BookOfAbstracts 15thWORKSHOP PDF

University of Naples - Federico II
Faculty of Agriculture
P
15th WORKSHOP on the Development in the Italian PhD
Research on Food Science Technology and Biotechnology
September 15-17, 2010
Facolt di Agraria, Universit degli Studi di Napoli - Federico II
Portici (NA)
15
th
Workshop on the Developments in the Italian PhD Research on Food Science Technology and Biotechnology,
University of Naples Federico II, Portici, 15-17 September, 2010
III
15
th
University of Napoli I Federico II, Portici, 15-17 September, 2010

Editors:

Silvana Cavella
University of Napoli Federico II

Gianpaolo Andrich
University of Pisa

Andrea Antonelli
University of Modena and Reggio Emilia

Marilena Budroni
University of Sassari

Claudio Cavani
University of Bologna

Francesca Clementi
Polytechnic University of Marche

Viviana Corich
University of Padova

Marco Esti
University of Tuscia

Natale Frega

Vincenzo Gerbi
University of Torino

Marco Gobbetti
University of Bari

Matteo Alessandro Del Nobile
University of Foggia

Emanuele Marconi
University of Molise

Valeria Mazzoleni
University Cattolica del Sacro Cuore

Germano Mucchetti
University of Parma

Eugenio Parente
University of Basilicata

Luciano Piergiovanni
University of Milano

Marco Poiana
Mediterranean University of Reggio Calabria

Alessandro Sensidoni
University of Udine

Giovanna Suzzi
University of Teramo

Antonella Verzera
University of Messina

Bruno Zanoni
University of Firenze

15
th

Editors:

Silvana Cavella

Gianpaolo Andrich
University of Pisa

Andrea Antonelli

Marilena Budroni

Claudio Cavani

Francesca Clementi

Viviana Corich

Marco Esti

Natale Frega

Vincenzo Gerbi

Marco Gobbetti
University of Bari

Matteo Alessandro Del Nobile

Emanuele Marconi

Valeria Mazzoleni

Germano Mucchetti
University of Parma

Eugenio Parente

Luciano Piergiovanni

Marco Poiana

Alessandro Sensidoni
University of Udine

Giovanna Suzzi

Antonella Verzera

Bruno Zanoni

15
th
IV
ii
15
th

Organising Committee
Silvana Cavella
Rossella Di Monaco
Danilo Ercolini
Paolo Masi
Gianluigi Mauriello
Annalisa Romano
Fabrizio Sarghini
Elena Torrieri
Francesco Villani
15
th
V
iii

15
th

Coordinator committee of the Italian PhD in Food Science,
Technology and Biotechnology

Prof. G.P. Andrich
University of Pisa

Prof. A. Antonelli

Prof. M. Budroni

Prof. C. Cavani

Prof.ssa S. Cavella

Prof.ssa F. Clementi

Prof.ssa V. Corich

Prof. M. Esti

Prof. N. Frega

Prof. V. Gerbi

Prof. M. Gobbetti
University of Bari

Prof. M.A. Del Nobile

Prof. E. Marconi

Prof.ssa V. Mazzoleni

Prof. G. Mucchetti
University of Parma

Prof. E. Parente

Prof. L. Piergiovanni

Prof. M. Poiana

Prof. A. Sensidoni
University of Udine

Prof. G. Spagna
University of Catania

Prof.ssa G. Suzzi

Prof.ssa A. Verzera

Prof. B. Zanoni
iii

15
th


Prof. G.P. Andrich
University of Pisa

Prof. A. Antonelli

Prof. M. Budroni

Prof. C. Cavani

Prof.ssa S. Cavella


Prof.ssa V. Corich

Prof. M. Esti

Prof. N. Frega

Prof. V. Gerbi

Prof. M. Gobbetti
University of Bari


Prof. E. Marconi


Prof. G. Mucchetti
University of Parma

Prof. E. Parente


Prof. M. Poiana

Prof. A. Sensidoni
University of Udine

Prof. G. Spagna

Prof.ssa G. Suzzi

Prof.ssa A. Verzera

Prof. B. Zanoni
iii

15
th


Prof. G.P. Andrich
University of Pisa

Prof. A. Antonelli

Prof. M. Budroni

Prof. C. Cavani

Prof.ssa S. Cavella


Prof.ssa V. Corich

Prof. M. Esti

Prof. N. Frega

Prof. V. Gerbi

Prof. M. Gobbetti
University of Bari


Prof. E. Marconi


Prof. G. Mucchetti
University of Parma

Prof. E. Parente


Prof. M. Poiana

Prof. A. Sensidoni
University of Udine

Prof. G. Spagna

Prof.ssa G. Suzzi

Prof.ssa A. Verzera

Prof. B. Zanoni
15
th
Contents
3
rd
Year PhD Student Oral Communications 1
2
nd
Year PhD Student Poster Communications 203
1
st
Year PhD Student Dissertation Project 309
Index 371
VII
15
th
3
rd
Year PhD Student
Oral Communications
15
th
3
15
th
Workshop on the Developments in the Italian PhD Research on Food Science Technology and
Biotechnology, University of Naples Federico II, Portici, 15-17 September, 2010
Hot Air-Drying and Rehydration of Fruits and Vegetables: Optimization
and Modelling
Giuseppina Adiletta (gadiletta@unisa.it)
Dept. Chemical and Food Engineering, University of Salerno, Fisciano (Sa), Italy
Mediterranian University of Reggio Calabria-administrative seat-, Reggio Calabria, Italy
Tutor: Prof. Marisa Di Matteo
The aim of this PhD project is to study and to optimize the drying and rehydration processes of eggplant and
pears. The effects of an innovative and natural pre-treatment during conventional hot air drying at different
temperatures were investigated on quality of the dried and rehydrated products. Suitable mathematical models
were developed to estimate the transport parameters of the hot air drying and rehydration and to study the pre-
treatments impact on the quality of the dried and rehydrated vegetable and fruit samples.
Essiccazione e reidratazione di frutta e verdure: Ottimizzazione e Modellazione
Scopo di questa tesi di dottorato lo studio dellessiccazione e della reidratazione di prodotti ortofrutticoli, con
particolare riferimento a prodotti quali melanzane e pere, agendo su pretrattamenti innovativi e operando a
diverse temperature di processo. Sono state valutate cinetiche di disidratazione, di reidratazione e le variazioni
dei principali parametri chimico-fisici e sensoriali dei prodotti essiccati e reidratati. Sono stati inoltre sviluppati
dei modelli matematici in grado di stimare con sufficiente precisione i parametri di trasporto di massa nei
processi di essiccamento e di reidratazione valutando anche lincidenza del pretrattamento alle diverse
temperature utilizzate.
Key words: vegetable; drying; rehydration; pre-treatment; modelling.
1. Introduction
In accordance with the PhD thesis project previously described (Adiletta, 2009), this oral communication reports
the main results of the following activities directed to investigate:
A1) the influence of pretreatment in hot-air drying and rehydration of eggplants and pears;
A2) suitable drying and rehydration models for describing the drying and rehydration processes.
2. Drying and rehydration of fruits and vegetables
Drying of vegetables is the oldest and widely used preservation method. It involves reduction of as much water
as possible from foods to arrest enzyme and microbial activities hence stopping deterioration.
Nevertheless, shrinkage, fading of natural color or discoloration, decreased flavor and unappetizing texture are
the most evident deficiencies of dry products. Moreover, poor rehydration ability and reduced nutritional quality
are also evidence of disadvantageous influence of drying on food. In the case of solid foods multiple pre-drying
processes are used. Generally they can be divided into chemical and physical treatments. The chemical
treatments of the material before drying include sulfiting, immersion in sodium chloride, calcium chloride or
sugars, use of surfactants and impregnation with biopolymers. The frequent treatment preceding drying is
blanching, but pre-treatments with high pressure or microwave energy are also investigated as means to improve
quality of dried products (Lewicki, 2006). Rehydration is a complex process and its main purpose consists of
restoring the properties of the dry foods. The capacity of the dry material to be rehydrated depends on certain
intrinsic properties of the vegetal tissue and also, on how the rehydration process is carried out (process
conditions) and on the previous pretreatments applied to the product (Kolawole et al.,2007).
3.Eggplant
3.1 Material and Methods
Drying experiments were conducted on Eggplants (Solanum melongena) cv. Longo with an initial moisture
content of 12,58 kg H
2
O/kg dry solids. Cylindrical slices with diameters of 30 mm and thickness of 6 mm were
obtained randomly from peeled vegetables. Two kinds of eggplant samples were compared during the drying at
two temperatures (50-60C):
UTR: untreated eggplant samples; TR: eggplant samples pre-treated by dipping into innovative solution for 20
minutes at 25C. Drying tests were carried out by a convective oven mod. Zanussi FCV/E6L3 with an air rate of
2,3 m
2
/s. At suitable time intervals the weight loss was monitored by means of an analytical balance (Gibertini,
Model E 42, Italy). The procedure was repeated until the water content plateau was reached.
Dehydrated samples were rehydrated in distilled water at 25C for 5 h using an eggplant: water ratio of 1:100
w/w. The samples were then removed, drained for 30 s, and weighed at suitable time intervals (Gibertini, Model
15
th
4
15
th
E 42, Italy). The operation is repeated until reaching the water content plateau.
3.1.1 Analyses Colour parameters (WI, Chroma and Hue angle), texture and microstructure changes of eggplant
samples were evaluated according to (Albanese et al.,2007) before and after drying.
3.1.2 Statistical analysis The analytical results were analysed using one-way analyses of variance. Differences
(p < 0.05) between means were studied with the Bonferroni test.
3.2 Mathematical modelling of eggplant drying process
Dehydration process is a complex process involving in general both mass and energy transfers. In this case, if it
considered the dimension of the eggplant samples (thickness lower than surface area), it was possible to assume
that the thickness was negligible and the time of the thermal transient was far less than that of mass transport.
Thus, the whole process may be regarded as taking place under isothermal conditions as for other similar
processes ( Bird et al., 1960; Di Matteo et al.,2003). The model was based on the Fick's law of mass diffusion. It
was built basing on the assumptions that the material is homogeneous and isotropic and that the water transport
along the lateral bases of the sample was negligible. Eggplants have shown structure modification during drying
processes which appeared as a shrinkage of the external surface area. It assumed that the effect of structure
changing was mainly due to the changes of pores structure of the sample which could became large or could
collapse because of material adjustment. However, the changes in pores structure influenced water diffusion and
thus it had to be taken into account. To this purpose, suitable porosity experiments were performed to highlight
the dependence of the void fraction due to pores on the water content (Wu et al.,2007). A variable diffusion
coefficient L
c]]
was introduced. The diffusion coefficient was thus written as the product of a constant term L
and a factor depending on the water content through a linear law:L
c]]
= L = L(o
1
+ o
2
c)
(1). Lwas a constant diffusion coefficient (which should hold in the hypothesis of no shrinkage phenomenon at
c=1). The parametero
1
was the maximum ratio between L
c]]
and L due to porosity variation, while
o
2
represented the porosity variation due to a water content variation of one unit. Under these assumptions the
mathematical model was the following:
c
t
=

x
jL(o
1
+o
2
c)
c
x
[ (2); in which c was the dimensionless water content
(weight of water over initial weight of water), r was the space variable, t was the temporal variable. As the
porosity values were normalized respect to the initial porosity value, the following relationship was valid:
o
1
= 1 - o
2
. The solutions of the differential equation (1) were found using the following initial condition (I.C.)
and boundary conditions (B.C.):
I.C.: c(r, u) = 1r e |-I, I] (3); B.C
1
.:

oc
ot
x=u
= ut > u B.C
2
:L(o
1
+ o
2
c)

oc
ox
x=I
= b [

c
s
|
x=I
0
- c
t > u (4)
The equilibrium distribution curve relating water content at eggplant/outer environment interface was assumed to
be linear and characterized by an equilibrium constant 0. Moreover, the water diffusion in the gaseous film
around the slice was described through a convective mass transfer coefficient b. Assuming that c
was
negligible respect toc
s
, the boundary conditions (4) were written in term of an overall mass transport
coefficientK as shown in this equations:

c
t
x=0
= ut > u L(o
1
+ o
2
c)

c
x
x=L
= K

c
s
|
x=L
t > u (5)
The parameter o
2
, stating the dependence of diffusion coefficient L
c]]
from the water content was carried out
applying the least squared method on the porosity vs water content experimental data.
The parameters values L and K of the dehydration model were derived through a numerical procedure based on
nonlinear regression methods. The procedure was based on the comparison between the diffusion equations
roots, obtained numerically by means of a finite difference method and the available experimental data for each
temperature. All the procedures were performed with the help of MatLab software.
For validation purpose normalized residuals and confidence intervals of the parameters were also computed.
3.3 Mathematical modelling of eggplant rehydration process
The rehydration process was described through a pure Fickian model. The equation was the following:
c
t
=

x
jL
c
x
[ (6), in which c is the dimensionless water content (weight of water over final weight of water). Initial
water content inside the slice was assumed to be negligible, as confirmed by dehydration experiments.
Moreover, as the samples were immersed in a water bath, a simplified boundary condition was adopted. It
consisted in imposing a water content value at the inner eggplant/water interface. Initial and boundary conditions
were reported in the following: I.C: c(r, u) = ur e |-I, I] (7); B.C.
1
:

c
t
x=0
= ut > u B.C
2
: c(r = I, t) = 1t > u (8)
4.Pear
4.1 Material and Methods
Drying experiments were conducted on Pears (Pyrus communis L. cultivar Conference), with an initial moisture
content of 5,23 kg H
2
O/kg dry solids. Spherical samples with radius of 14 mm were obtained randomly from
peeled fruits. Two kinds of pears samples were compared during the drying at three temperatures (45-50-55C):
UTR: untreated pear samples; TR: pear samples pre-treated by dipping into innovative solution for 10 minutes at
50C. The drying experiments were conducted with the same instruments used for the eggplants drying at an air
rate of 2,3 m
2
/s until the pears reached a water content of 25% (dry basis). This value corresponds to the
optimum value for this kind of fruit, considering its chemical and physical properties and preservation capacity
15
th
5
15
th
WI Chroma h
0
20
40
60
80
100
120
Fresh
UTR 50C
TR 50C
UTR 60C
TR 60C
a
b
a
b
a
b
a
b
a
b
a a
b
b
a
WI Chroma h
0
20
40
60
80
100
120
Fresh
UTR 50C
TR 50C
UTR 60C
TR 60C
a
c
b
c
a
b
a
c
a
c
a
c
b
c
b
b a
(Guin, 2005). The dried samples were placed in distilled water at 25C for 3 h, using a solid/liquid ratio of 1:30
w/w. At suitable time intervals pears samples were removed, drained for 30 s and weighed by an analytical
balance (Gibertini, Model E 42, Italy).
4.1.1 Analyses Colour and microstructure changes of pears samples before and after drying were evaluated
according to (Albanese et al.,2007). Texture Profile Analysis (TPA) was conducted on control and pre-treated
pear samples according to (Rolle et al.,2005).
4.1.2 Statistical analysis The analytical results were analysed using one-way analyses of variance. Differences
(p < 0.05) between means were studied with the Bonferroni test.
4.2 Mathematical modelling of pear drying process
For this drying mathematical modeling the same assumptions of eggplant drying modeling were in force. Under
the assumptions that the pear samples were spherical with constant radius, the mathematical model of
(isothermal) pear drying was reduced to the equation of mass diffusion from a spherical body:
C
t
= L[
2
C
2
+
2
(9); in which C was the dimensionless water content (weight of water over initial weight of water), r was the
space variable, t was the temporal variable. The equation was analytically solved by putting u = Cr.
The solutions of the differential equation (9) were found using the following initial conditions (I.C.) and
boundary conditions (B.C.): I.C.: t = uu(r, t = u) = u
0
= C
0
rvr e |u, o]; (10)
B.C.
1
: r = uu(r = u, t) = uvt > u ; B.C
2
: r = o

u
=u
=

[
1
u
-
K
L
u
=u
vt > u (11)
The parameters values L and K were calculated through a numerical procedure based on nonlinear regression
methods. The procedure was based on the comparison between the diffusion equations solutions, obtained
numerically by means of a finite difference method and the available experimental data for each temperature. All
the procedures were implemented in MatLab. Although not reported, for parameters validation purpose
normalized residuals were also computed.
4.3 Mathematical modelling of pear rehydration process
In the eggplant rehydration process the equation (9) was analytical solved using the following initial and
boundary conditions instead of 10-11 conditions:I.C.: t = uu(r, t = u) = u
1
= C
1
rvr e |u, o]; (12)
B.C.
1
: r = uu(r = u, t) = uvt > u B.C.
2
: r = ou(r = o, t) = C
0
ovt > u (13)
The initial condition corresponded to hypothesis that the sphere was initially at a uniform concentration C
1
while
BC
2
to hypothesis that the surface concentration was maintained at C
0
.
5. Eggplant results and discussion
5.1 Influence of pre-treatment on physical and chemical properties of the dried and rehydrated samples
Browning is one of the most important phenomenon occurring during drying process. The capability of slowing
down it represents a key element for food industries to improve the overall quality of their products. In order to
evaluate the magnitude of browning during drying tests at 50 and 60C and the effectiveness of pre-treatment at
the same temperatures, the WI, Chroma and Hue angle of fresh and dried eggplant samples were reported in
Figure 1a. No colour differences in treated dried eggplants (TR) were detected respect to fresh sample. UTR on
the contrary showed browning phenomenon with significant differences in colour parameters than the fresh
samples. A similar trend, for UTR and TR samples, was detected during the rehydration process (Figure 1b).
Both dried and rehydrated TR showed texture parameters closer to fresh samples than UTR ones. (Tables 1-2).
Although not reported, similar trends were observed in SEM images.
Figure 1 Colour parameters WI, Chroma and Hue
angle of dried UTR and TR eggplant samples at 50 and
60C (a) and of rehydrated UTR and TR eggplant
samples (b). At each parameter value followed by
different lowercase letters are significantly different at
P < 0.05.
Tables 1-2 Results of texture analysis for dried (Table 1) and rehydrated (Table 2)eggplant samples.

1
Stiffness
(Nm
-1
)
Young's
modulus
(Mpa)
Max
Load
(N)
Strain
at Max
Load
(MPa)
Work
to Max
Load
(MPa)
Deform.
at
Max
Load
(mm)
Fresh 40676,932
c
1,409
c
87,878
a
0,506
b
0,108
b
3,010
c
UTR
50C
58570,969
ab
3,171
a
28,719
b
0,287
c
0,031
c
4,385
b
TR
50C
69399,705
a
4,106
b
78,316
a
0,828
a
0,101
b
4,501
b
UTR
60C
48513,779
bc
3,232
ab
30,246
b
0,300
c
0,038
c
5,376
a
TR
60C
65691,014
ab
3,674
ab
85,361
a
0,827
a
0,133
a
4,649
b

2
Stiffness
(Nm
-1
)
Young's
modulus
(Mpa)
Max
Load
(N)
Strain
at Max
Load
(MPa)
Work
to Max
Load
(MPa)
Deform.
at
Max
Load
(mm)
Fresh 40676,932
c
1,409
c
87,878
a
0,506
bc
0,108
a
3,010
b
UTR
50C
92898,353
a
4,964
b
36,367
d
0,391
c
0,019
bc
4,271
a
TR
50C
110152,932
a
6,308
a
63,577
b
0,685
a
0,038
b
3,933
a
UTR
60C
98063,154
a
3,904
b
45,993
cd
0,479
bc
0,019
c
3,769
a
TR
60C
154943,861
b
7,444
a
52,349
bc
0,523
b
0,024
bc
3,194
b
15
th
6
15
th
t[min]
0 50 100 150 200 250
0,0
0,2
0,4
0,6
0,8
1,0
M M
M Mt
0
UTR experimental data
UTR predicted values
0 50 100 150 200 250 300
0,0
0,2
0,4
0,6
0,8
1,0
TR experimental data
Col 3 vs valori teorici
t[min]
M M
M Mt
0
Chroma h WI
0
20
40
60
80
100
120
Fresh
UTR45C
TR45C
UTR50C
TR50C
UTR55C
TR55C
d
b
c
ab
c
a ab
a
d
b
cd
ce e
a
d
b
cd
b
d
c
bcd
Cohesiveness Springiness Hardness
0
1
2
3
4
5
Fresh
UTR 45
TR 45
UTR 50
TR 50
UTR 55
TR 55
a
e
cd
de
c
c
b
c
b a ab
ab
abab
a
f
cd
ef
c
de
ab
5.2 Eggplant drying and rehydration modelling
The parameters values
of the dehydration model with confidence intervals were reported in Table 3.

The developed mathematical model was able to describe with sufficient accuracy the isothermal dehydration
processes with and without pretreatment. As an example, water content evolution in UTR and TR samples,
during drying at 60C, were shown in Figure 2(a,b). A higher dehydration rate of TR eggplants than UTR ones
can be easily observed. The latter may be due to the effect of pre-treatment able to preserve the structure of
vegetable samples during the evaporation phenomenon.

values of the rehydration model with confidence
intervals were reported in Table 4. The treated samples showed the

lower than UTR ones and this caused a
slow down in a water absorption. This condition allowed to the vegetable to preserve its structure without
leaching phenomenon. Water content evolution during rehydration time for dried UTR and TR at 60C were
shown in Figure 2(c,d). Although not reported, for parameters validation purpose normalized residuals are also
computed.
Tables 3-4 Results of mathematical modelling for eggplant drying (Table 3) and rehydration processes (Table 4)
Figure 2 Experimental and theoretical water content evolution during drying process (a,b) and during rehydration process
(c,d) for dried UTR and TR eggplants at 60C.
6. Pear results and discussion
6.1 Influence of pre-treatment on physical and chemical properties of the dried and rehydrated samples
The effect of drying conditions on texture and colour properties of dried UTR and TR samples were reported in
figures 3a and 3b respectively. Pear samples dried at 45 and 50C showed lower differences in colour
parameters than fresh samples. The collected data on texture parameters highlighted that the temperature and
treatment influenced hardness and springiness of the dried samples alike, excepting cohesiveness. Increasing the
drying temperature, an increase of hardness and springiness values were observed for UTR and TR pears
samples. Moreover, TR samples showed higher textural values than UTR ones. Similar trends was observed in
pears rehydration processes and in SEM images (data not reported).
Figure 3 Colour parameter values of UTR and TR dried
pear samples at 45, 50 and 55C (a) and TPA
parameter values of UTR and TR rehydrated pear
samples (b). At each parameter value followed by
different lowercase letters are at significantly different at
P < 0.05.
6.2 Pear drying and rehydration modelling
The parameters values
of the dehydration model with confidence intervals are reported in Table 5.

This diffusion model was found to be a good model for describing the drying curves pears as shown in figure 4
(a,b). The results of mathematical modelling also have shown that the pre-treatment increased the diffusivity
value during pears drying processes at each temperature. Moreover, the results of the rehydration model, the

values with confidence intervals, were reported in Table 6.
Regarding the pear rehydration model developed in this research activity, the
values extrapolated at three

different temperatures highlighted that no significant differences between UTR and TR pear samples were
Dehydration
T
(C)
Untreated Treated
Value C. I. Value C. I.
50
Deff
(cm
2
/s)
2,886E-04 2,2920E-04
3,4800E-04
3,306E-04 2,106E-04
4,506E-04
K
(cm/s)
4,780E-04 4,460E-04
5,100E-04
3,440E-04 2,9700E-04
3,9000E-04
2 -6,277E-01 -8,560E-01
-3,990E-01
-4,698E-01 -6,7900E-01
-2,6000E-01
60
Deff
(cm
2
/s)
4,368E-04 3,762E-04
4,980E-04
4,842E-04 9,9600E-05
8,7000E-05
K
(cm/s)
7,870E-04 6,710E-04
9,030E-04
5,430E-04 5,0300E-04
5,8200E-04
2 -2,088E-01 -2,429E-01
-1,747E-01
-4,674E-01 -7,2110E-01
-2,1370E-01
Rehydration
T
(C)
Untreated Treated
50 Deff
(cm
2
/s)
1,506E-04 1,395E-04
1,613E-04
8,880E-05 8,560E-05
9,211E-05
60 Deff
(cm
2
/s)
1,517E-04 1,482E-04
1,551E-04
8,845E-05 8,626E-05
9,065E-05
t[min]
0 50 100 150 200 250 300 350
0,0
0,2
0,4
0,6
0,8
1,0
1,2
0
0
M M
M Mt
TR experimental data
TR predicted values
t[min]
0 100 200 300
0,0
0,2
0,4
0,6
0,8
1,0
1,2
UTR experimental data
0
0
M M
M Mt
c
a
3
4
b
b a d
15
th
7
15
th
found. The developed mathematical models were able to describe with sufficient accuracy the isothermal
dehydration and rehydration processes with and without pretreatment. As an example, water content evolution
during dehydration at 50C and rehydration time, for both UTR and TR pears samples, were shown in Figure 4.
Although not reported, for parameters validation purpose normalized residuals are also computed.
Tables 5-6 Results of pear drying and rehydration mathematical modelling .
Figure 4 Experimental and theoretical water content evolution during drying process (a,b) and during rehydration process
(c,d) for dried UTR and TR pears at 50C.
7. Conclusions and future perspectives
In the third year of PhD activity, an improved drying and rehydration process of eggplant and pear samples have
been analysis. A suitable pretreatment applied to fresh products. The analysis has been carried out both
experimentally and theoretically. From the experimental point of view, several parameters have been taken into
account to assess quality of the dried material: colour, texture and SEM analysis. Experimental analysis has
shown the positive effect of pre-treatment in reducing browning and structural changes. A diffusive
mathematical model of the dehydration and rehydration processes has also been developed. Models parameters
are calculated on the basis of a developed numerical algorithm based on nonlinear regression procedures.
Through the mathematical model it has been shown these pretreatments could be used with the purpose to reduce
the intensity of the thermal treatments and its impact on the quality of vegetables and fruits.
8. References
Adiletta G (2009) Vegetables drying: optimization and modelling. In Proc.s of the 14
th
Workshop on the Developments in the Italian PhD
Research on Food Science Technology and Biotechnology, Oristano, 16-18 September, pp. 275-277.
Albanese D, Cinquanta L, Di Matteo M (2007) Effects of an innovative dipping treatment on the cold storage of minimally processed
Annurca apples. Food Chemistry, 105:10541060.
Bird B R, Steward, WL and Lightfoot EN (1960) Transport Phenomena, Wiley, New York, NY.
Di Matteo M, Cinquanta L, Galiero G, Crescitelli S (2003) A mathematical model of mass transfer in spherical geometry: plum (Prunus
domestica) drying. Journal of Food Engineering, 58: 183192.
Guin RPF (2005) Drying kinetics of some varieties of pears produced in Portugal. Food Bioprod Process, 83 (C4): 273-276.
Kolawole O and Emmanuel S (2007) Air-drying and rehydration characteristics of date palm (Phoenix dactylifera L.) fruits. Journal of Food
Engineering, 79: 724730.
Lewicki P (2006) Design of hot air drying for better foods. Trends in Food Science & Technology, 17: 153163.
Rolle L, Ghiraedello D, Zeppa G, Gerbi G (2005) Applicazione della Texture Analysis alla valutazione della qualit delluva. Quad. Vitic.
Enol. Univ.Torino, 28: 75-84.
Wu L, Orikasa T, Ogawa Y (2007) Vacuum drying characteristics of eggplants. Journal of Food Engineering, 83: 422- 429.
T (C)
Dehydration
Untreated Treated
45 Deff (cm
2
/s) 1,296E-05 1,149E-05 -
1,443E-05
1,731E-05 1,568E-05-
1,9001E-05
K (cm/s) 5,771E-05 4,830E-05 -
6,716E-05
4,706E-05 4,262E-05-
5,149E-05
50 Deff (cm
2
/s) 1,160E-05 1,045E-05 -
1,274E-05
1,236E-05 1,122E-05-
1,345E-05
K(cm/s) 1,159E-04 7,867E-05 -
1,531E-04
9,084E-05 7,128E-05-
1,104E-04
55 Deff (cm
2
/s) 1,824E-05 4,629E-06-
3,180E-05
3,201E-05 2,641E-05-
3,762E-05
K (cm/s) 7,789E-05 0-1,666E-04 7,498E-05 6,444E-05-
8,552E-05
T (C)
Rehydration
Untreated Treated
45 Deff
(cm
2
/s)
6,207E-05 5,880E-05
6,533E-05
6,860E-05 6,533E-05
7,187E-05
50 Deff
(cm
2
/s)
5,880E-05 5,553E-05
6,207E-05
6,860E-05 6,860E-05
7,187E-05
55 Deff
(cm
2
/s)
5,880E-05 5,553E-05
6,207E-05
6,207E-05 6,207E-05
6,533E-05
5
6
a
t [h]
0 10 20 30 40 50 60
0,0
0,2
0,4
0,6
0,8
1,0
UTR_1 experimental data
M M
M Mt
0
t[h]
0 4 8 12 16 20 24 28 32 36 40 44 48 52 56 60
0,0
0,2
0,4
0,6
0,8
1,0
TR_1 experimental data
TR predicted values
M M
M Mt
0
t [min]
0 20 40 60 80 100 120 140 160 180
0,0
0,2
0,4
0,6
0,8
1,0
1,2
0
0
M M
M Mt
t [min]
0 20 40 60 80 100 120 140 160 180
0,0
0,2
0,4
0,6
0,8
1,0
1,2
TR predicted values
0
0
M M
M Mt
b c d
15
th
8
15
th
Biotechnology, University of Naples I Federico II, Portici, 15-17 September, 2010
Removal of unstable proteins from white wine by immobilized acid protease
Ilaria Benucci (ilaria.be@tiscali.it)
Dept. Food Science and Technology, University of Tuscia, via S.C. de Lellis, Viterbo, Italy
Tutor: Prof. Marco Esti
This PhD thesis dealt with the assessment and optimization of different immobilization procedures of pineapple
stem bromelain, in order to promote an innovative biotechnological application for protein stabilization of
unstable white wines.
Stabilizzazione proteica di vini bianchi mediante proteasi acide immobilizzate
Questa tesi di dottorato ha riguardato lo sviluppo e lottimizzazione di diverse procedure dimmobilizzazione
della bromelina estratta da gambo dananas, al fine di promuovere unapplicazione biotecnologica innovativa per
la stabilizzazione proteica dei vini bianchi instabili.
Key words: Enzyme immobilization; stem bromelain; unstable wine proteins; kinetic parameters, model and real
wines.
1. Introduction
In accordance with the PhD thesis project previously described, this oral communication reports the main results
of the following four activities directed to:
A1) screen different immobilization supports for bromelain;
A2) optimise the immobilization conditions to maximise both enzyme coupling yields and half-lifes;
A3) assess free and immobilized enzyme activity in model wine solution using target synthetic substrate;
A4) assess the activity of free and immobilized enzyme in unstable white wines to test the proteolytic action on the
synthetic substrate, as well as total and unstable wine proteins.
2. Wine proteins
Though present in rather small amounts (15-500 mg l
-1
), proteins are of primary importance for the colloidal
stability and clarity of white wines. Heat-unstable soluble proteins in grape juices and wines may become
insoluble and precipitate, causing the formation of undesirable haze or deposits in white wines after bottling and
during storage. The protein haze may be induced by changes in pH, storage temperature and polyphenols
content, being almost certainly due to slow denaturation of the heat-unstable wine proteins. The major wine
haze-forming proteins are thaumatin-like and chitinases, which are pathogenesis-related proteins (PRs) (Ferreira
et al., 2002). Different tests have been proposed to assess wine instability with regards to protein haze. These
tests lead to protein aggregation and precipitation. Nevertheless, they are empirical and do not necessarily reflect
changes and destabilisation phenomena liable to occur in real wine storage conditions. Among these tests, heat
stability trials, based on heat-induced precipitation, are the most common (Sauvage et al., 2010). A wide range
of temperatures and processing times for the heat test is reported in the literature. When the level of haze is
measured instrumentally, it is possible to set a limiting difference in wine turbidity before and after thermal test
of above 2 NTU (Nephelometric Turbidity Units) (Pocock and Waters, 2006).
The traditional method of stabilizing white wine against haze formation is based on bentonite fining. Though
effective, this treatment generates different problems because of the non-specific adsorption properties of
bentonite, such that it removes various molecules or aggregates as aroma and flavour compounds, inducing
significant aroma loss and, occasionally, colour alteration. Bentonite fining also causes substantial volume losses
(between 3% and 10%) (Ferreira et al., 2002). Alternative fining technologies useful to prevent haze problem in
fruit juices and beers, are based on addition of free proteolytic enzymes. Meyer et al (2001) studied the
efficiency of enzymatic clarification on turbidity and haze in cherry juice using different proteases, one of these
was bromelain from pineapple stem. This cysteine protease, active at the normal beer pH (about 4.5), is widely
used for haze prevention of this beverage (Ash and Ash, 2002). In light of these considerations, the applicability
of immobilized pineapple stem bromelain for white wine stabilization was investigated.
3. Enzyme immobilization
The immobilization of enzymes onto solid materials could be traced back to the 1950s. Immobilization is
achieved by fixing enzymes to or within solid supports, as a result of which heterogeneous immobilized enzyme
15
th
9
15
th
systems are obtained. By mimicking the natural mode of occurrence in living cells, where enzymes for the most
cases are attached to cellular membranes, the systems stabilize the structure of enzymes, hence their activities.
Thus, as compared to free enzymes in solution, immobilized enzymes are more robust and resistant to
environmental changes (Krajewska, 2004). The immobilization on solid supports by covalent attachment, being
effective and durable, is one of the most used for application in food biotechnology. A lot of materials, such as
porous glass, epoxy-activated supports and chitosan have been assayed in recent years for different enzymes
immobilization, included proteases (Ma et al., 2009). Porous glass beads have several advantages, namely the
variety of available controlled shapes, sizes and characteristics, stability against chemical substances and
physical resistance to mechanical effects. Immobilization on this material is always carried out using
glutaraldehyde as crosslinker. Among epoxy-activated supports, Eupergit
-250L has been identified as one of

the most useful carriers for covalent immobilization of different enzymes because of its ability to stabilize
protein conformation by multipoint attachment (Andrich et al., 2009). To the best of our knowledge, a wide
variety of proteases have been covalently immobilized on chitosan by cross-linking with glutaraldehyde
(Krajewska, 2004). In the present work covalent immobilization of bromelain from pineapple stem was carried
out using: pre-activated matrix (Prosep-9CHO) that does not require cross-linking, epoxy-activated supports
(Eupergit C 250 L) and chitosan beads, pre-activated or not with glutaraldehyde.
4. Experimental Procedure
In this PhD thesis a five-step experimental procedure was set up by performing in sequence the following
activities: i) a suitable synthetic substrate was chosen to test stem bromelain activity at the average minimum pH
value of wine (3.2); ii) a kinetic study of free protease was carried out in McIlvaine and in model wine buffer;
iii) different immobilization procedures were applied and the best biocatalyst was chosen measuring
immobilization percentage, kinetic parameters and half-life (in model wine buffer); iv) a kinetic study was
carried out in different wines, using synthetic substrate, in order to compare catalytic properties of free and
immobilized bromelain; v) free and immobilized bromelain activity was compared in unstable white wines to
test proteolytic action both on total proteins and on unstable ones.
5. Materials and Methods
Bromelain from pineapple stem (EC 3.4.22.32) was obtained from Sigma-Aldrich (Milan, Italy). Synthetic
peptide substrates were purchased from Bachem GmbH (Weil am Rhein, Germany). The supports employed for
protease immobilization were: aldehydic controlled pore glass beads (Prosep-9CHO from Millipore, Milan,
Italy), epoxy-activated acrylic beads (Eupergit
-250L from Degussa Rohm GmbH&Co., Darmstadt, Germany)

and chitosan beads (Chitopearl BCW-3010 from Wako Chemicals GmbH, Neuss, Germany). A Scanning
Electron Microscope (SEM, mod. Jeol-JSM-5200) was employed to observe the support surface. Physico-
chemical characteristics of these supports and SEM images are reported in Table 1. The immobilization
procedures, described in Table 2, were performed with 100 mg of supports and 1 ml of enzyme preparation (5
mg ml
-1
) in two different buffer solution, phosphate buffer (pH 7) and tartaric buffer (pH 3.2), incubating with
slow tilt rotation, at different time and temperature according with cited procedures. To determine the percentage
of immobilized protein, supports were washed with 2 M NaCl solution and the amount of residual soluble
enzyme was determined using BSA (Bovine Serum Albumin) as standard (Bradford, 1976).
Table 1 Physico-chemical characteristics of employed supports and SEM images.
Support Prosep-9CHO Eupergit
-250L Chitopearl BCW-3010

Material aldehydic glass oxirane-acrylic copolymer chitosan
Functional groups
Diameter ( m) 200 100-200 840-1190
SEM images

To test stem bromelain activity at the average minimum pH value of wine (3.2), protease activity was measured
in McIlvaine buffer at various pH, using different model peptide substrates, as previously decribed. Kinetic
parameters (V
max
, k
cat
, K
M
, K
a
) of stem bromelain were determined both in McIlvaine and in model wine buffers
(ethanol 12% v/v; pH 3.2), using the Michaelis-Menten equation and a nonlinear regression procedure
(GraphPad Prism 5.0, GraphPad software, Inc.).
5000 x 200 x 200 x 10000 x
35 x
7500 x
15
th
10
15
th
Table 2 Description of applied immobilization procedures.
Support Cross-linker Cysteine
addition
Oriented
Immobilization
pH References Label
Prosep-9CHO - - - 3.2 Millipore co PRO 3.2
- - - 7 PRO 7
Eupergit
-250L - - - 3.2 Boller et al.,

2002
EU 3.2
- - - 7 EU 7
Chitopearl
BCW-3010
X - - 3.2 Oliveira et
al., 2001
BCW 3.2-CL
X - - 7 BCW 7-CL
- - - 3.2 BCW 3.2
- - - 7 BCW 7
- X - 3.2 Hale et al.,
2005
BCW 3.2-cys
- X - 7 BCW 7- cys
- - X 3.2 Mahmood et
al., 2007
BCW 3.2-OI
- - X 7 BCW 7- OI
Kinetic study of free or immobilized bromelain was carried out both in model wine (tartaric buffer, pH 3.2,
ethanol 12% v/v) and in 6 different real wines using Bz-Phe-Val-Arg-pNA substrate. Cleavage of the substrate
results in release of free pNA, that was detected colorimetrically at 410 nm using a Perkin-Elmer Lambda 25
UV/VIS (Beaconsfield Buks, B). Free and immobilized bromelain activity was determined measuring the change
in absorbance for 3 and 30 min, respectively. Protease activity was calculated in I.U. of pNA produced (=8.48
mM
-1
cm
-1
) and specific activity (A.S.) was calculated as I.U. mg
-1
of protein (Hale et al., 2005).
Six artisan and unrefined white wines, with a wide range of heat turbidity index (18-93 NTU), were used.
Aliquots of these wines were filtered through a PES membrane filter with a pore size of 0.45 m. The total
protein content in wines was detected by Bradfords method, while the unstable protein one according to heat
test at 80 C for 30 min and than cooled for 45 min. The turbidity, measured by nephelometry (turbidimeter HD
25.2, Delta Hom), was expressed in NTU. The difference in turbidity before and after the thermal test was
assumed to be proportional to protein instability. The wines were considered stable if this difference did not
exceed 2 NTU (Vincenzi et al., 2005). Each measurement was the average of three replicates.
6. Results and discussion
6.1 Synthetic substrate selection and kinetic study in two different buffers
Stem bromelain preferentially cleaved 3 substrates of the 11 synthetic substrates previously tested (data not
reported), showing maximal activity toward Bz-Phe-Val-Arg-pNA at pH 3.2 (Fig. 1). Thus, this substrate was
subsequently used for kinetic study of free or immobilized enzyme.
Kinetic parameters obtained with two different buffers revealed a significantly higher affinity of bromelain
towards synthetic substrates in model wine (tartaric buffer), as can be seen from the K
M
and K
a
values reported
in Table 3.
6.2 Stem bromelain immobilization
As shown in Table 4, immobilized bromelain, with the exception of a few procedures, showed both excellent
catalytic properties and higher half-life respect to the free enzyme. As well known, the activity of immobilized
enzymes, especially in covalently bound system, is more resistant against heat and denaturing agents than that of
the soluble form. All kinds of immobilization procedures applied at pH 7 allowed to obtain the highest
immobilization yield (%I), observing the maximum value for Eupergit
-250L (81%). Nevertheless, all

biocatalysts immobilized at pH 3.2 showed the highest V
max
and k
cat
value, indicating a good product release
velocity.
Buffer,
pH 3.2
V
max
(I.U. mg
-1
)
K
M
( M)
k
cat
(min
-1
)
K
a
(min
-1
M
-1
)
McIlvaine 0.44 0.02 342.6 31.3 1154.04 0.02 3.37 +0.34/-0.28
Tartaric 0.46 0.02 249.7 27.1 1201.90 0.02 4.81 +0.58/-0.47
Table 3 Kinetic parameters of stem bromelain toward Bz-Phe-Val-Arg-
pNA substrate in two different buffer solutions at pH 3.2, each containing
ethanol 12% v/v: McIlvaine and tartaric buffer.
Figure 1 Bromelain activity (U/mg of protein) in
McIlvaine buffer vs pH toward 3 synthetic
substrates: () Bz-Phe-Val-Arg-pNA, () Suc-
Phe-Leu-Phe-pNA and () Z-Arg-Arg-pNA.
2 3 4 5 6 7 8 9 10 11 12
0.0
0.6
1.2
1.8
2.4
pH
S
p
e
c
i
f
i
c

a
c
t
i
v
i
t
y

(
I
.
U
.

m
g
-
1
)
15
th
11
15
th
Table 4 Immobilization yield (IY), kinetic parameters (mean SD) and half-life of free or immobilized bromelain
toward Bz-Phe-Val-Arg-pNA substrate in model wine buffer.
IY
(%)
V
max
(I.U. mg
-1
)
K
M
( M)
k
cat
(min
-1
)
K
a
(min
-1
M
-1
)
Half-life
(h)
Free bromelain - 0.46 0.02 249.7 27.1 1201.90 0.02 4.81 +0.58/-0.47 40
PRO 3.2 19 1 1.18 0.06 103.7 10.3 1019.26 0.06 9.83 +1.08/-0.89 25
PRO 7 57 2 0.074 0.004 75.5 9.4 3.610 0.004 0.048 +0.007/-0.005 24
EU 3.2 36 4 1.49 0.08 153.4 15.1 824.94 0.08 5.38 +0.59/-0.48 37
EU 7 81 2 0.72 0.04 110.7 13.9 162.37 0.04 1.47 +0.21/-0.16 64
BCW 3.2-CL 41 2 0.60 0.09 305.2 66.1 214.49 0.09 0.70 +0.19/-0.12 50
BCW 7-CL 68 2 0.18 0.01 77.1 16.3 36.41 0.01 0.47 +0.12/-0.08 39
BCW 3.2 26 2 2.43 0.09 49.5 5.5 1735.89 0.09 35.08 +4.34/-3.48 50
BCW 7 70 1 0.66 0.04 48.4 9.1 166.34 0.04 3.44 +0.79/-0.54 66
BCW 3.2 - cys 41 3 2.98 0.21 136.1 18.1 1275.61 0.21 9.37 +1.43/-1.1 74
BCW 7- cys 66 5 1.09 0.08 91.8 15.1 331.42 0.08 3.61 +0.71/-0.51 176
BCW 3.2-OI 46 3 0.210 0.009 108.3 19.4 292.332 0.009 2.70 +0.58/-0.41 137
BCW 7- OI 57 2 0.029 0.009 1093 616 1.414 0.009 0.0013 +0.0017/-0.0005 664
Immobilization on chitosan beads in presence of cysteine improved both bromelain half-life and kinetic
parameters. These evidences could be due to the presence of free cysteine in immobilization medium that
maintains the Cys at the active site in the reduced form. Oriented immobilization allowed to obtain a
significantly higher half-life, but no positive effect was revealed in terms of kinetic properties. This results could
be explained considering that the number of covalent/noncovalent linkages between bromelain oligosaccharide
chain and support influences the stability of enzymes against to various forms of inactivation with stability
increasing with the number of linkages. Stem bromelain was successfully immobilized on chitosan beads without
glutaraldehyde. This procedure applied at pH 3.2 allowed to obtain the best catalytic properties. Immobilized
bromelain showed both higher k
cat
value, indicating a good product release velocity, and a lower K
M
value,
indicating a higher affinity for substrate than that of free bromelain. This may be due to the mild immobilization
process, which slightly affected the structural or conformational integrity of the enzyme (Tan et al., 2008). For
that reason, this biocatalyst (BCW 3.2) was used for all other experiments.
6.3 Kinetic study of free and immobilized bromelain in real wines
In all wines tested, immobilized bromelain (BCW 3.2) exhibited V
max
values about 10 times greater than the free
form. Higher k
cat
and K
a
values indicated both a better product release velocity and a greater specificity of the
immobilized protease toward the substrate. Nevertheless, higher K
M
values, reflecting the enzyme-substrate
complex formation, suggested a lower affinity of immobilized bromelain for synthetic substrate in wines. From
Table 5 it can be noted that the catalytic efficiency of immobilized bromelain with respect to the synthetic
substrate varied depending on the real wines tested, probably because of their different content in inhibitors
compounds.
Table 5 Kinetic parameters (mean SD) of free or immobilized bromelain in unrefined white wines toward Bz-Phe-
Val-Arg-pNA substrate.
Wine V
max
(I.U. mg
-1
) K
M
( M) k
cat
(min
-1
) K
a
(min
-1
M
-1
)
1
Free 0.115 0.003 39.8 3.7 304.111 0.003 7.65 +0.78/-0.65
Imm 1.37 0.06 74.1 7.4 680.35 0.06 9.18 +1.01/-0.83
2
Free 0.136 0.004 61.4 6.5 360.967 0.004 5.88 +0.69/-0.56
Imm 1.57 0.06 79.6 5.9 749.21 0.06 9.41 +0.76/-0.65
3
Free 0.145 0.006 107.0 11.2 382.122 0.006 3.57 +0.42/-0.34
Imm 4.48 0.22 137.4 12.8 3374.48 0.22 24.56 +2.52/-2.09
4
Free 0.116 0.004 73.1 7.1 306.227 0.004 4.19 +0.45/-0.37
Imm 3.86 0.15 100.6 8.7 3138.64 0.15 31.20 +2.95/-2.48
5
Free 0.081 0.001 24.24 2.03 214.015 0.001 8.83 +0.81/-0.69
Imm 1.46 0.04 63.41 4.32 670.53 0.04 10.57 +0.77/-0.67
6
Free 0.214 0.009 151.9 13.2 566.440 0.009 3.73 +0.36/-0.30
Imm 2.42 0.11 113.5 9.5 1129.13 0.11 9.95 +0.91/-0.77
6.4 Immobilized bromelain activity toward total and unstable wine proteins
As shown in Fig. 2, after 24-h treatment, the total protein removal yield (TPRY) varied from 59 to 93%
depending on the initial protein content. On the contrary, the turbidity removal yield (TRY) was practically
constant (66 7 %) for all the 6 wines tested independently of the initial NTU index (Fig. 3). This confirmed
that immobilized bromelain exerted its useful proteolytic activity on unstable wine proteins in almost the same
way whatever their nature and content.
15
th
12
15
th
Stem bromelain was successfully immobilized on chitosan beads without glutaraldehyde cross-linking, thus
improving the food safety of the biocatalyst of concern. By referring to the synthetic substrate used in the model
wine solution, the catalytic parameters (V
max
, K
M
) of immobilized enzyme resulted to be by far greater than those
of free enzyme and this was confirmed in a few real white wines spiked with the same substrate. In terms of
turbidity haze, a 24-h treatment using this immobilized enzyme reduced about 66% the initial NTU index
ranging from 20 to 90 NTU in the white wines tested. Further perspectives will be to maximise the rate of
turbidity haze removal with respect to biocatalyst loading per unit volume of wine to be treated, as well as to
optimise the architecture of the bioreactor system to be industrially applied.
8. Nomenclature
, molar absorptivity (mM
-1
cm
-1
); A.S., specific activity (I.U. mg
-1
of protein); IY, immobilization yield (%); V
max
,
maximum velocity at which enzyme catalyze reaction (I.U. mg
-1
); K
M
, Michaelis-Menten constant, reflects enzyme-substrate
complex formation (M); k
cat
, turnover number (V
max
/[E]
tot
), measures the number of substrate molecules turned over per
enzyme per minute (min
-1
); K
a
(k
cat
/K
M
), affinity constant, indicates affinity of enzyme toward substrate (min
-1
M
-1
).
9. References
Andrich L, Esti M, Moresi M (2005) Urea degradation in model wine solutions by free or immobilized acid urease in a free
or immobilized acid urease in a stirred bioreactor. Food Chem. 92: 227-233.
Ash M, Ash I (2002) Handbook of Food Additives. 2nd ed. New York: Synapse Information Resources Inc. Endicott.
Boller T, Meier C, Menzler S (2002) EUPERGIT Oxirane Acrylic Beads: How to Make Enzymes Fit for Biocatalysis. Org.
Process Res. Dev. 6: 509-519.
Bradford MM (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the
principle of protein-dye binging. Anal. Biochem. 72: 248-254.
Ferreira RB, Piarra-Pereira MA, Monteiro S, Loureiro VB, Teixeira AR (2002) The wine proteins. Trends Food Sci. Technol.
12: 230-239.
Hale LP, Greer PK, Trinh CT, James CL (2005) Proteinase activity and stability of natural bromelain preparations. Int.
Immunopharmacol. 5: 783-793.
Krajewska B (2004) Application of chitin- and chitosan-based materials for enzyme immobilizations: a review. Enzyme and
Microb. Technol. 35: 126-139.
Ma J, Zhang L, Liang Z, Zhang W, Zhang Y (2009) Recent advances in immobilized enzymatic reactors and their applications
in proteome analysis. Anal. Chim. Acta 632: 1-8.
Mahmood R, Saleemuddin M (2007) Additional Stabilization of Stem Bromelain Coupled to a Thermosensitive Polymer by
Uniform Orientation and Using Polyclonal Antibodies. Biochem. 72 (3): 307-312.
Meyer AS, Koser C, Adler-Nissen J (2001) Efficiency of enzymatic and other alternative clarification and fining treatments on
turbidity and haze in cherry juice. J. Agric. Food Chem. 49: 3644-3650.
Oliveira MIP, Pimentel MC, Montenegro MC, Arajo AN, Pimentel MF, Da Silva VL (2001) l-Glutamate determination in
food samples by flow-injection analysis. Anal. Chim. Acta 448: 207-213.
Pocock KF, Waters EJ (2006) Protein haze in bottled white wines:vHow well do stability tests and bentonite fining trials predict
haze formation during storage and transport? Aust. J. Grape Wine Res. 12: 212-220.
Sauvage FX, Bach B, Moutounet M, Vernhet A (2010) Proteins in white wines: Thermo-sensitivity and differential adsorbtion
by bentonite. Food Chem. 118: 26-34.
Tan Y, Liu C, Yu L, Cen X (2008) Effect of linoleic-acid modified carboxymethyl chitosan on bromelain immobilization onto
self-assembled nanoparticles. Front. Mater. Sci. China 2(2): 209-213.
Vincenzi S, Polesani M, Curioni A (2005) Removal of specific protein components by chitin enhances protein stability in a
white wine. Am J. Enol. Vitic. 56 (3): 246-254.
Figure 2 Total protein removal yield (TPRY, %) in 24 h by
immobilized bromelain in white wines with different initial
protein content, expressed as mg l
-1
BSA equivalent.
y = -0,0909x+ 107,98
R
2
= 0,9662
0
20
40
60
80
100
100 200 300 400 500 600
Initial Total Protein Concentration (mg l
-1
)
T
P
R
Y

(
%
)
6 3
2
4
5
1
Figure 3 Turbidity removal yield (TRY, %) in 24 h
by immobilized bromelain, in white wines with
different initial turbidity index, expressed as NTU.
0
20
40
60
80
100
0 20 40 60 80 100
NTU Index
0
T
R
Y

(
%
)
1
6
2
4
3
5
15
th
13
15
th
Biotechnology, University of Napoli I Federico II, Portici, 15-17 September, 2010
Protective role of dietary bioactive compounds: mechanisms and
hypothesis
Gaia Bonacina (gaia.bonacina@unimi.it)
Dept. Food Science and Microbiology, University of Milan, Italy
Tutor: Prof. Marisa Porrini; Co-tutor: Dr. Patrizia Riso

The effect of dietary bioactive compounds was investigated with in vivo and in vitro studies. During the first part
of this PhD research project the role of glucosinolate-rich sources (steamed broccoli) through in vivo dietary
intervention studies was investigated on healthy volunteers on markers of antioxidant status and oxidative stress.
The second part of PhD focused on the study of mechanisms of action at cellular level induced by anthocyanins.
Angiogenic and pro-coagulant properties of human microvascular endothelial cells were tested through in vitro
models after supplementation with delphinidin-3-glucoside and cyanidin-3-glucoside, anthocyanins which are
found in wild blueberry.
Ruolo protettivo di composti bioattivi della dieta: meccanismi ed ipotesi
Leffetto di composti bioattivi della dieta stato indagato con studi in vivo ed in vitro. Nella prima parte di
questo progetto di ricerca stato studiato il ruolo di alimenti contenenti glucosinolati (broccoli) con studi di
intervento dietetico su volontari sani su markers di stato antiossidante e stress ossidativo. La seconda parte del
dottorato si focalizzata sullo studio dei meccanismi dazione delle antocianine a livello cellulare. Le propriet
angiogeniche e pro-coagulanti delle cellule endoteliali umane del microcircolo sono state studiate in seguito a
supplementazione con delfinidina-3-glucoside e cianidina-3-glucoside, antocianine tipiche del mirtillo selvatico.

