A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum

resistance to Magnaporthe oryzae Alok Das, D.Soubam, P.K.Singh, S.Thakur, N.K.Singh & T.R.Sharma

Functional & Integrative Genomics ISSN 1438-793X Volume 12 Number 2 Funct Integr Genomics (2012) 12:215-228 DOI 10.1007/s10142-012-0284-1

1 23

Your article is protected by copyright and all rights are held exclusively by SpringerVerlag. This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to self-archive your work, please use the accepted authors version for posting to your own website or your institutions repository. You may further deposit the accepted authors version on a funders repository at a funders request, provided it is not made publicly available until 12 months after publication.

1 23

Author's personal copy

Funct Integr Genomics (2012) 12:215228 DOI 10.1007/s10142-012-0284-1

ORIGINAL PAPER

A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae
Alok Das & D. Soubam & P. K. Singh & S. Thakur & N. K. Singh & T. R. Sharma

Received: 9 February 2012 / Revised: 21 April 2012 / Accepted: 30 April 2012 / Published online: 17 May 2012 # Springer-Verlag 2012

Abstract The dominant rice blast resistance gene, Pi54 confers resistance to Magnaporthe oryzae in different parts of India. In our effort to identify more effective forms of this gene, we isolated an orthologue of Pi54 named as Pi54rh from the blast-resistant wild species of rice, Oryza rhizomatis, using allele mining approach and validated by complementation. The Pi54rh belongs to CC-NBS-LRR family of disease resistance genes with a unique Zinc finger (C3H type) domain. The 1,447 bp Pi54rh transcript comprises of 101 bp 5-UTR, 1,083 bp coding region and 263 bp 3-UTR, driven by pathogen inducible promoter. We showed the extracellular localization of Pi54rh protein and the presence of glycosylation, myristoylation and phosphorylation sites which implicates its role in signal transduction process. This is in contrast to other blast resistance genes that are predicted to be intracellular NBS-LRR-type resistance proteins. The Pi54rh was found to express constitutively at basal level in the leaves, but upregulates 3.8-fold at 96 h postinoculation with the pathogen. Functional validation of cloned Pi54rh gene using complementation test showed high degree of resistance to seven isolates of M. oryzae
A. Das : D. Soubam : P. K. Singh : S. Thakur : N. K. Singh : T. R. Sharma (*) National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi 110 012, India e-mail: trsharma@nrcpb.org T. R. Sharma e-mail: trsharma1965@gmail.com Present Address: A. Das Division of Crop Improvement, Indian Institute of Pulses Research, Kanpur, Uttar Pradesh 208 024, India

collected from different geographical locations of India. In this study, for the first time, we demonstrated that a rice blast resistance gene Pi54rh cloned from wild species of rice provides broad spectrum resistance to M. oryzae hence can be used in rice improvement breeding programme. Keywords Rice blast . NBS-LRR . Pi54 . Pikh . Allele mining . Magnaporthe oryzae . Oryza rhizomatis

Introduction Outbreaks of rice blast disease, caused by the fungal pathogen, Magnaporthe oryzae, are a recurrent problem in all rice-growing regions of the world. The pathogen infect rice plant at all growth stages from seedling to grain formation, affecting leaves, nodes, collars, panicles and roots resulting total loss of the rice grain (Dean et al. 2005). The use of resistance (R) genes in rice improvement breeding programmes for disease management has been considered as one of the best options (Hulbert et al. 2001). However, host resistance is short-lived in disease-prone environments because of high level of variability in the pathogen population. To develop durable blast resistance rice varieties, isolation of more resistance genes with varying specificities is required, as this helps in the gene stacking into elite cultivars via marker-aided breeding or transgenic approaches. Alternatively, broad spectrum disease resistance genes can also be used for blast management. Wild germplasm of rice are treasure trove, as they harbour many useful traits for tolerance to biotic and abiotic stresses, particularly disease resistance (Barclay 2004). Resistance source against grassy stunt virus from Oryza nivara, blast resistance gene Pi9(t) and bacterial blight resistance gene from Oryza minuta, Brown Plant Hopper, White Back Plant

Author's personal copy

216 Funct Integr Genomics (2012) 12:215228

Hopper and bacterial blight resistance from Oryza officinalis, cytoplasmic male sterility from Oryza rufipogon, and bacterial blight resistance gene, Xa21 from Oryza longistaminata are some of the examples of utilization of wild species of rice. The wild rice, Oryza rhizomatis has been found to be highly resistant to M. oryzae strain PLP-1, the predominant isolate widely distributed in the Northwestern Himalayan region (Sharma et al. 2002). One of the recent approaches used for cloning new and better forms of disease resistance genes is allele mining for which the nucleotide sequence of the gene should be known. The dominant blast-resistant gene, Pi54 cloned from the indica rice line Tetep, associated with resistance to rice blast disease prevalent in different parts of India, has been mapped, cloned and characterized (Sharma et al. 2005a, b; Rai et al. 2011; Gupta et al. 2012). Thus, allele mining for Pi54 orthologue from wild species of rice, O. rhizomatis can be a potential tool for finding alternate and better forms of the gene that can be used for rice blast management. The riceMagnaporthe interaction has emerged as a model system for the analysis of plantpathogen interactions because of its economic significance, genetic tractability and genomic resources available in these species. Racespecific resistance to M. oryzae closely follows the classical gene-for-gene relationship (Silue et al. 1992). The isolation and subsequent characterization of R-genes from rice will help to unravel varied molecular mechanisms underlying the interaction between host and the pathogen. Approximately 100 R-genes have been mapped on the rice genome but only 19 genes have been cloned and characterized (Sharma et al. 2012). The cloned genes includes, Pib (Wang et al. 1999), Pita (Bryan et al. 2000), Pi54(Pikh) (Sharma et al. 2005a, 2010), Pi-9 (Qu et al. 2006), Pid2 (Chen et al. 2006), Pi2 and Piz-t (Zhou et al. 2006), Pi-36 (Liu et al. 2007), Pi-37 (Lin et al. 2007), Pikm (Ashikawa et al. 2008), Pi5 (Lee et al. 2009), Pid3 (Shang et al. 2009), pi21 (Fukuoka et al. 2009), Pit (Hayashi et al. 2010a), Pb1 (Hayashi et al. 2010b), Pish (Takahasi et al. 2010), Pi-k (Zhai et al. 2011), Pik-p (Yuan et al. 2011) and Pia (Okuyama et al. 2011). With the exception of Pid2, which encodes -lectin receptor kinase, all the cloned R-genes are intracellular having NBS-LRR domains that function in conditioning disease resistance. In this paper, we describe the structural and functional characterization of the novel extracellular-LRR protein, Pi54rh and its effectiveness against the hemibiotropic pathogen M. oryzae.

