NIH Public Access

Author Manuscript
J Neurochem. Author manuscript; available in PMC 2007 November 5.
Published in final edited form as: J Neurochem. 2006 May ; 97(3): 607618.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

NFB in Neurons? The Uncertainty Principle in Neurobiology

Paul Massa1, Hossein Aleyasin2, David S. Park2, Xianrong Mao3, and Steven W. Barger3,4 1Departments of Neurology and Microbiology & Immunology, State University of New York-Upstate Medical University, Syracuse NY 13210, USA 2Department of Cellular and Molecular Medicine, University of Ottawa, Ottawa Health Research Institute, Neuroscience Group, Ottawa Ontario, Canada K1H 8M5 3Department of Geriatrics, University of Arkansas for Medical Sciences, Little Rock AR 72205, USA 4Department of Neurobiology & Developmental Sciences, University of Arkansas for Medical Sciences; Geriatric Research Education and Clinical Center, Central Arkansas Veterans Healthcare System, Little Rock AR 72205, USA

Abstract
Nuclear factor B (NFB) is a dynamically modulated transcription factor with an extensive literature pertaining to widespread actions across species, cell types, and developmental stages. Analysis of NFB in a complex environment such as neural tissue suffers from a difficulty in simultaneously establishing both activity and location. But much of the available data indicate a profound recalcitrance of NFB activation in neurons, as compared to most other cell types. Few studies to date have sought to distinguish between the various combinatorial dimers of NFB family members. Recent research has illustrated the importance of these problems, as well as opportunities to move past them to the nuances manifest through variable activation pathways, subunit complexity, and target sequence preferences. NFB is name given to a class of transcription factors that mediate diverse biological processes, from inflammation to apoptosis. While there are more extensive reviews on the variety to be found in NFB form and function (Hayden and Ghosh 2004), a cursory introduction is necessary for the discussions here. Active binding to specific DNA sequences is performed by hetero- or homodimers of NFB subunits; the names of vertebrate subunits are RelA (p65), RelB, c-Rel, p50 and p52. The most prominent and extensively studied dimer is that of RelA and p50, which we will refer to as NFBcan. Under basal conditions, this moiety is held inactive in the cytoplasm by an inhibitory subunit (IB through IB); the precursors of p50 and p52 p105 and p100, respectivelycan also serve inhibitory functions. In the canonical activation scheme, the IB is phosphorylated by an IB kinase (IKK) complex (below), leading to ubiquitination and proteasomal degradation of the IB. This frees NFBcan to translocate into the nucleus and induce transcription of genes containing B cis elements in their promoters. RelB and p52 form a dimer we will refer to as NFBnon, and this moiety participates in the noncanonical scheme. This alternative activation is roughly analogous to the canonical except that a single polypeptide, p100, is responsible for providing both the IB (p100 in its full-length form) and one of the subunits of the active transcription factor (p52, a proteolytic derivative of p100); kinases activating the noncanonical pathway stimulate the conversion of p100 to p52. Details of the canonical and noncanonical pathways differ by 1) the kinases that trigger phosphorylation-instigated, ubiquitin-directed proteolysis of the IB, 2) the time-frame for maximal activation, and 3) the specific DNA sequences to which their products (NFBcan vs. NFBnon) bind with highest affinity (Bonizzi et al. 2004). RelA/c-Rel dimers
Corresponding author: Steve Barger Reynolds Institute on Aging 629 Jack Stephens Dr., #807 Little Rock AR 72205 Tel: 501-526-5811 Fax: 501-526-5830 Email: bargerstevenw@uams.edu

Massa et al.

Page 2

have been described in some neural systems (Pizzi et al. 2005), and robust transactivating effects can result from various homodimers of subunits other than p50 or p52 (these lack a transactivation domain and generally stimulate transcription only when paired with a Rel subunit). However, the natural regulation of dimers other than NFBcan and NFBnon is poorly understood. Additional complexity is added by the varying requirements that have been reported for post-translational modification of RelA by phosphorylation and acetylation. A wide variety of genes with different and sometimes opposite functions respond to NFBcan. For example, proapoptotic genes such as p53 (Kirch et al. 1999), c-myc (La Rosa et al. 1994), Fas and FasL (Kimura et al. 1997;Matsui et al. 1998) can be regulated by NFBcan; but so can prosurvival genes such as IAP (inhibitors of apoptosis) (Chu et al. 1997;Yabe et al. 2005), Bcl-2 (Tamatani et al. 1999), Bcl-x and SOD2 (Mattson et al. 1997;Tamatani et al. 1999). Because of this apparent role of NFBcan in diverse phenomena, many investigators have been interested in determining whether or how NFBcan participates in neurobiology. The highly differentiated cell types and subtypes in the CNS create a particularly difficult challenge for studies of NFB. Traditional techniques for establishing cellular localization, such as immunohistochemistry, are rather limited in their ability to reflect the bioactivity of a set of proteins that are regulated by binding partners and multiple post-translational modifications. Likewise, activity assays that depend on in vitro binding assays typically require homogenization of relatively large (and cellularly complex) tissue samples. Therefore, difficulty arises in simultaneously determining both activity and location of NFB in the nervous systema biological analogy to the Heisenberg Uncertainty Principle. Until recently, rigorous studies of NFB in neurons (as opposed to other CNS cell types) have required the reductionist utility of cell culture, where additional activity assays like reporter-gene transfection can be more readily conducted, as well.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Is NFB Responsive to Glutamatergic Stimuli?

One of the most potent and consistent activators of NFB is tumor necrosis factor (TNF). Under some circumstances TNF can be cytotoxic (particularly, for tumor cells). So, guilt by association originally indicted NFB as a potential mediator of this toxicity. Other reports demonstrated that antioxidants could block activation of NFB (Schreck et al. 1991), leading to speculation that NFB mediated the untoward effects of reactive oxygen species (ROS). Eventually, it was reported that glutamate could activate NFB (Guerrini et al. 1995;Kaltschmidt et al. 1995) or p50 homodimers (Grilli et al. 1996) in cerebellar cultures, and NFB was assumed to contribute to excitotoxicity, despite the facts that 1) cerebellar neurons cannot be enriched with mitotic inhibitors (Seil et al. 1992), 2) glutamate promotes survival of cerebellar granule cell neurons, and 3) p50 homodimers alone are not transcriptionally competent (Schmitz and Baeuerle 1991). The hypothetical role for NFB in glutamate toxicity was revised when reports of survival enhancement by NFB began to appear in the literature. NFB was shown to ameliorate the conditional toxicity of TNF in epithelial and mesenchymal cells (Beg and Baltimore 1996;Van Antwerp et al. 1996;Wang et al. 1996); to mediate the trophic effects of activity-dependent neurotrophic factor (Glazner et al. 2000), depolarization, and IGF-1 (Koulich et al. 2001); to induce expression of the inhibitor of apoptosis (IAP) genes (Wang et al. 1998); and to contribute to neuroprotective inductions of manganese superoxide dismutase (SOD2) (Mattson et al. 1997). No longer relegated to the harmful side of the equation, NFB and its attendant phenomena took on a new light. Rather than participating in the toxicity of TNF or glutamate, NFB was interpreted to be a compensatory factor that might elevate expression of anti-oxidant and anti-apoptotic genes.