Key words: oxidative stress, DNA damage, broccoli, GSTM1, anthocyanins, angiogenesis, migration,
endothelium.
1. Introduction and aim
The evidence of the protective role of diets rich in fruit and vegetables is convincing and associated with healthy
lifestyle and low incidence of cancer (Word Cancer Research Fund 2007). Fruits and vegetables compounds,
able to reduce the risk of chronic diseases, include vitamins, minerals and numerous phytochemicals. The last
ones are non-nutrient secondary metabolites that have been shown to exert a wide range of biological activities.
These metabolites have low potency as bioactive compounds when compared to pharmaceutical drugs, but since
they are ingested regularly and in significant amounts as part of the diet, they may have a noticeable long-term
beneficial effect. Their bioactivity has been in part associated to their antioxidant properties (capacity to
scavenge free-radicals) which are involved in the onset development of many of the chronic degenerative
diseases (LDL oxidation in atheroma plaque development, DNA oxidation and cancer, oxidation and ageing,
inflammation, etc.) (Espin et al., 2007). Bioactive compounds that are present in the diet and have been
associated to health benefits include: glucosinolates contained in Cruciferae, sulphurcontaining compounds of
the Alliaceae, terpenoids (carotenoids, monoterpenes, and phytosterols), and various groups of polyphenols, such
as anthocyanins (ACNs), flavones, flavan-3-ols, isoflavones, stilbenoids, ellagic acid, etc. During my Phd I had
the opportunity to focuse on two types on bioactive compounds: glucosinolates contained in broccoli and ACNs
present in wild blueberry. Cruciferae and expecially Brassica gender contain high concentration of constituents
with antioxidant properties (e.g. carotenoids, vitamin C, folates) as well as glucosinolate precursors of
isothiocyanates (ITCs) and indoles that modulate xenobiotic biotransformation enzymes, such as Glutathione S-
Transferase (GST) (The International Agency for Research on Cancer 2004). Wild blueberry is composed of
different anthocyanidins such as delphinidin, malvidin, petunidin, cyanidin and peonidin. Anthocyanidins and
their glycosides (anthocyanins) are suggested to possess anti-inflammatory and anticarcinogenic properties
(Bagchi et al., 2004). During the first years of my PhD broccoli (Brassica oleracea L. var. italica) were tested
with two dietary intervention studies at DiSTAM-Division of Human Nutrition, University of Milan: single-dose
study with one serving of food and regular intake study with daily consumption of one serving of steamed
broccoli for 10 days. Subjects involved in the study were recruited on the basis of anthropometric
characteristics, food habits and their genetic characterization for polymorphisms of GSTM1 genotype. The
influence of genetic polymorphisms of GSTM1 on individual response to broccoli intake was also investigated.
The in vitro experiments were performed at Division of Immunohematology and Transfusion Medicine &
Hemostasis and Thrombosis Center, Dept. Oncology-Hematology, Ospedali Riuniti, Bergamo to compare the
effects of selected fruit bioactive compounds, i.e. delphinidin-3-glucoside (Dp-3-glc) and cyaniding-3-glucoside
(Cy-3-glc) contained in wild blueberry (Vaccinium angustifolium), on different cell functions involved in both
inflammation and hemostasis. The study of properties of Dp-3-glc and Cy-3-glc was designed on human
15
th
14
15
th
microvascular endothelial cells (HMEC-1) considered models of angiogenesis, migration and procoagulant
activity.
2.Materials and methods
2.1 Glucosinolate-rich sources protection against oxidative stress in humans
Young male smokers (>10 cigarettes/day) were enrolled on the basis of their food habits (food frequency
questionnaire) and GSTM1 polymorphisms within the students of the University of Milan. GSTM1 gene
presence or absence in genomic DNA samples extracted by DNeasy Blood and Tissue kit (QIAGEN) were
determined with a PCR method (Riso et al., 2009b). Twelve volunteers were selected for the single-dose study.
One serving of 250 g of steamed broccoli with 70 g of pasta was consumed as first meal. Fasting blood samples
were collected before broccoli consumption and at 3, 6, 8 and 24h after broccoli intake. Thirty subjects were
enrolled for the regular intake study. A cross-over design was scheduled: 15 volunteers followed the sequence
broccoli diet/wash-out/control diet; while the others followed the opposite sequence. Broccoli and control diet
were 10 days long and they were spaced out from 20 days of free diet. One serving consisted of 250 g of
steamed broccoli. All volunteers signed an informed written consent. Fasting blood samples were collected at
the beginning and at the end of each treatment period (0, 10, 30, 40 days). Plasma and lymphocytes were
separated and stored for specific analyses. Lymphocytes were separated by density gradient centrifugation of
whole blood with Histopaque 1077 (Sigma Chemicals Co, St Louis, MO, USA). The lymphocyte layer was
removed from the gradient, washed with PBS and used immediately for the determination of cell resistance to
oxidative stress (H
2
O
2
-induced strands breaks) through the COMET assay. Additional lymphocytes were
isolated and appropriately stored at -80C for the subsequent determination of biomarkers of oxidative stress and
GST activity quantification. Endogenous DNA damage as oxidized purines was measured by means of
formamidopyrimidine glycosylase (FPG) digestion (Riso et al., 2009a); in vitro DNA repair activity was
assessed in cryo-preserved lymphocytes by the Comet assay as described by Guarnieri et al, 2008; while
quantification of mRNA expression of hOGG1, hNUDT1 and hHO-1 levels was determined through RT-PCR
(Brauner et al., 2007). Briefly, cDNA was synthetised using the TaqMan GeneAmp RT-PCR kit as
recommended by Applied Biosystems (Naerum, Denmark); then quantitative PCR reaction were carried out in
ABI PRISM 7900HT (Applied Biosystems) using primers and c-DNA specific probes purchased from Applied
Biosystems. We used 18S rRNA as reference gene. Total GST activity in plasma and lymphocytes was
calculated by measuring the conjugation of 1-chloro-2,4-dinitrobenzene (CDNB) with reduced glutathione, and
normalized by the amount of proteins found in each sample (Riso et al., 2009b).

2.2 Role of anthocyanins on endothelial cells
2.2.1 Angiogenesis and migration assays
We designed an in vitro study to investigate on the effect of Dp-3-glc and Cy-3-glc on angiogenic and migratory
activities of HMEC-1. Standard of Dp-3-glc and Cy-3-glc were purchased from Polyphenols Laboratory
(Sadnes, Norway). They were stored dried at -20C until the execution of each experiment. Appropriate dilutions
of Dp-3-glc and Cy-3-glc were freshly prepared just prior to every assay in RPMI 1640 medium (Gibco,
Gaithersburg, MD, U.S.A.). HMEC-1 were incubated for up to 24h with culture media Dp-3-glc or Cy-3-glc
(0.1-100 !M) alone or in combination with purified proangiogenic factor VEGF. After incubation, angiogenesis
was evaluated by the capillary-like tube formation in Matrigel assay, where data are expressed as tube
length/area (mm/cm
2
), and cell migration by the wound healing assay, where Regrowth area was normalized
with the percentage of migration of control cells (CTR).
2.2.2 Procoagulant activity (PCA) assay
HMEC-1 were incubated for up to 24h with culture media Dp-3-glc or Cy-3-glc (1-100 !M) alone or in
combination with bacterial endotoxin (LPS, 10 !g/ml), which was used as prothrombotic stimulus. Thrombin
generation was determined in platelet-poor plasma (PPP) by calibrated automated thrombography (CAT,
Thrombinoscope) (Hemker et al., 2006) on monolayer of HMEC-1. Thrombin generation curves were described
in terms of lag time (expressed in min), time to Peak (ttPeak, expressed in min), and area under the curve
(endogenous thrombin potential, ETP, expressed as nM thrombin*min).
Tissue Factor (TF)-PCA was evaluated in HMEC-1 lysates, obtained after three cycles of freezing/thawing, by
the one-stage recalcification assay of PPP. TF-PCA was referred to a calibration curve constructed with different
dilutions of a standard rabbit brain thromboplastin (RBT; Sigma). Results are expressed as standard
thromboplastin arbitrary units (URBT), 1 unit the activity of 1 mEquiv/ ml of RBT in the coagulation assay.
TF antigen of HMEC-1 lysates was quantified by IMUBIND Tissue factor ELISA (American diagnostica inc.,
Stamford).
3.1 GST modulation and DNA protection by single portion of broccoli
All the 12 selected volunteers (age 20.81.6 y; BMI 22.52.1 kg/m
2
) completed the study. Six were GSTM1
positive and 6 were GSTM1 null. Table 1 shows the results of the single-dose study.
15
th
15
15
th

Table 1 Results of single-dose study (MeanSD). Data with different letters are significantly different (p<0.05) on the
same row.
Time 0 3 h 6 h 24 h
GST activity (n=9)
Plasma (pmol/min/mg*pr)
All subjects 65.719.3 58.124.5 74.530.0 58.913.3
GSTM1 positive 76.217.3
a
68.629.4
ab
87.535.2
b
64.515.3
a
GSTM1 null 52.613.4 45.05.9 58.110.8 51.96.3
Lymphocytes(nmol/min/mg*pr)
All subjects 39.711.4 36.621.3 35.127.3 35.812.9
GSTM1 positive 45.910.8 49.220.9 50.424.6 41.513.7
GSTM1 null 31.86.9 21.06.8 16.117.8 28.78.2
H
2
O
2
-induced strand breaks (% DNA in tail)
All subjects (n=9) 53.39.3 54.77.8 58.112.5 43.416.4
a
GSTM1 positive (n=4) 54.610.3 56.05.6 66.07.3 33.213.1
a
GSTM1 null (n=5) 55.29.5 53.69.8 51.812.7 51.515.0

GST activity in plasma and lymphocytes were analyzed in 9 subjects because data of 3 subjects were outliers
possibly due to analytical problems. In general, individuals with positive GSTM1 genotype showed a greater
plasma and lymphocyte GST activity compared to individuals with GSTM1 null genotype. However lymphocyte
GST activity resulted significantly different (p<0.05) between individuals with GSTM1 positive and GSTM1
null genotype. After broccoli consumption, plasma GST activity significantly increased (p<0.05) in individuals
with GSTM1 positive genotype at 6 h with respect to 3 h and 24 h but not with respect to baseline. No
significant difference was observed in lymphocytes GST activity. A significant reduction of ex-vivo induced
DNA damage (p<0.05) after 24 h from broccoli consumption intake with respect to time 0, 3 and 6 h was
observed. Broccoli under controlled dietary conditions modulate GST activity even if it seems to be more
evident in individuals with GSTM1 positive genotype, who showed also a greater protection against DNA
damage.

3.2 Decrease in DNA damage by regular consumption of broccoli
Twenty-seven male smokers of the 30 enrolled completed the regular-intake study (age 22.12.5 y; BMI
23.02.7 kg/m
2
). Fourteen were GSTM1 positive and 13 were GSTM1 null. In table 2 the most significant
results are shown. Cell protection against H
2
O
2
-induced DNA damage was higher after broccoli diet with respect
to control diet in the whole group of subjects. By analyzing data considering genotype as independent factor,
broccoli intake caused a more consistent and significant effect of protection against DNA damage in GSTM1
null (-27.6%) with respect to GSTM1 positive (-13.1%) subjects (p<0.05). Endogenous oxidatively damaged
purine bases (FPG-sensitive sites) decreased significantly (p<0.05) after broccoli intake (-22.6%) while no effect
of polymorphism was observed. DNA repair activity was analyzed on lymphocyte samples of 11 subjects (with 7
GSTM1 positive and 4 GSTM1 null genotypes): it did not differ throughout the intervention study. hOGG1,
hHO-1 and hNUDT1 mRNA expression evaluated on 17 samples (with 8 GSTM1 positive and 9 GSTM1 null
genotypes) were not significantly modulated.
Table 2 Results of regular intake study (MeanSD); Bbd: before broccoli diet, Abd: after broccoli diet, Bcd: before
controlled diet, Acd: after controlled diet; a: p<0.05; b: p<0.01; c: p<0.001
Bbd Abd Bcd Acd
H
2
O
2
-induced strand breaks (% DNA in tail)
All subjects (n=27) 61.411.1 47.911.4
c
55.413.3 55.29.6
GSTM1 positive (n=14) 57.611.8 48.812.1
a
52.412.7 54.09.4
GSTM1null (n=13) 65.49.1 46.911.1
c
58.713.7 56.510.1
Oxidized purines (%DNA in tail)
All subjects (n=19) 16.57.7 11.05.4
c
13.29.8 13.87.5
GSTM1 positive (n=9) 17.37.2 11.15.2
b
17.112.0 16.19.4
GSTM1 null (n=10) 15.98.4 10.95.9
a
9.86.0 11.64.8

3.4 Effect of anthocyanins on endothelial cells
3.4.1Effect of anthocyanins on angiogenesis and migration of HMEC-1
The results in Figure 1a show that Dp-3-glc inhibited capillary-like tube formation of HMEC-1 in unstimulated
conditions. While the treatment with proangiogenic factor VEGF induced a significant increase in tube lenght;
Dp-3-glc was able to decrease such stimulus reaching significant reduction at 100 !M (p<0.05) compared to
VEGF treated cells (Figure 1b).
15
th
16
15
th

Figure 1 Effect of Dp-3-glc on capillary-like tube formation. Dp-3-glc showed a significant inhibitory effect in tube
lenght at the maximum concentration when used alone (a) and in combination with VEGF (b). Data are
expressed as the mean of three indipendent experiments SD. * p<0.05 vs CTR; p<0.05 vs VEGF.
Similar results were obtained in the wound healing assay. Dp-3-glc decreased in dose dependent manner the
migration of HMEC-1 in unstimulated conditions (Figure 2a) with a maximum effect at 100 !M concentration
(p<0.05). The stimulus of VEGF induced a significant increase in HMEC-1 migration area that was counteracted
by Dp-3-glc starting at 1 !M concentration (p<0.05) in dose-dependent manner (Figure 2b).

Figure 2 Effect of Dp-3-glc on HMEC-1 migration. Dp-3-glc showed a significant inhibitory effect on Regrowth area
starting at 25!M concentration when used alone (a) while couteracted the stimulus of VEGF from 1 !M (b).
Data are expressed as the mean of three indipendent experiments SD. * p<0.05 vs CTR; p<0.05 vs VEGF
Cy-3-glc did not show any significant inhibitory effect both in capillary-like tube formation and in the wound
healing assay when used alone or in combination with VEGF, so it has not been tested in next experiments.

3.4.2 Anti-thrombotic effect of Dp-3-glc on TG potential of HMEC-1
Treatment with Dp-3-glc alone (from 4h to 24h) did not modify thrombin generation of HMEC-1 monolayer.
The effect of LPS as prothombotic stimulus induced a significant reduction in lagtime and ttPeak and an increase
ETP (p<0.05) compared to control cells. Dp-3-glc significantly counteracted the prothrombotic stimulus of LPS
starting from 10 !M, increasing lagtime and ttPeak and reducing ETP to the levels of control cells.

3.4.3 Anti-thrombotic effect of Dp-3-glc on TF-PCA and on TF antigen expression of HMEC-1
Preliminary data on the TF-PCA assay and the TF antigen quantification in PBS-lysates of HMEC-1, stimulated
with LPS and treated with Dp-3-glc, showed that LPS stimulus alone induced an increase in TF antigen and
URBT; while Dp-3-glc + LPS produced a reduction in both the variables analyzed (table 3). In particular, the
maximum concentration of Dp-3-glc tested induced 25 % inhibition in TF antigen expression.
Table 3 Effect of Dp-3-glc on TF-PCA and antigen expression by HMEC-1 stimulated with LPS (MeanSD); * p<0.05 vs
CTR, p<0.05 vs LPS
TF (pg/10
6
cells) URBT
CTR 26030 0.130.01
LPS 1315142
*
41.8823.89
*

LPS + Dp-3-glc 1 !M 1159124
6.032.33

LPS + Dp-3-glc 10 !M 1141132
6.173.31

LPS + Dp-3-glc 100 !M 105397
9.872.19

In this PhD project the effect of two types of dietary bioactive compounds were investigated at different levels.
In the first part of this work the role of broccoli as glucosinolates and antioxidants sources was analyzed on
*

*
*
*

*
*
a
b
a
b
VEGF + Dp-3-glc (!M)
Dp-3-glc (!M)
Dp-3-glc (!M)
VEGF + Dp-3-glc (!M)
15
th
17
15
th
humans. We found that 10 days of consumption of steamed broccoli can improve defence against DNA damage
but did not affect repair activity in young healthy smokers (Riso et al., 2009a, Riso et al., 2009b). Our data are in
accordance with shown protective effects of crouciferous vegetables, including Brussel sprouts, broccoli and
watercress, on biomarkers of oxidative damage to DNA in human intervention studies (Dusinska et al., 2001;
Murashima et al., 2004; Gasper et al., 2007; Jeffery and Keck, 2008; Hofmann et al., 2009). Also a single
portion of steamed broccoli was able to decrease DNA damage and to modulate GST activity. Even if
preliminary, our data suggest a diet/genetic interaction. In particular we supported the hypothesis that GSTM1
null genotype subjects might have particular benefit from brassica vegetable intake.
The data of in vitro studies showed that Dp-3-glc can affect angiogenic, migratory and procoagulant properties
of endothelial cells, while Cy-3-glc did not exert all these protective activities, in accordance with previous
studies (Zhang et al., 2005; Fernandes et al., 2010). These findings, together with the known capacity of Dp-3-
glc to affect tumor cell proliferation, make this compound a potential cancer chemopreventive agent. Our results
support health promotion strategies that favour fruit and vegetables consumption for prevention and protection
against chronic diseases.
5. References
Bagchi D, Sen CK, Bacghi M, Atalay M (2004) Anti-angiogenic, antioxidant, anti-carcinogenic properties of a
novel anthocyanin-rich berry extract formula. Biochemistry (Moscow) 69: 75-80.
Brauner EV, Forchhammer L, Moller P, Simonsen J, Glasius M, Wahlin P, Raaschou-Nielsen O, Loft S (2007)
Exposure to ultrafine particles from ambient air and oxidative stress-induced DNA damage. Environ Health
Perspect 115: 1177-1182.
Dusinska M, Ficek A, Horska A, Raslova K, Petrovska H, Vallova B, Drlickova M, Wood SG, Stupakova A,
Gasparovic J, Bobek P, Nagyova A, Kovacikova Z, Blazicek P, Liegebel U, Collins AR (2001) Glutathione S-
transferase polymorphisms influence the level of oxidative DNA damage and antioxidant protection in humans.
Mutat Res 482: 47-55.
Espin JC, Garcia-Conesa MT, Tomas-Barberan FA (2007) Nutraceuticals: facts and fiction. Phytochemistry 68:
2986-3008.
Fernandes I, Faria A, Azevedo J, Soares S, Calhau C, De Freitas V, Mateus N (2010) Influence of anthocyanins,
derivative pigments and other catechol and pyrogallol-type phenolics on breast cancer cell proliferation. J Agric
Food Chem 58: 3785-3792.
Gasper AV, Traka M, Bacon JR, Smith JA, Taylor MA, Hawkey CJ, Barrett DA, Mithen RF (2007) Consuming
broccoli does not induce genes associated with xenobiotic metabolism and cell cycle control in human gastric
mucosa. J Nutr 137: 1718-1724.
Guarnieri S, Loft S, Riso P, Porrini M, Risom L, Poulsen HE, Dragsted LO, Mller P (2008) DNA repair
phenotype and dietary antioxidant supplementation. Br J Nutr. 99(5):1018-1024.
Hemker HC, Al Dieri R, De Smedt E, Beguin S, (2006) Thrombin generation, a function test of the haemostatic-
thrombotic system. Thromb Haemost 96: 553-561.
Hofmann T, Kuhnert A, Schubert A, Gill C, Rowland IR, Pool-Zobel BL, Glei M (2009) Modulation of
detoxification enzymes by watercress: in vitro and in vivo investigations in human peripheral blood cells. Eur J
Nutr 48: 483-491.
Jeffery E, Keck A (2008) Translating knowledge generated by epidemiological and in vitro studies into dietary
cancer prevention. Mol. Nutr. Food Res. 52:s7-s17.
Murashima M, Watanabe S, Zhuo XG, Uehara M, Kurashige A (2004) Phase 1 study of multiple biomarkers for
metabolism and oxidative stress after one-week intake of broccoli sprouts. Biofactors 22: 271-275.
Riso P, Martini D, Visioli F, Martinetti A, Porrini M (2009a) Effect of broccoli intake on markers related to
oxidative stress and cancer risk in healthy smokers and nonsmokers Nutr Cancer 61(2):232-237.
Riso P, Brusamolino A, Moro M, Porrini M (2009b) Absorption of bioactive compounds from steamed broccoli
and their effect on plasma glutathione S-transferase activity Int J Food Sci Nutr 60:57-71
Riso P, Porrini M (1997) Determination of carotenoids in vegetable foods and plasma. Int J Vitamin Nutr Res
67:4754.
The International Agency for Research on Cancer (2004) Cruciferous vegetables, isothiocyanates and indoles.
Vol. 9 IARC press, Lyon, France.
World Cancer Research Fund / American Institute for Cancer Researc (2007) Food, Nutrition, Physical Activity,
and the Prevention of Cancer: a Global Perspective. Washington DC: AICR.
Zhang Y, Vareed SK, Nair MG (2005) Human tumor cell growth inhibition by nontoxic anthocyanidins, the
pigments in fruits and vegetables. Life Sci 761465-1472.
15
th
18
15
th

Evolution of Lactobacillus rhamnosus in Parmigiano Reggiano: isolation
and characterization of different strains during ripening
Claudio Giorgio Bove (claudiogiorgio.bove@nemo.unipr.it)
Dept. Genetic, Biology of Microorganism, Anthropology, Evolution, University of Parma, Italy
Tutor: Prof.ssa Monica Gatti

This PhD thesis deals with the study of different biotypes of Lactobacillus rhamnosus, isolated during ripening
of Parmigiano Reggiano (PR), by genotypic and proteomic characterization techniques. The aim of this work is
to investigate the adaptation modality of this microbial species during ripening of Parmigiano Reggiano cheese
and hypothesize their effect in the definition of organoleptic characteristics.
Evoluzione di Lactobacillus rhamnosus in Parmigiano Reggiano: isolamento e
caratterizzazione di differenti biotipi durante il periodo di stagionatura
Questa tesi di dottorato ha riguardato lo studio di differenti biotipi di Lactobacillus rhamnosus, isolati durante la
stagionatura del Parmigiano Reggiano, tramite tecniche di caratterizzazione genotipica (RAPD-PCR e REP-
PCR) e proteomica (2DE e spettrometria di massa) per comprendere le modalit di adattamento di questa specie
microbica alle condizioni di stagionatura del formaggio e poterne ipotizzare gli effetti nella definizione dei
caratteri di pregio

Key words: Lactobacillus rhamnosus; RAPD-PCR; REP-PCR; proteomics; 2DE; mass spectrometry.
2. Introduction
Parmigiano Reggiano (PR) is a hard-textured, cooked and long ripened cheese and belongs to those important
niche products of Italian food tradition that have been recognized with the attribution of Protected Designation
of Origin. This denomination is linked to a strictly artisanal manufacturing in specific areas of Northern Italy
(http://www.parmigiano-reggiano.it). The traditional PR cheese-making involves the use of unheated, partially
skimmed raw cow milk supplemented with natural whey starter (Mucchetti and Neviani, 2006). The mesophilic
lactic microflora, non starter lactic acid bacteria (NSLAB), autochthonic of raw milk and environment, and the
thermophilic lactic microflora, starter lactic acid bacteria (SLAB), originated from natural whey starter, under
effect of the technological pressure, are the protagonists of the different biochemical processes during
manufacturing and ripening stages involved in the development of appreciated PR cheese (Neviani et al., 2009).
Although the role of NSLAB in ripening has not yet been satisfactorily clarified, different authors suggested
their important role in the organoleptic profile of cheeses (Peterson and Marshall, 1990). Recent studies in
microbial ecology (Gatti et al., 2008; Neviani et al., 2009) of PR allowed a deeper insight of microbial dynamics
during the production and ripening of the same cheese-making. In particular, the optimization of a ripened
cheese-based medium to be used instead of traditional cultural media, allowed to recover the NSLAB population
in PR that may be present in little amounts in raw milk, natural whey starter and fresh curd (Lazzi et al., 2007;
Neviani et al., 2009). Further, the study of samples representative of the subsequent stages of the same cheese-
making by length heterogeneity PCR (LH-PCR) led to determine the microbial succession during 24-month of
PR ripening (Gatti et al., 2008). Indeed, LH-PCR results showed that SLAB are dominant until the second month
of ripening. After brining the species NSLAB are able to grow, while SLAB cells undergo autolysis.
Interestingly, Lactobacillus rhamnosus resulted to be the dominant species in the cheese from the second to the
twentieth month of ripening (Gatti et al., 2008). There is a surprising lack of information on the adaptive
physiology of lactobacilli to the industrial media containing milk protein and during their growing in cheese
ripening. There are a few functional genomics studies regarding the adaptation of certain lactic acid bacteria to
cultivation in milk (Koskenniemi et al., 2009). Recently, the genome of L. rhamnosus has been sequenced and
annotated (Morita et al., 2009), which enables large-scale proteomic studies on this bacterium.
The aim of this work is to investigate if different biotypes of NSLAB L. rhamnosus are present at different
stages of PR ripening and to individualize their differentially expressed protein. We report a study of the
genotypic and proteomic characterization of strains diverse for their ability of growing at various stages of PR
ripening. To reach that goal 2-DE proteomic analysis with biological duplicate samples prepared from L.
rhamnosus cultivated in ripened cheese-based medium (Cheese Broth) and the rich MRS laboratory medium
were performed.
15
th
19
15
th

2.1. Bacterial strains
Sixty six strains of L. rhamnosus isolated from different stages of PR manufacturing and ripening were used in
this study. The strains were isolated from twelve samples (curd after 6 and 48 hours, cheese at 1, 2, 3, 4, 6, 8, 10,
12, 16, 20 months of ripening) collected during the same cheesemaking from a cheese factory able to guarantee
the production of twin wheels (Gatti et al, 2008). All the strains were isolated and identified as described in
previous work (Neviani et al., 2009).

2.2. Characterization by RAPD-PCR and REP-PCR and cluster analysis
Strains were cultured overnight at 30C in MRS broth and then harvested by centrifugation. Total genomic DNA
was extracted from all isolates as described by De los Reyes-Gaviln et al. (1992). The primers M13 (5-
GAGGGTGGCGGTTCT-3) (Rossetti & Giraffa, 2005) and P1 (5-ACGCGCCCT-3) (De Angelis et al., 2001)
for RAPD-PCR and (GTG)
5
(5-GTGGTGGTGGTGGTG-3) (Coudeyras et al., 2008) for REP-PCR were used
singly in three series of amplification. The PCR products were separated on a 1,2% agarose gel in 1x TAE buffer
(40 mM Tris-acetate, 1 mM EDTA, pH 8.2) and visualized by ethidium bromide staining. The repeatability of
RAPD-PCR fingerprints was determined by triplicate loadings of independent triplicate reaction mixtures
prepared with the same strains. Conversion, normalization, and further analysis of the RAPD-PCR and REP-
PCR patterns were carried out with Bionumerics software (Version 3.0; Applied Maths). The two series of
RAPD-PCR profiles and the profiles of REP-PCR were combined to obtain a unique dendrogram. Cluster
analysis was carried out by using the unweighted pair group method with arithmetic average (UPGMA).

2.3. Fermentative profile by Biolog System
Strains were cultured overnight at 30C in MRS broth and then harvested by centrifugation. The pellet was
washed twice in K-posphate buffer 50 mM. The wells of the Biolog AN plates were inoculated with 150 l
bacterial suspensions adjusted to 65% transmittance as recommended by the manufacturer. Positive reactions
were automatically recorded using a microplate reader with a 590 nm wavelength filter. Similarities were
calculated using the Jaccard coefficient and UPMGA analysis as previously described (Parente et al., 2001).
Analysis was performed using the statistical software Statistica for Windows.

2.4. Growth and acidification curves
Strains were inoculated at 4% in MRS broth and incubated at 30C for 24 hours. The pH ad adsorbance values
were measured with a pH meter and spectrophotometer respectively and plotted against time.

2.5. Cell density measurement
Cell density was monitored in three different medium: MRS broth, milk and ripened cheese-based medium
(Cheese Broth). Strains were cultured at 30C for 24 hours in MRS and for 48 hours in milk and in cheese broth
and then serial dilutions were made in Ringers solution and plate in MRS agar.

2.6. Determination of free amino acids
The concentration of free amino acids (FAA) in supernatant of strains cultured in MRS broth, milk and Cheese
Broth was determined by using the Amino Acid Analyser using a Na-cation exchange column. Amino acids
were post-column derivatized with ninhydrin reagent and detected by absorbance at 440 (proline and
hydroxyproline) or 570 nm (all the other amino acids) (Di Cagno et al., 2004).

2.7. Protein extraction procedure
Strains were cultured in MRS broth and in Cheese Broth for 24 and 48 hours respectively and then harvested by
centrifugation at 4C. The pellet was washed twice in K-posphate buffer 50 mM. Bacterial cells were broken by
sonication in sonication buffer (Urea 8M, CHAPS 4%, DTT 65 mM, Tris 40 mM) for 5 min, which was repeated
three times. The samples were kept for 5 min on ice between sonication treatments. The samples were
centrifuged at 12000g for 3 min at room temperature, and the supernatant was collected. Protein concentrations
of the samples were determined using a Bradford protein assay.

2.8. 2-D gel electrophoresis
Isoelectric focusing (IEF) was conducted using 18 cm, 3-10 nonlinear pH range IPG Strips. A total of 200 g of
proteins in sample buffer was applied to the IPG strip. IEF was carried out at 20C for 24 hours using the
following parameters: rehydratation for 12 h, 0-300 V for 1 h, 300-500 V for 3 h, 500-2000 V for 4 h and a
constant 800 V for 9 h. After IEF, IPG strips were equilibrated for 12 min against buffer A [50 mM Tris-HCl,
pH 6.8, 6 M urea, 2% SDS, 30% glycerol, 2% DTT] and for 5 min against buffer B [50 mM Tris-HCl, pH 6.8, 6
M urea, 2% SDS, 30% glycerol, 2.5% iodoacetamide and 0.5% bromophenolo blue].
15
th
20
15
th

Two-dimensional electrophoresis was performed on 12% polyacrylamide gel electrophoresis at 15 V for 1 hour
and then at 30 V and at 15 C until the dye front reached the bottom of the gels.
The 2-D gels were silver-stained or stained by blue bromophenole method compatible with mass spectrometry
(MS). The gels were scanned and analyzed using GE healtcare analysis software.
3.1. Characterization by RAPD-PCR and REP-PCR
The sixty six L. rhamnosus isolated strains, originated from the same cheese-making of PR, were differentiated
at strain level by the combined use of RAPD-PCR, using primer P1 and M13, and REP-PCR analysis using
primer GTG
5
. The repeatability of the RAPD-PCR and REP-PCR fingerprints was assessed by comparing the
profiles obtained from three separate cultures of the same strain (data not shown).
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
826
827
1166
907
1017
1473
1905
1479
1093
1045
1471
1094
1116
1185
1022
1214
1225
1050
1172
1470
906
1227
1489
825
936
878
983
1328
1011
962
954
1149
1181
1171
1115
1051
932
1485
1476
1049
882
1480
908
1173
1468
1103
1215
1311
1038
1224
1216
1025
1314
828
1484
1478
830
850
1075
814
822
803
806
1019
802
811
CA
CA
WAM
MRS
CA
MRS
MRS
CA
MRS
MRS
WAM
MRS
WAM
WAM
MRS
CA
CA
CA
MRS
MRS
MRS
CA
MRS
MRS
MRS
WAM
MRS
MRS
MRS
WAM
MRS
CA
MRS
MRS
MRS
CA
CA
MRS
MRS
CA
MRS
CA
MRS
MRS
MRS
MRS
CA
WAM
WAM
CA
CA
MRS
MRS
CA
CA
CA
CA
WAM
CA
MRS
MRS
MRS
CA
CA
CA
CA
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
Salted cheese (1 month)
Cheese 10 months
Cheese 2 months
Cheese 4 months
Cheese 20 months
Cheese 8 months
Cheese 20 months
Cheese 8 months
Cheese 6 months
Cheese 20 months
Cheese 8 months
Cheese 10 months
Cheese 12 months
Cheese 2 months
Cheese 12 months
Cheese 12 months
Cheese 6 months
Cheese 12 months
Cheese 20 months
Cheese 2 months
Cheese 12 months
Cheese 20 months
Cheese 3 months
Cheese 2 months
Cheese 4 months
Cheese 16 months
Cheese 4 months
Cheese 3 months
Cheese 3 months
Cheese 10 months
Cheese 12 months
Cheese 12 months
Cheese 10 months
Cheese 6 months
Cheese 3 months
Cheese 20 months
Cheese 20 months
Cheese 6 months
Cheese 2 months
Cheese 20 months
Cheese 2 months
Cheese 12 months
Cheese 20 months
Cheese 8 months
Cheese 12 months
Cheese 16 months
Cheese 6 months
Cheese 12 months
Cheese 12 months
Cheese 6 months
Cheese 16 months
Cheese 20 months
Cheese 20 months
Cheese 8 months
Curd 6 h
Curd 6 h
Cheese 4 months
Curd 48 h
Curd 6 h
1
2
3
4
5
6
7
8
10
9
11
12
13
14
15
16
17
18
19
20
Pearson correlation ( Opt:1.00%) [0.0%- 100.0%]

The similarity of the electrophoretical patterns results were greater
than 80% using all the three primers, indicating a high level of
repeatability of both techniques. Thanks to the combined use of
RAPD-PCR and REP-PCR techniques, a wide genotypic
variability was found among L. rhamnosus strains. In order to
obtain a good discrimination at strain level, the two techniques
were integrated. The RAPD-PCR and REP-PCR profiles were
combined to obtain the UPGMA dendogram showed in fig. 1. At
80% similarity the L. rhamnosus strains from curd and cheeses at
different times were grouped into 19 clusters (Fig. 2), which can be
reasonably considered representative of 19 biotyes. Each cluster
included from 1 to 20 strains. Seven clusters (13, 14, 15, 16, 17,
18, 19) were formed by single strains. These biotypes, with the
exception of 1019, were isolated in the first period of maturation of
cheese. On the contrary, the biotypes 2, 4, 5 include strains isolated
only at the end of ripening. The clusters 1, 3, 5, 11 and 12 results
were the most heterogeneous as they included strains able to grow
during all the period of ripening. Indeed, these 5 biotypes are
present in cheese from the 1st or 2nd month of ripening till after
ten months. Among them, biotype 3 is in particular the one which
is more frequently isolated and therefore might be considered
dominant in the whole ripening process.

Fig.1. UPGMA dendrogram of L. rhamnosus strains based on the
combined analysis of RAPD-PCR patterns of the two primer P1 and M13,
and REP-PCR patterns, using primer GTG
5.

Ten strains (underlined in the figure 1) representative of the most
important clusters were chosen to carry out the following
characterisation studies.

3.2. Fermentative profile by Biolog System
The fermentative profile of 10 strains of L. rhamnosus
isolates was characterized by using 95 carbon sources.
All strains utilized up to 70 different carbon sources.
Among them only 13 were common for all the strains:
galactosamine, mannosamine, fructose, dextrin,
glucose, maltose, mannitole, mannose, butyric, lactic,
piruvic acid, timidine and uridine. Considering the
fermentative profile, five clusters were formed at a
distance legame of 20 (Fig. 2).
10% 15% 20% 25% 30% 35% 40%
Distanza Legame
1224
1215
1479
1019
830
1473
1484
826
1489
825
CLUSTER I
CLUSTER II
CLUSTER IV
CLUSTER V
CLUSTER III

Fig.2. Dendrogram of combined fermentative patterns for Lactobacillus rhamnosus isolates using Biolog System. Cluster
analysis was carried out on the Jaccard coefficient matrix by UPGMA cluster analysis.

3.3. Growth and acidification curves
Growth and acidification kinetics in MRS (figure 3) do not shown statistically significative differences among
the different biotypes analyzed.
On the contrary a different behaviour was detected in other media: milk and cheese broth.
15
th
21
15
th

Fig.3a. Growth curves of L. rhamnosus in MRS medium

Fig.3b. acidification curve of L. rhamnosus in MRS
medium

3.4. Cell density measurement
The results show that different biotypes reach a higher cellular density in MRS medium rather tan in milk or
Cheese Broth. Biotypes 826, 1224, 1489 have a very similar growth in the three media analyzed. We have not
observed significant cell density variation among biotypes growth in the same medium.

Significative variation was observed between
growth in MRS (complete medium - allows
optimum growth) and Cheese Broth (carbon sources
depleted medium). The cell density observed for
biotypes 826, 1224, 1489 and 830 growth in MRS
is about 1 log CFU/ml greater than the growth of
the same biotypes in Cheese Broth. The biotypes
825, 1479, 1484 the growth variation is about 0.5
log CFU/ml, biotypes 1019 and 1224 have 0.1 log
CFU/ml variation in the same conditions. Biotype
1473 has the greater growth variation (1.4 log
CFU/ml) in the above mentioned conditions.
Fig.3. Cell density of the different L. rhamnosus strains in
MRS broth, milk and Cheese Broth medium.

3.5. Amino acids (FAA) liberation in different medium
Microorganisms are able to release amino acids (aa) in
the medium according to the medium composition
itself. Cheese Broth is the best medium from this point
of view, followed by milk and MRS. In Cheese Broth
cultures biotype 825 is the best aa producer (3240
mg/Kg) followed by 1479, 1484 1019, 825 and 826.
Biotype 1473 is an aa consumer. In milk cultures
biotype 1473 is the best producer (450 mg/kg); in MRS
medium only biotypes 826, 830 and 1019 are aa
producers (2500 mg/kg).

Fig. 4 Score plot of Principal Component Analysis based on
individual free amino acids (FAA) of different biotype of L.
rhamnosus in cheese broth medium.

3.6. Detection of 2-D gel spots in MRS e Cheese Broth
L. rhamnosus 2D gel analysis (two independent experiments/biotype) has revealed about 180-200 protein spots.
Different biotypes express different proteins set if grown in different medium. The number of spots is different
among the biotypes analyzed.
15
th
22
15
th

Fig.4. Representative 2-DE images of proteins extracted from L. rhamnosus.


In consideration of its remarkable presence during the whole ripening period the microbial population, NSLAB
can be considered as one of the main factors in determining the typical cheese features. The intraspecies
heterogeneity evidenced in this work in L. rhamnosus strains during a cycle of PR manufacturing is certainly
correlated to the adaptation of the strains to the specific environmental conditions and production manufacturing.
In this regard, the detection of biotypes that mark specific moments in cheese ripening or that can develop
indifferently throughout the ripening process, suggests that they may have a specific role closely linked to their
peculiar technological properties. The adaptation of L. rhamnosus to the specific environmental conditions
during ripening of PR has been further studied in the present work. For this purpose, in this PhD thesis, we
compared the adaptation of 10 different biotypes of L. rhamnosus to a cheese-based medium (Cheese Broth) and
a rich MRS laboratory medium using a 2DE proteomic approach. The results, until now obtained, show
remarkable difference in the growth medium-dependent proteomes of L. rhamnosus, as about 50-60 separate
proteins were detected to be differentially produced when the proteomes of cell grown in Cheese broth and MRS
media were compared. In laboratory studies, the rich medium MRS is most commonly used to support the
growth of lactobacilli but microbial properties have been reported to be growth medium dependent.
Consequently, studies of proteins expression with MRS may not correspond to the conditions that L. rhamnosus
meets during ripening of PR. Our study clearly demonstrates that proteome of L. rhamnosus grown in Cheese
Broth medium differs significantly from that grown in rich MRS laboratory medium.
Future perspective. Cheese Broth medium reproduce in a best manner the characteristics of the PR. Sequencing
and identification of protein differentially expressed in the two different growth media may be useful to elucidate
what mechanism are implemented by L. rhamnosus to survive in a medium-poor carbon source.
A transcriptomic approach may allow both to detect gene differentially expressed, not detected with proteomic
analysis, and to confirm and quantify more accurately their level of expression.

Acknowledgment. The author is very grateful to Prof. Marco Gobbetti and Dr. Maria De Angelis of University
of Bari Department of Plant Protection and Applied Microbiology where part of PhD was carried out.
5. References
De Angelis M, Corsetti A, Tosti N, Rossi J, Corbo M.R, Gobbetti M. (2001). Characterization of Non-Starter Lactic Acid
Bacteria from Italian Ewe Cheeses Based on Phenotypic, Genotypic, and Cell Wall Protein Analyses. Applied and
Environmental Microbiology, 67, 2011-2020.
De Dea Lindner J, Bernini V, De Lorentiis A, Pecorari A, Neviani E, Gatti M. (2008). Parmigiano Reggiano cheese:
evolution of cultivable and total lactic microflora and peptidase activities during manufacture and ripening. Dairy
Science Technology, 88, 511523.
Gatti M, De Dea Lindner J, De Lorentiis A, Bottari B, Santarelli M, Bernini V, Neviani E. (2008). Dynamics of whole and
lysed bacterial cells during Parmigiano-Reggiano cheese production and ripening. Applied and Environmental
Microbiology, 74, 61616167.
Koskenniemi K, Koponen J, Kankainen M, Savijoki K, Tynkkynen S, de Vos WM, Kalkkinen N, Varmanen P. (2009).
Proteome Analysis of Lactobacillus rhamnosus GG Using 2-D DIGE and Mass Spectrometry Shows Differential
Protein Production in Laboratory and Industrial-Type Growth Media. Journal of Proteom Research, 2009, 49935007.
Morita H, Toh H, Oshima K, Murakami M, Taylor TD, Igimi S, Hattori M (2009). Complete Genome Sequence of
the Probiotic Lactobacillus rhamnosus ATCC 53103. Journal of Bacteriology, Dec. 2009, p. 76307631.
15
th
23
15
th
Evolution of the Oxidative Level of Virgin Olive Oil as a Function of the
Amounts of Added Monoacylglycerols
Giuseppina Bruno (giusybruno1@alice.it)
Department of Biology and Chemistry of Agro-Forestry and Enviroment (DIBCA),
University of Study of Bari Aldo Moro, BARI, Italy
Tutor: Prof. Tommaso Gomes
Among the compounds deriving from lipid degradation, as well as those arising from oxidation, considerable
importance assume the products of triacylglycerols hydrolysis. It was shown, in fact, that some of these
compounds could have influence on the shelf-life of foods and their nutritional value.
The aim of the present research was to evaluate the role of monoacylglycerols on the evolution of oxidation in
olive oil.
Evoluzione del Livello di Ossidazione dellOlio dOliva in Funzione della Quantit di
Monoacilgliceroli Aggiunti
Tra i composti di degradazione dei lipidi, oltre a quelli derivanti dallossidazione, notevole importanza assumono
i prodotti della degradazione idrolitica. stato dimostrato, infatti, che alcuni di questi composti possono
influenzare la shelf-life degli alimenti e il loro valore nutrizionale.
Obiettivo del presente lavoro stato quello di valutare il ruolo dei monoacilgliceroli sullevoluzione dei
fenomeni ossidativi in olio doliva.