study were originally received from Tamil Nadu Agricultural University, Coimbatore and then maintained at National Research Centre on Plant Biotechnology, New Delhi, India. The species were grown and maintained at the National Phytotron Facility (IARI), New Delhi. Seven isolates of M. oryzae such as PLP1, Shihunta1, RML29, MSF9 (Kangra Valley, Himachal Pradesh, India), Mawana, Deh-1 (North Indian Plains) and MG79 (East India) collected from different geographical locations of India were maintained at National Research Centre on Plant Biotechnology, New Delhi, India. The virulence spectrum of these isolates has already been tested on monogenic lines of rice (Rathour et al. unpublished data). All the oligos used in the study were HPLC purified are given in Table 1. Cloning of Pi54rh and expression analysis The nucleotide sequence of Pi54 gene (National Center for Biotechnology Information (NCBI) accession no. AY914077) was retrieved and aligned to the nucleotide sequence of O. sativa ssp. japonica cv. Nipponbare Chromosome 11 PAC Clone (NCBI account no. C104846) using the MegaBLAST software (Altschul et al. 1997) and the nucleotide sequence was retrieved along with 500-bp downstream and upstream flanking sequences. Primer pair (PIRH F and PIRH R) was designed by using Primer 3 software (Rozen and Skaletsky 2000) so as the full-length orthologue of Pi54 can be amplified from the genomic DNA of O. rhizomatis. PCR amplification was carried out on programmable Thermal Cycler (BioRad, Washington DC, USA) using the following temperature profile: initial DNA denaturation, 98 C for 30 s; followed by 35 cycles of denaturation, 98 C for 10 s; annealing, 60 C for 30 s; extension, 72 C for 1 min; and final extension at 72 C for 5 min and then hold at 4 C. The amplification product was cloned in pGEM-T Easy vector (Promega, Madison, USA), sequenced four times and assembled to obtain high-quality sequence. The orthologue amplified from the wild species, O. rhizomatis was named as Pi54rh (rh-rhizomatis). Inverse PCR was done to walk upstream of the cloned gene. For this, genomic DNA of O. rhizomatis was digested with Hind III (MBI Fermentas, Burlington, Ontario, Canada). The digested product was ligated using T4 DNA ligase (MBI Fermentas, Burlington, Ontario, Canada) and the ligated product was used as template for inverse PCR using primers (IL1 and IR1) designed from the terminals orienting outwards. The expression analysis of Pi54 orthologue in the wild species of rice, O. rhizomatis, pre- and post-infection with M. oryzae isolate PLP-1 (widely prevalent isolate collected from the Northwestern Himalayan region of India) was assessed using real-time PCR. Fifteen-day-old seedlings of O. rhizomatis and TP309 were inoculated with an M. oryzae spore suspension containing 10 5 spores/ml in 0.25 %

Materials and methods Plant material, fungal strains and oligos The wild species of rice O. rhizomatis (nrcpb 002) and the susceptible Oryza sativa cv. Taipei 309 (TP309) used in this

Author's personal copy

Funct Integr Genomics (2012) 12:215228 Table 1 List of oligos used in the study 217 Oligos Cloning of Pi54rh PIRH F PIRH R Inverse PCR IL 1 IR 1 Real-time PCR EXON F EXON R TUB F Sequence Tm (C)

5 CAGTTGCAGAAACAGATCAACAG 3 5 CATAAGCTAGACCTTGAAGGATGTC 3 5GGTTGGAGGTTTTCAGGTACTCCATGAT 3 5 TTTCTGTGAAGAGTTGCATGCTTCTTCA 3 5AAGATTTTCGAGGCTCTTCTCTA 3 5 GATGAATCTGTTTCCTCGTCTTG 3 5 TCCCTGGTCAGCTCAACTCT 3

60.0 60.0 60.0 60.0 58.0 58.0 58.0 58.0 60.0 60.0 62.0 58.0 58.0 58.0 60.0 60.0 58.0 58.0 58.0 58.0 58.0 58.0

TUB R 5 CATCCCACATTTGCTTGTGTC 3 Rapid amplification of cDNA ends (RACE) 5RACE OP 5R OP 5RACE IP 5R IP 3RACE OP 3R OP 5 GCTGATGGCGATGAATGAACACTG 3 5 TCAGACATGGTAGTAGCCCAAG 3 5CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG3 5 TGCCTTTTCACATGCTCTCA3 5 GCGAGCACAGAATTAAATACGACT 3 5 GGGTCTACAGGCTCTTGGTG 3

BF.EXON 5 CTGGATCCATGTACATTGGTAGTAGTGC 3 BR.EXON 5 CTGGATCCCTGGTTTTCTAAACTGGGGCA3 PCR screening of transgenic lines PI F 5 TGGAATGTGGATACCACCGA 3 PI R 5 CGAGGCTCTTCTCCACACCT 3 HYG F 5 TCAACACATGAGCGAAACCC 3 HYG R 5 AACTGTGATGGACGACACCG 3 Probe preparation MV F RH R 5 CAGGCTTTACACTTTATGCTTCCGGCTC 3 5 CGAGGCTCTTCTCCACACCT 3

gelatine, until leaves were covered with fine droplets. For mock control, plants were inoculated with gelatine only. The experiment was carried out under controlled growth conditions at 251 C and 90 % RH for 24 h in dark and then shifted to 16/8-h light/dark regime. Total RNA was isolated with the TRIzol reagent (Invitrogen, Carlsbad, CA) from 250-mg leaf tissues of seedlings (three to four leaf stage) of O. rhizomatis and Taipei 309 (TP 309) collected at 0, 24, 48, 72 and 96 h post-inoculation with M. oryzae. The relative quantification of the expression was performed using quantitative real-time PCR (qRT-PCR). The qRT-PCR analysis was conducted using SuperScript III Platinum(R) SYBR Green One-Step qRT-PCR Kit (Invitrogen, Carlsbad, CA) in the Comparative Quantification Programme of MxPro3000P system (Stratagene, Agilent Technologies, Santa Clara, USA). Primers (EXON F and EXON R) were designed from the 3end of the isolated gene using Primer 3 software so as to amplify 150-bp unique region. Similarly, primers (TUB F and TUB R) were designed from rice tubulin gene (NCBI GeneID: 4333632) for using as standard in the qRT-PCR

experiment. At least three independent leaf samples were used per treatment separately with exon-specific and tubulinspecific primers. The data was normalized by the value of rice tubulin gene using the CT method (Livak and Schmittgen 2001), and the fold change in the expression level was calculated compared with that of the sample harvested before inoculation and the standard error of the mean was calculated. Dissociation curve programme was executed to confirm the specificity of the target amplification product. Structural and comparative analysis of Pi54rh In silico structural and functional prediction of high-quality assembled sequence was performed using the following softwares. DNA sequence similarity search was done using homology dependent BLASTn (Altschul et al. 1997) and the comparison of nucleotide sequence was done using BioEdit Ver. 7.0.9 (www.mbio.ncsu.edu). Structural annotation was done with open reading frame (ORF) Finder, PLACE (Higo et al. 1999) and PlantCARE (Lescot et al. 2002) softwares.

