, despite the determination of numerous crystal structures (KE et al., 2007; SOUGAKOFF et al., 2002; SWARN et al., 1998) those properties that are responsible for carbapenemase activity in class A enzymes remain relatively obscure. Whilst it is clear that certain features (substitution of Arg244; possession of a disulfide bond between Cys69 and Cys238) are important, the close structural resemblance between the active sites of carbapenem-hydrolysing and carbapenem-inhibited enzymes has led to speculation that multiple subtle alterations are responsible for activity against carbapenem substrates. Moreover, to date there remains little information regarding the interactions between class A carbapenemases and their carbapenem substrates. Therefore, in order to pursue this lack of structural information on carbapenem binding and hydrolysis in class A carbapenemases we investigated SFC1, a close relative of KPC-type enzymes. Here we present crystal structures of wildtype SFC-1 and of complexes of site-directed mutants with the carbapenem meropenem in unhydrolysed and acylenzyme intermediate forms.

4.2

Materials and methods

4.2.1 Mutagenesis of SFC-1

The SFC-1 -lactamase gene from S. fonticola UTAD54 (HENRIQUES et al., 2004) was cloned into pET-26(b) and transformed into E. coli BL21(DE3) as described in Chapter 3. The recombinant plasmid harbouring SFC-1 (pMF13) was used as the DNA template for site-directed mutagenesis. The mutagenic oligonucleotide primers used in the PCR reactions are shown in Table 4.1. SFC-1 mutants were generated using QuikchangeTM Site-Directed

Mutagenesis Kit (Agilent) according to the manufacturers instructions, except for the PCR cycling parameters.

70

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

Briefly, the double stranded plasmid template pMF13 was initially denatured at 95C for 1 min and oligonucleotide primers containing the desired mutations were extended during 25 cycles of denaturation at 95C for 1 min, annealing at 55C for 2 min, and extension at 68C for 8 min by PfuTurbo DNA polymerase. Amplification products were digested by Dpn I (1h at 37C) to remove the parent strands and transformed into E. coli XL1-Blue. The transformation reaction was plated on LB agar plates supplemented with 50 g/ml kanamycin and incubated at 37C overnight. Plasmid DNA containing the putative mutation was subsequently isolated from transformed XL1-Blue cells using the QIAprep Spin Miniprep Kit (Qiagen) and sequenced in order to ensure the introduction of the desired mutation. DNA sequencing was performed by The Sequencing Service (School of Life Sciences, University of Dundee, Scotland).

Table 4.1 Primers used to generate SFC-1 mutants.

Primer S70A_F S70A_R E166A_F E166A_R

Sequence 5 --- 3 CGAGCGTTTTCCTCTCTGTGCTTCATTTAAAGGCTTCCTTG CAAGGAAGCCTTTAAATGAAGCACAGAGAGGAAAACGCTCGT CGTCTGGACCGATGGGCACTGGAGTTGAATTCC GGA ATTCAACTCCAGTGCCCATCGGTCCAGACG

4.2.2 Protein expression and purification

In order to obtain a yield suitable for crystallisation trials, wild-type SFC-1 was purified from cells growing in 4 L LB supplemented with kanamycin and purified as described in Chapter 3 (section 3.3.6). For protein expression mutant proteins were transformed into E. coli strain BL21 (DE3) and selected on LB agar plates containing 50 g/ml kanamycin. Overexpression and purification of the mutant proteins were performed as described for the wild-type SFC-1 (Chapter 3). After purification proteins were stored at 4C until use. Protein concentrations were determined by UV absorbance at 280 nm with molar extinction coefficients 280 = 31840 M-1 cm-1, estimated from the amino-acid

71

Chapter 4
____________________________________________________________________________________________________________________________________________________

composition by the method of Gill and von Hippel (GILL and VON HIPPEL, 1989) using the Protean application of Lasergene (DNAStar Inc.)

4.2.3 -Lactamase crystallisation

Wild-type or mutant SFC-1 in 10 mM phosphate buffer (pH 7.0) were concentrated by centrifugal filtration in Amicon Ultra-15 spin concentrators with a molecular weight cut off (MWCO) of 10 kD. For wild-type SFC-1, an initial screen of crystallisation parameters was performed by the sitting drop vapour diffusion method using protein concentrated to 12.3 and 6.15 mg/mL against the sparsematrix screens Structure screen I & II HT-96 (JANCARIK and KIM, 1991), JCSG-plus HT-96 and PACT premier (NEWMAN et al., 2005) (Molecular Dimensions) using a Phoenix crystallisation robot (Art Robbins Instruments) by mixing 0.5 L protein solution with 0.5 l screen solution. MRC two well crystallisation plates in the 96well format (Hampton Research) were used. Plates were sealed with ClearSeal FilmTM (Hampton Research) and incubated at 20 C. Within a week, plate-like crystals were observed in conditions F6 from Structure screen (no salt, 0.1 M Hepes pH 7.5, 4.3 M sodium chloride) and C10 from PACT premier (0.2 M magnesium chloride, 0.1 M Hepes pH 7.0, 20% w/v PEG 6000). Needle-like crystals were also obtained in condition F10 from the Structure screen (0.1 M MES pH 6.5, 1.6 M magnesium sulphate. These conditions were used to optimise crystal quality in 24-well XRL crystallisation plates (Molecular Dimensions) by hanging drop vapour diffusion using a wide range of approaches: varying salt and precipitant concentrations, pH, and the ratio of protein: crystallisation solution. Crystals obtained from these trials were taken to the Diamond synchrotron but no diffraction was observed probably due to their small size. In subsequent experiments protein concentration was increased to 30 mg/mL and the Additive screen (Molecular Dimensions) was tried (additives were mixed either in the drops of protein solution or in the reservoir solution, depending on the additive, to a final concentration of 10%) but no single crystals were obtained. A new inspection of the initial screens lead us to test condition E7 from the PACT screen, consisting of 0.2 M sodium acetate and 20% w/v PEG 3350 with 15 and 30 mg/mL of protein. Crystals were reproducible and diffraction quality single crystals of wildtype SFC-1 were grown by mixing 1.5 L of protein (30 mg/mL) with 1.5 L of

72

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

reservoir solution and equilibrating the samples against 500 L of reservoir solution. The reservoir solution contained 18-22% w/v PEG 3350 and 0.2 M sodium acetate.

Crystallisation of SFC-1 mutants was first attempted using the same condition as previously employed for the wild-type protein (17-22% w/v PEG 3350 and 0.2 M sodium acetate), using proteins concentrated to 15 and 30 mg/mL. The drops contained 1L of protein and 1L of reservoir solution and were equilibrated against 500 L of reservoir solution. However this condition did not yield crystals. The proteins were then screened with JCSG-plus HT-96 and PACT premier (Molecular Dimensions) using the Phoenix robot with drops containing 0.5 L of protein (10 and 20 mg/mL) and 0.5 L of reagent. After one week the most promising crystallisation conditions for the mutant proteins were D5 from JCSG-plus HT-96 (0.1 M Hepes pH 7.5, 70% v/v MPD) for the E166A mutant and F5 from PACT premier (0.2 M sodium nitrate, 0.1 M Bis Tris propane pH 6.5, 20% w/v PEG 3350) for the S70A mutant. Reproducibility and optimisation (changing precipitant concentration, pH and use of the Additive screen) of the crystals using the above conditions failed. In most cases clear drops were obtained. Therefore, in order to obtain single crystals of diffraction quality, crystals of native SFC-1 were used for streak seeding. In this trial mutant proteins were used at a concentration of 30 mg/mL. Drops were prepared by mixing 1.5 L of protein with 1.5 L of well solution (0.2 M sodium acetate, 18-22% w/v PEG 3350). A good crystal of native protein was touched with a whisker that transferred seeds to the prepared drops containing mutant proteins. Crystals emerged after 1 day. The crystals used for data collection were looped out from the cover slides using either nylon or litholoops (Molecular Dimensions) mounted on cryo-pins, dipped into the cryoprotectant solution for a few seconds and stored in liquid nitrogen until the diffraction experiments. Cryoprotectant solutions for crystals of both wild-type SFC-1 and mutant proteins consisted of mother liquor solution plus 20% ethylene glycol. Acylenzyme-intermediates and complexes with unhydrolysed meropenem were prepared by soaking crystals of the mutant proteins, E166A and S70A respectively, in cryoprotectant solution containing 50 mM meropenem for 30 to 50 minutes before freezing in liquid nitrogen.

73

Chapter 4
____________________________________________________________________________________________________________________________________________________

4.2.3 X-ray diffraction data collection and crystallographic refinement

Diffraction data were collected at 100 K on beamlines 10.1 of the SRS (Daresbury, UK) for wild-type enzyme, and IO2/IO3 of the Diamond Light Source (Didcot, UK) for mutant proteins. The crystals diffracted to maximum resolutions of 1.35 (WT), 1.08 (S70A substrate complex) and 1.3 (E166A acylenzyme complex). Data were processed and scaled using the programs HKL2000 (OTWINOWSKI and MINOR, 1997) or MOSFLM (LESLIE, 2006) and SCALA (EVANS, 2006) as shown in Table 4.2. The crystals of wild-type SFC-1 belong to the monoclinic space group P2 1 with two SFC-1 molecules in the asymmetric unit, while the space group of crystals from mutant proteins was P2 1 2 1 2 1 with one molecule in the asymmetric unit. Structures were determined by molecular replacement with PHASER (MCCOY et al., 2007) using chain A of the KPC-2 -lactamase (PDB ID 2OV5) (KE et al., 2007) (wild-type enzyme) or the wild-type structure (mutant enzymes) as the initial search model. Model building and refinement were performed with the programs COOT and REFMAC, respectively (EMSLEY et al., 2010), (MURSHUDOV et al., 1997). Ligand restraints were generated using the CCP4i monomer sketcher (POTTERTON et al., 2003) and the PRODRG server (SCHUTTELKOPF and VAN AALTEN, 2004). The models were further refined using conjugate gradient minimization in SHELXL (SHELDRICK, 2008). The program mtz2hkl (GRUNE, 2008) was used in the transition from REFMAC refinement to SHELXL. The refinement with SHELXL started with the lowest resolution data (to 2.5 resolution) and remaining data was added in steps to the highest resolution (Table 4.2). Anisotropic B-factors were introduced with the highest resolution data and produced a 13% drop in the R free values, depending on the datasets resolution. In all the structures it was possible to model alternative side chains in numerous residues. The progress of crystallographic refinement was monitored using the MOLPROBITY server (CHEN et al., 2010) and the quality of the final structures was verified with PROCHECK (LASKOWSKI et al., 1993).

74

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

4.3

Results and discussion

4.3.1 Structure of the SFC-1 carbapenemase
Crystals of the wild-type SFC-1 were obtained by the hanging drop vapour

diffusion technique using 30 mg/ml protein and 18-22% w/v polyethylene glycol 3350, 0.2M sodium acetate. Crystals of SFC-1 mutants were obtained by the same technique using streak seeding with crystals of the wild-type protein and the same protein concentration (Figure 4.1).

Figure 4.1 A, SFC-1 crystals growing in 0.2 M sodium acetate with different concentrations of PEG 3350 (w/v); B and C, SFC-1 S70A and E166A mutant crystals after seeding, respectively.

The crystal structure of SFC-1 was determined to 1.35 resolution by molecular replacement using the coordinates of the structure of the -lactamase KPC-2 from K. oxytoca as a search model (KE et al., 2007). The SFC-1 crystal reveals two molecules per asymmetric unit, which were refined in space group P2 1 to a final crystallographic R-factor and R free values of 11.6 and 16.0 %, respectively. The crystallographic and model statistics for the native and SFC-1 mutantcomplexes structures are reported in Table 4.2.

75

Chapter 4
____________________________________________________________________________________________________________________________________________________

Table 4.2 Data collection and refinement statistics for native and SFC-1 mutant-complexes structures. Dataset Processing Beamline Space Group Native HKL2000 SRS 10.1 P 21 a = 42.33 Cell Dimensions () b = 85.46 c= 70.29 = 103.26o Wavelength () Resolution () Total reflections Unique reflections Completeness (%) Redundancy I / (sig. I) R merge (%) Refinement (SHELXL) Resolution range () No. of reflections used R-factor/R free (%) R total (%) Ramachandran plot (%) favored/allowed disallowed RMSD values bond lengths () bond distances () Mean B-factor ( ) protein substrate ethylene carbonate water molecules all atoms
a 2

E166A MOSFLM/SCALA DLS I03 P 21 21 21 a = 59.17 b = 61.95 c= 79.11 0.9763 37.64 1.49 (1.57 1.49)a 678 589 48 468 (7 000)a 100 (100)a 14 (13.4)a 28.9 (14.0)a 9.0 (17.4)
a a

S70A MOSFLM/SCALA DLS I02 P 21 21 21 a = 59.06 b = 61.91 c= 79.01 0.9702 22.52 (1.08) (1.14 - 1.08)a 840 706 123 610 (17 824)a 99.5 (99.5)a 6.8 (6.6)a 16.9 (5.1)a 7.0 (28.5)a

1.117 50 1.35 (1.40 1.35)a 355 336 102 989 (8 012)a 96.6 (75.5)a 3.5 (2.0)a 18.6 (1.69)a 6.1 (50.7)

-1.35 97807 11.6/ 16.0

-1.30 64944 11.1/ 14.8

-1.08 116903 11.0/ 13.2

98.0/ 2.0 0 0.01 0.04 14.744 --9.864 27.435 15.733

98.9/ 1.1 0 0.014 0.031 12.150 15.348 --28.743 13.673

98.5/ 1.5 0 0.015 0.031 11.205 11.865 --30.517 13.193

The values in parentheses are for the highest-resolution shell used in refinement. One crystal was

used for the data collection of each dataset.

76

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

The final model contains two independent molecules: molecule A comprising residues Ser23Ala294 (numbering according to the standard Ambler scheme; AMBLER et al., 1991) of the mature polypeptide and molecule B comprising residues Ser23Arg296 with 13 and 10 residues not observed in molecules A and B, respectively, due to disorder. The Ramanchandran plot shows that 97.8% of the residues have and angles in the most favoured regions with no residues in the disallowed regions. When compared, the two monomers are very similar with an r.m.s. deviation in atomic positions of 0.5 for 270 aligned C atoms, using the secondary structure matching (SSM) algorithm (KRISSINEL and HENRICK, 2004) as implemented in COOT.

The SFC-1 active site is located in the cavity generated at the interface of the two domains and contains conserved residues that are known to play a role in substrate binding and/or catalysis in class A -lactamases (Figure 4.2). Such residues include the catalytic Ser70, Lys73, Ser130, Asn132, Glu166, Asn170, Lys234, Thr235 and Thr237, as well as the Cys69-Cys238 disulphide bridge (Figure 4.3). This disulphide bridge is a feature unique to class A carbapenemases and is thought to play a role in the stabilization of the protein fold (RAQUET et al., 1997; WALTHER-RASMUSSEN and HOIBY, 2007). The oxyanion hole is formed by the backbone nitrogen atoms of Ser70 and Thr237.

77

Chapter 4
____________________________________________________________________________________________________________________________________________________

Figure 4.2 Overall fold of class A carbapenemases. A) Ribbon secondary structure representation of the SFC-1 structure; -helices are shown in magenta and -strands in limon. B) Superposition of SFC-1 structure (magenta) with serine carbapenemases NMC-A (gray; PDB accession 1BUE) and KPC-2 (blue, PDB accession 2OV5). The labelled catalytic residues Ser70, Ser130 and Glu166 (shown as gray model sticks) and the -loop localize the active site. This and all subsequent figures were generated using the program Pymol (DELANO, 2008).

Unexpectedly a cyclic adduct, modelled as ethylene carbonate (EC), was shown to be present in the SFC-1 active site (Figure 4.3), and is observed in the active sites of both SFC-1 molecules in the asymmetric unit. The electron density found close to the catalytic Ser70 during model building did not correspond to any compound used in protein purification or crystallisation but resembled a fivemembered ring. In the literature there is a precedent for a similar interaction. Indeed, a structure of the recombinant () -lactamase from an Aureobacterium species was determined in complex with a cyclic ethylene carbonate molecule covalently bound to the catalytic serine residue (LINE et al., 2004). Therefore an ethylene carbonate molecule was built into the positive electron density and refined, and a good fit to the electron density maps was achieved. Moreover, in the final model, the B-factors of the ligand (mean less than 10 2) were comparable to those displayed by neighbouring amino acid residues, indicative of a good assignment of the ligand modelled into the active site of native SFC-1.

78

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

Figure 4.3 Stereoview of the SFC-1 active site with labelled conserved residues shown as stick models. 2mFo DFc electron density maps (blue) surrounding catalytic water molecule (Wat1) and the cyclic ethylene carbonate (EC; carbon atoms coloured grey) are contoured at 1.5. Hydrogen bonding interactions (black dashed lines) of the active site water molecule (red sphere) and the carbonyl group of ethylene carbonate are displayed.

The ethylene carbonate forms a tetrahedral complex with the catalytic Ser70 as described for the () -lactamase (LINE et al., 2004). It is also involved in hydrogen bonding with two other active site residues, namely Ser130 and Thr237. Interestingly, the carbonyl group of ethylene carbonate sits in the oxyanion hole formed by the main chain nitrogen atoms of Ser70 and Thr237, in the position usually occupied by a water molecule (Wat2) in class A -lactamases (CHEN et al., 2005; STEC et al., 2005; SWARN et al., 1998). This water molecule is also missing in the structure of carbapenemase KPC-2 due to the positioning of Ser70 side chain, partially blocking the oxyanion hole (KE et al., 2007). The carbonyl group of ethylene carbonate is hydrogen bonded to the backbone carbonyl (2.74 ) and nitrogen (2.95 ) of Thr237 and to the deacylation/catalytic water (Wat1) (Figure 4.3). In contrast to the class A carbapenemase Sme-1 (SOUGAKOFF et al., 2002) the putative deacylating water molecule (Wat1) is observed in the structure of SFC-1 and establishes a hydrogen bonding network with residues Glu166, Asn170 and Ser70, as described in other class A -lactamases (STEC et al., 2005; SWARN et al., 1998), and with the carbonyl group of ethylene carbonate (Figure 4.3).

79

Chapter 4
____________________________________________________________________________________________________________________________________________________

The superposition of the SFC-1 structure on to other available structures of class A serine carbapenemases such as NMC-A (SWARN et al., 1998) and KPC-2 (KE et al., 2007) points to the existence of some elements of difference between the three carbapenemases as shown in Figure 4.2. These comprise loops near residues 88 and 98, and two secondary elements in NMC-A and KPC-2 near residues 87 and 180 which are absent in SFC-1. However, all of these regions are distant from the active site and are therefore unlikely to explain the unusual spectrum of activity of SFC-1. When compared to other class A -lactamases, the main differences in SFC-1 are seen at the entrance of the catalytic cavity. Pro104 in SFC-1 and KPC-2 is substituted with Tyr and Phe in Sme-1 and NMC-A, respectively, and Glu in TEM-1 (STEC et al., 2005), indicating that the residue at Ambler position 104 is not conserved among class A -lactamases. In the structure of SHV-1, Asp was found at this position and it was observed that the substrate binding cavity was wider when compared to TEM-1 -lactamase (KUZIN et al., 1999). As described for SHV-1, it can be proposed that the small nonpolar residue Pro104 that is present in KPC-2 and SFC-1 contributes to an enlarged entry to the active site in these enzymes, resulting in increased activity against ceftazidime and cefotaxime. A site saturation mutagenesis study at position 104 in the SHV-1 and SHV-2 -lactamases (BETHEL et al., 2006) showed that the SHV-1 Asp104Pro variant expressed in E. coli DH10B increased resistance to cefotaxime (MIC range, 0.06 to 0.125 g/ml) while ampicillin resistance was fourfold decreased. In the SHV-2 Asp104Pro variant, however, resistance to all -lactams tested (ampicillin, cephalothin, cefotaxime and ceftazidime) was twofold increased (BETHEL et al., 2006). Adjacent to Pro104 is residue His105 which in SFC-1 (chain A) adopts a completely different orientation when compared to other class A -lactamases. In chain A of the SFC-1 structure the side chain of His105 is rotated more than 90 in the direction of the entrance of the binding cavity but away from Ser130. In contrast, the side chains of residues at position 105 in Sme-1 and NMC-A (His), KPC-2 (Trp) and TEM-1 (STEC et al., 2005), SHV-1 (KUZIN et al., 1999) and CTX-M-16 (CHEN et al., 2005) (Tyr) are directed towards the active site pocket making hydrogen bonds to the main chain carbonyl of the residue at position 129 (Met or Tyr in the enzymes referred above). This interaction is absent in SFC-1 whose His105 side chain and the backbone carbonyl of Tyr129 are hydrogen bonded to water molecules. This probably results in a widened active site cavity in SFC-1, which is able to recognize and

80

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

accommodate the large oxyimino-cephalosporins, possibly explaining the higher hydrolytic activity of SFC-1 against the third generation cephalosporins cefotaxime and ceftazidime (FONSECA et al., 2007). Doucet et al., (2004) previously reported a site saturation mutagenesis study of Tyr105 in TEM-1 -lactamase; their results suggest that Tyr105 is important in substrate recognition and stabilization rather than hydrolysis. Moreover, this study shows that the conformation of the residue at Ambler position 105 prevents unfavourable steric interactions with the substrate in the active site pocket (DOUCET et al., 2004).

Figure 4.4 Superposition of the C trace of class A carbapenemases (SFC-1, NMC-A, SME1, KPC-2) and carbapenem-inhibited enzymes (SHV-1, CTX-M-16, TEM-1). Arrow shows active site with key SFC-1 residues (Ser70, Glu166, Ser130 and the Cys69-Cys238 disulphide bridge) represented as sticks.

Despite the drastic differences in the ability to hydrolyse carbapenems among carbapenemases and non-carbapenemase enzymes, the overall folds of class A lactamases are shown to be closely conserved, as depicted in Figure 4.4. The comparison between the crystallographic structures of class A carbapenemhydrolysing -lactamases such as SFC-1, KPC-2, NMC-A and SME-1, and those of TEM-1, SHV-1 and CTXM-16, does not provide an unambiguous basis for the enhanced catalytic activity of class A carbapenemases against carbapenem substrates. The same conclusion was found by Ke and collaborators when analysing the structure of KPC-2 (KE et al., 2007). Therefore, the basis for the unusual spectrum of activity of SFC-1 and related enzymes is somewhat to be expected in

81

Chapter 4
____________________________________________________________________________________________________________________________________________________

subtle active site rearrangements, together with altered enzyme dynamics, rather than in gross structural changes.

To date there is no structural data on the interaction between class A carbapenemases and carbapenems, although a number of class A -lactamase structures with bound inhibitors or acyl intermediates are available (DELMAS et al., 2008; MAVEYRAUD et al., 1998; NUKAGA et al., 2008). To investigate how carbapenems achieve hydrolysis by these -lactamases, mutational techniques were used to determine atomic resolution structures of SFC-1 active site bound with the carbapenem meropenem, in both the Michaelis complex and the covalent acyl intermediate. The results provided relevant structural data on the recognition and hydrolysis of carbapenems by SFC-1, that can be extended to other class A carbapenemases.

4.3.2 The SFC-1 S70A-meropenem complex structure

In this study two catalytic-deficient mutants of SFC-1 were engineered. Mutating conserved active site residues, specifically the acylating nucleophile Ser70 and Glu166 (responsible for the activation of the catalytic water molecule during deacylation), to alanine residues generates class A -lactamases with impaired ability to complete the acylation or deacylation steps of the reaction, respectively. This strategy, previously employed by several researchers to maximize the possibility of trapping class A -lactamase acylenzyme intermediates for crystallographic analysis (CHEN and HERZBERG, 2001; IBUKA et al., 1999; PADAYATTI et al., 2004; SHIMAMURA et al., 2002; TREMBLAY et al., 2010), enabled us to obtain the first structures of a class A carbapenemase bound to an intact carbapenem (meropenem) (mutant S70A) and of an acylenzyme intermediate (meropenem complex of the E166A mutant).

The crystal structure of the SFC-1 S70A mutant in complex with the carbapenem meropenem was determined to a resolution of 1.08 by molecular replacement using chain A of the previously solved wild-type SFC-1 structure as the starting model. The complex crystallized in space group P2 1 2 1 2 1 with one molecule per asymmetric unit and was refined to final R-factor and R free values of 10.9 and

82

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

13.1%, respectively (Table 4.2). The refined structure of the S70A mutant is essentially similar to that of the wild-type, with an r.m.s. deviation of 0.47 between the C atoms of the two structures. Regardless of the better-diffracting crystals, it was not possible to model the position of all 283 residues of the mature protein in the electron density map, with 13 residues not observed at the C-terminus of the current structure due to disorder. The final model also contains a meropenem molecule located in the active site, seven sodium ions, four ethylene glycol molecules, and 550 water molecules. Initial difference electron density maps contoured at 3 clearly revealed the presence of meropenem bound in the active site of the mutant enzyme. Meropenem was readily fitted into the 2Fo-Fc maps and electron density for the entire antibiotic is complete, indicating that no fragmentation of the molecule occurred during soaking procedures. Indeed, the drug refines with an occupancy of 1.0 and temperature factors varying from less than 8.0 2 (from the hydroxyl to sulphanyl moieties) to more than 20.0 2 for atoms in the R side chain beyond the sulphur, where the electron density is less intense and no interaction with protein residues is observed. For comparison, the CB atom of the side chain of the mutated residue Ala70 has a B factor of 6.13 2, confirming a good fit of the bound antibiotic in the model.

Figure 4.5 Binding of unhydrolysed meropenem in SFC-1 active site. A) Wild-type SFC-1; ethylene carbonate molecule is omitted for clarity. B) SFC-1 S70A mutant showing bound meropenem (carbon atoms in gray). Sigma-A weighted electron densities displayed are contoured at 1.0.

83

Chapter 4
____________________________________________________________________________________________________________________________________________________

In the substrate complex, the -lactam carbonyl oxygen of meropenem is hydrogen bonded by the backbone nitrogen and carbonyl group of Thr237 (Figure 4.5) at 2.84 and 3.08 respectively. The hydrogen bonds formed by the carbonyl oxygen help to polarise this bond and increase its susceptibility to hydrolytic attack.

The hydroxyl oxygen of the -lactam interacts, also through hydrogen bonds, with the ND2 atom of Asn132 (2.95 ) and the catalytic water molecule (Wat1, 2.69 ). Additionally, hydrogen bonding interactions are observed between the meropenem carboxylate and the side chain hydroxyl groups of Thr235 (2.84 ), Thr237 (2.70 ) and Ser130 (2.84 ). The carboxylate is also hydrogen bonded to the side chain of Lys234 (3.04 ) and a water molecule (2.89 ) as shown in Figure 4.5.

4.3.3 The SFC-1 E166A-meropenem acylenzyme structure

The

SFC-1

E166A

mutant

in

complex

with

hydrolysed

meropenem

(acylenzyme) was crystallized and its structure determined by molecular replacement as described for the S70A mutant. The acylenzyme complex crystallised in space group P2 1 2 1 2 1 with one molecule in the asymmetric unit, and clear electron density was observed for residues 32292 in the initial maps. A total of 269 ordered residues, one hydrolysed meropenem molecule, four ethylene glycol molecules, and 510 water molecules were refined to a resolution of 1.30 with a crystallographic Rfactor of 11.1% and an R free of 14.8% (Table 4.2). No electron density was found for 13 residues in the C-terminal of the protein that were assumed to be disordered in the crystal structure. Electron density for meropenem, introduced during the soaking process, was observed in the active site pocket of the protein, whereas electron density for ethylene glycol, the cryoprotectant used for crystal freezing, was found mostly on the surface of the protein. The overall structure of the SFC-1 E166A acylenzyme is very similar to that of native SFC-1. In fact, the two proteins can be superimposed with an r.m.s.d. of 0.48 for 268 structurally aligned C positions. Upon alignment of SFC-1 E166A acylenzyme and S70A mutant with bound meropenem, an r.m.s.d. of 0.14 was determined for all C atoms, demonstrating the strong similarity throughout the entire proteins.

84

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

In the structure of the E166A acylenzyme, an uninterrupted electron density connects the active site catalytic residue Ser70 with the -lactam ring-opened form of meropenem, showing that the enzyme and the antibiotic have been covalently linked. This corresponds to the covalent acylenzyme intermediate formed upon attack of the conserved serine nucleophile (Ser70 in class A -lactamases) on the carbonyl carbon of the -lactam ring. The electron density of the covalent acylenzyme intermediate is displayed in Figure 4.6B.

Figure 4.6 A) Binding of unhydrolysed meropenem (gray carbons) in the active site of SFC1 S70A, shown for comparison. B) Binding and interactions of hydrolysed meropenem (yellow carbons) and catalytic water molecule (Wat1) in the active site of SFC-1 E166A. The sigma-A weighted electron density maps shown are contoured at 1.0.

An overlay of the S70A mutant-meropenem complex with the crystal structure of the E166A acylenzyme reveals that the -lactam ring carbonyl oxygen is placed deeper into the oxyanion hole in the structure of the E166A acylenzyme. In the meropenem complex the -lactam ring carbonyl oxygen was not hydrogen bonded to the Ala70 backbone amide (Figure 4.5B) and the distance to the Thr237 backbone amide nitrogen was 2.84 . In the acylenzyme, the -lactam ring carbonyl oxygen establishes hydrogen bonding contacts with the backbone amide nitrogen atoms of both Ser70 and Thr237 (2.82 ) (Figure 4.6B). Originally at a distance of 3.15 from the side chain carbon atom of Ala70 (in the S70A mutant-meropenem complex), the -lactam ring carbonyl carbon shifts position coming closer to Ser70 (2.7 to side chain carbon atom) to form a covalent bond (1.35 ) with the hydroxyl group (in the structure of the E166A acylenzyme), generating the ester bond and opening the lactam ring. Along with these changes, also the meropenem carboxylate is closer to
85

Chapter 4
____________________________________________________________________________________________________________________________________________________

the side chain hydroxyl of Thr237 and Thr235 (shifts from 2.76 to 2.66 and 3.02 to 2.54 , respectively), whereas the existing hydrogen bond with Ser130 hydroxyl group is lost, although its position remains unchanged. In the crystal structure of the E166A acylenzyme the 6-hydroxyethyl substituent of meropenem is rotated nearly 90 about the C6C61 axis keeping its hydrogen bond with Asn132 while bonding with the deacylating water molecule (Wat1) disappeared (Figure 4.6). The deacylating water molecule forms two hydrogen bonds, one with backbone oxygen of Ala166 (2.8 ) and another with the side chain oxygen atom of Asn132 (3.0 ). However, in crystal structures of class A carbapenem-inhibited enzymes with carbapenems covalently bound, a hydrogen bond is observed between the hydrolytic water molecule and the carbapenems hydroxyethyl substituent, an interaction considered to weaken the nucleophilicity of this important water molecule and thus contribute to the stability of carbapenems in the acylenzyme form in TEM-1 and SHV-1 -lactamases (MAVEYRAUD et al., 1998; NUKAGA et al., 2008). Superimposing the SFC-1 E166A-meropenem complex on the crystal

structure of class A carbapenem-inhibited class A -lactamases complexed with carbapenems such as TEM-1 (PDB 1BT5) and SHV-1 (PDB 2ZD8) (Figure 4.7), reveals some modifications in active site residues and binding of the carbapenem. SFC-1 binds meropenem in a single, well-defined orientation (Figure 4.5B, Figure 4.6). Two isomers of the carbapenems, 1 and 2-pyrroline that differ in the position of the double bond about the carbapenem nucleus have been observed in the active site of the -lactamase SHV-1 (KALP and CAREY, 2008). According to this work, the 1 acyl-enzyme is a long-lived, hydrolytically inert species, while the 2 acyl-enzyme is the reactive species that undergoes deacylation. Although it is not possible to visualize the tautomer in the crystal structure, the collinear positioning of the thioether sulfur atom in line with the N1, C2, C3, and C4 bonds is indicative of the presence of the reactive 2-pyrroline ring in SFC-1. This contrasts with the two orientations that have been observed for carbapenems bound to SHV-1 (NUKAGA et al., 2008) (Figure 4.7A). Moreover, the structure of SHV-1 acylated with meropenem showed that the carbonyl oxygen of the acyl group was flipped outside the oxyanion hole in one of the conformers, whereas in the SFC-1 structure the carbonyl oxygen is hydrogen bonded to the amide nitrogens of Ser70 and Thr237 that form the oxyanion hole. Also in the TEM-1: imipenem complex the carbonyl group was found outside the oxyanion hole (MAVEYRAUD et al., 1998).