Keywords: Monoacylglycerols; oxidative degradation; purified oil; virgin olive oil.
1. Introduction
Lipid oxidation is considered the most important cause of alteration of chemical, sensory and nutritional
properties of edible oils. Therefore, the evaluation of the oxidative stability of oils intended as the resistance to
degradative changes during processing and storage is of great importance. Alterations occurring in edible fats
and oils have mainly hydrolytic and oxidative nature.
The presence of partial acylglycerols in oils is due both to incomplete triacylglycerols biosynthesis and to
hydrolytic reactions, catalyzed by lipases, involving triacylglycerols. The latter phenomenon can also take place
without enzymatic catalysis, at high temperatures, with an accelerating role played by light (Nawar, 1996).
Oxidation is a degradation process that takes place in the presence of oxygen, producing volatile and non-volatile
compounds.
Besides oxygen, other factors influencing oxidative degradation are the unsaturation degree of fatty acids, the
exposure to light and heat, and the presence of pro-oxidant substances, as well as antioxidants that oppose to
such alteration (Caponio et al., 1999; Caponio et al. 2005; Velasco and Dobarganes, 2002).
The study of pro-oxidant compounds awakens interest due to their influence on the shelf-life and on the
nutritional value of food, as well as for their implications on human health (Billek et al., 2000; Udilova et al.,
2003). Besides metals, also compounds originating from the oxidation of triacylglycerols have been proved to
act as pro-oxidants, (Gomes et al., 2008; Yoon et al. 1988; Frankel et al., 1988) as well as free fatty acids and
partial acylglycerols (Miyashita and Takagi, 1986; Mistry and Min, 1987; 1988; Aubourg, 2001; Colakoglu,
2008; Paradiso et al., 2010).
In particular, studies regarding the pro-oxidant effect of partial acylglycerols have been carried out using mono-
and diacylglycerol commercial standards added to purified refined soybean oils, measuring headspace oxygen
consumption and/or hydroperoxide formation during accelerated oxidation of the oils.
Aubourg (2001) added commercial standards of mono- and diacylglycerols to hake liver oil and pointed out an
inhibitive effect on citric acid, with a consequent acceleration of lipid oxidation.
The aim of the present work was to evaluate the activity of monoacylglycerols (MAG) having the same fatty
acid composition as the tested oil, simulating conditions near to reality. Besides most commonly employed
analyses, also High Performance Size Exclusion Chromatography (HPSEC) analysis of polar compounds (PC)
was performed.
Such analytical technique, in fact, was successfully used before: i) to evaluate the actual oxidative and hydrolytic
degradation of refined oils or oils having undergone high temperature processes (Dobarganes et al., 1988;
Gomes and Caponio, 1998); ii) to investigate on the changes taking place during frying (Arroyo et al., 1992;
15
th
24
15
th
Garrido et al. 1994; Lopez-Varela et al., 1994); iii) to evaluate the quality of the lipid fraction of several foods
(Caponio et al., 2003; 2007; Caponio and Gomes, 2004,).
With this aim, MAG obtained in purity by partial saponification from a purified olive oil were added in
increasing amounts to the same purified olive oil, in order to evaluate their behaviour during oxidation both in an
oven test at 60C and in an accelerated test by Rancimat method.
2.1 Preparation of purified oil
The olive oil was purified using the method described by Lee and Min (1990) with some slight modifications.
2.2 Preparation of purified MAG
Purified MAG were obtained by partial saponification of an aliquot of purified oil (PO). In particular, 10 g of PO
were added with 100 mL of a 2N NaOH solution in methanol. After 3 min, 200 mL of distilled water and 200
mL of diethyl ether were added. After mixing, the aqueous phase was removed while the ether phase was
repeatedly washed with distilled water (80 mL each time), until neutrality of discarded water.
Then, after filtration on sodium sulphate anhydrous, the solvent was removed from the ether phase in a rotary
evaporator.
MAG were added to PO to obtain the following MAG/PO proportions: 10 g kg
-1
(MAG1); 20 g kg
-1
(MAG2); 30
g kg
-1
(MAG3). The adopted saponification method led to the formation of 98% of MAG, as confirmed by the
HPSEC analysis, while free fatty acids were discarded with the aqueous phase.
2.3 Rancimat test
Accelerated oxidation tests (AOCS, 1993) were carried out with the Rancimat apparatus (Metrohm, Herisau,
Switzerland). Three tests were performed on each oil sample to determine oxidation stability. The test was
carried out at 85C with an air flow of 20 L h
-1
.
2.4 Oven test
Five grams of oil samples with different contents of MAG as previously stated were weighted in 50 mL glass
vials and kept 18 days at 60C, which represent the temperature commonly employed in a forced air oven.
Preliminarily trials showed that the condition chosen (60C for 18 days) were useful to completely study the
oxidative process.
Five vials were prepared for each oil sample. At 4, 6, 9, 14 and 18 days a vial for each oil sample was taken and
its content was submitted to routine analyses and HPSEC of polar compounds. This experiment was carried out
twice.
2.5 Routine analyses
The routine analyses to characterize the oil samples and the PO were carried out as prescribed by the official
European Communities analytical methods (1991) to determine free fatty acids (FFA), peroxide value (PV) and
UV absorption.
2.6 Polar compounds separation and HPSEC analysis
Oil samples were submitted to silica gel column chromatography according to the AOAC method (2003) to
separate PC from the oils. Then, PC were analyzed by HPSEC analysis to determine the amount of
triacylglycerol oligopolymers (TAGP), oxidized triacylglycerols (ox-TAG), and diacylglycerols (DAG). The
HPSEC analysis was also used to assess the purity of PO and MAG.
Peak identification and quantification was carried out as described elsewhere (Gomes, 1992; Gomes and
Caponio, 1999). All the determinations were carried out in duplicate.
2.7 Statistical analysis
Analysis of variance (ANOVA), followed by Tukey HSD Test for multiple comparisons, was carried out on the
experimental data by the XLStat software (Addinsoft, New York, USA).
3. Results and Discussion
Purified oil used in the trials was almost exclusively composed of unaltered triacylglycerols and free from
oxidation products. Moreover, FFA and PV of PO were equal to zero and spectrophotometric constants were
very low and comparable to those observed in a previous study (Gomes et al., 2008). The Rancimat induction
time of the PO (control) and of the same oil added with increasing amounts of MAG (10 g kg
-1
, 20 g kg
-1
and 30
g kg
-1
) is reported in Figure 1 together with the results of the statistical analysis. The samples added with MAG
presented in all cases a significantly higher induction time than the control; besides, the induction time
progressively increased together with the amount of the added MAG, pointing out a slowdown of the oxidation
processes.
15
th
25
15
th

b
c
ab
a
9
12
15
18
PO MAG1 MAG2 MAG3
I
n
d
u
c
t
i
o
n

t
i
m
e

(
h

a
t

8
5
C
)

Figure 1 Rancimat induction time of the purified olive oil (PO, control) and of the same oil added with increasing amounts
of monoacylglycerols (MAG1, 10 g kg
-1
; MAG2, 20 g kg
-1
; MAG3, 30 g kg
-1
) together with the results of the
statistical analysis (one-way ANOVA followed by Tukey HSD test). Different letters mean significant difference at
p ! 0.05.
Table 1 reports the results of two-way ANOVA with first order interaction performed on the analytical data. The
ANOVA models resulted to be significant in all cases (p < 0.001). Time(d) and MAG(%) variables proved to
have a significant effect on all the indices, as well as the first-order interaction time(d)!MAG(%). Table 2 reports
the mean values of analyses carried out on the PO and on the same added with 10 g kg
-1
, 20 g kg
-1
and 30 g kg
-1

of MAG (MAG1, MAG2, MAG3, respectively) during the oven test at 60C as well as the results of the
statistical elaboration by means two-way ANOVA, followed by Tukey HSD test for multiple comparison.
The data obtained showed that the addition of MAG led in all cases to a significant slowdown of the oxidative
processes, considering both routine analyses and HPSEC indices. These trends were more evident as thermo-
oxidation went on. In particular, as regards the indices of primary oxidation (PV, K
232
, and ox-TAG), the values
observed for MAG1 were significantly lower than those of PO at each considered time. The addition of higher
amounts of MAG did not cause further significant variations of the same indices up to 6 days; starting from 9
days, MAG2 presented significantly lower values than MAG1, too; after 14 and 18 days also MAG3 generally
showed lower values than MAG2.
PC, that include all the substances having higher polarity than unaltered triacylglycerols, presented the same
trends as ox-TAG, being the latter the most abundant class of substances in PC.
The indices of secondary oxidation (K
270
and TAGP) pointed out a significant effect of MAG only after 9 days
of thermo-oxidation, values for MAG1 being significantly lower than for PO. After 14 days, a significant effect
of the amount of MAG was observed: indices were lower in MAG2 than in MAG1, while, as regards MAG3,
only K
270
after 18 days was lower respect to MAG2.
Table 1 Results of two-way ANOVA with first order interaction performed on the analytical data.
Model Time(d) MAG (%) Time(d)*MAG(%)
Determinations
F p-value F p-value F p-value F p-value
PV 951.88 < 0.001 2427.96 < 0.001 1860.46 < 0.001 232.70 < 0.001
K
232
678.31 < 0.001 1879.32 < 0.001 1377.19 < 0.001 103.25 < 0.001
K
270
544.70 < 0.001 1499.36 < 0.001 752.42 < 0.001 174.55 < 0.001
PC 1093.26 < 0.001 2883.82 < 0.001 2066.61 < 0.001 253.06 < 0.001
TAGP 219.57 < 0.001 308.75 < 0.001 570.49 < 0.001 80.31 < 0.001
ox-TAG 840.13 < 0.001 2210.54 < 0.001 1632.24 < 0.001 185.31 < 0.001
DAG 60.70 < 0.001 158.97 < 0.001 73.94 < 0.001 24.63 < 0.001
PV, peroxide value; K
232
, specific absorption at 232 nm; K
270
, specific absorption at 270 nm; PC, polar
compounds; TAGP, triacylglycerol oligopolymers; ox-TAG, oxidized triacylglycerols; DAG, diacylglycerols.
15
th
26
15
th

Table 2 Results of analyses and of the multiple comparison (Tukey HSD test) performed on analytical data.
Time (days)
Determinations MAG (g kg
-1
)
4d 6d 9d 14d 18d
PO
0 A 38.0 hi 59.5 g 95.5 e 17.5 c 331.5 a
MAG1 10 B 7.8 klm 17.6 jkl 31.2 ij 131.6 d 196.5 b
MAG2 20 C 3.6 lm 7.3 klm 11.7 klm 49.7 gh 99.1 e
PV
MAG3 30 D 1.8 m 5.9 klm 7.8 klm 20.5 jk 76.4 f
PO
0 A 1.80 fg 3.19 e 5.41 d 6.80 c 9.30 a
MAG1 10 B 0.87 i 1.08 hi 2.27 f 3.29 e 8.08 b
MAG2 20 C 0.78 i 0.87 i 1.13 hi 1.72 fg 5.19 d
K
232

MAG3 30 D 0.77 i 0.84 i 1.10 hi 1.57 gh 3.68 e
PO
0 A 0.06 jkl 0.06 jk 0.16 cd 0.17 c 0.35 a
MAG1 10 B 0.04 klm 0.05 klm 0.12 fg 0.14 de 0.21 b
MAG2 20 C 0.04 lm 0.04 klm 0.08 hi 0.10 gh 0.13 ef
K
270

MAG3 30 D 0.04 m 0.04 klm 0.07 ij 0.09 hi 0.10 gh
PO
0 A 7.6 gh 20.9 f 35.7 d 59.3 c 94.2 a
MAG1 10 B 2.0 i 3.1 i 10.9 g 36.0 d 66.0 b
MAG2 20 C 1.9 i 2.8 i 3,4 hi 26.6 e 34.7 d
PC
MAG3 30 D 2.0 i 2.7 i 3.1 i 4.5 hi 22.2 ef
PO
0 A 0.3 f 0.6 f 1.9 d 4.2 c 9.8 a
MAG1 10 B 0.1 f 0.1 f 0.4 f 1.8 d 6.2 b
MAG2 20 C 0.0 f 0.1 f 0.1 f 0.8 ef 2.3 d
TAGP
MAG3 30 C 0.0 f 0.1 f 0.1 f 0.1 f 1.7 de
PO
0 A 6.6 gh 19.3 f 32.7 d 53.1 c 81.3 a
MAG1 10 B 1.4 i 2.7 hi 9.3 g 32.9 d 58.3 b
MAG2 20 C 1.3 i 2.2 hi 2.7 hi 24.1 e 30.5 d
ox-TAG
MAG3 30 D 1.3 i 1.8 i 2.4 hi 3.9 hi 19.7 ef
PO
0 A 0.5 efg 0.8 def 0.8 def 1.6 b 2.8 a
MAG1 10 B 0.4 efg 0.3 g 0.9 de 1.1 cd 1.8 b
MAG2 20 B 0.5 efg 0.4 fg 0.5 efg 1.4 bc 1.7 b
DAG
MAG3 30 C 0.6 efg 0.5 efg 0.5 efg 0.5 efg 0.6 defg
PV, peroxide value (meq O
2
kg
-1
), K
232
270
, specific absorption at 270 nm; PC, polar
compounds (g kg
-1
); TAGP, triacylglycerol oligopolymers (g kg
-1
); ox-TAG, oxidized triacylglycerols (g kg
-1
); DAG,
diacylglycerols (g kg
-1
). Uppercase letters are used to compare the samples considering the effect of MAG levels, lower case
letters are used to compare the samples considering the combined effects of MAG (%), time(d) and time(d)"MAG(%)
interaction: different letters mean significant difference at p " 0.05.
Besides, the data reported in the table 2 pointed out that after 9 days of thermo-oxidation at 60C the oxidative
degradation of MAG3 was significantly lower than in PO after only 4 days; after 14 days only K
270
in MAG3
was higher than that found in PO after 4 days, while the other indices still remained not significantly different.
As regards the DAG, the data reported in the table 2 point out an increase of their amount during the experiment
(the increase became significant, for PO, after 14 days). This indicates that a mild heat treatment caused
hydrolytic processes in the oils (Vichi et al., 2003). The addition of MAG to PO caused also a slight but
significant decrease of the hydrolytic degradation. These findings disagree with those reported by Krishnamurthy
(Krishnamurthy, 1982) who suggested a catalytic effect of hydrolysis products on the triacylglycerol hydrolysis.
4. Conclusions and Future Perspectives
On the whole, the data point out a marked antioxidant effect of MAG in purified olive oil, contrary to what
observed by other authors, who noticed either a pro-oxidant or a non-antioxidant activity of these compounds in
purified soybean oil. This could be due to the different fatty acid composition of the two types of oils, being
olive oil richer in monounsatured fatty acids (MUFA) and poorer in polyunsaturated fatty acids (PUFA) respect
to soybean oil. It is well known the greater reactivity to oxygen of PUFA respect to MUFA. Preliminary trials
(data not shown) indicated that the same MAG added both to purified olive oil and purified soybean oil
conferred a different oxidative stability, which was imputable to the different fatty acid composition of the
purified oils. Nevertheless, further investigations are required to support such hypothesis.
15
th
27
15
th

5. References
AOAC (2003) Official methods of analysis of Association of Official Analytical Chemists International, Method 982.27, 17
th

ed. Horwitz W, editor. AOAC Press, Arlington, USA.
AOCS (1993) Official Methods and Recommended Practices of the American Oil Chemists Society, Method Ch 12b-92,
AOCS Press, Champaign, USA.
Arroyo R, Cuesta C, Garrido-Polonio C, Lpez-Varela S, Snchez-Muiz FJ (1992) High-performance size-exclusion
chromatography studies on polar components formed in sunflower oils used for frying, J Am Oil Chem Soc 69:557-63.
Aubourg SP (2001) Effect of partially hydrolysed lipids on inhibition of oxidation of marine lipids, Eur Food Res Technol
212:540-5.
Billek G (2000) Health aspects of thermoxidized oils and fats, Eur J Lipid Sci Technol 102 :587-93.
Caponio F, Alloggio V (1999) Phenolic compounds of virgin olive oil: influence of paste preparation techniques, Food Chem
64:203-9.
Caponio F, Bilancia MT, Pasqualone A, Sikorska E, Gomes T (2005) influence of the exoposure to light on extra virgin olive
oil qualit durino storage, Eur Food Res Technol 221:92-8.
Caponio F, Gomes T (2004) Examination of lipid fraction quality of margarine, J Food Sci 69:63-6.
Caponio F, Gomes T, Pasqualone A, Summo C (2007) Use of the high performance size exclusion chromatography analysis
for the measurement of the degree of hydrolytic and oxidative degradation of the lipid fraction of biscuits, Food Chem
102:232-6.
Caponio F, Gomes T, Summo C (2003) Assessment of the oxidative and hydrolytic degradation of oils used as liquid
medium of in-oil preserved vegetables, J Food Sci 68:147-51.
Colakoglu AS (2007) Oxidation kinetics of soybean oil in the presence of monoolein, stearic acid and iron, Food Chem
101:724-8.
Dobarganes MC, Prez-Camino MC, Mrquez-Ruiz G (1988) High performance size exclusion chromatography of polar
compounds in heated and non-heated fats, Fat Sci Technol 90:308-11.
Frankel E, Neff WE, Selke E, Brooks DD (1988) Analysis of autoxidized fats by gas chromatography-mass spectrometry: X.
Volatile thermal decomposition products of methyl linoleate dimmers, Lipids 23:295-8.
Garrido-Polonio C, Snchez-Muiz FJ, Arroyo R, Cuesta C (1994) Small scale frying of potatoes in sunflower oil:
thermoxidative alteration of the fat content in the fried product, Eur J Nutr 33:267-76.
Gomes T (1992) Oligopolymer, diglyceride and oxidized triglyceride contents as measure of olive oil quality, J Am Oil Chem
Soc 69:1219-23.
Gomes T, Caponio F (1998) Evaluation of the state of oxidation of olive-pomace oils. Influence of the refining process, J
Agric Food Chem 46:1137-42.
Gomes T, Caponio F (1999) Effort to improve the quantitative determination of oxidation and hydrolysis compound classes
in edible vegetable oils, J Chromatogr A 844:77-86.
Gomes T, Delcuratolo D, Paradiso VM (2008) Pro-oxidant action of polar trigliceride oligopolymers in edible vegetable oils,
Eur Food Res Technol 6:1409-14.
Krishnamurthy RG (1982) Cooking oils, salad oils and salad dressings. In Baileys industrial oil and fat products, vol. 2
4
th
ed, New York: Wiley, pp 315-41.
Lee SH, Min DB (1990) Effects, quenching mechanism and kinetics of carotenoids in chlorophyll-sensitized photooxidation
of soybean oil, J Agric Food Chem 38:1630-4.
Lpez-Varela S, Snchez-Muiz FJ, Garrido-Polonio C, Arroyo R, Cuesta C (1995) Relationship between chemical and
physical indexes and column and HPSE chromatography methods for evaluating frying oil, Eur J Nutr 34:308-13.
Mistry BS, Min DB (1987) Effects of fatty acids on the oxidative stability of soybean oil, J Food Sci 52:380-1.
Mistry BS, Min DB (1988) Prooxidant effects of monoglycerides and diglycerides in soybean oil, J Food Sci 53:1896-7.
Miyashita K, Takagi T (1986) Study on the oxidative rate and prooxidant activity of free fatty acids, J Am Oil Chem Soc
63:1380-4.
Nawar WW (1996) Chemistry. In Baileys Industrial Oil & Fat Products, vol 1 5
th
ed, New York: Wiley, pp 397-426.
Official Journal of the European Communities (1991) EC Regulation 2568/91, n.L. 248 of September 5
th
.
Paradiso VM, Gomes T, Nasti R, Caponio F, Summo C (2010) Effects of free fatty acids on the oxidative processes in
purified olive oil, Food Res Int 43:1389-94
Udilova N, Jurek D, Marian B, Gille L, Schulte-Hermann R, Nohl J (2003) Induction of lipid peroxidation in biomembranes
by dietary oil components, Food Chem Toxicol 41:1481-9.
Velasco J, Dobarganes C (2002) Oxidative stability of virgin olive oil, Eur J Lipid Sci Technol 104:661-76
Vichi S, Pizzale L, Conte LS, Buxaderas S, Lpez-Tamames E (2003) Solid-phase microextraction in the analysis of virgin
olive oil volatile fraction: modifications induced by oxidation and suitable markers of oxidative status, J Agric Food
Chem 51:6564-71.
Yoon SH, Jung MY, Min DB (1988) Effect of thermally oxidized triglycerides on the oxidative stability of soybean oil, J Am
Oil Chem Soc 65:1652-6.
15
th
28
15
th
Brettanomyces bruxellensis in wine: presence, off-odours production and
strategies for inhibition
Simona Campolongo (simona.campolongo@unito.it)
Dept. Exploitation and Protection of the Agricultural and Forestry Resources, University of Turin
Tutor: Prof. Luca Cocolin

During the PhD thesis, a multi disciplinary approach was carried out to deeply study the yeast Brettanomyces
bruxellensis. In the first year the presence of the yeast was investigated in 87 different Italian wines. In the
second year a proteomic approach was carried out in order to study the mechanism of off-odours production.
During the third year a new microscopic technique was used to understand the change of the intracellular pH in
response to several environmental conditions.
Brettanomyces bruxellensis in vino: presenza, produzione di composti sgradevoli e
strategie di inibizione
Questa tesi di dottorato tratta lo studio, sotto diversi aspetti, del lievito Brettanomyces bruxellensis. Il primo anno
la ricerca si incentrata sullanalisi della presenza del lievito in 87 diversi vini italiani. Durante il secondo anno
stato condotto uno studio di proteomica allo scopo di analizzare il meccanismo di produzione dei composti
sgradevoli. La ricerca del terzo anno stata incentrata sullo studio di strategie per linibizione del lievito
attraverso lutilizzo di nuove tecniche di microscopia.

Key words: Brettanomyces bruxellensis, off-odours, wine, 2D electrophoresis, SAU-PCR.
1. Introduction
Wine comprises a complex microbial ecology of opportunistic microorganisms, some of which could potentially
induce spoilage and result in consequent economic losses under uncontrolled conditions. One of the controversial
yeasts that has gained increasing attention in recent years, specifically as it is associated with wine spoilage,
belongs to the genera Brettanomyces and Dekkera, well known for the production of ethyl phenols. It catalyses
the transformation of hydroxycinnamic acid, naturally occurring in grapes, producing volatile phenols (Benito et
al. 2009). Its ability to convert hydroxycinnamic acids into volatile phenols can confer off-odours described as
phenolic, animal, mousy, wet wool, medicinal, smoky and spicy and consequently it reduces the organoleptic
quality of the final product (Chatonnet et al., 1992; Loureiro and Malfeito-Ferreira, 2003). Since important
economic losses may derive from wine spoilage by Brettanomyces/Dekkera, efforts towards the monitoring and
control of these organisms in musts and wines are essential since they will allow winemakers to take
prophylactic action in order to avoid problems before they arise. These yeasts are not among the dominant
organisms in must during fermentation, but their presence might have a great influence on the final product.
They are considered wine spoilage agents and their classical habitat in the winemaking environment is the
winery and its equipments (Ciani et al. 2003) particularly barrel-ageing red wines.
Traditional methods to identify spoilage yeasts in wine are mainly based on microbiological culturing. Authors
have recently described selective media developed by manipulating the type and concentration of selected
antimicrobial agents and carbon sources to suppress the growth of other yeast species and bacteria (Rodriguez et
al. 2001; Couto et al. 2005). These selective media are necessary to overcome difficulties for the recovery of
Dekkera/Brettanomyces from materials heavily contaminated with other yeasts or moulds, which by growing
faster prevent the detection of this slow growing microorganism. Culture dependent methods need from 7 to 15
days for the results. In recent times many efforts have been made in order to develop faster and innovative
methods for the detection and enumeration of Brettanomyces yeast, able to give results before the insurgence of
the alteration.
2. Experimental procedure
2. 1 Presence and biodiversity
In the first year of PhD the research was focused on the investigation of B. bruxellensis presence in some Italian
wines. For the detection and quantification of B. bruxellensis in 87 different wines coming from Liguria and
Piedmont regions in North-West Italy, quantitative PCR (qPCR) was applied directly in the wine, as culture
independent method, as well as traditional culture dependent method, using a selective medium (DBDM, Couto
15
th
29
15
th
et al. 2005) to define the prevalence of Brettanomyces spp. Species-specific PCR and restriction analysis were
performed on suspected colonies isolated from DBDM agar to identify B. bruxellensis and the molecular
characterization of 196 isolated strains, belonging to this species, was performed for a better knowledge of
strains biodiversity. Lastly, Headspace Solid-Phase Microextraction method (HS-SPME) was employed to
quantify ethyl and vinyl phenols in wines.
2.2 Mechanism of off-odours production
The transformation of the hydroxycinnamic acids, p-coumaric and ferulic acids, into volatile phenols is
predominantly associated with the activity of the Brettanomyces yeast genus.
The production of volatile phenols is related with the sequential activity of two enzymes which decarboxylate
(phenolic acid decarboxylase, PAD) hydroxycinnamic acids (e.g. ferulic, p-coumaric and caffeic acids) into
hydroxystyrenes (vinylphenols) which are then reduced to ethyl derivatives (vinylphenol reductase, VPR) (Edlin
et al. 1995).
The nucleotide and amino-acidic sequences of the two enzymes are still unknown. Very few researches have
been published about the putative sequences, but any author has proved until now that the published sequences
are really corresponding to the PAD and VPR proteins.
In the second year of PhD, the research was focused on unravelling the mechanism of off-odours production.
A genetic approach, as well as a proteomic approach, were used in order to discover the nucleotide and the
aminoacid sequences of the enzymes. By multi alignment of the nucleotide sequences present in Gene bank from
other bacteria and yeasts species degenerated primers for the PAD and VPR genes were designed. PCR with the
degenerated primers led to the amplification of DNA fragments corresponding to the genes most likely encoding
the two enzymes. In order to prove that they are truly the two responsible enzymes, a proteomic approach was
used to investigate variations occurring in the proteome of B. bruxellensis during the growth with and without
the hydroxy-cinnamic precursors. The aim was to detect the maximum number of proteins that vary in different
environmental conditions supposed to be connected with the spoiler compounds production.
2.3 Strategies of inhibition
The inhibition of the yeast B. bruxellensis could improve the quality of the worldwide wines. Recently they have
been isolated in different part of the world: South Africa (Oleofse et al. 2009), USA (Stender et al. 2001), Italy
(Cocolin et al. 2004, Agnolucci et al. 2009), France (Tessoniere et al. 2009) and Spain (Ibeas et al. 1996).
Previous results in literature deal of the potential inhibition of the yeast. Harris et al. (2008) report that the
presence of Hydroxy-cinnamic acids (HCAs) decreases the growth of yeast and metabolism of HCAs. Renouf
and Murat (2008) report that malolactic starter could potentially be employed to improve the control of
Brettanomyces risk. Recently Food and Drug administration allowed the addition of Dimethyl di carbonate
(DMDC) in wine to prevent the growth of unwanted microorganism. By FRIM (Fluorescent Ratio Imaging
Microscopy) the effect of DMDC, HCAs and several bacteria and yeast species on intracellular pH of B.
bruxellensis were investigated.
3.1 Presence and biodiversity

Eighty seven samples of red and white wines were collected, in a random way, directly from wineries or from
the market in Piedmont and Liguria regions, North-West of Italy. They were samples of Barbera, Nebbiolo,
Barbaresco, Barolo, Dolcetto, Grenache, Rossese, Cabernet, Ciliegiolo, Ormeasco, Mosaico. More specifically,
46 wine were collected from Piedmont and they were represented by 26 from tanks before the bottling and 20
bottled. In the same way, from Liguria, one was from tank and 40 from bottles.
Strain DSM 7001 of D. bruxellensis was used as references (DSMZ German Collection of Microorganisms and
Cell Cultures, Braunschweig, Germany). Wine samples, at an appropriate sample dilution, were spread on plates
containing DBDM agar (Rodrigues et al, 2001). One hundred nanograms of DNA were analyzed by species-
specific PCR amplification as described by Cocolin et al (2004). Two hundred nanograms of extracted DNA,
from strains identified as B. bruxellensis, was subjected to digestion using the Sau3A restriction endonuclease
(Roche Diagnostics, Milan, Italy), as described by Corich et al. (2005). One l of DNA, extracted whit a Master-
Pure Complete DNA Purification Kit (Epicentre, Madison, WI, USA), was amplified using the protocol
described by Phister and Mills (2003). For the Headspace Solid-Phase Microextraction (HS-SPME) a
DVB/CARBOXEN/PDMS fiber of 1 cm of length and the protocol described by Boutou and Chatonnet (2007).


For the DNA sequence of the PAD enzyme we have used two aminoacidic sequences found in literature for B.
15
th
30
15
th
anomalus. The primer forward ANPADF (3-AAGGTCGCTATTATYATCTAC) was designed using the
sequence obtained from Edlin et al (1998), while the reverse primer ANPADR (5-
CATCCAGCACCCCAAGCGG) was designed back-translating the sequence found from Harris et al. (2009)
For the DNA sequence of the VPR enzyme we have designed the primers using the putative ORF of the protein
described by Tchobanov et al (2008) (VPRF1-3-TTGACCATCCAGTATGATTCAGG, VPRR1 5-
TGACACCTGGAGTCTGCTTG TAAAGC). For the proteomic study the strain DSM 7001 was grown in YNB
broth supplemented whit p-coumaric acid and vinyl-phenol, when necessary. Cellular lysate after clarification
was quantified using the Bradford method. One mg of protein extract was purified by methanol-chloroform
precipitation, and loaded for IEF on a pI 3-10 linear strip. SDS-PAGE was carried out using 14% T acrilammide
gels. For each condition used, three technical replicates were obtained. Image analysis was performed using the
software Progenesis PG 200 software (Non Linear Dynamics, Durham, USA).

Cells were grown in YPD, harvested during exponential phase and stained for 30 minutes at 30C with 5-(and-
6)-carboxy-2,7-dichlorofluorescein diacetate, succinimidyl ester (Invitrogen). For DMDC and HCAs
inhibitions cells were loaded on a perfusion chamber and perfused whit synthetic wine with the addition of
DMDC, ferulic or para-coumaric acid. Experiments were performed for 10 minutes measuring the intensity
every 30 second. For B. bruxellensis and the interaction whit other microorganism, stained cells were loaded on
a microscopy chamber and the potentially inhibiting culture was added later.
4.1 Presence and biodiversity
In the Table 1 the comparison of the results obtained by traditional microbiological methods and qPCR is
reported. As shown, both approaches were able to detect B. bruxellensis in about half of the wines analyzed in
this study. qPCR gave positive results for 10 more wines, when compared to the traditional plating. Even if
number of wine samples falling within each logarithm interval was similar for both traditional culture dependent
and independent methods, by qPCR the number of wines was consistently higher. This was verified not only for
wines with high counts (>5 Log cfu/mL) but also for the low contaminations (1-2 Log cfu/mL). By traditional
microbiological analysis it was determined that the 15% of the wines from Liguria resulted positive, in contrast
to the 8% of the wines from Piedmont. This evidence underlines that, even if the 98% of the wines coming from
Liguria were already bottled and ready for the consumers, B. bruxellensis populations were alive and
metabolically active in wines coming from this region, not excluding the possibility of spoilage in the bottle.

Table 1 Comparative analysis of the results obtained by culture dependent and independent methods. Wines were grouped
based on the level of the counts of B. bruxellensis detected by the two approaches used.
Log cfu/mL
Method of analysis
<1 1-2 2-3 3-4 4-5 >5
Culture dependent method 48 4 11 10 10 4
Culture independent method

38 6 14 14 9 6

When the wines were subjected to HS-SPME-GC/MS for the quantification of all four phenols, results presented
in Table 2 were obtained. 4VP and 4VG in all the wines were below the quantification limit of the method.
About 70% of the wines showed very low contents of volatile phenols 4EP and 4EG, while about 20% of the
wines had contents from 10 to 200 !g/L. About ten percent of the samples presented a high content of these
molecules ranging between 200 and 400 !g/L. Only few wines showed a very high level of 4EP ranging from
400 to 800 !g/L. One sample had a 4EP content of about 1 mg/L. The results obtained in this study correlate
well with the available literature on 4EP content in wines from other countries (Nikfardjam

et al. 2009).

Table 2 Results obtained by SPME-GC/MS on the quantification of 4-Ethyl-phenol and 4-Ethyl-guaiacol in the
wines analyzed. The samples were classified based on the level of the two compounds (!g/L)
<10 10-200 200-400 400-600 600-800 800-1000 >1000
4-Ethyl-phenol 56 16 4 5 4 1 1
4-Ethyl-guaiacol 61 20 6 0 0 0 0

From the plates of DBDM a collection of 196 isolates was created. Seventy-four and 122 were from wines
coming from Piedmont and Liguria, respectively. One hundred-thirty two were collected from wines already
15
th
31
15
th
bottled, while 64 isolates were from tanks. After species-specific PCR and restriction enzyme analysis of the
PCR products obtained all of them were identified as B. bruxellensis.
In order to investigate B. bruxellensis strain biodiversity, a fingerprinting method, namely SAU-PCR, was used.
Four primers, as suggested by Corich et al. (2005), were used in the differentiation of the isolates, however only
primer SAG1 could be efficiently used for the differentiation (data not shown). The dendrogram obtained by
analyzing the SAU-PCR patterns is shown in Figure 1. The dendrogram, at a similarity level of 70%, could
differentiate 12 clusters and 10 single-strains. Two groups were particularly numerous including 45 and 32
isolates (clusters 1 and 10, respectively) coming from both regions, while ten groups were smaller containing
between 2 and 23 strains. Among 12 clusters, 9 consisted of strains from only one region (3 for Piedmont and 6
for Liguria), while only 3 had strains from both regions. The cluster from Liguria (identified in Fig.1 by numbers
2, 3, 5, 6, 7 and 8) had mainly strains isolated from bottled wine, while the clusters mixed (1, 4 and 10) and from
Piedmont (9, 11 and 12) have an high percentage of strains isolated from tanks.
It is interesting to underline how the fingerprinting method used in this study was able to differentiate isolates
based on the geographical origin and on the type of samples from where it was isolated.

Figure 1. Biodiversity of B. bruxellensis isolated from the wines used in this study and achieved comparing the strain
profile obtained by SAU-PCR using the primer SAG1 (Cocolin et al, 2004). Analysis was performed using the BioNumerics
Software (Applied Maths,) using a similarity coefficient of 70%


A multi alignment of the nucleotide sequences present in Gene bank from other bacteria and yeasts species, was
performed and degenerate primers for the PAD and VPR genes were designed. PCR with the degenerate primers
led to the amplification of DNA fragments corresponding to the genes most likely encoding the two enzymes.
In order to prove that they are truly the two enzymes responsible, a proteomic approach was used to investigate,
variations occurring in the proteome of B. bruxellensis during the growth with and without the hydroxy-cinnamic
precursors. After images analysis 59 proteins significantly vary in the three different conditions tested.
This underline the fact that the mechanism of off-odours production does not involve only the two PAD and
VPR enzyme, but a more complicated mechanism is set off in the yeast cells after HCAs exposure.
Between all the proteins significantly vary, 26 spots in the regions of interest of the two putative enzymes, were
identified by mass spectrometry analysis.

Figure 4. Reference 2DE map. With the black cross-hatched line is highlighted the region of interest for the PAD enzyme,
while the black line indicates the region of interest for the VPR enzyme. (Edlin et al.1998).
15
th
32
15
th
Unfortunately only the 40% of the B.bruxellensis genome has been published yet. For this reason it was not
possible to certainly identify the 26 spots sequenced on Protein Data Bank, and only two of them have high score
matches with glycolytic enzymes known from other yeast species.

From previous data in literature (Harris et al, 2008) is reported that HCAs could have a negative effect on the
grown of B. bruxellensis. This was confirmed by growth curve in synthetic wine media and YPD broth whit the
addition of HCAs. At the date of writing this document the experiment are on going.
The combination of the methods used in this study led us to the conclusion that an increase in the B. bruxellensis
population is not directly correlated to an high content in ethyl phenols. A better knowledge of the environmental
conditions that favor the production of ethyl phenols in B. bruxellensis will allow a greater understanding of the
management of some technological variables to control the production of these unwanted phenol compounds
during wine production. The comparison of the identified spot and the annotated genome of the yeast, that has
not been published yet, will allow us to unravel all the proteins involved in HCAs metabolism and off-odors
production. Until now is thought that only two enzymes have a role on HCAs metabolism, but by the proteomic
approach we found that a more deep mechanism is involved. After the confirmation that the two nucleotidic
sequences found are truly the PAD and VPR enzyme mainly involved in HCAs metabolism, a quantitavie PCR
study will allow us to better understand the environmental factors that play a role in the modulation of the
expression of the two gene of interest. This could help all the winemakers to better control B.bruxellensis risk in
wine.
8. References
Chatonnet P., D. Dubourdieu, J.N. Boidron, and M. Pons. 1992. The origin of ethyl-phenols in wine. J. Sci. Food Agric.
60:165-178.
Ciani M., F. Maccarelli, and F. Fatichenti. 2003. Growth and fermentation behaviour of Brettanomyces/Dekkera yeasts under
different conditions of aerobiosis. World J. Microb. Biotech. 19: 419-422.
Cocolin L., K. Rantsiou, L. Iacumin, R. Zironi, and G. Comi. 2004a. Molecular detection and identification of
Brettanomyces/Dekkera bruxellensis and Brettanomyces/Dekkera anomalus in spoiled wines. Appl. Environ.
Microbiol. 70:1347-1355.
Corich V., A. Mattiazzi, E. Soldati, A. Carraro, and A. Giacomini. 2005. Sau-PCR, a novel amplification technique for
genetic fingerprinting of microorganisms. Appl. Environ. Microbiol. 71: 6401-6406.
Couto J.A., A. Barbosa, and T. Hogg. 2005 A simple cultural method for the presumptive detection of the yeasts
Brettanomyces/Dekkera in wines. Lett. Appl. Microbiol. 41:505-510.
Edlin Dan. The production of phenolic flavour compounds by yeast and fungi. PhD thesis, University of Cardiff.
Edlin D., Narbad A., Gasson M., Dickinson R., Lloyd D.; Purification and characterization of hydroxycinnammate
decarboxylase from Brettanomyces anomalus. Enzyme and microbial technology, 1998. 22:232-239.
Harris V., Ford C., Jiranek V., Grbin P.; Survey of enzyme activity responsible for phenolic off-flavour production by
Dekkera and Brettanomyces yeast. Appl Microbiol Biotechnol, 2009. Vol.81 (6) Pages: 1117-1127
Miot-Sertier C., and A. Lonvaud-Funel. 2007. Development of a molecular method for the typing of Brettanomyces
bruxellensis (Dekkera bruxellensis) at the strain level. J. Appl. Microbiol. 102:555-562.
Nikfardjam

M.P., B. May, and C. Tschiersch. 2009. 4-Ethylphenol and 4-ethylguaiacol contents in bottled wines from the
German Wrttemberg region. Eur. Food Res. Technol. 230:333-341.
Oelofse A., A. Lonvaud-Funel, M. du Toit. 2009. Molecular identification of Brettanomyces bruxellensis strains isolated
from red wines and volatile phenol production. Food Microbiol. 26: 377-385.
Phister T.G., and D.A. Mills. 2003. Real-time PCR assay for detection and enumeration of Dekkera bruxellensis in wine.
Appl. Environ. Microbiol. 69:7430-7434.
Rodriguez N., G. Goncealves, S. Pereira-da-Silva, M. Malfeito-Ferreira, and V. Loureiro. 2001. Development and use of a
new medium to detect yeasts of the genera Dekkera/Brettanomyces. J. Appl. Microbiol. 90:588-599.
Tchobanov I, Gal L., Guillox-Benatier M., Remize F., Nardi T., Guzzo J., Serpaggi V., Alexandre H.; Partial vinyl phenol
reductase purification and characterization from Brettanomyces bruxellensis, 2008. FEMS Microbiol Lett 284- 213-217

15
th
33
15
th
Biotechnology, University of Naples Federico II, Port ici, 15-17 September, 2010

Use of non-dairy Lactobacillus plantarum, Lactobacillus paraplantarum and
Lactobacillus pentosus strains as adjuncts in cheese making
Felicia Ciocia (felicia.ciocia@unibas.it)
Dip. Difesa, Biologia e Biotecnologie Agro-Forestali, Universit degli Studi della Basilicata, Italia
Tutor: Prof. Eugenio Parente

In accordance with the PhD thesis project previously described (Ciocia, F., 2008), this oral communicat ion
reports the main results concerning the evaluation of the physiological, microbiological and technological
properties as well as the survival of ten selected L. plantarum, L. paraplantarum and L. pentosus strains during
their use as adjuncts in cheese manufacture. This thesis is aimed to the identification of strains with potential
technological properties and their exploitation as adjunct starters in food applications.
Uso di ceppi di origine non lattiero-casearia di Lactobacillus plantarum,
Lactobacillus paraplantarum e Lactobacillus pentosus come adjuncts nella
produzione di formaggio
In accordo con le attivit descritte in precedenza (Ciocia, F., 2008), questa comunicazione orale riporta i
maggiori risultati riguardanti la valutazione delle caratteristiche fisiologiche, microbiologiche e tecnologiche di
dieci ceppi selezionati di L. plantarum, L. paraplantarum and L. pentosus e la loro sopravvivenza durante
lutilizzo come adjuncts nella produzione di formaggio. Lo scopo principale di questa tesi di dottorato
lindividuazione di ceppi con particolari propriet tecnologiche e il loro uso come colture aggiuntive in sistemi
alimentari.

Key words: NSLAB, adjuncts, RP-HPLC, proteolysis.
1. State of the art
Non-starter lactic acid bacteria (NSLAB) are adventitious bacteria capable of growth under the selective
conditions of ripening cheese (Fox et al., 1998). Their presence in cheese may be due to post -pasteurizat ion
contamination, cheese making equipment or in ingredients or to strains surviving pasteurizat ion. Mesophilic
lactobacilli are generally the dominant NSLAB species found in Cheddar cheese, but pediococci may also be
found (Fit zsimons et al., 1999). NSLAB have been shown to contribute to flavour development in some varieties
of cheeses and thus are desirable in cheese, even if some authors have been demonstrated that NSLAB can also
develop off flavours and defects in cheese products (Lane et al., 1996). The dominant microflora during the
Cheddar cheese making process are the starter lactococci that grown rapidly on the day of manufacture reaching
high count levels (~10
9
cfu/g). Their number declines as the cheese ripens, mainly because of the adverse cheese
environmental conditions (pH, moisture, salt, temperature) and autolysis (McSweeney et al., 1994). With the
starter decrease there is an increase of the NSLAB counts that, from a very low level (~10 to 10
4
cfu/g in 1-d-old
Cheddar cheese manufactured with pasteurized milk) reach up to ~10
7
to 10
8
cfu/g within about three months of
ripening, becoming dominant for most of the cheese maturation period (El Soda et al., 2000). The dominant
NSLAB found in Cheddar cheese commonly include L. paracasei and L. plantarum, while other species (L.
curvatus, L. casei, L. brevis and L. rhamnosus) have been found as minor components (Banks & Williams,
2004). The heterogeneity of NSLAB populations in Cheddar cheese decreases during ripening; in fact, several
species encountered in young cheeses (L. plantarum and L. curvatus) are replaced by L. paracasei (Fitzsimons et
al., 2001). In New Zealand Cheddar cheese the dominant species were both L. paracasei and L. rhamnosus
(Crow et al., 2001). However, some authors found that the population of 8-week-old Irish Cheddar cheese had a
smaller proportion of L. paracasei and a larger proportions of L. plantarum and L. curvatus, leading the
conclusion that the dynamics of NSLAB population depends on several factors, such as cheese age (Fitzsimons
et al., 2001), use of raw or pasteurized milk, factory hygiene, starter used and cheese composition (Fox et al.,
1998). The introduction and the use of pasteurized milk for cheese-making has led to an overall reduction in
NSLAB numbers and a more bland flavour in the mature cheese. To replace the indigenous NSLAB microflora
in pasteurized milk, the use of selected secondary starters (adjunct) has been suggested. Adjuncts are added to
cheese milk to improve development of cheese sensory quality, increase aroma and flavour intensity, accelerate
ripening (Fox et al., 1998; El Soda et al., 2000) and eliminate defects by adventitious NSLAB inhibit ing their
growth (Wouters et al., 2002). As a result, many studies have shown that cheeses made with the addition of non-
starter lactobacilli are characterized by higher concentrations of free amino acids and enhanced flavour intensity
(Lynch et al., 1996; Ortigosa et al., 2005). The use of wild strains as adjuncts for the development of new
15
th
34
15
th

flavours is interesting, since these strains harbour more amino acids -converting enzymes than industrial starters
(Wouters et al., 2002). However, primary proteolysis seems not to be affected by the adjunct cultures even if
levels of small peptides and free amino acids are generally enhanced (Banks & Williams, 2004). L. plantarum is
an important industrially specie which is widespread in the environment and fermented products of an imal and
plant origin either as starter (Klaenhammer et al., 2002) or as NSLAB adjunct culture (Poveda et al., 2003;
Milesi et al., 2008). Different studies have reported the use of mesophilic NSLAB as potential adjunct in cheese
making and most of them, if not all, have been conducted with strains originating from good-quality mature
cheeses or raw milk. To our knowledge, no studies have dealt with non-starter L. plantarum strains from non-
dairy origins as adjunct in cheese manufacture. The objective of this study was to assess the technological
properties of non-starter L. plantarum, L. paraplantarum and L. pentosus strains isolated from different sources
and their use as adjunct cultures in cheese making. For that purpose, the strains (previously selected on the basis
of their stress response patterns, Parente et al., 2010, submitted) and peptidase pattern were tested in miniature
Cheddar-type cheeses to evaluate their influence on the chemical composition, biochemical properties and
proteolysis of cheese. After that, three strains with interesting characteristics from a technological point of view
were selected and tested as adjunct in the manufacture of a pilot -scale Cheddar cheese.
2.1 Strains
Lyophilized Lactococcus lactis subsp. cremoris and L. lactis subsp. lactis (Chr. Hansen, Horsholm, Denmark)
were used as a starter culture in the manufacture of miniature Cheddar cheese making. Adjunct cultures of L.
plantarum MTD2S (from sourdough), 1069 (from sourdough), 38AA (from cassava), UBS3 (from wine), P1.5
(from olives brine), L. plantarum subsp. argentoratensis DK022 (from Sour Cassava) and C17 (from
Caciocavallo cheese), L. pentosus 5TP (from olives water fermentation), L. paraplantarum MTG30L (from
Cornetto di Matera bread) and B7N26 (from Caciocavallo cheese) strains were obtained from the culture
collection of the Dipartimento di Biologia, Difesa e Biotecnologie Agro-Forestali, Universit degli Studi della
Basilicata, Potenza, Italy. The isolates were cultivated (1% w/v) in MRS broth (Oxoid Ltd., Basingstoke,
Hampshire, England) for 16 h at 30 C and added to the milk at level of 10
5
cfu ml
-1
.
2.2 Miniature Cheddar cheese model
Raw milk was obtained from CMP Dairy, Cork, Ireland and pasteurized at 63C for 30 min. Miniature Cheddar
cheeses were manufactured in aseptic conditions from 200 ml of batch-pasteurized milk by the procedure of
Shakeel-Ur-Rehman et al., (1998) with some modifications. Twelve miniature (20g) Cheddar cheeses (six
cheeses for each adjunct culture strains) were prepared in a laminar air-flow unit using sterile utensils on each
cheese-making day. Cheeses were vacuum packed and ripened at 8 C for up to 90 days. Microbiological counts
were performed in duplicate after 7, 14, 30, 60 and 90 days of ripening. Starter population was determined on
LM17 agar (Merck, Darmstadt, Germany) after incubation at 30C for 3 days. The adjunct cultures were
enumerated on LBS agar (Becton, Le Pont de Claix, France) after incubation at 30C for 5 days under anaerobic
conditions, while NSLAB were enumerated on Rogosa agar (Merck) after incubation at 30C for 5 days.
2.3 Gross composition of cheeses
The pH was measured in duplicate throughout cheese ripening at 7, 14, 30, 60 and 90 days with a pH meter
while samples of 90-days-old cheeses were analyzed in duplicate for moisture, salt, and nitrogen content was
determined by the macro-Kjeldhal method as described in Milesi et al. (2008).
2.4 Assessment of proteolysis
Proteolysis was monitored by measuring the percentage of total N soluble at pH 4.6 (pH 4.6-SN) on 90-day-old
cheeses according to the method of Kuchroo & Fox (1982). Peptide profiles of soluble fractions of the pH 4.6-
SN on 60 and 90-day-old cheeses were determined by reverse-phase HPLC using a Varian System (Varian
Associates Inc., Walnut Creek, CA, USA) and the assay conditions as described by Poveda et al. (2003). Casein
degradation was assessed by electrophoresis in polyacrylamide gels (UREA-PAGE) (12.5% T, 4% C, pH 8.9) on
14 and 90-day-old cheeses using a Protean II XI vert ical slab-gel unit (Bio-Rad Laboratories Ltd., Watford,
Herts., UK) according to the method of Andrews (1983) with modifications.(data not shown). Degree of
hydrolysis values were quantified with the o-phthaldialdehyde assay (OPA) (Church et al., 1983) and the
trinitrobenzene-sulphonic acid method (TNBS) (Adler-Nissen, 1979). In the latter case a calibration curve was
prepared using leucine (Leu, Sigma) as standard (range 0.0-1.0 mmol/ L of Leu), and results were expressed as
milligrams of Leu per gram of cheese.
2.5 Statistical anal yses
All statistical and graphic analyses were performed using Systat 10.0 for Windows (SPSS, Chicago, IL).
3.1 Cheese composition
Compositional analysis at 90 d for all the cheeses is shown in Table 1. The values obtained were within the
range typical for Cheddar cheese. All the cheeses had similar composition compared with the control, but some
15
th
35
15
th

differences were observed in cheese G (made with L. plantarum 1069 strain) that showed lower moisture values
and slightly higher S/M and soluble nitrogen content. There were not big differences in the pH values throughout
the ripening, with some exceptions at the end of the maturation, in particular in cheeses C, E, F, and G that
showed the highest pH values. Those cheeses also reported quite higher levels of absorbance for OPA assay in
the determination of the proteolytic act ivity.

