Chin J Integr Med 2009 Aug;15(4):289-292

289

EXPERIMENTAL RESEARCH
Effects of Kangquan Recipe () on Sex Steroids and Cell Proliferation in Rats with Benign Prostatic Hyperplasia
HUANG Yuan-peng ()12, DU Jian ( )2, HONG Zhen-feng ()2, Chen Zhi-qing ()1, Wu Jin-fa ()1, and Zhao Jin-yan ()2
ABSTRACT Objective: To investigate the effects of Kangquan Recipe (, KQR) on sex steroids and cell

proliferation in an experimental benign prostatic hyperplasia (BPH) model in rats. Methods: Seventy-two SD rats were randomly divided into six groups: the normal group, the model group, the finasteride group, and the low-, middle-, and high-dose KQR groups, 12 in each group. Except those in the normal group, the rats were injected with testosterone after castration for the establishment of BPH model and then given respectively with normal saline, finasteride, and low-, middle-, and high-dose of KQR for 30 days. The levels of plasma testosterone (T) and estradiol (E2) were determined by enzyme-linked immunosorbent assay (ELISA), and the mRNA expression of proliferating cell nuclear antigen (PCNA) in prostate tissue was detected by reverse transcription-polymerase chain reaction (RT-PCR) after administration. Results: Compared with the model group, the prostate weight, the plasma T, and the mRNA expression of PCNA were significantly lower, and the plasma E2 and the ratio of E2/T were higher in the three KQR groups (P <0.05 or P <0.01). There was no significant difference in the prostate weight, plasma T and E2, and ratio of E2/T among the finasteride group and the three KQR groups (P >0.05). The mRNA expressions of PCNA were significantly higher in the middle- and low-dose of KQR groups than those in the finasteride group (P <0.05). Conclusion: KQR shows multitarget effects on experimental BPH rats, and the mechanism might be related with regulating the balance of plasma T and E2 and decreasing the PCNAmRNA expression in prostate tissue to restrain cell proliferation in a dose-dependent manner. KEY WORDS Kangquan Recipe, benign prostatic hyperplasia, testosterone, estradiol, cell proliferation

Benign prostatic hyperplasia (BPH) is a common disease in old males. Epidemiological investigations reveal that the incidence of BPH in males over 60 years of age was more than 50%, and 15% to 30% of those are suffering from the lower urinary tract symptoms (LUTS). BPH greatly affects people's health and the quality of life. Chinese medicine has been widely applied to treat BPH because of its reliable effects, low cost, and few adverse reactions(1,2). Our previous studies showed that Kangquan Recipe ( , KQR) could obviously inhibit the pathological hyperplasia of the prostate gland and gland epithelium, decrease the number of the epithelial papillary structureand effectively regulate the mRNA expressions of bax and bcl-2 in prostate tissues to accelerate the cell apoptosis of the prostate in experimental BPH rats(3). On this basis, we further studied its effect on the levels of plasma testosterone (T) and estradiol (E2) and the mRNA expression of proliferating cell nuclear antigen (PCNA) in prostate tissues of BPH rats. The report is as follows.

METHODS
Experimental Animals
Seventy-two male Sprague-Dawley rats, clean grade, and weighing 230-260 g were provided by the Shanghai Shilaike Experimental Animal Co., Ltd., China, with a certificate serial number SCXK (Shanghai) 20030003.

Drugs and Reagents

KQR, composed of Radix morinda officinalis 15 g, eupolyphaga seu steleophaga 15 g, pheretima 15 g, Radix et Rhizoma Rhei 5 g, Ramulus Cimmamomi 5 g, and caulis trachelospermi 20 g, was provided by the Fujian
Supported by the Foundation of Traditional Chinese Medicine of Fujian Province (No. wzy0616), the Foundation of Key Projects from Science and Technology Department of Fujian Province (No. 2008Y0049), and the Foundation of Science and Technology Department of Xiamen (No. 3502Z20084014) 1. Department of Traditional Chinese MedicineZhongshan Hospital, Xiamen University, Fujian (361004), China; 2. Academy of Integrative Medicine, Fujian College of Traditional Chinese Medicine, Fuzhou (350108), China Correspondence to: Prof. HONG Zhen-feng, Tel/Fax: 86-591-22861012, E-mail: zfhong1953@163.com DOI: 10.1007/s11655-009-0289-3