86

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

Nukaga and collaborators reported that Ser130 is reoriented in the complex, when compared to the apo structure of SHV-1, with the hydroxyl group directed towards the amino group of Lys234 rather than to Lys73 (apo structure). A similar conformation is seen in the TEM-1: imipenem structure (Figure 4.7). In the structures of SFC-1, both the apo and meropenem complexes, Ser130 is in the same orientation and resembles that observed in the apo structure of SHV-1 (PDB 1SHV) (KUZIN et al., 1999). In SFC-1 the hydroxyl group of Ser130 interacts, via hydrogen bonds, with the amino groups of both Lys73 (2.79 ) and Lys234 (2.92 ) and, in the structure of the acylenzyme, the amide nitrogen (N4) of meropenem (2.88 ). This nitrogen is also hydrogen bonded to the hydroxyl of catalytic Ser70 (2.84 ). By contrast, no interactions are observed between the carbapenem amide nitrogen and protein residues in the TEM-1 and SHV-1 structures. This suggests that Ser130 is involved not only in the acylation step by proton transfer to the amide nitrogen (N4), but also in the deacylation step by helping to position the carbapenem in an orientation favourable to catalysis.

Figure 4.7 A) Superposition of SFC-1 E166A: meropenem and SHV-1: meropenem (blue: silver; PDB 2ZD8). B) Superposition of SFC-1 E166A: meropenem and TEM-1: imipenem (pink: brown; PDB 1BT5). In both schemes, active site residues of SFC-1 E166A and meropenem are coloured green and yellow, respectively and water molecules represented as red spheres; active site water molecules and their interactions are shown for SHV-1 (A) and TEM-1 (B). Black circles locate the side chains of active site Ser130.

Interestingly, the structures of carbapenem-inhibited enzymes complexed with carbapenems can be distinguished from that of the SFC-1 acylenzyme by the position and interaction of the carbapenems 6-hydroxyethyl substituent. In the

87

Chapter 4
____________________________________________________________________________________________________________________________________________________

acylenzymes of TEM-1 and SHV-1 the hydroxyl group of the substituent is directed towards the active site groove, interacting with the hydroxyl group of Ser70, the side chain oxygen of Asn132 and the deacylating water molecule. In SFC-1 the hydroxyl group of the 6 substituent is oriented in the opposite way, directed away from the active site and hydrogen bonded to the amide group of Asn132 and a water molecule. In class A carbapenemases the active site residue Asn132 is shifted away from the active site, enlarging the substrate binding cavity (SWARN et al., 1998). This rearrangement in the active site, along with increases in the hydrogen bonding distance between the meropenem hydroxyl group and Asn132 side chain (shifts from around 2.70 in TEM-1 and SHV-1 complexes to 2.86 in SFC-1) may possibly allow the hydrolytic water to approach the ester carbonyl of the acylenzyme species resulting in deacylation of active site bound carbapenems, as occurs in class A carbapenemases. In other class A -lactamases (MAVEYRAUD et al., 1998; NUKAGA et al., 2008) the reorientation of the hydroxyethyl substituent in the acylenzyme reduces the reactivity of the deacylating water molecule, thus stabilising the covalently bound carbapenem intermediate.

An arginine at position 244 is observed in most class A -lactamases, known to interact strongly with the substrate carboxylate in these enzymes (NUKAGA et al., 2008; STRYNADKA et al., 1992) (Figure 4.7) and has been shown to be important in the tautomerization of the 2- to 1-pyrroline acylenzyme involved in carbapenem inhibition by these enzymes (KALP and CAREY, 2008; ZAFARALLA and MOBASHERY, 1992). However, in class A carbapenemases an alanine is found replacing the arginine. Instead, the side chain of an arginine at position 220 is projected into the active site occupying a position similar to that of Arg244 of noncarbapenemases. Although this doesnt change the architecture of the active site, the anchoring of the substrates carboxylate is different in the two groups of enzymes. Indeed, in the SFC-1 complex meropenem carboxylate is anchored by Thr237, Thr235 and Lys234 while in TEM-1 and SHV-1 acylenzymes, carboxylate is hydrogen bonded to Arg244, Ser235 and water molecules. Consequently in TEM-1 and SHV-1 -lactamases, bound carbapenem adopts a different orientation due to interaction with Arg244, which results in flexible binding at a distance from Ser130 (Figure 4.7). It has been proposed that in the deacylation mechanism the leaving group lactam nitrogen is activated by accepting a proton from Ser130 (MINASOV et al., 2002). However, in the former -lactamases Ser130 is rotated away from the amide nitrogen

88

Crystallographic structure of SFC-1with bound carbapenem

____________________________________________________________________________________________________________________________________________________

(N4), impairing proton transfer. By contrast in the SFC-1 E166A acylenzyme structure reported here, the interaction of the amide nitrogen with Ser130 (Figure 4.7) maintains the hydrolytically active tautomer and allows the proton transfer from Ser130, essential for an efficient deacylation. Therefore, the results shown here provide evidences to explain the carbapenemase activity exhibited by SFC-1 and related enzymes.

4.3.4 Concluding remarks

Here is reported the atomic structures of mutants and native SFC-1, a class A carbapenemase that is closely related, at the amino acid sequence level, to the clinically relevant KPC enzymes. These data show, for the first time, the interaction of carbapenems with class A carbapenemases, both in the unhydrolysed form and the acylenzyme intermediate, by X-ray crystallography. The overall structure of SFC-1 closely resembles those of other known class A -lactamases. However, these first structures of a class A carbapenemase with bound carbapenem and carbapenem acylenzyme suggest that, in SFC-1, and likely other class A carbapenemases, tight interaction with Ser130 maintains bound meropenem, in a conformation suitable to carbapenem hydrolysis, without gross distortion of the overall structure. The SFC-1: meropenem complex reveals important differences in the interaction with meropenem when compared to carbapenem-inhibited enzymes, providing information on the mechanism of carbapenem hydrolysis by class A lactamases.

89

5. Over-expression, purification and

biochemical characterisation of Sfh-I

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

5.1

Introduction
Carbapenems are broad spectrum -lactams that are insusceptible to the

hydrolytic action of most -lactamases, and consequently are growing in importance as treatments for infection by opportunist Gram-negative bacterial pathogens (MASTERTON, 2009). As other treatment options for such organisms are frequently limited, carbapenem-hydrolyzing -lactamases pose a serious threat to the effective resolution of such infections (QUEENAN and BUSH, 2007; WALSH, 2008). Although they remain comparatively rare, the frequency of carbapenemase containing-bacterial species continues to increase (HAWKEY and JONES, 2009). Carbapenemase activity has now been reported for -lactamases of all four Ambler classes (A-D) (KIM et al., 2006; QUEENAN and BUSH, 2007). Ambler class B or metallo--lactamases (MBLs) require zinc as a cofactor and are not susceptible to serine -lactamase inhibitors (e.g. clavulanic acid) in clinical use (CROWDER et al., 2006). MBLs are divided, according to their sequence, metal requirement and substrate specificity, into three subclasses (GALLENI et al., 2001). Subclasses B1 and B3 generally bind two zinc equivalents and exhibit a broad spectrum of activity, hydrolyzing all classes of -lactams except monobactams (CROWDER et al., 2006). By contrast, subclass B2 MBLs, such as CphA (SEGATORE et al., 1993; VALLADARES et al., 1997), ImiS (CRAWFORD et al., 2004; WALSH et al., 1996) and AsbM1 (YANG and BUSH, 1996) from Aeromonas spp., are monozinc enzymes with a strong preference for carbapenem substrates, and are inhibited upon binding of a second zinc ion (VALLADARES et al., 1997; YANG and BUSH, 1996). These are the least studied MBLs. Serratia fonticola are Enterobacteriaceae found mainly in aquatic and other environmental samples (GAVINI et al., 1979; MLLER et al., 1995; MLLER et al., 1986) and are generally considered as nonpathogenic, but have also been described as occasional human pathogens associated with respiratory tract infections or as infectious agents in wounds (BOLLET et al., 1991; FARMER et al., 1985; GORRET et al., 2009; PFYFFER, 1992). Previously characterised S. fonticola strains are intrinsically resistant to -lactams due to the expression of both a chromosomally encoded extended-spectrum class -lactamase and a species-specific AmpC lactamase (PEDUZZI et al., 1997; STOCK et al., 2003).

93

____________________________________________________________________________________________________________________________________________________

Chapter 5

However, it was previously established that UTAD54, a S. fonticola strain isolated from a natural water source, also expresses a metallo--lactamase, Sfh-I (SAAVEDRA et al., 2003) and a class A carbapenem-hydrolysing -lactamase, SFC-1 (FONSECA et al., 2007; HENRIQUES et al., 2004), that are both absent from other S. fonticola strains. The Sfh-I amino acid sequence diverges markedly (approximately 50% identity) from those of previously described B2 MBLs originating from Aeromonas strains (SAAVEDRA et al., 2003). In order to further characterise the Sfh-I metallo-enzyme, the gene encoding Sfh-I from S. fonticola UTAD54 was cloned and over-expressed in E. coli. This chapter describes the purification and biochemical characterisation of the recombinant enzyme.

5.2

Materials and methods

5.2.1 Antimicrobial agents and reagents
Antibiotics were obtained as powders from Sigma-Aldrich (ampicillin,

benzylpenicillin, (imipenem), (nitrocefin).

carbenicillin, Research

cefepime, Products

cefotaxime, (meropenem)

cefoxitin, and

ceftazidime,

cephalothin, cephaloridine, moxalactam, piperacillin), Merck Sharp & Dohme Co Sequoia Becton-Dickinson

General reagents and buffers were purchased from Sigma-Aldrich or Merck Sharp & Dohme Co and were of analytical quality.

5.2.2 Cloning and over-expression of Sfh-I

Molecular biology procedures followed manufacturers protocols except where stated. Initially Sfh-I was expressed as the mature protein, i.e. without its own predicted leader peptide, using the pelB sequence leader from the expression vector pET-26b (Novagen) that encodes a signal sequence aimed to direct expressed recombinant proteins to the periplasmic space. The same procedure was used to

94

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

obtain a high yield of recombinant SFC-1 (FONSECA et al., 2007) (Chapter 3). For that, bla Sfh-I was PCR-amplified from the genomic DNA of Serratia fonticola UTAD54 using the methodology described in Chapter 3 (see section 3.2.3) and primers SfhFv2 and SfhRv2 (Table 5.1; the NcoI and XhoI recognition sequences are underlined), obtained from STAB VIDA (Caparica, Portugal). PCR products were purified with the JETQUICK PCR Purification Spin Kit (GENOMED). Purified products and vector were digested with NcoI and XhoI (Roche) and cloned into the corresponding site of the pET-26b expression vector. The recombinant plasmid (pSfh-Iv2) was transformed into E. coli TOP10 (Invitrogen) and the presence of unwanted mutations in the expression plasmid was confirmed by sequencing.

Table 5.1 Primers used to clone bla Sfh-I .

Primer SfhFv2 SfhRv2 SfhFv3 SfhFv4

Sequence 5 --- 3 GGATCCACCATGGCTTCTGAAAAAAACTTAACG GTGCTCGAGTTACTTAGGCGCCTTCTCAAGC GGATCCCATATGTCTGAAAAAAACTTAACGCTTACC GGATCCCATATGAATATTAAATATTTATTTACGGCTG

Underlined sequences represent restriction endonuclease sites.

Recombinant protein was expressed from E. coli BL21 (DE3) (Novagen). The expression of the recombinant -lactamase was optimised in a small scale (50 mL) by decreasing the post-induction temperature (26C, 20C, 15C) and concentration of the inducing agent (IPTG, 1 mM and 0.5 mM), analysing expression under different time-course of induction (1h, 3h, 5h, 12h, 24h) and using a range of different culture media in a commercially available Media Optimization KitTM (AthenaESTM). Several attempts were made to solubilise this material, either using the BugBuster Protein Extraction Reagent (Novagen) or strong denaturants (6M Guanidine-HCl, 8M Urea and CAPS pH 11), with refolding of the target protein in vitro, by dilution of supernatant (after centrifugation, 15000 g for 15 minutes) into 50 mM Tris pH 7.5, 100 M ZnCl 2 (4C, with gentle swirling). With the purpose of obtaining soluble active recombinant Sfh-I two further constructs were made lacking the pelB leader sequence of the pET-26b expression

95

____________________________________________________________________________________________________________________________________________________

Chapter 5

vector. Primers SfhFv4 (Sigma-Aldrich) (NdeI restriction site underlined) and SfhRv2 (Table 5.1) were used to amplify the complete Sfh-I open reading frame (including its own predicted leader sequence; Sfh-Iv4). To obtain a construct encoding Sfh-I without the predicted periplasmic leader sequence (i.e. nucleotides 55 759; SfhIv3), primers SfhFv3 (Sigma-Aldrich) and SfhRv2 (Table 5.1) were used. Sfh-I-containing DNA fragments were amplified from S. fonticola UTAD54 genomic DNA using Pfu polymerase (Fermentas) and purified from agarose electrophoresis gels using the QIAEX II Gel Extraction Kit (QIAGEN). Purified PCR products were digested overnight with NdeI and XhoI (New England Biolabs) at 37C and ligated, using the Quick Ligation KitTM (New England Biolabs) according to the manufacturer protocol, into the NdeI XhoI site of digested pET-26b. The recombinant plasmids (pSfh-Iv4 and pSfh-Iv3) were transformed into E. coli TOP10 and plated into LB agar containing 50 mg/ml kanamycin. Positive clones were identified by colony PCR procedures using the following protocol: 5 to 10 colonies were picked and resuspended in 5 l of sterile water, and incubated 10 minutes at 100C; 4 l of the supernatant solution were used as template DNA in the PCR reactions carried out with the T7 primers (Sigma-Aldrich). Plasmid DNA was purified, for the clones whose insert was amplified, using the QIAprep Spin Miniprep Kit (Qiagen). The cloned inserts were further characterised by restriction enzyme analysis of purified plasmid DNA using XhoI followed by agarose gel electrophoresis. The integrity of the Sfh-I DNA sequence was ensured by complete sequencing of the inserts in both recombinant plasmids.

5.2.3 -lactamase production and purification

For -lactamase expression recombinant plasmids (pSfh-Iv4 and pSfh-Iv3) were transformed into E. coli BL21 Star (DE3) (Invitrogen). Recombinant Sfh-Iv3 and Sfh-Iv4 were produced following procedures previously developed for production of recombinant SFC-1 (FONSECA et al., 2007) (Chapter 3) except that expression was induced by using 1mM IPTG overnight at 25C. Protein extracts were loaded onto a 40ml Q-Sepharose column (GE Healthcare) pre-equilibrated in Tris-HCl buffer (50 mM, pH 8.5) containing ZnCl 2 (100 M) and bound proteins eluted on a 400ml 0 to 500 mM NaCl linear gradient.

96

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

Fractions

with

-lactamase

activity,

identified

by

hydrolysis

of

the

chromogenic -lactam antibiotic nitrocefin, were concentrated by centrifugal filtration (Amicon Ultra, Millipore) and further purified on a 300ml Superdex 75 column (GE Healthcare) running in HEPES buffer (50 mM, pH 7.0). Active fractions were collected and concentrated. The presence and purity of protein at each stage of the purification process was confirmed by SDS-PAGE (LAEMMLI, 1970).

5.2.4 Determination of kinetic parameters

Kinetic parameters, k cat and K M , for the hydrolysis of a range of -lactam antibiotics were calculated from initial hydrolysis rates measured at 25C in HEPES buffer (50 mM, pH 7.0) in UV-transparent 96-well plates (BD Biosciences) at appropriate wavelengths (LARAKI et al., 1999), using a SpectraMax 190 plate-reader (Molecular Devices) as described previously (SAMUELSEN et al., 2008). Stock substrate concentrations were determined from measurements of complete hydrolysis using previously reported extinction coefficients (LARAKI et al., 1999). Typically, experiments were conducted in which data points were recorded every 3-4 seconds for 20 - 30 minutes. Substrate and enzyme concentrations employed were adjusted to ensure that the evolution of product remained linear over a substantial fraction of the total time recorded across the whole range of substrate concentrations under investigation, i.e. that the reaction was taking place under steady-state conditions and that initial rates were indeed being recorded. Results obtained from experiments conducted in an independent laboratory with a conventional spectrophotometer using a subset of substrates (M.N. Lisa and A.J. Vila, personal communication) were in good agreement with those reported here, giving us further confidence in the accuracy of plate reader data. Kinetic parameters (k cat (s-1) and K M (M)) were determined by non-linear least squares fitting of the initial velocity of hydrolysis versus substrate concentration plots using GraphPad Prism (version 5.01, GraphPad Software Inc., La Jolla, USA). For cephalothin, the K m was determined as the inhibition constant, K i , calculated by nonlinear global fitting of initial velocity versus [nitrocefin] curves obtained at multiple cephalothin concentrations using the competitive inhibition model contained within GraphPad Prism. Reactions were initiated by addition of Sfh-I (final concentration 1.5 M) to

97

____________________________________________________________________________________________________________________________________________________

Chapter 5

pre-mixed nitrocefin and cephalothin and data recorded immediately (i.e. there was no pre-incubation of Sfh-I with cephalothin).

5.2.5 Time- and concentration-dependence of Sfh-I inhibition by cephalothin

In assays of the time-dependence of inhibition, 1.5 M Sfh-I was incubated with a 1:5 molar ratio of cephalothin for 0.51200 minutes in 50 mM HEPES buffer pH 7.0 at room temperature. 100 l samples were withdrawn at appropriate time intervals and residual activity was assayed by introducing these into a 1 ml cuvette containing nitrocefin as reporter substrate at a final concentration of 200 M. Initial hydrolysis rates for the reporter substrate were measured using a Lambda 35 spectrophotometer (Perkin-Elmer). Extinction coefficients and wavelengths used were as described (LARAKI et al., 1999). Hydrolysis of cephalothin under these conditions was monitored in parallel in a 1 ml sample by continuously recording absorbance at 265 nm in another spectrophotometer. In order to determine the reversibility of inhibition, Sfh-I was incubated with cephalothin as above for a time sufficient to inhibit the enzyme, and the mixture was then dialyzed overnight at 4C against 50 mM HEPES buffer pH 7.0. A control sample of protein incubated in the absence of inhibitor was treated identically and used for comparison. The recovery of enzymatic activity was determined by measuring the residual activity as described above.

5.2.6 Inactivation of Sfh-I by hydrolysed antibiotics

The antibiotics here studied as putative Sfh-I inactivators (cephalothin, cefoxitin and moxalactam) (2 mM) were hydrolysed by IMP-1 (LARAKI et al., 1999) in 50 mM HEPES pH 7.0, as monitored spectrophotometrically. After complete hydrolysis, the products were separated from the enzyme by centrifugal filtration (Amicon Ultra-4 10,000 NMWL; Millipore) and stored on ice until use. Hydrolysed antibiotics at a concentration of 1 mM were used to inactivate 3.6 mM Sfh-I at 4C. Inactivation was followed by measuring the residual activity as described above.

98

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

5.2.7 Mass spectrometry

The molecular mass and metal content of Sfh-I were determined by electrospray mass spectrometry. Sfh-I (200 M) was dialysed into ammonium acetate buffer (25 mM, pH 7.0) and mass spectra were recorded under both native and denaturing conditions. Samples were delivered at nanolitre per minute flow rates using a Nanomate source (0.3psi, 1.4kV) and mass spectra were recorded on a QStar XL qTOF instrument in positive ion mode. Inhibition of Sfh-I by cephalothin was studied by liquid chromatography mass spectrometry (LC-MS). A sample of 500 pmols of a mixture (5:1 or 15:1) of cephalothin and Sfh-I (200 M) incubated for 30 minutes was run on a Zorbax C3 column with a linear gradient of 1:1 (v/v) water-acetonitrile containing 0.06% formic acid. Eluent was fed directly into a Q-TOF I (Micromass) mass spectrometer and mass spectra were acquired. The sample containing a 5:1 ratio of cephalothin-SfhI was incubated with trypsin (1:50 substrate ratio) for 3h at 37C and analysed by MALDI mass spectrometry.

5.2.8 Zinc binding

Fluorescence emission spectra of the enzyme (1 M) in the presence of increasing amounts of Zn2+ were recorded on a FluoroLog spectrofluorometer (Horiba Jobin Yvon) using excitation and emission wavelengths of 280 and 341 nm, respectively. Slits were set to a band pass width of 5 nm. Assays were conducted at 25C in 50 mM HEPES buffer, pH 7.0, in a 1 ml cuvette with continuous mixing provided by a magnetic stirrer. The dissociation constants (K d ) for zinc binding to Sfh-I were estimated by plotting the measured change in fluorescence (Y) against zinc concentration ([Zn2+]) and nonlinear fitting to a two-site hyperbola model:

Y=Y1*[Zn2+]/(K d1 +[Zn2+]) + Y2*[Zn2+]/(K d2 +[Zn2+])

where Y1 and Y2 are the maximal fluorescence changes associated with the binding events described by K d1 and K d2 , respectively.

99

____________________________________________________________________________________________________________________________________________________

Chapter 5

5.2.9 Zinc concentration dependence of Sfh-I activity

Zinc dependence assays of Sfh-I activity were conducted in 96-well plate format under the conditions described above using nitrocefin and imipenem as reporter substrates and a range of ZnCl 2 concentrations (0-500 M). Reactions were initiated by addition of Sfh-I (1.5 M with nitrocefin and 1.0 nM with imipenem) to pre-mixed nitrocefin and zinc and data recorded immediately. Apparent k cat and K M values were determined as described above in the presence of increasing concentrations of zinc. The ratio k cat /k cat0 (where k cat0 is the value of k cat measured in the absence of added zinc) was plotted against zinc concentration and the resulting hyperbola was fitted to Equation 5.1:

k cat /k cat0 = (K d2 + *[Zn2+]) /([Zn2+] + K d2 )

Equation 5.1

by non-linear regression analysis using GraphPad Prism where is the value of the k cat /k cat0 ratio when zinc concentration is saturating. K d 2 represents the dissociation constant for the second zinc ion. Circular dichroism (CD) spectroscopy was used to give information about the effect of zinc on the secondary structure of Sfh-I. For these studies, the buffer of the Sfh-I solution was exchanged to 20 mM sodium phosphate pH 7.0, by dialysis overnight at 4C, using Slide-A-Lyzer Dialysis Cassettes (10K MWCO, Pierce). CD spectra were recorded on a Jasco J-815 spectropolarimeter in the range 260-190 nm using 8.5 M Sfh-I in a 1 mm cuvette. Temperature was set to 20C. For each sample four spectra were collected and averaged. Baselines of phosphate buffer without protein were subtracted from the samples to yield the contribution of the protein component. Thermal stability spectra were measured at 220 nm with temperature stepwise increased from 20C to 90C at an interval of 5C. Four scans were obtained for each sample and averaged.

100

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

5.3

Results and Discussion

5.3.1 Over-expression and purification of Sfh-I
The production of S. fonticola Sfh-I in E. coli BL21 (DE3), from the T7

promoter-based expression vector pET-26b, was tested with 3 different constructs. The first construct of Sfh-I was prepared as previously described for production of recombinant SFC-1 (Chapter 3), i.e. the open reading frame encoding the mature Sfh-I polypeptide without the leader sequence was expressed as a fusion with the pelB leader sequence from the pET-26b vector. Although high-level expression was attained in E. coli (Figure 5.1A), the majority of the recombinant protein aggregated inside the cells in insoluble inclusion bodies (BANEYX and MUJACIC, 2004; VILLAVERDE and MAR CARRI, 2003) (Figure 5.1B).

Figure 5.1 Analysis of recombinant Sfh-Iv2 expression in E. coli BL21 (DE3) by SDS-PAGE (12%), stained with Coomassie Blue. A) Lane 1, marker proteins (Precision Plus Protein all blue standards Bio-Rad;); lanes 2-3, total protein from uninduced cultures grown in Glucose M9Y and LB broth, respectively; lanes 4-9, total protein from induced cultures (1 mM IPTG) grown at 37C in different culture media including Glucose M9Y, Turbo, Hyper, Super, Power and LB broth (lanes 49, respectively) 3h post-induction. B) marker proteins (lane 1), soluble (lane 2) and insoluble (lane 3) fractions of E. coli BL21 (DE3) host cells containing the pSfh-Iv2 plasmid induced with 1 mM IPTG (37C for 3h). Protein was extracted using the BugBuster Protein Extraction Reagent.

101

____________________________________________________________________________________________________________________________________________________

Chapter 5

An extensive expression optimization was carried out to improve solubility by testing a number of parameters. These included growth temperature, culture media composition (Figure 5.1A), time-course of induction and the concentration of the inducing agent. However, the improvement in the solubility of the recombinant enzyme was not significant as only a small quantity of soluble protein was achieved. In an effort to obtain soluble protein from this construct, the solubilisation and refolding of the insoluble material was attempted. Nonetheless, the efficiency of the procedures used to solubilise/refold the insoluble protein proved to be very low, as revealed by the activity assays (data not shown). Two other constructs were designed and cloned into pET-26b using the NdeI (and XhoI) restriction site(s) such that the pelB leader sequence was no longer present. Both the constructs pSfh-Iv3, which encodes a version from which the signal peptide is deleted, and pSfh-Iv4, which encodes a form that contains the original signal peptide, produced soluble recombinant protein.

When evaluated the expression of the two constructs without the pelB leader sequence by SDS-PAGE (Figure 5.2), mature Sfh-I (Sfh-Iv3) was generated in higher yields and was accordingly purified and used for kinetic experiments.

Figure 5.2 Analysis of recombinant Sfh-Iv3 (v3) and Sfh-Iv4 (v4) expression in E. coli BL21 (DE3) by SDS-PAGE (12%), stained with Coomassie Blue. A) Lane 1, protein ladder; lanes 2-9, soluble fraction from induced (1 mM IPTG, I) and uninduced (NI) cultures grown in LB media at 25C. Cells were collected at 3h (T3) and 5h (T5) post-induction. B) As described in A) except cells were grown up to 21h after induction. The blue arrow shows the position of a protein band with the expected size of Sfh-I. Protein was extracted using the BugBuster Protein Extraction Reagent.

102

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

Recombinant Sfh-I was readily purified from induced (1 mM IPTG) cultures of E. coli BL21 (DE3) cells containing the pSfh-Iv3 plasmid grown overnight at 25C. The optimised purification protocol consists of two chromatographic steps: an anionic exchange (Q-Sepharose) run with 50 mM Tris buffer pH 8.5 containing 100 M ZnCl 2 and eluted with a linear gradient (0-25 %) of 1 M NaCl (Figure 5.3A), followed by a gel filtration (Superdex 75).

Figure 5.3 Optimised purification of recombinant Sfh-Iv3. A) and C) Chromatograms obtained from an extract of culture of E. coli BL21 (DE3) cells containing the pSfh-Iv3 plasmid applied to a Q-SepharoseTM anionic exchange column with -lactamase active peak indicated by an arrow, and from the fraction pointed in A) applied to a SuperdexTM 75 gel filtration column, respectively. B) and D) Analysis of the purification by SDS-PAGE (12%) stained with Coomassie Blue. B) Soluble extract of E. coli culture (lane 2) and fractions from anionic exchange (lanes 3-9). D) Protein fractions from gel filtration chromatography. M is the protein ladder.

103

____________________________________________________________________________________________________________________________________________________

Chapter 5

The active fractions recovered from the anionic exchange were applied to the gel filtration column and elution was performed with 50 mM Hepes buffer pH 7.0 (Figure 5.3C). This step allows excess zinc and salt to be washed from the purified protein (peak in the conductivity scale; silver line in Figure 5.3C) as well as a change in the pH promoting a higher stability of the protein during storage. The analysis of purified protein by SDS-PAGE confirmed the purification of recombinant Sfh-I to homogeneity (Figure 5.3D). The purification procedure used enabled to yield 50 mg/liter of purified protein at a purity of >95% as adjudged by SDS-PAGE (Figure 5.3).

The interpretation of electrospray mass spectrometry experiments (in particular the native spectrum) is complicated by multiple peaks that may arise from bound salt and/or water molecules. However, the mass of 26 136 Da obtained under denaturing conditions (Figure 5.4A) is consistent with removal of the N-terminal methionine from Sfh-Iv3 and in agreement with the value predicted from sequence (26 134 Da). A similar result for the Sfh-Iv4 construct confirms previous predictions that Sfh-I is expressed with a 21-amino-acid signal peptide that is cleaved between Ala and Ser to generate the mature form of the enzyme (SAAVEDRA et al., 2003).

5.3.2 Sfh-I is isolated as a monozinc enzyme

In the native spectrum (Figure 5.4B) peaks at 26 201 Da (26 136 + 65 Da); 26 218 Da (26 152 + 66 Da) and 26 239 Da (26 170 + 69 Da) all indicate addition of one equivalent of zinc (65 Da) to species found under denaturing conditions. These results, together with the size exclusion analysis, confirm that as isolated Sfh-I exists primarily in the mononuclear form, consistent with the assignment, from sequence, of Sfh-I as a B2 MBL (SAAVEDRA et al., 2003). The same zinc content was reported from previous investigations of the CphA and ImiS enzymes (CRAWFORD et al., 2004; VALLADARES et al., 1997).