Author's personal copy

218 Funct Integr Genomics (2012) 12:215228

Functional annotation was performed after translating the sequence in all six reading frames. The largest reading frame was considered for further analysis. Functional motifs were predicted using COIL (Lupas et al. 1991) and ExPASy (http://www.expasy.ch/tools/) tools and tertiary structure predicted using Discovery Studio 2.1 (http://accelrys.com/ products/discovery-studio/). Amino acid sequence deduced from the ORF of Pi54rh was again compared with Pi54 sequence using BioEdit software. Structural relatedness of Pi54rh with other cloned R-genes of rice was analysed by constructing a phylogenetic tree based on sequence similarity. Coding DNA Sequence of 19 cloned blast resistance genes namely Pib (AB013448), Pita (AF207842.1), Pi54 (AY914077.1), Pi-9 (DQ285630.1), Pid2 (FJ915121.1), Pi2 and Piz-t (DQ352453.1 and DQ352040.1), Pi-36 (DQ900896.1), Pi-37 (DQ923494.1), Pikm (AB510262.1), Pi5 (EU869185.1), Pid3 (FJ773286.1), pi21 (AB430853.1), Pit (AB379816.1), Pb1 (AB570371.1), P i s h ( O s 0 1 g 0 7 8 2 1 0 0 , N M _ 0 0 11 8 5 6 6 3 . 1 ) , P i - k (HM048900.1), Pik-p (HM035360.1) and Pia (AB604626.1) were retrieved from the NCBI database. The derived sequences were used for multiple sequence alignment using Clustal X version 1.83 (Thompson et al. 1994). The output of the multiple sequence alignment was used to construct a phylogenetic tree by using MEGA 4.1 software (Tamura et al. 2007). Full-length transcript cloning and subcellular localization studies Rapid amplification of cDNA ends (RACE) was conducted by using the First Choice RLM-RACE (Ambion, Austin, Texas, USA), following the manufacturer's instructions. Total leaf RNA of O. rhizomatis was extracted at 96 h after inoculation with the M. oryzae, using SV Total RNA Isolation System (Promega, Madison, USA). Primers for the first round of amplification of the 5 RACE were used as 5RACE outer primer (supplied by the manufacturer) and 5R OP (designed 383-bp downstream of predicted ATG). A 10-fold dilution of the resulting PCR product served as template for the second round of amplification using 5 RACE inner primer (supplied by the manufacturer) and 5R IP (designed 350-bp downstream of predicted ATG). The 3 RACE was performed by using 3 RACE outer primer (supplied by manufacturer) and 3 R OP (designed 346-bp upstream of TAG). The RACE products were re-amplified and sequenced at least two times from both the directions. The deduced Pi54rh peptide sequence was subjected to subcellular location prediction using WoLF POSRT software (Horton et al. 2007). The open reading frame of Pi54rh excluding the stop codon was PCR amplified by the exonspecific primers (BF.EXON and BR.EXON) containing BamHI sites. After digestion, the PCR fragment was ligated

in frame with the N terminus of the sGFP coding region of pUC18 vector and expressed under the control of CaMV 35S promoter. The lower epidermis of onion was peeled and placed in osmoticum medium [MS+gelrite (2.5 g/L)+0.2 M each of mannitol and sorbitol] and incubated in dark for 4 h prior to bombardment. The native and recombinant constructs (1.0 g each) were coated separately on 0.6-mdiameter gold particles and shot into osmotically adjusted onion epidermal cell layers by a pneumatic particle gun (PDS-1000/He, BioRad, Washington DC, USA). Bombardment conditions were kept as 25-mmHg vacuum, 1,100 psiHe and target distance 6 cm from the launch assembly in a Gene gun (PDS 1000, BioRad, Washington DC, USA). The cells were retained in the osmoticum medium for 24 h at 22 C in dark. The cells were observed by a confocal microscope (TCS SP2, Leica, Wetzlar, Germany) with a filter set providing 455490-nm excitation and emission above 507 nm and the images were documented in Leica AF software. Complementation assay Rice transformation vector (pRTV) was constructed using pBlueScriptSKII (Stratagene, USA) containing full-length transcript of Pi54rh driven by CaMV35S (2X) and terminated by nos in the SmaI site of the MCS, and the BstXI and SacII fragment from pCAMBIA 1305.1 containing hygromycin (hygR) cassette. Rice callus was induced from the embryos of the mature seeds of japonica rice cultivar Taipei 309 (TP 309) which is highly susceptible to M. oryzae. Genetic transformation was attempted in the embryogenic calli of TP309 by biolistic approach using helium-driven Particle Delivery System (PDS 1000, BioRad, Washington DC, USA). The calli were regenerated into mature fertile plants following the standard methods (Hiei et al. 1994). Presence of transgene was assessed by PCR by Pi54rhspecific primers (PIF and PI R); hygR primers (HYG F and HYG R) and the integration of the transgene in the transgenic lines were further confirmed by Southern hybridization. For this, DIG-UTP-labelled PCR probe were prepared using primers MV F and RH R from the junction of CaMV35S and Pi54rh gene in the pRTV vector. For Southern hybridization, total genomic DNA was digested with EcoRI , electrphoresed and probed for the presence of Pi54rh. The RT-PCR was conducted using total leaf RNA by hygromycin-specific primers. Segregation ratio of independent events was analysed based on PCR amplification with gene-specific primers in T1 generation. A promising line (TP 8.3) was identified and advanced to T2 and T3 generations to attain homozygosity. The transmission of the transgene into subsequent selfed generation (T2 and T3) was confirmed by PCR with gene-specific primers and by phenotyping with specific isolate of M. oryzae.

Author's personal copy

Funct Integr Genomics (2012) 12:215228 219

For phenotyping of different generations of transgenic plants, 2-week-old seedlings of a transgenic line (TP 8.3) were inoculated separately with M. oryzae (isolates PLP1, Deh-1, Shihunta1, RML29, MSF9, MG79 and Mawana) spore suspension, as described earlier. The wild species, O. rhizomatis, susceptible line TP 309 were used as positive and negative controls, respectively. Disease reaction was recorded after 7 days of inoculation by using 05 disease assessment scale (Bonmann et al. 1986). Where 0 0 no evidence of infection; 1 0 brown specks smaller than 0.5 mm in diameter, no sporulation; 2 0 brown specks about 0.51.0 mm in diameter, no sporulation; 3 0 roundish to elliptical lesions, 1 3 mm in diameter, grey centre surrounded by brown margins, lesions capable of sporulation; 4 0 typical spindle-shaped blast lesions capable of sporulation,3 mm or longer; 5 0 lesions as in four but about half of one to two leaf blades killed by coalescence of lesions. Reaction types 0, 1, 2 and 3 were considered resistant, while 4 and 5 as susceptible.

Results Cloning, expression, annotation and comparative analysis of Pi54rh We cloned Pi54rh gene (~1.5 kb) from the genomic DNA isolated from wild species of rice, O. rhizomatis based on flanking sequence information from the genome sequences of rice cultivar Nipponbare. Cycle sequencing of amplified gene was performed four times by using M13 (forward and reverse) primers and ET-Dye terminator sequencing chemistry (Amersham Pharmacia Pvt. Ltd, USA). All the sequence reads were assembled to get a high quality (>Phred 30) consensus sequence (Ewing and Green 1998). Total sequence length of Pi54rh orthologue obtained after assembly was 1,448 bp and submitted to EMBL Database (accession no. HE589445). Inoculation of O. rhizomatis with M. oryzae strain, PLP-1 under artificial conditions showed that the wild species was resistant to the pathogen. To study the expression of Pi54 orthologue in this resistant species, real-time PCR analysis was performed for the quantitative estimation of the expressed Pi54rh upon M. oryzae infection. The relative quantity chart showed that the expression of Pi54rh in O. rhizomatis was maintained at basal level up to 72 h but increased up to 3.8-folds at 96 h post-inoculation (Fig. 1). The predicted 1,083 bp ORF of Pi54rh was compared to Pi54 gene sequence (account no. AY914077) earlier cloned from blast-resistant indica rice line Tetep (Sharma et al. 2005a). Forty seven transitions, 24 transversions and 1 InDel differentiated this orthologue from the original gene