Table 1 Microbial counts, pH values and gross composition of 90-days-old miniature Cheddar-type cheeses
1

LM17 Rogosa LBS pH Moist ure OPA S/M Prot ein SNDW
log (cfu/g) log (cfu/g) log (cfu/g) (%) (abs.340 nm) (%) (%) (%)
CHEESE mean mean mean mean mean mean mean mean mean
(SD) (SD) (SD) (SD) (SD) (SD) (SD) (SD) (SD)
A () 7.63 7.73 6.74 5.10 42.5 0.47 4.16 21.30 16.84
(0.04) (0.04) (0.03) (0.01) (0.2) (0.00) (0.02) (0.20) (0.19)
B ( ) 8.02 8.14 7.99 5.12 43.2 0.52 4.05 22.26 21.09
(0.03) (0.03) (0.03) (0.02) (0.2) (0.01) (0.02) (0.16) (0.36)
C () 7.37 7.87 7.59 5.19 43.9 0.44 4.13 21.40 17.38
(1.65) (0.04) (0.03) (0.02) (0.4) (0.00) (0.02) (0.11) (0.23)
D () 8.13 8.33 8.23 5.10 42.4 0.45 4.23 21.63 16.74
(0.02) (0.04) (0.01) (0.02) (0.2) (0.00) (0.01) (0.16) (0.30)
E ( ) 7.87 7.65 7.47 5.19 41.5 0.50 4.25 22.39 20.29
(0.03) (0.05) (0.03) (0.02) (0.1) (0.00) (0.02) (0.29) (0.24)
F () 7.86 7.65 7.49 5.19 41.5 0.49 4.26 23.40 17.21
(0.03) (0.05) (0.03) (0.02) (0.2) (0.00) (0.02) (0.32) (0.45)
G ( ) 8.16 7.92 7.65 5.19 37.5 0.48 4.36 21.47 20.67
(0.02) (0.05) (0.08) (0.01) (0.3) (0.00) (0.02) (0.22) (0.30)
H () 7.97 8.45 8.05 5.10 43.7 0.44 4.12 23.00 18.56
(0.03) (0.81) (0.03) (0.02) (0.2) (0.00) (0.02) (0.04) (0.75)
I () 8.03 8.37 8.19 5.13 42.5 0.41 4.17 21.95 15.49
(0.03) (0.03) (0.02) (0.03) (0.4) (0.00) (0.02) (0.02) (0.73)
J () 8.57 8.70 8.35 5.07 43.3 0.41 4.16 24.06 14.44
(0.03) (0.04) (0.02) (0.02) (0.3) (0.01) (0.02) (0.04) (0.24)
K ( ) 8.24 8.56 8.00 5.12 42.7 0.43 4.18 21.93 16.41
(0.04) (0.05) (0.04) (0.03) (0.3) (0.00) (0.02) (0.03) (0.23)

1
Means ( SD) of duplicate analyses;
2
Cheese: A = control cheese (), B = experimental cheese made with the addition of L.
plantarum P1.5 ( ); C = L. plantarum UBS3 (); D = L. pentosus 5TP (); E = L. plantarum 38AA ( ); F = L. plantarum
subsp. argentoratensis DK022 (); G = L. plantarum 1069 ( ); H = L. plantarum subsp. argentoratensis C17 (); I = L.
paraplantarum B7N26 (); J = L. paraplantarum MTG30L (); K = L. plantarum MTD2S ( ). S/M = salt in moisture;
SNDW= pH 4.6-soluble nitrogen on dry weight.

Figure 1 Microbial counts of starter lactococci in LM17 agar (a) and non-starter adjuncts lactobacilli in LBS agar (b) in
miniature Cheddar-type cheeses after 7, 14, 30, 60, and 90 d of ripening. The results shown are the means of duplicate
analyses and 3 cheesemaking trials for each treatment. Strains labels are reported in Table 1.

3.2 Microbi ological analyses
In both control and experimental cheeses the starter population grew to similar numbers throughout ripening
(~10
9
cfu/g) (Fig. 1a) suggesting that the addiction of L. plantarum strains did not influence the growth and the
survival of the starter bacteria and that the M17 medium was not as selective as expected, probably leading a
certain growth of NSLAB too. To that purpose, Lane et al. (1997) have considered that lactococcal counts on
M17 medium may be erroneous in cheese made with added lactobacilli, as growth of the latter on that medium
would give rise to colonies that might be mistakenly considered as lactococci. Starter counts decreased almost
1.5 log cycles over the course of ripening in cheeses made with and without adjuncts, exhibiting a similar trend
15
th
36
15
th

in all the cheeses and showing the typical decline during the first month. The development of the non-starter
adjuncts in all cheeses during ripening is shown in Fig.1b. Adjuncts lactobacilli were added to the cheesemilk at
10
5
cfu ml
-1
milk and they grew rapidly during the first week. Init ial counts were around 10
6
cfu g
-1
cheese, then
increased during the first month and remained constant at high levels (~10
8
-10
9
cfu g
-1
cheese) until the end of
the ripening. The control cheese were free of lactobacilli for the first weeks and the lactobacilli counts in the
experimental cheeses were almost 3 log cycles higher than the control even toward the end of the ripening. This
demonstrates the effectiveness of the aseptic work conditions used to avoid contaminations. NSLAB levels
developed in cheeses over ripening on Rogosa agar were comparable (data not shown) to those reported in other
studies (Fit zsimons et al., 2001).

3.3 Assessment of proteolysis
The concentration of free amino acids in the pH 4.6-soluble ext racts of control and experimental cheeses was
determined by using the TNBS method. At 1 and 2 weeks ripening, the concentrations of FAA measured ( Fig. 2)
were more or less similar in all cheeses. Differences
emerged over the ripening. At d 90, cheeses B, E and F
had elevated levels of FAA compared to the control while
cheeses C, G, H, I and J presented levels of FAA lower
than the control. Cheeses D and K showed intermediate
values of FAA. Higher concentrations of FAA in cheeses
containing adjunct lactobacilli has been noted by other
authors (Lynch et al., 1996) attributing this increase to
higher peptidase activity in cheeses made with adjuncts.
The RP-HPLC chromatograms of the pH 4.6-soluble
fraction at 60 and 90 days of ripening were similar for all
the cheeses, although some differences were observed,
especially for peptides eluting between RT 5.1, 17.2, 30
and 38 min. Major quantitative differences were observed
between the chromatograms of the control cheese (a) and
cheese K (b) after 60 and 90 d (Figure 3).
Principal component analysis (PCA) was carried out on
the data from the RP-HPLC chromatograms. The score
plot (Figure 4a) obtained from principal components 1
and 3 showed the greatest variation in all the samples,
according to both cheese treatment and ripening time.
Factor loadings associated with the first and the third
components are also shown in Fig. 4b and 4c. As can be
observed, the loading vectors showed that peaks that
explaining most of the variance are the peptides or group
of peptides eluted at 5.1, 17.2, 28.2, 29.3, 30.4, and 38.1
min, respectively. The small differences in the peptide profiles for all the cheese samples represented certain
variability between cheeses and cheeses -making process that could be attributed to the peptidase activity of the
different adjuncts lactobacilli.

Figure 3 RP-HPLC pseudocromatograms of the pH 4.6-soluble fraction of control cheese (a) made without adjuncts and the
experimental cheese (b) made with the adjunct of L. plantarum MTD2S.
Figure 2 Total free amino acid content during cheese
ripening in miniature Cheddar-type cheeses after 7, 14,
60, and 90 d of ripening. The results shown are the
means of duplicate analyses and 3 cheesemaking trials
for each treatment. Strains labels are reported in Table 1.
Results were expressed as milligrams of Leu per gram of
cheese.

15
th
37
15
th

Large variations in both cheeses composition and proteolysis was recorded among the miniature Cheddar-type
cheese made with the adjunct of different L. plantarum, L. paraplantarum and L. pentosus strains. Since during
cheese manufacture and ripening, complex interactions occur between individual components of the cheese flora
and the environment, elucidation of such interactions would greatly add to our understanding of the cheese
ripening process and would enable a more targeted approach to adjunct select ion for cheese quality
improvement. Based on all the characteristics determined in this work and throughout the RP-HPLC profiles
using PCA of the chromatographic data, it was possible to discriminate cheeses made using different adjuncts
lactobacilli and selected three strains (L. plantarum MTD2S, C17, and UBS3) which are in course of study in a
pilot scale experiment on Cheddar cheese production.

Figure 4 Principal component analysis score for RP-HPLC in all the samples. (a) Score for principal component 1 and 3; Bar
plots of the loading from principal components1 and 3, represented in (b) and (c), are shown on the same scale of the retention
time for PC1 and PC3, respectively.
8. References
Adler-Nissen J (1979) Determination of the degree of hydrolysis of food protein hydrolysates by trinitrobenzenesulfonic acid.
J. Agric. Food Chem. 27: 12561262.
Andrews AT (1983) Proteinases in normal bovine milk and their action on caseins. J. Dairy Res. 50: 45-55.
Banks JM and Williams AG (2004) The role of the nonstarter lactic acid bacteria in Cheddar cheese ripening. Int. J. Dairy
Technol. 57: 145-151.
Blakesley RW and Boezi JA (1977) A new staining technique for proteins in polyacrylamide gels using Coomassie Brilliant
Blue G250. Anal. Biochem. 82: 580-581.
Church FC, Swaisgood HE, Porter DH, Catignani L (1983) Spectrophotometric assay using o-phtaldialdehyde for
determination of proteolysis in milk and isolated milk proteins. J. Dairy Sci. 66: 1219-1227.
Crow V, Curry B, Hayes, M (2001) The ecology of non-starter lactic acid bacteria (NSLAB) and their use as adjuncts in New
Zealand Cheddar. Int. Dairy J. 11: 275-283.
El Soda M, Madkor SA, Tong PS (2000) Adjunct cultures: recent developments and potential significance to the cheese
industry. J. Dairy Sci. 83: 609-619.
Fitzsimons NA, Cogan TM, Condon S, Beresford T (1999) Phenotypic and molecular characterization of non-starter lactic
acid bacteria in mature commercial Irish Cheddar cheese. App. Envir. Microbiol. 65: 3418-3426.
Fitzsimons NA, Cogan TM, Condon S, Beresford T (2001) Spatial and temporal distribution of non-starter lactic acid
bacteria in Cheddar cheese. J. App. Microbiol. 90: 600-608.
Fox PF, McSweeney PLH, Lynch CM (1998) Significance of non-starter lactic acid bacteria in Cheddar cheese. The Austral.
J. Dairy Technol. 53: 83-89.
Klaenhammer T et al. (2002). Discovering lactic acid bacteria by genomics. Antonie van Leeuwenhoek. 82: 29-58.
Kuchroo CN and Fox PF (1982) Soluble nitrogen in Cheddar cheese; comparison of extraction procedures.
Milchwissenschaft, 37: 331-335.
Lane CN and Fox PF (1996) Contribution of starter and adjunct lactobacilli to proteolysis in Cheddar cheese during ripening.
Int. Dairy J. 6: 715-728.
Lynch CM, McSweeney PLH, Fox PF, Cogan TM, Drinan FD (1996) Manufacture of Cheddar cheese with and without
adjunct lactobacilli under controlled microbiological conditions. Int. Dairy J. 6: 851-867.
McSweeney PLH, Walsh EM, Fox PF, Cogan TM, Drinan FD, Castelo-Gonzalez M (1994) A procedure for the manufacture
of Cheddar cheese under controlled bacteriological conditions and the effect of adjunct lactobacilli on cheese quality.
Irish J. Agric. Food Res. 33: 183-192.
Milesi MM, McSweeney PLH, Hynes ER (2008) Viability and contribution to proteolysis of an adjunct culture of
Lactobacillus plantarum in two model cheese systems: Cheddar cheese-type and soft-cheese type. J. App. Microbiol.
105: 884-892.
Ortigosa M, Arizcun C, Torre P, Izco JM (2005) Use of wild Lactobacillus strains in an adjunct culture for a Roncal-type
cheese. J. Dairy Res. 72: 168-178.
15
th
38
15
th

Poveda JM, Sousa MJ, Cabezas L, McSweeney PLH (2003) Preliminary observations on proteolysis in Manchego cheese
made with a defined-strain starter culture and adjunct starter (Lactobacillus plantarum) or a commercial starter. Int.
Dairy J. 13: 169-178.
Ur-Rehman S, McSweeney PLH, Fox PF (1998) Protocol for the manufacture of miniature cheeses. Lait, 78: 607620.
Wouters JTM, Ayad EHE, Hugenholtz J, Smit, G (2002) Microbes from raw milk for fermented dairy products. Int. Dairy J.
12: 91-109.

15
th
39
15
th
Study and development of multiphase systems for new food design
strategies
Sara Da Pieve (sara.dapieve@uniud.it)
Dept. of Food Science, University of Udine, Italy
Tutor: Prof. ssa Maria Cristina Nicoli; Co-tutor: Dott.ssa Sonia Calligaris
This PhD research project has been focused on the development of new food design strategies based on the
exploitation of the ability of amphiphilic molecules to form self-assembled nanostructures. These structures have
shown promising applications in the setting up of foods able to fulfil the increasing consumer demand of
products with health-added value and/or enhanced sensorial performances. The main objectives pursued were the
followings:
the design of multiphase systems able to protect and deliver sensitive bioactive compounds during
formulation, processing and storage of foods;
the development of multiphase systems able to improve nutritional and sensorial properties of food
structure (i.e. to give structure to unsaturated oils in order to replace saturated lipids and/or trans fatty
acids in food formulations).
Studio e sviluppo di sistemi multifasici per nuove strategie di formulazione degli
alimenti
Questa tesi di dottorato ha riguardato lo studio e sviluppo di strategie innovative per la messa a punto di alimenti
funzionali, attraverso lutilizzo di nanostrutture formate da molecole anfifiliche. Queste strutture, infatti, hanno
mostrato promettenti applicazioni per la produzione di alimenti in grado di rispondere alla crescente domanda da
parte dei consumatori di prodotti ad alto valore nutrizionale e/o con migliori caratteristiche sensoriali. I principali
obiettivi perseguiti in questo studio sono stati:
messa a punto di sistemi multifasici capaci di proteggere e trasportare composti bioattivi
particolarmente sensibili negli alimenti,
sviluppo di sistemi multifasici capaci di migliorare le caratteristiche nutrizionali e sensoriali degli
alimenti (ad es. strutturare frazioni lipidiche insature al fine di sostituire grassi saturi e trans-isomeri
nelle formulazioni alimentari).
Key words: self-assembly structures, food design, delivering, structuring.
1. Introduction
Nowadays there is an increasing interest of the food industry on the possibility to design "tailor-made" foods,
which are able to fulfil specific consumer needs. In particular, the attention is mainly focused on foods with
enhanced sensorial performance and/or improved capacity to protect health and well being. Among the food
constituents, flavours and bioactive compounds are generally very unstable molecules which can interact with
oxygen or with other food components loosing, very quickly, their peculiar properties. For this reason, the
possibility to offer the consumers tailor-made foods is strictly related to the development of novel strategies for
food formulation and processing. One of the most promising approaches is the exploitation of the peculiar
properties of some food components at the nanoscale level (McClements, 2007). In particular, the self-assembly
capacity of amphiphilic molecules to form different nano-size structures has been proposed as the most efficient
tool to produce foods really fulfilling what they are designed for. A wide number of different amphiphilic
molecules able to self-assembly and impart structure to multiphase systems have been identified (Pernetti et al.,
2007). Among these structuring agents, saturated monoglycerides, ceramides and mixtures of phytosterols and
oryzanols are considered to be those with high potentials in the food industry. In particular, monoglycerides have
attracted considerable research attention for their ability to form self-assembly structures in both lipid and
aqueous phases (Sagalowicz et al., 2006). Among different self-assembly phases, the lamellar phase has been
indicated as one of the most promising for food applications. This is mainly due to the fact that the lamellar
phase, leading an increase in the viscosity of the solvent phase through the formation of a gel-like network, can
be exploited to give structure to some food products. The gel network characteristics can be modulated by
changing the polarity of the solvent. In particular, in the presence of both hydrophilic and lipophlic phases it is
possible to obtain hydro-gel systems in which monoglycerides are structured into lamellas in the interface
between the two phases (Calligaris et al., 2010). On the contrary, in the presence of a lipophilic phase
monoglycerides form organo-gel systems made of inversed lamellae (Rogers et al., 2009). Thanks to this
15
th
40
15
th
peculiar characteristic, monoglyceride gels have been proposed to solidify unsaturated oils, in order to obtain
plastic structures similar to hardstock fats without the attendant high levels of trans- and saturated fatty acids.
Another interesting application is the use of monoglyceride self assembled structures as carrier for the delivery
of bioactive compounds, such as carotenoids and essential fatty acids or aroma compounds. The success of this
kind of application depends on the capacity to incorporate the potential guest molecules in appropriate amounts
and to disperse them inside the food matrix without loosing their expected functionality (McClements et al.,
2007). In such context, key factors are expected to be the physical properties, such as the melting point and the
polymorphic crystal type, of the structures exploited in the system. It should be remembered that
monoglycerides, being lipid molecules, have the peculiarity to crystallize in different forms (polymorphism)
depending on their chemical composition and crystallization conditions. At present very few information are
available on physical properties of lipid small-size structures, and how these properties affect the chemical
stability of the lipid phase (solvent included) and of the embedded molecules (Sonoda et al., 2006). Moreover,
the sole assemble of the nanoscale delivery systems it not enough to guarantee their performances into foods. In
fact, the development of such systems should take into account the chemical, physical and sensorial properties of
the food in which they could be incorporated. In addition, the processing and storage conditions adopted during
food production and consumption should also be carefully considered.
The objective of this PhD thesis has been focused on exploiting the self-assembly properties of different
amphiphilic molecules to produce hydro- and organo-gels to be applied in the production of foods with health-
added value and/or enhanced sensorial performances (Fig.1).
In particular, the present communication
reports the main results of the activities
related to the study of monoglyceride
organogel systems as follows:
1. Preparation and characterization of
monoglyceride organogels
2. Evaluation of the effect of shearing
conditions on the formation of the
monoglyceride organogel structure
3. Assessment of the stability of
sensitive compounds incorporated in
the monoglyceride organogels.
Some of the research activities here reported have been carried out in the Food Department of the University of
Guelph in Canada.
Monoglyceride organogels preparation
Myverol
TM
saturated monoglycerides (fatty acid composition: 1.4 % C14:0, 59.8 % C16:0, 38.8 % C18:0;
melting point 68.05 0.5 C), supplied by Kerry Bioscience (Bristol, UK) was used. Cod liver oil, purchased at
a local pharmacy, was chosen as target lipid matrix to prepare the organogels. Cod liver oil added to increasing
amounts of monoglycerides ranging from 0 to 9 % (w/w) was prepared by mixing the ingredients at 80 C in a
temperature-controlled water bath. The samples were then crystallized till reaching 20 C at a rate of 15 C min
-1
during which shear ranging from shear rate of 0 (static conditions), 100, and 1000 s
-1
. The shear was applied
using a laminar shear crystallizer (Maleky et al., 2008). The OGs were examined after 24 hours of storage at 20
C to ensure that adequate time was given to anneal the network giving the maximum structure.
Analytical determination
The rheological properties of the different systems were evaluated using an AR 1000 Rheometer (TA
Instrument, Bew Castel, DE, USA) equipped with a 40-mm flat plate geometry. The organization of
monoglycerides in the systems was studied by Synchrotron X-ray diffraction techniques. The pattern were
recorded at the X-ray Diffrection beam line 5.2 at the Synchrotron Radiation Facility Elettra (Trieste, Italy). The
organogel microstructure was observed using a 20X objective with a polarized light microscope (Leica, Micro-
system Canda Inc., Richmond Hill, Canada) equipped with a CCD camera (Q-imaging Retiga, Burnaby, BC,
Canada), while the organogel nanostructure was characterized by a Cryo-SEM system (Hitachi S-570, Tokyo,
Japan) and images were capture digitally using the Quartz PCI imaging software (Quartz Imaging Corp.,
Vancouver, BC, Canada). The oil binding capacity of the organogels were determined considering the
percentage of oil released from the samples after centrifugation at 10000 rpm for 15 minutes. To evaluate the
organogel oxidative stability during storage, the evolution of the peroxide value (PV) and the propanal formation
in the sample head space were followed. The peroxide values of the samples were carried out according to the
Fig. 1: Overall PhD topics.
Structuring agents:
-saturated monoglycerides
-mixtures of fitosterols and -
oryzanol
Multiphase systems:
-Oil/water gels
-Water gels
-Oil gels
Sensory quality improvement:
-modulation of aroma release
Nutritional quality improvement:
-substitution/reduction of saturated f.a.
-protection of bioactive compounds
(carotenoids, PUFA)
Hydro-gels
Organo-gels
15
th
41
15
th
European Official Methods of Analysis (1991). Static head-space analyses were carried out by the mean of a
HGRC Mega 2 Series gas chromatograph (Fisons Instrument, Milan, Italy) equipped with a flame ionization
detector (Fisons HWD Control, Fison Instruments, Milan, Italy). The separation was done by using a capillary
column DB1 (length: 30 m, internal diameter: 0.535 mm, statior phase thikness: 5 m) (J and W Scientific Inc.,
Folsom, CA, USA). Analytical determinations were performed at 20 C. Each sample was analyzed in triplicate.
5.1 Preparation and characterization of monoglyceride organogels
Figure 1 shows the visual appearance of organogels (OG)
containing increasing amount of monoglycerides (MG) from
0 to 9 % (w/w) and crystallized under static conditions.
Since MG contents lower than 5 % were not sufficient to
structure the oil, OG systems made of 5, 6 and 9 % of MG
were considered.
Table 1 shows the rheological parameters of the systems. In
all cases, G is higher than G confirming the gel-like
behaviour of these structures. Moreover, as expected,
increasing the percentage of the structuring agent, the
rheological parameters also increase.
Tab. 1: Rheological parameters of 5, 7 and
9 % (w/w) MG organogels.
a,b,c
: means with the common letter in the same line are not
significantly different (p>0.05).
To have deeper insights on the OG micro- and nano-structure, the systems were observed with a polarized light
microscope and a Cryo-SEM system. All systems showed the same microstructure consisting of a network of
micro-crystalline platelets embedded in the liquid oil (Fig. 2a). Electron micrographs confirmed the presence of
platelet crystals with an average length of roughly 50 nm (Fig. 2a1). MG molecules, in fact, once introduced into
organic liquids are able to self-assemble into inverse bilayer structures that sub sequentially grow in lamellar
platelets microstructure. These structures lead to the formation of a three dimensional network that immobilize
the liquid oil via capillary forces (George et al., 2006).

Fig. 3: Polarized light microscope image (a) and Cryo-
SEM image (a1) of a 5 % MG organogel crystallized
under static condition.
The molecular organization of MG in the OG lamellar microstructures is still a matter of discussion. To try to
clarify this point, Syncrhotron X-ray diffraction analyses were performed. Figure 3 displays the XRD pattern of
a 5 % MG organogel. Similar XRD patters were recorded for the systems at 7 and 9 % of MG (data not shown).
Fig. 4: X-ray diffraction pattern recorded at 20 C
of a 5 % (w/w) MG organogel.
The sample shows broad diffraction peaks at 4.50 and 24.20 . The broadness of the peaks is due to the
amorphous scattering associated with the liquid-state triacylglicerol molecules. The single diffraction peak in the
small angle region corresponds to the interplanar distance of MG bilayers. These results indicate that the system
OG 5% OG 7% OG 9%
G 10
3
12.22 1.16
a
55.37 2.28
b
80.38 5.20
c
G 10
3
2.79 1.11
a
15.40 2.02
b
21.9 3.17
c
OG 6% OG 5% OG 9% Cod Liver Oil OG 4%
0
1000
2000
3000
4000
5000
6000
7000
8000
9000
10000
0.00 0.50 1.00 1.50 2.00 2.50 3.00 3.50
q (
-1
)
X
-
r
a
y

i
n
t
e
n
s
i
t
y

(
c
o
u
n
t
s
)
2.42
46.1
8.1
11.8
15.8
3.77
4.09
3.88
4.33
4.45
4.53
Fig. 2: Visual appearance of cod liver oil and OG
with a MG content from 4 to 9 % (w/w).
15
th
42
15
th
consist of lamellae with an approximate width of 46.4 . In the wide angle region, is evident a main peak
corresponding to a distance of 4.55 with a number of other peaks along the shoulder of the amorphous band.
These peaks are due to the in-plane ordering of monoglyceride aliphatic chains into the phase, as suggested by
Chen et al. (2009).
Results obtained in this part of the study allowed to better understand the MG organogel structure at nano-,
micro- and macro level. In particular, it is possible to conclude that the macroscopic characteristics of the OGs
can be attributed to the presence of a gel network of MG molecules that entraps the oil phase. Inside this network
the MGs are crystallised to form inversed bilayers with a width of 46.4 .
5.2 Evaluation of the effect of shearing condition on the formation of the MG organogel structure
Since the processing conditions are expected to greatly affect the OG structure, the impact of shearing conditions
on the OG structure was investigated. Figure 4 shows respectively the micro and nanostructures of a MG
organogel crystallized applying a shear rate of 100 s
-1
and those of an organogel crystallized at 1000 s
-1
.
Fig. 5: Polarized light microscope and Cryo-SEM images of
5 % MG organogels crystallized at 100 s
-1
(respectively b, b1)
and 1000 s
-1
(respectively c, c1).
The application of shear appears to hinder the formation of well-organized platelet- structure (Fig. 2), instead
promoting the random clustering of crystals domains into spherical assemblies and the formation of a structure
composed of a random distribution of crystal clusters. This may be attributed to the fact that the introduction of
the shear favours the nucleation over than the crystal growth. The macroscopic result is the formation of a weak
gel network as clearly evidenced by the rheological properties of the system (Tab. 2). In fact, sheared OG are
characterized by dramatically lower mechanical properties respect to those of statically-crystallized OG. On the
contrary, the rheological properties of the sheared systems do not exhibit a dependence on the shear rate.
It is interesting to note that, the molecular organisation of MG inside the gel network of sheared samples is
comparable to that of statically crystallized ones, as indicated by X-ray analyses (data not shown).

The oil binding capacity (OBC) of the samples confirmed the effect of the shear on OG structure (Tab. 3). In
fact, increasing the shear rate applied during crystallization, the amount of oil expressed also increases, resulting
in a lower ability of the system to entrap oil. These results confirm the presence of networks with different
strength among differently processed samples: strong gel network in the statically-crystallized OG and weak in
the shear-crystallized OG.
These results confirm the key role of processing on the OG structure. Applying different shearing condition it is
possible to modulate the OG structure characteristics. From a technological point of view, this information may
be exploited to engineer organogels structure and thus obtain tailored functionalities for specific food
applications.
Shear rate (s
-1
) G 10
2
G 10
2
100 1.55 0.04
a
0.6 0.01
a

1000 2.12 0.23
a
0.5 0.02
a

Shear rate (s
-1
) Oil released % (w/w)
0 19.17 0.9
a
100 37.46 0.6
b

1000 42.06 1.0
c
Tab. 2: Rheological parameters of 5 % (w/w) MG
organogels crystallized at 100 and 1000 s
-1
.
a,b,c
: means with the common letter in the same line are not
significantly different (p>0.05).
Tab. 3: Percentage of oil released after centrifugation as
a function of the shear rate applied during OG
crystallization.
a,b,c
: bars with the same are not significantly different (p>0.05).
15
th
43
15
th
5.3 Assessment of the stability of sensitive compounds incorporated in the monoglyceride organogels
In order to evaluate the possibility to use OG as delivery and protecting system of sensitive compounds suffering
oxidation, the kinetic of oil oxidation inside a 5 % MG organogel statically crystallized was followed at 20 C.
Figure 5a shows the evolution of the peroxide value in the OG and in unstructured cod liver oil. No differences
were appreciable in the two systems. These results indicate that the structural characteristics of the OG dont
influence the first steps of the oxidative reaction probably because the presence of a MG network does not affect
the oxygen accessibility inside the system.
Fig. 6: Peroxide value (a) and propanal in the headspace (b) of 5% MG organogel statically-crystallized and non structured
cod liver oil stored at 20 C.
Different consideration can be made for the propanal evolution in the headspace (Fig. 5b). In this case the
organogel is characterized by a lower propanal formation rate. This behaviour could be explained considering
the organogel structure as a physical hurdle to the molecular mobility. Since propanal is a secondary oxidative
product and its formation depends on the possibility of collision between the hydroperoxide molecules, it can be
hypothesized that the presence of a MG network, by reducing the molecular mobility of the system, could slow
down the kinetics of the final steps of oxidation. In the light of these results, the protection of oxidable molecules
inside the OG can be really effective only when the oxidation kinetics are under the control of molecular
mobility.
Results obtained in this PhD thesis highlight that new food design strategies can be achieved exploiting the self
assembly properties of amphiphilic molecules. In particular, food grade nanostructured materials, like saturated
monoglycerides, can be applied to formulate systems with tailored properties. For instance, the development of
new organogels appears to be an interesting strategy for the production of novel health-value added foods. The
future perspectives would be to asses the performances of these structures in lipid containing foods, such as
bakery and confectionary products.
7. References
Calligaris S., Da Pieve S., Arrighetti G., Barba L. Effect of the structure of monoglyceride-oil-water gels on aroma partition.
Food Research International, 43,671-677, 2010.
Chen CH, Terentjev EM (2009). Aging and Metastability of Monoglycerides in Hydrophobic Solutions. Langmuir, 25, 12,
6717-6724.
European Community (1991) Regulation 2568/91. Official Journal of European Community, L. 248.
George M, Weiss RG (2006) Low molecular mass organic gelators, in Molecular Gels. Materials with self-assembled
fibrillar networks ed. by Weiss RG, Terech P, Springer, Dordrecht, pp. 449-453.
Maleky F, Marangoni AG (2008). Process development for continuous crystallization pf fat under laminar shear. Journal of
Food Engineering. 89, 399-407.
McClements DJ, Decker EA, Weiss J (2007). Emulsion-based delivery systems for lipophilic bioactive components. Journal
of Food Science, 72, 109-124.
Pernetti M, van Malssen KF, Flter E, Bot A (2007). Structuring of edible oils by alternatives to crystalline fat. Current
Opinion in Colloid & Interface Science, 12, 221-231.
Rogers MA (2009). Novel structuring strategies for unsaturated fats Meeting the zero-trans, zero-saturated fat challenge:
review. Food Research International, 4, 747-753.
Sagalowicz L, Leser ME, Watzke HJ, Michel M. (2006). Monoglyceride self-assembly structures as delivery vehicles.
Trends in Food Science & Technology, 17, 204-214.
Sonoda T, Takata Y, Ueno S, Sato K (2006). Effects of emulsifiers on crystallization behaviour of lipid crystals in nanometer
size oil-in-water emulsion droplet. Crystal Growth & Design, 6, 1, 306-312, 2006.
0
20000
40000
60000
80000
100000
120000
140000
160000
180000
0 10 20 30 40 50 60
Days
P
r
o
p
a
n
a
l

p
e
a
k

a
r
e
a
Cod liver oil
5% MG organogel
0
10
20
30
40
50
60
70
80
0 10 20 30 40
Days
P
V

(
m
e
q
O
2
/
k
g
)
Cod liver oil
5% MG organogel
a b
15
th
44
15
th
Production and evolution of peptides naturally derived from milk protein
hydrolysis or generated by technological processes: proteomic and bio-
functional characterization
Carmela De Simone (carmela.desimone@unina.it)
Dept. Food Science and Technology, University of Naples Federico II, Portici, Italy
Tutor: Prof. Pasquale Ferranti

This PhD thesis dealt with the proteolysis evolution occurring on milk proteins in vivo by the endogenous
proteases, or by the technological process during milk transformation in mozzarella cheese and in vitro simulated
gastrointestinal digestion of donkey milk, commonly considered an hypoallergenic milk. The proteomic
approach was integrated with bio-functional studies on human adenocarcinoma cell line (CaCo2): evaluation of
cell cycle modulation and antioxidant activity was determined for peptides occurring in vivo and absorption
experiments were carried out for those produced in vitro.

Produzione ed evoluzione di peptidi derivati dallidrolisi delle proteine del latte in vivo o
generati dai processi tecnologici: caratterizzazione proteomica e bio-funzionale
Questa tesi di dottorato ha riguardato lo studio dellevoluzione dei pattern peptidici generati in vivo ad opera
delle proteasi endogene del latte e durante i processi tecnologici di trasformazione del latte di bufala in
mozzarella, nonch dellevoluzione delle proteine del latte di asina, comunemente ritenuto ipoallergenico,
durante la simulazione in vitro della digestione gastrointestinale. La caratterizzazione proteomica stata
complementata da quella bio-funzionale volta a studiare le potenziali attivit biologiche dei peptidi su cellule di
adenocarcinoma del colon (CaCo2) valutandone la modulazione del ciclo cellulare e lattivit antiossidante per
quelli generati in vivo e lassorbimento per quelli prodotti in vitro.

Key words: milk bioactive peptides; proteolysis; proteomics; peptidomics; mass spectrometry; antioxidant;
human adenocarcinoma cell line (CaCo2); donkey milk; genetic polymorphism;
1. Introduction
This communication reports the main results of the following two activities directed to:
A1) characterization of the soluble peptides originated from in vivo proteolysis involved in production of
Mozzarella di Bufala Campana PDO cheese. Peptides extracted from BSW, BWW and BS, were
characterized with the aim to trace the breakdown pathway generating potential bioactive peptides,
starting from raw river BM. Study of functional effect of BSW, BWW, BS and BM peptides on CaCo2
cytomodulatory and antioxidant activity; fractionation of the more bioactive peptide fraction and
explanation of the molecular mechanism involved in the response of CaCo2;
A2) proteomic analysis of donkey protein fraction; study of post-translational modifications and genetic
polymorphism. Characterization and antioxidant activity of in vivo peptides produced by action of
endogenous proteases on linolenic acid induced oxidative damage by H
2
O
2
.

2. Milk proteins bioactive peptides
The identification in foods of peptides with a bioactivity has a great interest in food science. Milk proteins are a
source of biologically active peptides (Meisel, 2005), which remain inactive until they are released in
consequence hydrolysis of either gastrointestinal digestion or food processing (Meisel and FitzGerald, 2000).
Once bioactive peptides are liberated, they may act as regulatory compounds with hormone-like activity. The
peptides generated from milk proteins can influence a wide number of physiological processes as they exhibit
antibacterial, immunomodulating, antihypertensive, antithrombotic, cytomodulant and opioid activities (Silva
and Malcata, 2005). A number of studies has been carried out on peptides produced in vitro from bovine milk
proteins, mainly by use of purified proteases or microbial cell-wall proteinases; on the contrary, peptides
naturally occurring in milk or in cheese whey have not been exhaustively characterized, and their potential
bioactive properties have not been studied so far. There is a great need for methods able to identify the
production and evolution of bioactive peptides from milk proteins as a consequence of either endogenous milk
proteases of technological process. Two exemplary cases are the production of peptides during cheese making
15
th
45
15
th
process as occurs in Mozzarella cheese PDO and the presence in vivo in donkey milk peptides.
In the first case, no study has been carried out on peptides in buffalo milk during technological transformation.
The need for the characterization of peptide fraction in buffalo milk arises from the fact that the production of
PDO cheese has recorded a strong increase in Regione Campania in the last years. Whey has to be considered as
a by-product in milk processing and, according to the Italian legislation (D. L. 22/97), it is a special waste and
its disposal engraves highly on costs. Three kinds of whey are produced: sweet whey, formed immediately after
or simultaneously to milk clotting; waste whey the acid whey formed through curd maturation; scotta, the
liquid fraction remaining after removal of thermally coagulated whey proteins for the production of ricotta
from the sweet whey. After separation of the valuable whey proteins, the residue remaining is putrescible and
has high chemical oxygen demand. On the other hand, during the production of Mozzarella, it is expected that a
large number of peptides can be released in the whey, for the combined proteolytic effect on milk caseins
endogenous enzymes (plasmin, cathepsin D), rennet enzymes (chymosin, pepsin) and lactic acid bacteria exo-
and endo-peptidases. The mild manufacturing conditions employed in production of Mozzarella di Bufala cheese
could effectively preserve the bioactive molecules in whey, particularly in sweet whey and waste whey.
In the second way, no study has been carried out on peptides occurring in donkey milk both by action of
endogenous proteases and by simulation of the in vitro human complete digestion with the aim of clarifying its
hypoallergenicity. At this regard, recently, donkey milk intake showed a positive effect in diet therapy of cows
milk protein allergy (CMPA) patients (Salimei et al., 2004). Anyway, compared with bovine milk, the
characterization of donkey milk caseins is at a relatively early stage progress, and only limited data are related to
its genetic polymorphism. The main studies available on mammal milk proteins (caseins and whey proteins) are
focused on the four ruminant species (cow, water buffalo, sheep and goat) because of the worldwide availability
and use of their milk or derived products (fermented milks, cheeses or dry powders) in human diet. From a
quantitative point of view, the donkeys milk protein fraction is more similar to human milk than bovine
particularly for the higher lactose content and the lower protein content compared to cows milk. The available
knowledge on donkey milk protein structures mainly concerns the primary structure and genetic polymorphism
of !-La, "-Lg I and II, lysozyme and SA (serum albumin). Regarding donkey casein composition, the entire "-
CN (Cunsolo et al., 2009a) and !
s1
-CN sequences has been determined (Cunsolo et al., 2009b).
These two above cases have been studied in this PhD thesis project as models of important food supplements for
their nutritional and economical significance.
In this PhD thesis the experimental procedure was set up by performing in sequence the following tests, that are:
i) peptides extraction from BM, BSW, BWW and BS with a 3-KDa cut-off membrane, purification by SPE
(Solid Phase Extraction) and characterization with RP-HPLC, LC/ESI-MS and MALDI-TOF-MS; ii) cell
culture, cell proliferation assay and antioxidant effect of BM, BSW, BWW and BS peptide extracts; iii)
mithocondrial oxidative stress, determination of heat shock proteins (Hsp 70 and Hsp 90) expression, cell cycle,
differentiation, production of ceramides and senescence for BWW peptide sub-fractions. These effects were
investigated on CaCo2 cell line in which oxidative damage was induced with hydrogen-peroxide (H-CaCo2), to
simulate the response of intestinal cells which are constantly exposed to luminal oxidants during food digestion;
iv) peptides extraction from donkey milk samples with a 3-KDa cut-off membrane, purification by SPE (Solid
Phase Extraction) and characterization with MALDI-TOF-MS; v) antioxidant activity of peptides extracted from
donkey milk with TBARs test on linolenic acid and on linolenic acid induced peroxidation by H
2
O
2
; vi)
proteoma analysis of donkey milk using one-dimensional and 2-DE profiles, with structural MS analysis;
The proteomic and biological assay were performed as previously described: for A1 (De Simone et al., 2009a;
De Simone et al., 2010); A2 (De Simone et al., 2009b; Chianese et al., 2010).
5.1 Characterization of the soluble peptide produced from in vivo proteolysis during production of
Mozzarella di Bufala Campana cheese
The proteolysis of milk proteins during the production of Mozzarella di Bufala Campana PDO cheese is the
result of a complex series of events because of the combined action of native or endogenous milk proteases, milk
clotting enzymes, starter culture and contaminating microflora. During the maturation of curd under whey,
proliferation of bacterial microflora results in a rapid acidification of whey and in a prominent secondary
proteolysis performed by endo- and exo-cellular peptidases and proteinases. Accordingly, we found that
composition of low-molecular-mass peptides in BWW was highly heterogeneous compared to BM (Fig 1) with a
large number of different oligopeptides. Thermal treatments also influence the peptide composition in BS, by
activating or more likely inhibiting the activity of peptidases and proteases.
15
th
46
15
th

Figure 1 MALDI TOF mass spectrum of the low molecular mass peptide fraction extracted from river buffalo raw milk
(BM). In the insets the peptides derived from the main fragments !-CN f193209 and "s1-CN f123 are
schematised.

Only exposure of H-CaCo2 cells to BWW resulted in a 43% reduction in cell proliferation (Fig 2a) and
decreased mitochondrial superoxide CaCo2 anion production analysed by FACS. The adduct mean fluorescence
intensity decreased from 6.2% (H-CaCo2 cells) to 3.7% with BWW peptide extract fraction (Fig 2b). To further
investigate the effect of peptide extracted from BWW on cell proliferation, the distribution in each phase of the
cell cycle was determined by flow cytometric analysis of DNA content. As reported in Figure 2c, a significant
reduction (p < 0.05) of cells in S phase and an accumulation in the G1 phase were observed in CaCo2 cells
treated with 0.08 mg/ml of BWW treatment for 24 h. These results suggest that, at the experimental
concentration, BWW peptide extract is able to inhibit cell proliferation, interfere with cell cycle and exert a
possible pro-apoptotic activity in CaCo2 cancer cells.

Figure 2 H-CaCo2 proliferation assay (a). The control sample was constituted by H-CaCo2 cells untreated with the
peptide extracts. Cell proliferation measured in treated samples was expressed as percent increase (proliferative
effect) or decrease (antiproliferative effect) compared with that of the control sample, assumed as 100%. Flow
cytometry analysis of oxidative stress in H-CaCo2 after incubation with BM, BSW, BWW and BS (b). The control
representedH-CaCo2 cells untreated with peptide extract. BM and BWW effects on G1 and S phase of H-CaCo2
cell cycle (c). All experiments were performed on triplicate cultures and data are the mean SD of three
experiments.
Reiteration of biological assay on H-CaCo2 with BWW simplified sub-fractions obtained by RP-HPLC (Fig 3a)
allowed us to demonstrate that only a purified peptide sub-fraction (f3) exherted an antiproliferative effect higher
than BWW (Fig 3b). f3 induced a reduction of mitochondrial superoxide anion with subsequent decrease in heat
shock protein 70 and 90 expression. After 24h of f3 treatment we observed a decrease of mitochondrial
superoxide anion level and a subsequent reduction of Hsp 70 and 90 expression in survived H-CaCo2 cells. It is
well known that CaCo2 cell lines constitutively express high levels of Hsp 70 and 90 even under non stress
conditions, which is at the basis of their high resistance to chemical agents. The lowered Hsp expression induced
by f3 treatment made these cells significantly more sensitive to the injurious effects of the oxidant agents.
Moreover, we observed a 5-fold decrease in cyclin A expression and cell cycle arrest in G1/G0 phases. These
responses were associated with increased activity of alkaline phosphatase and beta-galactosidase, markers of
differentiation and senescence respectively. At this stage, mass spectrometry analysis identified sphngolipid
molecules, including ceramides and cerebrosides in the cell culture media. It is well accepted that ceramides
b) c)
a)
15
th
47
15
th
function as a second messenger in cells and the increase in their intracellular concentration in response to
extracellular signals induces cell arrest and inhibition of growth in cancer cells. We found that f3 treatment
induces increased secretion of ceramides which resulted in cell cycle arrest, differentiation, and in subsequent
accelerated senescence cell death in H-CaCo2.

5.2 Proteomic and peptidomic characterization of donkey milk samples
The heterogeneity of donkey caseome was investigated using a proteomic approach, based on electrophoresis
and MS analysis. These combined methodologies allowed the contemporary identification of donkey !s1, !s2,
and" #-CN with their related heterogeneity due to phosphorylation (!s
1
-, !s
2
"- and" #-CN) and incorrect splicing of
RNA in mRNA (deleted forms of !s
1
-CN and #-CN). In the case of !s
1
-CN, for the first time, the primary
structure of the expressed protein, corresponding to the only available donkey !s
2
-CN cDNA sequence, was
determined. Furthermore #-CN was found in homozygous and heterozygous state for the occurrence of genetic
#-CN variants having more one amminoacidic substitution compared to the common #-CN phenotype showing
for the first time the occurrence of a genetic polymorphism at the casein locus of #-CN.
The donkey milk peptides (DMPs) were individually characterized by MALDI-TOF. Briefly, we ascertained
that: a) #-cn produced numerous peptides caming from the entire zone 40-55 and from its C-terminal sequence
beginning from the precursor peptide f176-201; b) in 6 DMPs peptides coming from !
s2
-cn have been identified
and among them caseinophosphopeptides; in 1 DMP have been identified five peptides produced from !s1-cn;
no information were reported for peptides produced from k-cn because the primary sequence have not been fully
acquired. The antioxidant activity evaluated as inhibition of lipid peroxidation by TBARS test allowed us to
conclude that: DMPs have a pro oxidant activity in wild type condition compared to control, while in oxidation
stress induced by H
2
O
2
, same DMPs express an higher antioxidant activity compared to control. Currently, we
have no information about the molecular mechanism involved in the different quantitative production of MDA
mediated by DMP. Probably, as every antioxidant including vitamin antioxidants, DMP could react as a redox
(reduction-oxidation) agent, protecting against free radicals in some circumstances, promoting free radical
generation in others. In particular, DMP has an anti-oxidant function in vitro only when molecules with a pro-
oxidant action as H
2
O
2
are concomitantly presents.
CaCo2 cells are remarkably resistant to injury by radiation and systemic, immunological and chemotherapeutic
agents. The lowered Hsp expression induced only by purified BWW peptide extracts treatment, made these cells
significantly more sensitive to the injurious effects of the oxidant agents. This means that the production of
peptides with potential bioactivity occurs mainly in BWW. This finding might also envisage future applications
of the active peptide fractions for the development of nutraceuticals in diets aimed to increase the efficacy of
drugs for treatment of gastrointestinal cancer using a by-product in milk processing as BWW.
Moreover, the combined methodologies applied in this study were able to disclose the heterogeneity of each
donkey casein fraction due to post-translational phenomena, as well as the occurrence of polymorphism at #-CN
locus. These results may be useful when programming breeding strategies for preservation and selection of
donkey biodiversity, aimed to production of donkey milk for human consumption. In fact, the variability
associated with genetic polymorphism complemented with a major or minor complexity in the expression of
single casein components may influence qualitative and quantitative donkey milk composition and, as a
consequence, its allergenic properties.
Figure 3 RP-HPLC fractionation of the 3
kDa-permeate obtained from BWW (a). Each
peptide fraction was collected at 10 min time
intervals and termed with f followed by a
number. Cell proliferation assay (b) of H-
CaCo2 treated for 24h with different RP-
HPLC sub-fractions (f1-f5) of BWW. Cell
proliferation was expressed as percent
compared with the control. Each
experimental value is the mean of three
different determinations.