104

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

Figure 5.4 Electrospray mass spectra of purified Sfh-I showing molecular mass of 26 136 Da (A) and binding of one zinc equivalent (Mr = 65) per protein molecule under non-denaturing conditions (B).

5.3.3 Kinetic parameters of Sfh-I

Hydrolysis of a representative set of -lactam antibiotics by Sfh-I was investigated under steady-state conditions (Table 5.2). Sfh-I efficiently hydrolyses carbapenems (imipenem, meropenem) but exhibits low affinity (K M > 300M) for many penicillins (ampicillin, carbenicillin and benzylpenicillin) and some cephalosporins (cefotaxime, ceftazidime). This behaviour is broadly similar to that previously reported for other Aeromonas B2 enzymes (FELICI and AMICOSANTE, 1995; FELICI et al., 1993; SEGATORE et al., 1993; VANHOVE et al., 2003; WALSH et al., 1996; YANG and BUSH, 1996). However, compared to A. hydrophila CphA, Sfh-I shows higher K M values (indicative of lower affinity) for penicillins (with the exception of ampicillin) and significantly increased turnover rates (k cat ) for ampicillin. For cephalosporins such as cefoxitin, nitrocefin and cephaloridine, K M values are reduced (indicative of higher affinity) compared to those reported for CphA (Table 5.2). With respect to CphA, catalytic efficiency (k cat /K M ) is thus increased for all noncarbapenem substrates except carbenicillin and cephaloridine. In the case of ampicillin this increase is almost four orders of magnitude. Sfh-I hydrolysed the cephalosporins cefotaxime and ceftazidime, as well as the serine--lactamase

105

____________________________________________________________________________________________________________________________________________________

Chapter 5

inhibitor sulbactam, but plots of hydrolysis rate against substrate concentration were linear and we were consequently unable to derive kinetic parameters for these substrates. Unexpectedly, and in contrast to the poor hydrolysis of many other cephalosporins, Sfh-I (0.01 M) hydrolysed cefepime with relatively high efficiency (3.02 x 103 M-1s-1) when compared to that of CphA for other cephalosporin substrates. Felici and Amicosante have previously reported that 0.5 M CphA shows no detectable activity towards cefepime (FELICI and AMICOSANTE, 1995). Compared to the other less well characterised subclass B2 MBLs from other Aeromonas species, Sfh-I is distinguished by its faster hydrolysis of penicillins and differs from AsbM1, but resembles ImiS, in its relatively low affinity towards penicillins. Faster hydrolysis (higher k cat ) but weaker K M values for meropenem compared to imipenem appears to be a shared property of all of these enzymes.

106

Table 5.2 Kinetic parameters of purified Sfh-I -lactamase and comparison with other B2 metallo--lactamases.a Substrate or inhibitor

k cat (s-1) Sfh-I

9.53 ND 9.15 0.06 8.21 x 10-5 ND ND ND 0.032 0.61 0.017 51 109

K M (M) ImiS
1.1 0.53 0.5 0.024g NH NR NH NR NH NR NH 350f 296g >1000 >500 99 202 91 79 215

k cat /K M (M-1s-1) ImiS

510 250 260 51g NH NR NH NR NH NR NH 100f 308g

CphA
<0.01b 0.03 10d 0.0028 <0.006 NR 0.009b NR 0.02e NHc NR 1200 3100

AsbM1
0.13 1.2 0.44 0.02 0.06 NR NR NR 0.06 NR NR 71 220

Sfh-I
676 >1500 1280 106 334

CphA
2500b 870 500d 1200 ~6000 NR 1000b NR 615e NHc NR 340 1340

AsbM1
65 160 28 ND ND NR NR NR ND NR NR 230 630

Sfh-I
1.41 x 104 ND 7.18 x 103 5.67 x 102 2.46 x 10-1 ND ND ND 3.23 x 102 3.16 x 103 1.87 x 102 6.42 x 105 5.05 x 105

CphA
<4b 35 2.0 x 104d 2.5 <1 NR 9b NR 33e NHc 5.6e 3.5 x 106 2.3 x 106

AsbM1
7.5 x 103 2.0 x 103 1.6 x 104 ND ND NR NR NR ND NR NR 3.1 x 105 3.5 x 105

ImiS
2.2 x 104 2.1 x 103 2.1 x 103 4.0 x 103g NH NR NH NR NH NR NH 9.1 x 105f 3.3 x 106g

Ampicillin Benzylpenicillin Carbenicillin Nitrocefin Cephaloridine Cephalothin Cefotaxime Ceftazidime Cefoxitin Cefepime Moxalactam Imipenem Meropenem
a

Kinetic data displayed for CphA, AsbM1 and ImiS as reported by Vanhove et al. (2003), Yang et al. (1996) and Walsh et al. (1996), respectively, except

where indicated.
b

Bebrone et al. (2005), c Felici and Amicosante (1995), d Segatore et al., (1993), e Zervosen et al. (2001), f Sharma et al. (2006) g Crawford et al. (2004).

ND, values could not be determined; NH, no hydrolysis detected; NR, not reported.

107

Chapter 5
____________________________________________________________________________________________________________________________________________________

5.3.4 Inhibition of Sfh-I by cephalothin

Previous workers (ZERVOSEN et al., 2001) have reported that A. hydrophila CphA may be inactivated by the cephamycin cefoxitin and the oxacephem moxalactam, as well as by other cephalosporin antibiotics with good 3 leaving groups. Similarly, the degradation products of various cephalosporins have been shown to inhibit the subclass B1 MBL BcII from Bacillus cereus (BADARAU et al., 2005). Accordingly, we investigated the interactions of Sfh-I with the hydrolysis products of cefoxitin, cephalothin and moxalactam. Incubation (18 h; 25C) of Sfh-I (3.6 M) with each of these hydrolysis products (1 mM) resulted in reductions in hydrolytic activity against imipenem (200 M) of 13% (cefoxitin), 36% (cephalothin) and 94% (moxalactam). These results suggest that, similarly to CphA, Sfh-I is inhibited by the degradation products of certain cephalosporins and related compounds, although in no case were we able to obtain complete inactivation. As the reactions of CphA with hydrolysed cefoxitin and moxalactam have been extensively described (ZERVOSEN et al., 2001), but those with cephalothin have not, we investigated the Sfh-I:cephalothin interaction in more detail. Experiments in which Sfh-I was preincubated with cephalothin, or its hydrolysis product, and aliquots removed and assayed for nitrocefin hydrolysis at a range of time points, confirmed that both of these compounds inactivate the enzyme in a time-dependent fashion. Experiments in which absorbance at 265 nm (reporting breakdown of cephalothin during incubation with Sfh-I) was monitored in parallel with measurements of enzyme activity suggested that loss of Sfh-I activity correlates with cephalothin hydrolysis (Figure 5.5), indicating that the hydrolysis product is the likely inhibitory species. Activity of cephalothin-treated samples remained 54% that of control samples, even after overnight dialysis was performed to remove unbound cephalothin and/or its degradation products, suggesting that inactivation results from a modification of the enzyme.

108

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

Figure 5.5 Effect of cephalothin on Sfh-I activity. A) Activity of Sfh-I (1.5 M) after incubation with cephalothin (7.5 M) assayed in the presence of 200 M nitrocefin; the control sample was submitted to the same treatment but without cephalothin added in the incubation mixture. B) Hydrolysis of cephalothin measured as a decrease in absorbance monitored at 265 nm.

Zervosen and co-workers have suggested that the moxalactam, and probably cefoxitin, hydrolysis products form covalent bonds to the free thiol of the conserved cysteine, Cys221, in the B2 MBL active site (ZERVOSEN et al., 2001). Similar inactivation mechanisms, in which Cys221 could interact either with the thiol generated by opening the dihydrothiazine ring of the hydrolysed cephalosporin (BADARAU et al., 2005), or by addition to the exo-methylene formed after elimination of the 3 leaving group, could also explain inactivation of Sfh-I by cephalothin. Accordingly we incubated Sfh-I with cephalothin, used trypsin to degrade the sample and analysed the resulting peptide mixture by MS/MS. Unfortunately, while all expected Sfh-I-derived peptides were detected, we were unable to observe any modified fragments, suggesting that the inhibitory complex is labile under the conditions employed.

5.3.5 The effect of excess Zn2+

Previous studies have revealed that CphA binds a single zinc ion tightly (K d1 < 20 nM) and is most active as a mono-zinc enzyme, but can bind a second, inhibitory zinc ion more weakly (K d2 = 46 M) (VALLADARES et al., 1997). As shown by mass spectrometry (Figure 5.4), in the absence of added zinc Sfh-I is already in a monozinc

109

Chapter 5
____________________________________________________________________________________________________________________________________________________

form, as is the case for ImiS and CphA (CRAWFORD et al., 2004; VALLADARES et al., 1997).

Monitoring fluorescence emission during a titration of Sfh-I with excess zinc (Figure 5.6) shows two distinct transitions, demonstrating that the enzyme is able to bind 2 further zinc ions with dissociation constants for the second (K d2 ) and third (K d3 ) zinc equivalents calculated as 95 14 M and 2300 870 M, respectively. The value that we obtained for K d2 is broadly comparable to that reported for binding of a second zinc ion to CphA. The crystal structure of CphA determined in the presence of excess zinc (BEBRONE et al., 2009) shows that CphA can bind a third zinc ion on the protein surface at a site distinct from the active site. Similarly, our results indicate that binding of a third zinc equivalent by Sfh-I is weak (very high K d3 ) and accordingly is unlikely to be of physiological relevance.

Figure 5.6 Variation in fluorescence emission intensity of Sfh-I (1 M) as a function of the concentration of added zinc monitored at 341 nm. The data were background subtracted and analysed by nonlinear fitting using two site binding analysis in GraphPad Prism.

Other members of subclass B2 are known to be active as monozinc enzymes, whereas the binding of a second zinc ion results in non-competitive inhibition (CRAWFORD et al., 2004; VALLADARES et al., 1997; YANG and BUSH, 1996).

110

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

To investigate the effect of added zinc on Sfh-I activity, hydrolysis of the substrates nitrocefin and imipenem was measured in the presence of increasing concentrations of zinc (Figure 5.7). The activity of Sfh-I against imipenem was essentially unaffected in the presence of zinc up to 400 M, in clear contrast to reports for related enzymes. Previous studies revealed that the highest imipenem hydrolysis activity was observed when ImiS, CphA, or AsbM1 bind one equivalent of zinc and the activity of the enzyme decreases as the more zinc is added (CRAWFORD et al., 2004; VALLADARES et al., 1997; YANG and BUSH, 1996). Surprisingly, nitrocefinase activity increased (3.7 fold) with the increase in zinc concentration (Figure 5.7), due to increases in k cat with little effect on K M (Table 5.3). It was shown for CphA that added zinc did not influence the activity of the enzyme with nitrocefin as substrate (BEBRONE et al., 2005) but an increase in activity was observed for some CphA mutants. These results, together with the substrate-dependent activity of Sfh-I in the presence of added zinc, reinforce the idea of a different mechanism for hydrolysis of imipenem and nitrocefin, as already suggested for CphA mutants (BEBRONE et al., 2005; VANHOVE et al., 2003). Although Sfh-I and CphA have the functional (active site) residues conserved, the two enzymes overall share just 50% identity, so the differences in activity described here can most likely be attributed to a combination of substitutions.

Figure 5.7 Effect of added zinc on k cat /k cat0 (ratio of k cat at a given zinc concentration to k cat0 determined in the absence of excess zinc) for hydrolysis of nitrocefin (filled circles) and imipenem (open circles). Solid line is a fit of nitrocefin data to Equation 5.1.

111

Chapter 5
____________________________________________________________________________________________________________________________________________________

Table 5.3 Influence of added zinc on k cat and K M values of nitrocefin hydrolysis by Sfh-I. Antibiotic Nitrocefin Added zinc (M) 0 50 100 200 500 k cat (s-1) 0.13 0.22 0.27 0.31 0.35 K M (M) 250 160 190 200 190 K d2 (M) 90

To study the effect of added zinc on Sfh-I secondary structure and stability, circular dichroism (CD) wavelength scans and temperature melts were acquired (Figure 5.8).

Figure 5.8 Effect of additional zinc on Sfh-I. A) Far-UV circular dichroism spectra of Sfh-I measured in the absence (green line) and presence (red line) of 1 mM Zn2+. B) Second derivatives of plots of ellipticity at 220nm against temperature for thermal unfolding of Sfh-I in the absence (green line) and presence (red line) of 1 mM Zn2+.

112

____________________________________________________________________________________________________________________________________________________

Over-expression and biochemical characterisation of metallo--lactamase Sfh-I

The CD spectra obtained for Sfh-I in the presence and absence of 1 mM Zn2+ reveals that the addition of zinc does not cause major structural rearrangements, inducing a small increase in Sfh-I secondary structure (Figure 5.8A). The thermal stability monitored by CD spectroscopy showed no significant difference between the midpoint for thermal unfolding of Sfh-I in the absence (60C) and in the presence of additional Zn2+ (58C) (Figure 5.8B), indicating that the addition of Zn2+ to the Sfh-I enzyme does not significantly affects its thermal stability.

5.3.6 Concluding remarks

We show here that Sfh-I is readily produced from recombinant E. coli and that the purified protein is a monozinc enzyme with a strong preference for carbapenem substrates. These properties confirm Sfh-I to be a member of the B2 MBL subgroup, previously known to contain only enzymes from Aeromonas spp. Our kinetic characterisation, however, shows that Sfh-I differs significantly from CphA, the best characterised B2 MBL, in its activity towards a range of substrates including cephalosporins (cefepime) and sulbactam. Fluorescence and activity measurements suggest that, while isolated as a predominantly monozinc enzyme, Sfh-I is able to bind up to three zinc ions with varying affinities, and that the effect of added zinc on enzyme activity is substratedependent. Further investigation of the recombinant enzyme is needed to establish the basis for these differences.

113

mechanism for subclass B2 metallo-lactamases

6. Structural characterisation of Sfh-I:

____________________________________________________________________________________________________________________________________________________

Structural characterisation of Sfh-I: mechanism for subclass B2 metallo--lactamases

6.1

Introduction
Class B -lactamases are zinc-dependent enzymes that are also known as

metallo--lactamases (MBLs) (CROWDER et al., 2006)). These enzymes are able to inactivate almost all -lactams, including the carbapenems, drugs of increasing importance in treatment of infections by multidrug resistant Gram-negative bacteria (MASTERTON, 2009), and are resistant to the clinical -lactamase inhibitors (e.g. clavulanic acid, sulbactam) currently available. Despite the increasing importance of the MBLs, clinically useful inhibitors are not yet available. MBLs are divided into subclasses B1, B2 and B3, based on their primary sequences, substrate specificity, and metal-ion requirement (GALLENI et al., 2001). Subclasses B1 and B3 include the most extensively studied enzymes, display activity against a wide range of -lactam substrates and generally bind two zinc ions (FELICI et al., 1993), (SPENCER et al., 2001). In these enzymes the binuclear zinc centre comprises a tetrahedral site (Zn1) with three histidine ligands (His116, His118, His196), and a five-coordinate site (Zn2) with cysteine (Cys221) histidine (His263) aspartate (Asp120; subclass B1) or histidine (His121) histidine (His263) - aspartate (Asp120; B3) ligands. Coordination is completed by two water molecules, one bridging the two metal ions and the other situated in the Zn2 site (CROWDER et al., 2006; WALSH et al., 2005). A number of crystal structures for representatives of subclasses B1 and B3 are currently available (CARFI et al., 1995; CONCHA et al., 2000; CONCHA et al., 1996; MURPHY et al., 2006; ULLAH et al., 1998). In contrast, the best characterised representatives of subclass B2, CphA and ImiS from Aeromonas sp., efficiently hydrolyse carbapenems but have poor activity against penicillins and cephalosporins (FELICI et al., 1993; WALSH et al., 1996). These enzymes lack the Zn1 ligand His116 and are fully active with one bound zinc ion, located in the Zn2 (Cys His Asp) site, but are noncompetitively inhibited upon binding of a second zinc equivalent (CRAWFORD et al., 2004; VALLADARES et al., 1997). Despite efforts to characterise B2 MBLs with regard to substrate specificity, zinc binding and catalytic mechanism, (WALSH et al., 1996), (COSTELLO et al., 2006), (BEBRONE et al., 2008), (SHARMA et al., 2006; SIMONA et al., 2009; XU et al., 2006), these remain the least studied MBLs. To date the only structures available for B2 MBLs are of CphA from A. hydrophila, including a CphA mutant in complex

117

Chapter 6
____________________________________________________________________________________________________________________________________________________

with the hydrolysis product of the carbapenem biapenem (BEBRONE et al., 2009; GARAU et al., 2005). The mechanism of action of B2 MBLs is also incompletely understood (GARAU et al., 2005; SHARMA et al., 2006; SIMONA et al., 2009; XU et al., 2006). Previously determined crystal structures (BEBRONE et al., 2009; GARAU et al., 2005) all contain small molecule ligands such as bicarbonate or sulphate and the origin and mechanism of activation of the water nucleophile essential to the hydrolytic reaction, and the identity of the proton donor to the -lactam amide nitrogen, thus remain to be unambiguously established. Computational studies have proposed two possible candidates: His118 (SIMONA et al., 2009) or Asp120 (XU et al., 2006) for the general base that activates the nucleophilic water molecule in subclass B2 MBLs. Sfh-I, a member of the B2 MBL subclass, was previously described. Sfh-I possesses 60% sequence identity to A. hydrophila CphA (mature polypeptides) and is specific to Serratia fonticola strain UTAD54 (SAAVEDRA et al., 2003). Like previously characterised B2 MBLs, Sfh-I efficiently hydrolyses carbapenems but displays reduced activity against penicillins and cephalosporins (Chapter 5). However, Sfh-I also displays some distinctive properties when compared to other B2 enzymes, showing some hydrolytic activity against the cephalosporin cefepime and being only weakly inhibited by excess zinc in a substrate-dependent fashion (Chapter 5). Sfh-I is thus the most divergent member of the B2 MBL subgroup that has been identified to date. This Chapter presents crystal structures of Sfh-I determined at two different resolutions in the presence and absence of a bound glycerol ligand. The glycerol complex structure results from attempts at ligand soaking. These data reveal, for the first time, the architecture of water molecules in the B2 MBL active site and strongly suggest that the catalytic water nucleophile is associated with His118, rather than the active site zinc ion or Asp120. Based on these results, a catalytic mechanism for B2 MBLs is offered.

118

____________________________________________________________________________________________________________________________________________________

Structural characterisation of Sfh-I: mechanism for subclass B2 metallo--lactamases

6.2

Materials and methods

6.2.1 Purification and crystallisation

Wild-type Sfh-I was produced in Escherichia coli BL21 (DE3) cells harbouring the pSfh-Iv3 recombinant plasmid and purified by liquid chromatography as described in Chapter 5. Following purification protein fractions showing >99% purity by SDSPAGE were concentrated by Amicon Ultra-15 spin concentrators with a molecular weight cut off (MWCO) of 10 kD, stored at 4C, and used in crystallisation trials. Purified Sfh-I was quantified spectroscopically by absorbance at 280 nm using a molar extinction coefficient of 35995 M-1cm-1 calculated from the amino acid composition using the method of Gill and von Hippel (1989) as implemented in the software Protean (Lasergene Software, DNAStar Inc.). Initial crystallisation trials of native Sfh-I were performed by the sitting drop vapour diffusion method using Molecular Dimensions Structure screen I & II HT-96 (JANCARIK and KIM, 1991), JCSG-plus HT-96 and PACT premier screens (NEWMAN et al., 2005). Drops were set up using a Phoenix liquid-handling system (Art Robbins Instruments) and 96-well MRC two well crystallisation plates (Hampton Research). Crystallisation drops consisted of 1 L of both the protein, concentrated to 11 and 22 mg/mL, and reservoir solutions. Plates were sealed with ClearSeal FilmTM (Hampton Research) and placed at 20C. The initial crystallisation conditions were optimised in 24-well XRL

crystallisation plates (Molecular Dimensions) using a gradient of PEG and salt concentration, by the hanging drop vapour diffusion method. The drops resulted from a 1:1 mixture of protein solution at 15 mg/mL and reservoir solution (1 l each component). Samples were equilibrated against 500 L of reservoir solution. Conditions derived from C3 (0.2 M ammonium nitrate, 20% polyethylene glycol (PEG) 3350) and H6 (0.1 M ammonium acetate, 0.1 M Bis Tris pH 5.5, 17% PEG 10000) were further refined using an Additive Screen (Molecular Dimensions) with protein concentrated to 15 mg/mL. The most promising crystals of Sfh-I were observed in drops consisting of 0.1 M ammonium nitrate and 25% PEG 3350 with several additives (calcium chloride, strontium chloride, dioxane, isopropanol) at a final concentration of 10%. Using these crystals higher quality crystals were obtained by streak seeding (Figure 6.1A).

119

Chapter 6
____________________________________________________________________________________________________________________________________________________

The best crystals of native Sfh-I grew in 0.1 M ammonium nitrate, 3% v/v isopropanol, 25% w/v PEG 3350. Crystals appeared after 2-3 days at 20C, in a variety of morphologies from flattened hexagonal rods to rhombohedral crystals. Prior to data collection crystals were briefly soaked in reservoir solution supplemented with 30% v/v ethylene glycol as cryoprotectant and flash-cooled in liquid nitrogen. Further screening was carried out with the aim of obtaining diffraction-quality crystals of Sfh-I in complex with excess zinc (1 mM), cefepime or cephalothin at different concentrations. This included co-crystallisation using commercial screens as above with substrate/zinc as additives, seeding to new drops containing the additive with additional refinement of some of the conditions and adding -lactam powder to drops containing crystals. Although data sets from several crystals were collected, no complex was obtained. However, this screening established that superior crystals could be generated by mixing 2.5 l of protein (15 mg/mL), 2 L of reservoir solution (0.2 M sodium acetate, 27% w/v PEG 3350) and 0.5 l 30% glycerol (Figure 6.1B) and equilibrating against a 500 l reservoir in hanging-drop format in XRL crystallisation plates (Molecular Dimensions). 20% v/v PEG 400 was used as a cryoprotectant.

6.2.2 Data collection and crystallographic refinement

Diffraction data were collected at Diamond Light Source beamline IO4 and processed with HKL2000 (OTWINOWSKI and MINOR, 1997) (apo Sfh-I) or MOSFLM (LESLIE, 2006) and SCALA (EVANS, 2006) (glycerol complex) (Table 6.1) from the CCP4 program suite (COLLABORATIVE COMPUTATIONAL PROJECT, 1994). Structures were solved by molecular replacement using the programs AMoRe (NAVAZA, 2001) (apo Sfh-I) or PHASER (MCCOY et al., 2007) (glycerol complex) and the three-dimensional structure of A. hydrophila CphA (GARAU et al., 2005) (PDB ID 1X8G) as a search model.

120

____________________________________________________________________________________________________________________________________________________

Structural characterisation of Sfh-I: mechanism for subclass B2 metallo--lactamases

Table 6.1 Data Collection Statisticsa

Native X-ray Source Wavelength () Data processing Space group Asymmetric unit Cell dimensions a, b, c () , , () Resolution () R merge No. reflections (total) No. reflections (unique) I / I Completeness (%) Redundancy a = 32.92 b = 72.17 c = 86.46 = 90.12 50 1.8 (1.86 1.8) 0.076 (0.500) 109 572 (9 549) 36 421 (3 537) 13.2 (1.9) 97.3 (95.3) 3.0 (2.7) a = 32.83 b = 87.28 c = 72.57 = 90.85 33.5 1.37 (1.45 1.37) 0.056 (0.55) 603 317 (84 447) 84 788 (12 336) 18.0 (3.3) 99.8 (100) 7.1 (6.8) DIAMOND IO4 0.9529 HKL2000 P21 2 molecules Glycerol complex DIAMOND IO4 0.9795 MOSFLM/SCALA P21 2 molecules

*Values in parentheses are for the highest resolution shell.

Models were refined iteratively using positional refinement in REFMAC5 (MURSHUDOV et al., 1997) followed by manual rebuilding into 2mF o dF c electron density maps using the program COOT (EMSLEY et al., 2010). Water molecules were added to the models at positions showing large positive peaks in F o -F c electron density. During iterative rebuilding residue geometries, van der Waals contacts and hydrogen bonds were monitored using the MOLPROBITY server (CHEN et al., 2010). Statistics from structure refinement are shown in Table 6.2.

121

Chapter 6
____________________________________________________________________________________________________________________________________________________

Table 6.2 Refinement Statisticsa

Native Resolution () No. reflections R work / R free No. atoms Protein Ligand/ion Water B-factors Protein Ligand/ion Water R.m.s deviations Bond lengths () Bond angles () 0.0128 1.338 0.0101 1.322 13.42 28.91 19.50 15.40 22.95 27.02 3 662 2 266 3 878 14 436 27.70 1.80 (1.847 1.800) 34 573 (2 482) 18.7/23.6 (23.5/33.8)) Glycerol complex 26.23 1.37 (1.41 1.37) 80 514 (5 932) 16.3/19.6 (26.5/30.2)

aValues

in parentheses are for the highest resolution shell.

6.2.3 Circular Dichroism (CD)

Circular dichroism (CD) spectroscopy was employed to compare the secondary structure, and the conformational stability of both Sfh-I and ImiS by increasing the temperature. ImiS is the Aeromonas veronii subclass B2 MBL, with a sequence 98% identical to that of CphA (differing at only seven amino acids) (WALSH et al., 1998). ImiS was used as a comparator as an over-expressing construct was readily available. ImiS was over-expressed and purified as previously reported (CRAWFORD et al., 2004). Briefly, 4 x 1L flasks of LB containing 50 g/mL kanamycin were inoculated with an overnight culture of E. coli BL21 DE3 containing the pET26bimiS plasmid and incubated at 37C until an optical density of 0.6 was reached. At this point cell cultures were induced with 1 mM IPTG and allowed to grow at 37C for 3

122

____________________________________________________________________________________________________________________________________________________

Structural characterisation of Sfh-I: mechanism for subclass B2 metallo--lactamases

hours. Cells were collected by centrifugation (4000 rpm, 30 minutes at 4C), resuspended in 40 mL of cold, 50 mM Tris 100 M ZnCl 2 , pH 7.0, and lysed by sonication followed by centrifugation (18000 rpm, 30 min at 4C). The supernatant with protein solution was dialyzed overnight at 4C versus 2 L of 50 mM Tris 100 M ZnCl 2 , pH 7.0. The dialyzed crude extract was centrifuged (18000 rpm, 30 min at 4C) and the cleared supernatant was loaded onto a pre-equilibrated SP-Sepharose column with 50 mM Tris 100 M ZnCl 2 , pH 7.0. Elution was performed with a linear gradient of 0 to 50 mM NaCl in 50 mM Tris 100 M ZnCl 2 , pH 7.0. Fractions containing ImiS were identified by SDS-PAGE (bands of approximately 25 kDa), concentrated by Amicon Ultra-15 spin concentrators (MWCO of 10 kDa) and loaded onto a Superdex 75 gel filtration column. ImiS was eluted in 50 mM Tris, pH 7.0 and protein fractions were analysed by SDS-PAGE. ImiS fractions with purity greater than 95% were pooled and concentrated. For CD studies, protein samples, both Sfh-I and ImiS, were dialyzed overnight at 4C versus 1 L of 20 mM sodium phosphate pH 7.0 using Slide-A-Lyzer Dialysis Cassettes (10K MWCO, Pierce). The concentration of ImiS was determined from absorbance at 280 nm using the extinction coefficient, = 37250 M1cm1, estimated previously by Crawford and co-workers (2004). CD spectra were recorded at 20C on a Jasco J-815 CD spectropolarimeter using 8.5 M protein in 20 mM sodium phosphate, pH 7.0. The wavelength range scanned was 260-190 nm. For each sample four spectra were collected and averaged. Baselines of phosphate buffer without protein were subtracted from the samples to yield the contribution of the protein component. Thermal stability spectra were measured at 220 nm with temperature stepwise increased from 20C to 90C at an interval of 5C. Four scans were obtained for each sample and averaged.

6.2.4 Accession numbers

The coordinates and structure factors for the two Sfh-I structures have been deposited in the Protein Data Bank (PDB) with accession numbers 3Q42 (unliganded structure) and 3Q6V (glycerol complex).

123

Chapter 6
____________________________________________________________________________________________________________________________________________________

6.3

Results and Discussion

6.3.1 Sfh-I overall structure

From the initial crystallisation trials of native Sfh-I using commercial screens, the most promising conditions, containing plate-like crystals or small crystals, were identified as conditions C3 (0.2 M ammonium nitrate, 20% w/v PEG 3350), H6 (0.1 M ammonium acetate, 0.1 M Bis Tris pH 5.5, 17% w/v PEG 10000), H7 (0.2 M ammonium sulphate, 0.1 M Bis Tris pH 5.5, 25% w/v PEG 3350) and H9 (0.2 M lithium sulphate, 0.1 M Bis Tris pH 5.5, 25% w/v PEG 3350) from JCSG-plus HT-96. Upon optimisation of initial conditions, crystals of apo Sfh-I grew by hanging drop vapour diffusion from 15 mg/ml protein and 0.1 M ammonium nitrate, 25% (w/v) PEG3350 with isopropanol as additive (3% v/v). Streak seeding was employed to improve crystal quality for X-ray diffraction experiments (Figure 6.1A). Crystals grown in conditions such as 0.2 M sodium acetate, 27% (w/v) PEG 3350, 3% glycerol and 0.2 M lithium chloride, 0.1 M Hepes pH 7.0, 28% (w/v) PEG 3350 (Figure 6.1B and 6.1C) were also used to collect diffraction data. However, crystals recovered from the lithium chloride solution proved to be highly mosaic and these data were not used for the determination of the Sfh-I structure.

Figure 6.1 Crystals of native Sfh-I. A. Individual panels showing the effect of additives on Sfh-I crystallisation in 0.1 M ammonium nitrate, 25% (w/v) PEG3350. B. and C. Native crystals grown in 0.2 M sodium acetate, 27% (w/v) PEG 3350, 3% glycerol and in 0.2 M lithium chloride, 0.1 M Hepes pH 7.0, 28% (w/v) PEG 3350 with additives (glycerol and ethylene glycol), respectively.

124

____________________________________________________________________________________________________________________________________________________

Structural characterisation of Sfh-I: mechanism for subclass B2 metallo--lactamases

Two crystal structures of recombinant Sfh-I were determined by molecular replacement, using the structure of A. hydrophila CphA (GARAU et al., 2005) as a search model. An unliganded structure was obtained to a resolution of 1.8 , and a structure with glycerol bound in the active site to a resolution of 1.4 . Both structures contain 228 amino acids (residues 41-304 using the BBL numbering system (GALLENI et al., 2001)). The overall fold of Sfh-I (Figure 6.2) conforms to the / sandwich structure characteristic of MBLs and related enzymes, with the active site located in a shallow cleft formed by the interface of the two -sheets. The two Sfh-I structures are almost identical (root mean square deviation (r.m.s.d.) of 0.279 between C atoms for molecule A in the respective structures as determined using SSM (KRISSINEL and HENRICK, 2004)).