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 3

The possibility that a glutamate NFB pathway contributed to conditioning or compensatory responses inspired attempts to replicate the glutamatergic induction of NFB that had been reported for cerebellar cultures, instead using highly enriched cultures of cortical neurons (both neocortical and hippocampal cultures) (Mao et al. 1999;Moerman et al. 1999). Cortical cultures documented to be approximately 99% neurons were exposed to glutamate, and nuclear extracts were analyzed by electrophoretic mobility shift assays (EMSA) utilizing probes that contained a B sequence. Surprisingly, the only consistent effect of glutamate under these conditions is a rapid reduction in the DNA-binding activity (Mao et al. 1999;Moerman et al. 1999). Results consistent with these are obtained when cortical neurons are transfected with a B-responsive reporter plasmid (Barger et al. 2005). When resolved electrophoretically under denaturing conditions, the proteins constitutively binding B sequences in neurons show apparent molecular weights inconsistent with those of NFB family members (Moerman et al. 1999). Furthermore, the B-binding proteins in such neuronal cultures are insensitive to antibodies against p50, p52, RelA, RelB, or c-Rel; instead, this neuronal B-binding activity is attributable to Sp1-related proteins (below). However, NFBcan is readily detectable after glutamate treatment of mixed neuron-glia cocultures (Mao et al. 1999;Moerman et al. 1999). In other experiments, neurons and glia have been grown in separate but communicating chambers to permit independent extractions of the nuclei from each cell type. In this paradigm, glia grown in the presence of neurons show a robust activation of NFB by glutamate; neither neurons from these cultures nor pure glial cultures respond to glutamate (Moerman et al. 1999). These results have been observed in both hippocampal and neocortical cultures. Besides documenting glia as the cellular source of NFB activated by glutamate, the coculture experiments described above exclude the possibility that technical artifacts of experimental conditions obviated the detection of active NFB in neurons. Nonetheless, they do not exclude the possibility that cell-cell contact between neurons and glia in vivo permits cortical neurons to respond to glutamate with an activation of NFB. To address this caveat, a mouse line carrying a -galactosidase transgene driven by a promoter with B elements was employed. Cortical neurons from these mice were placed in culture with nontransgenic glia, thus creating conditions in which NFB activity could be detected specifically in neurons, even while permitting direct physical interactions between glia and neurons. But this scenario also failed to detect a neuronal activation of NFB in glutamate-treated cultures (Figure 1). Other reports have claimed that glutamate can activate NFB in cortical neurons (e.g., (Qiu et al. 2001;Meffert et al. 2003;Pizzi et al. 2005). However, most of these reports used culture conditions likely to permit glial contamination of the neuronal cells when they reported DNAbinding activity. And other assays, such as the translocation of immunocytochemically detected RelA, do not measure the actual activity of NFB factors. One approach that mitigates these issues is the use of a reporter gene that can be assessed on a cell-by-cell basis, such as galactosidase. Two recent reports use such a system to provide compelling evidence that neurons contain constitutively active B-dependent transcription in vivo (Bhakar et al. 2002;Fridmacher et al. 2003); both used auxillary transgenic expression of IB to demonstrate that the -gal signal was sensitive to an NFB inhibitor. Caveats include the fact that IB can inhibit other transcription factors, including Sp1 (Algarte et al. 1999;Heckman et al. 2002). The p105 promoter used by Fridmacher et al. (Fridmacher et al. 2003) to create a NFBresponsive reporter construct relies upon a B element (GGGGGCTTCCC) that would appear to bind Sp1-related factors robustly (below).

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Unique Control of NFB by Canonical and Translational Pathways In Neurons

Neurons appear to either silence or activate NFB in a tissue-specific fashion consistent with unique adaptive stress responses in these cells (Ward and Massa 1995;Jarosinski et al. 2001). Thus, a key question is how NFB may be uniquely regulated in neurons to effect appropriate expression of NFB-responsive genes in health and disease.

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 4

Class I major histocompatibility (MHC) molecules have held fascination for neuroimmunologists as a component of hypotheses about CNS immunoprivilege during viral infections. MHC class I molecules are responsible for the presentation of an infected cell's viral antigens to cytotoxic T cells, essentially sacrificing the infected cell in order to mitigate viral replication. As this would be a disadvantageous strategy with regard to post-mitotic neurons, it was hypothesized that the CNS enjoyed an immunoprivilege (Oldstone et al. 1986;Streilein 1993). MHC class I were connected to the first mechanistic explanations of this phenomenon (Schachner and Hammerling 1974;Schnitzer and Schachner 1981;Lampson et al. 1983;Lampson 1987;Drew et al. 1993). These studies described the conspicuous lack of MHC class I molecules in the brain, primary neurons, or neuroblastoma cells grown in culture. It was also noted that MHC class I genes could be induced by proinflammatory cytokines in glia but not neurons in vivo or in vitro (Wong et al. 1984;Wong et al. 1985;Mauerhoff et al. 1988;Massa 1989;Massa et al. 1993;Ward and Massa 1995). These studies were followed by a number of elegant investigations in which the functional relevance of MHC class I exclusion from neurons was demonstrated using animal models of CNS viral infection (Joly et al. 1991;Rall et al. 1995;Oldstone 1997). Speculation about mechanisms for regulating MHC class I genes have naturally focused on transcription. A number of conserved regulatory elements appear to be responsible for either constitutive or cytokine-induced expression (Burke et al. 1989;Burke and Ozato 1989). In response to cytokines, at least two adjacent elements activate MHC class I transcription: one for interferon-mediated induction (interferon regulatory factor element, IRF-E) and the other for expression induced by tumor necrosis factor (TNF) (Sugita et al. 1987;Kieran et al. 1990;Dey et al. 1992;Massa et al. 1992;Drew et al. 1995). This latter element (MHC class I B site, MHC-B) is a NFB-binding site; in some cell types, the two sites appear to act synergistically in response to IFN- and TNF to induce high levels of MHC class I (Drew et al. 1995). TNF or double-stranded RNA stimulates binding of the transactivating NFBcan to the MHC-B, replacing the repressive p50 homodimer bound to this site under basal conditions (Yano et al. 1987;Kieran et al. 1990;Drew et al. 1995;Massa and Wu 1995). Similarly, the IRFE is bound by a stimulatory transcription factor (IRF-1) or a repressor (IRF-2) (Yano et al. 1987;Kieran et al. 1990;Drew et al. 1995;Massa and Wu 1995). IRF-1 expression is activated by NFB (Harada et al. 1994;Ohmori et al. 1997), and this relationship means that MHC class I genes are predominantly controlled by the IRF-E in astrocytes, secondary to induction of IRF-1 by NFB (Massa and Wu 1995;Jarosinski and Massa 2002). If neurons are to avoid transcriptional activation of MHC class I genes during viral infections, the above data indicate that squelching NFB would be effective. In neurons, one observes neither constitutive MHC class I promoter activity nor induction of this promoter by IFN-, consistent with a severe attenuation of NFBcan binding to the MHC-B in neurons compared to glia (Massa et al. 1993). And this inactivity is not limited to IFN-: multiple Toll-like receptor (TLR) ligands, including lipopolysaccharide and dsRNA, as well as proinflammatory cytokines TNF and interleukin-1, fail to induce NFBcan in primary neurons, even after prolonged treatment (Jarosinski et al. 2001). In all cases, this refractoriness of neuronal NFBcan was compared to positive controls in primary astrocytes, which responded to these same stimuli within 30 minutes. Clearly, MHC class I promoter activity, NFBcan activity, and IRF-1 expression are profoundly suppressed in neurons in response to various inducers (Ward and Massa 1995). Given this confirmed recalcitance of NFBcan in neurons, it came as a surprise when subsequent studies found that dsRNA or Sendai virus (ligands of TLR-3) produced convincing activation of the interferon- (IFN-) gene in neurons under the same conditions in which MHC class I genes remained silent (Ward and Massa 1995). Induction of the IFN- expression by dsRNA and virus infection is critically dependent on a B cis element in the IFN- promoter (Thanos

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 5

and Maniatis 1992,1995a). TLR-3 ligands also induce transcription of IRF-2 in cerebellar granule cell cultures (Ward and Massa 1995), probably via a B site (Harada et al. 1994). The treatment of these cultures with dsRNA evokes a selective binding to the IFN- promoter cis element (PRDII/IFN-B) but not the MHC-B site. This specificity of the binding activity results from RelA homodimers (henceforth designated RelA2) rather than NFBcan (Ward and Massa 1995), consistent with a higher affinity of RelA2 for the PRDII/IFN-B site versus the MHC-B (Fujita et al. 1992;Ganchi et al. 1993). Similar findings were obtained with LPS treatment of neuronal cultures (Figure 2). Thus, TLR3 appears to be connected to a specific activation of RelA2 rather than NFBcan in neurons, permitting responses to dsRNA and LPS through a set of genes distinct from those that create vulnerability to cytotoxic T-cells.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

NFB Induction by Translational Inhibition: An Alternative Noncanonical Pathway in Neurons?