15
th
48
15
th
7. Nomenclature
BM buffalo milk; BSW, buffalo sweet whey; BWW, buffalo waste whey; BS buffalo scotta; CaCo2, human
epithelial colon cancer; H-CaCo2, human epithelial colon cancer treated with H
2
O
2
; f3, purified peptide
subfraction from BWW; RP-HPLC, Reversed Phase High Performance Liquid Chromatography; ROS, reactive
oxygen species; PDO, Protected Denomination of Origin; Hsp, heat shock protein; SA-!-gal, senescence
associated #-galactosidase activity; HE, Hydroethydine; MALDI-TOF MS, Matrix Assisted Laser
Desorption/Ionization Time Of Flight Mass Spectrometry; AKT, Serine/threonine kinase; SA-!-gal, senescence
associated #-galactosidase activity; PI3-K, Phosphoinositide 3-kinases; p-GSK-3, p-Glycogen synthase kinase;
8. References
Meisel H (2005) Biochemical properties of peptides encrypted in bovine milk proteins. Curr. Med. Chem. 12:
19151919.
Meisel H, FitzGerald RJ (2000) Opioid peptides encrypted in intact milk protein sequences. Br. J. Nutr. 84: S27
S31.
Silva SV, Malcata FX (2005) Caseins as source of bioactive peptides. Int Dairy J. 15: 1-15.
Salimei E, Fantuz F, Coppola R, Chiofalo B, Polidori P, Varisco G (2004) Composition and characteristics of
asss milk. Anim. Res. 53: 6778
Cunsolo V, Cairone E, Saletti R, Muccilli V, Foti S (2009a) Sequence and phosphorylation level determination
of two donkey b caseins by mass spectrometry. Rapid Commun. Mass Spectrom. 23: 19071916.
Cunsolo V, Cairone E, Fontanini D, Crescione A, Muccilli V, Saletti R, Foti S (2009b) Sequence determination
of "s1-casein isoforms from donkey by mass spectrometric methods. J. Mass. Spectrom. 44: 1742-1753.
De Simone C, Picariello G, Mamone G, Stiuso P, Dicitore A, Vanacore D, Chianese L, Addeo F, Ferranti P
(2009a) Characterization and cytomodulatory properties of peptides from Mozzarella di Bufala Campana
cheese whey. J Pept Sci. 15: 251-258.
De Simone C, Ferranti P, Picariello G, Scognamiglio I, Dicitore A, Addeo F, Chianese L, Stiuso P (2010)
Peptides from water buffalo cheese whey induced senescence cell death via ceramide secretion in human
colon adenocarcinoma cell line. Mol Nutr Food Res. In press. accepted manuscript
De Simone C, Ferranti P, Stiuso P, Dicitore A, Vanacore

D, Mauriello R, Ramunno L, D'Avino A, Chianese L
(2009b) Identificazione e propriet antiossidanti dei componenti peptidici della frazione azotata non
proteica del latte di asina. 9 CISETA acta.
Chianese L, Calabrese MG, Ferranti P, Mauriello R, Garro G, De Simone C, Quarto M, Addeo F, Cosenza G,
Ramunno L (2010) Proteomic characterization of donkey milk "caseome". J. Chromatogr. A, 1217: 4834-
4840.

15
th
49
15
th
Biopreservation against Listeria monocytogenes:
activity of natural antimicrobial compounds
Federica Di Pasquale (fdipasquale@unite.it)
Dept. Food Science, University of Teramo, Mosciano S.Angelo (TE), Italy
Tutor: Prof. Antonello Paparella
Co-tutor: Dott.ssa Annalisa Serio
In this PhD thesis several isolates of Listeria spp. from meat products were identified and characterized by
molecular methods to determine genotype and serotype. Moreover, an antimicrobial susceptibility test was
conducted for Listeria monocytogenes strains to evaluate the incidence of resistance.
Finally, new strategies of biopreservation with plant extracts and chitosan edible films were evaluated and
applied on several strains selected on the basis of the results of the previous research activities.
Bioconservazione nei confronti di Listeria monocytogenes:
attivit di sostanze antimicrobiche naturali
In questa tesi di dottorato sono stati identificati e caratterizzati, con metodi molecolari, numerosi ceppi di
Listeria spp. isolati da prodotti a base di carne. I ceppi di Listeria monocytogenes sono stati sottoposti anche a
test di suscettibilit a diversi agenti antimicrobici per valutare la presenza e la diffusione del fenomeno
dellantibiotico-resistenza. Infine, alcune strategie innovative nellambito della bioconservazione, come il
trattamento con estratti vegetali e film edibili di chitosano, sono state valutate su ceppi selezionati in base alle
analisi dei risultati ottenuti nelle precedenti attivit di ricerca.
Key words: Listeria monocytogenes, biopreservation, plant extracts, chitosan.
1. Introduction
In accordance with the PhD thesis project previously described (Di Pasquale, 2008), this oral communication
reports the main results of the following activities aimed to:
A1) Identification and molecular characterization of Listeria strains isolated from meat products, using
RAPD-PCR and REP-PCR to discriminate biotypes and to select strains for epidemiological investigations and
for biopreservation studies;
A2) Molecular serotyping and antimicrobial susceptibility testing, to provide an additional tool in
epidemiologic investigations of L. monocytogenes strains in meat products.
A3) Assessment of new strategies for food biopreservation, considering antimicrobial effectiveness and
potential application in food chains. The study included the evaluation of the antimicrobial activity of plant
extracts (A3.1) and of a chitosan edible film (A3.2)
2. Biopreservation against Listeria monocytogenes
The presence of L. monocytogenes in foods is an important issue of public health, because of its characteristics
of resistance and pathogenicity. Beside the consumer hazards, the presence of pathogenic organisms in foods
may also have important economic consequences for a manufacturer, resulting from the recall and withdrawal of
contaminated products (Besse et al., 2006). The food industry constantly investigates new preservation
techniques, due to the increased consumer demand for nutritious, minimally processed and easy-to-handle food
products. Considerable interest has recently been focused on the antimicrobial activity of natural compounds like
plant extracts. Because of the high contents of bioactive compounds, such as phenolics and organic acids, they
are considered a natural and effective alternative to chemical preservatives (Rauha et al., 2000; Puupponen-
Pimia et al., 2001). On the other hand, the use of edible films based on natural antimicrobial polymers like
chitosan, might open up interesting new perspectives in food biopreservation (Coma et al., 2002).
Some natural extracts, such as chitosan, have a broad spectrum of biological effects, whereas others may exert
specific activity toward certain groups of microorganisms. Several reviews suggested that the antimicrobial
activity could be the result of disturbance in several enzymatic systems, but also of interactions with cellular
membranes and that the effectiveness may be influenced by the interactions with food components (libro). For
15
th
50
15
th
UBC 55+rep
finger
1
0
0
8
0
6
0
4
0
finger UBC 55 rep
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
84436
95970
95986
279496
14968
14971
244063
251702/03
6584
54235
65208
244473/03
287835/03
45616
58712
58708
251714
266549
65204
96142
251767
309139/03
251712
65192
318938/03
65164
48961
132101
226181
96139
251708
244152
251756
232687
14956
307663
303743
25611
319215
**2508/04
319484
***319397
2512/04
*319455
*319455/03
45610
309418/03
***319397/03
25644
25685
303733
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
l.innocua
l.innocua
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.monocytogenes
l.innocua
l.innocua
l.innocua
l.innocua
l.innocua
l.innocua
l.innocua
l.innocua
l.innocua
l.innocua
l.monocytogenes
l.monocytogenes
l.innocua
1/2c
1/2a
4b
1/2b
1/2b
1/2b
1/2b
1/2b
1/2b
1/2b
1/2c
1/2c
1/2c
1/2a
1/2c
1/2a
1/2c
1/2a
1/2c
1/2c
1/2c
1/2a
1/2a
1/2a
1/2a
1/2c
1/2c
1/2c
1/2c
1/2a
1/2c
1/2a
1/2b
1/2c
1/2c
1/2c
4b
1/2a
Figure 1:RAPD-PCR and REP-PCR combined cluster
this reason, the evaluation of the spectrum of activity, the interaction with other factors on microbial growth and
the response of microorganisms to different concentrations is of paramount importance for food applications.
A1) A total of 51 isolates were identified by multiplex PCR according to Border et al. (1990). The
characterization was carried out by two molecular typing methods, RAPD-PCR and REP-PCR, to increase the
discriminatory power among Listeria strains.
A2) A broth microdilution method, proposed by the Clinical and Laboratory Standards Institute (CLSI) (Zhang
et al., 2007), was used to evaluate the antimicrobial susceptibility profiles of the isolates against 8 antimicrobial
agents.
Strain serotyping was performed by multiplex PCR, according to Doumith et al. (2004).
A3.1) In our preliminary experimental work, three aqueous plant extracts, blueberry (Vaccinium myrtillus), plum
(Prunus domestica) and myrtle (Myrtus communis L.) were tested for their antimicrobial activity against 45 L.
monocytogenes strains of different origin. A broth microdilution method was used to determine the Minimum
Inhibitory Concentration (MIC). A 3-factor-5-level Central Composite Design was then used to evaluate the
extracts activity in combination with compounds commonly present in some food products, such as lactic acid
and NaCl, where they can constitute a hurdle for bacterial growth.
The most effective extract was also used in in vitro and in vivo studies of inhibition dynamics, carried out during
a research period spent at the Department of Nutrition and Food Science of the University of Vermont (U.S.A.);
at the same time, the recovery of injured or stressed cells, following treatments with sub-lethal concentrations of
extract, was evaluated using two different media: Listeria Repair Broth (LRB) and UVM (Donnelly, 2002).
A3.2) The antimicrobial activity of chitosan (1 and 2%) in 1% acetic acid solution was evaluated. Starting from
in vitro trials, the activity was tested against several strains of Listeria monocytogenes of different serotype,
genotype and source. The effectiveness of a chitosan film prepared by dipping was also investigated on pork
loins, inoculating 3 L. monocytogenes isolates, individually and as a cocktail, stored at 4C in ordinary
atmosphere and under-vacuum. The impact of chitosan on the pH and a
w
of the food product was considered
during the storage time.
The antimicrobial tests were also conducted on 6 strains of Salmonella spp. to compare the activity of natural
extracts and chitosan between Gram positive and Gram negative bacteria.
A1) 51 isolates were identified as 38
L monocytogenes and 13 L.
Innocua. The combined profile
generated by RAPD-PCR and REP-
PCR, shown in Figure 1, evidenced
different biotypes which allowed the
selection of strains for the following
biopreservation studies.
A2) Results obtained by PCR
serotyping, reported in the cluster
for each isolate (Figure 1), indicate
that all the 38 L. monocytogenes
strains belonged to the most
common serotypes: 1/2c (42%),
1/2a (32%), 1/2 b (21%), and 4b
(5%).
The results of the antimicrobial
susceptibility tests are shown in
Table 1. Resistance to one or more
antibiotics was observed in almost
50% of the isolates. In particular,
24% of the isolates showed
multidrug resistance.
15
th
51
15
th
Figure 3: Inhibition dynamics of 4% myrtle on L.monocytogenes cells
Only ciprofloxacin and penicillin were effective against all the isolates, whereas resistance to gentamicin and
tetracycline was the most common (Di Pasquale et al., 2009).
These results are in accordance with literature data (Rodas-Suarez et al., 2006; Conter et al., 2009) and increase
the concern about food-borne antimicrobial resistance as a biological hazard.
In this study, resistance did not correlate statistically with species, serotype and genotype.
A3.1) Evaluation of the antimicrobial activity of
Vaccinium myrtillus, Prunus domestica and Myrtus
communis against Listeria monocytogenes
The results obtained in this research activity (Figure
2.A) demonstrate that myrtle extract was the most
effective, with MIC values generally ranging from 0.5
to 2.0%. Interesting results were also obtained with the
plum extract, although with MIC values from 1 to 4%.
Blueberry was effective only at high concentration
levels, even above 10%. Isolates from the smoked
salmon industry were generally less sensitive, suggesting that resistance to plant extracts may somehow be
related to strain origin (Figure 2.B) (Serio et al., 2010).
Significant differences were observed in the trials carried out with Salmonella spp. strains, which were resistant
to all the concentrations tested for each plant extract. These results agree with those reported in the literature,
suggesting that Gram negative microorganisms can be less sensitive to some natural compounds (Helander et al.,
1998).
Results from CCD, not shown in this presentation, demonstrated that only few strains were able to grow at the
CCD conditions. Our results indicated that myrtle extract activity was boosted by lactic acid and salt; for this
reason, new studies are in progress to define the interaction model among the selected parameters.
Recovery studies, carried out with LRB
and UVM to define the antimicrobial
activity of myrtle, demonstrated the
bactericidal effect of some
concentrations of the extract on
L.monocytogenes cells. In fact, the
inhibition dynamics (Figure 3), together
with the enrichment recovery results,
showed the death of inoculated cells after
24h in in vitro experiments at
concentrations over the MIC. Otherwise,
results of recovery studies at sub-lethal
concentrations of extract highlighted
significant differences between the
media. In fact, LRB was the most
effective to detect both injured and
stressed cells, followed by UVM, with a
lower rate of recovery.
Table 1: Resistant strains for each antibiotic
0 5 10 15
resistant
strains
A B
Figure 2:MIC results for myrtle extract in isolates from meat (A) and fish (B) products
53.8%
33.3%
30.3%
30.3%
6.1%
15.4%
15.4%
15.4%
Recovery study with LRB and UVM
15
th
52
15
th
Figure 5: Chitosan activity against L.monocytogenes cocktail
(ALOA count) in pork loin in ordinary atmosphere.
Figure 6: Chitosan activity in vacuum packaged pork loin
against L.monocytogenes cocktail (Lm), aerobic plate count
(PC) and lactic acid bacteria (LAB).
A3.2) In vitro results (Figure 4, A-B) clearly indicated a good antimicrobial activity of chitosan against L.
monocytogenes strains, that increased with growing chitosan concentrations. The strains showed variable
sensitivity, with a maximum inhibition rate () of 98.90 at
chitosan 2%. Salmonella spp. strains were evidently more
resistant with respect to L. monocytogenes, probably because of
the different cell wall composition.
In the challenge test on pork loins, good results
were obtained in ordinary atmosphere, both for
the single strains and the cocktail, since L.
monocytogenes load was reduced of about 3
Log CFU during 7 days shelf-life. As can be
seen in Figure 5, the antimicrobial effect was
already attained after 3 days and was the same
between chitosan 1 and 2%. The effect of
chitosan was more evident in vacuum packaged
loins. Figure 6 shows that L. monocytogenes, as
well as aerobic plate count (PC) and lactic acid
bacteria(LAB), sharply decreased over time
with 3 Log CFU reduction of the inoculum
after 3 days and 5 Log CFU reduction,
compared with the untreated sample, at the end
of the trial.
Physical-chemical analyses demonstrated that
a
w
values of all the samples did not change
substantially during storage, while pH values of
the samples coated with chitosan remained
below 6.0 during the storage time, while pH of
untreated control reached almost 7.0, likely due
to the spoiling process. The results obtained in
the challenge test were particularly positive,
confirming the bacteriostatic activity of
chitosan against L.monocytogenes both in
ordinary atmosphere and under-vacuum
conditions.
Microbiological data, together with the
interesting effect on pH stability, suggests that
chitosan may be particularly useful for shelf-life extension of fresh meats.
The presence of L. monocytogenes in foods is of particular concern. Even when meat products are subjected to
listericidal treatments during processing, this pathogen may be isolated from finished products usually as a result
of cross contamination or post-processing contamination. Results reported here contribute to the knowledge of
the incidence and the variability of genotypes and serotypes of Listeria spp. strains in meat products. Moreover,
considering that L. monocytogenes isolated from foods is becoming resistant to an increasing number of
Figure 4: Antimicrobial activity of chitosan against L.monocytogenes (A) and Salmonella spp.(B).
(Zheng and Zhu, 2003)
15
th
53
15
th
antibiotics, a continued surveillance on its prevalence and on emerging resistances is important to ensure
effective treatment of human listeriosis.
The positive results from antimicrobial tests with natural compounds confirm the potential application in foods,
in agreement with the increasing demand for reduced-additive and more natural food products. Plant extracts and
chitosan edible film could represent a valid alternative or an additional barrier to common preservative
treatments against Listeria monocytogenes.
6. References
Besse N. G, Audinet N., Barre L., Cauquil A, Cornu M., Colin P., (2006) Effect of the inoculum size on
Listeria monocytogenes growth in structured media. International Journal of Food Microbiology 110, 4351
Border, P.M., Howard, J.J., Plastow, G.S., Siggens, K.W., (1990). Detection of Listeria species and Listeria
monocytogenes using polymerase chain reaction. Letters in Applied Microbiology 1, 158162
Conter M., Paludi D., Zanardi E., Ghidini S., Vergara A., Ianieri A.(2009) Characterization of antimicrobial
resistance of foodborne Listeria monocytogenes International Journal of Food Microbiology 128, 497-500
Coma, V., Gros, M.A, Garreau, S., Copinet, A., Salin, F., Deschamps, A. (2002). Edible antimicrobial films
based on chitosan matrix. Journal of Food Science 67(3):1162-9
Di Pasquale F., (2008) Characterization of Listeria strains isolated from meat products 13th Workshop on the
Developments in the Italian PhD Research on Food Science Technology and Biotechnology, University of Turin,
504-505
Di Pasquale F., Serio A., Chaves Lpez C., Paparella A., (2009).Antibiotico-resistenza di ceppi di Listeria spp.
Isolati dall'industria delle carni. Riassunto delle comunicazioni e dei poster "CISETA 9 Congresso Italiano di
Scienza e Tecnologia degli Alimenti".Milano, p. 4 (Full text is in press in Proceedings of Congress).
Donnelly C., (2002) Detection and Isolation of Listeria monocytogenes from food samples: implications of
sublethal injury. Journal of AOAC International 85, n. 2, 495-500
Doumith M., Buchrieser C., Glaser P., Jacquet C., Martin P. (2004). Differentiation of the major Listeria
monocytogenes serovars by multiplex PCR. Journal of Clinical Microbiology, 42 (8), 3819-22
Helander, I.M., Alakomi, H.L., Latva-Kala, K., Mattila-Sandholm, T., Pol, I., Smid, E.J., Gorris, L.G.M., Von
Wright, A., (1998). Characterization of the action of selected essential oil components on Gram negative
bacteria. Journal of. Agricolture and Food Chemestry. 46, pp 359095
Lopez-Malo Vigil A., Palou E., Alzamora S.M., (2005) Naturally Occurring Compound- Plant Source
Antimicrobials in food- Third Edition, Davidson P.M., Sofos J.N., Branen A.L., 14, 429-505
Puupponen-Pimia R., Nohynek L., Meier C., Kahkonen, M., Heinonen, M., Hopia A., (2001). Antimicrobial
properties of phenolic compounds from berries. Journal of Applied Microbiology, 90, 494-507
Rauha, J. P., Remes, S., Heinonen, M., Hopia, A., Kahkonen, M., & Kujala, T. (2000). Antimicrobial effects of
Finnish plant extracts containing flavonoids and other phenolic compounds. International Journal of Food
Microbiology, 56, 3-12
Rodas-Suarez O.R., Flores-Pedroche J.F., Betancourte-Rule J.M., Quinones-Ramirez E.I., Vazquez-Salinas C.
(2006) Occurrence and antibiotic sensitivity of Listeria monocytogenes strain isolated from oyster, fish and
estuarine water. Applied and Environmental Microbiology 72, 7410-12
Serio A., Di Pasquale F., Paparella A., (2010). Evaluation of theantimicrobial activity of Vaccinium myrtillus,
Prunus domestica and Myrtus communis against Listeria monocytogenes Book of abstracts"Isopol XVII,
International Symposium on problems of listeriosis",Porto, Portugal, 5-8 May 2010, ref C/P 101, p113.
Zhang Y., Yeh E., Hall G., Cripe J., Bhagwat A.A., Meng J. (2006) Characterization of Listeria monocytogenes
isolated from retail foods International Journal of Food Microbiology 113,47-53
Zheng L.Y., Zhu J.F. (2003). Study on antimicrobial activity of chitosan with different molecular weight.
Carbohydrate Polymers, 54, 527-530
15
th
54
15
th

Biotechnological Production of Vanillin from Natural Feedstocks and
Development of New Procedures for the Recovery of the Product.

Paola Di Matteo (paola.dimatteo@unitus.it)
Dept. Agrobiology and Agrochemistry, University of Tuscia, Viterbo, Italy
Tutor: Prof. Maurizio Ruzzi

This PhD research project was focused on innovative biotechnological production and recovery of vanillin and
vanillin precursors. Experiments carried out using whole cells or crude enzyme preaparations demonstrated that:
selective recovery of the product, using macroporous resins, enhances the biological conversion of ferulic acid to
vanillin using resting cells of Escherichia coli FR13 strain; (b) thermal pre-treatment at 55C of crude PVA
acylase from Streptomyces mobaraensis DSM40847 improves the conversion of capsaicin to vanillylamine.

Produzione Biotecnologica di Vanillina da Matrici Naturali e
Sviluppo di nuove tecniche di Recupero del Prodotto

Il progetto di tesi di dottorato riguarda linnovativa produzione biotecnologica e il recupero di vanillina e di
precursori naturali della vanillina. Gli esperimenti eseguiti con cellule e preparati enzimatici grezzi hanno
dimostrato che: (a) il recupero selettivo del prodotto con una resina macroporosa, favorisce la bioconversione
dellacido ferulico in vanillina usando cellule resting del ceppo di Escherichia coli FR13; (b) un pre-trattamento
termico a 55C della PVA acilasi ottenuta dal ceppo di Streptomyces mobaraensis DSM40847 nel preparato
enzimatico grezzo migliora la conversione di capsaicina in vanillilamina.

Key words: vanillin; enzymatic synthesis; microbial acylase; Streptomyces mobaraensis; Escherichia coli;
product recovery; adsorbent resin.
1. Introduction
Nowadays, flavours cover over a quarter of the world market for food additives. Flavouring compounds are
mainly produced via chemical synthesis or by extraction from natural materials. Flavours obtained by chemical
synthesis of starting natural substances cannot legally be labelled as natural and the environmentally unfriendly
production processes are subject to various problems such as lacks substrate selectivity, which may cause the
formation of unwanted compounds thus reducing process efficiency and increasing downstream costs. On the
other hand, the extraction processes from plants is often expensive because of the low concentrations of the
molecule of interest in the raw material. Moreover the cost depends on uncontrollable factors such as plant
diseases and weather conditions. The drawbacks of both methods and the increasing interest of consumers in
natural product, reported in recent market survays, have led to the search for other strategies to produce natural
flavours. Vanillin (4-hydroxy-3-methoxybenzaldehyde) is the most widely used flavoring in food and
pharmaceutical industries. Chemically synthesized vanillin accounts nowadays for more than 99 % of the total
market share. Extraction from vanilla beans is expensive and limited by plant supply, curing time and labour
cost. Those factors make vanillin a promising target for biotechnological flavour production. As the Regulation
(EC) no 1334/2008 of the European Parliament and of the Council of 16 December 2008 specify, vanillin
produced in biotechnological processes starting from natural substrates can be classified as natural flavouring on
condition that the natural starting material is specified. In recent years a large number of studies have been made
on natural vanillin biosynthesis using microorganisms or isolated enzymes. However, these bioconversions are
not yet economically feasible. Biovanillin can be synthesized using cells or enzymes starting from different
natural compounds, such as ferulic acid, eugenol or capsaicin. The latter, ((6E)-N-(4-hydroxi-3-metoxibenzil)-8-
metil-6-nonenamide) is the pungent compound in chili pepper related plants of the Capsicum family. It can be
hydrolyzed to vanillylamine, (4-hydroxy-3-methoxybenzylamine), a natural precursor of vanillin, by cleavage of
its amine bond using specific microbial acylases (Figure 1). The aims of the thesis were: to evaluate different
strategies for enhancing the production of the capsaicin acylase from Streptomyces mobaraensis DSM40847
strain (1), to identify optimal conditions for capsaicin hydrolysis by using the acylase from Streptomyces
mobaraensis DSM40847 strain (2), to develop efficient procedures for the recovery of vanillin from diluted
aqueous solutions (3), and to enhance vanillin production from the recombinant strain of E. coli FR13, starting
from ferulic acid and by using XAD-4
resin (4).
Penicillin acylases (EC 3.5.1.11) are produced by a wide range of microorganisms, including bacteria, yeasts,
and fungi and generally catalyze the hydrolysis of the side amide bonds in !-lactam compounds like as penicillin
G (Pen G), penicillin V (Pen V), and ampicillin. In particular, penicillin G acylase (PGA) and penicillin V
acylase (PVA) hydrolyze Pen G and Pen V specifically, producing 6-aminopenicillanic acid (6-APA), whose
commercial importance in industrial synthesis of various semi-synthetic penicillins has led to the development of
penicillin amidase research and application. Their high efficiency has resulted in the replacement of conventional
15
th
55
15
th

Figure 1 Enzymatic hydrolysis of capsaicin

chemical process in favour of enzymatic ones by the industry. Penicillin acylase have been categorized as !-
lactam acylase. This kind of enzymes are generally characterized as an N-terminal-nucleophile (Ntn) hydrolase
superfamily, which is composed of enzymes that share a common fold around the active site and contain a
catalytic serine, cysteine, or threonine residue at the N-terminal end (Brannigan et al., 1995). These enzyme are
initially produced in the cytoplasm of the cells as a single-chain precursor with four distinct segments (signal
sequence, small (") subunit, linker peptide, and large (!) subunit. After the removal of several polypeptides
through posttranslational autocatalytic processes, the enzymes are then converted to the mature form of a
heterodimer composed of an " subunit and a ! subunit in the cell periplasm (Kasche et al., 1999; Shizmann et
al., 1990; Kim and Kim, 2001), S. mobaraensis has been shown to produce a capsaicin-hydrolysing acylase,
(Sm-PVA) that is secreted in the culture medium (Koreishi et al. 2006). In order to develop a cost-effective
process for the biotechnological production of vanillin, we considered the use of crude enzyme and the
performance of different extraction procedures on the recovery of vanillin from diluted aqueous solutions. In
particular, we investigated the performance of: adsorption-regeneration techniques, using macroporous resins
with cross linked-polystyrene framework or active carbon powder and liquid-liquid extraction techniques, with
n-butyl acetate. The high chemical activity and toxicity of vanillin cause low yield from ferulic acid. Moreover
little vanillin was accumulated due to the higher degrading rate of this molecule than that of ferulic acid. We
investigated the in situ product adsorption using adsorbent resin to improve the vanillin yield using E. coli
FR13resting cells.
2.1 Microorganisms and culture conditions
Conversion of capsaicin to vanillylamine was carried out using Sm-PVA acilasi from Streptomyces mobaraensis.
Cultivation of DSM40847 strain was carried out at 28C in shaken Erlenmeyer flasks (120 rpm), or in STR-type
reactor (aeration rate, 1 vol/vol min
-1
; stirrer speed, 450 rpm). For inocolum the microorganism was grown on
medium containing: glucose (10.0 g/L), dextrin (10.0 g/L), N-z amine (5.0 g/L), yeast extract (5.0 g/L), CaCO
3

(1.0 g/L). For production of Sm-PVA, the strain was grown on media M or MT amended with glucose (5 g/L) or
soluble starch (40g/L) as carbon source. Medium M contains: polypeptone (20.0 g/L), beef extract (40.0 g/L),
MgSO
4
(20.0 g/L), K
2
HPO
4
(2.0 g/L). Medium MT contains: soy bean meal (10 g/L), beef extract (4 g/L),
peptone (4 g/L), yeast extract (1 g/L), MgSO
4
(20.0 g/L), K
2
HPO
4
(2.0 g/L).
Bioconversion of ferulic acid to vanillin was carried out in phosphate salin buffer using Escherichia coli FR13.
Cells were grown in LB medium (Composition per liter: tryptone 10 g; NaCl 5 g; yeast extract 5g) containing
kanamicin (25 g/ml). Conversion of ferulic acid to vanillin and hydrolysis of capsaicin were monitored by
HPLC (see below).

2.2 Determination of enzymatic activity
Acylase activity was determined either by a spectrophotometric method, (Varian Cary 50 MPR), using a coupled
enzymatic reaction with DAO, (diamine oxidase EC 1.4.3.6) and POD, (peroxidase EC 1.11.1.7) or by a
specifically developed HPLC method using capsaicin (130 mM) as substrate. In the latter case the consumption
of the substrate and the production of vanillylamine were monitored. HPLC reverse phase system was equipped
with a C-18 column (250 x 14,6 mm I.D; S-5m) and UV detection at 235 nm. The mobile phase was composed
of acetonitrile and phosphate buffer pH 8 (1:1).

2.3 Preparation of Sm-PVA
Crude preparations from the liquid culture of Streptomyces mobaraensis DSM40847 strain were obtained by the
precipitation of extracellular proteins with ammonium sulfate at 65% in Tris-HCl 50 mM, pH 7.80.

Acylase
15
th
56
15
th

2.4 Vanillin recovery
XAD-4
macroporous adsorption resin with crosslinked styrene-divinylbenzene framework were used in this
research. The resin was first soaked with ethanol for 24 h, 2% hydrochloric acid (v/v) and 2% (w/v) sodium
hydroxide for 2 h, respectively. The kinetic studies were carried out at 30C, with resin in solutions of vanillin in
M9 buffer. The solutions were shaken at 180 rpm. An aliquot of the mixture at 15-min intervals was taken and
the content of residual vanillin and ferulic acid in the supernatant solution was monitored by HPLC analysis. A
set of adsorption tests in mixtures of vanillin and ferulic acid, have been performed at different pH value in the
range [4.00-11.50], with resin at 0,1 g/ml. Liquid/liquid extraction experiments with n-butyl acetate were carried
out with mixture of vanillin, (0,5 mg/ml) and ferulic acid (0,5 mg/ml), at 20C with a total volume ratio of
solution and organic solvent of # in a double extraction process. Vanillin and ferulic acid concentrations were
measured by HPLC analysis using a C-18 column (50x 2 mm I.D; S-2,5m) and UV detection at 235 nm. The
mobile phase was composed of water and methanol with 1% acetic acid (1:1).
3.1 Effect of medium composition on the production of Sm-PVA from Streptomyces mobaraensis
In preliminary experiments we evaluated the effect of different carbon and nitrogen sources (see Materials and
Methods) on the production of Sm-PVA. Data reported in Figure 2 indicated that both profile and production
level of acylase were affected from the source of nitrogen provided for the growth. The highest level of acylase
(140 U/L) was obtained on medium M providing soluble starch as carbon source and polypeptone and meat
extract as nitrogen sources.

3.2 Effect of temperature on the conversion of capsaicin to vanillylamine
The effect of the temperature on the hydrolysis of capsaicin using crude preparations of Sm-PVA acylase was
investigated. Experiments were carried out in the range of temperature 37-60C, and acylase activity was
measured by HPLC monitoring the consumption of capsaicin during the time. The results, reported in Figure 3a,
indicated that: PVA acylase from DSM40847 strain was active in a wide range of temperature and the highest
enzymatic activity was measured at 55C.

3.3 Effect of cobalt ions on the hydrolysis of capsaicin using Sm-PVA
Experiments carried out using PVA from Streptomyces mobaraensis 13819 strain indicated that acylase activity
of the purified enzyme, increased adding cobalt ions to the reaction buffer (Koreishi et al. 2006). We evaluated
if a similar effect could be determined with crude preparations of Sm-PVA from strain DSM40847. Hydrolysis
reactions were carried out at different temperatures, using
~
7.5 mU of acylase activity (measured at 55C) (see
Materials and Methods). The results reported in Figure 3b indicated that the stimulatory effect of cobalt ions on
the acylase activity was detected only at low temperature (37C). In this condition the addiction of cobalt ions
determined an increase from 1.2 0.1 U/L to 1.50.07 U/L. The same effect was not observed at higher
temperatures using crude enzyme preparations of Sm-PVA acylase.

Figure2 Acylase production of Streptomyces mobaraensis grown on medium M and MT containing soluble starch as
carbon source (a); Acylase production of Streptomyces mobaraesins DSM40847 grown on medium M and MT
containing glucose (5 g/L) as carbon source (b). Error bars indicate standard deviations.

3.4 Stability of crude enzyme preparations of Sm-PVA
Stability of Sm-PVA was determined on samples stored for 7 and 14 days at three different temperatures: -20C,
4C and 20C for. All enzymatic reactions were carried out at 55C for 2 hours. The results reported in Figure
3c, indicated that crude preparations of Sm-PVA at 4C and 20C showed a rapid loss of activity (75% after 14
days). The highest residual activity (60% after 14 days) was obtained maintaining the enzymatic preparation at
-20C. Pre-incubation of crude enzyme stored at -20C for at least 2 hours determined a 5-fold increase in the
a
a
15
th
57
15
th

Figure 3 Effect of temperature (a) and of cobalt ions (b) on acylase activity from S. mobaraensis; Acylase activity levels of
crude enzymatic preparation pre-incubated at different temperature in the range of 0 18 hours (c); Relative
activity (%) of crude enzyme stored for 14 days (d). Experiments were carried out using raw enzymatic
preparation obtained from fermentation broths of Streptomyces mobaraensis strain cultivated on MA medium.
Acylase activity was determined using capsaicin as substrate and measured by HPLC analysis. Error bars are
standard deviations.
level of acylase activity compared to untreated samples or to the samples incubated at 4C or 37C (Figure 2d).

3.5 Selective recovery of vanillin
Ferulic acid and vanillin can be recovered from liquid medium using macroporous resins, such as XAD-4
resin.
To evaluate the effect of pH on the adsorption capacity and selectivity of XAD-4
resin, adsorption experiments

were carried out in acqueous mixture of vanillin and ferulic acid at 30C. Results, reported in Figure 4a,
indicated that the adsorption capacity of XAD-4
resin was affected by pH. In moderate acidic condition

(pH 5.50-6.00) the resin had the best capacity to adsorb vanillin (5.98 mg vanillin/g resin) and showed no
selectivity. The highest selectivity (more than 95%), but lower adsorption capacity values were obtained at
alkaline pH (9.00-10.50) when vanillin molecules became deprotonated and are negatively charged.
We also investigated the recovery of vanillin and ferulic acid in acqueous mixture by using liquid/liquid
extraction with n-butyl acetate. The results reported in Figure 4b indicated that recovery vanillin percentage was
98% and that high recovery and high selectivity were obtained.

Figure 4 Adsorption capacity of XAD-4 resin (a); Recovery of vanillin (%) by using liquid/liquid extraction with n-butyl
acetate (b). Liquid/liquid experiments were carried out at 20C. Vanillin concentration in acqueous phase was
measured by HPLC analysis. Error bars are standard deviations.

a
a
a
a
15
th
58
15
th

4. Conclusions
Streptomyces mobaraensis DSM40847 strain produces an acylase that can be used for the conversion of
capsaicin to vanillylamine. The production of this enzyme is stimulated growing the microorganism medium
containing soluble starch as carbon source and meat extract and polypeptone as source of organic nitrogen. A
crude preparation of this acylase can be successfully used for the production of vanillylamine carrying out the
reaction at 55C and pre-treating the crude enzyme preparation at the same temperature for at least 2 hours.
XAD-4
resin can be used for the selective recovery of vanillin working at alkaline pH. Under this condition the
conversion of ferulic acid to vanillin using resting cells of E.coli FR13 strain can be also obtained. Liquid/Liquid
extraction with n-butyl acetate of acqueous solutions containing mixture of ferulic acid and vanillin allowed high
recovery of vanillin and high selectivity.
5. References
Koreishi M, Zhang D, Imanaka H, Imamura K, Adachi S, Matsuno R, Nakanishi K (2006) A Novel Acylase from
Streptomyces mobaraensis that Efficiently Catalyzes Hydrolysis/Synthesis of Capsaicins as Well as N-Acyl-L-amino
Acids and N-Acyl-peptides. J. Agric. Food Chemistry 54: 72-78.
Zhang D, Koreishi M, Imanaka H, Imamura K, Adachi S, Matsuno R, Nakanishi K (2007) Cloning and characterization of
penicillin V acylase from Streptomyces mobaraensis. Journal of Biotechnology 128: 788800.
Zhang Q-F, Jiang Z.T (2007) Recovery of Vanillin from Acqueous Solutions using Macroporous Adsorption Resins.
Eur Food Res Technology 226:377-383.
D.Hua, C.Ma et al. (2007) Enhanced Vanillin Production from Ferulic Acid Using Adsorbent Resin. Appl. Microbial
Biotechnololy 74:783-790.
M.A. Longo and M.A. Sanromn (2006) Production of Food Aroma Compounds. Food Technol. Biotechnology 44: (3)
335353.
Wilfried Schwab, Rachel Davidovich-Rikanati and Efraim Lewinsohn (2008) Biosynthesis of plant-derived flavor
compounds. The Plant Journal 54: 712732.
Sio Cf, Quax WJ (2004) Improved beta-lactam acylases and their use as industrial biocatalysts.. Curr.Opin.Biotechnology 15:
34955.
Dolores R. Duarte, E. Castillo, E. Barzana & A. Lopez-Mungu (2000) Capsaicin hydrolysis by Candida antarctica lipase.
Biotech. Letters 22: 18111814.
Zabkova M, Borges da Silva E A, Rodrigues A E (2006) Recovery of vanillin from Kraft lignin oxidation by ion-exchange
with neutralization. Separation and Purification Technology 55: 56-68.
Ramachandra Rao S, Ravishankar GA (2000) Vanilla flavour: production by conventional and biotechnological routes.
J. of the Science of Food and Agricolture 80: 289-304.
Bruggink A , Ross E.C, de Vroom E (1998) Penicillin acylase in industrial production of !-lactamase antibiotics.
Org process Res Dev 2:128-133.
Chandel, A.K, Rao L.V, Narasu M.L, Singh, O.M (2007) The realm of penicillin G acylase in !-lactam antibiotics. Elseiver.
Dignum M.J.W, Kerler J, Verpoorte R (2001) Vanilla production: technological, chemical, and biosynthetic aspects. Food
Rev. Int 17: 199-219.
Chiang C, Bennet E (1966) Purification and Properties of penicillin Amidase from Bacillus Megaterium.
Journal of Bacteriology 93: 302-308.
Rolinson G.N, Geddes A.M (2007) The 50
th
anniversary of the discovery of 6 APA.
International Journal of Antimicrobial Agents 2007: 3-8.
Rolinson G.N, Batchelor F.R, Butterworth D (1960) Formation of 6-APA from penicillin by enzymatic hydrolysis. Nature,
187: 236-7.
Li T, Rosazza J.P.N (2000) Biocatalytic synthesis of vanillin. Appl. Environ. Microbiology 66: 684-687.
15
th
59
15
th
Workshop on the Developments in the Italian PhD Research on Food Science and Technology and
Optimization of White Wine Clarification Process by means of Bentonites

Roberta Dordoni (roberta.dordoni@unicatt.it)
Institute of Enology and Food Engineering, Universit Cattolica del Sacro Cuore, Piacenza, Italy
Tutor: Prof. Dante Marco De Faveri

This PhD thesis dealt with the evaluation of different sodium bentonite samples. The planned activities were
aimed to understand the interactions between bentonites and different molecular weight proteins naturally
contained in white wines. Further investigations were related to the impact of the clays on varietal and
fermentative aroma compounds of musts and/or wines. Results underscore the key role exerted by the matrix
factors: bentonite dose and typology and wine style have to be carefully considered before planning a fining
treatment.

Ottimazione del processo di chiarificazione di vini bianchi
mediante limpiego di bentoniti

Questa tesi di dottorato ha riguardato la valutazione di differenti campioni di bentoniti sodiche. Le attivit
pianificate sono state indirizzate a comprendere linterazione dei suddetti materiali con proteine a diverso peso
molecolare naturalmente contenute nei vini bianchi. Ulteriori indagini hanno riguardato leventuale impatto delle
argille testate sui composti aromatici di origine varietale e fermentativa dei mosti e/o dei vini. I risultati
sottolineano il ruolo chiave esercitato dal fattore matrice: oltre al tipo di vino, prima di pianificare un
trattamento di fining, devono essere considerate anche la tipologia e la dose di bentonite da utilizzare.

Key words: Bentonite; Fining; Wine proteins; Wine aroma compounds.

1.Objectives

In accordance with the PhD thesis project previously described (Dordoni, 2008), this paper reports the main
results of the following activities aimed to:
A1) Define the physical parameters of bentonites.
Some key physical characteristics related to the clay deproteinizing properties were detected.
A2) Determine the interaction between sodium bentonites and proteins of musts and wines obtained from
different white grape cultivars.
Protein adsorption capacity and clarifying effect of the clays by means of suitable chemical methods
and physical tests were evaluated. The bentonites were analyzed in order to detect their interaction with
the protein fractions and to identify their relationship with different MW proteins.
A3) Investigate the possible side-effects on the aromatic profile resulting from the bentonite treatment.
Losses of varietal and/or fermentative aroma compounds, both in musts and in wines, were checked and
quantified.

2. Materials

2.1 Bentonites
Samples of activated sodium bentonite: Top Gran (T), Superbenton (S), Powder W (PW), Powder N (PN),
Granular W (GW), Granular W2 (GW2) and an Experimental Clay were purchased from Dal Cin Gildo S.p.a.
(Sesto S.Giovanni, Milan, Italy). Superbenton and Top Gran were usually applied in wine clarification.
Superbenton was a powder and Top Gran was granular. The other clays were not used for wine clarification.
Powder W, Powder N, and the Experimental Clay were dusty bentonites, while Granular W and W2 were grainy.

2.2 Musts and/or wines from aromatic grapes
Experimental tests were set up on musts and wines produced from Moscato di Chambave, an aromatic white
grape cultivar grown in Valle dAosta.

2.3 Wines from non aromatic grapes
Experimental plan included two series of bentonite treatments on heat unstable white wines.
First tests were managed on two wines originated from Chardonnay grape: Chardonnay A was processed by
traditional white vinification without any aging on lees. Chardonnay B was obtained by traditional white
vinification including a six month aging on yeast lees after the end of alcoholic fermentation.

15
th
60
15
th

The second trials included the use of two wines vinified from Chardonnay and Sauvignon blanc grapes,
harvested at technological maturity, using standard winemaking practices. Specifically the wines did not receive
lees contact or fining treatments before tests.


3.1 Must and/or wine bentonite treatments
The study was carried out during two harvests. Every year four tests on must and eight tests on wine are
prepared, considering one bentonite label (Top Gran) and working in duplicate. Each must was divided into 4
batches and two of these were clarified with bentonite. The bentonite slurries were prepared in deionized water
at concentration of 10% (w/w). After 24 hour re-hydration the gels were stirred. Each resulting solution was
added to one batch must (100 g/hL) and thoroughly mixed. An untreated sample of each must was kept in double
as a control test. The samples were maintained at 5C for 48 hours. After racking, a selected yeast culture was
inoculated and fermentation was conducted at controlled temperature (20C). At the end of fermentation, each
batch of wines was subdivided in two lots and to one lot bentonite was added. In the first year bentonite was
applied at 100 g/hL dose, while in the second one the most appropriate dose was determined after preliminary
heat stability test (Dubourdieu et al. 1988). An untreated sample of each wine was kept in double as a control
wine. After 96 hour clarification at 5C, samples were racked. Before bottling, the wine was placed at 5C,
added with SO
2
(up to 150 mg/L) then filtered. On liquid limpid fractions of both treated and control wines
chemical analysis were performed.

3.2 Wine fining
Trials were carried out on lab scale on Chardonnay A and B. Each sample of bentonite was added to each wine
in three different doses: 20, 50 and 100 g/hL. For each amount considered two sets of samples were prepared. An
untreated sample of each wine was kept in double as a control test. The bentonite slurries were prepared in
deionized water at a concentration of 10% (w/w). After 90 minute re-hydration the gels were stirred. Each
resulting solution was added to 1 liter of wine and thoroughly mixed. All the samples were put into 4 liter
demijohns equal for dimensions and shape. They were maintained for 5 days at 16-18C into 60% relative
humidity conditioned room. Then, the limpid liquid phases were separated and filtrated through folded filters
(595 !, Whatman GmbH, Germany). The untreated wine samples, kept as control tests, were treated and filtered
under the same conditions as samples. On liquid limpid fractions of both treated and control wines chemical
analysis were performed.
Regarding Chardonnay and Sauvignon wines, each bentonite sample was added to each wine in a single dose, as
determined by the preliminary stability test (Dubourdieu et al. 1988): 100 g/hL were used for Chardonnay and 50
g/hL were employed for Sauvignon. For each bentonite label two sets of samples were prepared. An untreated
sample of each wine was kept in double as a control test. The bentonite slurries were prepared in deionized water
at a concentration of 5% (w/w). After 90 minute re-hydration the gels were stirred. Each resulting solution was
added to 4 liters of wine and thoroughly mixed. All the samples were put into glass demijohns egual in
dimensions and shape. They were kept for 5 days at 16-18C in a 60% relative humidity conditioned room.
Then, the limpid liquid phases were separated and filtrated through folded filters (595 !, Whatman GmbH,
Germany). The untreated wine samples, kept as control tests, were treated and filtered under the same conditions
as samples. Analysis were performed on limpid fined wine fractions.

4. Methods

Different sodium bentonite samples were examined in order to determine: elemental analysis and morphological
structure (by an energy dispersive X-ray detector attached to a scanning electron microscope), surface charge
density (Ferrarini et al., 1996), specific surface area and swell index (Res. Oeno11/2003, O.I.V. 2003).
On bentonite treated and untreated wine samples the following evaluations were performed: wine general
parameters (O.I.V., 2009), heat stability test (Pocock e Rankine 1973), wine total protein concentration
(Schacterle e Pollak, 1973), different molecular weight fractions, preliminarily by HPLC (Silva e al., 1990)
afterwards by SDS page (Laemmli e al., 1970), wine odour active compounds (Silva e al., 1988) (Mamede and
Pastore, 2006), sensory evaluation (ISO 4120:2004).


5.1 Define the physical parameters of bentonites.
It is understood that each clay mineral presents different characteristics depending on origin, type and label.
Further differences were revealed by analyzing the same bentonites produced in different years. Elemental
analysis showed significant differences between the bentonite samples. However, from the point of view of
substantive content, these differences are less important.

15
th
61
15
th

Table 1 Physicochemical parameter of bentonite samples. Different letters indicate statistically different values according
to post-hoc comparison (Tukeys test) at ! = 0.05.

Bentonite Surface Charge Density Specific Surface Area Swell index
meq/100g m
2
/g mL/g
Top Gran 2007 102.0 + 8.9 a 402.6 + 6.4 c 6.75 + 0.65 b
Superbenton 2007 97.0 + 4.9 a 103.5 + 2.4 b 5.85 + 0.60 b
Experimental clay 2007 102.0 + 5.1 a 86.7 + 2.5 a 4.25 + 0.60 a
Top Gran 2008 357.5 + 5.9 f 396.2 + 6.4 c 6.13 + 0.90 b
Superbenton 2008 323.2 + 5.7 e 101.7 + 2.4 b 6.18 + 0.95 b
Powder W 2008 305.6 + 3.8 d 82.7 + 2.3 a 4.12 + 0.50 a
Granular W 2008 362.0 + 5.9 f 406.4 + 2.4 c 7.31 + 0.80 c
Granular W2 2008 162.7 + 3.5 b 530.3 + 4.2 e 8.06 + 1.85 d
Top Gran 2009 305.7 + 5.8 d 409.9 + 4.1 c 5.75 + 0.30 b
Powder W 2009 321.3 + 4.2 e 80.0 + 1.5 a 4.75 + 0.30 a
Powder N 2009 464.8 + 4.8 h 937.3 + 50.4 f 16.25 + 0.25 f
Granular W 2009 262.4 + 2.8 c 443.5 + 11.2 d 5.00 + 0.05 a
Granular W2 2009 430.1 + 4.1 g 519.4 + 38.8 e 11.25 + 0.30 e

Additional physicochemical analysis of clays provided the results reported in Table 1. The electric charge of
bentonites is related to their ability in removing proteins and to adsorption capacity with regard cationic
compounds in wine. The values were high when compared to those recently reported in literature (Catarino et al.
2008). Nevertheless, bentonites produced in 2007 showed the lowest values. This is likely due to a different
activation process of the clays as reported in bentonite samples - technical sheets. As regards Specific Surface
Areas (SSAs), our results showed highly significant differences between samples which could self explain
distinct activity. In fact, higher specific SSAs indicates a greater amount of active adsorption sites on the
bentonite surface: Powder N showed the highest value, while Experimental clay and Powder W had the lowest
areas. The swell indexes are dependent on intrinsic soil properties and are related to the water volume adsorbed
by bentonites pores. Powder N bentonite was characterized by the highest value.

5.2 Determine the interaction between sodium bentonites and proteins of musts and wines obtained from
different white grape cultivars.
The relationship between heat-unstable wine proteins and bentonite fining is still unclear: whether bentonite
removes selectively some protein classes (Sauvage et al., 2010) or whether this removal changes as a function of
matrix parameters (Achaerandio et al. 2001; Blade and Boulton 1988; de Bruijn et al. 2009; Lambri et al. 2010)
is a matter of debate. Among all tests, only the results related to Chardonnay and Sauvignon blanc are reported
as example. The study intended to detect the protein fractions of two international white wines and to
characterize the fining effect of five different types of activated sodium bentonite.
Sauvignon blanc was more acid, had a lower pH and concentration of total sulfur dioxide and showed a darker
color than Chardonnay. The total protein level was: 101 mg/L in Chardonnay and 66 mg/L in Sauvignon. The
performances of each clay type on the different wine protein fractions were evaluated first by HPLC and then by
SDS-PAGE (Figure 1).
Results revealed differences in the physical properties of the different used clays. The protein profiles of the two
unfined white wines were quite similar, but major differences were found after bentonite fining. The Chardonnay
protein fractions, both the low and the medium molecular weight ones, were prone to removal by clay particles.
Only the 3 low molecular weight bands were removed in Sauvignon after fining.