 290

Chin J Integr Med 2009 Aug;15(4):289-292

Tongchun Medicament Stock Company, China. The preparation room of the Fujian College of Traditional Chinese Medicine was responsible for its preparation and quality control. The drugs were decocted and concentrated, each milliliter containing 1.3 g of crude drugs. Proscar (batch No. 260970): each contains 5 mg finasteride, provided by Merck Sharp & Dohme Limited, UK. After griding, it was added into 80 distilled water to solve. Enzyme-linked immunosorbent assay (ELISA) kits for T and E2 were both purchased from the Beijing North Institute of Biological Technology, China. Trizol was obtained from Invitrogen Company, USA. DNTP and M-MLV reverse transcriptase were bought from Promega Company, USA. Taq polymerase and RNase inhibitor were obtained from Amresco Company, USA.

group and the finasteride group died accidentally during the gastrogavage.

Measurement of Indexes of Prostate

Prostate exponent (PE) was calculated based on the following formula: PE= prostate weight (PW)/body weight (BW)100%.

Determination of T and E2 in Plasma

Two milliliter blood samples were collected using heart puncture in rats. The levels of T and E2 were determined by ELISA according to the instructions of the kits.

Determination of mRNA Expression of PCNA in Prostate Tissue

Total RNA was extracted by Trizol reagent. RNA concentration was measured by UV spectrophotometer at 260/280 nm. Agarose gel denaturated with 1% formaldehyde electrophoresis was used to identify RNA quality. PCNA mRNA and internal reference -actin primer were designed and supplied by Invitrogen Limited. PCNAmRNA: sense: 5'- GACACATACCGCTGCGATCG - 3', antisense: 5'- TCACCACAGCATCTCCAATAT' - 3 ', and the product length was 307 bp. -actin sense: 5'-GGCATTGTGATGGACTC-3 ', antisense: 5'-CAG CACTGTGTTGGCATAGA-3', and the product length was 201 bp. Reaction parameters: predegeneration lasted at 95 for 5 min, degeneration at 94 for 30 s, annealing at 59 for 40 s, extension at 72 for 30 s, and terminal extension at 72 for 7 min, which was 30 cycles in total. PCR products were examined by electrophoresis with 1.5% agarose gel. The optical density of DNA bands was scanned using the gel imaging system. The ratio between PCNA mRNA and -actin was calculated. The experiment was repeated for five times.

Experimental Apparatus
Type 9600 PCR instrument was manufactured by Eppendorf Company, Germany. Type Gel DOC 2000 gel digital imaging and analysis system was by Bio-Rad Company, USA. Electrophoresis instrument and horizontal shafts electrophoresis (Type DYY-12) was by Bio-Rad Company, USA. Type DU-650 RNA/ DNA quantitative detector was by Beckman Company, USA. Type 230SEL Enzyme-linked immunosorbent analyzer was by Organon Teknika, Holland.

Grouping, Modeling, and Administration

Seventy-two SD rats were randomly divided into six groups after 1 week of adaptive breeding: the normal group (normal saline, 10 mL/kg), the model group (normal saline, 10 mL/kg), the finasteride group (0.8 mg/kg, equivalent to 10 times the dose for a human adult), the low-dose KQR (LKQR) group (6.5 g/ kg, equivalent to 5 times the dose for a human adult), the middle-dose KQR (MKQR) group (13.0 g /kg, equivalent to 10 times the dose for a human adult), and the high-dose KQR (HKQR) group (19.5 g /kg, equivalent to 15 times the dose for a human adult). BPH model was induced by subcutaneously injecting testosterone propionate, 3.5 mg/kg once a day for 30 days after castration in all rats(4), except those in the normal group, and then, saline or corresponding drugs were administrated by gastrogavage once daily for 30 days. On the next day, after the last administration, the rats were decapitated. The whole prostate tissue was isolated and stored in a -80 refrigerator. During the observation period, one rat in the model

Statistical Analysis
An analysis was performed using SPSS 12.0 statistical software. Data were expressed as mean standard deviation. Statistical significance was analyzed with One-way ANOVA and q -test. P value less than 0.05 was taken as statistically significant.

RESULTS
Comparison of BW, PW, Prostate Volume, and PE among Groups
There was no significant difference in BW

Chin J Integr Med 2009 Aug;15(4):289-292 Table 1.