The above considerations of immunoprivilege notwithstanding, evidence suggests that NFB is activated in neurons by non-immunological stimuli, including developmental signals or stress in adult brain (Bethea et al. 1998;Kaltschmidt et al. 2001;Mattson et al. 2001;Qiu et al. 2001;Bhakar et al. 2002;Aleyasin et al. 2004;Pizzi et al. 2005). In some cases, these data appear to be confounded by glial contamination in neural cultures (Barger et al. 2005). But reporter constructs that allow visualization of their products in individual cells indicate B-dependent transcription in neurons. What pathways participate in activation of NFB and NFBresponsive genes during these instances? Although NFBcan is not appreciably induced in primary neurons by glutamate, TLR ligands, or proinflammatory cytokines, p50, RelA, and IB are expressed at similar levels in neurons and glia (Jarosinski et al. 2001). Expression of these molecules is consistent with a potential role for NFB in neurons. To wit, the levels of IB can be reduced pharmacologically by treatment with inhibitors of translation (Jarosinski et al. 2001). Multiple translational inhibitors lead to a relatively slow decline in IB levels over a four-hour period. This is in sharp contrast to astrocytes, where a rapid degradation of IB occurs within fifteen minutes of application of TNF and IL-1, presumably through the canonical pathway (Jarosinski et al. 2001). Concomitant with the slow decline of neuronal IB caused by translation inhibitors, a gradual increase is observed in a DNA-binding activity containing RelA; an increase in IRF-1 mRNA is also observed under these conditions. Therefore, the potential for activation of NFB exists in neurons, particularly in response to severe translation inhibition. Natural pathways to translational inhibition of IB and activation of NFB in neurons There are natural stress conditions in which translation may be inhibited, including irradiation, unfolded protein response, and essential amino acid starvation (Anderson and Kedersha 2002). Protein translation is rapidly inhibited by amino acid starvation, for instance, via the activity of the eIF2 kinase GCN2 (Narasimhan et al. 2004). IB may be particularly sensitive to this process, leading to induction of NFB (Jiang and Wek 2005). Similarly, removal of the essential amino acid arginine from growth medium of primary astrocytes resulted in a slow decay in IB content, peaking at two hours (Figure 3). Concomitant with this decrease, DNA binding by NFBcan and trace amounts of RelA2 were observed in the nucleus in astrocytes, detected by EMSA using an iNOS-B probe (Figure 3). When neurons and astrocytes were analyzed in parallel samples, four hours of arginine depletion depressed IB levels and induced B DNA-binding activity similarly in both cell types (Figure 4). Interestingly, the migration and composition of the binding activity differed between the cell types, with astrocytes showing activation of NFBcan but neurons showing activation of RelA2 only. Thus, the amino acid starvation pathway may lead to preferential activation of NFB in astrocytes but of RelA2 in neurons, as was seen with dsRNA and LPS.

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 6

In addition to the activation of RelA2, neurons may control transcription of some B elements through Sp1-related factors. Sp1, Sp3, and Sp4 are present at relatively high levels in the CNS and bind DNA sequences rich in poly(G) and poly(C), as are most B elements. Recent immunofluorescence analysis of hippocampal cultures localized Sp1 and Sp3 to astrocytes; neurons, on the other hand, appeared to express only Sp3 and Sp4 abundantly (Figure 5). Corroborating evidence was obtained with western blot analysis and reverse-transcriptase polymerase chain reaction (Mao and Barger 2005). The first indication of neuronal Sp-family proteins binding to B elements came from EMSA, where these proteins were identified as the most prominent factors constitutively binding a B element from the immunoglobulin and HIV promoters (Mao et al. 2002). Functional relevance was provided by reporter-gene assays, where manipulation of Sp-family factors was shown to influence expression dependent on a B element (Mao et al. 2002;Barger et al. 2005). Sequence selectivity of B binding factors Sp1 and related factors from neuronal nuclei were initially found to bind the B element contained in the immunoglobulin/HIV promoter: AGTTGAGGGGACTTTCCCAGGC (NFB target underlined) (Mao et al. 2002). Because this widely used, commercially available probe also shows extraneous binding by RBP-J (this factor's target sequence is partially in the flanking region and not an essential component of the NFB consensus) (Mao et al. 2002), it was important to characterize the components of the probe that permitted Sp-factor binding. Through substitution of individual nucleotides in competition assays, it was determined that neuronal Sp1-related proteins bind to a subset of B elements: those containing four guanosines, a spacer sequence of three to five nucleotides, followed by three cytosines (Mao et al. 2005). Alteration of either of the guanines or even the 3' cytosine abrogated binding by Sp1-related factors (Table I). However, alterations of the two most distal nucleotides (the 5' G or the 3' C) still permit binding by NFBcan. It has become clear that different dimer combinations of NFB family members recognize somewhat different B sites fitting a loosely palindromic consensus decamer. Thus, p50 homodimers (KBF1) bound to the consensus decamer GGGGATYCCC, and RelA2 recognized a notably unique sequence with high AT rich sequence at the center of the decamer (GGGRNTTTCC) where Y is a pyrimidine, R is a purine, and N is any nucleotide (Kunsch et al. 1992) (Table II). Binding of NFB heterodimers was proposed to be most avid to elements with a combination of these features on each half site. Perhaps more important was for the center of the palindrome to be AT-rich (Thanos and Maniatis 1992;Falvo et al. 1995;Thanos and Maniatis 1995b). Interestingly, a number of RelA-responsive anti-apoptotic genes including IAP1, IAP2, Bcl-xL, and Bf1-1/A1 (Burstein and Duckett 2003;Kucharczak et al. 2003) have AT-rich B sites (Chen et al. 1999) which may preferentially bind to RelA2 in neurons. It will be important to determine whether these RelA2-responsive genes are preferentially activated in neurons and are important for neuronal survival under stressful conditions in the CNS.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Role of NFB in Neuronal DNA Damage: Friend or Foe

Neuronal death, central to neurodegenerative and pathological disorders, is initiated by numerous factors. For example, during stroke the death signalling cascade is initiated by lack of oxygen and glucose. In other pathologies, such as Alzheimer's or Parkinson's disease, the initiators are less well defined and likely involve multiple death/stress cues (Hutchins and Barger 1998). DNA damage is one such death initiator implicated in a number of pathological neurodegenerative conditions such as Parkinson's disease (Alam et al. 1997), Huntington's (Dragunow et al. 1995), Alzheimer's (Overmyer et al. 2000), and amyotrophic lateral sclerosis
J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 7