Figure 6.2 Stereo ribbon diagram of the Sfh-I structure (glycerol complex). The polypeptide chain is colour-ramped from N- (blue) to C- (red) terminus. Zinc ion is rendered as a grey sphere and zinc ligands shown as sticks (atom colours as standard, carbons in green). Bound glycerol is shown as a stick model with carbon atoms in cyan. This figure and Figures 6.3, 6.5 and 6.6A were generated using PyMol (DELANO, 2008).

Comparison with A. hydrophila CphA (Figure 6.3A) shows the two B2 MBL structures to be closely superimposable (C r.m.s.d. 0.646 ) with the major difference between them the extended loop between helix 4 and strand 12 arising from the presence of a 4-amino acid insertion (BBL residues 254a-d) in the Sfh-I sequence relative to that of CphA.
125

Chapter 6
____________________________________________________________________________________________________________________________________________________

The Sfh-I crystal structure, the second for a B2 MBL, thus confirms that the elongated and kinked 3 helix, and the absence of extended mobile loops between strands 2 and 3 (as in B1 MBLs) or between 3 and strand 7 (as in B3 MBLs) are likely to be general structural features that distinguish B2 MBLs from those of subclasses B1 and B3 (GARAU et al., 2005).

Figure 6.3 A. Overlay of Sfh-I (blue) and A. hydrophila CphA (red; pdb accession 1X8G) (GARAU et al., 2005) structures. Positions of loops (114; 412) whose conformations vary between the two structures are marked. B. Ribbon diagram of Sfh-I structure (blue) highlighting (green) positions of residues that differ between Sfh-I and CphA. Positions of alterations involving proline residues are numbered and coloured magenta (proline deletions in Sfh-I relative to CphA) or orange (proline insertions in Sfh-I relative to CphA). Proline substitutions in the vicinity of the Sfh-I active site (positions 162, 194 and 198) are labelled and depicted in stick form.

In CphA the conformation of the loop connecting 11 and 4 varies between the uncomplexed and biapenem-bound structures, enabling Asn233 to make Hbonding contacts with the C3 carboxylate of bound biapenem (GARAU et al., 2005). In both of our Sfh-I structures this loop adopts the closed conformation associated with the biapenem-bound CphA structure, rather than that observed in the uncomplexed enzyme. However, in the unliganded structure the Asn233 side chain adopts either a dual conformation (molecule A of the 2 molecules in the asymmetric unit), or points away from, rather than towards, the zinc centre, indicating that some mobility at this position is required to permit interactions with bound -lactam substrates.

126

____________________________________________________________________________________________________________________________________________________

Structural characterisation of Sfh-I: mechanism for subclass B2 metallo--lactamases

Sfh-I, like other subclass B2 MBLs and unlike the enzymes of subclasses B1 and B3, displays a strong preference for carbapenem substrates and has only weak activity against -lactams of other classes (e.g. penicillins and cephalosporins). However, Sfh-I has some limited activity against certain substrates, for example the cephalosporin cefepime, against which CphA is entirely inactive (Chapter 5). Accordingly, the positions where the Sfh-I and CphA sequences differ onto the Sfh-I structure were mapped in an effort to identify substitutions likely to affect the spectrum of activity of Sfh-I (Figure 6.3B). While the majority of the substitutions are in surface-exposed regions, such as -helices 1, 2, 4 and 5 and at the ends of strands, that are not expected to influence catalytic activity, it is noticeable that Sfh-I contains 4 fewer proline residues than does CphA. In particular, two of these substitutions, CphA Pro194Glu and CphA Pro198Lys, are at positions that define a loop (linking strands 12 and 13) that bears the conserved active site residue His196; and the CphA Pro168Glu substitution is located at the end of the extended 3 helix.

Figure 6.4 Circular dichroism (CD) spectroscopy of Sfh-I (green) and ImiS (red) A. CD spectra from 8.5 M protein in 20 mM phosphate buffer, pH 7.0 at 20C. B. Thermal unfolding of the metallo--lactamases by stepwise increasing the temperature, measured by CD at 222 nm.

It is possible that these substitutions may increase the flexibility of the Sfh-I active site with respect to that of CphA (or ImiS), potentially enabling it to adjust to accommodate some additional substrates. In order to explore possible collective impact of these substitutions on protein secondary structure and stability, circular

127

Chapter 6
____________________________________________________________________________________________________________________________________________________

dichroism (CD) wavelength scans and temperature melts were carried out for Sfh-I and ImiS (Figure 6.4). The CD spectra produced for each of the purified enzymes were nearly superimposable (Figure 6.4A), revealing a very similar secondary structure. Moreover, the thermal stability monitored by CD spectroscopy indicated no significant difference between the midpoint for thermal unfolding of Sfh-I (60C) compared to that of ImiS (58C) (Figure 6.4B) or that reported for CphA (58.7C; (BEBRONE et al., 2009)), demonstrating that these substitutions do not impose a stability cost on the Sfh-I enzyme.

6.3.2 Active site

The active site of uncomplexed Sfh-I (Figure 6.5) contains a single zinc ion coordinated by the three conserved protein ligands: Asp120 (one oxygen; 1.98 , distances are for chain A), Cys221 (2.39 ) and His263 (2.01 ) that comprise the Zn2 site. Similar to CphA, but unlike the Zn2 sites of B1 or B3 MBLs, the Zn2 site adopts a tetrahedral, rather than trigonal bipyramidal, geometry. Coordination is completed by a single water molecule (Wat1; 2.24 ) that occupies a similar position to the amide nitrogen (N1) of bound biapenem in the CphA complex structure; i.e. a location distinct from those of water molecules found in B1 or B3 MBL active sites.

Figure 6.5 Stereo view of uncomplexed Sfh-I active site. Electron density shown is 2FoFc. calc , contoured at 1.2. Zinc ion is rendered as a grey and water molecules as red spheres. Protein is colour-ramped from N- (blue) to C- (red) terminus; side chain atom colouring is as standard excepting carbon atoms are rendered in green. Hydrogen and coordination bonds are depicted as dashed lines. Bound glycerol, positioned by overlaying the complex structure, is rendered semitransparent with carbon atoms in cyan.

128

____________________________________________________________________________________________________________________________________________________

Structural characterisation of Sfh-I: mechanism for subclass B2 metallo--lactamases

In common with other B2 MBLs, Sfh-I lacks the Zn1 ligand His116 and consequently binds a second zinc equivalent with greatly reduced affinity (Chapter 5). In Sfh-I structure the Zn1 site is instead occupied by a second water molecule (Wat2) that is tightly bound (2.00 ) by His118 and makes weaker interactions with both His196 (2.50 ) and Wat1 (2.52 ). Importantly, Wat2 is comparatively far (3.82 ) from the unbound oxygen of Asp120. In the complex structure, the positions of glycerol oxygen atoms superimpose upon those of Wat1 and Wat2 (Figure 6.5). Taken together, these two structures thus define two favoured positions for protein:ligand interactions in the Sfh-I active site.

6.3.3 Implications for catalytic mechanism

The catalytic mechanism of B2 MBLs has been the subject of considerable debate (GARAU et al., 2005; SHARMA et al., 2006; SIMONA et al., 2009; XU et al., 2006). Available CphA crystal structures (BEBRONE et al., 2009; GARAU et al., 2005) all contain small molecule ligands (biapenem, sulphate or bicarbonate), and the disposition of water molecules in the B2 active site, and thus the likely means by which the water nucleophile is activated, have consequently remained uncertain. The identification of bound water molecules in the Sfh-I active site therefore provides new insights into B2 MBL mechanism. Previous crystal structures, including that of the CphA biapenem complex (GARAU et al., 2005), and spectroscopic studies (SHARMA et al., 2006) suggest interaction between Zn2 and the -lactam amide nitrogen during the catalytic cycles of all MBL subclasses (GARRITY et al., 2004; SPENCER et al., 2005; TIONI et al., 2008). These data indicate that Wat1 is displaced by substrate during the catalytic cycle and we thus consider Wat2 to be the most likely nucleophile. Computational studies have suggested that either Asp120 (XU et al., 2006) or His118 (SIMONA et al., 2009) may activate a water nucleophile (Wat2) located in the B2 Zn1 site. The location of Wat2 in the structure of metallo--lactamase Sfh-I strongly supports the proposal that His118 fulfils this function: Wat2 makes a tight interaction with His118 but a much weaker contact with Asp120. Inspection of both the Sfh-I and CphA crystal structures further supports the idea that His118, while completely conserved across all three MBL subclasses, fulfils a different function in B2 MBLs (activating the hydrolytic water molecule) compared

129

Chapter 6
____________________________________________________________________________________________________________________________________________________

to subclasses B1 and B3, where it is a Zn1 ligand. In B1 MBLs His118 is H-bonded to a conserved acidic residue (Asp or Glu) at position 236 (Figure 6.6A). In available crystal structures of B3 enzymes this interaction is maintained, although the sequence position of the interacting carboxylic acid varies. Such second shell interactions between histidine zinc ligands and aspartate or glutamate side chains have been proposed to promote catalysis by enzyme zinc centres through a range of effects that include enhancing the reactivity of the metal-bound hydroxide nucleophile (LIN et al., 2005). By way of contrast, in the Sfh-I and CphA structures, the residue at position 236 is a phenylalanine, and the His118 side chain is not strongly H-bonded, but instead occupies a hydrophobic pocket formed by the side chains of Tyr117, Ile153 and Phe236 (Figure 6.6A). By virtue of its tight association with His118, Wat2 is therefore part of an electron-rich environment that, we believe, will enhance its nucleophilicity. Additional interactions with Wat1 and with the His196 side chain will then serve to appropriately orient Wat2 for nucleophilic attack upon the carbonyl carbon of incoming -lactam substrate.

Figure 6.6 A. Active site of VIM-2 (GARCIA-SAEZ et al., 2008) (PDB accession 1KO3) showing altered second shell ligands of His118. Protein is colour-ramped from N- (blue) to C- (red) terminus; side chain atom colouring is as standard excepting carbon atoms that are rendered in magenta. Hydrogen and coordination bonds are depicted as dashed lines. B. Molecular surfaces of uncomplexed Sfh-I (left) and VIM-2 (right) coloured by electrostatic potential. A molecule of meropenem (atom colours as standard; carbons in green) is manually placed in the Sfh-I structure to highlight the occluded Sfh-I active site. Figure 6.6B was generated using CCP4MG (POTTERTON et al., 2004).

130

____________________________________________________________________________________________________________________________________________________

Structural characterisation of Sfh-I: mechanism for subclass B2 metallo--lactamases

6.3.4 Proposed catalytic mechanism

Based upon these and previously published observations, a catalytic mechanism for Sfh-I and, by inference, for other B2 MBLs is therefore proposed (Scheme 6.1).

Scheme 6.1. Hydrolysis of the carbapenem meropenem by subclass B2 metallo-lactamases. Zinc: ligand interactions (omitted for clarity in lower panels) are shown as dotted lines.

Incoming

carbapenem

substrate 1 displaces Wat1 from the Sfh-I active site to interact directly through with the the C2 zinc ion carboxylate

group. The second carboxylate oxygen contacts the side chain of Lys224, (GARAU decreases activity of the as et observed al., in the CphA:biapenem complex 2005).

Replacement of Lys224 by Thr carbapenemase related ImiS

enzyme (SHARMA et al., 2006). This mode of binding positions Wat2, activated as described by contact with His118, to make a nucleophilic amide. The consequent electronic rearrangement results in opening of the -lactam ring and accumulation of negative charge in a delocalized system, comprising N1, C2 and C3, that is partially stabilized by proximity to the Sfh-I zinc centre. Stabilisation of anionic species 2, generated upon fission of the -lactam amide bond, by interaction with the metal ion in the MBL Zn2 site has been proposed to be important to MBL-catalysed hydrolysis of a attack upon the carbonyl carbon of the -lactam

131

Chapter 6
____________________________________________________________________________________________________________________________________________________

range of cephalosporin and carbapenem substrates (MCMANUS-MUNOZ and CROWDER, 1999; SPENCER et al., 2005; TIONI et al., 2008; WANG, Z. et al., 1999). Freeze-quench EPR studies of meropenem hydrolysis by Co++-substituted ImiS identified populated species with a 5 co-ordinate metal centre, as proposed for this species, rather than the resting 4 co-ordinate state (SHARMA et al., 2006). This anionic species may then decay by up to three possible routes. Proton transfer to N1 from an incoming water molecule, most likely in the Wat2 position, will generate the expected hydrolysis product (2 tautomer, 3). An appropriately positioned water molecule, located very close to the Sfh-I Wat2 site, is observed in the CphA:biapenem complex (GARAU et al., 2005). However, this structure also reveals hydrolysed biapenem to be present in an unanticipated cyclised form, suggesting that, for B2 MBLs, carbapenem hydrolysis may also involve an intramolecular rearrangement that requires abstraction of a proton from the C8 hydroxyl, its addition to C3, and subsequent attack of the nucleophile so generated upon C2 (4). Protonation at C3 could then also occur from an incoming water molecule, generating the hydrolysis product in the imine (1) tautomer 5. The role of zinc in B2 MBLs is then twofold: firstly binding substrate via interaction with the C2 carboxylate, and second in providing a means of stabilizing the negative charge that accumulates on N1 during and after cleavage of the -lactam amide bond. In contrast to the binuclear enzymes of subclasses B1 and B3, the metal ion is not involved in activation of the water nucleophile. Such a mechanism implies comparatively inefficient proton transfer to N1, a possible consequence of the occluded active site observed in the Sfh-I and CphA structures (Figure 6.6B), in which access of water molecules to the carbapenembound active site may be difficult. It would also predict that the anionic intermediate 2 can accumulate during carbapenem hydrolysis. Preliminary investigations of imipenem hydrolysis by Sfh-I under pre-steady-state conditions indeed indicate the existence of transiently populated intermediates during the catalytic cycle (Lisa, M.N. and Vila, A.J., personal communication). The preference of Sfh-I, and other B2 MBLs, for carbapenem substrates then arises from a combination of factors- restricted access to the active site, likely to be particularly deleterious to binding of substrates with bulky substituents at the C6 (penicillin) or C7 (cephalosporin) positions; presence of the C2 = C3 double bond in carbapenems, enabling anionic species to be stabilized by conjugation as well as interaction with zinc; and the availability of the C8 hydroxyl group, permitting

132

____________________________________________________________________________________________________________________________________________________

Structural characterisation of Sfh-I: mechanism for subclass B2 metallo--lactamases

resolution of the anionic intermediate 2 by intramolecular rearrangement, as in 4. Limited activity, as is observed against some penicillin substrates, may be possible when some of these factors are absent, but only carbapenems satisfy all of these criteria. These are thus the preferred substrates for B2 MBLs.

6.3.4 Concluding remarks

The data presented here, from a divergent member of the B2 metallo-lactamase subclass, confirms that structural features such as the extended 3 helix and occluded active site cavity are likely to be common to this group of enzymes and distinguish them from other MBLs. Most importantly, clear evidence is provided for an active site water molecule bound to His118, rather than Asp120, clarifying the means by which the nucleophile is activated for -lactam hydrolysis in these enzymes. In support of this contention it is shown that His118 occupies a distinct environment in B2 MBLs, consistent with a mechanistic function rather than a role as a zinc ligand. These results provide further evidence that B2 MBLs operate via a distinct catalytic mechanism and thus highlight the challenges associated with development of MBL inhibitors with activity against the full range of these enzymes.

133

7. General Discussion

General Discussion
____________________________________________________________________________________________________________________________________________________

7.1

Antibiotic resistance the problem

Antibiotics have been successfully used since the 1940s and are essential

drugs with which to treat patients who have infectious diseases. For the last 70 years antibiotic use has significantly reduced morbidity and mortality caused by infectious diseases. However, the wide and prolonged use of these drugs, initially seen as magic bullets, promoted the evolution of the target infectious bacteria in order to overcome their action and make them ineffective (KUMARASAMY et al., 2010; LIVERMORE, D., 2009). While some microorganisms are resistant to a single antibiotic or related class, others can develop resistance to several antibiotics. The later are known as multidrug resistant (MDR) strains (LIVERMORE, 2007). The continuing emergence, development and spread of drug-resistant pathogenic strains are a cause of increasing concern. Antibiotic resistance is now one of the leading unresolved problems in public health whose consequences include high human and economic costs associated with the treatment of infectious diseases. Indeed, infections caused by drug-resistant strains require longer, resulting in potential spread of resistant microorganisms to others, and more expensive therapies, being associated with an increased risk of death (DE KRAKER et al., 2011; NOSKIN et al., 2005). Recently a study based on a sample of high-risk hospitalised adult patients, 13.5% of which had antibiotic resistant infections (ARIs), revealed that the medical cost attributable to ARIs ranged from $18,588 to $29,069 per patient, while the duration of hospital stay was extended by 6.4 to 12.7 days for affected patients (ROBERTS et al., 2009). This study found that ARIs alone contribute to an excess mortality of 6.5 %, a death rate two times higher than in patients without ARIs. All together, these reports aim to be an alert for a better management of infections caused by antibiotic resistant strains and for an effective control and prevention of these infections. However, bacteria resistant to several antibacterial agents now occur worldwide and are no longer limited to the nosocomial environment. Originally, most multidrug resistant pathogens emerged in hospitals, in which antibiotic use was prevalent, though antibiotic resistant strains are spreading and becoming more common in the community (DELEO et al., 2010; ROONEY et al., 2009). The widespread development of antibiotic resistance has weakened their value as treatments for bacterial infections. Moreover, there is paucity in the development of

137

Chapter 7
____________________________________________________________________________________________________________________________________________________

new effective drugs, in particular against Gram-negative bacterial pathogens such as A. baumannii and P. aeruginosa (ABBANAT et al., 2008). Since the 1990s, the number and effort of pharmaceutical companies conducting research to discover novel antimicrobials has decreased (PROJAN, 2003). This is possibly explained by the fact that antibacterial agents have a low rate of return on investment. Indeed, antibiotics are taken just for a few days/weeks, in comparison with other drugs that are used for life, they become useless after a while due to resistance, and also because it takes a long time and funds for a new drug to reach the market (PROJAN, 2003; SPELLBERG et al., 2008).

7.2

Antibiotic resistance as a whole

As previously referred, bacteria resistant to multiple antibiotics represent a

huge threat in the hospital setting and, consequently, the majority of the studies address the antibiotic resistance mechanisms of clinically important bacteria (PATERSON and BONOMO, 2005; RICE, 2009). Nonetheless these reports do not address the origin and sources of the resistance determinants that are of clinical significance at present. Moreover, it is clear that currently disseminated resistance mechanisms represent just a fraction of the total antibiotic resistance scenario. A broader view of antibiotic resistance would involve all of the antibiotic resistance genes found in microorganisms, known as the resistome (WRIGHT, 2007). The resistome, a concept introduced by DCosta et al. (2006), comprises not only resistance elements from pathogens but also those found in environmental organisms that are not usually associated with disease. It includes resistance genes from antibiotic-producing bacteria, and genes that are embedded in the bacterial chromosome and have some potential to have a role in resistance, termed cryptic genes. The resistome also comprises precursor genes encoding proteins with modest antibiotic resistance activity but that are able to evolve into effective resistance genes if the right selective pressure is applied (WRIGHT, 2007). In recent years, several studies have drawn the attention of the scientific community to the fact that important resistance determinants that have emerged clinically are closely associated with mechanisms found in environmental organisms, whether antibiotic producers or not (ALLEN et al., 2010; D'COSTA et al., 2006;

138

General Discussion
____________________________________________________________________________________________________________________________________________________

DANTAS et al., 2008). For example, -lactam resistance by production of CTX-M lactamases is likely to have originated from environmental isolates of Kluyvera spp. (HUMENIUK et al., 2002; POIREL et al., 2002), while water-borne Shewanella algae and Vibrionacea species are the potential progenitors of the qnr quinolone resistance determinants, encoding proteins that protect DNA gyrase and topoisomerase IV from the inhibitory activity of quinolones (CATTOIR et al., 2007; POIREL et al., 2005). These reports show that it is essential to expand research into antibiotic resistance to include nonpathogenic organisms. Thus, an integrated view of resistance determinants may help researchers to better understand the evolution of antibiotic resistance and predict new resistance mechanisms prior to their emergence clinically (MARTINEZ, 2009; WRIGHT, 2010). The knowledge obtained can therefore be used to develop new therapeutic strategies to fight resistance before it reaches pathogenic bacteria (MARTINEZ, 2009; WRIGHT, 2010).

7.3

Study of carbapenemases from S. fonticola UTAD54

The overall purpose of this dissertation was to study the biochemical

properties, and determine the structures of carbapenemases expressed by Serratia fonticola UTAD54, a naturally-occurring strain isolated from untreated drinking waters in the Northeastern Portugal. Previous studies have shown that carbapenemresistant S. fonticola UTAD54 possesses chromosomal genes encoding two carbapenem-hydrolyzing -lactamases, a class A enzyme and a subclass B2 metalloprotein (HENRIQUES et al., 2004; SAAVEDRA et al., 2003). These genes are absent from other S. fonticola strains and are phylogenetically distant from previously characterised related -lactamases (HENRIQUES et al., 2004; SAAVEDRA et al., 2003). Carbapenems are the most powerful class of -lactams and have a broad spectrum of activity against Gram-negative opportunist pathogens including both the Enterobacteriaceae and non-fermenting species such as P. aeruginosa and A. baumannii (BAUGHMAN, 2009). The spread of resistance to other antibiotics, including penicillins and cephalosporins, in these species, has severally reduced treatment options for these patients (LIVERMORE, D., 2009; MASTERTON, 2009). Therefore, S. fonticola UTAD54 is a potential source of new resistance mechanisms to antibiotics that are clinically used as last resort treatments for serious infections by Gram-negative organisms. Moreover, there is evidence that the carbapenem

139

Chapter 7
____________________________________________________________________________________________________________________________________________________

resistance gene blaSfh-I encoded on the chromosome of S. fonticola UTAD54 is embedded in mobile genetic elements (I Henriques and A. Correia, unpublished results), potentially enabling its dissemination into other bacteria.

In order to overcome resistance to -lactam antibiotics it is fundamental to understand in detail the mechanisms of resistance and the mechanism of action of -lactamases, so that new effective drugs and/or inhibitors can be developed. The results here presented can be seen as part of this global approach. This work is divided in two independent parts, each concerning the study of a carbapenemase from S. fonticola UTAD54. Thus, in the discussion I will consider each of these enzymes in turn.

7.3.1 SFC-1, an Ambler class A carbapenemase

SFC-1 is a Bush subgroup 2f -lactamase that has been shown to be active against penicillins, cephalothin, and aztreonam with reduced susceptibility to the carbapenems meropenem and imipenem, and to be inhibited by clinically used inhibitors (HENRIQUES et al., 2004). Although this resistance profile is typical for class A carbapenem-hydrolysing -lactamases, the kinetic characterisation of SFC-1 revealed that this enzyme exhibits unique properties. In this work it was shown that for SFC-1 the turnover rates for ceftazidime and cefoxitin are higher than those reported for IMI-1 and KPC-2. Previous studies have shown that a threonine at position 237, as displayed by SFC-1 and KPC, is involved in broadening the activity of class A carbapenemases to include extendedspectrum cephalosporins (MAJIDUDDIN and PALZKILL, 2005; SOUGAKOFF et al., 1999). Additionally, a second substitution present in SFC-1 and KPC amino acid sequences but absent in the remaining enzymes of subgroup 2f, an Ala240Val mutation can also explain the increased activity against the extended-spectrum cephalosporins, as suggested for the ESBL TEM-149 (PERILLI et al., 2008). Nonetheless, more studies are required to validate these hypotheses in SFC-1. This study of SFC-1 also demonstrated that although this enzyme is inhibited by the typical class A -lactamase inhibitors, the inhibition is weak (IC 50 higher than 1 M) when compared to carbapenemases IMI-1 and KPC (RASMUSSEN et al., 1996; YIGIT et al., 2001). These results show that SFC-1 is a class A -lactamase with a

140

General Discussion
____________________________________________________________________________________________________________________________________________________

very broad substrate profile, able to hydrolyse carbapenems and extended-spectrum cephalosporins with reduced susceptibility to available -lactamase inhibitors. Although the genetic context of blaSFC-1 does not include mobile genetic elements, unpublished results reveal a close proximity (within 10 Kb) of the bla SFC-1 and blaSfh-I genes on the chromosome of S. fonticola UTAD54. Therefore we cannot rule out the possibility that both genes are associated to mobile genetic elements. Moreover, these genes were found in S. fonticola UTAD54 (HENRIQUES et al., 2004) but not in related strains, further supporting an exogenous origin.

Despite

the

availability

of

crystal

structures

for

several

class

carbapenemases (KE et al., 2007; SOUGAKOFF et al., 2002; SWARN et al., 1998), the structural basis for -lactam resistance mediated by these enzymes remains elusive. In an attempt to attain more information on the interaction between lactamases and -lactams, especially carbapenems, crystal structures of the carbapenemase SFC-1, the acylation-deficient S70A mutant and the deacylationdeficient E166A mutant in complex with the carbapenem meropenem, were solved during this work. As reported for other class A carbapenemases, the structure of native SFC-1 is very similar to those of class A -lactamases, such as TEM-1 (STEC et al., 2005) and SHV-1 (KUZIN et al., 1999), but with the disulphide bridge between Cys69 and Cys238 that distinguishes class A carbapenemases (WALTHERRASMUSSEN and HOIBY, 2007). The structure of wild-type SFC-1 alone does not offer a clear explanation for its broad spectrum of activity. However, the presence of a proline residue at position 104 and the orientation of His105 may contribute to the expansion of the catalytic cavity. The opened cavity can then accommodate the bulky side chains of extended-spectrum cephalosporins, avoiding steric constraints that could arise from bulkier or more flexible residues at positions 104 and 105 (BETHEL et al., 2006; DOUCET et al., 2004). A study concerning the role of the residue at position 104 in SHV supports these results, providing indication that the Asp104Pro substitution increases -lactam resistance, according to reported MIC values (BETHEL et al., 2006). However, in a similar investigation using -lactamase SME-1, the Tyr104Pro mutant only maintained high levels of resistance to imipenem, exhibiting a decrease in resistance to ampicillin and, to a lesser extent, cefotaxime (MAJIDUDDIN and PALZKILL, 2005). These studies demonstrate that is difficult to assign substrate specificity in many -lactamases to a single position, and most

141

Chapter 7
____________________________________________________________________________________________________________________________________________________

likely this property results from the interaction of several residues and its influence in the active site of these enzymes. The X-ray crystal structure of the SFC-1 S70A mutant in complex with meropenem has shown that the -lactam carbonyl oxygen of the substrate is completely bound in the oxyanion hole, a result that clearly differs from earlier observations of other class A -lactamases (MAVEYRAUD et al., 1998; NUKAGA et al., 2008). It was also observed that bound meropenem establishes contacts with the amide nitrogens of Thr237 and Ala70, and Ser130 is close to the meropenem amide nitrogen, consistent with a role in the protonation of the -lactam nitrogen. The structure of the E166A acylenzyme shows that a number of modifications occur upon acylation of the SFC-1 -lactamase. Among these are: the positioning of the -lactam ring carbonyl oxygen in close proximity to the amide nitrogens of both Ser70 and Thr237, the substrate carboxylate is nearer to the side chain hydroxyls of Thr237 and Thr235 than in the substrate complex, while the hydrogen bond between the meropenem carboxylate and Ser130 is missing. Also, the 6-hydroxyethyl substituent of meropenem is rotated and no longer interacts with the catalytic water molecule, a result that distinguishes the acylenzyme of SFC-1 from carbapenem acylenzymes of TEM-1 and SHV-1 (MAVEYRAUD et al., 1998; NUKAGA et al., 2008). In the later enzymes, the 6-hydroxyethyl carbapenem substituent is hydrogen bonded to the hydrolytic water, possibly explaining the longevity of carbapenem acylenzymes in the active sites of these -lactamases. Another important observation, arising from the structures of SFC-1, refers to the position adopted by Ser130 in class A carbapenemases. In TEM-1 and SHV-1, both non-carbapenemases, Ser130 is reoriented in the presence of the substrate, pointing its hydroxyl group towards the amino group of Lys234 instead of Lys73, as seen in the apo structure (MAVEYRAUD et al., 1998; NUKAGA et al., 2008). By contrast, in SFC-1 the Ser130 hydroxyl assumes the same position as in the apo structures of other class A -lactamases. This arrangement allows interaction with Lys73 and Lys234, as well as the amide nitrogen (N4) of meropenem in the SFC-1 acylenzyme, suggesting that Ser130 also helps to position meropenem in a favorable orientation for deacylation. A close interaction of the acylenzyme amide nitrogen with Ser130 may also prevent tautomerisation to the less reactive imine (delta-1 tautomer) form.