Chardonnay Sauvignon blanc

Figure 1 SDS-PAGE of Chardonnay and Sauvignon wines untreated and treated with different bentonite labels.
15
th
62
15
th

5.3 Investigate the possible side-effects on the aromatic profile resulting from the bentonite treatment.
Thanks to mutual flocculation with positively charged hydrocolloids and to adsorption phenomena, bentonite
interacts not only with proteins, but also with other molecules. The occurrence of aroma depletion during fining
is generally observed as a secondary, unspecific effect of bentonite, but mechanisms and occurrence related to
white wine style are not clear. Here below the main results concerning the tests on two different Chardonnay
wine styles are described.
The aim of this study was to analyze the effect of fining with three samples of sodium bentonite, applied in
three different amounts, on odor active compounds of two white wines (Table 2).
It was observed that bentonite dose, bentonite sample and wine style significantly affected the percentage
reductions of some odor active compounds of white wine during bentonite fining (Table 3).
The most of volatiles was indirectly removed via deproteinization, as they can be fixed to macromolecules by
weak bonds, and only few odor active molecules were directly removed by bentonite through adsorption
phenomena, e.g. 1-hexanol (Figure 2). Wine proteins are normally classified as macromolecular colloids with a
positive charge and an hydrophilic character conferring stability. Some hydrophilic odor active compounds can
be weakly retained by hydrogen bonds on to protein surface, while more hydrophobic aroma molecules can be
linked to inner protein sites with a stronger affinity for hydrophobic substances. When yeast released derived
material represents an important fraction of wine macromolecules, as in wine B, colloids with the same electric
charge of bentonite are in solution. Consequently, they are held apart by electrostatic forces and they do not
precipitate. In this situation increased opportunities for a direct adsorption of odor active substances on bentonite
sheets were hypothesized.

Table 2 Wine general parameters.

Wine pH Alcohol degree Total nitrogen Total proteins
(% v/v) (mg/L) (mg/L)
Chardonnay A 3.30 + 0.02 11.00 + 0.10 340 + 18.7 41.5 + 8.3
Chardonnay B 3.60 + 0.03 14.20 + 0.20 2700 + 176 318.6 + 70.1

Table 3 Effect of bentoniti on odour active compounds in Chardonnay: significance of aroma percentage reduction versus
Bentonite dose, Bentonite type and Wine style
a
.

Bentonite dose Bentonite type Wine style
Ethyl butyrate *** n.s. ***
Ethyl hexanoate n.s. * **
Ethyl octanoate * n.s. n.s.
Isoamyl acetate n.s. n.s. n.s.
Phenylethyl acetate * n.s. ***
"-Phenylethanol ** n.s. n.s.
1-Hexanol * * n.s.
Hexanoic acid ** n.s. **
Octanoic acid n.s. n.s. n.s.

a
n.s., not significant
* significant differences (p < 0.05)
** significant differences (p < 0.01)
*** significant differences (p < 0.001)

Figure 2 Effect of bentonite dose
and sample in wines A and B on
percentage reductions of 1-hexanol.
Each bar represents the mean, n = 6;
error bars denote standard error.
Different letters at each bar indicate
statistically different values according
to post-hoc comparison (Tukeys test)
at ! = 0.05.

15
th
63
15
th


Results in paragraph 5.2 could explain the contradictory data found in other reports (Sauvage et al., 2010;
Achaerandio et al., 2001): bentonite action is specific in Sauvignon for LMW protein fractions, while on
Chardonnay, it removes all the protein fractions. In addition, on Chardonnay we can easily appreciate differences
in the degree of removal among different bentonite labels, while on Sauvignon the clay types behave more or
less the same.
Concerning the effect of bentonite fining on odor active compounds of two different white wine styles
(paragraph 5.3), results confirm the key role exerted by the matrix factors. Data suggested that chemical
nature, hydrophobicity and initial concentration of wine odor active compounds, abundance and nature of wine
proteins are able to modulate the removal of wine odor active compounds during bentonite fining. Moreover this
study suggested that low adsorbent amounts (20 g/hL), sometimes useful to stabilize wine, did not significantly
affect the concentration of the most of the odorous substances.
This outcomes are really sound for practical application in which bentonite dose and typology and wine style
have to be carefully considered before planning a fining treatment. Further studies on the mechanism of
interaction among wine proteins, odor-active compounds, and bentonite are currently underway.

7. References

Achaerandio I., Pachova V., Guell C., Lopez F. (2001). Protein adsorption by bentonite in a white wine model
solution: effect of protein molecular weight and ethanol concentration. Am. J. Enol. Vitic. 52:122-126.
Blade, W.H. and Boulton R. (1988). Adsorption of protein by bentonite in a model wine solution. Am. J. Enol.
Vitic. 39;193-199.
Catarino S., Madeira M., Monteiro F., Rocha F., Curvelo-Garcia A.S., Bruno de Sousa R. (2008). Effect of
bentonite characteristics on the elemental composition of wine. J. Agric. Food Chem. 56:158-165.
de Bruijn, J., Loyola C., Flores A., Hevia F., Meln P., Serra. I. (2009). Protein stabilisation of Chardonnay wine
using trisacryl and bentonite: a comparative study. Int. J. Food Sci. Tech. 44: 330-336.
Dordoni R. (2008). Optimization of white wine clarification process by means of bentonites, Proceedings of the
13th workshop on the developments in the italian PhD research on food science technology and
biotechnology, Alba (CN), 10-12 Settembre.
Dubourdieu D., Serrano M., Vannier A.C., Riberau-Gayon P. (1988). Etude compare des tests de stabilit
proteique. Conn. Vigne Vin, 22: 261-273.
Ferrarini R., Celotti E., Zironi R. (1996). Importance des charges electriques superficielles des adjuvants
oenologiques, des particules et des colloides presents dans les mouts et les vins. Revue Francaise Oenol.
36:5-10.
International Organization for Standardization (2004). ISO 4120:2004. Sensory analysis methodology
general guidance. ISO.
Laemmli U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature, 227: 680-685.
Lambri, M., Dordoni R., Silva A., De Faveri D.M. (2010). Effect of Bentonite Fining on Odor-Active
Compounds in Two Different White Wine Styles. Am. J. Enol. Vitic. 61(2): 225-233.
Mamede M.E.O., Pastore G.M. (2006). Study of methods for the extraction of volatile compounds from
fermented grape must. Food Chem. 96: 586-590.
O.I.V. (2003). Resolution Oeno 11/2003. Codex Oenologique International, 2003.
O.I.V. (2009). Recueil des methods internationals danalyse des vins et des mouts.
Pocock K.F., Rankine B.C. (1973). Heat test for detecting protein instability in wine. Aust. Wine. Brew. Spirit
Rev., 91: 42-43.
Sauvage F.X., Bach B., Moutounet M., Vernhet A. (2010). Proteins in white wines: Thermo-sensitivity and
differential adsorbtion by bentonite. Food Chem. 118: 26-34.
Schacterle G.R., Pollak R.L. (1973). A simplified method for the quantitative assay of small amounts of protein
in biologic material. Anal. Biochem. 51:654-655.
Silva A., Fumi M.D., Montesissa G., Colombi M.G., Colagrande O. (1988). Osservazione sperimentale sulla
conservazione dello spumante in presenza di lieviti. Industria delle bevande XVII, 8: 312-327.
Silva A., Fumi M.D., Trioli G., Petegolli D., Ragg E. (1990). Evoluzione delle frazioni glicoproteiche e dei
composti fosforilati del lievito durante la maturazione dello spumante in bottiglia. Industrie delle Bevande
19: 380-387.
15
th
64
15
th
The Oxidative Level of Refined Olive Oil as a Function of Crude Oil
Quality and Refining Process
Viviana Durante (vdurante@hotmail.com)
Department of Biology and Chemistry of Agro-Forestry and Environment (DIBCA), University of Study of Bari
Aldo Moro, BARI, Italy

Lipid oxidation has been recognised as the major problem affecting edible oils, as it is the cause of important
deteriorative changes in their chemical, sensory and nutritional properties. The aim of this study was to test the
influence of the level of degradation of crude oil on the presence of new-formation substances during refining.
Il Livello Ossidativo dellOlio di Oliva Raffinato in Funzione della Qualit dellOlio
Grezzo e del Processo di Raffinazione
Lossidazione dei lipidi stato riconosciuto essere il problema maggiore degli oli edibili, poich la causa di
importanti cambiamenti deteriorativi nelle propriet chimiche, sensoriali e nutrizionali degli oli. Lobiettivo del
lavoro stato quello di verificare linfluenza del livello di degradazione dellolio grezzo di partenza sulla
comparsa di sostanze di neo-formazione nel corso della raffinazione.

Keywords: Olive oil; Oxidative stability; Refining process; Triacylglycerol oligopolymers.
1. Introduction
The most important cause of edible oils and fats deterioration is oxidation, which does not only reduce their shelf
life and nutritional value, but also produces toxic compounds (Guillen and Goicoechea, 2009). In fact,
triacylglycerols undergo changes, which have as a consequence the formation of a great number of compounds:
hydroperoxides, conjugate dienes and trienes, trans isomers, triacylglycerol oxidation products, volatile
oxidation compounds (Frankel, 1982; Denise, 1996; Gertz et al., 2000; Farhoosh et al., 2009).
Olive oil is a blend of refined olive oil, derived by refining of lampante virgin olive oil with virgin olive oil
different from the lampante oil. The purpose of refining process is to remove undesirable compounds in order to
improve oil quality. Elimination of phospholipids, free fatty acids, pigments and volatile compounds responsible
for off-flavours is foreseen in the different steps of the process (Ruiz-Mndez et al., 1997).
The refining process is necessary to make edible both vegetable oils extracted by solvent from oilseeds and
olive-pomace oil and lampante virgin olive oil, that are very degraded with evident organoleptic defects. On the
other hand, the refining process leads to the presence of new formation substances, such as stigmastadienes,
trans isomers of unsaturated fatty acids and triacylglycerol oligopolymers (TAGP).
In literature there are many studies about the influence of the refining process on the quality of the corresponding
refined oils. Ruiz-Mndez et al. (1997) analyzing olive, sunflower and soybean oils pointed out that the TAGP
were the only group of compounds showing a significant increase during refining, which was due to fatty acid
composition and initial quality of crude oils, while the amounts of oxidized triacylglycerols (ox-TAG) and
diacylglycerols (DAG) in refined oils remained close to those found in the starting crude oils. Hopia (1993),
analyzing three vegetable oils during refining, found that the TAGP increased after bleaching and deodorization
while the content of ox-TAG in refined oils was comparable to that in crude oils. Gomes et al. (2003) evidenced
that the significant increase of TAGP during refining was accompanied by a concomitant significant decrease of
ox-TAG. Authors concluded that the ox-TAG are intermediate lipid oxidation substances that, depending on the
processing conditions, can remain unmodified or undergo either polymerization reactions, with formation of
TAGP, or degradation reactions, with a raise of the volatile oxidation compounds. Farhoosh et al. (2009)
evaluated the effect of commercial refining steps on the rancidity measures of soybean and canola oils. The data
showed that the carbonyl value continuously increased during the refining steps, whereas the oxidative stability
index (OSI) significantly decreased after the neutralization without any considerable changes during the further
refining steps. Finally, Garca et al. (2006) evaluated the influence of the different refining steps on the
polyphenol content of crude oils and the by-products generated during the process, whereas Medina-Jurez et al.
(2000) investigated the trans fatty acid and tocopherol contents in refined vegetable oils produced in Mexico.
Few information is available, instead, about the relationships between the oxidative degree of the crude oil and
the quality of the corresponding refined oils. The aim of this study was to verify the influence of the crude oil
quality and the refining process on the oxidative level of the corresponding refined oil.

15
th
65
15
th
2.1 Sampling
A virgin olive oil was refined as it is (T0, PV meq O
2
kg
-1
~ 15) and after oxidation in glass containers (1.55 g
cm
-2
) in the presence of light and at room temperature (T1, PV ~ 20 meq O
2
kg
-1
; T2, PV ~ 30 meq O
2
kg
-1
; T3,
PV ~ 40 meq O
2
kg
-1
; T4, PV ~ 50 meq O
2
kg
-1
; T5, PV ~ 60 meq O
2
kg
-1
). Two independent trials were carried
out for each samples at different oxidative level.
2.2 Refining process
A laboratory scale pilot plant has been adopted as developed in a previous paper (Durante et al., 2010).
Neutralization: 500 mL of crude oil was heated to 60C and the required amount of NaOH (1%, w/w) and 10%
of excess was added. Then the contents were stirred and neutralized for 30 min at room temperature. The soap
stock was separated from the neutralized oil by decantation and centrifugation. The oil was washed three times
with water (20% w/w). The success of the neutralization was verified by the determination of the free fatty acid.
Bleaching: the oil was brought to 90C under vacuum and 1% (w/w) of bleaching earth (Tonsil Optimum
210FF) was added. Once this temperature was reached, the oil was held for 30 min with magnetic stirring,
cooled and filtered through filter paper. The success of the bleaching was verified by the determination of the
peroxide value (PV). Deodorization: the neutralized and bleached oils was deodorized in glass laboratory
equipment. The deodorization was carried out under a vacuum of less than 1 mm Hg. The temperature was
220C for 2 h. As stripping gas was used the nitrogen because it was more effective in the deodorization step of
oils as stripping gas of oils (Ruiz-Mndez et al., 1997). SPME GC-MS analysis was used to verify the success of
the deodorization.
2.3 Analytical determination
Each sample was submitted to routine analyses. The PV and UV spectrophotometric constants were determined
as prescribed by the official EC analytical methods (Official Journal of the European Communities, 1991). The
determination of the chlorophylls was performed according with the AOCS method no. Cc 13i-96. The amount
of carotenoids was determined following the instructions in a previous paper (Bilancia et al., 2007) by measuring
the absorbance at 449 nm. Polar compounds (PC) were separated from the oil samples by silica gel column
chromatography, according to the AOAC method no. 982.27 (2003). The evaluation of TAGP, ox-TAG and
DAG was performed by analysis HPSEC of PC. The chromatographic system consisted of a Perkin-Elmer pump,
series 200, a 50 L injector loop, a PL-gel guard column (Perkin-Elmer, Beaconsfield, UK) of 5 cm length 7.5
mm i.d., and a series of three PL-gel columns (Perkin-Elmer, Beaconsfield, UK) of 7.5 mm i.d. 30 cm in
length each. The columns were packed with highly crosslinked styrene divinylbenzene copolymers with a
particle diameter of 5 m and pore diameters of 500 , 500 and 100 , respectively. The detector was a
differential refractometer (series 200A, Perkin Elmer, Beaconsfield, UK). The elution solvent used was CH
2
Cl
2

for HPLC at a flow rate of 1.0 mL min
-1
. The identification and quantization of individual peaks was carried out
as described in previous papers (Gomes, 1992; Gomes and Caponio, 1999).
Analysis of variance (ANOVA), followed by Tukey HSD test for multiple comparisons, was carried out on the
experimental data by the XLStat software (Addinsoft, New York, USA).
With the aim to evaluate the influence of the crude oil quality and the refining process on the oxidative level of
refined oil, a retail extra virgin olive oil and the same oil, after oxidation in glass containers at room temperature
and in presence of air and light, were submitted to refining process.
Table 1 reports the results of two-way ANOVA with first order interaction performed on the analytical data.
Table 1 Results of two-way ANOVA, with first order interaction, performed on the analytical data.
Model Time (oxidation level) Refining Time*Refining
Determination
F p-value F p-value F p-value F p-value
K
232
50.22 < 0.001 65.24 < 0.001 255.96 < 0.001 4.06 < 0.001
K
270
92.25 < 0.001 10.43 < 0.001 677.21 < 0.001 2.53 < 0.01
Chlorophylls 1806.07 < 0.001 3.81 < 0.01 13827.26 < 0.001 2.59 < 0.01
Carotenoids 127.05 < 0.001 11.41 < 0.001 941.73 < 0.001 2.66 < 0.01
PC 83.20 < 0.001 370.19 < 0.001 13.59 < 0.001 1.46 0.145
TAGP 606.78 < 0.001 262.88 < 0.001 3719.36 < 0.001 98.89 < 0.001
ox-TAG 174.49 < 0.001 667.61 < 0.001 185.11 < 0.001 7.89 < 0.001
DAG 3.59 < 0.001 10.94 < 0.001 2.68 0.053 1.33 0.210
K
232
and K
270
, specific absorption at 232 and 270 nm; chlorophylls (mg kg
-1
); carotenoids (mg kg
-1
); PC, polar compounds
(%); TAGP, triacylglycerol oligopolymers (%); ox-TAG, oxidized triacylglycerols (%); DAG, diacylglycerols (%).
15
th
66
15
th
The ANOVA models resulted to be significant in all cases (p < 0.001). Time (oxidation level) and refining
variables proved to have a significant effect on all the indices with the exception of DAG for the refining
treatment variable. The first-order interaction time (oxidation level)refining resulted not significant only for
DAG and PC.
Table 2 reports the mean values of analyses carried out on the retail extra virgin olive oil (T0) and the same oil
after oxidation (T1-T5), as well as the results of the statistical elaboration by means two-way ANOVA, followed
by Tukey HSD test for multiple comparison. Concerning the determination of spectrophotometric constants, it is
possible to observe that respect to the oxidative level of crude oil, neutralization generally produced slight
decreases of the constants without statistical significance. Bleaching determined always significant decreases for
K
232
and significant increase for K
270
. The subsequent deodorization caused slight variation of
spectrophotometric constants, which was usually not significant. The content of chlorophylls and carotenoids
underwent a first significant decrease after the neutralization, to decrease dramatically after the bleaching phase,
confirming what previously found in other studies (Jung et al., 1989; Rossi et al., 2001).
The PC, which comprise all substances having greater polarity than that of unchanged triacylglycerols,
independently to oxidation level of starting crude oil not suffered significant changes during the neutralization
phase, in contrast to what observed in previous studies during refining of crude oil with high content of free fatty
acids (Gomes and Caponio, 1996; 1998; Gomes et al., 2003). The trend observed in this experiment is due,
therefore, to the low hydrolytic degradation of the used oil, as evidenced by the low value of diacylglycerols.
Table 2 Results of analyses and of the multiple comparison (Tukey HSD test) performed on the analytical data.
Time (oxidation level)
Determination Refining
T0 T1 T2 T3 T4 T5
CO A 2.308 def 2.458 de 2.614 cd 2.973 bc 3.119 ab 3.517 a
NO A 2.397 de 2.275 def 2.439 de 2.943 bc 2.974 bc 3.222 ab
BO B 1.781 hij 1.436 j 1.627 hig 1.816 ghij 1.830 ghij 1.927 fghi
K
232

DO C 1.948 fghi 1.533 ij 1.784 hij 2.041 efgh 2.228 defg 2.552 cd

CO A 0.159 e 0.173 e 0.159 e 0.165 e 0.171 e 0.213 e
NO A 0.131 e 0.139 e 0.123 e 0.140 e 0.153 e 0.157 e
BO B 0.658 abc 0.562 cd 0.637 bcd 0.670 abc 0.645 abc 0.728 ab
K
270

DO B 0.629 bcd 0.503 d 0.552 cd 0.617 bcd 0.641 abcd 0.777 a

CO A 16.87 a 16.38 a 16.34 a 16.28 a 16.31 a 16.23 a
NO B 14.97 b 13.75 c 13.92 c 13.93 c 14.38 bc 15.08 b
BO C 0.18 d 0.16 d 0.20 d 0.22 d 0.20 d 0.07 d
Chlorophylls
DO C 0.18 d 0.20 d 0.20 d 0.00 d 0.00 d 0.05 d

CO A 10.87 a 10.81 a 10.46 a 10.45 a 9.24 abc 10.45 a
NO B 10.20 a 10.43 a 9.00 abc 7.45 c 7.92 c 8.22 bc
BO C 1.19 de 2.81 d 0.24 e 1.16 de 1.33 de 0.67 de
Carotenoids
DO C 0.81 de 1.95 de 0.07 e 0.31 e 1.18 de 0.40 e

CO A 2.89 ef 2.96 ef 3.36 d 4.06 bc 4.24 ab 4.42 a
NO A 2.98 ef 2.87 ef 3.43 d 3.97 bc 4.07 bc 4.44 a
BO B 2.81 f 2.78 f 3.19 de 3.85 c 3.99 bc 4.02 bc
PC
DO A 2.88 ef 2.98 ef 3.38 d 4.10 abc 4.16 abc 4.19 abc

CO C 0.003 i 0.025 i 0.018 i 0.022 i 0.025 i 0.037 i
NO C 0.033 i 0.013 i 0.021 i 0.028 i 0.032 i 0.034 i
BO B 0.125 h 0.114 h 0.175 g 0.274 ef 0.271 ef 0.318 de
TAGP
DO A 0.253 f 0.344 cd 0.390 c 0.589 b 0.691 a 0.713 a

CO A 0.84 ijk 0.86 ijk 1.23 h 1.84 bc 2.01 b 2.25 a
NO A 0.91 ij 0.84 ijk 1.29 gh 1.85 bc 1.99 b 2.30 a
BO B 0.66 kl 0.72 jkl 1.00 i 1.43 efgh 1.61 de 1.69 cd
ox-TAG
DO C 0.62 l 0.68 kl 0.93 ij 1.37 fgh 1.44 efg 1.52 def

CO A 1.77 abcd 1.81 abcd 1.85 abcd 1.91 ab 1.89 abc 1.84 abcd
NO A 1.80 abcd 1.77 abcd 1.87 abcd 1.90 ab 1.81 abcd 1.83 abcd
BO A 1.79 abcd 1.72 d 1.79 abcd 1.86 abcd 1.86 abcd 1.76 abcd
DAG
DO A 1.79 abcd 1.74 cd 1.83 abcd 1.91 a 1.79 abcd 1.75 bcd
K
232
270
, specific absorption at 270 nm; chlorophylls (mg kg
-1
); carotenoids (mg kg
-1
); PC,
polar compounds (%); TAGP, triacylglycerol oligopolymers (%); ox-TAG, oxidized triacylglycerols (%); DAG,
diacylglycerols (%). Uppercase letters are used to compare the samples considering the effect of Refining process, lower
case letters are used to compare the samples considering the combined effects of Refining process, Time (oxidation level of
crude oil), and TimeRefining process: different letters mean significant difference at p 0.05.

15
th
67
15
th

After bleaching and deodorization the PC did not undergo significant changes, confirming what already found in
previous studies (Gomes and Caponio, 1996; 1998; Gomes et al., 2003). Also DAG did not change significantly
during refining, confirming the findings on different sets of industrial refining (Gomes and Caponio, 1996; 1998;
Gomes et al., 2003). TAGP and ox-TAG did not vary significantly during the neutralization. The former
increased significantly during the bleaching, due to the catalytic effect of the bleaching earth and subsequent
deodorization, which represents the most important heat refining stage (Bernardini, 1983), whereas the latter
significantly decreased. The total data obtained confirm the findings reported in previous studies (Gomes and
Caponio, 1996; 1998; Gomes et al., 2003).
Figure 1 shows the correlation between the total oxidation of crude oil, calculated by the sum of twice the TAGP
more ox-TAG contents, versus the TAGP content of refined oil. The significant correlation (p < 0.001) between
the two parameters supports the hypothesis that the formation of polymeric compounds in refined olive oil is
related to the oxidative level of the crude oil.
y = 0.2938x + 0.0433
R
2
= 0.9228
0.20
0.40
0.60
0.80
0.50 1.00 1.50 2.00 2.50
Total oxidation crude oils (2TAGP+ox-TAG)
T
A
G
P

r
e
f
i
n
e
d

o
i
l
s

Figure 1 Percent content of triacylglycerol oligopolymers (TAGP) in refined oils versus the total oxidation of crude oil
valuated by 2TAGP + ox-TAG (oxidized triacylglycerols).
4. Conclusions
The experimental research has evinced that the oxidation level of crude oil submitted to refining has influence on
the quality of the corresponding refined oil. In particular, the content of triacylglycerol oligopolymers in refined
oil was significantly correlated to the total oxidation level of the starting crude oil. The polymeric products
stable substances that remain unchanged in the oil at high amount exert adverse effects on consumer health
(Billek, 2000; Saguy, 2003) and a pro-oxidant activity (Frankel et al., 1988; Gomes et al., 2008), contributing
negatively to the shelf-life of the product. Taking into account this events should be advisable to minimize the
oxidation of the oils that will undergo refining.
References
AOCS (1998) Official Methods and Recommended Practices of the American Oil Chemists Society, AOCS Press,
Champaign, USA.
AOAC (2003) Official methods of analysis of Association of Official Analytical Chemists International. 17
th
ed. Horwitz W,
editor. AOAC Press, Arlington, USA.
Bernardini E (1983) Bleaching of fats and oils In Oilseeds, oils and fats, vol. II. Roma: Publishing House, pp.171-82.
Bilancia MT, Caponio F, Sikorska E, Pasqualone A, Summo C (2007) Correlation of triacylglycerol oligopolymers and
oxidised triacylglycerols to quality parameters in extra virgin olive oil during storage. Food Res Int 40:855-61.
Billek G (2000) Health aspects of thermoxidized oils and fats. Eur J Lipid Sci Tech 102:587-93.
Denise J (1996) Fats refining. In Oils & fats Manual. A. Karleskind (ed). Hampshire, UK: Intercept Ltd, 807-93.
15
th
68
15
th
Dobarganes MC, Perez-Camino MC, Mrquez-Ruiz G (1988) High performance size exclusion chromatography of polar
compounds in heated and non-heated fats. Fat Sci Technol 90:308-11.
Durante V, Caponio F, Summo C, Gomes T (2010) Messa a punto di un impianto di raffinazione per oli alimentari su scala di
laboratorio. Riv Ital Sostanze Grasse. In Press.
Farhoosh R, Einafshat S, Sharayei P (2009) The effect of commercial refining steps on the rancidity measures of soybean and
canola oils. Food Chem 115:933-8.
Frankel EN (1982) Volatile lipid oxidation products. Prog Lipid Res 22:1-33.
Frankel E, Neff WE, Selke E, Brooks DD (1988) Analysis of autoxidised fats by gas chromatography-mass spectrometry: X.
Volatile thermal decomposition products of methyl linoleate dimers. Lipids 23:295-8.
Garca A, Ruiz-Mndez MV, Romero C, Brenes M (2006) Effect of refining on the phenolic composition of crude olive oils.
J Am Oil Chem Soc 83:159-64.
Gertz C, Klostermann S (2000) A new analytical procedure to differentiate virgin or non-refined from refined vegetable fats
and oils. Eur J Lipid Sci Tech 102:329-36.
Gomes T (1992) Oligopolymer, diglyceride and oxidized triglyceride contents as measure of olive oil quality, J Am Oil Chem
Soc 69:1219-23.
Gomes T, Caponio F (1996) A study of oxidation and polymerization compounds during vegetabke oil refining. Riv. Ital.
Sostanze Grasse 73:97-100.
Gomes T, Caponio F (1998) Evaluation of the state of oxidation of olive-pomace olis. Influence of the refining process. J
Agric Food Chem 46:1137-42.
Gomes T, Caponio F (1999) Effort to improve the quantitative determination of oxidation and hydrolysis compound classes
in edible vegetable oils. J Chromatogr A 844:77-86.
Gomes T, Caponio F, Delcuratolo D (2003) Fate of oxidized triglycerides during refining of seed oils. J Agric Food Chem
51:4647-51.
Gomes T, Delcuratolo D, Paradiso VM (2008) Pro-oxidant action of polar triglyceride oligopolymers in edible vegetable oils.
Eur Food Res Technol 226:1409-14.
Guillen MD, Goicoechea E (2009) Oxidation of corn oil at room temperature: Primary and secondary oxidation products and
determination of their concentration in the oil liquid matrix from 1H nuclear magnetic resonance data. Food Chem
116:183-92.
Hopia A (1993) Analysis of high molecular weight autoxidation products using high performance size exclusion
chromatography: II. Changes during processing. Lebensm-Wiss Technol 26:56871.
Jung MY, Yooh SH, Min DB (1989) effects of processing steps on the contents of minor compounds and oxidation of
soybean oil. J Am Oil Chem Soc 66:118-20.
Medina-Jurez LA, Gmez-Meza N, Ortega-Garca J, Noriega-Rodriguez JA, Angulo-Guerrero O (2000) Trans fatty acid
composition and tocopherol content in vegetable oils produced in Mexico. J Am Oil Chem Soc 77:721-4.
Official Journal of European Communities (1991) European Community Regulation No. 2568/91. N.L 248 of July 11
th
.
Rossi M, Giannazza M, Alamprese C, Stanga F (2001) The effects of bleaching and physical refining on color and minor
components of palm oil. J Am Oil Chem Soc 78:1051-5.
Ruiz-Mndez MV, Mrquez-Ruiz G, Dobarganes MC (1997) Relationships between quality of crude and refined edible oils
based on quantitation of minor glyceridic compounds. Food Chem 60:549-54.
Saguy S, Dana D (2003) Integrated approach to deep fat frying: engineering, nutrition, health and consumer aspects. J Food
Eng 56:143-52.
15
th
69
15
th
Investigation of thiol compounds from yeast affecting wine properties

Daniela Fracassetti (daniela.fracassetti@unimi.it)
Dept. of Food Science, Technology and Microbiology, University of Milan, Milan, Italy
Tutor: Prof. Antonio Tirelli

This PhD thesis dealt the validation of liquid chromatography analytical method to determine the thiol
compounds in yeast cell-wall fractions. The addition of these preparations to wine can improve its sensorial
characteristics and increase the shelf-life. Cysteine, glutathione and thiol groups bound to the mannoprotein
fractions can be identified and quantified. Moreover, the glutathione content can be determined in grape juice,
must and wine employing the same analytical method.
Indagine dei composti tiolici metabolizzati dal lievito che influenzano le propriet del
vino
Questa tesi di dottorato ha riguardato la validazione di un metodo analitico in cromatografia liquida per la
determinazione dei composti tiolici nelle frazioni parietali di lievito impiegate nel settore enologico al fine di
migliorare le caratteristiche sensoriali del vino. Nello specifico, possibile identificare e quantificare cisteina,
glutatione e gruppi tiolici legati alle frazioni mannoproteiche di parete. Inoltre, con lo stesso metodo analitico,
possibile determinare il contenuto di glutatione in succo duva, mosto e vino.

Keywords: cysteine, glutathione, mannoprotein, Saccharomyces cerevisiae, thiols, yeast cell-wall, wine.
1. Introduction
In accordance with the PhD thesis project previously described, this oral communication reports the main results
of the following activities:
A1) quantification of free (Cys) and protein bound (SH) cysteine and reduced glutathione (GSH) in yeast cell-
wall fractions. An innovative analytical method for their quantification was validated;
A2) evaluation of the heat damage due to the industrial preparation through the furosine (-N-(2-
furoylmethyl)-lysine) quantification, a derivative of the Amadori compound;
A3) quantification of glutathione during winemaking;
A4) preliminary data concerning the interaction between caffeic acid, catechin, glutathione and sulphur
dioxide correlated to the oxygen consumption in wine.
2.1 Derivatization of thiol compounds
The derivatization of GSH and Cys was conducted as described by Tirelli et al. (2010): 2 mL of the samples
were added to 100 L of 400 M p-benzoquinone (pBQ) in methanol. After 1 minute mixing, 1 mL of 500 M
3-mercaptopropanoic acid (3-MPA) in 0.3 M citrate buffer pH 3.5 was added in order to remove the exceeding
pBQ.
2.2 Yeast cell-wall fraction
Thiols were quantified in the following yeast fractions: 4 mannoproteins, 4 hulls, 4 lysates and 2 extracts;
moreover, 16 active dried yeasts were analyzed. All the samples were commercially provided.
The samples were treated as described by Tirelli et al. (2010): amounts in the range 1 g L
-1
to 100 g L
-1
were
dispersed (or dissolved if mannoproteins) in 50 mM citrate buffer pH 5. After derivatization (see paragraph 2.1)
the suspension was centrifuged at 14000 x g for 5 minutes and the supernatant was microfiltered prior the HPLC
separation. Mannoprotein solutions were derivatized as above and ultrafiltered (3 kDa cut-off) after the addition
of 3-MPA.
The retentate was washed twice with 0.5 mL hydrochloric ethanol (0.1%) (Ummarino et al., 2001) and dried
under vacuum; the dried material was re-dissolved in 0.5 mL water. Such solution and the permeate were
separately analyzed by HPLC.
The HPLC separation was performed by a hexyl-phenyl column (250 x 4.6 mm, 110, Phenomenex). Eluents
were water/trifluoroacetic acid (0.05% v/v) and methanol; the concentration of the latter increased from 10% to
35% of methanol in 18 minutes in the eluting gradient. Detection was carried out by spectrophotometry at 303
nm wavelength.
Both furosine level and protein content were determined as described by Resmini et al. (1990).
15
th
70
15
th
The acid hydrolyzed obtained for the furosine quantification was dried under vacuum and re-dissolved in 0.15 M
sodium carbonate buffer pH 8.6 in order to determined the overall Cys content according to Krause et al. (1995).
2.3 Grape juice, must and wine
Six grape samples from different cultivars, 13 red wine samples and 6 white wine samples, produced from
different grape cultivars, vintages and winemaking, were collected at the market. Must and wine samples were
obtained from 8 winemaking processes performed in 4 different wineries with 4 grape cultivars (Chardonnay,
Sauvignon, Pinot and Trebbiano) and 7 S. cerevisiae strains.
The extraction of GSH from grape juice were performed introducing 250-300 g of grape in a plastic bag. The
berries were kept under vacuum after the addition of 2 mL 0.12 M NaF and 0.75 mL 0.5 M EDTA. The grape
was hand crushed and the juice obtained was stored at room temperature for 60 minutes. The juice was extracted
from the plastic bag and then transferred in a beaker and maintained under nitrogen flow for 2-3 minutes. The
derivatization was conducted as described above on 2 mL juice (paragraph 2.1); the reaction mix was
microfiltered prior the HPLC separation.
Must and wine were stirred at 5000 x g for 5 minutes. The supernatant was added to 100 L ethanal 320 mM, it
was derivatized as described above (paragraph 2.1) after 15 minutes resting and it was microfiltered.
The HPLC separation was performed as described for the yeast cell-wall fractions (paragraph 2.2).
2.4 Evaluation of oxidation rate
Sauvignon Blanc wine was treated with bentonite (0.1 g L
-1
) and active carbon (0.4 g L
-1
) in order to remove
proteins and phenols, respectively.
The wine was kept at 37C, added to SO
2
50 mg/L if expected, stirred to saturate it with oxygen and caffeic acid
or catechin and GSH if expected, were added at the concentration 0.22 mM. Wine was transferred in a 100 mL
bottles and the bottles were closed by tight cap. The wine was stored at 37C. The oxygen concentration was
periodically monitored (2-3 times daily). The SO
2
(free and total) was measured by a titration with KI. The GSH
derivatized with pBQ (paragraph 2.1) and caffeic acid or catechin were determined by UPLC.
The UPLC separation was performed by a C18 column (100 x 1.7 mm, Waters). Eluents were
water/trifluoroacetic acid (0.05% v/v) and methanol; the concentration of the latter increased from 10% to 35%
in 8,5 minutes in the eluting gradient. Detection was carried out by spectrophotometry at 303 nm, 280 nm and
320 nm wavelength for GSH, catechin and caffeic acid, respectively.
Color changes were also monitored at wavelength 280 nm, 420 nm and 440 nm.
3.1 Derivatization of thiol compounds
Derivatized Cys, GSH and MPA were separated by HPLC under the analytical conditions adopted. Low amounts
of pBQ could also be reduced to hydroquinone (HQ). The UPLC analysis allowed the separation of derivatized
GSH, caffeic acid and catechin. Following to derivatization, free Cys, GSH, HQ, MPA caffeic acid and catechin
were quantified directly from the chromatographic peak areas.
3.2 Yeast cell-wall fractions
Besides GSH and free Cys, the protein Cys was significant to evaluate the antioxidant potential of yeast cell-wall
fraction. It was determined as follows:

[Cys]
prot
= [pBQ] ([Cys]
free
+ [HQ] + [GSH] + [3MPA]
derivatised
) (1)

The precision parameters for the quantification of free Cys, protein Cys and GSH were assessed by analyzing
one sample of yeast hull and two samples of yeast lysates. An average value of 5.4% can be assumed for the
relative standard deviation (RSD) of Cys thiol concentrations exceeding 10 M.
The detection limit for Cys and GSH was 0.30 M and 0.26 M, respectively; for the same compounds, the
quantification limit was 1.0 M and 0.85 M, respectively.
No interferences due to disulphide bonds and reactions with carbohydrates were detected, as demonstrated the
calibration curves performed in water and water solutions of lisozyme, starch and partially caramelised starch
(starch heat-treated at 120C for 24h at pH 1 with 1 M HCl). No important differences were found, except the
free Cys concentration could be about 20% understimated in starch.
The content of thiols in samples of commercial yeast-fractions was very heterogeneous (table 1). Mannoproteins
samples contained neither free Cys nor GSH. Sample M4 showed the highest amount of bound Cys (i. e. 0.51
mmol/100 g product), therefore the production of mannoproteins having low heat damage and high thiol content
can be obtained. The overall Cys was lower in sample M1 and M2, but the former was characterized by the
lowest protein content. Sample M2, despite a protein content comparable to the other samples of cell-wall
fractions, had the highest furosine index, probably due to a stronger heat damage following the preparation
procedure, as demonstrated by the low content of bound Cys.
Similar levels of protein Cys content were detected in hulls samples, except H4 which contained high amounts of
both free Cys and GSH (2.6 and 0.85 mmol/100 g product, respectively). Probably, such free thiols were added
by the producer to increase the antioxidant properties since Cys was not detected in active dry yeasts (table 2).
15
th
71
15
th
Table 1 Quantification of thiol groups in commercial yeast cell-wall fractions: mannoproteins (M), hulls (H),
lysates (L) and extracts (E).
Yeast
fraction
Protein Furosine
Unrecovered
Cys
Free
Cys
GSH
Protein
Cys
Overall
Cys
(%)
(mg/100 g
protein)

(mmol/100 g product)
M1 2,9 28 <0,01 0 0 0,03 0,55
M2 10,5 254 <0,01 0 0 0 0,54
M3 9,0 62 0,04 0 0 0,03 2,3
M4 8,8 67 0,41 0 0 0,51 3,1
H1 7,5 17 0,04 0 0 0,08 3,3
H2 8,8 12 0,03 0 0 0,07 4,4
H3 8,9 6 0,04 0 0 0,14 3,3
H4 11,9 12 0 2,6 0,85 0,86 10,6
L1 10,0 3 0 0 0,45 0,73 6,9
L2 17,9 5 0 0 0,33 1,4 15,8
L3 16,8 38 0 0,32 4,6 0,81 12
L4 14,3 3 0 0,07 2,8 1,3 8,1
E1 21,7 154 0,46 0 0 1,1 37,4
E2 23,9 20 0,29 0 0 0,76 25,4

High contents of thiolic compounds were found in yeast lysates (i. e. 5.7 mmol/100 g product) due to the release
from the cytoplasm after the lysis. Cys and GSH could have been added in these samples, too.
Samples M4, E1 and E2 were also able to bind soluble free thiols (i.e. 0.4 mmol Cys/100 g product, 0.5 mmol
Cys/100 g product and 0.3 mmol Cys/100 g product, respectevely); therefore these fractions could deplete wine
from its varietal flavours or remove the mercaptans responsible for the reduced odours. Such a behaviour can be
useful in aging or bottling of white wine without exposing the product to oxygen.
Higher furosine values may arise from degradative preparation procedures of yeast cell-wall fractions. Moreover,
strong heat treatments can give unpleasant odour and flavour to wine.
Mannoproteins having lower heat damage and higher thiols content should be produced in order to increase the
antioxidant potential of wine.
The active dried yeast samples showed similar thiol patterns (table 2). High amounts of GSH were detected,
likely due to a partial cell-wall lysis that occurs following the industrial preparation.
Table 2 Characterization of active dried yeasts.
Active dried
yeast
Protein Furosine

GSH
Protein
Cys
Overall
Cys
(%) (mg/100 g protein) (mmol/100 g)
1

11.3 2.7

0.92 0.76

7.1
2

11.0

0.45 0.80

3

10.5

0.71 0.86

4

12.0 3.6

0.39 0.88

6.8
5

12.0

0.73 0.89

6

10.3 7.6

0.63 0.90

6.9
7

12.0

0.77 0.91

8

12.0

0.60 0.91

9

11.2

0.83 0.91

10

13.9 7.8

0.55 0.95

4.5
11

11.0

0.45 0.96

12

9.2

0.54 0.97

13

16.9 2.3

0.58 0.99

7.8
14

13.6 6.4

0.82 1.02

7.8
15

14.9

0.58 1.05

16 11.2 0.63 1.28

Average 12.1 5.1 0.64 0.94 6.8

15
th
72
15
th
3.3 Grape juice, must and wine
The derivatization of GSH with pBQ has linear response for added GSH concentrations ranged from 0 M to
100 M. Calibration curves in juice and citrate buffer show very similar response as described by their slopes
(figure 1). Higher absolute values were detected in white wine because of the native GSH content.

The preparation of juice, must and wine samples is easy, rapid and accurate. The analytical procedure proposed
can be use for routine analysis employing apparatus commonly available in laboratories which perform must and
wine control analysis.
The detection and quantification limits for GSH are 0.42 M and 1.41 M, respectively.
Quantification of cysteine is allowed (detection limit 0.54 M and quantification limit 1.80 M) by the proposed
method.
The GSH concentration detected in the grape samples ranged from 130 M to 246 M, according to the data
reported in literature (Cheynier et al., 1989).
No red wine sample contained GSH; in white wines, the maximum GSH amount revealed was 10 M.
GSH content was monitored during 8 winemaking processes of white wines performed under different redox
conditions, production areas, grape cultivars and S. cerevisiae strains. Must and wine shares were drawn during
winemaking for up to 40 days after the yeast inoculum. The fermentation processes were conducted at
temperature ranged from 17C to 26C. The content of readily assimilable nitrogen in musts exceeded 220 mg L
-1
,
except in one must which had 129 mg L
-1
of readily assimilable nitrogen. GSH content was lower than 3 M
(< 1 mg L
-1
) after fining even when obtained under reduced conditions (pressing grape under N
2
).
GSH increased after the middle of the alcoholic fermentation due to yeast metabolic activity and following to the
cell lysis. The GSH maximum in 7 winemaking ranged from 34 M to 63 M, concentrations slightly lower than
those quantified in literature (Cheynier et al., 1989), regardless grape cultivar, production area and yeast strain.
GSH content decreased gradually to 13 - 24 M at the end of the alcoholic fermentation and during the ageing
on the lees in stainless steel vat. Two winemaking were performed with the same S. cerevisiae strain but they
show different behavior of the GSH content during the alcoholic fermentation. Therefore, factors other than
yeast strain can affect the GSH content in must and wine.
In winemaking from must having the lowest readily assimilable nitrogen, the maximum GSH was detected after
grape pressing (< 3 M); before the yeast inoculum, the GSH concentration was less than 2 M and no GSH was
revealed after 5 days from the inoculum. It means the yeast could not release GSH during the alcoholic
fermentation if it grew and fermented in nitrogen starvation, according to the literature (Lavigne and
Dubourdieu, 2004).
The role of S. cerevisiae in the GSH content of wine is essential since the GSH deriving from grape appears to
be lost before fermentation. An adequate amount of nutrients, such as nitrogen and sulphur, can affect the GSH
yeast metabolism thus increasing the GSH concentration in wine. GSH from yeast can insure the antioxidant
activity and volatile and thiol-related aromas protection in white wine.
The GSH levels detected in the wine samples could be enough to protect the product from oxidation during the
ageing, as reported by Lavigne and Dubourdieu (2004).
3.4 Evaluation of oxidation rate
The total phenols content in Sauvignon Blanc wine after treatment with active carbon was lower than 18 mg L
-1
;
no caffeic acid and catechin were detected. It contained also GSH 2 M.
The presence of metals, as iron and copper, can increase the oxidation rate (Danilewicz, 2007). The
concentration of Fe and Cu in the tested wine was 0.21 mg L
-1
and 0.12 mg L
-1
, respectively. No extra amount
was added.
The wine contained 5.5 mg L
-1
of free SO
2
and 17.2 mg L
-1
of total SO
2
. Since no SO
2
was added to wine, it
could have origin from the yeast strain employed in fermentation.
y
juice
= 7,19 x + 698,4; R = 0,9994
y
citrate buffer
= 7,99 x - 2,59; R = 0,9999
y
white wine
= 5,94 x + 72,0; R = 0,9986
y
red wine
= 5,88 x + 25,9; R = 0,9995
0
400
800
1200
1600
0 20 40 60 80 100 120
A
r
e
a

(
m
V
*
s
)
Concentration added ( M)
Figure 1: Calibration curves from known
additions of GSH to citrate buffer (),
grape juice (), white wine () and red
wine ().
15
th
73
15
th
The concentration of caffeic acid, catechin and GSH added was in line to the amounts found typically in white
wine. Beside to the equimolar concentration considered in the experiment, the amount of SO
2
was added
according to the limit allowed by the law.
Wine was stored at 37C in order to increase the oxidation rate.
As expected, the oxygen consumption was faster in presence of GSH and SO
2
and the O
2
was completely
consumed after 16 days in presence of caffeic acid and after 30 days in presence of catechin. Both GSH and SO
2

decreased during the experiments. The consumption rate of SO
2
was similar either for caffeic acid or for
catechin, while GSH concentration decreased faster in presence of catechin. The adsorbance at 280 nm decreased
in presence of caffeic acid and it increased for catechin. Its values at 420 nm and 440 nm increased for caffeic
acid and remained stable for catechin.
In wine samples not added with GSH and sulphite, O
2
was detected for longer than 80 days in both the
experiments. The oxygen consumption was slightly faster in presence of catechin than caffeic acid. The low
concentration of SO
2
was consumed slower in presence of caffeic acid than catechin; the opposite happened for
the GSH consumption. The adsorbance at 280 nm increased either in presence of caffeic acid or catechin, while
its values at 420 nm and 440 nm remained stable for caffeic acid and decreased for catechin.
Wine containing increased concentration of thiol compounds, GSH in particular, is assuming particular interest
due to their effect on the protection against oxidation both during winemaking and shelf-life. The GSH content
could be affected by the yeast strain, yeast growth conditions (i. e. nitrogen content in must, grape cultivar,
temperature, oxygen) and the winemaking process. The addition of yeast-cell wall fractions could represent an
useful tool in wine protection and the production of mannoproteins having lower heat damage and higher thiols
content should be obtained to improve the antioxidant potential of wine. Moreover, the relationship between
GSH, SO
2
and phenols permit to better understand the rate and the resistance against the wine oxidation.
The selection of high producer strains of mannoprotein having high thiols content and the individuation of the
better yeast growth conditions (i. e. medium, temperature, growth phase) are important to produce fractions with
better antioxidant performances. Further investigations concerning the preservation and the metabolism of GSH
during winemaking and its interactions with phenols and SO
2
in oxidation protection of wine could explain more
clearly the metabolic and the chemical mechanisms involving GSH.
5. Selected References:
Cheynier V, Souquet JM, Moutounet M (1989) Glutathione content and glutathione to hydroxycinnamic acid
ratio in Vitis vinifera grapes and musts, Am J Enol Vitic 40: 320-4.
Danilewicz JC (2007) Interaction of sulfur dioxide, polyphenols, and oxygen in a wine-model system: central
role of iron and copper, Am J Enol Vitic 58: 53-60.
Krause I, Bockhardt A, Neckermann H, Henle T, Klostermeyer H (1995) Simultaneous determination of amino
acids and biogenic amines by reversed-phase high-performance liquid chromatography of the dabsyl
derivatives, J chromatogr 715: 67-79.
Lavigne V, Dubourdieu D (2004) Affinamento sulle fecce e freschezza dei vini bianchi, Vignevini 31:58-66.
Resmini P, Pellegrino L, Battelli G (1990) Accurate quantification of furosine in milk and dairy products by a
direct HPLC method, Italian J Food Science 2: 173-83.
Tirelli A, Fracassetti D, De Noni I (2010) Determination of reduced cysteine in oenological cell wall fraction of
Saccharomyces cerevisiae, J Agric Food Chem 58: 4565-70.
Ummarino I, GarciaMoruno E, Di Stefano R (2001) Interazione polifenoli - scorze di lievito, Riv Viticultura
Enologia 54: 37-45.
15
th
74
15
th
Interaction between proteins of plant origin and wine components:
molecular-based choice of protein fining agents for organoleptic
improvement
Tiziana Mariarita Granato (tiziana.granato@unimi.it)
Section of Biochemistry, DISMA, University of Milan, Via G. Celoria 2, 20133 Milan, Italy
Tutors: Prof. Francesco Bonomi, Prof.ssa Stefania Iametti

Protein-based fining agents are commonly employed to improve the stability of wine and to control browning
and over-oxidation events during storage and ageing. The formation of covalent and non-covalent interactions
between the protein matrix and wine polyphenolics is the basis of the flocculation and of the consequent
clarification which results in an overall improvement of wine quality parameters. In this work we studied the
molecular basis of the interactions between plant proteins and polyphenolic/aroma compounds in wine-like
model solutions and wines by using up-to-date methodologies. The final objective is to use protein finings to
specifically control the concentration of specific classes of compounds.
Effetto del trattamento con proteine vegetali sulle componenti aromatiche e tanniche del
vino: selezione su base molecolare di coadiuvanti proteici per il miglioramento della
qualit organolettica dei vini
Il collaggio proteico consente di rimuovere dal vino sostanze di natura colloidale responsabili della torbidit,
controllare imbrunimento e polimerizzazione ossidativa di composti polifenolici nonch ridurre la sensazione di
astringenza. In questo lavoro sono state studiate le basi molecolari dell interazione preferenziale tra molecole
idrofobiche, responsabili di diverse note organolettiche in vini (polifenoli e molecole odorose), e proteine
vegetali utilizzabili per trattamenti di chiarifica in enologia. Sono state caratterizzate qualitativamente e
quantitativamente le molecole che legano selettivamente chiarificanti proteici di varia origine. Il fine della
sperimentazione lutilizzo razionale dei chiarificanti allo scopo di rimuovere e/o trattenere nel vino classi
specifiche di composti, migliorandone caratteristiche organolettiche e stabilit.