sequence of Pi54. Transitions were more as compared to transversions in the ORF region and single-nucleotide polymorphism (SNP) frequency was 1 SNP/23 bp. Overall, 93.45 % identity was observed in the DNA sequence of the ORF of Pi54 and its orthologue, Pi54rh. The deduced ORF encode 360 residue polypeptide with an estimated molecular weight of 41.00 kD, pI of 5.09 and instability index of 53.02, predicting it a cytosolic unstable protein. The deduced amino acid sequence of PI54RH was 88.78 % identical to Pi54 protein, besides being 30 residues longer. The COIL analysis showed that a Coiled Coil (CC) region is probably present (P >0.95) between position 22 and 49 of amino acids sequence. A nucleotide binding site (NBS) motif was obtained between amino acids 145 and 165, with low probability. The two leucine-rich repeats (LRRs) domains spanning 253275 and 277299 amino acids were also predicted in the sequence. A unique Zn-finger domain was predicted between NBS and LRR region spanning 253 263 amino acids. Besides, the deduced polypeptide has three N-glycosylation sites, ten caesin kinase II phosphorylation sites, four N-myristoylation sites, two protein kinase phosphorylation sites and a tyrosine kinase phosphorylation site, implicating its role in signal transduction process. Regulatory elements viz., CAAT Box (105-bp upstream of ATG), BH-box (205-bp upstream of ATG), G-box (285-bp upstream of ATG) were also predicted in the upstream region of the isolated orthologue. The structural features of Pi54 orthologues isolated from Nipponbare, Tetep and O. rhizomatis (Pi54rh) were compared (Fig. 2ac). The Pi54 orthologue in Nipponbare has three insertions: a 49-bp insertion in the promoter region, a 30-bp insertion in the open reading frame and 140-bp insertions in the terminator region. In Tetep, five regulatory elements viz., WUN-1 motif, MeJA responsive element, CAAT box, TATA box and GT-1 box were predicted in the promoter along with a 990-bp open reading frame followed by polyA signal. In O. rhizomatis, four regulatory elements viz., G-box, BH-box, CAAT box and WRKY box were predicted in the promoter region along with a 1,080-bp open reading frame followed by polyA signal (Fig. 2ac). The tertiary structure of PI54RH protein formed 13 -helices and 10 -sheets and has a horseshoe-shaped appearance (Fig. 2d). The comparative analysis of Pi54rh with 19 blast disease resistance genes cloned from rice formed two major groups (cluster I and cluster II) with distinct gene-wise subgrouping. The two subgroups, namely IA (Pi2, Pi-zt, Pi9, Pi37, Pish, Pikm, Pik and Pikp) and IB (Pi36, Pib, Pid3, Pb1, pi21, Pid2, Pia and Pit) were obtained within the cluster I and the rest (Pita, Pi54, Pi54rh and Pi5) in cluster II (Fig. 3). The Pi54rh gene appears to be more closely related to Pi54 (distance matrix value 1.73), indicating its homology (ortholog nature) and more evolutionary relatedness as compared to another blast resistance gene Pi5.

Author's personal copy

220 Fig. 1 Relative quantity chart showing expression of Pi54rh and tubulin in O. rhizomatis and TP309 at 0, 24, 48, 72 and 96 h post-inoculation with M. oryzae. (I) O. rhizomatis, (II) TP309 and (III) tubulin. Tubulin was used as internal control in the experiment Funct Integr Genomics (2012) 12:215228

49 bp insertion

30 bp insertion

140 bp insertion

ATG

1017
Exon 1

1121

TAA Exon 11

1492

134

Poly A
1443

423
-343 -269 -221 -101 -64 -47

1122

A TG 990 bp (ORF) 452

TA A

Poly A
1442 TA G

WUN-1 Me JA resp CAAT TATA Motiff Box Box Box

GT Box

-285 -205 -105

-39

A TG 1080 bp (ORF) 335

c
G Box BH CAAT WRKY Box Box Box

Poly A
1415

Fig. 2 Structural components of Pi54 orthologues. a Nipponbare; b Tetep [both obtained from Sharma et al. 2005a]; c O. rhizomatis and d tertiary structure of PI54RH protein generated by homology modelling using Modeller module of Accelrys Discovery Studio Software. CC

domain (sky blue), NBS domain (parrot green), LRR domains (violet) and Zn-finger domain (yellow), N indicates amino terminal and C indicates carboxy terminal of PI54RH protein

Author's personal copy

Funct Integr Genomics (2012) 12:215228 Fig. 3 Phylogenetic analysis of the Pi54rh with 19 blast resistance genes cloned from rice. Bootstrap values, corresponding to the match times of branching orders (1,000 replicates), are shown at the nodes of each branch point. The unit of branch length is 0.2 nucleotide substitutions per site, as indicated by a bar at the bottom left corner of the tree
51 Pi9 100

221

Pizt Pi2 Pi37

IA

61

100 Pish

Pikm
100

Pik
100 Pikp

I
Pi36 Pib

Pid3 Pb1 pi21 Pid2 Pia Pit Pita Pi54rh Pirh

51

IB

II

Pi5

0.2

Isolation of full-length transcript and subcellular localization of Pi54rh Rapid amplification of cDNA Ends (RACE) indicated 101-bp upstream of start codon (ATG) and 263-bp downstream of stop codon (TGA), corresponding to 5 and 3 UTR of the Pi54rh transcript making the total to 1,447 bp. The subcellular location of the PI54RH protein was predicted to be extracellular (secreted) with the neural net score of 2.3 and identity of 11.0 % to the secreted protein. To validate this prediction, reporter gene for GFP was fused in-frame to the C-terminal of Pi54rh under the control of constitutive CaMV 35S promoter and bombarded into osmotically balanced onion epidermal cells. The gene expression was analysed after 24 h using a fluorescent microscope. The fluorescence comparison with bright field images indicated that the fusion protein, PI54RH-GFP was localized extracellularly, whereas the GFP control was evenly distributed throughout the cell (Fig. 4ac). These results indicate that the PI54RH protein is extracellular in nature. Complementation analysis of Pi54rh The rice transformation vector pRTV (Fig. 5a) containing Pi54rh and hygR selectable marker genes were transferred

into the highly blast susceptible rice variety Taipei 309. The transgenic plants were first confirmed by PCR. The presence of 625 bp Pi54rh-specific and 475 bp hygR-specific amplification products was obtained in all the T0 transgenic plants (Fig. 5b). Southern analysis of transgenic plants showed presence of a typical gene-specific band indicating integration of gene in the rice genome (Fig. 5c). The RT-PCR analysis of selected transgenic lines confirmed the expression of hygromycin gene (Fig. 5d). In subsequent generations (T1, T2 and T3) a 625 bp gene specific product was obtained in the transgenic plants. The examples of gene-specific PCR product are given in Fig. 5e, f. All the transgenic plants were evaluated for their reaction to M. oryzae at seedling stage and also in different generations. The detailed phenotypic analysis of the transgenic event TP 8.3 was performed in different generations (Table 2). Disease reaction of 16 TP 8.3 plants showed segregation of plants as 14 in resistant and 2 in susceptible categories. One of the highly resistant plants TP 8.3.45 was selfed and its progenies (T2 generation) showed 3:1 Mendelian ratio (P 0 0.6153) when evaluated with the same isolate of M. oryzae. These plants were selfed and progenies of resistant (reaction category 1) plant TP 8.3.45.2 were again evaluated in T3 generation to achieve complete homozygosity. All the plants were resistant to M. oryzae isolate PLP-1 (Table 2). The progenies derived

Author's personal copy

222 Fig. 4 Subcellular localization of the PI54RH protein in onion epidermal cells observed under confocal microscope. Green fluorescent protein (GFP) images are captured in a dark field, cellular architectures are visualized under a light field (LIGHT) and the two images are superimposed (MERGE); a GFP-PI54RH fusion protein under the control of CaMV 35S promoter appeared extracellular; b GFP alone under the control of CaMV 35S promoter appeared throughout the cells and c Untransformed onion epidermal cells Funct Integr Genomics (2012) 12:215228

GFP a

LIGHT

MERGE

from highly resistant T2 line (TP8.3.45.2) were also evaluated against six isolates (Deh-1, Shihunta1, RML29, MSF9, MG79 and Mawana) of M. oryzae. All the transgenic lines were found to be highly resistant (Disease reaction 02) against these six isolates as compared to highly susceptible non-transgenic (wild type) lines of TP309 (Fig. 6a, b).