142

General Discussion
____________________________________________________________________________________________________________________________________________________

7.3.2 Sfh-I, a subclass B2 metallo--lactamase

Sfh-I is the first subgroup B2 metallo--lactamase to be identified in a genus other than Aeromonas. The gene coding for Sfh-I is present on the chromosome of S. fonticola UTAD54 (SAAVEDRA et al., 2003). However unpublished results from our group (I. Henriques and A. Correia, personal communication) provide evidence that bla Sfh-I is flanked by transposable elements, suggesting a potential horizontal transfer of this genetic determinant from/into other isolates in the environment. In this work it was demonstrated that Sfh-I, like CphA and ImiS, has a preference for carbapenem substrates and displays high activity when coordinating one equivalent of Zn(II) (Chapter 5). Other groups of metallo--lactamases have a broad substrate profile but require two Zn(II) ions for optimal activity (CROWDER et al., 2006). Previous studies have shown that B2 MBLs are able to bind a second zinc ion, but their enzymatic activity is noncompetitively inhibited in this situation (CRAWFORD et al., 2004; VALLADARES et al., 1997). Sfh-I, however, is revealed to be a singular B2 MBL that exhibits a substrate-dependent behaviour upon binding of a second zinc ion (Chapter 5). No inhibition was detected when a good substrate (imipenem) was assayed, but nitrocefinase activity increased in the presence of a second zinc ion. Bebrone et al., (2005) reported no influence of added zinc on CphA activity when nitrocefin was used as substrate. In this investigation a CphA mutant, N116H/N220G, was engineered, whose di-zinc form is more active against nitrocefin (among other -lactam antibiotics) than the mono-zinc form. With imipenem the activity decreases by binding of a second zinc ion (BEBRONE et al., 2005). A similar result has been observed for the CphA mutant N116H (VANHOVE et al., 2003). Based on these results the authors proposed that a slightly different mechanism would be used by these mutants to hydrolyse carbapenem, and some cephalosporin, substrates (BEBRONE et al., 2005). Our results on the effect of added zinc on Sfh-I activity thus emphasize the divergence between this enzyme and previously characterised B2 MBLs. Another distinctive property of Sfh-I is its ability to hydrolyse cefepime (Chapter 5), a fourth generation cephalosporin displaying enhanced in vitro activity against Gram-positive pathogens, along with Gramnegative bacteria producing ESBLs (SADER et al., 2005). To our knowledge, this is the first description of cefepime hydrolysis by a subgroup B2 MBL; this

143

Chapter 7
____________________________________________________________________________________________________________________________________________________

cephalosporin

was

not

recognised

as

substrate

by

CphA

(FELICI

and

AMICOSANTE, 1995). The studies conducted along this dissertation provided evidence that Sfh-I binds up to three zinc ions if enough zinc is added to the enzymes milieu (Chapter 5), although the binding affinities for the different zinc ions vary hugely. We were unable to determine the binding affinity for the first zinc ion but we believe it to be high, as reported for related enzymes (VALLADARES et al., 1997) and evidenced by its high occupancy in our crystal structures. However, the second zinc binds with an affinity (K d2 ) similar to that reported for CphA (VALLADARES et al., 1997). Sfh-I binds a third zinc equivalent but very loosely (K d3 > 1 mM), and we consider this metal ion unlikely to play a role in the enzymes activity. This result is in agreement with the crystal structure of CphA determined in the presence of excess zinc, where a third zinc ion was observed on the surface of the protein, away from the catalytic cavity (BEBRONE et al., 2009). To understand how -lactams are hydrolysed by metallo--lactamases and hence make possible the design of new -lactams, and/or inhibitors with decreased susceptibility to these enzymes, it is essential to determine the exact molecular mechanism that underlies the turnover of most -lactams. Mechanistic and structural data is particularly scarce for subclass B2 metallo--lactamases. Until now, the only crystal structures available for a B2 MBL are of CphA from A. hydrophila containing small molecules in the active site (BEBRONE et al., 2009; GARAU et al., 2005). No unliganded structure is accessible for subclass B2 MBLs. Moreover, there is no consensus about the catalytic mechanism employed by these enzymes, although crystallographic (GARAU et al., 2005), spectroscopic (SHARMA et al., 2006) and molecular modelling (SIMONA et al., 2009; XU et al., 2006) studies addressed this subject. The most important issue to be unambiguously clarified refers to the identity of the general base responsible for the activation of nucleophilic water, proposed to be either Asp120 (XU et al., 2006) or His118 (SIMONA et al., 2009). In this work, the crystal structure of Sfh-I from S. fonticola UTAD54 was solved. The overall fold was shown to be very similar to the previously determined structure of CphA from A. hydrophila (Chapter 6). The structure of Sfh-I is the first for an unliganded subclass B2 MBL, explicitly revealing the position of two water molecules in the active site. In the Sfh-I structure, the fourth zinc ligand is a water

144

General Discussion
____________________________________________________________________________________________________________________________________________________

molecule (Wat1) in contrast with the CphA structure where a carbonate ion occupies this position (GARAU et al., 2005). The involvement of a second water molecule (Wat2) in the catalytic mechanism of CphA was previously predicted by computational methods (SIMONA et al., 2009). However, no structural data to support this calculation was available. The observed bound water molecules in the Sfh-I active site-pocket thus provide new insights into the catalytic mechanism of subclass B2 MBLs. In fact, the structural data obtained on Sfh-I, suggest Wat2 to be the most likely nucleophile. Wat2 is positioned closer to His118 when compared to Asp120, the strongest candidates to act as the general base, and therefore, it is proposed that Wat2 is activated by His118, rather than by Asp120 as has been suggested for CphA (XU et al., 2006).

7.4

Conclusions
The work developed and described along this dissertation, through

characterisation of the unique -lactamases SFC-1 and Sfh-I found in S. fonticola UTAD54, provides new information on the interaction and hydrolysis of -lactam antibiotics by Ambler class A carbapenemases and subclass B2 metallo-lactamases. The main conclusions that can be extracted from the study here presented are as follows:

1.

As expressed in E. coli, SFC-1 is an enzyme with a very broad substrate

profile, including penicillins, oxyimino-cephalosporins (ceftazidime and cefotaxime), cephamycins (cefoxitin), carbapenems (imipenem, meropenem) and the -lactamase inhibitors (clavulanic acid, sulbactam and tazobactam); 2. When compared to other class A carbapenemases, SFC-1 is more

resistant to extended-spectrum cephalosporins and -lactamase inhibitors; 3. The crystal structure of SFC-1 reveals an overall fold that is essentially

identical to those of other class A -lactamases; 4. The determination of atomic resolution structures of SFC-1 point

mutants in complex with bound meropenem provided, for the first time,

145

Chapter 7
____________________________________________________________________________________________________________________________________________________

information on the recognition and hydrolysis of carbapenems by class A carbapenemases; 5. Recombinant Sfh-I produced from E. coli is a mono-zinc subclass B2

MBL with a strong preference for carbapenem substrates, that is typical of such enzymes. Nonetheless, Sfh-I is able to hydrolyse cefepime and sulbactam, substrates not recognised by related enzymes; 6. In the presence of added zinc Sfh-I was shown to behave differently

from previously characterised B2 MBLs, since Sfh-I carbapenemase activity was not inhibited by elevated zinc concentrations; 7. Despite the unique properties revealed by the kinetic characterisation

of Sfh-I, the structure of this enzyme closely resembles that of CphA from A. hydrophila. Thus the differences in specificity exhibited by Sfh-I cannot be inferred from the structure alone; 8. Of most importance, the structure of Sfh-I, the first for an unliganded

B2 MBL, provides important information on the catalytic mechanism of these enzymes, for example the identity of the nucleophile species (Wat2) and the way it is activated (His118).

7.5

Future studies
The overall goal of this project was to characterise the carbapenem-

hydrolysing -lactamases SFC-1 and Sfh-I from S. fonticola UTAD54. To continue pursuit of these objectives, further studies are suggested. In the work presented here, it was not possible to offer a clear explanation for the increased activity against oxyimino-cephalosporins, and the inhibitor resistance, displayed by SFC-1, when compared to other class A carbapenemases. To address this question it would be interesting to use site-directed mutagenesis, targeting residues at positions 237 and 240. Positions 237 and 240 are suggested to be involved in the activity of KPCs and TEM-149 against oxyimino-cephalosporins (PAPP-WALLACE et al., 2010b; PERILLI et al., 2008), respectively, while Thr at position 237 is also thought to play a role in inhibitor resistance in KPC (PAPPWALLACE et al., 2010b). Protein crystallography can also be used to unravel how
146

General Discussion
____________________________________________________________________________________________________________________________________________________

SFC-1

and

related

-lactamases

(e.g.

KPCs)

hydrolyse

extended-spectrum

cephalosporins. This project also raises a number of questions regarding the activity of Sfh-I. For example, the mechanism of inactivation of Sfh-I by cephalothin remains to be fully elucidated. Despite several attempts to co-crystallise Sfh-I with cephalothin, and the use of mass spectrometry in attempts to identify the modified peptide, no conclusive answer was obtained. The interaction between Sfh-I and cephalothin can also be examined by molecular modelling methods using the structure of Sfh-I. The same techniques can be used to describe the hydrolysis of cefepime by Sfh-I MBL. Further investigations to understand the effect of added zinc on the carbapenemase activity of Sfh-I are required. As crystals of Sfh-I in the presence of a high concentration of zinc proved to be difficult to obtain, the information about the metal binding sites can be achieved using spectroscopic techniques such as EXAFS (COSTELLO et al., 2006; CRAWFORD et al., 2005).

147

8. References

References
____________________________________________________________________________________________________________________________________________________

ABBANAT, D., MORROW, B., and BUSH, K. (2008). New agents in development for the treatment
of bacterial infections. Current Opinion in Pharmacology. Vol. 8 (5), p. 582-592. DOI: 10.1016/j.coph.2008.08.001. ABRAHAM, E., and CHAIN, E. (1940). An enzyme from bacteria able to destroy penicillin. Nature. Vol. 146 (3713), p. 837. DOI: 10.1038/146837a0. ADACHI, H., OHTA, T., and MATSUZAWA, H. (1991). Site-directed mutants, at position 166, of RTEM-1 -lactamase that form a stable acyl-enzyme intermediate with penicillin. Journal of Biological Chemistry. Vol. 266 (5), p. 3186-3191. ALLEN, H. K., DONATO, J., WANG, H. H., CLOUD-HANSEN, K. A., DAVIES, J., and HANDELSMAN, J. (2010). Call of the wild: antibiotic resistance genes in natural environments. Nat Rev Microbiol. Vol. 8 (4), p. 251-259. DOI: 10.1038/nrmicro2312. AMBLER, R. P. (1980). The structure of -lactamases. Philos Trans R Soc Lond B Biol Sci. Vol. 289 (1036), p. 321-331. DOI: 10.1098/rstb.1980.0049 AMBLER, R. P., COULSON, A. F., FRERE, J. M., GHUYSEN, J. M., JORIS, B., FORSMAN, M., LEVESQUE, R. C., TIRABY, G., and WALEY, S. G. (1991). A standard numbering scheme for the class A lactamases. Biochem J. Vol. 276 ( Pt 1), p. 269-270. AUBRON, C., POIREL, L., ASH, R. J., and NORDMANN, P. (2005). Carbapenemase-producing Enterobacteriaceae, U.S. rivers. Emerg Infect Dis. Vol. 11 (2), p. 260-264.

BADARAU, A., LLINAS, A., LAWS, A. P., DAMBLON, C., and PAGE, M. I. (2005). Inhibitors of

metallo--lactamase generated from -lactam antibiotics. Biochemistry. Vol. 44 (24), p. 8578-8589. DOI: 10.1021/bi050302j.

BANEYX, F., and MUJACIC, M. (2004). Recombinant protein folding and misfolding in Escherichia coli. Nat Biotech. Vol. 22 (11), p. 1399-1408. DOI: 10.1038/nbt1029. BARBER, M. (1947). Staphylococcal infection due to penicillin-resistant strains. Br Med J. Vol. 2 (4534), p. 863-865. BAUGHMAN, R. P. (2009). The use of carbapenems in the treatment of serious infections. J Intensive Care Med. Vol. 24 (4), p. 230-241. DOI: 10.1177/0885066609335660. BAYLES, K. W. (2000). The bactericidal action of penicillin: new clues to an unsolved mystery. Trends in Microbiology. Vol. 8 (6), p. 274-278. DOI: 10.1016/S0966-842X(00)01762-5.

151

References
____________________________________________________________________________________________________________________________________________________

BEADLE, B. M., and SHOICHET, B. K. (2002). Structural Basis for Imipenem Inhibition of Class C Lactamases. Antimicrob. Agents Chemother. Vol. 46 (12), p. 3978-3980. DOI: 10.1128/aac.46.12.3978-3980.2002. BEBEAR, C. M., and PEREYRE, S. (2005). Mechanisms of Drug Resistance in Mycoplasma pneumoniae. Current Drug Targets - Infectious Disorders. Vol. 5 (3), p. 263-271. BEBRONE, C. (2007). Metallo--lactamases (classification, activity, genetic organization, structure, zinc coordination) and their superfamily. Biochem Pharmacol. Vol. 74 (12), p. 1686-1701. DOI: 10.1016/j.bcp.2007.05.021. BEBRONE, C., ANNE, C., DE VRIENDT, K., DEVREESE, B., ROSSOLINI, G. M., VAN BEEUMEN, J., FRERE, J. M., and GALLENI, M. (2005). Dramatic broadening of the substrate profile of the Aeromonas hydrophila CphA metallo--lactamase by site-directed mutagenesis. J Biol Chem. Vol. 280 (31), p. 28195-28202. DOI: 10.1074/jbc.M414052200. BEBRONE, C., ANNE, C., KERFF, F., GARAU, G., DE VRIENDT, K., LANTIN, R., DEVREESE, B., VAN BEEUMEN, J., DIDEBERG, O., FRERE, J. M., et al. (2008). Mutational analysis of the zinc- and substrate-binding sites in the CphA metallo--lactamase from Aeromonas hydrophila. Biochem J. Vol. 414 (1), p. 151-159. DOI: 10.1042/BJ20080375. BEBRONE, C., DELBRUCK, H., KUPPER, M. B., SCHLOMER, P., WILLMANN, C., FRERE, J. M., FISCHER, R., GALLENI, M., and HOFFMANN, K. M. (2009). The structure of the dizinc subclass B2 metallo--lactamase CphA reveals that the second inhibitory zinc ion binds in the histidine site. Antimicrob Agents Chemother. Vol. 53 (10), p. 4464-4471. DOI: 10.1128/AAC.0028809. BELLAIS, S., AUBERT, D., NAAS, T., and NORDMANN, P. (2000). Molecular and Biochemical Heterogeneity of Class B Carbapenem-Hydrolyzing -Lactamases in Chryseobacterium meningosepticum. Antimicrob. Agents Chemother. Vol. 44 (7), p. 1878-1886. DOI: 10.1128/aac.44.7.1878-1886.2000. BENNETT, P. M. (2008). Plasmid encoded antibiotic resistance: acquisition and transfer of antibiotic resistance genes in bacteria. Br J Pharmacol. Vol. 153 (Suppl 1), p. S347-S357. DOI: 10.1038/sj.bjp.0707607. BERTINI, A., GIORDANO, A., VARESI, P., VILLA, L., MANCINI, C., and CARATTOLI, A. (2006). First Report of the Carbapenem-Hydrolyzing Oxacillinase OXA-58 in Acinetobacter baumannii Isolates in Italy. Antimicrob. Agents Chemother. Vol. 50 (6), p. 2268-2269. DOI: 10.1128/aac.00166-06.

152

References
____________________________________________________________________________________________________________________________________________________

BETHEL, C. R., HUJER, A. M., HUJER, K. M., THOMSON, J. M., RUSZCZYCKY, M. W., ANDERSON, V. E., PUSZTAI-CAREY, M., TARACILA, M., HELFAND, M. S., and BONOMO, R. A. (2006). Role of Asp104 in the SHV -lactamase. Antimicrobial Agents and Chemotherapy. Vol. 50 (12), p. 4124-4131. DOI: 10.1128/AAC.00848-06. BETRIU, C., GMEZ, M., LPEZ-FABAL, F., CULEBRAS, E., RODRGUEZ-AVIAL, I., and PICAZO, J. (2010). Activity of doripenem against extended-spectrum -lactamase-producing Enterobacteriaceae and Pseudomonas aeruginosa isolates. European Journal of Clinical Microbiology & Infectious Diseases. Vol. 29 (9), p. 1179-1181. DOI: 10.1007/s10096-0100974-3. BIRNBAUM, J., KAHAN, F. M., KROPP, H., and MACDONALD, J. S. (1985). Carbapenems, a new class of beta-lactam antibiotics. Discovery and development of imipenem/cilastatin. Am J Med. Vol. 78 (6A), p. 3-21. BOLLET, C., GAINNIER, M., SAINTY, J. M., ORHESSER, P., and DE MICCO, P. (1991). Serratia fonticola isolated from a leg abscess. J Clin Microbiol. Vol. 29 (4), p. 834-835. BONFIGLIO, G., RUSSO, G., and NICOLETTI, G. (2002). Recent developments in carbapenems. Expert Opin Investig Drugs. Vol. 11 (4), p. 529-544. DOI: 10.1517/13543784.11.4.529. BONNET, R. (2004). Growing group of extended-spectrum -lactamases: the CTX-M enzymes. Antimicrob Agents Chemother. Vol. 48 (1), p. 1-14. DOI: 10.1128/AAC.48.1.1-14.2004. BONOMO, R. A., and SZABO, D. (2006). Mechanisms of Multidrug Resistance in Acinetobacter Species and Pseudomonas aeruginosa. Clinical Infectious Diseases. Vol. 43 (Supplement 2), p. S49-S56. DOI: 10.1086/504477. BOSCHI, L., MERCURI, P. S., RICCIO, M. L., AMICOSANTE, G., GALLENI, M., FRERE, J.-M., and ROSSOLINI, G. M. (2000). The Legionella (Fluoribacter) gormanii Metallo--Lactamase: a New Member of the Highly Divergent Lineage of Molecular-Subclass B3 -Lactamases. Antimicrob. Agents Chemother. Vol. 44 (6), p. 1538-1543. DOI: 10.1128/aac.44.6.15381543.2000. BROWN, A., BUTTERWORTH, D., COLE, M., HANSCOMB, G., HOOD, J., READING, C., and ROLINSON, G. (1976). Naturally-occurring -lactamase inhibitors with antibacterial activity. The Journal of antibiotics. Vol. 29 (6), p. 668-669. BUSH, K. (1989). Characterization of -lactamases. Antimicrob Agents Chemother. Vol. 33 (3), p. 259-263. BUSH, K. (2002). The impact of -lactamases on the development of novel antimicrobial agents. Curr Opin Investig Drugs. Vol. 3 (9), p. 1284-1290.

153

References
____________________________________________________________________________________________________________________________________________________

BUSH, K. (2010). Alarming -lactamase-mediated resistance in multidrug-resistant Enterobacteriaceae. Current Opinion in Microbiology. Vol. 13 (5), p. 558-564. DOI: 10.1016/j.mib.2010.09.006. BUSH, K., and JACOBY, G. A. (2010). Updated functional classification of -lactamases. Antimicrob Agents Chemother. Vol. 54 (3), p. 969-976. DOI: 10.1128/AAC.01009-09. BUSH, K., JACOBY, G. A., and MEDEIROS, A. A. (1995). A functional classification scheme for lactamases and its correlation with molecular structure. Antimicrob Agents Chemother. Vol. 39 (6), p. 1211-1233. BUYNAK, J. D. (2006). Understanding the longevity of the -lactam antibiotics and of antibiotic/lactamase inhibitor combinations. Biochemical Pharmacology. Vol. 71 (7), p. 930-940. DOI: 10.1016/j.bcp.2005.11.012.

CANTON, R., and COQUE, T. M. (2006). The CTX-M -lactamase pandemic. Curr Opin Microbiol.
Vol. 9 (5), p. 466-475. DOI: 10.1016/j.mib.2006.08.011. CANTU, C., and PALZKILL, T. (1998). The Role of Residue 238 of TEM-1 -Lactamase in the Hydrolysis of Extended-spectrum Antibiotics. Journal of Biological Chemistry. Vol. 273 (41), p. 26603-26609. DOI: 10.1074/jbc.273.41.26603. CARENBAUER, A., GARRITY, J., PERIYANNAN, G., YATES, R., and CROWDER, M. (2002). Probing substrate binding to Metallo--Lactamase L1 from Stenotrophomonas maltophilia by using site-directed mutagenesis. BMC Biochemistry. Vol. 3 (1), p. 4. DOI: 10.1186/1471-2091-3-4. CARFI, A., PARES, S., DUEE, E., GALLENI, M., DUEZ, C., FRERE, J. M., and DIDEBERG, O. (1995). The 3-D structure of a zinc metallo--lactamase from Bacillus cereus reveals a new type of protein fold. EMBO J. Vol. 14 (20), p. 4914-4921. CARRER, A., POIREL, L., YILMAZ, M., AKAN, O. A., FERIHA, C., CUZON, G., MATAR, G., HONDERLICK, P., and NORDMANN, P. (2010). Spread of OXA-48-Encoding Plasmid in Turkey and Beyond. Antimicrob. Agents Chemother. Vol. 54 (3), p. 1369-1373. DOI: 10.1128/aac.01312-09. CARTWRIGHT, S. J., and COULSON, A. F. W. (1979). A semi-synthetic penicillinase inactivator. Nature. Vol. 278 (5702), p. 360-361. DOI: 10.1038/278360a0. CASTANHEIRA, M., JONES, R. N., and LIVERMORE, D. M. (2009). Antimicrobial activities of doripenem and other carbapenems against Pseudomonas aeruginosa, other nonfermentative bacilli, and Aeromonas spp. Diagnostic Microbiology and Infectious Disease. Vol. 63 (4), p. 426-433. DOI: 10.1016/j.diagmicrobio.2009.01.026.

154

References
____________________________________________________________________________________________________________________________________________________

CASTANHEIRA, M., TOLEMAN, M. A., JONES, R. N., SCHMIDT, F. J., and WALSH, T. R. (2004). Molecular Characterization of a -Lactamase Gene, blaGIM-1, Encoding a New Subclass of Metallo--Lactamase. Antimicrob. Agents Chemother. Vol. 48 (12), p. 4654-4661. DOI: 10.1128/aac.48.12.4654-4661.2004. CATTOIR, V., POIREL, L., MAZEL, D., SOUSSY, C.-J., and NORDMANN, P. (2007). Vibrio splendidus as the Source of Plasmid-Mediated QnrS-Like Quinolone Resistance Determinants. Antimicrob. Agents Chemother. Vol. 51 (7), p. 2650-2651. DOI: 10.1128/aac.00070-07. CHAIN, E., FLOREY, H. W., GARDNER, A. D., HEATLEY, N. G., JENNINGS, M. A., ORR-EWING, J., and SANDERS, A. G. (1940). PENICILLIN AS A CHEMOTHERAPEUTIC AGENT. The Lancet. Vol. 236 (6104), p. 226-228. DOI: 10.1016/S0140-6736(01)08728-1. CHEN, C. C., SMITH, T. J., KAPADIA, G., WASCH, S., ZAWADZKE, L. E., COULSON, A., and HERZBERG, O. (1996). Structure and Kinetics of the -Lactamase Mutants S70A and K73H from Staphylococcus aureus PC1. Biochemistry. Vol. 35 (38), p. 12251-12258. DOI: 10.1021/bi961153v. CHEN, C. C. H., and HERZBERG, O. (2001). Structures of the AcylEnzyme Complexes of the Staphylococcus aureus -Lactamase Mutant Glu166Asp:Asn170Gln with Benzylpenicillin and Cephaloridine. Biochemistry. Vol. 40 (8), p. 2351-2358. DOI: 10.1021/bi002277h. CHEN, V. B., ARENDALL, W. B., III, HEADD, J. J., KEEDY, D. A., IMMORMINO, R. M., KAPRAL, G. J., MURRAY, L. W., RICHARDSON, J. S., and RICHARDSON, D. C. (2010). MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallographica Section D. Vol. 66 (1), p. 12-21. DOI: 10.1107/S0907444909042073. CHEN, Y., BONNET, R., and SHOICHET, B. K. (2007). The Acylation Mechanism of CTX-M Lactamase at 0.88 Resolution. Journal of the American Chemical Society. Vol. 129 (17), p. 5378-5380. DOI: 10.1021/ja0712064. CHEN, Y., DELMAS, J., SIROT, J., SHOICHET, B., and BONNET, R. (2005). Atomic Resolution Structures of CTX-M -Lactamases: Extended Spectrum Activities from Increased Mobility and Decreased Stability. Journal of Molecular Biology. Vol. 348 (2), p. 349-362. DOI: 10.1016/j.jmb.2005.02.010. CHEN, Y., MINASOV, G., ROTH, T. A., PRATI, F., and SHOICHET, B. K. (2006). The Deacylation Mechanism of AmpC -Lactamase at Ultrahigh Resolution. Journal of the American Chemical Society. Vol. 128 (9), p. 2970-2976. DOI: 10.1021/ja056806m. CHIA, J. H., SU, L. H., LEE, M. H., KUO, A. J., SHIH, N. Y., SIU, L. K., and WU, T. L. (2010). Development of High-Level Carbapenem Resistance in Klebsiella pneumoniae Among

155

References
____________________________________________________________________________________________________________________________________________________

Patients with Prolonged Hospitalization and Carbapenem Exposure. Microb Drug Resist. DOI: 10.1089/mdr.2009.0048. CLARDY, J., FISCHBACH, M. A., and WALSH, C. T. (2006). New antibiotics from bacterial natural products. Nat Biotech. Vol. 24 (12), p. 1541-1550. DOI: 10.1038/nbt1266. COLLABORATIVE COMPUTATIONAL PROJECT, N. (1994). The CCP4 suite: programs for protein crystallography. Acta Crystallographica Section D. Vol. 50 (5), p. 760-763. DOI: doi:10.1107/S0907444994003112. COLLIGNON, P. (2004). Antibiotic growth promoters. J. Antimicrob. Chemother. Vol. 54 (1), p. 272. DOI: 10.1093/jac/dkh266. CONCHA, N. O., JANSON, C. A., ROWLING, P., PEARSON, S., CHEEVER, C. A., CLARKE, B. P., LEWIS, C., GALLENI, M., FRERE, J. M., PAYNE, D. J., et al. (2000). Crystal structure of the IMP-1 metallo -lactamase from Pseudomonas aeruginosa and its complex with a mercaptocarboxylate inhibitor: binding determinants of a potent, broad-spectrum inhibitor. Biochemistry. Vol. 39 (15), p. 4288-4298. DOI: bi992569m CONCHA, N. O., RASMUSSEN, B. A., BUSH, K., and HERZBERG, O. (1996). Crystal structure of the wide-spectrum binuclear zinc -lactamase from Bacteroides fragilis. Structure. Vol. 4 (7), p. 823-836. DOI: 10.1016/S0969-2126(96)00089-5 COSTELLO, A. L., SHARMA, N. P., YANG, K. W., CROWDER, M. W., and TIERNEY, D. L. (2006). X-ray absorption spectroscopy of the zinc-binding sites in the class B2 metallo--lactamase ImiS from Aeromonas veronii bv. sobria. Biochemistry. Vol. 45 (45), p. 13650-13658. DOI: 10.1021/bi061547e. CRAWFORD, P. A., SHARMA, N., CHANDRASEKAR, S., SIGDEL, T., WALSH, T. R., SPENCER, J., and CROWDER, M. W. (2004). Over-expression, purification, and characterization of metallo-lactamase ImiS from Aeromonas veronii bv. sobria. Protein Expr Purif. Vol. 36 (2), p. 272279. DOI: 10.1016/j.pep.2004.04.017 CRAWFORD, P. A., YANG, K. W., SHARMA, N., BENNETT, B., and CROWDER, M. W. (2005). Spectroscopic studies on cobalt(II)-substituted metallo--lactamase ImiS from Aeromonas veronii bv. sobria. Biochemistry. Vol. 44 (13), p. 5168-5176. DOI: 10.1021/bi047463s. CROWDER, M. W., SPENCER, J., and VILA, A. J. (2006). Metallo--lactamases: Novel Weaponry for Antibiotic Resistance in Bacteria. Accounts of Chemical Research. Vol. 39 (10), p. 721-728. DOI: 10.1021/ar0400241.

156

References
____________________________________________________________________________________________________________________________________________________

CROWDER, M. W., WALSH, T. R., BANOVIC, L., PETTIT, M., and SPENCER, J. (1998). Overexpression, Purification, and Characterization of the Cloned Metallo--Lactamase L1 from Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. Vol. 42 (4), p. 921-926.

D'COSTA, V., MCGRANN, K., HUGHES, D., and WRIGHT, G. (2006). Sampling the antibiotic
resistome. Science. Vol. 311 (5759), p. 374-377. DOI: 10.1126/science.1120800 DAL PERARO, M., VILA, A. J., CARLONI, P., and KLEIN, M. L. (2007). Role of Zinc Content on the Catalytic Efficiency of B1 Metallo -Lactamases. Journal of the American Chemical Society. Vol. 129 (10), p. 2808-2816. DOI: 10.1021/ja0657556. DALBADIE-MCFARLAND, G., NEITZEL, J. J., and RICHARDS, J. H. (1986). Active-site mutants of lactamase: use of an inactive double mutant to study requirements for catalysis. Biochemistry. Vol. 25 (2), p. 332-338. DOI: 10.1021/bi00350a008. DANTAS, G., SOMMER, M. O. A., OLUWASEGUN, R. D., and CHURCH, G. M. (2008). Bacteria Subsisting on Antibiotics. Science. Vol. 320 (5872), p. 100-103. DOI: 10.1126/science.1155157. DAVIES, J. (1994). Inactivation of antibiotics and the dissemination of resistance genes. Science. Vol. 264 (5157), p. 375-382. DOI: 10.1126/science.8153624. DE KRAKER, M. E. A., WOLKEWITZ, M., DAVEY, P. G., KOLLER, W., BERGER, J., NAGLER, J., ICKET, C., KALENIC, S., HORVATIC, J., SEIFERT, H., et al. (2011). Burden of antimicrobial resistance in European hospitals: excess mortality and length of hospital stay associated with bloodstream infections due to Escherichia coli resistant to third-generation cephalosporins. Journal of Antimicrobial Chemotherapy. Vol. 66 (2), p. 398-407. DOI: 10.1093/jac/dkq412. DE LENCASTRE, H., DE JONGE, B. L., MATTHEWS, P. R., and TOMASZ, A. (1994). Molecular aspects of methicillin resistance in Staphylococcus aureus. J Antimicrob Chemother. Vol. 33 (1), p. 724. DOI: 10.1093/jac/33.1.7. DELAIRE, M., LENFANT, F., LABIA, R., and MASSON, J.-M. (1991). Site-directed mutagenesis on TEM-1 -lactamase: role of Glul66 in catalysis and substrate binding. Protein Engineering. Vol. 4 (7), p. 805-810. DOI: 10.1093/protein/4.7.805. DELANO, W. (2008). The PyMOL molecular graphics system. DeLano Scientific LLC, Palo Alto, CA, USA. DELEO, F. R., OTTO, M., KREISWIRTH, B. N., and CHAMBERS, H. F. (2010). Community-associated meticillin-resistant Staphylococcus aureus. The Lancet. Vol. 375 (9725), p. 1557-1568. DOI: 10.1016/s0140-6736(09)61999-1.