(Bogdanov et al. 2000). Importantly, evidence from some experimental models shows DNA strand breaks well advanced of DNA fragmentation caused by the apoptotic process (Cui et al. 2000). Impairment of DNA repair mechanisms has also been implicated in neurodegeneration, as well as in developmental defects of the central nervous system (Barnes et al. 1998;Deans et al. 2000). Such evidence supports the idea that DNA damage is among the primary events which cause neuronal death. Death pathways initiated by DNA damage can be examined in cell culture models of neuronal death initiated by the topoisomerase I inhibitor, camptothecin. Camptothecin induces singlestranded DNA breaks in post-mitotic neurons that initiates a cascade of events ultimately leading to apoptosis. Previous studies have shown that mitochondrial translocation of Bax and release of cytochrome c, followed by activation of the apoptosome, define the irreversible stage of neuronal death in this model (Cregan et al. 1999;Keramaris et al. 2000). The tumor suppressor p53 as well as cell-cycle regulatory pathways involving CDK/E2F/Rb seem to play pivotal role in determining whether the mitochondrial pathway to death is activated (Park et al. 1998). Effective inhibition of each of these upstream pathways substantially delays neuronal death. How these signaling pathways work together to orchestrate neuronal death remains to be elucidated. In addition, these two pathways are clearly not the only sets of events which regulate the conserved mitochondrial pathway of death. A network of cross-talking pro-death and pro-survival signals decides the ultimate survival/death fate of a neuron. Several lines of evidence suggest activation of the NFB pathway following DNA damage. Camptothecin evokes degradation of IB and elevated DNA binding by NFBcan in cortical cultures (albeit much lower than that of the Sp1-related factors) (Aleyasin et al. 2004). Inhibition of NFB with pharmacological agents considerably delays camptothecin-induced neuronal death. Two inhibitors of NFBhelenalin, a chemical agent that causes alkylation of RelA (Lyss et al. 1998), and caffeic acid phenethyl ester (CAPE)both showed protection against camptothecin. One must always be cautious about interpretation of data obtained with first-generation pharmacological inhibitors of NFB. For instance, CAPE suppresses NADPHdependent events (Hiipakka et al. 2002), lipoxygenases, cyclooxygenase, glutathione Stransferase, xanthine oxidase, matrix metalloproteinase-9, and lipid peroxidation (Chung et al. 2004); helenalin inhibits thioredoxin, glutaredoxin, IMP dehydrogenase, the ribonucleotide reductase complex, and DNA polymerase- (Hall et al. 1988). However, protection was also afforded by over-expression of a degradation-resistant IB mutant (IB super-repressor); similar protection was observed after reduction of RelA levels through RNA interference techniques. Another pharmacological agent BAY11-7082an IKK inhibitorfailed to show any protection against camptothecin. But this may simply indicate that camptothecin activates NFB by an IKK-independent mechanism. Indeed, phosphorylation of serine 32 in IB (a critical site for IKK action) was not detected in camptothecin-treated cultures. These data suggest that an unconventional activation of NFB plays a central role in death of neurons evoked by camptothecin. A key player in neuronal death induced by DNA damage is p53. The mRNA and protein levels of p53 increase in cortical neurons when treated with camptothecin (Aleyasin et al. 2004). Embryos from mice genetically ablated for p53 are substantially resistant to camptothecininduced death (Morris et al. 2001). All the NFB inhibitors capable of promoting neuronal viability in the face of camptothecin also inhibit p53 transcript and protein (Aleyasin et al. 2004). Moreover, transcription of noxa and puma, two downstream targets of p53, are suppressed by helenalin. Together, these data document an effect of NFB on p53 and its downstream pro-death targets in this model. The IKK inhibitor BAY11-7082, which is not neuroprotective, also fails to prevent activation of noxa and puma. Finally, over-expression of p53 in the presence of helenalin reverses the protective effect of this NFB inhibitor, favoring

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 8

a model in which p53 is downstream of NFB. These results are consistent with previous reports indicating that p53 can be a target of NFB (Hellin et al. 1998;Kirch et al. 1999).

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

While the above evidence indicates a pro-death role for NFB, final interpretations await elucidation of the pro-survival functions of this family of transcription factors. In fact, several pharmacological NFB inhibitors tend to be neurotoxic in cortical cultures over time. While some of this toxic effect could be due to nonspecific effects on molecules other than NFB, it is also possible that some tonic level of RelA2 plays a survival role, as well. Forced expression of IB also promotes death of cortical neurons; this approach should inhibit RelA2 as well as NFBcan and is less likely be confounded by the nonspecific effects that plague pharmacological approaches. Suppression of RelA by helenalin, which delays neuronal death, also causes morphological damage to neurites (Aleyasin et al. 2004). These data suggest a role for a RelA-containing factor in neuronal survival and neurite maintenance. The above studies underscore the complexity of NFB function and suggest that the ultimate biological effect will be dependent on the mechanism by which NFB is activated/repressed, the subunit composition of the NFB activated, and the incumbant DNA target sites modulated. Thus, it is not surprising that differing technical approaches can color the interpretation of experiments. Culmsee et al. (Culmsee et al. 2003) found that camptothecin inhibits NFB activity, as measured by association with the transcriptional cofactor p300 or activation of a transgenic luciferase reporter; they also found that inhibition of NFB has no effect on camptothecin toxicity and actually blocks the action of a neuroprotective agent. Bahkar and colleagues (Bhakar et al. 2002) found that RelA over-expression leads to increased levels of IAPs and protection from camptothecin-induced death. This paradigm likely leads to RelA2 rather than NFBcan, and this undoubtedly influences distinct subsets of B cis elements residing in the promoters of different genes (above). Neurons from animals genetically ablated for RelA (or p50, for that matter) survive well in culture and are no more sensitive nor resistant to neuronal death induced by camptothecin (Aleyasin et al. 2004). While the ever-present concerns about compensatory responses to germ-line deficiency apply, it is also possible that different ways of interfering or activating the NFB pathway lead to activation of different target genes. Finally, NFB will certainly have different consequences for neurotoxicity when activated in glia versus in the neurons themselves. This suggests that care must be taken with data concerning NFB, the interpretation of which may change depending upon how or where one modulates this complex signaling pathway and which dimers of the Rel family are active.

Relative Induction of NFB and RelA2 in Neurons: Appropriately Disparate Effects on Viability?
Here, we have described various unique responses of neurons with regard to activation of nuclear B-binding activities dependent on particular stimuli. These ranged from 1) poor induction of NFB by proinflammatory cytokines or excitotoxins; 2) preferential induction of RelA2 by TLR ligands or amino acid starvation; and 3) the induction of NFBcan by translational blockade or DNA damage. If translational blockade and DNA damage induce NFBcan but milder physiological stresses induce RelA2 in neurons, then is there a functional difference in response to these insults? It seems likely that transient induction of RelA2 in response to amino acid starvation or through other related pathways that impact translation, such as an unfolded protein response, is neuroprotective. However, translational blockade may have a number of detrimental consequences, including activation of NFBcan and induction of multiple pro-inflammatory and pro-apoptotic genes like p53. Mechanistically, this scenario could involve pathways related to the eIF2 kinase known as PERK, which mediates translational inhibition during the ER stress response. Transient activation of PERK, like GCN2, can lead to NFBcan activation during ER stress and is thought to be important in the induction of anti-apoptotic responses (Jiang et al. 2003a;Deng et al. 2004). Conversely, chronic
J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 9

PERK-mediated phosphorylation of eIF2 has been implicated in neuronal death in Alzheimer's disease or in response to transient focal ischemia in the CNS (Kumar et al. 2001;Mengesdorf et al. 2002;Owen et al. 2005). These untoward effects of PERK could involve persistent translational inhibition, but the role for NFBcan activation was not addressed in these models. As summarized in Figure 6, translational inhibition and other stress pathways may be a double-edged sword in neuron-specific survival and cell-death responses; modest, survivable stresses could shore up cellular defenses through induction of Rel2-responsive genes, while irrecoverable errors such as widespread DNA strandbreaks or severe translation poisons would initiate apoptosis (and possibly even immunological elimination) of the affected neuron through autonomous activation of NFBcan. An important unresolved issue concerns the mechanism of selective activation of RelA2 homodimers in neurons following exposure to dsRNA, LPS, or amino acid starvation. In nonneuronal cells, both dsRNA and LPS are known to induce high levels IFN- through Toll/ IL-1 receptor (TIR) domain-containing adapter proteins (Beutler et al. 2005;Sen and Sarkar 2005). The TIR-containing adapter used by TLR3 and TLR4 in IFN- induction is called TIR domain-containing adapter inducing IFN- (TRIF; aka, TICAM-1) (Yamamoto et al. 2002) (Figure 6). TRIF is able to effect the rapid, IKK-dependent phosphorylation/degradation of IB, activating NFBcan. However, dsRNA binding to TLR3 can also lead to activation of the eIF2 kinase protein kinase R (PKR) and activate B binding (Jiang et al. 2003b). The identity of the proteins responsible for this B binding was not determined; nor was its reliance on IKK. One intriguing possibility is that activation of PKR preferentially activates RelA2 by acting on eIF2 to bring about translational inhibition of IB, thus initiating an IKKindependent pathway similar to amino acid starvation. Nevertheless, the ability of eIF2 kinases (PKR, PERK, or GCN2) to trigger activation of NFBcan in nonneuronal cells suggests that an additional level of regulation is involved in bringing about the neuron-specific activation of RelA2 in response to physiological stimuli.
Acknowledgements Portions of this work were supported by NIH grant R01NS046439.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