Discussion Efforts towards development of rice blast-resistant varieties have always been a major challenge because of its potentially devastating economic and humanitarian impact. Strategies aimed at breeding for durable blast resistance rice cultivars have focused on the possibility of stacking of

multiple R-genes or transferring broad spectrum disease resistance genes in cultivated varieties (Liu et al. 2007). In the present study, we used allele mining approach to clone a novel orthologue of durable rice blast resistance gene Pi54 (Rai et al. 2011). In the present investigation, the expression of Pi54 orthologue was confirmed in the blast-resistant wild species of rice, O. rhizomatis using real-time PCR, postinoculation with the pathogen M. oryzae isolate PLP-1. The orthologue isolated from O. rhizomatis, was thus named as Pi54rh (rh-rhizomatis) to distinguish it from the blast resistance gene Pi54 cloned from O. sativa spp. indica cultivar Tetep (Sharma et al. 2005a, b, 2010). The Pi54rh expressed constitutively in O. rhizomatis at basal level, but its expression increased up to 3.8-fold after 72 h of pathogen challenge. This is in contrast to blast resistance gene Pi54

Author's personal copy

Funct Integr Genomics (2012) 12:215228 223

a
0

2X 35S

Pi54rh nos 35S

T0

hygR

nos
T1

ampR
7613

M
kb

9 kb

0.75 0.50 kb 21.0 M 1 2 3 4 5 6 7 8 9 10

0.75

T2
M 1 2 3 4 5 6 7 8

13.0

9.0 1.3 0.8

M 1 2 3 4 5 6 7 8 9

kb 0.75

f
T3
M kb 0.75 1 2 3 4 5 6 7 8

kb 0.50

Fig. 5 Molecular analysis of the transgenic line (TP309: Pi54rh). a Map of the rice transformation vector (pRTV); b PCR confirmation of T0 transgenic lines with primers specific to Pi54rh (625 bp) and hygromycin (475 bp) genes; M: 1.0-kb DNA ladder, lane 1: untransformed TP 309, lanes 29: T0 transgenic lines; c Southern blot analysis of the T0 rice lines; M: DIG labelled DNA ladder, lane 1: Positive Control (pRTV), lane 2: blank, lane 3: untransformed TP 309, lanes 4 10: T0 transgenic lines; d RT-PCR with hygromycin primers in T0 lines; M: 1.0 kb DNA ladder, lane 1: untransformed TP 309, lanes 29: T1 transgenic lines derived from selfing of TP 8.3; e PCR confirmation

of T1 transgenic lines derived from TP 8.3 plant with primers specific to Pi54rh (625 bp),M: 1.0 kb DNA ladder, lanes17: T1 transgenic lines, lane 8: untransformed TP 309; f PCR confirmation of T2 transgenic lines derived from selfing of TP 8.3.45 plant with primers specific to Pi54rh (625 bp); M: 1.0 kb DNA ladder, lanes17: T2 transgenic lines, lanes 8: untransformed TP 309; g PCR confirmation of T3 transgenic lines derived from selfed plant TP8.3.45.2 with primers specific to Pi54rh (625 bp); M: 1.0 kb DNA ladder, lanes18: T3 transgenic lines

that is reported to be upregulated only upon pathogen challenge. The blast resistance gene Pib was reported to be induced upon altered environmental conditions such as temperature and darkness besides pathogen inoculation
Table 2 Disease reaction of transgenic plants containing Pi54rh gene in different generations against M. oryzae isolate PLP-1 Lines R resistance; S susceptible
a

(Wang et al. 1999). Similar upregulation was observed for rice Xa1 gene against Xanthomonas oryzae pv. oryzae, the causal organism of bacterial leaf blight in response to pathogen and wounding (Yoshimura et al. 1998). The enhancement

Selfed generations of transgenic plant TP8.3 T1 (TP8.3) Total 16 30 R 14 0 S 2 30 T2 (TP8.3.45)a Total 33 22 R 26 0 S 7 22 T3 (TP8.3.45.2) Total 23 25 R 23 0 S 0 25

Chi-square 3:1 (P 0 0.6153)

TPPi54rh TP309

Author's personal copy

224 Fig. 6 Phenotyping of transgenic lines with M. oryzae isolates. a Percent disease reaction (05 scale) of T3 transgenic line derived from the selfing of plant TP 8.3.45.2 vis-a-vis susceptible TP309 against six isolates on M. oryzae. b Disease reaction of transgenic lines 8.3 (T3) with fungal isolates (Mawana, MG79, MSF9, RML29, Shihunta1 and Deh-1) collected from different geographical regions of India [NT: non-transgenic lines, T: transgenic lines] Funct Integr Genomics (2012) 12:215228

a
100

Plants in each category (%)

90 80 70 60 50 40 30 20 10 0 TP8.3.45.2

Reaction Categories
0 1 2 3 4 5

TP8.3.45.2

TP8.3.45.2

TP8.3.45.2

TP309

TP309

TP309

TP8.3.45.2

Shihunta-1

MG-79

Mawana

MSF-9

RML-29

TP8.3.45.2

Deh1

Shihunta1

MG79

Mawana

MSF9

RML29

Deh-1

Magnaporthe oryzae isolates

b
Mawana MG-79 MSF-9

NT

NT

NT
Deh1

RML-29

Shihunta-1

NT

NT

NT

of resistance by the late upregulation of the Pi54rh gene might be limiting the spread of pathogen infection in the cells adjacent to the site of infection and also secondary spread of fungal biomass and preventing conidiation at later stages (Parker et al. 2008) or by fortifying the membrane and plasmodesmata (Kankanala et al. 2007). It was demonstrated that Pi54 triggers up regulation of defence response genes (Callose, laccase, PAL, chictinases and peroxidise) and transcription factors (NAC6, Dof Zinc Finger, MAD Box, bZIP and WRKY) which results in resistance phenotype of rice (Gupta et al. 2012). The predicted ORF of Pi54rh was aligned to Pi54 to differentiate nucleotide sequence between the orthologues.