157

References
____________________________________________________________________________________________________________________________________________________

DELMAS, J., CHEN, Y., PRATI, F., ROBIN, F., SHOICHET, B. K., and BONNET, R. (2008). Structure and Dynamics of CTX-M Enzymes Reveal Insights into Substrate Accommodation by Extendedspectrum -Lactamases. Journal of Molecular Biology. Vol. 375 (1), p. 192-201. DOI: 10.1016/j.jmb.2007.10.026. DEMAIN, A. L., and ELANDER, R. P. (1999). The -lactam antibiotics: past, present, and future. Antonie Van Leeuwenhoek. Vol. 75 (1), p. 5-19. DOI: 10.1023/a:1001738823146. DIDEBERG, O., CHARLIER, P., WERY, J. P., DEHOTTAY, P., DUSART, J., ERPICUM, T., FRERE, J. M., and GHUYSEN, J. M. (1987). The crystal structure of the -lactamase of Streptomyces albus G at 0.3 nm resolution. Biochem J. Vol. 245 (3), p. 911-913. DOCQUIER, J.-D., BENVENUTI, M., CALDERONE, V., STOCZKO, M., MENCIASSI, N., ROSSOLINI, G. M., and MANGANI, S. (2010). High-Resolution Crystal Structure of the Subclass B3 Metallo-Lactamase BJP-1: Rational Basis for Substrate Specificity and Interaction with Sulfonamides. Antimicrob. Agents Chemother. Vol. 54 (10), p. 4343-4351. DOI: 10.1128/aac.00409-10. DOCQUIER, J.-D., PANTANELLA, F., GIULIANI, F., THALLER, M. C., AMICOSANTE, G., GALLENI, M., FRERE, J.-M., BUSH, K., and ROSSOLINI, G. M. (2002). CAU-1, a Subclass B3 Metallo-Lactamase of Low Substrate Affinity Encoded by an Ortholog Present in the Caulobacter crescentus Chromosome. Antimicrob. Agents Chemother. Vol. 46 (6), p. 1823-1830. DOI: 10.1128/aac.46.6.1823-1830.2002. DONADIO, S., MAFFIOLI, S., MONCIARDINI, P., SOSIO, M., and JABES, D. (2010). Sources of novel antibioticsaside the common roads. Applied Microbiology and Biotechnology. Vol. 88 (6), p. 1261-1267. DOI: 10.1007/s00253-010-2877-8. DOUCET, N., DE WALS, P. Y., and PELLETIER, J. N. (2004). Site-saturation mutagenesis of Tyr-105 reveals its importance in substrate stabilization and discrimination in TEM-1 -lactamase. Journal of Biological Chemistry. Vol. 279 (44), p. 46295-46303. DOI: 10.1074/jbc.M407606200. DRAWZ, S. M., and BONOMO, R. A. (2010). Three Decades of -Lactamase Inhibitors. Clin. Microbiol. Rev. Vol. 23 (1), p. 160-201. DOI: 10.1128/cmr.00037-09. DUPONT, M., PAGS, J.-M., LAFITTE, D., SIROY, A., and BOLLET, C. (2005). Identification of an OprD Homologue in Acinetobacter baumannii. Journal of Proteome Research. Vol. 4 (6), p. 23862390. DOI: 10.1021/pr050143q.

158

References
____________________________________________________________________________________________________________________________________________________

EASTON, C. J., and KNOWLES, J. R. (1982). Inhibition of the RTEM lactamase from Escherichia
coli. Interaction of the enzyme with derivatives of olivanic acid. Biochemistry. Vol. 21 (12), p. 2857-2862. DOI: 10.1021/bi00541a008. EMSLEY, P., LOHKAMP, B., SCOTT, W. G., and COWTAN, K. (2010). Features and development of Coot. Acta Crystallographica Section D. Vol. 66 (4), p. 486-501. DOI: 10.1107/S0907444910007493. ENGLISH, A. R., RETSEMA, J. A., GIRARD, A. E., LYNCH, J. E., and BARTH, W. E. (1978). CP-45,899, a Beta-Lactamase Inhibitor That Extends the Antibacterial Spectrum of -Lactams: Initial Bacteriological Characterization. Antimicrob. Agents Chemother. Vol. 14 (3), p. 414-419. DOI: 10.1128/aac. ESCOBAR, W. A., TAN, A. K., and FINK, A. L. (1991). Site-directed mutagenesis of -lactamase leading to accumulation of a catalytic intermediate. Biochemistry. Vol. 30 (44), p. 1078310787. DOI: 10.1021/bi00108a025. EVANS, P. (2006). Scaling and assessment of data quality. Acta Crystallographica Section D. Vol. 62 (1), p. 72-82. DOI: 10.1107/S0907444905036693.

FABIANE, S. M., SOHI, M. K., WAN, T., PAYNE, D. J., BATESON, J. H., MITCHELL, T., and SUTTON,

B. J. (1998). Crystal structure of the zinc-dependent -lactamase from Bacillus cereus at 1.9 A resolution: binuclear active site with features of a mononuclear enzyme. Biochemistry. Vol. 37 (36), p. 12404-12411. DOI: 10.1021/bi980506i.

FARMER, J. J., DAVIS, B. R., HICKMAN-BRENNER, F. W., MCWHORTER, A., HUNTLEY-CARTER, G. P., ASBURY, M. A., RIDDLE, C., WATHEN-GRADY, H. G., ELIAS, C., and FANNING, G. R. (1985). Biochemical identification of new species and biogroups of Enterobacteriaceae isolated from clinical specimens. J Clin Microbiol. Vol. 21 (1), p. 46-76. FELICI, A., and AMICOSANTE, G. (1995). Kinetic analysis of extension of substrate specificity with Xanthomonas maltophilia, Aeromonas hydrophila, and Bacillus cereus metallo-lactamases. Antimicrob Agents Chemother. Vol. 39 (1), p. 192-199. FELICI, A., AMICOSANTE, G., ORATORE, A., STROM, R., LEDENT, P., JORIS, B., FANUEL, L., and FRERE, J. M. (1993). An overview of the kinetic parameters of class B -lactamases. Biochem J. Vol. 291 (Pt 1), p. 151-155. FISHER, J. F., MEROUEH, S. O., and MOBASHERY, S. (2005). Bacterial resistance to -lactam antibiotics: compelling opportunism, compelling opportunity. Chem Rev. Vol. 105 (2), p. 395-424. DOI: 10.1021/cr030102i.

159

References
____________________________________________________________________________________________________________________________________________________

FISHER, J. F., and MOBASHERY, S. (2009). Three decades of the class A -lactamase acyl-enzyme. Curr Protein Pept Sci. Vol. 10 (5), p. 401-407. FLEMING, A. (1929). On the antimicrobial action of cultures of a penicillium with special reference to their use in the isolation of B. influenzae. British Journal of Experimental Pathology. Vol. 10, p. 226-236. FONSECA, F., SARMENTO, A. C., HENRIQUES, I., SAMYN, B., VAN BEEUMEN, J., DOMINGUES, P., DOMINGUES, M. R., SAAVEDRA, M. J., and CORREIA, A. (2007). Biochemical Characterization of SFC-1, a Class A Carbapenem-Hydrolyzing -Lactamase. Antimicrob. Agents Chemother. Vol. 51 (12), p. 4512-4514. DOI: 10.1128/aac.00491-07. FRASE, H., SMITH, C. A., TOTH, M., CHAMPION, M. M., MOBASHERY, S., and VAKULENKO, S. B. (2011). Identification of products of inhibition of GES-2 -lactamase by tazobactam by x-ray crystallography and spectrometry. Journal of Biological Chemistry. DOI: 10.1074/jbc.M110.208744. FROST, L. S., LEPLAE, R., SUMMERS, A. O., and TOUSSAINT, A. (2005). Mobile genetic elements: the agents of open source evolution. Nat Rev Micro. Vol. 3 (9), p. 722-732. FUDA, C. C., FISHER, J. F., and MOBASHERY, S. (2005). -lactam resistance in Staphylococcus aureus: the adaptive resistance of a plastic genome. Cell Mol Life Sci. Vol. 62 (22), p. 26172633. DOI: 10.1007/s00018-005-5148-6.

GALLENI, M., LAMOTTE-BRASSEUR, J., ROSSOLINI, G. M., SPENCER, J., DIDEBERG, O., and FRERE,
J.-M. (2001). Standard Numbering Scheme for Class B -Lactamases. Antimicrob. Agents Chemother. Vol. 45 (3), p. 660-663. DOI: 10.1128/aac.45.3.660-663.2001. GARAU, G., BEBRONE, C., ANNE, C., GALLENI, M., FRERE, J. M., and DIDEBERG, O. (2005). A metallo--lactamase enzyme in action: crystal structures of the monozinc carbapenemase CphA and its complex with biapenem. Journal of Molecular Biology. Vol. 345 (4), p. 785-795. DOI: 10.1016/j.jmb.2004.10.070. GARAU, G., GARCIA-SAEZ, I., BEBRONE, C., ANNE, C., MERCURI, P., GALLENI, M., FRERE, J. M., and DIDEBERG, O. (2004). Update of the standard numbering scheme for class B -lactamases. Antimicrob Agents Chemother. Vol. 48 (7), p. 2347-2349. DOI: 10.1128/AAC.48.7.23472349.2004. GARCIA-FERNANDEZ, A., MIRIAGOU, V., PAPAGIANNITSIS, C. C., GIORDANO, A., VENDITTI, M., MANCINI, C., and CARATTOLI, A. (2010). An Ertapenem-Resistant Extended-Spectrum-Lactamase-Producing Klebsiella pneumoniae Clone Carries a Novel OmpK36 Porin Variant. Antimicrob. Agents Chemother. Vol. 54 (10), p. 4178-4184. DOI: 10.1128/aac.01301-09.

160

References
____________________________________________________________________________________________________________________________________________________

GARCIA-SAEZ, I., DOCQUIER, J. D., ROSSOLINI, G. M., and DIDEBERG, O. (2008). The threedimensional structure of VIM-2, a Zn--lactamase from Pseudomonas aeruginosa in its reduced and oxidised form. Journal of Molecular Biology. Vol. 375 (3), p. 604-611. DOI: 10.1016/j.jmb.2007.11.012. GARCA-SEZ, I., HOPKINS, J., PAPAMICAEL, C., FRANCESCHINI, N., AMICOSANTE, G., ROSSOLINI, G. M., GALLENI, M., FRRE, J.-M., and DIDEBERG, O. (2003). The 1.5- Structure of Chryseobacterium meningosepticum Zinc -Lactamase in Complex with the Inhibitor, DCaptopril. Journal of Biological Chemistry. Vol. 278 (26), p. 23868-23873. DOI: 10.1074/jbc.M301062200. GARCIA-SAEZ, I., MERCURI, P. S., PAPAMICAEL, C., KAHN, R., FRRE, J. M., GALLENI, M., ROSSOLINI, G. M., and DIDEBERG, O. (2003). Three-dimensional Structure of FEZ-1, a Monomeric Subclass B3 Metallo--lactamase from Fluoribacter gormanii, in Native Form and in Complex with d-Captopril. Journal of Molecular Biology. Vol. 325 (4), p. 651-660. DOI: 10.1016/S0022-2836(02)01271-8. GARRITY, J. D., BENNETT, B., and CROWDER, M. W. (2004). Direct Evidence That the Reaction Intermediate of Metallo--lactamase L1 Is Metal Bound. Biochemistry. Vol. 44 (3), p. 10781087. DOI: 10.1021/bi048385b. GAVINI, F., FERRAGUT, C., IZARD, D., TRINEL, P. A., LECLERC , H., LEFEBVRE, B., and MOSSEL, D. A. A. (1979). Serratia fonticola, a New Species from Water. Int J Syst Bacteriol. Vol. 29 (2), p. 92-101. DOI: 10.1099/00207713-29-2-92. GEORGOPAPADAKOU, N. H. (1993). Penicillin-binding proteins and bacterial resistance to lactams. Antimicrob. Agents Chemother. Vol. 37 (10), p. 2045-2053. DOI: 10.1128/aac. GIANI, T., D'ANDREA, M. M., PECILE, P., BORGIANNI, L., NICOLETTI, P., TONELLI, F., BARTOLONI, A., and ROSSOLINI, G. M. (2009). Emergence in Italy of Klebsiella pneumoniae Sequence Type 258 Producing KPC-3 Carbapenemase. J. Clin. Microbiol. Vol. 47 (11), p. 3793-3794. DOI: 10.1128/jcm.01773-09. GILL, S. C., and VON HIPPEL, P. H. (1989). Calculation of protein extinction coefficients from amino acid sequence data. Analytical Biochemistry. Vol. 182 (2), p. 319-326. DOI: 10.1016/00032697(89)90602-7 GIRLICH, D., NAAS, T., and NORDMANN, P. (2004). Biochemical Characterization of the Naturally Occurring Oxacillinase OXA-50 of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. Vol. 48 (6), p. 2043-2048. DOI: 10.1128/aac.48.6.2043-2048.2004. GIRLICH, D., POIREL, L., and NORDMANN, P. (2010). Novel Ambler Class A CarbapenemHydrolyzing -Lactamase from a Pseudomonas fluorescens Isolate from the Seine River,

161

References
____________________________________________________________________________________________________________________________________________________

Paris, France. Antimicrob. Agents Chemother. Vol. 54 (1), p. 328-332. DOI: 10.1128/aac.00961-09. GOLDSTEIN, E. J. C., and CITRON, D. M. (2009). Activity of a novel carbapenem, doripenem, against anaerobic pathogens. Diagnostic Microbiology and Infectious Disease. Vol. 63 (4), p. 447-454. DOI: 10.1016/j.diagmicrobio.2009.01.022 GOLEMI, D., MAVEYRAUD, L., VAKULENKO, S., SAMAMA, J.-P., and MOBASHERY, S. (2001). Critical involvement of a carbamylated lysine in catalytic function of class D -lactamases. Proceedings of the National Academy of Sciences of the United States of America. Vol. 98 (25), p. 14280-14285. DOI: 10.1073/pnas.241442898. GORRET, J., CHEVALIER, J., GASCHET, A., FRAISSE, B., VIOLAS, P., CHAPUIS, M., and JOLIVETGOUGEON, A. (2009). Childhood delayed septic arthritis of the knee caused by Serratia fonticola. Knee. Vol. 16 (6), p. 512-514. DOI: 10.1016/j.knee.2009.02.008 GREBE, T., and HAKENBECK, R. (1996). Penicillin-binding proteins 2b and 2x of Streptococcus pneumoniae are primary resistance determinants for different classes of -lactam antibiotics. Antimicrob Agents Chemother. Vol. 40 (4), p. 829-834. GRUNE, T. (2008). mtz2sca and mtz2hkl: facilitated transition from CCP4 to the SHELX program suite. Journal of Applied Crystallography. Vol. 41 (1), p. 217-218. DOI: doi:10.1107/S0021889807050054. GUILLAUME, G., VANHOVE, M., LAMOTTE-BRASSEUR, J., LEDENT, P., JAMIN, M., JORIS, B., and FRERE, J. M. (1997). Site-directed mutagenesis of glutamate 166 in two -lactamases. Kinetic and molecular modeling studies. J Biol Chem. Vol. 272 (9), p. 5438-5444. DOI: 10.1074/jbc.272.9.5438. GLMEZ, D., WOODFORD, N., PALEPOU, M.-F. I., MUSHTAQ, S., METAN, G., YAKUPOGULLARI, Y., KOCAGOZ, S., UZUN, O., HASCELIK, G., and LIVERMORE, D. M. (2008). Carbapenem-resistant Escherichia coli and Klebsiella pneumoniae isolates from Turkey with OXA-48-like carbapenemases and outer membrane protein loss. International Journal of Antimicrobial Agents. Vol. 31 (6), p. 523-526. DOI: 10.1016/j.ijantimicag.2008.01.017

HAKENBECK, R., BALMELLE, N., WEBER, B., GARDES, C., KECK, W., and DE SAIZIEU, A. (2001).
Mosaic Genes and Mosaic Chromosomes: Intra- and Interspecies Genomic Variation of Streptococcus pneumoniae. Infect. Immun. Vol. 69 (4), p. 2477-2486. DOI: 10.1128/iai.69.4.2477-2486.2001.

HALL, R. M., and COLLIS, C. M. (1998). Antibiotic resistance in gram-negative bacteria: the role of gene cassettes and integrons. Drug Resistance Updates. Vol. 1 (2), p. 109-119. DOI: 10.1016/S1368-7646(98)80026-5.

162

References
____________________________________________________________________________________________________________________________________________________

HARTMAN, B. J., and TOMASZ, A. (1984). Low-affinity penicillin-binding protein associated with lactam resistance in Staphylococcus aureus. J Bacteriol. Vol. 158 (2), p. 513-516. HAWKEY, P. M., and JONES, A. M. (2009). The changing epidemiology of resistance. J Antimicrob Chemother. Vol. 64 (Suppl 1), p. i3-i10. DOI: 10.1093/jac/dkp256. HENQUELL, C., CHANAL, C., SIROT, D., LABIA, R., and SIROT, J. (1995). Molecular characterization of nine different types of mutants among 107 inhibitor-resistant TEM -lactamases from clinical isolates of Escherichia coli. Antimicrob. Agents Chemother. Vol. 39 (2), p. 427-430. HENRIQUES, I., MOURA, A., ALVES, A., SAAVEDRA, M. J., and CORREIA, A. (2004). Molecular Characterization of a Carbapenem-Hydrolyzing Class A -Lactamase, SFC-1, from Serratia fonticola UTAD54. Antimicrob. Agents Chemother. Vol. 48 (6), p. 2321-2324. DOI: 10.1128/aac.48.6.2321-2324.2004. HERITIER, C., POIREL, L., AUBERT, D., and NORDMANN, P. (2003). Genetic and Functional Analysis of the Chromosome-Encoded Carbapenem-Hydrolyzing Oxacillinase OXA-40 of Acinetobacter baumannii. Antimicrob. Agents Chemother. Vol. 47 (1), p. 268-273. DOI: 10.1128/aac.47.1.268-273.2003. HERITIER, C., POIREL, L., LAMBERT, T., and NORDMANN, P. (2005). Contribution of Acquired Carbapenem-Hydrolyzing Oxacillinases to Carbapenem Resistance in Acinetobacter baumannii. Antimicrob. Agents Chemother. Vol. 49 (8), p. 3198-3202. DOI: 10.1128/aac.49.8.3198-3202.2005. HERMANN, J. C., PRADON, J., HARVEY, J. N., and MULHOLLAND, A. J. (2009). High Level QM/MM Modeling of the Formation of the Tetrahedral Intermediate in the Acylation of Wild Type and K73A Mutant TEM-1 Class A -Lactamase. The Journal of Physical Chemistry A. Vol. 113 (43), p. 11984-11994. DOI: 10.1021/jp9037254. HERZBERG, O., and MOULT, J. (1987). Bacterial resistance to -lactam antibiotics: crystal structure of -lactamase from Staphylococcus aureus PC1 at 2.5 A resolution. Science. Vol. 236 (4802), p. 694-701. DOI: 10.1126/science.3107125 HODGKIN, D. C. (1949). The X-ray analysis of the structure of penicillin. Adv Sci. Vol. 6 (22), p. 8589. HU, Z., and ZHAO, W.-H. (2009). Identification of plasmid- and integron-borne blaIMP-1 and blaIMP-10 in clinical isolates of Serratia marcescens. J Med Microbiol. Vol. 58 (2), p. 217221. DOI: 10.1099/jmm.0.006874-0.

163

References
____________________________________________________________________________________________________________________________________________________

HULETSKY, A., KNOX, J. R., and LEVESQUE, R. C. (1993). Role of Ser-238 and Lys-240 in the hydrolysis of third-generation cephalosporins by SHV-type -lactamases probed by sitedirected mutagenesis and three-dimensional modeling. Journal of Biological Chemistry. Vol. 268 (5), p. 3690-3697. HUMENIUK, C., ARLET, G., GAUTIER, V., GRIMONT, P., LABIA, R., and PHILIPPON, A. (2002). Lactamases of Kluyvera ascorbata, Probable Progenitors of Some Plasmid-Encoded CTX-M Types. Antimicrobial Agents and Chemotherapy. Vol. 46 (9), p. 3045. DOI: 10.1128/AAC.46.9.3045-3049.2002. HUOVINEN, P., HUOVINEN, S., and JACOBY, G. A. (1988). Sequence of PSE-2 -lactamase. Antimicrob Agents Chemother. Vol. 32 (1), p. 134-136. HUSSAIN, M., CARLINO, A., MADONNA, M. J., and LAMPEN, J. O. (1985). Cloning and sequencing of the metallothioprotein -lactamase II gene of Bacillus cereus 569/H in Escherichia coli. J. Bacteriol. Vol. 164 (1), p. 223-229.

IBUKA, A., TAGUCHI, A., ISHIGURO, M., FUSHINOBU, S., ISHII, Y., KAMITORI, S., OKUYAMA, K.,

YAMAGUCHI, K., KONNO, M., and MATSUZAWA, H. (1999). Crystal structure of the E166A mutant of extended-spectrum -lactamase toho-1 at 1.8 resolution. Journal of Molecular Biology. Vol. 285 (5), p. 2079-2087. DOI: 10.1006/jmbi.1998.2432.

JACOBY, G. A., and MUNOZ-PRICE, L. S. (2005). The new -lactamases. N Engl J Med. Vol. 352 (4),
p. 380-391. DOI: 10.1056/NEJMra041359. JANCARIK, J., and KIM, S.-H. (1991). Sparse matrix sampling: a screening method for crystallization of proteins. Journal of Applied Crystallography. Vol. 24 (4), p. 409-411. DOI: 10.1107/S0021889891004430. JAURIN, B., and GRUNDSTROM, T. (1981). ampC cephalosporinase of Escherichia coli K-12 has a different evolutionary origin from that of -lactamases of the penicillinase type. Proc Natl Acad Sci U S A. Vol. 78 (8), p. 4897-4901. JEAN-MARIE, G. (1997). Penicillin-binding proteins. Wall peptidoglycan assembly and resistance to penicillin: facts, doubts and hopes. International Journal of Antimicrobial Agents. Vol. 8 (1), p. 45-60. DOI: doi:10.1016/S0924-8579(96)00358-5 JELSCH, C., LENFANT, F., MASSON, J. M., and SAMAMA, J. P. (1992). -lactamase TEM1 of E. coli Crystal structure determination at 2.5 resolution. FEBS Letters. Vol. 299 (2), p. 135-142.

164

References
____________________________________________________________________________________________________________________________________________________

JELSCH, C., MOUREY, L., MASSON, J. M., and SAMAMA, J. P. (1993). Crystal structure of Escherichia coli TEM1 -lactamase at 1.8 resolution. Proteins: Structure, Function, and Bioinformatics. Vol. 16 (4), p. 364-383. DOI: 10.1002/prot.340160406. JEVONS, M. P. (1961). Celbenin - resistant Staphylococci. British Medical Journal. Vol. 1 (521), p. 124-125.

KALP, M., and CAREY, P. R. (2008). Carbapenems and SHV-1 -Lactamase Form Different AcylEnzyme Populations in Crystals and Solution. Biochemistry. Vol. 47 (45), p. 11830-11837. DOI: 10.1021/bi800833u. KE, W., BETHEL, C. R., THOMSON, J. M., BONOMO, R. A., and VAN DEN AKKER, F. (2007). Crystal Structure of KPC-2: Insights into Carbapenemase Activity in Class A -Lactamases. Biochemistry. Vol. 46 (19), p. 5732-5740. DOI: 10.1021/bi700300u. KIM, J. Y., JUNG, H. I., AN, Y. J., LEE, J. H., KIM, S. J., JEONG, S. H., LEE, K. J., SUH, P.-G., LEE, H.-S., LEE, S. H., et al. (2006). Structural basis for the extended substrate spectrum of CMY-10, a plasmid-encoded class C -lactamase. Molecular Microbiology. Vol. 60 (4), p. 907-916. DOI: 10.1111/j.1365-2958.2006.05146.x. KNOX, J. R. (1995). Extended-spectrum and inhibitor-resistant TEM-type -lactamases: mutations, specificity, and three-dimensional structure. Antimicrob Agents Chemother. Vol. 39 (12), p. 2593-2601. KNOX, J. R., MOEWS, P. C., and FRERE, J.-M. (1996). Molecular evolution of bacterial lactam resistance. Chemistry & Biology. Vol. 3 (11), p. 937-947. KOTRA, L. P., and MOBASHERY, S. (1999). Mechanistic and clinical aspects of -lactam antibiotics and -lactamases. Arch Immunol Ther Exp (Warsz). Vol. 47 (4), p. 211-216. KRISSINEL, E., and HENRICK, K. (2004). Secondary-structure matching (SSM), a new tool for fast protein structure alignment in three dimensions. Acta Crystallographica Section D. Vol. 60 (12 Part 1), p. 2256-2268. DOI: doi:10.1107/S0907444904026460. KUMAR, A., and SCHWEIZER, H. P. (2005). Bacterial resistance to antibiotics: Active efflux and reduced uptake. Advanced Drug Delivery Reviews. Vol. 57 (10), p. 1486-1513. DOI: 10.1016/j.addr.2005.04.004. KUMARASAMY, K. K., TOLEMAN, M. A., WALSH, T. R., BAGARIA, J., BUTT, F., BALAKRISHNAN, R., CHAUDHARY, U., DOUMITH, M., GISKE, C. G., IRFAN, S., et al. (2010). Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and

165

References
____________________________________________________________________________________________________________________________________________________

epidemiological study. The Lancet Infectious Diseases. Vol. 10 (9), p. 597-602. DOI: 10.1016/S1473-3099(10)70143-2 KUZIN, A. P., NUKAGA, M., NUKAGA, Y., HUJER, A. M., BONOMO, R. A., and KNOX, J. R. (1999). Structure of the SHV-1 -Lactamase. Biochemistry. Vol. 38 (18), p. 5720-5727. DOI: 10.1021/bi990136d.

LAEMMLI, U. K. (1970). Cleavage of Structural Proteins during the Assembly of the Head of
Bacteriophage T4. Nature. Vol. 227 (5259), p. 680-685. LAIBLE, G., SPRATT, B. G., and HAKENBECK, R. (1991). Interspecies recombinational events during the evolution of altered PBP 2x genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Mol Microbiol. Vol. 5 (8), p. 1993-2002. LAMBERT, P. A. (2005). Bacterial resistance to antibiotics: Modified target sites. Advanced Drug Delivery Reviews. Vol. 57 (10), p. 1471-1485. DOI: 10.1016/j.addr.2005.04.003 LAMOTTE-BRASSEUR, J., DIVE, G., DIDEBERG, O., CHARLIER, P., FRERE, J. M., and GHUYSEN, J. M. (1991). Mechanism of acyl transfer by the class A serine -lactamase of Streptomyces albus G. Biochem J. Vol. 279 ( Pt 1), p. 213-221. LARAKI, N., FRANCESCHINI, N., ROSSOLINI, G. M., SANTUCCI, P., MEUNIER, C., DE PAUW, E., AMICOSANTE, G., FRERE, J. M., and GALLENI, M. (1999). Biochemical characterization of the Pseudomonas aeruginosa 101/1477 metallo--lactamase IMP-1 produced by Escherichia coli. Antimicrob Agents Chemother. Vol. 43 (4), p. 902-906. LASKOWSKI, R. A., MACARTHUR, M. W., MOSS, D. S., and THORNTON, J. M. (1993). PROCHECK: a program to check the stereochemical quality of protein structures. Journal of Applied Crystallography. Vol. 26 (2), p. 283-291. DOI: 10.1107/S0021889892009944. LAURETTI, L., RICCIO, M. L., MAZZARIOL, A., CORNAGLIA, G., AMICOSANTE, G., FONTANA, R., and ROSSOLINI, G. M. (1999). Cloning and Characterization of blaVIM, a New Integron-Borne Metallo--Lactamase Gene from a Pseudomonas aeruginosa Clinical Isolate. Antimicrob. Agents Chemother. Vol. 43 (7), p. 1584-1590. LEE, W., MCDONOUGH, M. A., KOTRA, L. P., LI, Z.-H., SILVAGGI, N. R., TAKEDA, Y., KELLY, J. A., and MOBASHERY, S. (2001). A 1.2- snapshot of the final step of bacterial cell wall biosynthesis. Proceedings of the National Academy of Sciences of the United States of America. Vol. 98 (4), p. 1427-1431. DOI: 10.1073/pnas.98.4.1427 LEE, Y., YUM, J. H., KIM, C.-K., YONG, D., JEON, E. H., JEONG, S. H., AHN, J. Y., and LEE, K. (2010). Role of OXA-23 and AdeABC Efflux Pump for Acquiring Carbapenem Resistance in an

166

References
____________________________________________________________________________________________________________________________________________________

Acinetobacter baumannii Strain Carrying the blaOXA-66 Gene. Ann Clin Lab Sci. Vol. 40 (1), p. 43-48. LEFLON-GUIBOUT, V., SPELDOOREN, V., HEYM, B., and NICOLAS-CHANOINE, M.-H. (2000). Epidemiological Survey of Amoxicillin-Clavulanate Resistance and Corresponding Molecular Mechanisms in Escherichia coli Isolates in France: New Genetic Features of bla TEM Genes. Antimicrob. Agents Chemother. Vol. 44 (10), p. 2709-2714. DOI: 10.1128/aac.44.10.27092714.2000. LESLIE, A. (2006). The integration of macromolecular diffraction data. Acta Crystallographica Section D. Vol. 62 (1), p. 48-57. DOI: doi:10.1107/S0907444905039107. LEVY, S. B., and MARSHALL, B. (2004). Antibacterial resistance worldwide: causes, challenges and responses. Nat Med. DOI: 10.1038/nm1145 LI, X., NIKAIDO, H., and POOLE, K. (1995). Role of mexA-mexB-oprM in antibiotic efflux in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. Vol. 39 (9), p. 1948-1953. LIETZ, E. J., TRUHER, H., KAHN, D., HOKENSON, M. J., and FINK, A. L. (2000). Lysine-73 Is Involved in the Acylation and Deacylation of -Lactamase. Biochemistry. Vol. 39 (17), p. 4971-4981. DOI: 10.1021/bi992681k. LIMANSKY, A. S., MUSSI, M. A., and VIALE, A. M. (2002). Loss of a 29-Kilodalton Outer Membrane Protein in Acinetobacter baumannii Is Associated with Imipenem Resistance. J. Clin. Microbiol. Vol. 40 (12), p. 4776-4778. DOI: 10.1128/jcm.40.12.4776-4778.2002. LIN, Y.-F., WALMSLEY, A. R., and ROSEN, B. P. (2006). An arsenic metallochaperone for an arsenic detoxification pump. Proceedings of the National Academy of Sciences. Vol. 103 (42), p. 15617-15622. DOI: 10.1073/pnas.0603974103. LIN, Y. L., LEE, Y. M., and LIM, C. (2005). Differential effects of the Zn-His-Bkb vs Zn-His-[Asp/Glu] triad on Zn-core stability and reactivity. J Am Chem Soc. Vol. 127 (32), p. 11336-11347. DOI: 10.1021/ja051304u. LINE, K., ISUPOV, M. N., and LITTLECHILD, J. A. (2004). The Crystal Structure of a (-) Lactamase from an Aureobacterium Species Reveals a Tetrahedral Intermediate in the Active Site. Journal of Molecular Biology. Vol. 338 (3), p. 519-532. DOI: 10.1016/j.jmb.2004.03.001. LIVERMORE, D. (2009). Has the era of untreatable infections arrived? Journal of Antimicrobial Chemotherapy. Vol. 64 (Supplement 1), p. i29-i36. DOI: 10.1093/jac/dkp255.