Group Normal Model Finasteride LKQR MKQR HKQR

291

Comparison of BW, PW, PV, and PE among Groups ( s )

BW (g) 402.7545.36 435.1043.29 413.9040.50

n
12 11 11 12 12 12

PW (g)
0.520.15 1.080.26 0.760.24 0.790.25 0.730.27 0.620.21

PV (mL)
0.870.33 1.730.45 1.300.47 1.420.43 1.290.52 1.100.49

PE (%)
0.1420.049 0.2580.082 0.1890.062 0.2010.064 0.1830.071 0.1610.052

399.9038.19 414.1732.28 408.8229.71

Notes: P <0.01, compared with the normal group; P <0.05, P <0.01, compared with the model group; the same in Table 2.

among all groups, which was comparable among groups before administration (P >0.01). Compared with the normal group, PW, PV, and PE in the model group were significantly higher (P <0.01), indicating that the BPH model was successfully established. Compared with the model group, PW, PV, and PE were significantly lower in the MKQR and HKQR groups (P <0.05 or P <0.01), while PW was significantly lower in the LKQR group (P <0.05). PW, PV, and PE in the three KQR groups had no significant difference compared with the finasteride group (P >0.05, Table 1).

model group (P <0.01). They were significantly lower in the three KQR groups and the finasteride group than that in the model group (P <0.05 or P <0.01). Compared with the finasteride group, they were significantly higher in the LKQR and MKQR groups (P <0.05, Table 3, Figure 1).
Table 3. Comparison of Expression of PCNA mRNA in Prostate Tissue among Groups ( s )
Group Normal Model Finasteride LKQR MKQR HKQR

n
12 11 11 12 12 12

PCNA mRNA (OD value) 0.9860.452 2.8690.812 1.2050.674 1.9560.768 1.8160.724 1.5320.697

Comparison of Plasma Levels of T, E 2, and Ratio of E2/T among Groups

Compared with the normal group, the plasma T was significantly higher, and the plasma E2 and ratio of E2/T were significantly lower in the model group (P <0.01). Compared with the model group, the plasma T was significantly lower, and the E2/T ratio was significantly higher in the three KQR groups (P <0.05 or P <0.01), whereas the plasma E 2 was significantly higher in the MKQR and HKQR groups (P <0.05). There was no significant difference in the above indexes between the three KQR groups and the finasteride group (P >0.05, Table 2).

Notes: P <0.01, compared with the normal group; P <0.05,

P <0.01, compared with the model group; P <0.05, compared

with the finasteride group

500 bp 400 bp 300 bp 200 bp 100 bp

307 bp 201 bp

Comparison of Expression of PCNAmRNA in Prostate Tissue among Groups

Compared with the normal group, the mRNA expression of PCNA was significantly increased in the
Table 2. Comparison of Plasma Levels of T, E2, and Ratio of E2/T among Groups ( s )
Group Normal Model Finasteride LKQR MKQR HKQR

Figure 1.

PCNA mRNA Electrophoresis in Prostate Tissue

Notes: A1,A2: the LKQR group; B1, B2: the MKQR group; C1, C2: the HKQR group; D1, D2: the finasteride group; E1, E2: the normal group; F1, F2: the model group

DISCUSSION
Berry, et al (5) discovered that BPH incidence in histology was about 10% in the 35 years old; it gradually increased with aging and was more than 50% in males over 60. Gu, et al (6) found that the incidence of BPH in China was similar to that in Europe and United States according to 321 cases of domestic prostate autopsy specimens in 1993.