Overall, 93.45 % identity was observed between the DNA sequence (ORFs) of Pi54rh and Pi54. A total of 71 SNPs (47 transitions and 24 transversions) and one 8-bp InDel were identified in the ORF. In the ORF, transitions (4.3 %) were more frequent than transversions (2.21 %) which were comparable to the earlier studies of plant genomes (Rafalski 2002 and IRGSP 2005). The average frequency of SNP (one in 23 bp) detected in the ORF of Pi54rh is higher than that observed in the coding regions (one in 100600 bp) of cereal genomes (Gupta and Rustogi 2004). This discrepancy might be due to the inclusion of nucleotide sequence from both wild and cultivated species for SNP analysis in the

TP309

TP309

TP309

Author's personal copy

Funct Integr Genomics (2012) 12:215228 225

present investigation. Similarly, higher variation was observed in 26 kb of DNA sequence spanning 22 loci between O. sativa ssp. indica and O. rufipogon (Rakshit et al. 2007). The Pi54rh isolated in the present study, encodes single 360 amino acid residue polypepetide having two LRR domains and rudimentary CC and NBS domains. The CC domains are predominant in R-genes cloned from monocotyledons, particularly in the cereals. They mediate recognition and activation of R-genes (Hwang and Williamson 2003). A centrally located NBS domain identified in Pi54rh between 145 and 165 amino acids were similar to the NBS domains encoded by Pi54. It is an intron-less gene and comparatively smaller to the NBS domains present in other cloned R-genes having three short amino acid motifs, i.e., kinase-1a or P-loop (phosphate-binding loop), kinase-2 and kinase-3. The NBS domain has been implicated in the signal transduction cascades involving phosphorylation/dephosphorylation with either ATP or GTP (Dangl and Jones 2001). A unique zinc finger domain (C3H type) similar to Pi54 gene (Sharma et al. 2005a) has been identified between 253 and 263 amino acids of the Pi54rh gene. The Zn-finger domain protein is responsive to various stresses like wounding, stress hormones, cold, salt, submergence, heavy metals and desiccation (Vij and Tyagi 2008). The deduced amino acid sequence also encoded two LRR domains spanning 253275 and 277299 amino acids, in contrast to Pi54 in which only one LRR domain has been reported (Sharma et al. 2005a). The LRR domain is the major determinant of recognition specificity of pathogen avirulence factors (Meyers et al. 1999). However, the predicted LRR protein in Pi54rh did not match to the typical LXXLXXLXXXLX (N/C/T)X(X)LXXPXX motif identified in R-gene product with cytoplasmic LRRs (Jones and Jones 1997). Instead Cterminal region of Pi54rh have a highly imperfect LRR structures of 46 residue length based on the consensus LXXLXXL sequence. The predicted PI54RH protein also showed 13 sites of phosphorylation, indicating its involvement in signal transduction by activating further downstream components by activating/inactivating itself or by phosphorylation/dephosphorylation but the kinase domain like Xa21 (Song et al. 1995) was absent in Pi54rh. The presence of four N-myristoylation sites in the predicted protein showed its role in membrane anchoring and three Nglycosylation sites obtained in Pi54rh play an important role in protein targeting. The 3-D tertiary structure predicted from the 360 amino acid residue formed a typical horseshoe-shaped molecule with sheets of LRR region on the concave side providing surface for interactions with Avr proteins. These types of structures of R-proteins are common in many cloned plant disease resistance genes (Farnham and Baulcombe 2006; Rai et al. 2011). The presence of general promoter element like CAAT box in Pi54rh may facilitate the binding of RNA polymerase

for its constitutive expression at basal level. The G-box, WRKY box (W-box) and BELL homeodomain (BH) box predicted in the Pi54rh are specialized nucleotide sequences that are reported to be involved in upregulation of defence response genes. The G-box (CACGTG), a ubiquitous ciselement has also been identified in the promoter region of plant defence response genes such as PAL and CHS which specifically bound to the G-box binding factor family of bZIP transcription factor which mediate responses to the diverse environmental stimuli (Menkens et al. 1995). Similarly, the specialized DNA sequence motifs like W-boxes bind with the WRKY transcription factor and play crucial role in plant defence response (Eulgem et al. 2000). Such boxes have also been identified in the promoter regions of defence response genes like NPR1 gene in Arabidopsis (Yu et al. 2001), tobacco Class I chitinase gene, CHN50 (Yang et al. 1999) and parsely PR-1 gene (Rushton et al. 1996). It has been reported that WRKY transcription factor acts as an activator of defencerelated genes in rice after inoculation with Magnaporthe grisea (Chujo et al. 2007). The BH-box predicted in the promoter region may be the binding site for BELL type homeodomain transcription factor and was associated with blast resistance response in rice (Luo et al. 2005). Thus, the presence of defence-related regulatory elements in the promoter region of Pi54rh might be involved in the unique expression pattern of Pi54rh gene upon pathogen challenge. Further, the common polyA signal was predicted at 61-bp downstream of the stop codon (TAG) in the cloned Pi54rh sequence. The presence of polyA tail is important for nuclear export, stability and translation of mRNA (Shen et al. 2008). Comparative sequence homology approach is an ideal computational tool for analysing structural relatedness and establishing phylogenetic relationships among cloned Rgenes. We constructed, a phylogenetic tree by including the Pi54rh ortholog with 19 cloned rice blast R-genes encoding NBS-LRR functional proteins. A wide range of diversification was obtained among these R-genes suggesting their evolutionary advantage for recognizing, binding and defending against a broad array of pathogens (Lehman 2002). Further, the definitive clustering of Pi54rh ortholog with other R-genes indicated the divergence of all these Rgenes from a common ancestor. The R-genes generally occur as a member of clustered gene families that have evolved through segmental duplication and diversification due to recombination, which might contribute to their structural homogeneity as well as diversity (Martin et al. 2003). The high sequence similarity (9395 %) supported by clustering of Pi54rh with Pi54 further confirmed the orthologous relationship among these genes. The clustering of Pi54rh with four other NBS-LRR type of blast resistance genes in Cluster II, classified the Pi54rh under the NBSLRR type of rice R-gene class. It is interesting to note that the Pi54rh also showed high sequence homology with Pi5,

Author's personal copy

226 Funct Integr Genomics (2012) 12:215228

besides Pi54 and thus grouped together. Like Pi54 and Pi54rh, the blast resistance gene Pi-5 (comprising of two genes) has also been reported as pathogen inducible and constitutive (Lee et al. 2009). The Pita gene in the cluster also has higher sequence homology with Pi54rh and thus remained closer as compared to other genes. Thus, the clustering pattern obtained from blast resistance genes corresponded well with their known phylogenetic relationships. Molecular characterization of Pi54rh can be better performed by obtaining its full-length cDNA. Hence, the fulllength transcript of Pi54rh was obtained by RLM-RACE and compared to the genomic DNA sequence for delineating transcript ends. The full-length transcript of Pi54rh was 1,447 bp consisting of 101 bp 5 UTR, 1,083 bp of coding sequence and 263 bp 3 UTR. The 5 UTR (or the leader sequence) is the part of the mRNA from the transcription start site (TSS) to the start codon (ATG). The leader sequence serve as binding sites for the proteins which plays an important role in expression regulation, ribosome binding sites and also protein independent regulatory elements like riboswitches (Pickering and Willis 2005). The 3 UTR is the part of mRNA following the coding region that contains poly adenylation signal, binding sites for protein regulation and miRNAs (Mazumdar et al. 2003). The 5 UTR identified in Pi54rh was devoid of any introns and contained only WRKY box which might be responsible for binding of WRKY transcription factor involved in defence response mechanism. Generally, introns have been commonly detected in both the 3 UTR and 5 UTR regions of cloned R-genes (Vos et al. 1998). The Pi37 gene has one intron of 3,943 bp in the 5 UTR and another of 124 bp in the 3 UTR, Pi36 has 65 bp intron in 5 UTR and a 725 bp intron in the 3 UTR. However, only two introns of 575 and 102 bp were present in 3 UTR of Pi9. Thus, the short transcript of Pi54rh ortholog (1,447 bp) devoid of introns might be a good candidate for use in development of transgenic rice. Because of small size, Pi54rh can be easily cloned in the gene cassette, which can facilitate its subsequent transfer in the blast susceptible varieties by using Agrobacteriummediated or biolistics approaches. Most of the disease resistance genes belonging to NBSLRR class are intracellular proteins with few exceptions, responsible for recognizing Avr signals from the pathogens (Dangl and Jones 2001). In the present investigation, PI54RH protein was also annotated as extracellular. To validate this annotation, the experiment was conducted on the analysis of subcellular localization of the PI54RH protein tagged with GFP. The expression and localization of GFP tagged PI54RH protein was found to be extracellular, confirming the in silico prediction. Similar subcellular localization studies using GFP have also been done for the blast resistance gene, Pi-d2 using roots of 3-day-old Arabidopsis seedlings (Lin et al. 2007). They confirmed its