167

References
____________________________________________________________________________________________________________________________________________________

LIVERMORE, D. M. (2007). Introduction: the challenge of multiresistance. International Journal of Antimicrobial Agents. Vol. 29 (Supplement 3), p. S1-S7. LIVERMORE, D. M. (2009). -Lactamases- the Threat Renews. Curr Protein Pept Sci. Vol. 10 (5), p. 397-400. DOI: 10.2174/138920309789351994. LIVERMORE, D. M., and WOODFORD, N. (2006). The -lactamase threat in Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends Microbiol. Vol. 14 (9), p. 413-420. DOI: 10.1016/j.tim.2006.07.008. LLANES, C., HOCQUET, D., VOGNE, C., BENALI-BAITICH, D., NEUWIRTH, C., and PLESIAT, P. (2004). Clinical Strains of Pseudomonas aeruginosa Overproducing MexAB-OprM and MexXY Efflux Pumps Simultaneously. Antimicrob. Agents Chemother. Vol. 48 (5), p. 1797-1802. DOI: 10.1128/aac.48.5.1797-1802.2004. LLARRULL, L. I., FABIANE, S. M., KOWALSKI, J. M., BENNETT, B., SUTTON, B. J., and VILA, A. J. (2007). Asp-120 locates Zn2 for optimal metallo--lactamase activity. J Biol Chem. Vol. 282 (25), p. 18276-18285. DOI: 10.1074/jbc.M700742200.

MACHEBOEUF, P., CONTRERAS-MARTEL, C., JOB, V., DIDEBERG, O., and DESSEN, A. (2006).

Penicillin Binding Proteins: key players in bacterial cell cycle and drug resistance processes. FEMS Microbiology Reviews. Vol. 30 (5), p. 673-691. DOI: 10.1111/j.15746976.2006.00024.x.

MAJIDUDDIN, F. K., and PALZKILL, T. (2003). Amino Acid Sequence Requirements at Residues 69 and 238 for the SME-1 -Lactamase To Confer Resistance to -Lactam Antibiotics. Antimicrob. Agents Chemother. Vol. 47 (3), p. 1062-1067. DOI: 10.1128/aac.47.3.10621067.2003. MAJIDUDDIN, F. K., and PALZKILL, T. (2005). Amino acid residues that contribute to substrate specificity of class A -lactamase SME-1. Antimicrob Agents Chemother. Vol. 49 (8), p. 34213427. DOI: 10.1128/AAC.49.8.3421-3427.2005. MAMMERI, H., NORDMANN, P., BERKANI, A., and EB, F. (2008). Contribution of extendedspectrum AmpC (ESAC) -lactamases to carbapenem resistance in Escherichia coli. FEMS Microbiology Letters. Vol. 282 (2), p. 238-240. DOI: 10.1111/j.1574-6968.2008.01126.x. MANDELL, L. (2009). Doripenem: a new carbapenem in the treatment of nosocomial infection. Clin Infect Dis. Vol. 49 Suppl 1, p. S1-3. DOI: 10.1086/599809.

168

References
____________________________________________________________________________________________________________________________________________________

MARIOTTE-BOYER, S., NICOLAS-CHANOINE, M. H., and LABIA, R. (1996). A kinetic study of NMC-A -lactamase, an Ambler class A carbapenemase also hydrolyzing cephamycins. FEMS Microbiology Letters. Vol. 143 (1), p. 29-33. DOI: 10.1111/j.1574-6968.1996.tb08457.x. MARTINEZ, J. L. (2009). The role of natural environments in the evolution of resistance traits in pathogenic bacteria. Proceedings of the Royal Society B: Biological Sciences. Vol. 276 (1667), p. 2521-2530. DOI: 10.1098/rspb.2009.0320. MARTINEZ, J. L., SNCHEZ, M. B., MARTNEZ-SOLANO, L., HERNANDEZ, A., GARMENDIA, L., FAJARDO, A., and ALVAREZ-ORTEGA, C. (2009). Functional role of bacterial multidrug efflux pumps in microbial natural ecosystems. FEMS Microbiology Reviews. Vol. 33 (2), p. 430449. DOI: 10.1111/j.1574-6976.2008.00157.x. MASSIDDA, O., ROSSOLINI, G. M., and SATTA, G. (1991). The Aeromonas hydrophila cphA gene: molecular heterogeneity among class B metallo--lactamases. J. Bacteriol. Vol. 173 (15), p. 4611-4617. MASSOVA, I., and MOBASHERY, S. (1998). Kinship and Diversification of Bacterial PenicillinBinding Proteins and -Lactamases. Antimicrob. Agents Chemother. Vol. 42 (1), p. 1-17. MASTERTON, R. G. (2009). The new treatment paradigm and the role of carbapenems. International Journal of Antimicrobial Agents. Vol. 33 (2), p. 105.e101-105.e108. MASUDA, N., SAKAGAWA, E., OHYA, S., GOTOH, N., TSUJIMOTO, H., and NISHINO, T. (2000). Substrate Specificities of MexAB-OprM, MexCD-OprJ, and MexXY-OprM Efflux Pumps in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. Vol. 44 (12), p. 3322-3327. DOI: 10.1128/aac.44.12.3322-3327.2000. MATAGNE, A., LAMOTTE-BRASSEUR, J., and FRERE, J. M. (1998). Catalytic properties of class A lactamases: efficiency and diversity. Biochem J. Vol. 330 ( Pt 2), p. 581-598. MATERON, I. C., and PALZKILL, T. (2001). Identification of residues critical for metallo--lactamase function by codon randomization and selection. Protein Science. Vol. 10 (12), p. 2556-2565. DOI: 10.1110/ps.40884. MAVEYRAUD, L., GOLEMI-KOTRA, D., ISHIWATA, A., MEROUEH, O., MOBASHERY, S., and SAMAMA, J.-P. (2002). High-Resolution X-ray Structure of an Acyl-Enzyme Species for the Class D OXA-10 -Lactamase. Journal of the American Chemical Society. Vol. 124 (11), p. 2461-2465. DOI: 10.1021/ja016736t. MAVEYRAUD, L., GOLEMI, D., KOTRA, L. P., TRANIER, S., VAKULENKO, S., MOBASHERY, S., and SAMAMA, J.-P. (2000). Insights into Class D -Lactamases Are Revealed by the Crystal

169

References
____________________________________________________________________________________________________________________________________________________

Structure of the OXA10 Enzyme from Pseudomonas aeruginosa. Structure. Vol. 8 (12), p. 1289-1298. DOI: 10.1016/s0969-2126(00)00534-7. MAVEYRAUD, L., MOUREY, L., KOTRA, L. P., PEDELACQ, J.-D., GUILLET, V., MOBASHERY, S., and SAMAMA, J.-P. (1998). Structural Basis for Clinical Longevity of Carbapenem Antibiotics in the Face of Challenge by the Common Class A -Lactamases from the Antibiotic-Resistant Bacteria. Journal of the American Chemical Society. Vol. 120 (38), p. 9748-9752. DOI: 10.1021/ja9818001. MAZEL, D., and DAVIES, J. (1999). Antibiotic resistance in microbes. Cellular and Molecular Life Sciences. Vol. 56 (9), p. 742-754. DOI: 10.1007/s000180050021. MCCOY, A. J., GROSSE-KUNSTLEVE, R. W., ADAMS, P. D., WINN, M. D., STORONI, L. C., and READ, R. J. (2007). Phaser crystallographic software. Journal of Applied Crystallography. Vol. 40 (4), p. 658-674. DOI: 10.1107/S0021889807021206. MCMANUS-MUNOZ, S., and CROWDER, M. W. (1999). Kinetic mechanism of metallo--lactamase L1 from Stenotrophomonas maltophilia. Biochemistry. Vol. 38 (5), p. 1547-1553. DOI: 10.1021/bi9826512. MINASOV, G., WANG, X., and SHOICHET, B. K. (2002). An Ultrahigh Resolution Structure of TEM-1 -Lactamase Suggests a Role for Glu166 as the General Base in Acylation. Journal of the American Chemical Society. Vol. 124 (19), p. 5333-5340. DOI: 10.1021/ja0259640. MOALI, C., ANNE, C., LAMOTTE-BRASSEUR, J., GROSLAMBERT, S., DEVREESE, B., VAN BEEUMEN, J., GALLENI, M., and FRRE, J.-M. (2003). Analysis of the Importance of the Metallo-Lactamase Active Site Loop in Substrate Binding and Catalysis. Chemistry & Biology. Vol. 10 (4), p. 319-329. DOI: 10.1016/S1074-5521(03)00070-X. MOEWS, P. C., KNOX, J. R., DIDEBERG, O., CHARLIER, P., and FRERE, J. M. (1990). -lactamase of Bacillus licheniformis 749/C at 2 A resolution. Proteins. Vol. 7 (2), p. 156-171. DOI: 10.1002/prot.340070205. MOLSTAD, S., LUNDBORG, C. S., KARLSSON, A. K., and CARS, O. (2002). Antibiotic prescription rates vary markedly between 13 European countries. Scand J Infect Dis. Vol. 34 (5), p. 366371. MOURA, A., HENRIQUES, I., SMALLA, K., and CORREIA, A. (2010). Wastewater bacterial communities bring together broad-host range plasmids, integrons and a wide diversity of uncharacterized gene cassettes. Research in Microbiology. Vol. 161 (1), p. 58-66. MLLER, H. E., FANNING, G. R., and BRENNER, D. J. (1995). Isolation of Serratia fonticola from mollusks. Syst Appl Microbiol. Vol. 18 (2), p. 279-284.

170

References
____________________________________________________________________________________________________________________________________________________

MLLER, H. E., STEIGERWALT, A. G., and BRENNER, D. J. (1986). Isolation of Serratia fonticola from birds. Zentralbl Bakteriol Mikrobiol Hyg A. Vol. 261 (2), p. 212-218. MURPHY, T. A., CATTO, L. E., HALFORD, S. E., HADFIELD, A. T., MINOR, W., WALSH, T. R., and SPENCER, J. (2006). Crystal Structure of Pseudomonas aeruginosa SPM-1 Provides Insights into Variable Zinc Affinity of Metallo--lactamases. Journal of Molecular Biology. Vol. 357 (3), p. 890-903. MURSHUDOV, G. N., VAGIN, A. A., and DODSON, E. J. (1997). Refinement of Macromolecular Structures by the Maximum-Likelihood Method. Acta Crystallographica Section D. Vol. 53 (3), p. 240-255. DOI: 10.1107/S0907444996012255. MUSSI, M. A., LIMANSKY, A. S., and VIALE, A. M. (2005). Acquisition of Resistance to Carbapenems in Multidrug-Resistant Clinical Strains of Acinetobacter baumannii: Natural Insertional Inactivation of a Gene Encoding a Member of a Novel Family of -Barrel Outer Membrane Proteins. Antimicrob. Agents Chemother. Vol. 49 (4), p. 1432-1440. DOI: 10.1128/aac.49.4.1432-1440.2005.

NAAS, T., LIVERMORE, D. M., and NORDMANN, P. (1995). Characterization of an LysR family

protein, SmeR from Serratia marcescens S6, its effect on expression of the carbapenemhydrolyzing -lactamase Sme-1, and comparison of this regulator with other -lactamase regulators. Antimicrob Agents Chemother. Vol. 39 (3), p. 629-637.

NAAS, T., and NORDMANN, P. (1994). Analysis of a carbapenem-hydrolyzing class A -lactamase from Enterobacter cloacae and of its LysR-type regulatory protein. Proc Natl Acad Sci U S A. Vol. 91 (16), p. 7693-7697. NAGARAJAN, R., BOECK, L. D., GORMAN, M., HAMILL, R. L., HIGGENS, C. E., HOEHN, M. M., STARK, W. M., and WHITNEY, J. G. (1971). -Lactam antibiotics from Streptomyces. Journal of the American Chemical Society. Vol. 93 (9), p. 2308-2310. DOI: 10.1021/ja00738a035. NAVAZA, J. (2001). Implementation of molecular replacement in AMoRe. Acta Crystallogr D Biol Crystallogr. Vol. 57 (Pt 10), p. 1367-1372. NEWMAN, J., EGAN, D., WALTER, T. S., MEGED, R., BERRY, I., JELLOUL, B., SUSSMAN, J. L., STUART, D. I., and PERRAKIS, A. (2005). Towards rationalization of crystallization screening for smallto medium-sized academic laboratories: the PACT/JCSG+ strategy. Acta Crystallographica Section D: Biological Crystallography. Vol. 61 (10), p. 1426-1431. NIKAIDO, H. (2003). Molecular basis of bacterial outer membrane permeability revisited. Microbiol Mol Biol Rev. Vol. 67 (4), p. 593-656.

171

References
____________________________________________________________________________________________________________________________________________________

NORDMANN, P., CUZON, G., and NAAS, T. (2009). The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. The Lancet Infectious Diseases. Vol. 9 (4), p. 228-236. DOI: 10.1016/s1473-3099(09)70054-4. NORDMANN, P., MARIOTTE, S., NAAS, T., LABIA, R., and NICOLAS, M. H. (1993). Biochemical properties of a carbapenem-hydrolyzing -lactamase from Enterobacter cloacae and cloning of the gene into Escherichia coli. Antimicrob Agents Chemother. Vol. 37 (5), p. 939946. NORDMANN, P., POIREL, L., TOLEMAN, M. A., and WALSH, T. R. (2011). Does broad-spectrum lactam resistance due to NDM-1 herald the end of the antibiotic era for treatment of infections caused by Gram-negative bacteria? Journal of Antimicrobial Chemotherapy. Vol. 66 (4), p. 689-692. DOI: 10.1093/jac/dkq520. NOSKIN, G. A., RUBIN, R. J., SCHENTAG, J. J., KLUYTMANS, J., HEDBLOM, E. C., SMULDERS, M., LAPETINA, E., and GEMMEN, E. (2005). The Burden of Staphylococcus aureus Infections on Hospitals in the United States: An Analysis of the 2000 and 2001 Nationwide Inpatient Sample Database. Arch Intern Med. Vol. 165 (15), p. 1756-1761. DOI: 10.1001/archinte.165.15.1756. NUKAGA, M., ABE, T., VENKATESAN, A. M., MANSOUR, T. S., BONOMO, R. A., and KNOX, J. R. (2003a). Inhibition of Class A and Class C -Lactamases by Penems: Crystallographic Structures of a Novel 1,4-Thiazepine Intermediate. Biochemistry. Vol. 42 (45), p. 1315213159. DOI: 10.1021/bi034986b. NUKAGA, M., BETHEL, C. R., THOMSON, J. M., HUJER, A. M., DISTLER, A., ANDERSON, V. E., KNOX, J. R., and BONOMO, R. A. (2008). Inhibition of Class A -Lactamases by Carbapenems: Crystallographic Observation of Two Conformations of Meropenem in SHV-1. Journal of the American Chemical Society. Vol. 130 (38), p. 12656-12662. DOI: 10.1021/ja7111146. NUKAGA, M., MAYAMA, K., HUJER, A. M., BONOMO, R. A., and KNOX, J. R. (2003b). Ultrahigh Resolution Structure of a Class A -Lactamase: On the Mechanism and Specificity of the Extended-spectrum SHV-2 Enzyme. Journal of Molecular Biology. Vol. 328 (1), p. 289-301. DOI: 10.1016/S0022-2836(03)00210-9.

OCHIAI, S., SEKIGUCHI, S., HAYASHI, A., SHIMADZU, M., ISHIKO, H., MATSUSHIMA-NISHIWAKI,
R., KOZAWA, O., YASUDA, M., and DEGUCHI, T. (2007). Decreased affinity of mosaicstructure recombinant penicillin-binding protein 2 for oral cephalosporins in Neisseria gonorrhoeae. Journal of Antimicrobial Chemotherapy. Vol. 60 (1), p. 54-60. DOI: 10.1093/jac/dkm166.

172

References
____________________________________________________________________________________________________________________________________________________

OEFNER, C., D'ARCY, A., DALY, J. J., GUBERNATOR, K., CHARNAS, R. L., HEINZE, I., HUBSCHWERLEN, C., and WINKLER, F. K. (1990). Refined crystal structure of -lactamase from Citrobacter freundii indicates a mechanism for -lactam hydrolysis. Nature. Vol. 343 (6255), p. 284-288. OHNISHI, M., WATANABE, Y., ONO, E., TAKAHASHI, C., OYA, H., KUROKI, T., SHIMUTA, K., OKAZAKI, N., NAKAYAMA, S., and WATANABE, H. (2010). Spread of a chromosomal cefixime-resistant penA gene among different Neisseria gonorrhoeae lineages. Antimicrobial agents and chemotherapy. Vol. 54 (3), p. 1060-1067. DOI: 10.1128/AAC.01010-09. OKAMOTO, K., GOTOH, N., and NISHINO, T. (2001). Pseudomonas aeruginosa Reveals High Intrinsic Resistance to Penem Antibiotics: Penem Resistance Mechanisms and Their Interplay. Antimicrob. Agents Chemother. Vol. 45 (7), p. 1964-1971. DOI: 10.1128/aac.45.7.1964-1971.2001. ORENCIA, M. C., YOON, J. S., NESS, J. E., STEMMER, W. P., and STEVENS, R. C. (2001). Predicting the emergence of antibiotic resistance by directed evolution and structural analysis. Nat Struct Biol. Vol. 8 (3), p. 238-242. DOI: 10.1038/84981. OTWINOWSKI, Z., and MINOR, W. (1997). Processing of X-ray diffraction data collected in oscillation mode. Macromolecular Crystallography, Pt A. Vol. 276, p. 307-326. OUELLETTE, M., BISSONNETTE, L., and ROY, P. H. (1987). Precise insertion of antibiotic resistance determinants into Tn21-like transposons: nucleotide sequence of the OXA-1 -lactamase gene. Proc Natl Acad Sci U S A. Vol. 84 (21), p. 7378-7382.

PADAYATTI, P. S., HELFAND, M. S., TOTIR, M. A., CAREY, M. P., HUJER, A. M., CAREY, P. R.,

BONOMO, R. A., and VAN DEN AKKER, F. (2004). Tazobactam Forms a Stoichiometric transEnamine Intermediate in the E166A Variant of SHV-1 -Lactamase: 1.63 Crystal Structure. Biochemistry. Vol. 43 (4), p. 843-848. DOI: 10.1021/bi035985m.

PADILLA, E., LLOBET, E., DOMENECH-SANCHEZ, A., MARTINEZ-MARTINEZ, L., BENGOECHEA, J. A., and ALBERTI, S. (2010). Klebsiella pneumoniae AcrAB Efflux Pump Contributes to Antimicrobial Resistance and Virulence. Antimicrob. Agents Chemother. Vol. 54 (1), p. 177183. DOI: 10.1128/aac.00715-09. PAGES, J.-M., LAVIGNE, J.-P., LEFLON-GUIBOUT, V., MARCON, E., BERT, F., NOUSSAIR, L., and NICOLAS-CHANOINE, M.-H. (2009). Efflux Pump, the Masked Side of -Lactam Resistance in Klebsiella pneumoniae Clinical Isolates. PLoS One. Vol. 4 (3), p. e4817. DOI: 10.1371/journal.pone.0004817.

173

References
____________________________________________________________________________________________________________________________________________________

PANG, Y., BROWN, B. A., STEINGRUBE, V. A., WALLACE, R. J., JR, and ROBERTS, M. C. (1994). Tetracycline resistance determinants in Mycobacterium and Streptomyces species. Antimicrob. Agents Chemother. Vol. 38 (6), p. 1408-1412. DOI: 10.1128/aac. PAPP-WALLACE, K. M., BETHEL, C. R., DISTLER, A. M., KASUBOSKI, C., TARACILA, M., and BONOMO, R. A. (2010a). Inhibitor Resistance in the KPC-2 -Lactamase, a Preeminent Property of This Class A -Lactamase. Antimicrob. Agents Chemother. Vol. 54 (2), p. 890897. DOI: 10.1128/aac.00693-09. PAPP-WALLACE, K. M., TARACILA, M., HORNICK, J. M., HUJER, A. M., HUJER, K. M., DISTLER, A. M., ENDIMIANI, A., and BONOMO, R. A. (2010b). Substrate Selectivity and a Novel Role in Inhibitor Discrimination by Residue 237 in the KPC-2 -Lactamase. Antimicrob. Agents Chemother. Vol. 54 (7), p. 2867-2877. DOI: 10.1128/aac.00197-10. PATERSON, D. L., and BONOMO, R. A. (2005). Extended-spectrum -lactamases: a clinical update. Clin Microbiol Rev. Vol. 18 (4), p. 657-686. DOI: 10.1128/CMR.18.4.657-686.2005. PEDUZZI, J., FARZANEH, S., REYNAUD, A., BARTHELEMY, M., and LABIA, R. (1997). Characterization and amino acid sequence analysis of a new oxyimino cephalosporin-hydrolyzing class A lactamase from Serratia fonticola CUV. Biochim Biophys Acta. Vol. 1341 (1), p. 58-70. PELEG, A. Y., and HOOPER, D. C. (2010). Hospital-Acquired Infections Due to Gram-Negative Bacteria. New England Journal of Medicine. Vol. 362 (19), p. 1804-1813. DOI: 10.1056/NEJMra0904124. PEREZ, F., ENDIMIANI, A., HUJER, K. M., and BONOMO, R. A. (2007). The continuing challenge of ESBLs. Curr Opin Pharmacol. Vol. 7 (5), p. 459-469. DOI: 10.1016/j.coph.2007.08.003. PERILLI, M., CELENZA, G., DE SANTIS, F., PELLEGRINI, C., FORCELLA, C., ROSSOLINI, G. M., STEFANI, S., and AMICOSANTE, G. (2008). E240V Substitution Increases Catalytic Efficiency toward Ceftazidime in a New Natural TEM-Type Extended-Spectrum -Lactamase, TEM-149, from Enterobacter aerogenes and Serratia marcescens Clinical Isolates. Antimicrob. Agents Chemother. Vol. 52 (3), p. 915-919. DOI: 10.1128/aac.01028-07. PFYFFER, G. E. (1992). Serratia fonticola as an infectious agent. Eur J Clin Microbiol Infect Dis. Vol. 11 (2), p. 199-200. POIREL, L., HERITIER, C., and NORDMANN, P. (2004a). Chromosome-Encoded Ambler Class D Lactamase of Shewanella oneidensis as a Progenitor of Carbapenem-Hydrolyzing Oxacillinase. Antimicrob. Agents Chemother. Vol. 48 (1), p. 348-351. DOI: 10.1128/aac.48.1.348-351.2004.

174

References
____________________________________________________________________________________________________________________________________________________

POIREL, L., HERITIER, C., TOLUN, V., and NORDMANN, P. (2004b). Emergence of OxacillinaseMediated Resistance to Imipenem in Klebsiella pneumoniae. Antimicrob. Agents Chemother. Vol. 48 (1), p. 15-22. DOI: 10.1128/aac.48.1.15-22.2004. POIREL, L., KMPFER, P., and NORDMANN, P. (2002). Chromosome-encoded Ambler class A lactamase of Kluyvera georgiana, a probable progenitor of a subgroup of CTX-M extendedspectrum lactamases. Antimicrobial agents and chemotherapy. Vol. 46 (12), p. 4038. POIREL, L., LAGRUTTA, E., TAYLOR, P., PHAM, J., and NORDMANN, P. (2010a). Emergence of Metallo--Lactamase NDM-1-Producing Multidrug-Resistant Escherichia coli in Australia. Antimicrob. Agents Chemother. Vol. 54 (11), p. 4914-4916. DOI: 10.1128/aac.00878-10. POIREL, L., LE THOMAS, I., NAAS, T., KARIM, A., and NORDMANN, P. (2000). Biochemical sequence analyses of GES-1, a novel class A extended-spectrum -lactamase, and the class 1 integron In52 from Klebsiella pneumoniae. Antimicrob Agents Chemother. Vol. 44 (3), p. 622-632. DOI: 10.1128/aac.44.3.622-632.2000. POIREL, L., and NORDMANN, P. (2002). Acquired carbapenem-hydrolyzing -lactamases and their genetic support. Curr Pharm Biotechnol. Vol. 3 (2), p. 117-127. POIREL, L., RODRIGUEZ-MARTINEZ, J.-M., AL NAIEMI, N., DEBETS-OSSENKOPP, Y. J., and NORDMANN, P. (2010b). Characterization of DIM-1, an Integron-Encoded Metallo-Lactamase from a Pseudomonas stutzeri Clinical Isolate in the Netherlands. Antimicrob. Agents Chemother. Vol. 54 (6), p. 2420-2424. DOI: 10.1128/aac.01456-09. POIREL, L., RODRIGUEZ-MARTINEZ, J.-M., MAMMERI, H., LIARD, A., and NORDMANN, P. (2005). Origin of Plasmid-Mediated Quinolone Resistance Determinant QnrA. Antimicrob. Agents Chemother. Vol. 49 (8), p. 3523-3525. DOI: 10.1128/aac.49.8.3523-3525.2005. POIREL, L., WELDHAGEN, G. F., NAAS, T., DE CHAMPS, C., DOVE, M. G., and NORDMANN, P. (2001). GES-2, a Class A -Lactamase from Pseudomonas aeruginosa with Increased Hydrolysis of Imipenem. Antimicrob. Agents Chemother. Vol. 45 (9), p. 2598-2603. DOI: 10.1128/aac.45.9.2598-2603.2001. POOLE, K. (2007). Efflux pumps as antimicrobial resistance mechanisms. Ann Med. Vol. 39 (3), p. 162-176. DOI: 10.1080/07853890701195262. POTTERTON, E., BRIGGS, P., TURKENBURG, M., and DODSON, E. (2003). A graphical user interface to the CCP4 program suite. Acta Crystallographica Section D. Vol. 59 (7), p. 1131-1137. DOI: 10.1107/S0907444903008126. POTTERTON, L., MCNICHOLAS, S., KRISSINEL, E., GRUBER, J., COWTAN, K., EMSLEY, P., MURSHUDOV, G. N., COHEN, S., PERRAKIS, A., and NOBLE, M. (2004). Developments in the

175

References
____________________________________________________________________________________________________________________________________________________

CCP4 molecular-graphics project. Acta Crystallogr D Biol Crystallogr. Vol. 60 (Part 12 Sp. Iss. 1), p. 2288-2294. POURNARAS, S., POULOU, A., VOULGARI, E., VRIONI, G., KRISTO, I., and TSAKRIS, A. (2010). Detection of the new metallo--lactamase VIM-19 along with KPC-2, CMY-2 and CTX-M-15 in. Journal of Antimicrobial Chemotherapy. Vol. 65 (8), p. 1604-1607. DOI: 10.1093/jac/dkq190. PROJAN, S. J. (2003). Why is big Pharma getting out of antibacterial drug discovery? Current Opinion in Microbiology. Vol. 6 (5), p. 427-430. DOI: 10.1016/j.mib.2003.08.003.

QIN, X., RAZIA, Y., JOHNSON, J. R., STAPP, J. R., BOSTER, D. R., TSOSIE, T., SMITH, D. L., BRADEN,

C. R., GAY, K., ANGULO, F. J., et al. (2006). Ciprofloxacin-Resistant Gram-Negative Bacilli in the Fecal Microflora of Children. Antimicrob. Agents Chemother. Vol. 50 (10), p. 3325-3329. DOI: 10.1128/aac.00548-06.

QUALE, J., BRATU, S., GUPTA, J., and LANDMAN, D. (2006). Interplay of Efflux System, ampC, and oprD Expression in Carbapenem Resistance of Pseudomonas aeruginosa Clinical Isolates. Antimicrob. Agents Chemother. Vol. 50 (5), p. 1633-1641. DOI: 10.1128/aac.50.5.16331641.2006. QUEENAN, A. M., and BUSH, K. (2007). Carbapenemases: the Versatile -Lactamases. Clin. Microbiol. Rev. Vol. 20 (3), p. 440-458. DOI: 10.1128/cmr.00001-07. QUEENAN, A. M., SHANG, W., SCHRECKENBERGER, P., LOLANS, K., BUSH, K., and QUINN, J. (2006). SME-3, a novel member of the Serratia marcescens SME family of carbapenem-hydrolyzing -lactamases. Antimicrob Agents Chemother. Vol. 50 (10), p. 3485-3487. DOI: 10.1128/AAC.00363-06. QUEENAN, A. M., TORRES-VIERA, C., GOLD, H. S., CARMELI, Y., ELIOPOULOS, G. M., MOELLERING, R. C., JR., QUINN, J. P., HINDLER, J., MEDEIROS, A. A., and BUSH, K. (2000). SME-type carbapenem-hydrolyzing class A -lactamases from geographically diverse Serratia marcescens strains. Antimicrob Agents Chemother. Vol. 44 (11), p. 3035-3039.

RAQUET, X., LAMOTTE-BRASSEUR, J., BOUILLENNE, F., and FRERE, J. M. (1997). A disulfide bridge
near the active site of carbapenem-hydrolyzing class A -lactamases might explain their unusual substrate profile. Proteins. Vol. 27 (1), p. 47-58. DOI: 10.1002/(SICI)10970134(199701)27:1<47::AID-PROT6>3.0.CO;2-K.

RASIA, R. M., and VILA, A. J. (2004). Structural determinants of substrate binding to Bacillus cereus metallo--lactamase. J Biol Chem. Vol. 279 (25), p. 26046-26051. DOI: 10.1074/jbc.M311373200.