n
12

T (ng/mL) 9.183.07

E2 (pg/mL) 70.5219.16 82.2425.19 86.2122.93

E2/ T () 4.951.85 7.022.67 7.45231

110.7630.29 11.673.18

11 17.234.25 11 12.975.01 12 13.054.78

12 11.834.59 96.1928.47 9.352.97 12 11.325.26 92.8926.05 9.172.86

 292

Chin J Integr Med 2009 Aug;15(4):289-292

For BPH, KQR is one of the effective prescriptions proved by our long-term clinical practice. Through literature research and theoretical analysis, we consider that the basic pathologensis of BPH from the view of Chinese medicine is Shen ( ) deficiency, blood stasis, heat, and toxin obstructing the collaterals (7). KQR prescription, conforming to the rule of tonifying Shen but without prolonging pathogenic factors and eliminating pathogenic factors but without damaging vital qi, has effects on tonifying Shen, promoting blood flow, removing the obstruction of collaterals, clearing away heat, and resolving mass. This study shows that KQR could effectively reduce prostate weight, prostate volume, and regulating sex hormones levels in experimental BPH rats. Prostate is a sex steroid-dependent organ. Studies showed that the occurrence of BPH is related to the interaction between androgen and estrogen. The imbalance between E2 and T plays an important role in the pathogenesis of BPH(8). This study shows that the plasma T in the model group was significantly higher, and the plasma E 2 and ratio of E 2/T were significantly lower compared with the normal group. Compared with the model group, the levels of the plasma T were significantly lower in the three KQR groups; the levels of the plasma E2 were significantly higher in the middle and high dose KQR groups; and the ratios of E2/T were significantly higher in the three KQR groups. These indicated that one of the mechanisms of KQR in inhibiting BPH in experimental rats might be related with regulating the balance of plasma E2 and T, which might be consistent with the theory of its effect of tonifying Shen. Cell proliferation and death are bound to achieve a dynamic balance to maintain a normal structure and function of the prostate, which are both involved in the occurrence process of BPH (9, 10). PCNA is a 36 kD ribonucleoprotein that can be used as an important indicator of proliferation activity (11). Our studies show that the expression of PCNA mRNA in the model group was significantly higher compared with the normal group, implying that cell proliferation was involved in the process of BPH occurrence. The expressions of PCNA mRNA were obviously lower in the three KQR groups compared with the model group. The indexes were obviously higher in the middle-and low-dose KQR groups but that in the high-dose KQR group was insignificantly different

compared with the finasteride group, indicating that one possible mechanism of KQR therapeutic effects in rats with BPH might be related with decreasing the expression of PCNA mRNA in the prostate tissue to inhibit the cell proliferation of the prostate, but the effects of the low- and middle-dose KQR to inhibit the cell proliferation of the prostate were not as good as that of finasteride. In summary, KQR shows multitarget effects in BPH rats. It can significantly increase plasma E2, reduce plasma T and regulate the balance of T and E2, as well as decrease PCNA mRNA expression in the prostate tissue to inhibit the cell proliferation of prostate in a dose-dependent manner.

REFERENCES
1. 2. Gu FL, ed. Modern prostate diseases. 1st ed. Beijing: People's Military Medical Press; 2003:3-187. Guo J, Chang DG, eds. Integrated traditional and Western medical treatment of andrology. 1st ed. Beijing: People's Military Medical Press; 2003:243-271. 3. Huang YP, Du J, Hong ZF, Chen ZQ, Zhao JY, Li TJ, et al. Effect of Kangquan Recipe on apoptosis regulatory genes bax and bcl-2mRNA in prostate of rats. Chin J Integr Tradit West Med (Chin) 2007;27:711-714. 4. Ministry of Health, P.R. China. Guidance on principle of preclinical research on new drugs. Beijing: People's Medical Publishing House; 1993:101-103. 5. Berry SJ, Coffey DS, Walsh PC, Ewing LL. The development of human benign prostatic hyperplasia with age. J Urol 1984;132:474-479. 6. Gu FL. Preliminary study of the frequency of benign prostatic hyperplasia and prostatic cancer in China. Chin J Surg (Chin) 1993;31:323-326. 7. Huang YP, Wu JF. On relation of collaterals diseases in TCM and benign prostatic hyperplasia. Chin J Tradit Chin Med Pharm (Chin) 2006;21:45-46. 8. Zhu G, Wang JY, Liu JD. Effects of estrogen and androgen on prostatic stromal cell proliferation. Chin J Urol (Chin) 2000;21:361-363. 9. Deng FM, Gu FL, Xia TL, Kong XT. Proliferation and apoptosis in BPH. Chin J Surg (Chin) 1996;34:620-622. 10. Peng J, Zhang Q, Yu W, Guo YL, Jin J. Effect of angiotensin on prostatic cell proliferation and apoptosis in rats. Chin J Urol (Chin) 2006;27:615-617. 11. Hall PA, Levison DA, Woods AL, Yu CC, Kellock DB, Watkins JA, et al. Proliferating cell nuclear antigen (PCNA) immunolocalization in paraffin sections: an index of cell proliferation with evidence of deregulated expression in some neoplasms. J Pathol 1990;162:285-293. (Received September 5, 2008) Edited by GUO Yan