location to the plasma membrane. The Pi37 gene was also fused to eGFP under the control of 35S promoter and transiently expressed in the onion epidermal cells following ballistic transformation. It showed the distribution of protein throughout the cytoplasm (Lin et al. 2007). Based on the phenotyping of transgenic line (TP 8.3), it was confirmed that resistance phenotype can be attributed to the presence of Pi54rh, in otherwise susceptible cultivar, TP309. The inheritance and durability of Pi54rh was confirmed by phenotyping of this line for three generations (T1 to T3) with different isolates of M. oryzae. The broad spectrum nature was confirmed by phenotyping with seven isolates of M. oryzae collected from different epidemiological regions of the India. Whereas the blast resistance gene Pi54 earlier cloned from rice line Tetep has been shown to be resistant to four isolates of M. oryzae (Rai et al. 2011). Therefore, present study provides another blast resistance gene in the hands of rice breeders which can be effectively used for the development of resistant varieties. The gene Pi54rh has been cloned and characterized from the wild rice species, O. rhizomatis having cross-compatibility barriers with cultivated rice, O. sativa. However, using transgenic approach, it can be transferred to the cultivated varieties of O. sativa. Isolation of such genes using molecular biology approaches and their transfer to the elite cultivated rice lines can be used for blast disease management.
Acknowledgments TRS is thankful to ICAR and National Agricultural Innovation Project (code C4/C1071) for financial support. We thank Dr. S.R. Bhat for his help in conducting experiments on subcellular localization studies. Thanks are due to the in-charge, National Phytotron Facility, IARI, New Delhi, for providing facilities for maintaining wild species of rice and transgenic lines. We sincerely thank Dr. R. Rathour, Dr. M. Variar and Dr. U.D. Singh for providing fungal strains for phenotyping. A.D. and D.S. were supported by PG School, IARI, New Delhi in the form of fellowships for their Ph.D. and M.Sc. degrees, respectively.

References
Altschul SF, Madden TL, Schffer AA, Zhang J, Zhang Z et al (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programmes. Nucleic Acids Res 25:33893402 Ashikawa I, Hayashi N, Yamane H, Kanamori H, Wu J et al (2008) Two adjacent nucleotide-binding site-leucine rich repeat class genes are required to confer Pikm-specific rice blast resistance. Genetics 180:22672276 Barclay A (2004) Feral Play. Rice Today 3:1419 Bonmann JM, Dedios TV, Khin MM (1986) Physiologic specialization of Pyricularia oryzae in Phillippines. Plant Dis 70:767769 Bryan GT, Wu KS, Farrall L, Jia Y, Hershey HP et al (2000) A single amino acid difference distinguishes resistance and susceptible alleles of the rice blast resistance gene Pi-ta. Plant Cell 12:2033 2046 Chen XW, Shang JJ, Chen DX, Lei CL, Zou Y (2006) A -lectin receptor kinase gene conferring rice blast resistance. Plant J 46:794804