REFERENCES
Alam ZI, Jenner A, Daniel SE, Lees AJ, Cairns N, Marsden CD, Jenner P, Halliwell B. Oxidative DNA damage in the parkinsonian brain: an apparent selective increase in 8-hydroxyguanine levels in substantia nigra. J. Neurochem 1997;79:11961203. [PubMed: 9282943] Aleyasin H, Cregan SP, Iyirhiaro G, O'Hare MJ, Callaghan SM, Slack RS, Park DS. Nuclear factor-B modulates the p53 response in neurons exposed to DNA damage. J Neurosci 2004;24:29632973. [PubMed: 15044535] Algarte M, Kwon H, Genin P, Hiscott J. Identification by in vivo genomic footprinting of a transcriptional switch containing NF-B and Sp1 that regulates the IB promoter. Mol Cell Biol 1999;19:6140 6153. [PubMed: 10454561] Anderson P, Kedersha N. Visibly stressed: the role of eIF2, TIA-1, and stress granules in protein translation. Cell. Stress Chaperones 2002;7:213221. [PubMed: 12380690] Barger SW, Moerman AM, Mao X. Molecular mechanisms of cytokine-induced neuroprotection: NFB and neuroplasticity. Curr Pharm Des 2005;11:985998. [PubMed: 15777249] Barnes DE, Stamp G, Rosewell I, Denzel A, Lindahl T. Targeted disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice. Curr. Biol 1998;8:13951398. [PubMed: 9889105] Beg AA, Baltimore D. An essential role for NF-B in preventing TNF--induced cell death. Science 1996;274:782784. [PubMed: 8864118] Bethea JR, Castro M, Keane RW, Lee TT, Dietrich WD, Yezierski RP. Traumatic spinal cord injury induces nuclear factor-B activation. J. Neurosci 1998;18:32513260. [PubMed: 9547234]

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 10

Beutler B, Hoebe K, Georgel P, Tabeta K, Du X. Genetic analysis of innate immunity: identification and function of the TIR adapter proteins. Adv. Exp. Med. Biol 2005;560:2939. [PubMed: 15934170] Bhakar AL, Tannis LL, Zeindler C, Russo MP, Jobin C, Park DS, MacPherson S, Barker PA. Constitutive nuclear factor-B activity is required for central neuron survival. J. Neurosci 2002;22:84668475. [PubMed: 12351721] Bogdanov M, Brown RH, Matson W, Smart R, Hayden D, O'Donnell H, Beal FM, Cudkowicz M. Increased oxidative damage to DNA in ALS patients. Free Radic. Biol. Med 2000;29:652658. [PubMed: 11033417] Bonizzi G, Bebien M, Otero DC, Johnson-Vroom KE, Cao Y, Vu D, Jegga AG, Aronow BJ, Ghosh G, Rickert RC, Karin M. Activation of IKK target genes depends on recognition of specific B binding sites by RelB:p52 dimers. Embo J 2004;23:42024210. [PubMed: 15470505] Burke PA, Ozato K. Regulation of major histocompatibility complex class I genes. Year Immunol 1989;4:2340. [PubMed: 2467459] Burke PA, Hirschfeld S, Shirayoshi Y, Kasik JW, Hamada K, Appella E, Ozato K. Developmental and tissue-specific expression of nuclear proteins that bind the regulatory element of the major histocompatibility complex class I gene. J. Exp. Med 1989;169:13091321. [PubMed: 2926327] Burstein E, Duckett CS. Dying for NF-B? Control of cell death by transcriptional regulation of the apoptotic machinery. Curr. Opin. Cell Biol 2003;15:732737. [PubMed: 14644198] Chen F, Demers LM, Vallyathan V, Lu Y, Castranova V, Shi X. Involvement of 5-flanking B-like sites within bcl-x gene in silica-induced Bcl-x expression. J. Biol. Chem 1999;274:3559135595. [PubMed: 10585435] Chu ZL, McKinsey TA, Liu L, Gentry JJ, Malim MH, Ballard DW. Suppression of tumor necrosis factorinduced cell death by inhibitor of apoptosis c-IAP2 is under NF-B control. Proc Natl Acad Sci U S A 1997;94:1005710062. [PubMed: 9294162] Chung TW, Moon SK, Chang YC, Ko JH, Lee YC, Cho G, Kim SH, Kim JG, Kim CH. Novel and therapeutic effect of caffeic acid and caffeic acid phenyl ester on hepatocarcinoma cells: complete regression of hepatoma growth and metastasis by dual mechanism. Faseb J 2004;18:16701681. [PubMed: 15522912] Cregan SP, MacLaurin JG, Craig CG, Robertson GS, Nicholson DW, Park DS, Slack RS. Bax-dependent caspase-3 activation is a key determinant in p53-induced apoptosis in neurons. J. Neurosci 1999;19:78607869. [PubMed: 10479688] Cui J, Holmes EH, Greene TG, Liu PK. Oxidative DNA damage precedes DNA fragmentation after experimental stroke in rat brain. FASEB J 2000;14:955967. [PubMed: 10783150] Culmsee C, Siewe J, Junker V, Retiounskaia M, Schwarz S, Camandola S, El-Metainy S, Behnke H, Mattson MP, Krieglstein J. Reciprocal inhibition of p53 and nuclear factor-B transcriptional activities determines cell survival or death in neurons. J Neurosci 2003;23:85868595. [PubMed: 13679428] Deans B, Griffin CS, Maconochie M, Thacker J. Xrcc2 is required for genetic stability, embryonic neurogenesis and viability in mice. EMBO J 2000;19:66756685. [PubMed: 11118202] Deng J, Lu PD, Zhang Y, Scheuner D, Kaufman RJ, Sonenberg N, Harding HP, Ron D. Translational repression mediates activation of nuclear factor B by phosphorylated translation initiation factor 2. Mol. Cell. Biol 2004;24:1016110168. [PubMed: 15542827] Dey A, Thornton AM, Lonergan M, Weissman SM, Chamberlain JW, Ozato K. Occupancy of upstream regulatory sites in vivo coincides with major histocompatibility complex class I gene expression in mouse tissues. Mol. Cell. Biol 1992;12:35903599. [PubMed: 1630463] Dragunow M, Faull RL, Lawlor P, Beilharz EJ, Singleton K, Walker EB, Mee E. In situ evidence for DNA fragmentation in Huntington's disease striatum and Alzheimer's disease temporal lobes. Neuroreport 1995;6:10531057. [PubMed: 7632894] Drew PD, Lonergan M, Goldstein ME, Lampson LA, Ozato K, McFarlin DE. Regulation of MHC class I and 2-microglobulin gene expression in human neuronal cells. J. Immunol 1993;150:33003310. [PubMed: 8468472] Drew PD, Franzoso G, Becker KG, Bours V, Carlson LM, Siebenlist U, Ozato K. NFB and interferon regulatory factor 1 physically interact and synergistically induce major histcompatibility class I gene expression. J. Interferon Cytokine Res 1995;15:10371045. [PubMed: 8746784]