Key words: Fining treatment, vegetal proteins, white wine model solution, flavan-3-ol monomers and polymers,
ANS, protein hydrophobicity, HPLC, mass spectrometry.
1. Introduction
Gelatine, casein, egg albumin, and, more recently, proteins from plant sources are commonly used in
winemaking as fining agents to remove particles responsible for turbidity, to improve stability, and to control
browning, over-oxidation, and bitterness during ageing (Spagna et al., 2000; Cosme et al., 2008). The formation
of covalent and non-covalent interactions (hydrogen bonds and hydrophobic interactions) between the protein
matrix and wine polyphenolics is the basis of the flocculation and of the consequent clarification which results in
an overall improvement of wine quality parameters (Versari et al., 1999; Sarni-Machado et al., 1999).
In accordance with the PhD thesis project previously described, we studied the molecular basis of the
interactions between selected plant proteins (soybean, pea, lentil and gluten proteins) and polyphenolic and
aroma compounds by using spectrometric and mass spectrometry methodologies (LC-ESI MS, MALDI TOF
MS). Protein surface hydrophobicity was investigated in a wine-like model system by spectrofluorimetric
determination of changes in the binding properties of 1,8-anilinonaphthalenesulfonate (ANS), used as extrinsic
fluorescent probe. Hydrophobic interactions between phenolic compounds and protein finings were evaluated by
the study of competition of phenolic compounds with the ANS probe for the same binding sites. Structural
characterization of phenolic compounds (polymer chain length and chemical structure and composition of
individual chains), as well as their interactions with the plant proteins, essential for the definition of protein
binding affinity, was performed by means of mass spectrometry techniques. Differences among interactions
between polyphenols with the various protein matrices have been related with the quality parameters of the
resulting wines.
The wine-like model solution used was ethanol/water (10:90 v/v), buffered at pH 3.5 by adding tartaric acid. The
fining agents for experimental activities included commercial protein extracts from soybean and pea, lentil flour,
and gluten proteins.
15
th
75
15
th
Probe binding studies. Protein surface hydrophobicity was assessed by using 1,8-anilinonaphtalensulphonate
(ANS) as a fluorescent probe. Binding of ANS was monitored at !ex 390 nm and !em 460 nm; multiple addition
of the fluorescent probe were done up to saturation with the probe (constant fluorescence response). Titration
results were analyzed by standard binding algorithms that allowed to estimate the overall binding capacity of the
proteins for the probe (given as fluorescence at saturating ANS, F
max
) and the apparent dissociation constant of
the proteins-ANS complex (K
d
app
). The overall binding capacity (F
max
) was then corrected for the total protein
content of each sample. A protein surface hydrophobicity index was calculated as [Fmax (corrected for the
protein content) x (K
d
app
)-1] (Bonomi et al., 2004). The ability of insoluble proteins to bind ANS was measured
by adding an excess of the fluorescent probe (> 2 " Kdapp) to a suspension of proteins in a wine-like solution.
An aliquot of the supernatant was mixed with a detergent solution (Triton X-100 2% w/w), that incorporated free
ANS and ANS bound to soluble proteins. The amount of ANS in the micellar phase was quantitated
spectrofluorimetrically by adding ANS as an internal standard.
Competition studies. Hydrophobic interactions between polyphenol compounds and proteins of plant origin
were evaluated by competition studies. Excess ANS (> 2xK
d
app
) was added to protein suspensions. The decrease
in ANS fluorescence due to probe displacement or by quenching was measured as a function of added
polyphenolics (catechin or oligomeric proanthocyanidins). Concentration of oligomeric proanthocyanidins was
expressed as catechin equivalents. Titration with polyphenolics was continued until no further changes in
fluorescence were observed.
Mass spectrometry analysis. Proteins (200 mg/L) were added to oligomeric proanthocyanin complexes (OPC)
solutions (1 mg/mL) in 20 mL of wine-like buffer. Each sample was mixed for 30 minutes, and centrifuged at
3000"g for 15 minutes. For qualitative and quantitative purposes, monomeric/oligomeric proanthocyanidins in
model solution and molecules flocculated by interaction of these compounds with finings were analyzed by LC-
ESI MS and MALDI-TOF MS. Pellets were taken up either in wine-like buffer or in a 2:1 mixture of acetonitrile
and 0.1% TFA in water, and centrifuged before the analysis. LC ESI-MS was carried on a single quadrupole
instrument (HP1100-MSD, Agilent Technologies, Santa Clara, CA, USA) and by using C18 columns (Vydac,
Hesperia, CA, USA; 2.1 " 250 mm). MALDI-TOF spectra were recorded in positive-ion mode, using a Voyager
DE-Pro spectrometer (PerSeptive BioSystems, Framingham, MA) equipped with a N2 laser (337 nm). Alpha-
cyano-4-hydroxycinnamic acid (Fluka, Buchs, Switzerland) was used as the matrix.
Fining experiments. Young white and red wine of vintage 2009 was used in this study made from various
grapevine varieties (all Vitis vinifera) from the Campania Region, Italia. Fining tests were performed in
graduated cylinders (volume, 100 mL). As the clarifying activity of tested proteins was totally unknown, doses
used for the tests were 20 gr/hl. Optical density at 420 nm (for white wines), colour intensity index (A
420
+ A
520
+
A
620
) and tonality (A
420
/A
520
)

for red wines, turbidity and the volume of lees generated were measured 1, 4, 10,
20, 32, 48, 60 and 168 h after the addition of fining agents. The quali-qualitative analysis of odorous compounds
(varietal molecules such as terpenes, volatile phenols and non varietal compounds such as acids, esters,
aldehydes, lactones, etc) was performed by the analytical approach of solid phase micro-extraction (SPME) and
gas chromatography-mass spectrometry (Nasi et al., 2008).
3.1 Protein surface hydrophobicity
Spectrofluorimetric titrations with increasing ANS of protein suspensions in wine-like buffer are presented in
Figure 1: the various preparations of plant proteins had evident differences in their overall binding capacity
towards the probe.

Figure 1. Fluorometric titration with 1-anilino-8-
naphtalene sulphonate (ANS) of soybean, pea,
lentil flour, and gluten proteins (each at 1 mg
protein/ml in a wine-like model solution (10%
ethanol (v/v), tartrate buffer, pH 3.50)).

The number of surface sites available for binding of the probe is expressed by F
max
, the fluorescence at saturating
probe concentration corrected for the protein content of individual preparations. Soybean proteins were
characterized by the highest number of binding sites per unit mass protein followed by pea proteins, by gluten,
and by proteins in lentil flour. Insoluble proteins in soybean and pea preparations (accounting for 99.44 and
99.06 % of total proteins, respectively, in the wine-like buffer used in these studies) captured almost 50% of the
15
th
76
15
th
fluorescent probe initially present, whereas the almost completely insoluble gluten and insoluble proteins in
lentil flour (99.76 % of the total proteins) managed to capture about 30% and 20%, respectively, despite the
modest overall affinity of these proteins for the probe as assessed by the titration studies shown in Figure 1.
3.2 Competition studies
The specificity of the interactions between polyphenols and proteins of plant origin was evaluated by
competition studies, in which polyphenols were tested for their ability to displace protein-bound ANS. As shown
in Figure 2, the addition of increasing amounts of either catechin or oligomeric proanthocyanidins resulted in a
detachment of the hydrophobic probe from the probe and so a decrease of ANS fluorescence in all cases. This
finding seems to confirm that the interactions between proteins and phenolic compounds are governed by
hydrophobic forces. Indeed, for both catechin and oligomeric proanthocyanidins, the ability to compete with the
probe was higher for those proteins having
the lower surface hydrophobicity.

Figure 2. Decrease of ANS fluorescence upon
addition of increasing amounts of oligomeric
proanthocyanidins to wine-like model solutions
(10% ethanol (v/v), tartrate buffer, pH 3.50)
containing 60 #M ANS and 1 mg/ml of proteins
of various origin. Concentration of oligomeric
proanthocyanidins is given as cathechin
equivalents.

The same competition approach was used to assess the amount of ANS remaining bound to the insoluble fraction
after incubation of each protein system in the presence of fixed concentrations of ANS (0.1 mM) and oligomeric
proanthocyanidins (10 mM as cathechin equivalents). The excess of proanthocyanidins was unable to prevent
binding of ANS to the insoluble proteins in any of the systems.
3.3 Structural characterization of phenolic compounds before and after interaction with protein finings
In order to investigate the molecular basis of tannin-protein associations, each of the various fining agents
(protein concentration 200 mg/l) were added to OPC wine-like model solution, that were stirred for 30 minutes
and centrifuged. The identification of newly formed compounds and the changes in composition and
concentration of OPCs in the resulting supernatants and the pellets were analyzed by LC-ESI MS and MALDI
TOF MS. Proanthocyanidin solution, without addition of fining agents, were used as control solution. Total ion
current chromatograms of all treated wine-like systems resembled those obtained for OPC standard solution,
which allowed to identify the small oligomeric flavan-3ols. This finding was also supported by MALDI TOF
mass spectrometry results (data not shown): all tested protein fining agents selectively removed polymeric
proanthocyanidins, lowering their mean degree of polymerization in fined model wine with respect to the
unfined one. Characterization and estimates of the relative amounts of polyphenols precipitated from wine-like
model system were made by LC-ESI MS analysis of pellets after fining treatment. All the pellets showed the
presence of newly formed products. For instance, we observed the presence of vinyl-catechin and vinyl-
epicatechin (m/z 316), eluting later than their unmodified compounds (figure 3), and originating by
catechin/epicatechin auto-polymerization induced by acetaldehyde.
Figure 3. A) TIC (total ion current) chromatogram obtained in positive ion mode by injection of insoluble fraction of pea
protein isolate (1 mg/ml in 10% ethanol (v/v), 10 mM proantocyanidins, tartrate buffer, pH 3.50). B) ESI mass spectra
obtained from the TIC chromatogram for 20.52 minute elution time, showing the [M-H]+ peaks of vinyl-catechin (m/z 316).
15
th
77
15
th
3.4 Fining experiments
The study of the mechanism of interaction of proteins and phenolic compounds was extended to real wine with
fining experiments on a laboratory scale, monitoring turbidity, optical density and lees volume after treatment. In
order to evaluate clarifying efficiency, white (Fiano and Catalanesca varieties respectively) and red wines
(Aglianico var.) were treated with protein fining agents at the end of alcoholic and malolactic fermentation.
Catalanesca wines were fined after cold stabilization. The fining agents tested allowed efficient clarification of
white and red wines: for all treatments the turbidity and the optical density values obtained always decreased
with time (4, 10, 20, 32 and 168 h of settling). For doses of 20 g/hl on white wines, the protein finings have
relatively similar activities despite differences in their biochemical characteristics: the clarifying efficiencies of pea
protein and lentil flour were situated between the efficiencies values for soy and gluten protein in both white wines
tested (figure 4 and 5 A). Differences were observed for the kinetic of clarifying because of higher initial turbidity of
Fiano wine.
Figure 4. A) Kinetics of the Catalanesca white wine clarifying. B) Content (in mg/l) in low molecular weight procyanidins
in fined Catalanesca wine.
We also carried out a detailed quantitative LC-MS analysis of the most important flavonoid compounds with
respect to white wine oxidation (monomeric and dimeric proanthocyanidins), in order to evaluate which
molecules were most prefencially removed by the various proteins. The browning capacity of white wines
depends largely on the nature of polyphenols: the monomeric catechins and the dimeric procyanidins browning
more intensely than other phenolics (Lee et al., 1988). A general decrease in the concentration of all these
species considered as a whole - was observed after treatment with proteins (figure 4 B). Lentil flour was the
most effective removal agent, followed by gluten, soy, and pea proteins: this observation is in agreement with
the competition experiments results. The differences in clarifying efficiency is likely related to the molecular
composition, the biochemical characteristics, and the conformation of proteins relevant to the complex
interactions that ultimately lead to flocculation of their complexes with polyphenols and to clarification of wine.
The effect of tested finings on the volatile composition of wine was investigated by the analytical approach of
solid phase micro-extraction (SPME) and GC MS and compared with gelatin, the most common fining agent of
animal origin used in wine-making. All protein fining agents reduced the total concentration of the aromatic
families responsible of varietal and fermentative aroma in the same range as gelatin (figure 5 B).
Figure 5. A)Kinetics of the Fiano white wine clarifying. B) Percentage content of aroma compounds in fined Fiano wine
normalized on reference wine
The fining treatments of red wines were performed including also two preparations obtained from enzymatically
hydrolyzed pea proteins. Lentil flour, soy proteins and the hydrolyzate of pea protein 1 showed a very good
fining behaviour in red wine. The hydrolyzed pea protein presented a slower fining rate, probably because of the
time needed for the flocculate formation, but, after 168 h, their clarifying efficiency was comparable and also
15
th
78
15
th
better then their native proteins and gelatin (figure 6 A). Proteins of non-animal origin produced also less lees
volume than gelatin: this observation was interesting for winery because it means high yield in wines.
Figure 6. A)Kinetics of the Aglianico white wine clarifying. B)Percentage content of anthocyanin monoglucosides in fined
Aglianico wine respect to unfined wine.
Qualitative and quantitative analysis of anthocyanin compounds were performed by LC-ESI MS before and after
treatments. The content of anthocyanins monoglucosides, of their acetyl and p-coumaryl-derivatives and of
condensed anthocyanin-tannin compounds (ethyldiene bridged anthocyanin- flavan-3-ol oligomers,
anthocyanin- vinyl-flavan-3-ol pigments) decreased after treatments. This fining-induced loss of anthocyanin
content was expected in view of previous reports of the same effects (Maury et al. 2001). Figures 6 B) showed
the percentage of total anthocyanin monoglucosides of treated wines with respect to the unfined wine: the
behaviour of decrease of these compounds remarked those of turbidity. However, if the loss was studied in terms
of individual molecules, there is evidence that molecular specificity plays a role in governing the interaction
between hydrophobic sites on the protein surface and the molecules considered here.
However, although the proteins used reduced the anthocyanins content and colour intensity of fined wines, they
did not modify the wine tonality, in accordance with other studies (Lefebvre et al., 2000).
The molecular characterization of the effect of the fining agents on wine components allowed to assess
molecular properties of protein of plant origin in terms of surface hydrophobicity, number and affinity of binding
sites on the surface of the various proteins. The competition studies confirm the ability of phenolic compounds to
compete with the probe, but the interpretation of results was made difficult by simultaneous binding of the
fluorescent probe and of polyphenols. This indicates the existence of multiple binding sites on the protein
surface, with a possible different specificity for the various wine compounds. This observation implies that
proteins of different origin may selectively bind peculiar fractions in a complex mixture of polyphenols,
suggesting the possibility to selectively use protein agents for "fine tuning" the properties of the finished product
with respect to important organoleptic properties and to their stability. In experiments on real white and red
wines we found that these protein matrices reduced the wine turbidity in percentages comparable to the effect of
gelatin and produced less lees volume than did the conventional fining agent.
5. References
Spagna G, Barbagallo R N, Pifferi P G (2000) Fining treatements of white wines by means of polymeric adjuvants for their stabilization against
browning. J. Agric. Food. Chem., 48: 4619-4627.
Cosme F, Richardo-da-Silva J M, Laureano O (2008) Interactions between protein fining agents and proanthocyanidins in white wine. Food
Chemistry, 106: 536-544.
Versari A, Barbanti D, Potentini G, Parpinello G P, Galassi S (1999)Preliminary study on the interaction of gelatine-red wine. Ital. J. Food Sci., 11:
231-239.
Sarni-Machado P, Deleris A, Avallone S, Cheynier V, Moutounet M (1999) Analysis and characterization of wine condensed tannins precipited by
proteins used as fining agent in enology. Am. J. Enol. Vitic., 50: 81-86.
Bonomi F, Mora G, Pagani M A, Iametti S (2004) Probing structural features of water-insoluble proteins by front-face fluorescence. Anal.
Biochem., 329: 104-111.
Nasi A, Ferranti P, Amato S, Chianese L (2008) Identification of free and bound volatile compounds as typicalness and authenticity markers
of non-aromatic grapes and wines through a combined use of mass spectrometric techniques, Food Chemistry, 110: 762-768.
Lee C Y, Jaworski A W (1988) Phenolic and browning potential of white grape grown in New York. Am. J. Enol. Vitic. , 39, 337-340.
Maury C, Sarni-Manchado P, Lefebvre S, Cheynier V, Moutounet M (2001). Influence of fining with different molecular weight gelatins on
proanthocyhanidin composition and perception of wines. American Journal of Enology and Viticulture, 52: 140145.
Lefebvre S, Gerland C, Maury C, Gazzola M (2000). Nouvelles colles vegetales: origines, proprietes et performances. Revue Francaise
dOenologie, 184: 2831.

15
th
79
15
th

Evaluation of the use of milk as bioindicator of the environmental
contamination of dl-PCB and PCDD/F
Esteban Herrera (egherreranunez@unite.it)
Dept. Food Science, University of Teramo, TE, Italy
Tutor: Prof. Michele Amorena

The aim of the PhD project was to study the relationship between milk and soil contaminated with PCDD/F and
dl-PCB in Campania (Italy) by applying GIS-based techniques. The project involved geostatistical interpolations
(ordinary kriging) of the soil contamination and further regression analysis. The ordinary least squares (OLS)
regression showed a statistically significant correlation between milk and soil for the 3 matrixes studied (buffalo,
cow and sheep milk). However, the Koenker test indicated that the relationship between the variables was
spatially variable . Consequently, a Geographically Weighted Regression (GWR) was performed to improve the
model, showing R
2
values of 0.66, 0.52, 0.57 for buffalo, cow and sheep milk contaminated with PCB
respectively. The Global Moran's I test performed to the standardized residuals showed a clustered distribution in
the case of buffalo milk. For the PCDD/F the R
2
obtained with the GWR was 0.40, 0.21, 0.29 for the sheep, cow
and buffalo milk respectively with the residual distributed randomly only for cow milk.
Valutazione del latte come bioindicatore della contaminazione ambientale con diossine e
PCB diossina simili
Lobiettivo del lavoro stato quello di studiare tramite tecniche geostatistiche la relazione tra il latte prodotto da
alcune specie di animali di allevamento ed il suolo contaminato con dl-PCB e diossine. La prima fase stata
quella di creare delle mappe continue della contaminazione del suolo attraverso linterpolazione dei dati puntuali
che, insieme ai dati di contaminazione del latte, sono state utilizzate per determinare la relazione tra le due
variabili in studio attraverso una regressione lineare. La regressione ha evidenziato una relazione positiva e
significativa tra la contaminazione del suolo e quella del latte per le 3 matrici, ci nonostante, il Koenker test ha
determinato che la relazione tra le due variabili si modifica nello spazio. Di conseguenza, stata necessaria
lapplicazione di una Geographically Weighted Regression, con la quale si sono ottenuti dei valori di R
2
di 0.66,
0.52 e 0.57 nel caso del latte bufalino, bovino e ovino contaminato con PCB rispettivamente. Dallanalisi dei
residui con il Global Morans I si identificato che nel caso dei bufali questi erano clusterizzati. Nel caso dei
PCDD/F i valori di R
2
ottenuti sono stati 0.40, 0.21, 0.29 rispettivamente per il latte ovino, bovino e bufalino.

Key words: PCB; PCDD/F; GIS.
1. Introduction
The study of dl-PCB and PCDD/F is important because of their toxic and persistent nature and
carcinogenic/mutagenic health effects (Salihoglu and Tasdemir, 2008). These contaminants spread in the
environment due to accidental emissions or to human activities such as mining, industrial emissions, agricultural
practices, waste disposal, combustion, heating, and traffic (Colles et al. 2008). These particles are deposited by
atmospheric sedimentation on soil, that acts as sink, and leafy vegetation such as grass (Zhang et al. 2009).
Therefore grazing animals ingest contaminated grass, or hay and silage and then PCDD/F and dl-PCB
accumulates in the animals fat tissue and then secreted in milk during lactation (Schmid et al. 2003).
2. Inverse Distance Weighted
Inverse Distance Weighted (IDW) is a method of interpolation that estimates cell values by averaging the values
of sample data points in the neighborhood of each processing cell. The closer a point is to the center of the cell
being estimated, the more influence, or weight, it has in the averaging process. This method is probably one of
the oldest spatial prediction technique; is an exact and convex interpolation method that fits only the continuous
model of spatial variation (Hengl, 2007).
3. Kriging
Kriging is a procedure for spatial prediction at an unobserved location, using data at observed locations,
optimized with reference to a specific error criterion. The criterion is the squared prediction error at the
unobserved location averaged over a conceptual class of spatial prediction problems that have the same
15
th
80
15
th

configuration of observed and unobserved locations. The specification of this averaging class is the model under
which the optimization is carried out and the estimation error is reported. A kriging estimate of the field at an
unobserved location is an optimized linear combination of the data at the observed locations. The coefficients of
the kriging estimate and the associated error measure both depend on the spatial configuration of the data, the
unobserved location relative to the data locations, and spatial correlation or the degree to which one location can
be predicted from a second location as a function of spatial separation (El-Shaarawi and Piegorsch, 2001).
In this PhD thesis a four-step experimental procedure was set up by performing in sequence the following steps,
i) introduction of data (milk contamination in 3 matrices: cows, buffalos and sheeps; and soil contamination with
dl-PCB and PCDD/F) in a GIS system to analyze the spatial correlation and distribution; ii) interpolation of data
to create continuous maps of soil contamination evaluating 2 different techniques (Inverse Distance Weighting
and Kriging) varying some parameters; iii) determination of the relationship between the variables through
ordinary least squares and geographically weighted regression; and iv) predictions of environmental
contamination and validation of the model.
5.1 Interpolations
The maps obtained using data from 2008 were compared using the Root Mean Square Error. In Table 1 are
shown the different summary statistics used to select the best map.

Table 1 Comparison of models using the Root Mean Square Error.

PCB PCDD/F
metodi
RMSE Average Std E RMSE_std RMSE Average Std E RMSE_std
Stable 0,1735 0,1978 0,8894 1,079 1,148 0,9525
J-bessel 0,1736 0,1961 0,9012 1,088 1,168 0,9445
K-bessel 0,1734 0,1973 0,8916 1,077 1,148 0,9515
Hole Effect 0,1739 0,1972 0,8958 1,086 1,167 0,9417
Rational
Quadratic 0,1749 0,1926 0,9303 1,071 1,161 0,941
Gaussian 0,1736 0,1981 0,8882 1,078 1,148 0,9525
Exponential 0,1741 0,1928 0,9226 1,072 1,147 0,9553
Pentaspherical 0,1734 0,1947 0,9067 1,073 1,115 0,9434
Tetraspherical 0,1732 0,1952 0,9029 1,073 1,156 0,9442
Circular 0,1729 0,1966 0,8927 1,074 1,146 0,9514
k
r
i
g
i
n
g

Spherical 0,1731 0,1958 0,8984 1,074 1,15 0,9495
IDW 0,175 1,081

Figure 1 Interpolation of soil contamination with (a) dl-PCB using a circular semivariogram, lag size=4619.94 and 15
neighbours; (b) PCDD/F using a rational quadratic semivariogram, lag size=4003.71, and angle of 33.8 and 15
neighbours.
a b
15
th
81
15
th

Figure 2 sampled point of (a) sheep milk; (b) buffalo milk; (c) cow milk.

5.2 Ordinary Least Squares (OLS)
For the three matrices and the two contaminants, the soil contamination was positive and statistically significant
(p<0.05) for the milk contamination, as expected considering the indications of Schuhmacher (2000) that soils
reflect cumulative deposition during rather long periods of time, and as a consequence reflect the contamination
at which had been exposed the animals. However the statistically significance to the Koenker test indicated that
the relationship between the variables was spatially variable, thus it was necessary to use another a
Geographically Weighted Regression. This is in accordance with Rhind (2002) which indicates that soil
ingestion by grazing ruminants are highly variable and results may depend on seasonal changes in soil and
weather conditions and methodological errors.

5.3 Geographically Weighted Regression

5.3.1. PCB. The regression showed R
2
values of 0.66, 0.52 and 0.57 respectively for the buffalo, cow and sheep
milk. The Global Morans test I showed that the residual had a random distribution except for the buffalos who
had clustered residuals, indicating that at least one key explanatory variable is missing in the model.

5.3.2. PCDD/F. The regression showed R
2
value of 0.40, 0.21, 0.29 for the sheep, cow and buffalo milk,
respectively and the Global Morans test I showed that the residual had a random distribution only in the case of
cows milk.

5.4 Predictions and Validation
For the prediction of the environmental contamination, represented by soil contamination, data from 2009 was
used to create a continuous map and a error map (Figure 3) in order to validate the predictions with the most
reliable observed values.

Figure 3 Interpolation of soil contamination with (a) dl-PCB using a exponential semivariogram, lag size=5566.728, 15
neighbours and 329.8of angle; (b) Standard Error Map of the interpolation..
a b c
15
th
82
15
th

The points in black in Figure 4 indicate the locations where predicted values was being compared with the
observed values of soil contamination with dl-PCB. From this comparison were calculated the mean errors of the
predictions using the three matrices (Table 2) resulting the sheep milk the best indicator for the environmental
contamination having the minor error in the predictions.

Table 2 Mean Error of the predictions of soil contamination in three different matrices.
Matrix Mean Error
Sheep milk 23%
Cow milk 25%
Buffalo milk 59%

5.4 Feed influence on the milk contamination

Considering the clustered residuals in the regression and the high mean error in the predictions using buffalo
milk, the influence of feed on the milk contamination was analyzed. The OLS performed showed a positive and
statistically significant relationship between feed and milk but in addition that it was variable in the space.
Therefore, the relationship was analyzed using a Geographically weighted regression showing a R
2
=0.89,
indicating that there is a strong relationship between the contamination in feed and milk as indicated by Durand
et al.(2007) . This strong influence of feed indicates that buffalo milk cannot be used as a reliable bioindicator
for the environmental contamination because, as indicated by Schuhmacher (2000), the levels in vegetation can
be an indicator of the atmospheric emissions of these organic pollutants during short periods of time, as a
consequence the values would be to variable and the results of the models could be erratic, as seen in table 2.

In addition, contamination of forage (e.g. grass, hay) by POPs present in soil can unlikely occur through
transmigration from roots to plants epigeal parts. However, contaminated soil particles may accompany leafy
vegetables; these may also be subject to a contaminated fallout. Cattles fed on grass silage could ingest daily up
to 400 g of soil (Brambilla et al. 2004).

Considering the results, the ovine milk reflects better than bovine and buffalo milk the soil contamination with
dl-PCB and PCDD/F. Moreover, the ovine milk presented the minor mean error in the predictions of soil
contamination with dl-PCB. In conclusion, the predicted values of soil contamination with dl-PCB are reliable in
the case of bovine and ovine milk. In the case of buffalo milk, the level of contamination of milk was strongly
influenced by feed and thus it could not predict well the soil contamination within the study area.
This approach is very important due to the advantages showed by the use of milk for the prediction of the
environmental contamination through a non-destructive analysis. However, the study needs to be enriched with
new data in order to obtain more accurate predictions.

Figure 4 points used for the validation of the predictions of soil contamination with dl-PCB using (a) sheep milk; (b)
cow milk; (c) buffalo milk.
a
b c
15
th
83
15
th

8. References
Schmid P, Gujer E, Zenneg M, Studer C (2003) Temporal and local trends of PCDD/F levels in cows milk in Switzerland.
Chemosphere 53: 129-136.
Zhang S, Peng P, Huang W, Li X, Zhang G (2009) PCDD/PCDF pollution in soils and sediments from the Pearl River Delta
of China. Chemosphere 75: 1186-1195.
Salihoglu G and Tasdemir Y (2009) Prediction of the PCB pollution in the soils of Bursa, and industrial city in Turkey. J.
Hazardous Materials 164: 1523-1531.
Colles A, Koppen G, Hanot V, Nelen V, Dewolf M, Noel E, Malisch R, Kotz A, K K, Biot P, Vinkx C, Schoeters G (2008)
Fourth WHO-coordinated survey of human milk for persistent organic pollutants (POPs): Belgian results. Chemosphere
73: 907-914.
Hengl, T. (2007) A Practical Guide to Geostatistical Mapping of Environmental Variables. JRC Scientific and Technical
Reports. European Comission. 2007.
El-Shaarawi, A.; Piegorsch, W. (2001) Encyclopedia of Environmetrics. Wiley and Sons. Volume I. Pages: 1109-1118.
Durand B, Dufour B, Fraisse D, Defour S, Duhem K, Le-Barillec K (2007) Levels of PCDDs, PCDFs and dioxin-like PCBs
in raw cows milk collected in France in 2006. Chemosphere 70: 689-693.
Schuhmacher M, Granero S, Rivera J, Muller L, Llobet J, Domingo J (2000) Atmospheric deposition of PCDD/F near an old
municipal solid waste incinerator: levels in soil and vegetation. Chemosphere 40: 593-600.
Brambilla G, Cherubini G, De Filippis, Magliuolo M, Domenico A (2004) Review of aspects pertaining to food
contamination by polychlorinated dibenzodioxins, dibenzfurans and biphenyls at the farm level. Analytica Chimica
Acta 514: 1-7.
Rhind S (2002) Endocrine disrupting compounds and farm animals: their properties, actions and routes of exposure.
Domestic Animal Endocrinology 23: 179-187.
15
th
84
15
th
Modelling of transient heat exchange during natural convective air
cooling of cheese by FEM analysis
Romina Iezzi (romina.iezzi@unipr.it)
Dept. Industrial Engineering, University of Parma, Parma, Italy
Tutor: Prof. Germano Mucchetti

This part of PhD thesis dealt with the analysis and prediction of natural convective air cooling of cheese and
cheese curd. A finite element model, describing the transient heat exchange inside products with different
composition and size, was proposed. The heat transfer coefficient was experimentally determined and then
calculated adapting the Nusselt equation. Both the model and the coefficients found were validated by
experimental data, giving good fitting results between simulated and measured time-temperature curves, as
verified by RMSE determination.
Modellazione attraverso analisi FEM dello scambio termico transitorio durante il
raffreddamento ad aria di formaggio per convezione naturale
Questa parte della tesi di dottorato ha affrontato la tematica dellanalisi predittiva del raffreddamento ad aria di
formaggio e cagliata per convezione naturale. stato proposto un modello predittivo agli elementi finiti capace
di descrivere lo scambio transitorio di calore allinterno di prodotti con differente composizione e dimensioni. Il
coefficiente di scambio termico stato determinato sperimentalmente e quindi calcolato adattando lequazione di
Nusselt. Il modello proposto ed i coefficienti calcolati sono stati validati dal confronto con dati sperimentali, e il
valore di RMSE ha dimostrato la buona riproducibilit delle curve tempo-temperatura simulate rispetto a quelle
sperimentali.

Key words: natural convection, cheese air cooling, FEM analysis, heat exchange coefficient.
1. Introduction
In accordance with the PhD thesis project previously described (Iezzi, 2008), this communication reports the
main results of the activities concerning the study of heat exchange involved in cheese air cooling and directed
to:
A1) calculate: i) k
c
, c
pc
values according to composition of cheese; ii) !
c
values of cheeses; iii) heat exchange
coefficients (h) according to different size of cheeses and air properties;
A2) apply mathematical models to Finite Elements (FE) analysis considering one cheese curd and two semi-hard
cheese varieties;
A3) verify the developed model by means of cheese making trials in different conditions.
2. Prediction of temperature applications
The ability to predict the cooling rate is fundamental to improve dairy technology. Many scenarios involving
heat alone or heat and mass exchange are foreseeable, e.g. the cooling of fermenting moulded curds, the
hardening of stretched cheeses by air contact, typical of some artisanal cheeses from Sicily, or by the more
common practice of dipping Mozzarella in fluent or quiet water, or finally the air-cooling of packaged dairy
products as Ricotta, Mascarpone or melted cheeses. While studies about mass and heat transfer in food are
various, in the dairy sector the literature is more limited (Pajonk et al., 2003; Reinbold et al., 1992).
Numerical method as the FE Analysis may be a useful tool for handling complex conditions as those deriving
from the need of estimating the cooling behaviour of food under realistic conditions such as variation of initial
temperature, non-linear thermal properties and irregular shaped bodies.
3. Simulation model
3.1 Transient heat transfer during natural convective cooling
The energy balances during unsteady-state heat transfer in a food sample are described by the Fouriers law (1)
while those occurring in air lead by equation (2) (Curcio et al., 2008). All symbols used in those equations are
given in section 8.

0 ) (
/ / /
= ! " # ! +
$
$
T k
t
T
c
m c pm pc m c
% (1)
15
th
85
15
th

0 ) ( = ! " + ! # " ! +
$
$
T u c T k
t
T
c
pa a a pa a
% % (2)

At the food-mould interfaces, where no accumulation occurs, the continuity of heat flux was imposed. Whereas
at the food-air and at the mould-air interfaces the boundary conditions were:

( )
inf
T T h
n
T
k ! =
"
"
! (3)

The h value was evaluated by Nusselt equation, using a and m coefficients tabulated by Perry et al (1999) and
Incropera et al. (2002):

m
Gr a Nu Pr) ( = (4)

The other boundary conditions imposed were:

0 =
!
!
i
x
T
at x
i
=0 (5)
T = T
inf
at air surfaces (6)

The system of unsteady non-linear Partial Differential Equations has been solved by Finite Elements Method
using Heat Transfer Module of Comsol Multiphysics
TM
3.5. Food and air domains were discretized into a
variable total number of meshes, according to sample size. Second order Lagrange finite elements were used for
the three domains (cheese, mould and air). The time-dependent problem was solved by GMRES linear system
solver, characterized by the relative and absolute tolerances of 0.01 and 0.001 respectively.
The comparison between simulated and experimental data was performed by the calculation of root mean
squared error (RMSE), as proposed by Siripon at al. (2007):

n
T T
RMSE
n
i
i s i e !
=
"
=
1
2
, ,
) (
(7)

3.2 Model assumption
The following assumptions were taken:
a) the food sample is a homogeneous and isotropic continuum;
b) heat is transferred only by conduction inside the sample;
c) the initial temperature T
0
of the sample is homogeneous;
d) the volume of the cheese sample is constant, neglecting the effect of possible whey drainage;
e) the heat and mass transport due to moisture surface evaporation is neglected;
f) no heat generation by Lactic Acid Bacteria (LAB).
The procedure adopted was the following: i) first estimation of the h coefficient for air natural convection with a
trial and error procedure, introducing in the model values from 5 to 25 W m
-2
K
-1
(Singh et al. 1984), until the
simulated curve fitted with the experimental one; ii) calculation of h values, adapting equation (4) and using as
characteristic length L the ratio of volume to total surface area of the cheese; iii) application of the proposed
model and validation using dairy products with different composition and/or size.
5.1 Sample preparation and data acquisition
Several cylindrical shape samples were taken from Montasio and Edam cheeses (Table 1). The cheese curd
samples were produced at CRA-FLC dairy (Lodi, Italy). Curd was made following the cooked cheeses
technology, so limiting the whey drainage from the moulded curd. To verify extent of the whey drainage, and
consequently the mass reduction, curds were weighed before and after cooling with a scale (Mettler Toledo,
Milano, Italy) with a precision of 1 g. Each sample was characterised by different L and T
0
values (Table 1).
Each experiment was replicated twice.
15
th
86
15
th
Table 1 Characteristics of experimental conditions.
Sample Type of
cheese
Initial temperature
T
0
(C)
Diameter of
cheese (m)
Height of cheese
(m)
Material
of mould
Thickness of
mould (m)
A Montasio 480.2 0.097 0.070 PVC 0.001
B Edam 400.8 0.100 0.130 PP 0.003
C Edam 480.8 0.100 0.130 PP 0.003
D Edam 541.5 0.100 0.130 PP 0.003
E Cheese curd 511.0 0.275 0.140 PE 0.002

The lateral and bottom surfaces of the cheese samples were covered by the mould. Samples A to D were heated
in a water bath till the cheese temperature uniformly reached the established T
0
. Then, each sample, placed on a
plastic net with squared meshes (side 0.05 m), was cooled at room temperature totally lapped by air. Air velocity
and temperature were measured by a hot-wire anemometer (mod. 0635-1535 Testo AG, Germany) and the mean
value for each experiment was introduced into each model as a constant. To follow the time-temperature radial
and axial changes within the cheeses, up to 9 wire thermocouples K type (Ni/Cr-Ni/Al) (HF/D-30-KK, Tersid,
Italy) were used. Each thermocouple was connected with a multimeter/data acquisition system (HD 32.8.16,
Delta Ohm, PD, Italy) and it was positioned at different well known cheese points. The recording frequency was
set at 30 sec.
k
c
and c
pc
values of cheeses were calculated from their composition (Table 2) using Choi and Okos equations
(1986). These equations were introduced into the model so that the change of k
c
and c
pc
in function of the
decrease of temperature was taken into account in each time step of simulation. Densities (!
c
) of cheeses were
calculated as a ratio of mass to volume.
The cooling process proceeded until the temperature of the coldest point was in balance with the room
temperature.
Table 2 Composition (g / 100 g of cheese) and physical properties of cheeses and cheese curd.
Sample Moisture Fat Protein Carbohydrate Ash k
c 20C
c
pc 20C
!
Montasio 36.0 32.0 25.6 1.4 5.0 0.32 2750 1108.3 10.6
Edam 46.3 22.9 27.2 N/A 4.1

0.38 2990 1109.3 12.5
Cheese curd 41.6 29.9 24.6 1.3 2.6 0.35 2890 1119.37.3

The significance of the difference between the results was statistically evaluated by analysis of variance
(ANOVA) at one tailed significance level using SPSS Statistics17.0 (IBM Company, USA).
6.1 The natural convective heat exchange parameters
The mean temperature of air was 21.41.5C, while the mean velocity was 2.3E
-03
5.8 E
-03
m s
-1
. The ratio
between Gr number and square Re number, always much higher than 1, confirmed the air flow was due to
natural convection. The air physical properties were always evaluated at the T
film
.
Because of the cheese k
c
values, it could be estimated, in a first approximation, a mean Bi number ranging from
0.43 to 0.76, according to the specific L values. Furthermore, the numerical solutions were used, because the
analytical solutions of the foregoing series of an infinite cylinder and slab could be approximated by the first
term of the series only when the Fourier number is higher than 0.2 (Incropera, 2002); this condition, in our trials,
was reached with a delay from the beginning of cooling not suitable for the aims of the model utilization.

6.2 The adaptation of Nusselt equation
The equations to find Nu are very problem-specific and require the simultaneous solution of the coupled
equations of motion and energy. So, first of all, an h value was experimentally found. It was established, as a
first approach, that the better h value is that able to minimize the RMSE value in a sample which respected
model assumptions: h was found to be 15 W m
-2
K
-1
for a cylindrical Montasio cheese (data not shown).
Then, the equation (4) was adapted choosing suitable values of characteristic length and Nusselt constants. The
calculated h coefficients used to predict the heat exchange were summarized in Table 3. Under all the above
assumptions, for sample A h ranged between 7.83 and 14.41 W m
-2
K
-1
for the vertical surfaces and between
7.17 and 8.88 W m
-2
K
-1
for the horizontal flat surfaces, facing upward. These values well agree with those by
Singh at al. (1984). As already shown by Verboven et al. (2001), it can be observed that h value decreased with
increase in sample diameter (Table 1). h values for the horizontal flat surfaces facing downward, instead, were
smaller, ranging from 3.58 to 4.44 W m
-2
K
-1
, according to the general theory of heat transfer by natural
convection.
15
th
87
15
th
Table 3 Characteristic length L (m), Nusselt equation adimensional constants (a, m) for different surfaces [vertical
surface V.S.; horizontal flat surface (facing upward) H.F.S (FU); horizontal flat surface (facing downward)
H.F.S (FD)] and h (W m
-2
K
-1
) values calculated adopting the Nusselt equation in each experimental sample.
a a a m m m h h h Sample L
V.S. H.F.S.
(FU)
H.F.S.
(FD)
V.S. H.F.S.
(FU)
H.F.S.
(FD)
V.S. H.F.S.
(FU)
H.F.S.
(FD)
A 0.014 1.36 0.54 0.27 0.20 0.25 0.25 14.41 8.88 4.44
B 0.019 0.59 0.54 0.27 0.25 0.25 0.25 8.09 7.41 3.70
C 0.019 0.59 0.54 0.27 0.25 0.25 0.25 8.90 8.15 4.07
D 0.019 0.59 0.54 0.27 0.25 0.25 0.25 9.27 8.48 4.24
E 0.035 0.59 0.54 0.27 0.25 0.25 0.25 7.83 7.17 3.58

6.3 Model validation
Transient temperature changes in the cheese at different air conditions were simulated and compared with the
experimental data (Fig. 1). The mean RMSE values (Table 4) showed that the simulated curves fitted well with
the experimental ones, being RMSE generally lower than 2.13C and being 4.64C the largest difference,
calculated for an external point of the cheese curd. RMSEs values for Montasio and Edam samples (B, C and D,
characterized by the same size but different T
0
) were not significantly different (p > 0.05). This result confirmed
the reliability of the model applied to different cheeses, when no mass transfer occurred.
Table 4 Mean RMSE (C) between experimental and simulated temperature profiles. In a column values with the
same superscript were not significantly different according to the one way ANOVA test (p < 0.05).
Sample N Mean St. Dev. Median Min Max 95% C. I.
A 9 0.95
a
0.16 0.90 0.78 1.23 0.12
B 9 0.58
a
0.20 0.56 0.38 0.97 0.15
C 9 1.00
a
0.46 0.94 0.39 1.68 0.36
D 8 1.05
a
0.58 0.81 0.60 2.29 0.44
E 8 2.13
b
1.28 1.81 0.68 4.64 1.07

RMSE mean value of cheese curd (2.131.28C) was acceptable, but significantly higher (p < 0.01) than all the
others. The simulated and measured temperature curves in the interior of the cheese curd are shown in Fig. 2.
This gap may be partially explained because of some assumptions adopted for the model (constant volume, no
heat generation by LAB and uniformity of T
0
) were not fully respected by cheese curd. The cheese curds lost
about 5% of their initial weight due to the whey drainage, reducing their height from 0.14 m to 0.13 m. The
starter LAB correctly fermented the lactose to lactic acid and it is well known (Turner et al., 1983) that
fermentation generates heat according to growth rate into the curd. This heat generation is usually measurable as
temperature increase at the start of fermentation only in the centre of large sized cheeses, because of the poor k
c

value. Close to surface, the cooling effect prevails. The initial temperature distribution was not uniform because
of the presence of many other factors influencing the cooling of the curd (e.g. curd turn over, contact with
surfaces etc) before moulding.
20
25
30
35
40
45
50
0 120 240 360 480 600 720 840 960
Time (min)
T
e
m
p
e
r
a
t
u
r
e
(
C
)

20
25
30
35
40
45
50
0 120 240 360 480 600 720 840 960
Time (min)
T
e
m
p
e
r
a
t
u
r
e
(
C
)

Figure 1 Comparison of observed and simulated temperatures at the centre point (at the left) and 1 cm under the upper
surface (on the right) of Edam cheese characterized by the initial uniform temperature of 48C (sample C).
The average ambient temperature was 22.10.96C with the air velocity field of 0.0040.01 m s
-1
. Red lines
are the simulated temperatures, black lines are the experimental temperatures.

Figure 2 Comparison between predicted and experimental
temperature profiles in the centre of a cheese curd of initial mass 9.25 kg.
RMSE = 1.04C. Red line is the simulated temperature, black line is the
experimental temperature.
34
36
38
40
42
44
46
48
50
52
0 60 120 180 240 300
Time (min)
T
e
m
p
e
r
a
tu
r
e
(
C
)
15
th
88
15
th
A FE model, which considered the heat transfer by conduction and convection, was established to describe the
spontaneous air cooling of cheese. Given measured air conditions as input, the model was successfully used to
predict transient temperatures inside dairy products. The prediction accuracy was improved by including a
temperature-dependant function accounting for the variation of the thermal properties of cheese. Moreover, using
a specific definition of characteristic length, the Nusselt equation was adapted to the transient situation to obtain
an h coefficient which permitted to predict the temperature change into the cheese with small RMSEs values
between simulated and experimental data.
The results confirmed both the reliability of calculated h value and the ability of the model to predict heat
exchange in natural convective air cooling, as it can occur in traditional stretched cheeses from Sicily. With
future incorporation of mass transfer model and Computational Fluid Dynamic models, such a model could be
further used to predict cheese cooling by air forced convection or by dipping into water. To optimize the
prediction of cheese curd cooling, an equation involving the prevision of heat generated by LAB fermentation
has to be studied.
8. Nomenclature
a, Nusselt equation constant; Bi, Biot number (=h L k
c
-1
); c
pc/pm
, c
pa
, specific heat of cheese/mould and air (J kg
-1
C
-1
); g,
acceleration due to gravity (=9.81 m s
-2
); Gr, Grashof number (=L
3
!
a
2
g "
a
#T
a
-2
); h, heat transfer coefficient (W m
-2
K
-1
);
k
c/m
, k
a
, thermal conductivity of cheese/mould and air (W m
-1
C
-1
); L, characteristic length = volume/total surface area of the
cheese (m); m, Nusselt equation constant; n, number of data points; Nu, Nusselt number (=h L k
a
-1
) Pr, Prandtl number (c
pa
a
k
a
-1
); Re, Reynolds number (=!
a
u
a
L
a
-1
); T, the temperature (C); T
e,i,
,

T
s,i
, i-th experimental and simulated temperature
(C); T
film
, film temperature (=(T
0
+T
inf
)/2, C); T
0
, initial temperature (C); u
a
, air velocity vector (m s
-1
); x
i
, Cartesian
coordinates x, y and z and the point, whose coordinates are (0; 0; 0), is the geometrical centre of the cheese; "
a
, volumetric
coefficient of expansion of air (K
-1
); #T, temperature difference between the cheese surface and the surrounding air (C);
a
,
viscosity of air (N s m
-2
); !
c/m
, !
a
, density of cheese/mould and air (kg m
-3
).
9. References
Choi Y, Okos MR (1986) Effects of temperature and composition on the thermal properties of foods. In: M. Lemaguer and P.
Jelen, Editors, Food Engineering and Process Applications, Elsevier Applied Science Publishers.
Curcio S, Aversa M, Calabr V, Iorio G (2008) Simulation of food drying: FEM analysis and experimental validation, J.
Food Eng. 87: 541-553.
Heidenreich S, Langner T, Rohm H (2007) Heat capacity of cheese: determination or calculation?, J. Therm. Anal. Calorim.
89: 815819.
Iezzi R (2008) Heat exchange modelling in not liquid dairy matrices, In Proc.s of the 13
th
Workshop on the Developments in
the Italian PhD Research on Food Science Technology and Biotechnology, University of Turin, 10-12 September.
Incropera FP, Dewitt DP (2002) Fundamentals of heat and mass transfer, 5
th
edition, John Wiley and Sons, Inc.
Pajonk AS, Saurel R, Andrieu J, Laurent P, Blanc D (2003) Heat transfer study and modelling during Emmental ripening, J.
Food Eng. 57: 249-255.
Perry RH, Green DW, Maloney JO (1999) Perrys chemical engineers handbook, McGraw-Hill Inc.
Singh RP, Heldman DR (1984) Introduction to food engineering, Academic Press, Inc.
Siripon K, Tanskul A, Mittal GS (2007) Heat transfer modelling of chicken cooking in hot water, Food Res. Int. 40: 923-930.
Reinbold HS, Ernstrom CA, Hansen CL (1992) Temperature, pH, and moisture profiles during cooling of 290-kilogram
stirred-curd cheddar cheese blocks, J. Dairy Sci. 75: 2071-2082.
Turner KW, Morris HA, Martley FG (1983) Swiss type cheese. II. The role of thermophilic lactobacilli in sugar fermentation,
N. Z. J. Dairy Sci. Technol. 18: 117-123
Verboven P, Scheerlinck N, De Baerdemaeker J, Nicola BM (2001) Sensistivity of the food centre temperature with respect
to the air velocity and the turbulence kinetic energy, J. Food Eng. 48: 53-60.
15
th
89
15
th
Emerging Properties of Oligopeptides in
Higly Proteolized Novel and Traditional Foods
Francesca Lambertini (francesca.lambertini@nemo.unipr.it)
Department of Organic and Industrial Chemistry, University of Parma, Parma, Italy
Tutors: Prof. Stefano Sforza, Prof. Arnaldo Dossena

This Ph.D Thesis concerns the molecular characterization of highly proteolyzed foods, with particular attention
to the influence on their biological and functional properties exerted by oligopeptides and amino acids. Two
different kinds of foods containing low molecular weight nitrogen compounds have been considered: those
derived from a natural proteolysis, conisdering as a model system a traditional food product, such as Parmigiano-
Reggiano cheese, and those obtained by a proteolytic process generated by innovative biocatalytic processes,
such as proteic hydrolizates obtained from the recovery of poultry industry leftovers.
Propriet Emergenti di Oligopeptidi in Alimenti Nuovi e Tradizionali
Questa tesi di dottorato riguarda la caratterizzazione molecolare di alimenti altamente proteolizzati, volgendo
particolare attenzione allinfluenza sulle loro propriet biologiche e funzionali esercitata da oligopeptidi e
amminoacidi. Sono state prese in considerazione due tipologie diverse di alimenti contenenti composti azotati a
basso peso molecolare: quelli derivati da una proteolisi naturale, prendendo a sistema modello un prodotto
tradizionale come il Parmigiano-Reggiano, e quelli ottenuti da una proteolisi generata da processi biocatalitici
innovativi, quali idrolizzati proteici dal recupero di scarti della lavorazione avicola.