Author's personal copy

Funct Integr Genomics (2012) 12:215228 Chujo T, Takai R, Akimoto-Tomiyama C, Ando S, Minami E et al (2007) Involvement of the elicitor-induced gene OsWRKY53 in the expression of defense-related genes in rice. Biochim Biophys Acta 1769:497505 Dangl JJ, Jones JD (2001) Plant pathogen and integrated defence responses to infection. Nature 411:826833 Dean RA, Talbot NJ, Ebbole DJ, Farman ML, Mitchell TK et al (2005) The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434:980986 Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY superfamily of plant transcription factors. Trends Plant Sci 5:199 206 Ewing B, Green P (1998) Base calling sequencer traces using Phred II. Error probabilities. Genome Res 8:186194 Farnham G, Baulcombe DC (2006) Artificial evolution extends the spectrum of viruses that are targeted by a disease resistance gene from potato. Proc Natl Acad Sci USA 103:1882818833 Fukuoka S, Saka N, Koga H, Ono K, Shimizu T et al (2009) Loss of function of a proline-containing protein confers durable disease resistance in rice. Science 325(5943):9981001 Gupta PK, Rustogi S (2004) Molecular markers from the transcribed/ expressed region of the genome in higher plants. Funct Integr Genomics 4:139162 Gupta SK, Rai AK, Kanwar SS, Chand D, Singh NK, Sharma TR (2012) The single functional blast resistance gene Pi54 activates a complex defense mechanism in rice. J Exp Bot 63(2):757772 Hayashi K, Yasuda N, Fujita Y, Koizumi S, Yoshida H (2010a) Identification of the blast resistance gene Pit in rice cultivars using functional markers. Theor Appl Genet 121(7):13571367 Hayashi N, Inoue H, Kato T, Funao T, Shirota M et al (2010b) Durable panicle blast-resistance gene Pb1 encodes an atypical CC-NBSLRR protein and was generated by acquiring a promoter through local genome duplication. Plant J 64(3):498510 Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of T-DNA. Plant J 6:271282 Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database. Nucleic Acids Res 27:297300 Horton P, Park KJ, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai K (2007) WoLF PSORT: protein localization predictor. Nucleic Acids Res 35(Web Server Issue):W585W587 Hulbert SH, Webb CA, Smith SM, Sun Q (2001) Resistance gene complexes: evolution and utilization. Annu Rev Phytopathol 39:285312 Hwang C, Williamson VM (2003) Leucine-rich-repeat mediated intramolecular interactions in nematode recognition and cell death signalling by the tomato resistance protein Mi. Plant J 34:585593 IRGSP (International Rice Genome Sequencing Project) (2005) The map-based sequence of the rice genome. Nature 436:793800 Jones DA, Jones JDG (1997) The role of leucine rich repeat protein in plant defense. Adv Bot Res 24:89167 Kankanala P, Czymmek K, Valent B (2007) Roles of rice membrane dynamics and plasmodesmata during biotrophic invasion by the blast fungus. Plant Cell 19:706724 Lee SK, Song MY, Seo YS, Kim HK, Ko S et al (2009) Rice Pi5mediated resistance to Magnaporthe oryzae requires the presence of two CC-NB-LRR genes. Genetics 181:16271638 Lehman P (2002) Structure and evolution of plant disease resistance genes. J Appl Genet 43:403413 Lescot M, Dhais P, Thijs G, Marchal K, Moreau Y, de Peer YV et al (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal of tools for in silico analysis of promoter sequences. Nucleic Acids Res 30:325327 Lin F, Chen S, Que Z, Wang L, Liu X, Pan Q (2007) The blast resistance gene Pi37 encodes a nucleotide binding site-leucine227 rich repeat protein and is a member of a resistance gene cluster on rice chromosome 1. Genetics 177:18711880 Liu X, Lin F, Wang L, Pan Q (2007) The in silico map-based cloning of Pi36, a rice coiled-coil-nucleotide-binding site-leucine-rich repeat gene that confers race-specific resistance to the blast fungus. Genetics 176:25412549 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T) method. Methods 25:402408 Luo H, Song F, Goodman RM, Zheng Z (2005) Up-regulation of OsBIHD1, a rice gene encoding BELL homeodomain transcriptional factor, in disease resistance responses. Plant Biol (Stuttg) 7 (5):459468 Lupas A, Van Dyke M, Stock J (1991) Predicting coiled coils from protein sequences. Science (New York, NY) 252(5010):1162 1164 Martin GB, Bogdanove AJ, Sessa G (2003) Understanding the functions of plant disease resistance proteins. Annu Rev Plant Biol 54:2361 Mazumdar B, Seshadri V, Fox PL (2003) Translation control by the 3 UTR: the ends specify the means. Trends Biochem Sci 28:91 98 Menkens AE, Schindler U, Cashmore AR (1995) The G-box: a ubiquitous regulatory DNA element in plants bound by the GBF family of bZIP proteins. Trends Biochem Sci 20:506510 Meyers BC, Dickerman AW, Michelmore RW, Sivaramakrishnan S, Sobral BW, Young ND (1999) Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide binding superfamily. Plant J 20(3):317332 Okuyama Y, Kanzaki H, Abe A, Yoshida K, Tamiru M et al (2011) A multifaceted genomics approach allows the isolation of the rice Pia-blast resistance gene consisting of two adjacent NBS-LRR protein genes. Plant J 66:467479 Parker D, Beckmann M, Enot DP, Overy DP, Rios ZC et al (2008) Rice blast infection of Brachypodium distachyon as a model system to study dynamic host/pathogen interactions. Nat Protoc 3:435 445 Pickering BM, Willis AE (2005) The implication of structured 5 untranslated region on translation and disease. Semin Cell Dev Biol 16:3947 Qu S, Liu G, Zhou B, Bellizzi M, Zeng L (2006) The broad-spectrum blast resistance gene Pi9 encodes a nucleotide-binding siteleucine-rich repeat protein and is a member of a multigene family of rice. Genetics 172:19011914 Rafalski JA (2002) Applications of single nucleotide polymorphism in crop genetics. Curr Opin Plant Biol 5:94100 Rai AK, Kumar SP, Gupta SK, Gautam N, Singh NK, Sharma TR (2011) Functional complementation of rice blast resistance gene Pi-kh (Pi54) conferring resistance to diverse strains of Magnaporthe oryzae. J Plant Biochem Biotechnol 20(1):5565 Rakshit S, Rakshit A, Matsumura H, Takahashi Y, Hasegawa Y et al (2007) Large scale DNA polymorphism study of Oryza sativa and Oryza rufipogon reveals the origin and divergence of Asian rice. Theor Appl Genet 114:731743 Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, NJ, pp 365386 Rushton PJ, Torres JT, Parniske M, Wernert P, Hahlbrock K et al (1996) Interaction of elicitor-induced DNA-binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO J 15:56905700 Shang J, Tao Y, Chen X, Zou Y, Lei C et al (2009) Identification of a new rice blast resistance gene, Pid3, by genome-wide comparison of paired NBS-LRR genes and their pseudogene alleles between the two sequenced rice genomes. Genetics 182:13031311

Author's personal copy

228 Sharma TR, Chauhan RS, Singh BM, Paul R, Sagar V, Rathour R (2002) RAPD and pathotype analyses of Magnaporthe grisea population from North-Western Himalayan Region of India. J Phytopathol 150:649656 Sharma TR, Madhav MS, Singh BK, Shanker P, Jana TK et al (2005a) High resolution mapping, cloning and molecular characterization of the Pi-kh gene of rice, which confers resistance to Magnaporthe grisea. Mol Genet Genomics 274:569578 Sharma TR, Shanker P, Singh BK, Jana TK, Madhav MS et al (2005b) Molecular mapping of rice blast resistance gene Pi-kh in rice variety Tetep. J Plant Biochem Biotechnol 14:127133 Sharma TR, Rai AK, Gupta SK, Singh NK (2010) Broad-spectrum blast resistance gene Pi-kh cloned from rice line Tetep designated Pi54. J Plant Biochem Biotechnol 19(1):8789 Sharma TR, Rai AK, Gupta SK, Vijayan J, Devanna BN, Ray S (2012) Rice blast management through host resistance: retrospect and prospects. Agric Sci 1:3752 Shen Y, Ji G, Haas BJ, Wu X, Zheng J et al (2008) Genome level analysis of rice mRNA 3end processing signals and alternative polyadenylation. Nucleic Acids Res 36:31503161 Silue D, Notteghem JL, Tharreau D (1992) Evidence for a gene-forgene relationship in the Oryza sativa-Magnaporthe grisea pathosystem. Phytopathology 82:577582 Song WY, Wang GL, Chen LL, Kim HS, Pi LY et al (1995) A receptor kinase like protein encoded by rice disease resistance gene Xa21. Science 270:18041806 Takahasi A, Hayashi N, Miyao A, Hirochika H (2010) Unique features of the rice blast resistance Pish locus revealed by large scale retrotransposon tagging. BMC Plant Biol 10:175189 Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA 4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24:15961599 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment Funct Integr Genomics (2012) 12:215228 through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 22:46734680 Vij S, Tyagi AK (2008) A20/AN1 zinc-finger domain-containing proteins in plants and animals represent common elements in stress response. Funct Integr Genomics 8:301307 Vos P, Simons G, Jesse T, Wijbrandi J, Heinen L (1998) The tomato Mi-1 gene confers resistance to both root-knot nematodes and potato aphids. Nat Biotechnol 16:13651369 Wang ZX, Yano M, Yamanouchi U, Iwamoto M, Monna L et al (1999) The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine rich repeat class of plant disease resistance genes. Plant J 19:5564 Yang P, Chen C, Wang Z, Fan B, Chen Z (1999) A pathogen- and salicylic acid-induced WRKY DNA-binding activity recognizes the elicitor response element of the tobacco class I chitinase gene promoter. Plant J 18(2):141149 Yoshimura S, Yamanouchi U, Katayose Y, Toki S, Wang ZX et al (1998) Expression of Xa1, a bacterial blight resistance gene in rice, is induced by bacterial inoculation. Proc Natl Acad Sci USA 95:16631668 Yu D, Chen C, Chen Z (2001) Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression. Plant Cell 13:15271540 Yuan B, Zhai C, Wang W, Zeng X, Xu X et al (2011) The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes. Theor Appl Genet 122(5):10171028 Zhai C, Lin F, Dong Z, He X, Yuan B et al (2011) The isolation and characterization of Pik, a rice blast resistance gene which emerged after rice domestication. New Phytol 189(1):321334 Zhou B, Qu S, Liu G, Dolan M, Sakai H, Lu G, Bellizzi M, Wang GL (2006) The eight amino acid differences within three leucine rich repeats between Pi2 and Piz-t resistance proteins determine the resistance specificity to Magnaporthe grisea. Mol Plant Microbe Interact 19(11):12161228