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 11

Falvo JV, Thanos D, Maniatis T. Reversal of intrinsic DNA bends in the IFN gene enhancer by transcription factors and the architectural protein HMGI(Y). Cell 1995;83:11011111. [PubMed: 8548798] Fridmacher V, Kaltschmidt B, Goudeau B, Ndiaye D, Rossi FM, Pfeiffer J, Kaltschmidt C, Israel A, Memet S. Forebrain-specific neuronal inhibition of nuclear factor-B activity leads to loss of neuroprotection. J Neurosci 2003;23:94039408. [PubMed: 14561868] Fujita T, Nolan GP, Ghosh S, Baltimore D. Independent modes of transcriptional activation by the p50 and p65 subunits of NF-B. Genes Dev 1992;6:775787. [PubMed: 1577272] Ganchi PA, Sun S-C, Greene WC, Ballard DW. A novel NFB complex containing p65 homodimers: Implications for transcriptional control at the level of subunit dimerization. Mol. Cell. Biol 1993;13:78267835. [PubMed: 8246997] Glazner GW, Camandola S, Mattson MP. Nuclear factor-B mediates the cell survival-promoting action of activity-dependent neurotrophic factor peptide-9. J Neurochem 2000;75:101108. [PubMed: 10854252] Grilli M, Goffi F, Memo M, Spano P. Interleukin-1 and glutamate activate the NF-B/Rel binding site from the regulatory region of the amyloid precursor protein gene in primary neuronal cultures. J. Biol. Chem 1996;271:1500215007. [PubMed: 8663145] Guerrini L, Blasi F, Denis-Donini S. Synaptic activation of NF-B by glutamate in cerebellar granule neurons in vitro. Proc. Natl. Acad. Sci. USA 1995;92:90779081. [PubMed: 7568076] Hall IH, Williams WL Jr. Grippo AA, Lee KH, Holbrook DJ, Chaney SG. Inhibition of nucleic acid synthesis in P-388 lymphocytic leukemia cells in culture by sesquiterpene lactones. Anticancer Res 1988;8:3342. [PubMed: 2895992] Harada H, Takahashi E, Itoh S, Harada K, Hori TA, Taniguchi T. Structure and regulation of the human interferon regulatory factor 1 (IRF-1) and IRF-2 genes: implications for a gene network in the interferon system. Mol. Cell. Biol 1994;14:15001509. [PubMed: 7507207] Hayden MS, Ghosh S. Signaling to NF-B. Genes Dev 2004;18:21952224. [PubMed: 15371334] Heckman CA, Mehew JW, Boxer LM. NF-B activates Bcl-2 expression in t(14;18) lymphoma cells. Oncogene 2002;21:38983908. [PubMed: 12032828] Hellin AC, Calmant P, Gielen J, Bours V, Merville MP. Nuclear factor - B-dependent regulation of p53 gene expression induced by daunomycin genotoxic drug. Oncogene 1998;16:11871195. [PubMed: 9528861] Hiipakka RA, Zhang HZ, Dai W, Dai Q, Liao S. Structure-activity relationships for inhibition of human 5-reductases by polyphenols. Biochem. Pharmacol 2002;63:11651176. [PubMed: 11931850] Hutchins JB, Barger SW. Why neurons die: cell death in the nervous system. New Anatomist 1998;253:7990. Jarosinski KW, Massa PT. Interferon regulatory factor-1 is required for interferon--induced MHC class I genes in astrocytes. J. Neuroimmunol 2002;122:7484. [PubMed: 11777545] Jarosinski KW, Whitney LW, Massa PT. Specific deficiency in nuclear factor-B activation in neurons of the central nervous system. Lab. Invest 2001;81:12751288. [PubMed: 11555675] Jiang HY, Wek RC. GCN2 phosphorylation of eIF2 activates NF-B in response to UV irradiation. Biochem. J 2005;385:371380. [PubMed: 15355306] Jiang HY, Wek SA, McGrath BC, Scheuner D, Kaufman RJ, Cavener DR, Wek RC. Phosphorylation of the subunit of eukaryotic initiation factor 2 is required for activation of NF-B in response to diverse cellular stresses. Mol. Cell. Biol 2003a;23:56515663. [PubMed: 12897138] Jiang Z, Zamanian-Daryoush M, Nie H, Silva AM, Williams BR, Li X. Poly I:C-induced TLR3-mediated activation of NFB and MAP kinases is through an IRAK-independent pathway employing signaling components TLR3-TRAF6-TAK1-TAB2-PKR. J. Biol. Chem. 2003b Joly E, Mucke L, Oldstone MBA. Viral persistence in neurons explained by lack of major histocompatibility class I expression. Science 1991;253:12831285. [PubMed: 1891717] Kaltschmidt B, Kaltschmidt C, Hofmann TGH, Droge W, Schmitz ML. The pro- or anti-apoptotic function of NF-B is determined by the nature of the apoptotic stimulus. Euro. J. Biochem 2001;267:38283835.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 12

Kaltschmidt C, Kaltschmidt B, Baeuerle PA. Stimulation of ionotropic glutamate receptors activates transcription factor NF-B in primary neurons. Proc. Natl. Acad. Sci. USA 1995;92:96189622. [PubMed: 7568184] Keramaris E, Stefanis L, MacLaurin J, Harada N, Takaku K, Ishikawa T, Taketo MM, Robertson GS, Nicholson DW, Slack RS, Park DS. Involvement of caspase 3 in apoptotic death of cortical neurons evoked by DNA damage. Mol. Cell. Neurosci 2000;15:368379. [PubMed: 10845773] Kieran M, Blank V, Logeat F, Vandederckhove J, Lottspeich F, Le Bail O, Urban MB, Kourilsky P, Baeuerle PA, Israel A. The DNA binding subunit of NFB is identical for factor KBF1 and homologous to the rel oncogene product. Cell 1990;62:10071018. [PubMed: 2203531] Kimura K, Asami K, Yamamoto M. Structure of the promoter for the rat Fas antigen gene. Biochim Biophys Acta 1997;1352:238242. [PubMed: 9224946] Kirch HC, Flaswinkel S, Rumpf H, Brockmann D, Esche H. Expression of human p53 requires synergistic activation of transcription from the p53 promoter by AP-1, NF-B and Myc/Max. Oncogene 1999;18:27282738. [PubMed: 10348347] Koulich E, Nguyen T, Johnson K, Giardina C, D'Mello S. NF-B is involved in the survival of cerebellar granule neurons: association of IB phosphorylation with cell survival. J Neurochem 2001;76:11881198. [PubMed: 11181838] Kucharczak J, Simmons MJ, Fan Y, Gelinas C. To be, or not to be: NF-B is the answer-- role of Rel/ NF-B in the regulation of apoptosis. Oncogene 2003;22:89618982. [PubMed: 14663476] Kumar R, Azam S, Sullivan JM, Owen C, Cavener DR, Zhang P, Ron D, Harding HP, Chen JJ, Han A, White BC, Krause GS, DeGracia DJ. Brain ischemia and reperfusion activates the eukaryotic initiation factor 2 kinase, PERK. J. Neurochem 2001;77:14181421. [PubMed: 11389192] Kunsch C, Ruben SM, Rosen CA. Selection of optimal B/Rel DNA-binding motifs:Interaction of both subunits of NFB with DNA is required for transcriptional activation. Mol. Cell. Biol 1992;12:4412 4421. [PubMed: 1406630] La Rosa FA, Pierce JW, Sonenshein GE. Differential regulation of the c-myc oncogene promoter by the NF-B rel family of transcription factors. Mol. Cell. Biol 1994;14:10391044. [PubMed: 8289784] Lampson LA. Molecular basis of immune response to neural antigens. Trends Neurosci 1987;10:211. Lampson LA, Fisher CA, Whelan JP. Striking paucity of HLA-A,C.C and 2-microglobulin on human neuroblastoma cell lines. J. Immunol 1983;130:24712478. [PubMed: 6187860] Lyss G, Knorre A, Schmidt TJ, Pahl HL, Merfort I. The anti-inflammatory sesquiterpene lactone helenalin inhibits the transcription factor NF-B by directly targeting p65. J Biol Chem 1998;273:33508 33516. [PubMed: 9837931] Mao X, Barger SW. Excitotoxicity activates calpain to degrade Sp3 and Sp4, the prominent Sp-family transcription factors in neurons. 2005(submitted for publication) Mao X, Moerman AM, Barger SW. Neuronal B-binding factors consist of Sp1-related proteins: Functional implications for autoregulation of NR1 expression. J. Biol. Chem 2002;277:44911 44919. [PubMed: 12244044] Mao X, Moerman AM, Lucas MM, Barger SW. Inhibition of the activity of a neuronal B-binding factor (NKBF) by glutamate. J. Neurochem 1999;73:18511858. [PubMed: 10537043] Mao X, Moerman-Herzog AM, Wang W, Barger SW. Neuronal Sp-factors act as transcriptional repressors via a B-element in the SOD2 gene. 2005(submitted) Massa PT. Sites of antigen presentation in T-cell mediated demyelinating diseases. Res. Immunol 1989;140:175248. Massa PT, Wu H. Interferon regulatory factor element and interferon regulatory factor 1 in the induction of major histocompatibility complex class I genes in neural cells. J. Interferon Cytokine Res 1995;15:799810. [PubMed: 8536108] Massa PT, Ozato K, McFarlin DE. Cell type-specific regulation of major histocompatibility complex (MHC) class I gene expression in astrocytes, oligodendrocytes, and neurons. Glia 1993;8:201207. [PubMed: 8225560] Massa PT, Hirschfeld S, Levi B-Z, Quigley LA, Ozato K, McFarlin DE. Expression of major histocompatibility complex (MHC) class I genes in astrocytes correlates with the presence of nuclear factors that bind to constitutive and inducible enhancers. J. Neuroimmunol 1992;41:3542. [PubMed: 1460091]
J Neurochem. Author manuscript; available in PMC 2007 November 5.