176

References
____________________________________________________________________________________________________________________________________________________

RASMUSSEN, B. A., and BUSH, K. (1997). Carbapenem-hydrolyzing -lactamases. Antimicrob Agents Chemother. Vol. 41 (2), p. 223-232. RASMUSSEN, B. A., BUSH, K., KEENEY, D., YANG, Y., HARE, R., O'GARA, C., and MEDEIROS, A. A. (1996). Characterization of IMI-1 -lactamase, a class A carbapenem-hydrolyzing enzyme from Enterobacter cloacae. Antimicrob Agents Chemother. Vol. 40 (9), p. 2080-2086. RASMUSSEN, B. A., GLUZMAN, Y., and TALLY, F. P. (1990). Cloning and sequencing of the class B lactamase gene (ccrA) from Bacteroides fragilis TAL3636. Antimicrob. Agents Chemother. Vol. 34 (8), p. 1590-1592. DOI: 10.1128/aac. RHODES, G., HUYS, G., SWINGS, J., MCGANN, P., HINEY, M., SMITH, P., and PICKUP, R. W. (2000). Distribution of Oxytetracycline Resistance Plasmids between Aeromonads in Hospital and Aquaculture Environments: Implication of Tn1721 in Dissemination of the Tetracycline Resistance Determinant Tet A. Appl. Environ. Microbiol. Vol. 66 (9), p. 3883-3890. DOI: 10.1128/aem.66.9.3883-3890.2000. RICE, L. B. (2009). The clinical consequences of antimicrobial resistance. Current Opinion in Microbiology. Vol. 12 (5), p. 476-481. DOI: 10.1016/j.mib.2009.08.001. RICHMOND, M. H. (1963). Purification and Properties of the Exopenicillinase from Staphylococcus aureus. Biochem J. Vol. 88, p. 452-459. RICHMOND, M. H., and SYKES, R. B. (1973). The -lactamases of Gram-negative bacteria and their possible physiological role. Adv Microb Physiol. Vol. 9, p. 31-88. ROBERTS, R. R., HOTA, B., AHMAD, I., SCOTT, R. D., FOSTER, S. D., ABBASI, F., SCHABOWSKI, S., KAMPE, L. M., CIAVARELLA, G. G., SUPINO, M., et al. (2009). Hospital and Societal Costs of Antimicrobial-Resistant Infections in a Chicago Teaching Hospital: Implications for Antibiotic Stewardship. Clinical Infectious Diseases. Vol. 49 (8), p. 1175-1184. DOI: 10.1086/605630. ROBLEDO, I. E., AQUINO, E. E., SANTE, M. I., SANTANA, J. L., OTERO, D. M., LEON, C. F., and VAZQUEZ, G. J. (2010). Detection of KPC in Acinetobacter spp. in Puerto Rico. Antimicrob. Agents Chemother. Vol. 54 (3), p. 1354-1357. DOI: 10.1128/aac.00899-09. RODRIGUEZ-MARTINEZ, J. M., POIREL, L., and NORDMANN, P. (2009). Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother. Vol. 53 (11), p. 4783-4788. DOI: 10.1128/AAC.00574-09. ROONEY, P. J., O'LEARY, M. C., LOUGHREY, A. C., MCCALMONT, M., SMYTH, B., DONAGHY, P., BADRI, M., WOODFORD, N., KARISIK, E., and LIVERMORE, D. M. (2009). Nursing homes as a reservoir of extended-spectrum -lactamase (ESBL)-producing ciprofloxacin-resistant

177

References
____________________________________________________________________________________________________________________________________________________

Escherichia coli. Journal of Antimicrobial Chemotherapy. Vol. 64 (3), p. 635-641. DOI: 10.1093/jac/dkp220. ROSSOLINI, G. M., CONDEMI, M. A., PANTANELLA, F., DOCQUIER, J.-D., AMICOSANTE, G., and THALLER, M. C. (2001). Metallo--Lactamase Producers in Environmental Microbiota: New Molecular Class B Enzyme in Janthinobacterium lividum. Antimicrob. Agents Chemother. Vol. 45 (3), p. 837-844. DOI: 10.1128/aac.45.3.837-844.2001. ROSSOLINI, G. M., FRANCESCHINI, N., RICCIO, M. L., MERCURI, P. S., PERILLI, M., GALLENI, M., FRERE, J. M., and AMICOSANTE, G. (1998). Characterization and sequence of the Chryseobacterium (Flavobacterium) meningosepticum carbapenemase: a new molecular class B -lactamase showing a broad substrate profile. Biochem. J. Vol. 332 (1), p. 145-152. RUSSO, T. A., MACDONALD, U., BEANAN, J. M., OLSON, R., MACDONALD, I. J., SAUBERAN, S. L., LUKE, N. R., SCHULTZ, L. W., and UMLAND, T. C. (2009). Penicillin-binding protein 7/8 contributes to the survival of Acinetobacter baumannii in vitro and in vivo. J Infect Dis. Vol. 199 (4), p. 513-521. DOI: 10.1086/596317.

SAAVEDRA, M. J., PEIXE, L., SOUSA, J. C., HENRIQUES, I., ALVES, A., and CORREIA, A. (2003). Sfh-I,
a subclass B2 metallo--lactamase from a Serratia fonticola environmental isolate. Antimicrob Agents Chemother. Vol. 47 (7), p. 2330-2333. SABATH, L. D., and ABRAHAM, E. P. (1966). Zinc as a cofactor for cephalosporinase from Bacillus cereus 569. Biochem J. Vol. 98 (1), p. 11C-13C. SADER, H. S., FRITSCHE, T. R., and JONES, R. N. (2005). Potency and spectrum trends for cefepime tested against 65746 clinical bacterial isolates collected in North American medical centers: results from the SENTRY Antimicrobial Surveillance Program (1998-2003). Diagnostic Microbiology and Infectious Disease. Vol. 52 (3), p. 265-273. DOI: 10.1016/j.diagmicrobio.2005.02.003. SAMUELSEN, ., CASTANHEIRA, M., WALSH, T. R., and SPENCER, J. (2008). Kinetic characterization of VIM-7, a divergent member of the VIM metallo-beta-lactamase family. Antimicrob Agents Chemother. Vol. 52 (8), p. 2905-2908. SAVES, I., BURLET-SCHILTZ, O., SWARN, P., LEFVRE, F., MASSON, J.-M., PROM, J.-C., and SAMAMA, J.-P. (1995). The Asparagine to Aspartic Acid Substitution at Position 276 of TEM-35 and TEM-36 Is Involved in the Lactamase Resistance to Clavulanic Acid. Journal of Biological Chemistry. Vol. 270 (31), p. 18240-18245. DOI: 10.1074/jbc.270.31.18240. SCHLEIFER, K. H., and KANDLER, O. (1972). Peptidoglycan types of bacterial cell walls and their taxonomic implications. Microbiol. Mol. Biol. Rev. Vol. 36 (4), p. 407-477.

178

References
____________________________________________________________________________________________________________________________________________________

SCHUTTELKOPF, A. W., and VAN AALTEN, D. M. F. (2004). PRODRG: a tool for high-throughput crystallography of protein-ligand complexes. Acta Crystallographica Section D. Vol. 60 (8), p. 1355-1363. DOI: 10.1107/S0907444904011679. SEGATORE, B., MASSIDDA, O., SATTA, G., SETACCI, D., and AMICOSANTE, G. (1993). High specificity of cphA-encoded metallo--lactamase from Aeromonas hydrophila AE036 for carbapenems and its contribution to -lactam resistance. Antimicrob Agents Chemother. Vol. 37 (6), p. 1324-1328. SHARMA, N. P., HAJDIN, C., CHANDRASEKAR, S., BENNETT, B., YANG, K. W., and CROWDER, M. W. (2006). Mechanistic studies on the mononuclear ZnII-containing metallo--lactamase ImiS from Aeromonas sobria. Biochemistry. Vol. 45 (35), p. 10729-10738. SHELDRICK, G. (2008). A short history of SHELX. Acta Crystallographica Section A. Vol. 64 (1), p. 112-122. DOI: doi:10.1107/S0108767307043930. SHIMAMURA, T., IBUKA, A., FUSHINOBU, S., WAKAGI, T., ISHIGURO, M., ISHII, Y., and MATSUZAWA, H. (2002). Acyl-intermediate Structures of the Extended-spectrum Class A Lactamase, Toho-1, in Complex with Cefotaxime, Cephalothin, and Benzylpenicillin. Journal of Biological Chemistry. Vol. 277 (48), p. 46601-46608. DOI: 10.1074/jbc.M207884200. SIMM, A. M., HIGGINS, C. S., PULLAN, S. T., AVISON, M. B., NIUMSUP, P., ERDOZAIN, O., BENNETT, P. M., and WALSH, T. R. (2001). A novel metallo--lactamase, Mbl1b, produced by the environmental bacterium Caulobacter crescentus. FEBS Letters. Vol. 509 (3), p. 350-354. SIMONA, F., MAGISTRATO, A., DAL PERARO, M., CAVALLI, A., VILA, A. J., and CARLONI, P. (2009). Common mechanistic features among metallo--lactamases: a computational study of Aeromonas hydrophila CphA enzyme. J Biol Chem. Vol. 284 (41), p. 28164-28171. DOI: 10.1074/jbc.M109.049502. SMITH, A. M., FELDMAN, C., MASSIDDA, O., MCCARTHY, K., NDIWENI, D., and KLUGMAN, K. P. (2005). Altered PBP 2A and its role in the development of penicillin, cefotaxime, and ceftriaxone resistance in a clinical isolate of Streptococcus pneumoniae. Antimicrob Agents Chemother. Vol. 49 (5), p. 2002-2007. DOI: 10.1128/AAC.49.5.2002-2007.2005. SMITH MOLAND, E., HANSON, N. D., HERRERA, V. L., BLACK, J. A., LOCKHART, T. J., HOSSAIN, A., JOHNSON, J. A., GOERING, R. V., and THOMSON, K. S. (2003). Plasmid-mediated, carbapenem-hydrolysing -lactamase, KPC-2, in Klebsiella pneumoniae isolates. J Antimicrob Chemother. Vol. 51 (3), p. 711-714. SONG, W., SUH, B., CHOI, J. Y., JEONG, S. H., JEON, E. H., LEE, Y. K., HONG, S. G., and LEE, K. (2009). In vivo selection of carbapenem-resistant Klebsiella pneumoniae by OmpK36 loss during

179

References
____________________________________________________________________________________________________________________________________________________

meropenem treatment. Diagn Microbiol Infect Dis. Vol. 65 (4), p. 447-449. DOI: 10.1016/j.diagmicrobio.2009.08.010. SOUGAKOFF, W., L'HERMITE, G., PERNOT, L., NAAS, T., GUILLET, V., NORDMANN, P., JARLIER, V., and DELETTRE, J. (2002). Structure of the imipenem-hydrolyzing class A lactamase SME-1 from Serratia marcescens. Acta Crystallographica Section D. Vol. 58 (2), p. 267-274. DOI: doi:10.1107/S0907444901019606. SOUGAKOFF, W., NAAS, T., NORDMANN, P., COLLATZ, E., and JARLIER, V. (1999). Role of Ser-237 in the substrate specificity of the carbapenem-hydrolyzing class A -lactamase Sme-1. Biochim Biophys Acta. Vol. 1433 (1-2), p. 153-158. DOI: S0167-4838(99)00138-7. SPELLBERG, B., GUIDOS, R., GILBERT, D., BRADLEY, J., BOUCHER, H. W., SCHELD, W. M., BARTLETT, J. G., EDWARDS, J., and AMERICA, T. I. D. S. O. (2008). The Epidemic of Antibiotic-Resistant Infections: A Call to Action for the Medical Community from the Infectious Diseases Society of America. Clinical Infectious Diseases. Vol. 46 (2), p. 155-164. DOI: 10.1086/524891. SPENCER, J., CLARKE, A. R., and WALSH, T. R. (2001). Novel mechanism of hydrolysis of therapeutic -lactams by Stenotrophomonas maltophilia L1 metallo--lactamase. J Biol Chem. Vol. 276 (36), p. 33638-33644. DOI: 10.1074/jbc.M105550200. SPENCER, J., READ, J., SESSIONS, R. B., HOWELL, S., BLACKBURN, G. M., and GAMBLIN, S. J. (2005). Antibiotic Recognition by Binuclear Metallo--Lactamases Revealed by X-ray Crystallography. Journal of the American Chemical Society. Vol. 127 (41), p. 14439-14444. DOI: 10.1021/ja0536062. STEC, B., HOLTZ, K. M., WOJCIECHOWSKI, C. L., and KANTROWITZ, E. R. (2005). Structure of the wild-type TEM-1 -lactamase at 1.55 A and the mutant enzyme Ser70Ala at 2.1 A suggest the mode of noncovalent catalysis for the mutant enzyme. Acta Crystallographica Section D. Vol. 61 (8), p. 1072-1079. DOI: 10.1107/S0907444905014356. STOCK, I., BURAK, S., SHERWOOD, K. J., GRUGER, T., and WIEDEMANN, B. (2003). Natural antimicrobial susceptibilities of strains of 'unusual' Serratia species: S. ficaria, S. fonticola, S. odorifera, S. plymuthica and S. rubidaea. J Antimicrob Chemother. Vol. 51 (4), p. 865-885. DOI: 10.1093/jac/dkg156. STOCZKO, M., FRERE, J.-M., ROSSOLINI, G. M., and DOCQUIER, J.-D. (2006). Postgenomic Scan of Metallo--Lactamase Homologues in Rhizobacteria: Identification and Characterization of BJP-1, a Subclass B3 Ortholog from Bradyrhizobium japonicum. Antimicrob. Agents Chemother. Vol. 50 (6), p. 1973-1981. DOI: 10.1128/aac.01551-05.

180

References
____________________________________________________________________________________________________________________________________________________

STRYNADKA, N. C. J., ADACHI, H., JENSEN, S. E., JOHNS, K., SIELECKI, A., BETZEL, C., SUTOH, K., and JAMES, M. N. G. (1992). Molecular structure of the acyl-enzyme intermediate in -lactam hydrolysis at 1.7 A resolution. Nature. Vol. 359 (6397), p. 700-705. SWARN, P., MAVEYRAUD, L., RAQUET, X., CABANTOUS, S., DUEZ, C., PDELACQ, J.-D., MARIOTTEBOYER, S., MOUREY, L., LABIA, R., NICOLAS-CHANOINE, M.-H., et al. (1998). X-ray Analysis of the NMC-A -Lactamase at 1.64- Resolution, a Class A Carbapenemase with Broad Substrate Specificity. Journal of Biological Chemistry. Vol. 273 (41), p. 26714-26721. DOI: 10.1074/jbc.273.41.26714. SYKES, R. (2010). The 2009 Garrod Lecture: The evolution of antimicrobial resistance: a Darwinian perspective. Journal of Antimicrobial Chemotherapy. Vol. 65 (9), p. 1842-1852. DOI: 10.1093/jac/dkq217. SYKES, R. B., CIMARUSTI, C. M., BONNER, D. P., BUSH, K., FLOYD, D. M., GEORGOPAPADAKOU, N. H., KOSTER, W. H., LIU, W. C., PARKER, W. L., PRINCIPE, P. A., et al. (1981). Monocyclic lactam antibiotics produced by bacteria. Nature. Vol. 291 (5815), p. 489-491. SYKES, R. B., and MATTHEW, M. (1976). The -lactamases of Gram-negative bacteria and their role in resistance to -lactam antibiotics. J Antimicrob Chemother. Vol. 2 (2), p. 115-157.

TAHLAN, K., AHN, S. K., SING, A., BODNARUK, T. D., WILLEMS, A. R., DAVIDSON, A. R., and

NODWELL, J. R. (2007). Initiation of actinorhodin export in Streptomyces coelicolor. Molecular Microbiology. Vol. 63 (4), p. 951-961. DOI: 10.1111/j.1365-2958.2006.05559.x.

TATO, M., COQUE, T. M., BAQUERO, F., and CANTON, R. (2010). Dispersal of Carbapenemase blaVIM-1 Gene Associated with Different Tn402 Variants, Mercury Transposons, and Conjugative Plasmids in Enterobacteriaceae and Pseudomonas aeruginosa. Antimicrob. Agents Chemother. Vol. 54 (1), p. 320-327. DOI: 10.1128/aac.00783-09. THERRIEN, C., and LEVESQUE, R. C. (2000). Molecular basis of antibiotic resistance and lactamase inhibition by mechanism-based inactivators: perspectives and future directions. FEMS Microbiology Reviews. Vol. 24 (3), p. 251-262. DOI: 10.1111/j.15746976.2000.tb00541.x. THOMSON, J. M., and BONOMO, R. A. (2005). The threat of antibiotic resistance in Gram-negative pathogenic bacteria: -lactams in peril! Current Opinion in Microbiology. Vol. 8 (5), p. 518524. TIONI, M. F., LLARRULL, L. I., POEYLAUT-PALENA, A. A., MARTI, M. A., SAGGU, M., PERIYANNAN, G. R., MATA, E. G., BENNETT, B., MURGIDA, D. H., and VILA, A. J. (2008). Trapping and characterization of a reaction intermediate in carbapenem hydrolysis by B. cereus metallo-lactamase. J Am Chem Soc. Vol. 130 (47), p. 15852-15863. DOI: 10.1021/ja801169j.
181

References
____________________________________________________________________________________________________________________________________________________

TIPPER, D. J., and STROMINGER, J. L. (1965). Mechanism of action of penicillins: a proposal based on their structural similarity to acyl-D-alanyl-D-alanine. Proceedings of the National Academy of Sciences of the United States of America. Vol. 54 (4), p. 1133-1141. TOLEMAN, M. A., BENNETT, P. M., and WALSH, T. R. (2006). ISCR Elements: Novel Gene-Capturing Systems of the 21st Century? Microbiol. Mol. Biol. Rev. Vol. 70 (2), p. 296-316. DOI: 10.1128/mmbr.00048-05. TOLEMAN, M. A., SIMM, A. M., MURPHY, T. A., GALES, A. C., BIEDENBACH, D. J., JONES, R. N., and WALSH, T. R. (2002). Molecular characterization of SPM-1, a novel metallo--lactamase isolated in Latin America: report from the SENTRY antimicrobial surveillance programme. Journal of Antimicrobial Chemotherapy. Vol. 50 (5), p. 673-679. DOI: 10.1093/jac/dkf210. TOMAS, M. D. M., BECEIRO, A., PEREZ, A., VELASCO, D., MOURE, R., VILLANUEVA, R., MARTINEZBELTRAN, J., and BOU, G. (2005). Cloning and Functional Analysis of the Gene Encoding the 33- to 36-Kilodalton Outer Membrane Protein Associated with Carbapenem Resistance in Acinetobacter baumannii. Antimicrob. Agents Chemother. Vol. 49 (12), p. 5172-5175. DOI: 10.1128/aac.49.12.5172-5175.2005. TREMBLAY, L. W., XU, H., and BLANCHARD, J. S. (2010). Structures of the Michaelis Complex (1.2 ) and the Covalent Acyl Intermediate (2.0 ) of Cefamandole Bound in the Active Sites of the Mycobacterium tuberculosis -Lactamase K73A and E166A Mutants. Biochemistry. Vol. 49 (45), p. 9685-9687. DOI: 10.1021/bi1015088.

ULLAH, J. H., WALSH, T. R., TAYLOR, I. A., EMERY, D. C., VERMA, C. S., GAMBLIN, S. J., and

SPENCER, J. (1998). The crystal structure of the L1 metallo--lactamase from Stenotrophomonas maltophilia at 1.7 A resolution. J Mol Biol. Vol. 284 (1), p. 125-136. DOI: 10.1006/jmbi.1998.2148.

VALLADARES, M. H., FELICI, A., WEBER, G., ADOLPH, H. W., ZEPPEZAUER, M., ROSSOLINI, G. M.,

AMICOSANTE, G., FRERE, J. M., and GALLENI, M. (1997). Zn(II) dependence of the Aeromonas hydrophila AE036 metallo--lactamase activity and stability. Biochemistry. Vol. 36 (38), p. 11534-11541. DOI: 10.1021/bi971056h.

VANHOVE, M., ZAKHEM, M., DEVREESE, B., FRANCESCHINI, N., ANNE, C., BEBRONE, C., AMICOSANTE, G., ROSSOLINI, G. M., VAN BEEUMEN, J., FRERE, J. M., et al. (2003). Role of Cys221 and Asn116 in the zinc-binding sites of the Aeromonas hydrophila metallo-lactamase. Cell Mol Life Sci. Vol. 60 (11), p. 2501-2509. DOI: 10.1007/s00018-003-3092-x.

182

References
____________________________________________________________________________________________________________________________________________________

VENKATACHALAM, K. V., HUANG, W., LAROCCO, M., and PALZKILL, T. (1994). Characterization of TEM-1 -lactamase mutants from positions 238 to 241 with increased catalytic efficiency for ceftazidime. Journal of Biological Chemistry. Vol. 269 (38), p. 23444-23450. VILLAVERDE, A., and MAR CARRI, M. (2003). Protein aggregation in recombinant bacteria: biological role of inclusion bodies. Biotechnology Letters. Vol. 25 (17), p. 1385-1395. DOI: 10.1023/a:1025024104862. VILLEGAS, M. V., LOLANS, K., CORREA, A., KATTAN, J. N., LOPEZ, J. A., QUINN, J. P., and AND THE COLOMBIAN NOSOCOMIAL RESISTANCE STUDY GROUP. (2007). First Identification of Pseudomonas aeruginosa Isolates Producing a KPC-Type Carbapenem-Hydrolyzing Lactamase. Antimicrob. Agents Chemother. Vol. 51 (4), p. 1553-1555. DOI: 10.1128/aac.01405-06. VOLLMER, W., BLANOT, D., and DE PEDRO, M. A. (2008). Peptidoglycan structure and architecture. FEMS Microbiol Rev. Vol. 32 (2), p. 149-167. DOI: 10.1111/j.15746976.2007.00094.x. VOURLI, S., GIAKKOUPI, P., MIRIAGOU, V., TZELEPI, E., VATOPOULOS, A. C., and TZOUVELEKIS, L. S. (2004). Novel GES/IBC extended-spectrum -lactamase variants with carbapenemase activity in clinical enterobacteria. FEMS Microbiology Letters. Vol. 234 (2), p. 209-213. DOI: 10.1111/j.1574-6968.2004.tb09535.x.

WACHINO, J.-I., DOI, Y., YAMANE, K., SHIBATA, N., YAGI, T., KUBOTA, T., and ARAKAWA, Y.

(2004). Molecular Characterization of a Cephamycin-Hydrolyzing and Inhibitor-Resistant Class A -Lactamase, GES-4, Possessing a Single G170S Substitution in the mega-Loop. Antimicrob. Agents Chemother. Vol. 48 (8), p. 2905-2910. DOI: 10.1128/aac.48.8.29052910.2004.

WALSH, C. (2000). Molecular mechanisms that confer antibacterial drug resistance. Nature. Vol. 406 (6797), p. 775-781. WALSH, T. R. (2008). Clinically significant carbapenemases: an update. Current Opinion in Infectious Diseases. Vol. 21 (4), p. 367-371 DOI: 10.1097/QCO.0b013e328303670b. WALSH, T. R., GAMBLIN, S., EMERY, D. C., MACGOWAN, A. P., and BENNETT, P. M. (1996). Enzyme kinetics and biochemical analysis of ImiS, the metallo--lactamase from Aeromonas sobria 163a. J Antimicrob Chemother. Vol. 37 (3), p. 423-431. WALSH, T. R., HALL, L., ASSINDER, S. J., NICHOLS, W. W., CARTWRIGHT, S. J., MACGOWAN, A. P., and BENNETT, P. M. (1994). Sequence analysis of the L1 metallo--lactamase from Xanthomonas maltophilia. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. Vol. 1218 (2), p. 199-201.

183

References
____________________________________________________________________________________________________________________________________________________

WALSH, T. R., NEVILLE, W. A., HARAN, M. H., TOLSON, D., PAYNE, D. J., BATESON, J. H., MACGOWAN, A. P., and BENNETT, P. M. (1998). Nucleotide and amino acid sequences of the metallo--lactamase, ImiS, from Aeromonas veronii bv. sobria. Antimicrob Agents Chemother. Vol. 42 (2), p. 436-439. WALSH, T. R., TOLEMAN, M. A., POIREL, L., and NORDMANN, P. (2005). Metallo--lactamases: the quiet before the storm? Clin Microbiol Rev. Vol. 18 (2), p. 306-325. DOI: 10.1128/CMR.18.2.306-325.2005. WALTHER-RASMUSSEN, J., and HOIBY, N. (2007). Class A carbapenemases. J Antimicrob Chemother. Vol. 60 (3), p. 470-482. DOI: 10.1093/jac/dkm226. WALTHER-RASMUSSEN, J., and HIBY, N. (2006). OXA-type carbapenemases. Journal of Antimicrobial Chemotherapy. Vol. 57 (3), p. 373-383. DOI: 10.1093/jac/dki482. WALTHER-RASMUSSEN, J., JOHNSEN, A. H., and HOIBY, N. (1999). Terminal truncations in amp C -lactamase from a clinical isolate of Pseudomonas aeruginosa. Eur J Biochem. Vol. 263 (2), p. 478-485. WANG, J., ZHOU, J. Y., QU, T. T., SHEN, P., WEI, Z. Q., YU, Y. S., and LI, L. J. (2010). Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa isolates from Chinese hospitals. Int J Antimicrob Agents. Vol. 35 (5), p. 486-491. DOI: 10.1016/j.ijantimicag.2009.12.014. WANG, Z., FAST, W., and BENKOVIC, S. J. (1999). On the Mechanism of the Metallo--lactamase from Bacteroides fragilis. Biochemistry. Vol. 38 (31), p. 10013-10023. DOI: 10.1021/bi990356r. WANG, Z., FAST, W., VALENTINE, A. M., and BENKOVIC, S. J. (1999). Metallo--lactamase: structure and mechanism. Curr Opin Chem Biol. Vol. 3 (5), p. 614-622. DOI: S13675931(99)00017-4. WATANABE, M., IYOBE, S., INOUE, M., and MITSUHASHI, S. (1991). Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother. Vol. 35 (1), p. 147151. WEGENER, H. C. (2003). Antibiotics in animal feed and their role in resistance development. Curr Opin Microbiol. Vol. 6 (5), p. 439-445. DOI: S1369527403001206. WITTE, W. (1998). Medical consequences of antibiotic use in agriculture. Science. Vol. 279 (5353), p. 996-997.

184

References
____________________________________________________________________________________________________________________________________________________

WOODFORD, N., TIERNO, P. M., JR., YOUNG, K., TYSALL, L., PALEPOU, M. F., WARD, E., PAINTER, R. E., SUBER, D. F., SHUNGU, D., SILVER, L. L., et al. (2004). Outbreak of Klebsiella pneumoniae producing a new carbapenem-hydrolyzing class A -lactamase, KPC-3, in a New York Medical Center. Antimicrob Agents Chemother. Vol. 48 (12), p. 4793-4799. DOI: 10.1128/AAC.48.12.4793-4799.2004. WRIGHT, G. D. (2007). The antibiotic resistome: the nexus of chemical and genetic diversity. Nat Rev Micro. Vol. 5 (3), p. 175-186. WRIGHT, G. D. (2010). Antibiotic resistance in the environment: a link to the clinic? Current Opinion in Microbiology. Vol. 13 (5), p. 589-594. DOI: DOI: 10.1016/j.mib.2010.08.005. WRIGHT, G. D., and BEGLEY, T. P. (2007). Antibiotics: Bacterial Resistance: John Wiley & Sons, Inc.

XI, C., ZHANG, Y., MARRS, C. F., YE, W., SIMON, C., FOXMAN, B., and NRIAGU, J. (2009).

Prevalence of Antibiotic Resistance in Drinking Water Treatment and Distribution Systems. Appl. Environ. Microbiol. Vol. 75 (17), p. 5714-5718. DOI: 10.1128/aem.00382-09.

XU, D., XIE, D., and GUO, H. (2006). Catalytic mechanism of class B2 metallo--lactamase. J Biol Chem. Vol. 281 (13), p. 8740-8747. DOI: 10.1074/jbc.M512517200.

YAMAGUCHI, Y., TAKASHIO, N., WACHINO, J.-I., YAMAGATA, Y., ARAKAWA, Y., MATSUDA, K.,

and KUROSAKI, H. (2010). Structure of metallo--lactamase IND-7 from a Chryseobacterium indologenes clinical isolate at 1.65- resolution. Journal of Biochemistry. Vol. 147 (6), p. 905-915. DOI: 10.1093/jb/mvq029.

YANG, Q., WANG, H., SUN, H., CHEN, H., XU, Y., and CHEN, M. (2010). Phenotypic and Genotypic Characterization of Enterobacteriaceae with Decreased Susceptibility to Carbapenems: Results from Large Hospital-Based Surveillance Studies in China. Antimicrob. Agents Chemother. Vol. 54 (1), p. 573-577. DOI: 10.1128/aac.01099-09. YANG, Y., and BUSH, K. (1996). Biochemical characterization of the carbapenem-hydrolyzing lactamase AsbM1 from Aeromonas sobria AER 14M: a member of a novel subgroup of metallo--lactamases. FEMS Microbiology Letters. Vol. 137 (2-3), p. 193-200. DOI: 10.1111/j.1574-6968.1996.tb08105.x. YANG, Y. J., WU, P. J., and LIVERMORE, D. M. (1990). Biochemical characterization of a lactamase that hydrolyzes penems and carbapenems from two Serratia marcescens isolates. Antimicrob Agents Chemother. Vol. 34 (5), p. 755-758.

185

References
____________________________________________________________________________________________________________________________________________________

YIGIT, H., QUEENAN, A. M., ANDERSON, G. J., DOMENECH-SANCHEZ, A., BIDDLE, J. W., STEWARD, C. D., ALBERTI, S., BUSH, K., and TENOVER, F. C. (2001). Novel carbapenem-hydrolyzing lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother. Vol. 45 (4), p. 1151-1161. DOI: 10.1128/AAC.45.4.1151-1161.2001. YIGIT, H., QUEENAN, A. M., RASHEED, J. K., BIDDLE, J. W., DOMENECH-SANCHEZ, A., ALBERTI, S., BUSH, K., and TENOVER, F. C. (2003). Carbapenem-Resistant Strain of Klebsiella oxytoca Harboring Carbapenem-Hydrolyzing -Lactamase KPC-2. Antimicrob. Agents Chemother. Vol. 47 (12), p. 3881-3889. DOI: 10.1128/aac.47.12.3881-3889.2003. YONG, D., TOLEMAN, M. A., GISKE, C. G., CHO, H. S., SUNDMAN, K., LEE, K., and WALSH, T. R. (2009). Characterization of a New Metallo--Lactamase Gene, blaNDM-1, and a Novel Erythromycin Esterase Gene Carried on a Unique Genetic Structure in Klebsiella pneumoniae Sequence Type 14 from India. Antimicrob. Agents Chemother. Vol. 53 (12), p. 5046-5054. DOI: 10.1128/aac.00774-09. YU, Y.-S., DU, X.-X., ZHOU, Z.-H., CHEN, Y.-G., and LI, L.-J. (2006). First Isolation of blaIMI-2 in an Enterobacter cloacae Clinical Isolate from China. Antimicrob. Agents Chemother. Vol. 50 (4), p. 1610-1611. DOI: 10.1128/aac.50.4.1610-1611.2006.

ZAFARALLA, G., and MOBASHERY, S. (1992). Facilitation of the to pyrroline tautomerization

2 1

of carbapenem antibiotics by the highly conserved arginine-244 of class A -lactamases during the course of turnover. Journal of the American Chemical Society. Vol. 114 (4), p. 1505-1506. DOI: 10.1021/ja00030a070.

ZAMORANO, L., MOYA, B., JUAN, C., and OLIVER, A. (2010). Differential -lactam resistance response driven by ampD or dacB (PBP4) inactivation in genetically diverse Pseudomonas aeruginosa strains. J Antimicrob Chemother. Vol. 65 (7), p. 1540-1542. DOI: 10.1093/jac/dkq142. ZERVOSEN, A., VALLADARES, M. H., DEVREESE, B., PROSPERI-MEYS, C., ADOLPH, H. W., MERCURI, P. S., VANHOVE, M., AMICOSANTE, G., VAN BEEUMEN, J., FRERE, J. M., et al. (2001). Inactivation of Aeromonas hydrophila metallo--lactamase by cephamycins and moxalactam. Eur J Biochem. Vol. 268 (13), p. 3840-3850. ZHOU, X. Y., BORDON, F., SIROT, D., KITZIS, M. D., and GUTMANN, L. (1994). Emergence of clinical isolates of Escherichia coli producing TEM-1 derivatives or an OXA-1 -lactamase conferring resistance to -lactamase inhibitors. Antimicrob. Agents Chemother. Vol. 38 (5), p. 10851089. DOI: 10.1128/aac.

186