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Massa et al.

Page 13

Matsui K, Fine A, Zhu B, Marshak-Rothstein A, Ju ST. Identification of two NF-B sites in mouse CD95 ligand (Fas ligand) promoter: functional analysis in T cell hybridoma. J Immunol 1998;161:3469 3473. [PubMed: 9759866] Mattson MP, Culmsee C, Yu Z, Camandola S. Roles of nuclear factor B in neuronal survival and plasticity. J. Neurochem 2001;74:443456. [PubMed: 10646495] Mattson MP, Goodman Y, Luo H, Fu W, Furukawa K. Activation of NF-B protects hippocampal neurons against oxidative stress-induced apoptosis: evidence for induction of manganese superoxide dismutase and suppression of peroxynitrite production and protein tyrosine nitration. J. Neurosci. Res 1997;49:681697. [PubMed: 9335256] Mauerhoff T, Pujol-Borrell R, Mirakian R, Bottazzo GF. Differential expression and regulation of major histocompatibility complex (MHC) products in neural and glial cells of the human fetal brain. J. Neuroimmunol 1988;18:271289. [PubMed: 3133393] Meffert MK, Chang JM, Wiltgen BJ, Fanselow MS, Baltimore D. NF-B functions in synaptic signaling and behavior. Nat Neurosci 2003;6:10721078. [PubMed: 12947408] Mengesdorf T, Proud CG, Mies G, Paschen W. Mechanisms underlying suppression of protein synthesis induced by transient focal cerebral ischemia in mouse brain. Exp. Neurol 2002;177:538546. [PubMed: 12429199] Moerman AM, Mao X, Lucas MM, Barger SW. Characterization of a neuronal B-binding factor distinct from NF-B. Mol. Brain Res 1999;67:303315. [PubMed: 10216229] Morris EJ, Keramaris E, Rideout HJ, Slack RS, Dyson NJ, Stefanis L, Park DS. Cyclin-dependent kinases and p53 pathways are activated independently and mediate Bax activation in neurons after DNA damage. J. Neurosci 2001;21:50175026. [PubMed: 11438577] Narasimhan J, Staschke KA, Wek RC. Dimerization is required for activation of eIF2 kinase Gcn2 in response to diverse environmental stress conditions. J. Biol. Chem 2004;279:2282022832. [PubMed: 15010461] Ohmori Y, Schreiber RD, Hamilton TA. Synergy between interferon- and tumor necrosis factor- in transcriptional activation is mediated by cooperation between signal transducer and activator of transcription 1 and nuclear factor B. J. Biol. Chem 1997;272:1489914907. [PubMed: 9169460] Oldstone MBA. How viruses escape from cytotoxic T lymphocytes: molecular parameters and players. Virology 1997;234:179185. [PubMed: 9268148] Oldstone MBA, Blount P, Southern PJ, Lampert PW. Cytoimmunotherapy for persistent virus infection reveals a unique clearance pattern from the central nervous system. Nature 1986;321:239243. [PubMed: 3086743] Overmyer M, Kraszpulski M, Helisalmi S, Soininen H, Alafuzoff I. DNA fragmentation, gliosis and histological hallmarks of Alzheimer's disease. Acta Neuropathol. (Berl) 2000;100:681687. [PubMed: 11078220] Owen CR, Kumar R, Zhang P, McGrath BC, Cavener DR, Krause GS. PERK is responsible for the increased phosphorylation of eIF2 and the severe inhibition of protein synthesis after transient global brain ischemia. J. Neurochem 2005;94:12351242. [PubMed: 16000157] Park DS, Morris EJ, Padmanabhan J, Shelanski ML, Geller HM, Greene LA. Cyclin-dependent kinases participate in death of neurons evoked by DNA- damaging agents. J. Cell Biol 1998;143:457467. [PubMed: 9786955] Pizzi M, Sarnico I, Boroni F, Benarese M, Steimberg N, Mazzoleni G, Dietz GP, Bahr M, Liou HC, Spano PF. NF-B factor c-Rel mediates neuroprotection elicited by mGlu5 receptor agonists against amyloid -peptide toxicity. Cell Death Differ 2005;12:761772. [PubMed: 15818410] Qiu J, Grafe MR, Schmura SM, Glasgow JN, Kent TA, Rassin DK, Perez-Polo JR. Differential NF-B regulation of bcl-x gene expression in hippocampus and basal forebrain in response to hypoxia. J Neurosci Res 2001;64:223234. [PubMed: 11319766] Rall GF, Mucke L, Oldstone MBA. Consequences of cytotoxic T lymphocyte interactions with major histocompatibility complex class I-expressing neurons in vivo. J. Exp. Med 1995;182:12011212. [PubMed: 7595191] Schachner M, Hammerling U. The postnatal development of antigens on mouse brain cell surfaces. Brain Res 1974;73:362371. [PubMed: 4208648]

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 14

Schmitz ML, Baeuerle PA. The p65 subunit is responsible for the strong transcription activating potential of NF-B. EMBO J 1991;10:38053817. [PubMed: 1935902] Schnitzer J, Schachner M. Expression of Thy-1, H-2 and NS-4 cell surface antigens and tetanus toxin receptors in early postnatal and adult mouse cerebellum. J. Neuroimmunol 1981;1:429456. [PubMed: 6125529] Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-B transcription factor and HIV-1. EMBO J 1991;10:22472258. [PubMed: 2065663] Seil FJ, Drake-Baumann R, Herndon RM, Leiman AL. Cytosine arabinoside effects in mouse cerebellar cultures in the presence of astrocytes. Neuroscience 1992;51:149158. [PubMed: 1465178] Sen GC, Sarkar SN. Transcriptional signaling by double-stranded RNA: role of TLR3. Cytokine Growth Factor Rev 2005;16:114. [PubMed: 15733829] Streilein JW. Immune privilege as the result of local tissue barriers and immunosuppressive microenvironments. Curr. Opin. Immunol 1993;5:428432. [PubMed: 8347303] Sugita K, Miyazaki J, Appella E, Ozato K. Interferons increase transcription of a major histocompatibility class I gene via a 5 interferon consensus sequence. Mol. Cell. Biol 1987;7:26252630. [PubMed: 3475569] Tamatani M, Che YH, Matsuzaki H, Ogawa S, Okado H, Miyake S, Mizuno T, Tohyama M. Tumor necrosis factor induces Bcl-2 and Bcl-x expression through NFB activation in primary hippocampal neurons. J Biol Chem 1999;274:85318538. [PubMed: 10085086] Thanos D, Maniatis T. The high mobility group protein HMG I(Y) is required for NFB-dependent virus induction of the human IFN- gene. Cell 1992;71:777789. [PubMed: 1330326] Thanos D, Maniatis T. Identification of the rel family members required for virus induction of the human interferon gene. Mol. Cell. Biol 1995a;15:152164. [PubMed: 7799921] Thanos D, Maniatis T. Virus induction of human IFN gene expression requires the assembly of an enhanceosome. Cell 1995b;83:10911100. [PubMed: 8548797] Van Antwerp DJ, Martin SJ, Kafri T, Green DR, Verma IM. Suppression of TNF--induced apoptosis by NF-B. Science 1996;274:787789. [PubMed: 8864120] Wang CY, Mayo MW, Baldwin ASJ. TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-B. Science 1996;274:784787. [PubMed: 8864119] Wang CY, Mayo MW, Korneluk RG, Goeddel DV, Baldwin AS Jr. NF-B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c- IAP2 to suppress caspase-8 activation. Science 1998;281:16801683. [PubMed: 9733516] Ward LA, Massa PT. Neuron-specific regulation of major histocompatibility complex class I, interferon, and anti-viral state genes. J. Neuroimmunol 1995;58:145155. [PubMed: 7759604] Wong G, Bartlett P, Clark-Lewis I, Battye F, Schrader J. Inducible expression of H-2 and Ia antigens on brain cells. Nature 1984;310:688691. [PubMed: 6433204] Wong GHW, Bartlett PF, Clark-Lewis I, McKimm-Breschkin JL, Schrader JW. Interferon- induces the expression of H-2 and Ia antigens on brain cells. J. Neuroimmunol 1985;7:255278. [PubMed: 3919057] Yabe T, Kanemitsu K, Sanagi T, Schwartz JP, Yamada H. Pigment epithelium-derived factor induces pro-survival genes through cyclic AMP-responsive element binding protein and nuclear factor B activation in rat cultured cerebellar granule cells: Implication for its neuroprotective effect. Neuroscience 2005;133:691700. [PubMed: 15893882] Yamamoto M, Sato S, Mori K, Hoshino K, Takeuchi O, Takeda K, Akira S. Cutting edge: a novel Toll/ IL-1 receptor domain-containing adapter that preferentially activates the IFN- promoter in the Toll-like receptor signaling. J. Immunol 2002;169:66686672. [PubMed: 12471095] Yano O, Kanellopoulos J, Kieran M, Le Bail O, Israel A, Kourilsky P. Purification of KBF1, a common factor binding to both H-2 and 2-microglobulin enhancers. EMBO J 1987;6:33173324. [PubMed: 3322806]

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 15

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Figure 1. Glutamate suppression of NFB activity in primary neurons

Cortical neurons were prepared from the neocortex of mice transgenic for a B-reporter galactosidase gene; these neurons were cultured alone (with a transient AraC exposure to kill mitotic cells) or plated onto a confluent monolayer of wildtype astrocytes. At T0, glutamate was applied at 50 M transiently (10 min) or at 20 M continuously. -gal activity was measured in lysates at the subsequent times indicated (h). CD40L was also applied to cocultures for 18 h at the concentrations indicated (g/mL). Values represent activity relative to untreated cultures SEM. Comparison between control and each treatment yielded p < 0.02. (Activity was undetectable in pure neuronal cultures 24 h after glutamate application.)

Massa et al.

Page 16

NIH-PA Author Manuscript NIH-PA Author Manuscript

Figure 2. Like dsRNA, LPS induces NFBcan in astrocytes but RelA homodimers (RelA2) in neurons

DNA-binding activity in nuclear extracts from mouse astrocytes or cerebellar granule cell cultures was specifically detected with an iNOS-B site and IFN-B site, respectively.

NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 17

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Figure 3. Induction of IB degradation and NFB nuclear binding activity in astrocytes by amino acid starvation

Astrocytes were treated with standard medium or with arginine-free medium for 0.5 to 4 h. Nuclear extracts were analyzed for NFB binding activity with the iNOS-B probe (5'AACTGGGGACTCTCCCTT-3'). This probe binds primarily to p50:RelA heterodimers (NFBcan) but also shows some affinity for RelA2.

Massa et al.

Page 18

NIH-PA Author Manuscript

Figure 4. Preferential induction of different B binding activities by amino acid starvation in neurons and astrocytes

Purified astrocyte and neuron primary cultures were treated with either standard or argininefree medium for 4 h. Cytosolic extracts were tested for IB degradation western blot analysis, and nuclear extracts were tested for NFB induction by EMSA. Neurons show activation of RelA2 while astrocytes show activation of NFBcan.

NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 19

NIH-PA Author Manuscript

Figure 5. Sp1 is glial and Sp4 is neuronal

Mixed neuron/glia primary cocultures from rat hippocampus were fixed and subjected to immunofluorescence with FITC (green)-conjugated antibodies to Sp1 (right) or Sp4 (left), combined with Texas red-conjugated antibodies to GFAP (top) or MAP2 (bottom). Colocalization appears yellow. Note the restriction of Sp1 from neurons (MAP2+) and the restriction of Sp4 from astrocytes (GFAP+). Both cell types expressed Sp3 (not shown).

NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 20

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Figure 6. Induction of RelA homodimers via physiologic translational pathways in neurons: A preferential pathway in neurons?

Several stimuli, coupled to distinct initial signal transduction events, may converge on the phosphorylation of eIF2, irrespective of cell type. The phosphorylation of eIF2 can act as a switch, preferentially inhibiting the translation of specific mRNAs; one of those dramatically affected is IB. The reduction of this inhibitor tends to be permissive for NFB activity, but the particular dimer activated depends in some manner on cell type. Distinct dimers also have preferential affinity for different DNA sequences, and particular DNA sequences may be grouped in functionally related genes. For example, sequences with preferential affinity for Rel2 may be present in important prosurvival genes, whereas NFBcan binds the promoters of genes connected to a more generalized immune system activation.

Massa et al.

Page 21

TABLE I

Selectivity for Sp1-related factors or NFB

Name of element Ig/HIV-B Ig/HIV-B-mut1 Ig/HIV-B-mut2 APP1 APP2 Bcl-x COX-2 SOD2 (human) Sequence of B element AGTTGAGGGGACTTTCCCAGGC AGTTGAcGGGACTTTCCCAGGC ATTGGGGACTTTCCAGGC GAGACGGGGTTTCACCGTGTT GCATGGGGCTCCTCCCACCG GCGGGGGGGACTGCCCAGGGAG GGGAGAGGGGATTCCCTGCGCC AGACTGGGGAATACCCCAGTTGT Sp1 binding ? +++ + + +++ +++ + +++ NFB binding ? +++ +++ +++ +++ + +++ +++ +++

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.

Massa et al.

Page 22

TABLE II

Preferred NFB heterodimer and RelA homodimer B sites

p50:RelA heterodimers (NFBcan) and p50 homodimers (KBF1) MHC class I-B (GGGGATTCCC) IRF-1-B (GGGGAATCCC) iNOS-B (GGGACTCTCC) p50:RelA heterodimers (NFBcan) and RelA homodimers (Rel2) IFN--B(GGGAAATTCC) iNOS-B (GGGACTCTCC) IRF-2-B(GGGGATTTCC)

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

J Neurochem. Author manuscript; available in PMC 2007 November 5.