Keywords: peptides, proteolysis, functional food, antioxidant, antihypertensive
1. Introduction
Peptides are of particular interest in food science and nutrition because they have been shown to play
physiological roles that can affect biological processes or substrate and, hence, have an impact on body function
or condition and ultimately, healt (Korhonen 2006).
Naturally occurring proteolysis is a fundamental process in the production of many traditional foods, such as
cheeses (Sforza, 2003) or hams (Sforza, 2006). Moreover, the proteolytic process can be exploited for the
production of novel foods starting from non conventional ingredients, such as food industry leftovers.
In accordance with the PhD. thesis project previously described, this oral communication reports the main results
of the following activities:
A1) molecular characterization and nutritional properties of proteinaceous hydrolyzates obtained by the
recovery of poultry by-products;
A2) molecular characterization of Parmigiano Reggiano cheese;
A3) testing of some bioactive properties and relationship whit food features.
2. Material and Methods
In order to characterize oligopeptides in complex mixtures, in this PhD. thesis standard and advanced mass
spectrometry techniques coupled with liquid chromatography were extensively used. To test bioactive and
functional properties of foods several previously described procedures were applied with the opportune
modifications.

2.1 Sample description

2.1.1 Poultry hydrolyzates
Samples of poultry hydrolysates were obtained from VNIIPP (State Institution All-Russian Research Institute for
Poultry Processing Industry of Russian Academy of Agricultural Sciences, RF). Poultry protein hydrolizates
production is based on deep controllable conversion of poultry meat&bone residues using multienzyme
composition containing four commercially available enzyme preparations (Alcalase, Neutrase, Flavourzyme,
Protamex from Novozymes, Bagsvaerd, Denmark). This technology had been previously optimized by
multifactor experiments aiming at maximum protein recovery ratio (Nikolaev, 2008). Three samples of poultry
protein hydrolysates were produced under different hydrolytic conditions, coded as 58T (lowest hydrolysis
degree), 78T (highest hydrolysis degree) and 83T (halfway condition).

15
th
90
15
th
2.1.2 Parmigiano-Reggiano cheeses
Parmigiano-Reggiano is a well-known Italian hard cheese, long ripened, made from raw and partially skimmed
cows milk. It is included in the list of Italian cheese bearing the Protected Designation of Origin (PDO, EU
regulation 2081/92). Samples of Parmigiano-Reggiano cheese were obtained from Consorzio del Parmigiano-
Reggiano. In this PhD. thesis were analysed samples at different ageing time (from 6 to 36 months of ripening)
coming from 6 different factories and produced in different seasons.

2.2 Procedures

2.2.1. Molecular characterization by chromatographic and electrophoretic methodologies
Samples for LC-ESI/MS and LC-ESI/MS/MS analysis of oligopeptide fraction in Parmigiano-Reggiano cheese
were prepared by homogenization of 20g of minced cheese in 90 ml of water and successive filtration trough
paper filter, whereas for the analysis of poultry hydrolyzates, 20 mg of dried sample were dissolved in 1 ml of
deionized water containing 1% of Phe-Phe 1 mM as internal standard and filtered through 0.45 !m Durapore
Membrane Filters tipe HV (Millipore Corporation, Bedford, MA).
Characterization of sample protein composition was performed using Precast ready gels Tris HCl, according to
the protocol suggested by the costumers (Bio-Rad, Hercules, CA, USA). Silver staining was carried out
according to the protocol reported by Blum et al. (1987).
Quantification of amino acid composition of poultry hydrolyzates was carried out by a new mass spectrometry
method developed and validated during the PhD. thesis.

2.2.2 Antioxidant activity
Antioxidant activity was tested by using ABTS assay as described by Re et al (1999).
A 0.05 mg/ml solution of poultry protein hydrolyzate samples dissolved in phosphate buffer saline (PBS) is
added to a freshly prepared ABTS+ 2 mM PBS solution. The absorbance is measured at 734 nm after reaction
time of 11 min.
Water soluble extracts (WSE) of P-R cheese were diluted in PBS at ratio 1:50 and added to a freshly prepared
ABTS+ 2 mM PBS solution. The absorbance is measured at 734 nm after reaction time of 5 min.
For both type of sample the results were expressed as !mlole of Trolox Equivalent Antioxidant Capacity
(TEAC) per gram of sample calculated trough a calibration curve obtained by the analysis in the same condition
of a standard trolox solutions.

2.2.3 Antihypertensive activity
Antihypertensive activity of the biosynthetic proteinaceous hydrolyzates derived from poultry leftovers and of
WSE was determined by Cushman & Cheung assay (1971), a method based on the production of hippuric acid
by the Angiotensin Converting Enzime (ACE), starting from the substrate Hyppuryl-Hystidyl-Leucine (HHL).
The original method, based on the spectrophotometric determination of hippuric acid, was improved by using
LC/MS for its determination.
In both cases samples at ten different concentration were subjected to the analysis of ACE inhibitory activity in
order to obtained a sigmoid calibration curve by which calculate the IC50 value (concentration necessary to
inhibit the 50% of ACE activity). To perform the assay 20 !l of 0.1 U/ml ACE solution, 200 !l of HHL 5 mM
solution and 80 !l of opportunely diluted sample solutions were used.
3.2 Molecular characterization of amino acids, peptides and proteins in poultry hydrolyzates
The main part of the poultry hydrolyzate samples was found to be composed by molecules having molecular
weight less than 10 kDa. In order to evaluate the biological value of this new product, free and total amino acids
content, nutritional score and D/L amino acid ratio were first studied.
The results obtained showed that free amino acids constituted an important fraction of these proteinaceous
hydrolyzates, ranging from 25% in the lowest hydrolyzed sample to 35% in the highest one. The total amino acid
analysis, perforemd after hydrolysis in 6N HCl for 23 hours, indicated that proteic material constituted about
95% of the crude hydrolyzates in all samples. Chemical scores, calculated by using egg white amino acid content
as reference, indicated a high nutritional value, since all essential amino acids gave a score higher than 50%,
except Met and Cys, with a score of about 30%, which were the limiting amino acids.
The high nutrition value of this hydrolyzates was confirmed by D/L amino acid ratio since only traces of D-Asp
were found, indicating that the applied proteolytic treatment was quite mild, and microbial contamination was
absent, making the amino acids totally bioavailable.
Poultry hydrolyzate samples, were also analyzed by UPLC/MS in order to determine the most abundant nitrogen
compounds, besides amino acids, having low MW. The detection was performed by a single quadrupole ESI
mass spectrometer in the full scan mode. Mass spectra of the main chromatographic peaks were used to calculate
15
th
91
15
th
the molecular weight of the associated compounds and the most abundant were also analyzed by HPLC-MS/MS
on a triple quadrupole instrument in order to identify their structure. The fragmentations, obtained by performing
product ion scan experiments, allowed to identify these molecules as carnosine and anserine (muscle histidyl
dipeptides), creatine and creatinine (molecules involved in the energy metabolism of the muscles), inosine and
guanosine, hypoxanthine and guanine, derived from the latter after the loss of the ribose moiety. In order to
confirm these attributions product ion scan experiments of the corresponding standard solutions were also
carried out. These peptides were then semiquantified by extracting the chromatogram defined by their
characteristics ions, integrating the corresponding chromatographic peak and calculating the ratio between its
area and the area, obtained in the same way, of the internal standard Phe-Phe. Each compound was found to be
inversely related to the proteolysis degree: the lowest proteolyzed sample shows the highest value for every
compound, and the highest proteolyzed sample presents the lowest values, indicating that increasing the
harshness of treatment induces an higher degradation of nitrogen compounds.
The relative amount of each compound in the different samples indicates that guanine is the most sensitive to the
proteolytic conditions (90% of the amount present in the lowest proteolyzed sample is loss in the highest
proteolyzed one), followed by guanosine (80% loss), carnosine and anserine (50% loss).
The oligopeptide identification turned out to be hampered by the complexity of the mixtures. In order to
overcome this complexity, an off-line 2D-HPLC-MS approach was then applied.
A first HPLC fractionation was performed by means of a ZIC-HILIC hydrophilic stationary phase column,
twenty-seven fractions were collected and then analysed by HPLC-ESI HRMS on PepMap C18 column. Data
dependent scan experiments were used for data acquisition. BioWorks 3.3 software was used for data
interpretation and protein/peptides identification. A specific chicken protein database was created using entries
from UNIPROT Tremble. The acquired data were searched using the Sequest programme (ThermoFisher)
against a specific chicken protein database created using entries reporting Gallus Gallus from UNIPROT
Tremble (downloaded from http://expasy.org/, September 2009). A protein probability value lower than 0.001
was set as threshold for identification. Identification of sequences of most abundant peptides in the mixtures was
performed with the main purpose of providing a detailed molecular characterization which can eventually be
linked to desirable functional and technological properties (digestibility, antioxidant activity, bifidogenic
activity, etc).. Samples with a low and medium degree of proteolysis showed the presence of similar peptides
mostly derived from actin and myosin. Peptides from these proteins were not detected in the highly proteolyzed
sample, which also showed the lowest number of identified proteins.

3.3 Molecular characterization of peptides and proteins in Parmigiano-Reggiano cheese
In order to analyze the evolution of the proteinaceous fraction during ripening, water soluble extracts of
Parmigiano-Reggiano cheese were first subjected to SDS-PAGE.
Bands corresponding to the standard of "-lactoglobulin were found to be the most abundant in all cheese aqueous
extracts and, in smaller amount, also bands corresponding to the standard of #-lactoalbumin were found, whereas
caseins in intact form were only detected in fresh cheeses. A more detailed analysis carried out by UPLC-
ESI/MS has confirmed the presence of whey proteins even after a long period of ripening, also allowing to
discriminate different lactoglobulin isoforms (Lambertini et al.)
In order to identify the most abundant oligopeptides, a representative sample was fractionated by
semipreparative RP-HPLC and then analyzed by HPLC-ESI/MS/MS (QqQ) performing Daughters scan
experiments. Product ion spectra were compared to theoretical ones, calculated by using appropriate proteomic
tools available on line (ExPASy Proteomics Server, systembiology proteomic tools). By this approach a great
number of oligopeptides coming from alfaS1-casein and beta-casein were identified and some of them
correspond to a previously described bioactive compounds. The presence of the non proteolitic peptides,
previously described by (Sforza et al. 2009), was also confirmed and a new one was identified for the firs time.
The abundance of the all molecules identified in each sample was then evaluated by extracting the
chromatograms defined by their characteristic ions, and integrating the corresponding chromatographic peak,
obtained by UPLC-ESI/MS analysis in full scan mode. All data obtained were use to perform Principal
Component Analysis in order to evaluate the main factors influencing the oligopeptide composition.
As expected, ageing time has been identified as the leading factor affecting oligopeptide presence in cheeses,
while no significant differences were found between samples produced in different factories.

3.4 Bioactive and functional properties
The free radical scavenging capacity of the biosynthetic proteinaceous hydrolyzates derived from poultry
leftovers was evaluated against ABTS
+
generated according to the chemical procedure. The absorbance was
measured at 734 nm after reaction time of 11 minutes. Trolox Equivalents (TE) were calculated using a standard
curve prepared with trolox and expressed in !moles per gram of sample. The results showed that these samples
posses marked antioxidant capacity, equivalent to 0.8 g of ascorbic acid or 2 g of alfa-tocopherol, calculated on
the basis of databases presents in literature (Re et al. 1999). This antioxidant capacity was positively related to
the hydrolysis degree of the samples. In order to further collect data on the antioxidant compounds, one sample
15
th
92
15
th
was fractionated by semipreparative RP-HPLC and the fractions obtained were also tested by ABTS assay.
Results obtained shown that the main active fraction is that containing free amino acids, which was quite
obvious, being this fraction also the most abundant, but it also resulted evident that in all the samples, a not
negligible percentage of the antioxidant activity was also exerted by the fractions containing peptides. As
expected, these fractions were found to give a more important relative contribution to the antioxidant capacity in
the less proteolyzed sample.
By applying the improved method described in the experimental section, the inhibitory activity of the
biosynthetic proteinaceous hydrolyzates derived from poultry leftovers samples was measured. The most
hydrolysed samples turned out to be less inhibitory (IC
50
=7.3 mg/ml), whereas the less hydrolyzed sample was
found to be the most inhibitory (2.6 mg/ml), indicating that the ACE inhibition is likely due to peptides.
Antioxidant activity of water soluble extracts of P-R cheese was estimated applying the same assay after dilution
of the extracts 50 times. As expected P-R cheese posses very high antioxidant capacity that remains just about
constant during the ageing time, a slight decrease was only observed after 24 moths of ripening.
The data obtained have also showed a positive relation between the antioxidant capacity of cheese and the total
amount of bioactive peptides identified which was resulted lower in highly aged samples.
P-R cheese ACE inhibitory activity, carried out as previously described, was resulted to be following the same
trend of antioxidant activity. In this case more bioactive peptides were identified, in particular coming from the
degradation of beta-casein.
In this PhD. thesis the nitrogen fractions of proteinaceous hydrolyzates coming from different food matrices,
both traditional and produced according to novel technologies, have been extensively studied by means of mass
spectrometry coupled with liquid chromatography. This technique has been demonstrated to be a valid approach
to monitor the composition of complex peptide mixtures, because of its high sensibility and selectivity.
Free and total amino acid analysis of the biosynthetic proteinaceous hydrolyzates derived from poultry leftovers
have shown that this potential novel foods posses an high nutritional value, due to the total bioavailability of
essential amino acids. Amino acidic composition, and overall oligopeptide fractions, have been found to be
strictly related to the proteolytic conditions used for food production , thus bioactive compound amounts may be
regulated on the basis of the desired features. For example, samples with the highest hydrolysis degree may be
used as functional food ingredient in virtue of their high antioxidant capacity.
At the same time, cheese is a natural product with a potential high biological value. Proteolysis occurring during
ageing time leads to the release of a large number of peptides from caseins, which have been demonstrated to be
biologically active by in vitro studies. Since data of their effective bioavailability are still quite scarce, at the
moment the work of the present PhD. thesis is addressed to the study of the biological activity of the
oligopeptide fraction derived from Parmigiano-Reggiano cheese after simulated gastrointestinal digestion.

5. References
Blum, H., Beier, H., GrossBlum H.J. (1987). Improved silver staining of plant proteins, RNA and DNA in
polyacrylamide gels. Electrophoresis, 8, 93-99.
Cushman D. W. and Cheung. H. S. (1971) Spectrometric Assay and Properties of the Angiotensin-Converting
Enzyme of Rubbit Lung. Biochem. Pharmacol., 20: 1637-1648.
Korhonen, H.; Pihlanto, A. (2006) Bioactive peptides: Production and functionality. International Dairy Journal,
16, (9), 945-960.
Lambertini F., Galaverna G., Mucchetti G., Dossena A., Marchelli R., Sforza S. Whey proteins in Parmigiano-
Reggiano cheese. (submitted).
Nikolaev I.V., Stepanova E.V., Eremeev N.L., Ismailova D.Y., Zaichik B.T., Ruzhitskii A.O., Khotchenkov
V.P.,. Kostyleva E.V,. Sinitsyn A.P, Volik V.G., Koroleva O.V. (2008). Optimization of enzymatic hydrolysis of
animal raw material for obtaining functional meat protein preparation. Biotechnology (Moscow), 5: 59-67.
Re R., Pellegrini N., Proteggente A., Pannala A., Yang M. and Rice Evans C. (1999) Antioxidant activity
applying an improved ABTS radical cation decolorization - Free Radical Biology and Medicine 26: 1231- 1237
Sforza S, Ferroni L, Galaverna G, Dossena A, Marchelli R. (2003). Extraction, semi-quantifcation, and fast on-
line identification of oligopeptides in Grana Padano cheese by HPLC-MS. Journal of Agricultural and Food
Chemistry, 51, 8: 2130-2135
Sforza S., Galaverna G., Schivazappa C., Marchelli R., Dossena A., Virgili R. (2006). Effect of extended aging
of parma dry-cured ham on the content of oligopeptides and free amino acids. Journal of Agricultural and Food
Chemistry, 54, 25: 9422-9427.
Sforza S., Cavatorta V., Galaverna G., Dossena A., Marchelli R. (2009). Accumulation of non-proteolytic
aminoacyl derivatives in Parmigiano-Reggiano cheese during ripening. International Dairy Journal,19, 10:582-
587.
15
th
93
15
th
Functionality of grape proteins in relation to turbidity of white wine:
Botrytis cinerea as remover of grape proteins
Marco Lucchetta (marco.lucchetta@unipd.it)
Dipartimento di Biotecnologie Agrarie, Centro Interdipartimentale per la Ricerca in Viticoltura ed Enologia
(C.I.R.V.E.), Universit di Padova, via dellUniversit 16, 35020 Legnaro (PD), Italy.
Tutor: Prof. Andrea Curioni

This PhD thesis evaluates the capacity of Botrytis cinerea to remove grape proteins and to produce proteolytic
enzymes able to decrease the protein instability in white wines. The experiments showed a new mechanism used
by fungus to remove the grape proteins. In detail, laccase activity seems to be the responsible of grape proteins
removal through the oxidation of the polyphenols and their complexation with proteins. A purified proteolytic
enzyme obtained from B. cinerea was not able to remove grape proteins from wine in the standard winemaking
conditions. Purified laccase could be a new tool fro protein removal from wines.
Funzionalit delle proteine delluva in relazione alla torbidit del vino bianco: Botrytis
cinerea per la rimozione delle proteine delluva
Questa tesi di dottorato ha valutato la capacit di Botrytis cinerea di rimuovere le proteine delluva e di produrre
enzimi proteolitici capaci di diminuire linstabilit proteica dei vini bianchi. Gli esperimenti hanno dimostrato un
nuovo meccanismo usato dal fungo per la rimozione delle proteine delluva. In dettaglio la attivit della laccasi
sembra essere responsabile della rimozione delle proteine attraverso lossidazione dei polifenoli e la loro
complessazione con le proteine. Un enzima proteolitico ottenuto da B. cinerea non fu capace di rimuovere le
proteine delluva in una classica produzione di vino. La laccasi purificata potrebbe essere un nuovo strumento
utile allindustria enologica.

Key words: Botrytis cinerea, wine, haze, grape proteins, laccase, protease.
1. Introduction
The proteins from grapes can provoke one of the most common non-microbial defects of commercial white
wines: the proteins instability leading to haze formation during wine storage in the bottle (Waters et al 1992).
The grape proteins in wine can insolubilize forming amorphous sediments or aggregates, which greatly reduces
the commercial value of the wine, making it unacceptable for sale. The proteins causing this problem are
pathogenesis-related (PR) proteins of the grape (Robinson and Davies, 2000), which are involved in the
mechanisms of plant defence against pathogens (Monteiro et al., 2003). Botrytis cinerea causes grey mould
disease on grapevine, resulting in loss of grape production and wine quality. This fungal pathogen kills the host
plant tissue to acquire the nutrients necessary for growth and reproduction. This process is assisted by the
secretion of cell-wall-degrading enzymes and phytotoxic compounds. However, to successfully colonize the
plant tissue, B. cinerea must also neutralize several plant anti-fungal compounds; in the case of grape berries,
these compounds are primarily the stilbenic phytoalexins (trans-resveratrol) and pathogenesis-related (PR)
proteins. Proteome and transcriptome analyses have shown that grape berries constitutively contain large
amounts of chitinase, !-1,3-glucanase, osmotin, and thaumatin-like proteins, all considered PR proteins. These
proteins may contribute to protect berries from fungal infection and are considered resistant to proteolytic
digestion by the fungi (Ferreira et al., 2002). However grape berries infected with B. cinerea show a strong
reduction of the protein content in comparison to healthy ones (Marchal et al., 1998) and this finding was
ascribed to a putative proteolytic activity secreted by the fungus during colonization. We hypothesized that an
insolubilization mechanism is responsible for the removal of proteins from infected grape berries.

2. Materials and Method
B. cinerea cultures. Botrytis cinerea strain PM-10 isolated from grape was kindly provided by Prof. Giuseppe
Firrao, University of Udine (Italy). The fungus was grown on Petri dishes on potato dextrose agar (PDA, Difco)
at 24C. For spore production, completely colonized plates were incubated under near UV light for 16 h as
reported by Schouten et al. (2002). After 15 days, conidia were collected into 5 ml of sterile water by gently
scraping the plates with a glass rod. Conidia were filtered through a sterilized gauze and counted using a
haemocytometer. Liquid cultures were produced in a modified Czapek-Dox medium (NaNO
3
2 g l
-1
, KCl 0.5 g l
-1
,
15
th
94
15
th
MgSO
4
*H
2
O 0.5 g l
-1
, K
2
HPO
4
1 g l
-1
, FeSO
4
0.01 g l
-1
, 1 ml of a solution of 1% ZnSO
4
plus 0.5% CuSO
4
,
and glucose 20 g l
-1
), adjusted to pH 3.5 with tartaric acid (about 10 mM), which was sterilized by autoclaving.
The medium was prepared at a double concentration, and 2 ml aliquots were plated onto Petri dishes (3 cm
diameter) and diluted 1:2 with filter-sterilized stock solutions of grape proteins, grape polyphenols, trans-
resveratrol (Sigma-Aldrich, purity >99%), and/or water, and with the concentrated spore suspension to obtain a
final concentration of 10
4
conidia ml
-1
.
Two levels (absence and presence) of each factor (proteins, polyphenols, and trans-resveratrol) were compared in
an experimental factorial design. Proteins, polyphenols, and trans-resveratrol were supplied at 100 g ml
-1
, 200
g ml
-1
, and 200 g ml
-1
, respectively. The trans-resveratrol stock solution (25 mg ml
-1
) was in 95% ethanol,
and the same amount of ethanol (0.8%, v/v) was added to the cultures not treated with trans-resveratrol. Crystals
formed when trans-resveratrol was added at the beginning of the experiment, but the compound dissolved during
the course of the culturing. A higher ethanol amount (4%, v/v) has been recommended to increase the trans-
resveratrol solubility (Adrian et al., 1998), but this was not used because we observed a reduced growth of the
fungus at this ethanol concentration. Each treatment was replicated three times.
The cultures were maintained in the dark at 24C for 4 days. Aliquots of 100 l were harvested daily from each
culture to assess laccase activity and the protein pattern. At the end of the experiment, the content of each culture
medium was transferred into 5 ml pre-weighed tubes and centrifuged at 12000 "g for 30 min. In addition, each
plate was rinsed with 3 ml of water, which was then added to each tube, and the mycelium mat was briefly
vortexed and centrifuged again. The supernatant was discarded, and the tubes were oven dried at 80C for 3 days
and then weighed.
Grape berry source and inoculation. White ripe grape (Vitis vinifera, cv. IM 6.0.13) was harvested in the first
week of September 2008 from a typical vineyard area near the city of Conegliano (TV, Italy) and stored for 36
days at 4C before protein and polyphenol extraction and B. cinerea inoculation.
For inoculation, the berries were detached from the bunch and surface sterilized with ethanol (99%) for 1 min,
then rinsed with sterile water. A piece (3 " 2 mm) of PDA-colonized agar, cut from the marginal zone of an
actively growing fungal colony, was placed on a small wound created on the berry surface with a razor blade. The
berries were placed above a moist filter paper and closed in a plastic bag at about 22C. After 7 days, the
inoculated berries appeared extensively brownish, and they were harvested and stored at -20C until extracted.
Berries inoculated with non-colonized PDA were incubated in a similar way and used as the control. Healthy and
naturally infected berries with grey mould symptoms were harvested from the vineyard at the beginning of
November 2008.
Grape protein extraction and analysis. Proteins were extracted from about 1 L of grape juice obtained by hand
crushing about 1.6 kg of berries at 4C in a beaker. The grape juice was immediately filtered through a nylon gauze,
and cysteine was added to give a final concentration of 4 mM to prevent polyphenol oxidation. All successive
operations were also performed at 4C. The juice was centrifuged at 30000 "g for 30 min, and the supernatant was
filtered in succession through glass-microfibre discs (GMD) and cellulose acetate filters (0.8 m) (Sartorius) and
dialyzed overnight (membrane cut off=10 kDa) against 10 mM potassium tartrate buffer, pH 3.5. The dialyzed
material was adjusted to 20% saturation with (NH
4
)
2
SO
4
and stirred for 1 h. After centrifugation at 30000 "g for 30
min, the supernatant was filtered in succession through 0.8, 0.45, and 0.2 m membranes, concentrated 8 times
with a VivaFlow 5000 apparatus (Sartorius), and loaded on a Sephadex G-25 column (PD-10, GE Healthcare). The
protein was eluted with water and further concentrated with a VivaFlow 5000 apparatus and then assayed for protein
(Bradford, 1976) and phenol (Folin-Ciocalteau assay) amounts using BSA and gallic acid as the standards,
respectively. The protein recovered, about 20 g g
-1
of berry fresh weight, was approximately one-third that
measured initially in the grape juice. The estimated weight ratio between protein and phenols in the final protein
preparation was about 5:1. This protein was used for B. cinerea cultures and in vitro assays.
The protein profile was analyzed after precipitation of the protein with four volumes of cold ethanol at -20C for
2 h. The pellet containing the precipitated protein was washed once with cold 70% ethanol. After centrifugation
at 12000 "g for 15 min, the precipitated protein was air dried and separated by sodium dodecyl sulphate gel
electrophoresis on 16% (w/v) polyacrylamide gels (SDS-PAGE). The gel was stained with the colloidal
Coomassie G-250 blue silver method (Candiano et al., 2004).
To compare the protein patterns of healthy and infected berries, 10 healthy and 10 infected berries were crushed,
and the juice was centrifuged, filtered, and passed through a PD-10 column as described above. A volume of
extract of healthy berries containing 5 g of protein and an identical volume from the infected berries were
precipitated and analyzed by SDS-PAGE, as described above.
Grape phenol extraction. Once crushed and divested of seeds, the solid grape residue was mixed with potassium
metabisulphite at a concentration of 0.5 g kg
-1
of fresh grape and stored at -20C. Grape polyphenols were
extracted by the method of Kammerer et al. (2004) with some modifications. A total of 50 g of the stored
material was stirred with four volumes of methanol/0.1% HCl (v/v) for 2 h under nitrogen at room temperature.
The extract was filtered through filter paper and vacuum dried using a Rotavapor at 30C. The residue was
15
th
95
15
th
dissolved in 100 ml of acidified methanol, centrifuged at 8600 "g for 20 min, and dried again. The residue was
dissolved in 40 ml of deionized water brought to pH 3.5 with HCl. The aqueous suspension was centrifuged at
8600 "g for 15 min. The supernatant was filtered through 0.45 m membranes, and 10 ml aliquots were loaded
onto SPE DSC-18/6 ml columns (Supelco) equilibrated with deionized water. After washing with 5% methanol
in water, the phenols were eluted with absolute methanol and concentrated using the Rotavapor, as described
above. The residue was dissolved in 2 ml of deionized water, and the phenol concentration was determined by the
Folin-Ciocalteau assay, using gallic acid as a standard. About 500 g of phenols per gram of grape fresh weight
were obtained and stored at -20C until required.
B. cinerea laccase production, purification, and activity assay. Laccase of B. cinerea was extracted as
described by Slomczynski et al. (1995). After culturing for 7 days, several 250 ml Erlenmeyer flasks, each
containing 50 ml of culture, were pooled, and the content was filtered through GMD and then using a cellulose
acetate membrane (0.8 and 0.45 m) (Sartorius). The filtrates were dialysed against deionized water, concentrated
to 40 ml using a VivaFlow 5000 apparatus, adjusted to pH 6.0 with 10 mM potassium tartrate, and loaded onto
a Q-sepharose column (16 " 120 mm, Pharmacia). Bound protein was eluted with a 60 min linear gradient of 0
0.5 M NaCl dissolved in the 10 mM K tartrate buffer. Laccase activity was assayed in the eluted fractions (2 ml),
and the fraction with the highest activity was used in the following assays. This fraction showed a 96 kDa band
when analyzed by SDS-PAGE, similar in size to the protein purified by Slomczynski et al. (1995).
Laccase activity was determined spectrophotometrically as described by Wolfenden and Willson (1982) in a total
volume of 0.8 ml containing 0.7 ml of 0.1 M acetate buffer, 0.1 ml of 2 mM 2,2-azinobis-(3-
ethylbenzthiazoline-6-sulphonate) (ABTS) substrate, and variable volumes of samples (130 l). The enzyme
assay was performed at 30C by monitoring the A
420
. One laccase unit (U) was defined as the amount of enzyme
that oxidizes 1 mol ABTS per min.
Polyphenols, protein and trans-resveratrol interactions. Grape proteins, grape polyphenols, and trans-
resveratrol were mixed in the same weight ratio of 1:2:2 as used for the B. cinerea cultures. Grape proteins (50
g ml
-1
), trans-resveratrol (100 g ml
-1
), and polyphenols (100 g ml
-1
) were dissolved in 0.1 M potassium-
tartrate buffer pH 3.5 in the presence or absence of the purified laccase (0.02 U ml
-1
). After 24 h of incubation at
24C, 100 l aliquots of the mixtures were centrifuged at 16000 "g for 20 min, and the supernatant was
separated from the pellet. The pellet containing the precipitated protein was washed once with cold 70% ethanol.
The protein in the supernatant (soluble protein) was precipitated with 4 volumes of cold ethanol at -20C for 2 h
and then washed once with cold 70% ethanol. Both soluble and insoluble proteins were recovered by
centrifugation and air dried. Proteins were run on SDS-PAGE gels and stained as described above.
Juice treatment by purified proteolytic enzyme from B. cinerea. A purified proteolytic enzyme was obtained
from a liquid culture after B. cinerea growing. The medium was filtered 0.45 m and dialysed against deionized
water, concentrated to 40 ml using a VivaFlow 5000 apparatus and loaded onto a Q-sepharose column (16 " 120
mm, Pharmacia). Bound protein was eluted with a 60 min linear gradient of 00.5 M NaCl dissolved in the 10 mM
K tartrate buffer. Protease activity was assayed in the eluted fractions (2 ml), and the fraction with the highest
activity was used in the juice treatment. The protease added in the juice was 180 #g/L. After 24 hours the DV10
strain was inoculated in the juice and the fermentation was monitored by refractometric analysis. When the
fermentation was finished the samples were putted at 4C for 4 days and then filtered 0.45 m and added of SO
2
to
protect the wine from oxidation. The samples were analyzed by heat test (Waters et al. 1992) and SDS- PAGE gel.
Statistical analysis. Data for laccase activity and mycelium dry matter were subjected to analysis of variance
according to a multifactorial design with three replicates.

In the juice obtained from grape berries infected with B. cinerea the proteins content is dramatically reduced,
(figure 2) confirming previous literature results (Marchal 1998).
B. cinerea cultures were produced in a medium supplied with grape proteins as the sole nitrogen source. The
residual protein content after 8 days-old of B. cinerea incubation indicated only a limited protein degradation
even in the presence of a measurable proteolytic activity (figure 3 and figure 4). In contrast with previous
findings obtained by other authors (Marchal 1998, Girbau 2004), this result excludes the possibility to use the
proteases of B. cinerea to remove the grape proteins in order to reduce the instability in white wines. This
finding was confirmed when the Botrytis protease, partially purified from the fungal culture, was used for the
treatment of Manzoni bianco juice before the alcoholic fermentation. As a matter of fact, this enzyme was not
able to reduce the haze in the finished wine (figure 1).
During the different experiments, we observed that the grape proteins induced a strong fragmentation of the B.
cinerea mycelium (figure 4), but this event was prevented by the addition of grape polyphenols in the medium
(Favaron 2009). Further in vitro experiments also showed that laccase activity of the fungus caused the
insolubilization of the grape proteins in the presence of grape polyphenols and/or resveratrol (figure 5).
15
th
96
15
th
Figure 1. Heat Test of the wines obtained from the fermentation of
Manzoni bianco juice. The protease from Botrytis cinerea was compared
with the pepsin treatment and the control (no protease added). The protease
from B. cinerea increase the instability.

Figure 2 Figure 3

Figure 2. SDS-PAGE of the protein extracted from grape berries either healthy or infected with B. cinerea. (A) Protein
extracted from healthy (lane1) and artificially infected berries (lane 2) at 7 days from inoculation. (B) Protein extracted from
healthy (lane 2) and infected berries (lane 3) harvested from a vineyard. A sample (approximately 5 mg) of the partially
purified grape protein was also loaded (lane1).

Figure 3. SDS-PAGE of the residual grape proteins in liquid medium (with purified grape proteins as the sole nitrogenous
source) during the development of B. cinerea. The fungus changed the pattern but did not remove the proteins.

Figure 4 Figure 5

Figure 4. SDS-PAGE patterns of proteins collected from B. cinerea cultures. The cultures were incubated in 4 ml Czapek-
Dox medium at pH 3.5 supplied with grape proteins and grape proteins + grape polyphenols. In the culture treated with
protein only, the band at 31 kDa disappears and a new 28 kDa band appears. In the culture supplied with grape polyphenols,
the 31 kDa band gradually disappeared and the 25 kDa band faded, becoming barely detectable at the end of experiment.

Figure 5. An in vitro experiment has been performed by mixing grape proteins (P) with B. cinerea laccase (+Laccase) and
polyphenols (+Pph), and/or resveratrol (+R). After 24 h of incubation, laccase precipitates most grape proteins when
polyphenols, resveratrol or both are present. Mixtures without laccase (-Laccase) have been used as controls.
15
th
97
15
th
4. Conclusions
In presence of grape polyphenols, B. cinerea laccase, probably through the production of oxidized phenol
intermediates, modifies the solubility of grape PR proteins. This mechanism seems to be responsible of the grape
proteins removal in infected berries. Our studies showed that the proteolytic activity produced in vitro by B.
cinerea is not very effective to degrade the grape proteins. Partially purified proteolytic enzyme from B. cinerea
was not able to reduce the proteins instability in juice treated before the fermentation. Therefore, laccase activity
could be mean to reduce the protein instability in white wine. This finding warrants further investigation.

5. References
Adrian M, Jeandet P, Veneau J, Weston LA and Bessis R (1997) Biological activity of resveratrol, a stilbenic
compound from grapevines, against Botrytis cinerea, the causal agent for gray mould, Journal of Chemical
Ecology 23, 1689-1702.
Bradford MM (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding, Analytical Biochemistry 72, 248-254.
Candiano G, Bruschi M, Musante L, Cantucci L, Ghiggeri GM, Carnemolla B, Orecchia P, Zardi L and
Righetti PG (2004) Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis,
Electrophoresis 25, 1327-1333.
Girbau T, Stummer BE, Pocock KF, Baldock GA, Scott ES and Waters JE (2004) The effect of Uncinula
necator (powdery mildew) and Botrytis cinerea infection of grapes on the levels of haze-forming
pathogenesis-related proteins in grape juice and wine, Australian Journal of Grape and Wine Research 10,
125-133.
Favaron F, Lucchetta M, Odorizzi S, Pais da Cuhna AT and Sella L (2009) The role of grape polyphenols on
trans-resveratrol activity against Botrytis cinerea and of fungal laccase on the solubility of putative grape PR
proteins, Journal of Plant Pathology 91, 579-588.
Ferriera RB, Piarra-Pereira MA, Monteiro S, Loureiro VB and Teixeira AR (2002) The wine proteins,
Trends in Food Science & Technology 12, 230-239.
Kammerer D, Claus A, Carle R, Schieber A (2004) Polyphenol screening of pomace from red and white
grape varities (Vitis vinifera L.) by HPLC-DAD-MS/MS. Journal of Agricultural and Food Chemistry 52,
4360-4367.
Marchal R, Berthier L, Legendre L, Marchal-Delahaut L, Jeandet P and Maujean A (1998) Effects of Botrytis
cinerea Infection on the Must Protein Electrophoretic Characteristics, J. Agric. Food Chem. 46, 4945-4949.
Monteiro S, Barakat M, Piarra-Pereira MA, Teixeira AR, Ferreira RB, 2003. Osmotin and thaumatin from
grape: a putative general defense mechanism against pathogenic fungi. Phytopathology 93: 1505-1512.
Robinson SP and Davis C (2000), Molecular biology of grape berry ripening, Australian Journal of Grape
Wine Research, 6: 175-188.
Schouten A, Wagemakers L Stefanato FL, van der Kaaij RM and van Kan JAL (2002) Resveratrol acts as a
natural profungicide and induces self-intoxication by a specific laccase, Molecular Microbiologo 43, 883-
894.
Slomczynsky D, Nakas JP and Tanenbaum SW (1995) Production and characterization of laccase from
Botrytis cinerea 61-34, Applied and Environmental Microbiology 61, 907-912.
Waters EJ, Wallace W and Williams PJ (1992) The identification of heat-unstable wine proteins and their
resistance to peptidases. Journal of Agricultural and Food Chemistry 40, 1514- 1519.
Wolfenden BS and Willson RL (1982) Radical-cations as reference chromogens in kinetic studies of one-
electron transfer reactions: pulse radiolysis studies of 2,2-azinobis-(3-ethyl-benzthiazoline-6-sulphonate).
Journal of Chemical Society Perkin Transactions II, 805-812.
Acknowledgements
My PhD course is supported by Provincia di Treviso. I thank the laboratory of oenology in Conegliano (Simone
Vincenzi, Deborah Franceschi, Matteo Marangon and Diana Gazzola) and the laboratory of pathology in Padova
(Francesco Favaron, Silvana Odorizzi, Luca Sella, Carla Castiglioni, AT Pais da Cunha).
15
th
98
15
th

Physical Approaches to Improve the Quality of Gluten-Free Pasta
Alessandra Marti (alessandra.marti@unimi.it)
Dipartimento di Scienze e Tecnologie Alimentari e Microbiologiche - Universit degli Studi di Milano
Tutor: Prof.ssa Maria Ambrogina Pagani
The aim of this PhD thesis is to investigate physical treatments on rice flour suitable for improving cooking
quality of gluten-free (GF) pasta. Particular attention has been focused on the macromolecular modifications
induced by different processing conditions. The effect of starch modifications on cooking behavior was also
investigated.
Messa a punto di interventi fisici idonei a migliorare le caratteristiche di
paste gluten-free
Questo progetto di tesi di dottorato mira allindividuazione di interventi fisici da applicare a sfarinati di riso al
fine di migliorare le loro caratteristiche tecnologiche e le propriet strutturali degli alimenti da essi derivanti.
Particolare attenzione stata rivolta allo studio del comportamento in cottura della pasta e dellorganizzazione
strutturale dellamido in funzione delle condizioni del processo di estrusione.
Keywords: gluten-free rice pasta; conventional extrusion; extrusion-cooking; cooking quality; starch properties.
1. State of the art on GF pasta
The market of gluten-free (GF) pasta is growing to satisfy not only the needs of celiac patients but also the
increasing demand of consumers who wish to exclude gluten-based products from their diet. Both these
consumer categories look for GF products with the same appearance and texture as conventional products.
Unfortunately, the majority of GF pasta currently on the market, if compared with their wheat counterparts,
show a very poor quality. Therefore, the replacement of gluten still represents a major technological challenge.
Two main approaches can be taken to replace gluten in GF pasta. One is based on appropriate
ingredients/additives suitable for inducing a cohesive structure to overcome the absence of gluten. In this
approach, primary ingredients are used in GF pasta: starch (rice, corn, pseudocereal, or tuber flours) and protein
(egg or milk proteins, legume flours, etc) sources, emulsifier and/or hydrocolloids. The second and more
interesting approach focuses on the role of processing conditions able to promote a new and efficacious starch
organization able to substitute the gluten network in the final product (Pagani, 1986). At this regard, the
production of GF pasta borrows from the Oriental countries the technology from the ancient but still used
processes for making noodles. Traditionally, rice pasta are prepared from high-amylose rice flour which is
transformed into noodles by using a long process consisting of repeated heating and cooling treatments of the
mixture (Juliano and Sakurai, 1985). The sequence of thermal events induces starch gelatinisation, followed by
its retrogradation. The latter is strategic for creating a starchy network, responsible for assuring a cohesive
structure and preventing the dissolution of solid matter into the boiling water (Pagani, 1986). However, the
artisanal process for rice noodles presents several critical factors, because of the discontinuity of the process
(time-consuming, labour-intensive, low productivity), the hygienic conditions, and the environmental impact
(water- and heat-consuming). Moreover, the cooking loss are frequently high and the consistency of cooked
products is often judged too firm in comparison with wheat pasta. For all these reasons, the artisanal noodle
technology is tricky to transfer to an industrial scale.
2. Objectives and Experimental plan
The final objective of this PhD project is the improvement of the characteristics of the current rice pasta-
products, preferring physical treatments of raw materials to induce effective macromolecular organization. To
achieve this goal, the study of macroscopic and molecular structure of components, according to the processing
conditions, is necessary. The experimental activities are here presented gathered into three main phases, as
summarized in Table 1. The results and the discussion of each part represent the starting points for the following
part.
Phase 1: The aim of the first part of the work was to explore the cooking characteristics of GF pasta products
prepared according to the two technologies currently used in Italy. Pasta samples were prepared only with rice
15
th
99
15
th

flour, without the addition of any additives (as modified starches, gums, emulsifiers, etc.), generally present in
all the commercial pasta-products.
Phase 2a: Preliminary physical treatments to rice flour suitable for improving pasta cooking quality were
investigated. The effect of different extrusion conditions on cooking behaviour was also studied. At the same
time, it was also considered the role played by native components other than starch on the structural changes
promoted by the process.
Phase 2b: This part of the project focused on understanding starch organization and arrangements in the
experimental rice pasta, according to the extrusion conditions. Multiscale and complementary approaches were
explored.
Phase 3: During the last part of the project, the attention was paid on the optimization of the formulation.
Table 1. Experimental plan of the PhD project
3.1 Preparation of rice pasta
The experimental pasta samples (macaroni shape) were produced in the pilot-plant of DiSTAM, University of
Milan. Two different extrusion technologies were carried out: a conventional extrusion (process A) and an
extrusion-cooking (process B). Drying was carried out at low temperature in both processes (Figure 1).
Phase Aim Pasta sample Ingredients Pasta making process
Phase 1
Comparison of cooking
behaviour of rice pasta
according to the current
technologies
PaPGF
100% PGF
(pregelatinized rice flour)
Process A
(conventional extrusion)
PaRF
100% RF
(untreated rice flour)
Process B
(extrusion-cooking)
Phase 2a
Investigation of physical
treatments on rice flour to
improve pasta cooking quality.
Effect of extrusion conditions on
pasta cooking quality
PaMR_A
100% MRF
(heat-treated milled rice flour)
Process A
PaBR_A
100% BRF
(heat-treated brown rice flour)
Process A
PaMR_B 100% MRF Process B
PaBR_B 100% BRF Process B
Phase 2b
Understanding the relationship
between starch organization and
processing conditions
PaMR_A 100% MRF Process A
PaMR_B 100% MRF Process B
Phase 3a
Optimization of pasta
formulation: role of different
rice flours
PaPGMR 50% PGF + 50% MRF Process A
Phase 3b
Optimization of pasta
formulation: role of coagulable
proteins
PaEP 98.5% MRF + 1.5% egg protein Process A
PaWP3 97% MRF + 3% whey protein Process A
PaWP5 95% MRF +5% whey protein Process A
Figure 1. Process conditions
for experimental rice pasta-
making.
15
th
100
15
th

3.1 Cooking quality of rice pasta
Cooking behavior (optimum cooking time - OCT, water absorption and cooking loss): according to DEgidio et
al (1990); Textural characteristics (evaluated by Kramer shear test): according to Marti et al.(2010).
3.2 Starch characterization in rice flours and pasta samples
Starch susceptibily to -amylase and pasting properties: according to Marti et al. (2009); Thermal properties and
Wide Angle X-ray Powder Diffraction: according to Marti et al. (2010); Colorimetric analyses of granular
samples exposed to iodine vapour: according to Saibene and Seetheraman (2006).
4. Preliminary studies by using the current technologies (phase 1)
The current processes used to produce GF pasta are shown in Figure 1. In this preliminary phase, process A was
carried out using a pregelatinized rice flour (PGF), while an untreated rice flour (RF) was preferred for process
B. Both rice pasta products showed cooking loss values which are three times higher than semolina pasta ones
(3.5%), despite the lower swelling capacity of these GF samples. Also the cooking behaviour (evaluated by
instrumental approaches) highly differed from that exhibited by the reference semolina product. In particular,
both cooked rice pasta showed a significant lower firmness, even if PaPGF presented a higher consistency than
sample PaRF. This behaviour could probably be related to a different macromolecular organization during pasta-
making process. In order to improve cooking quality of GF products, industries are used to add texturing
ingredients, such as modified starches, protein, and/or additives. The aim of this PhD thesis was to investigate if
hydro-thermal treatments on whole rice could assure, by themselves, satisfactory pasta-making behaviour to rice
flour and good cooking properties to the corresponding pasta.
5. Effects of extrusion conditions on cooking quality of experimental rice pasta (phase 2a)
A commercial paddy rice (Thai cultivar) was steam-treated and two kinds of pre-heated flour were obtained: a
brown rice flour (BRF) and a milled rice flour (MRF). Starting from BRF and MRF and using process A and
process B, four pasta samples were prepared (Table 1).
The extrusion temperature greatly affected the cooking parameters of pasta from MRF. In particular, the high
extrusion temperature of process B promoted the formation of a new macromolecular structure, more
hydrophilic and able to retain more water than PaMR_A (76% vs 62%, respectively). At the same time, these
conditions assured a more continuous and less soluble structure than process A, accounting for the low cooking
loss (4% vs 16%, respectively) and the extreme firmness of the product (1529 N vs 525 N, respectively). On the
other hand, process A created a matrix showing a consistency similar to that of semolina pasta (488 N).
These macroscopic properties accounted for different starch organizations according to the extrusion conditions,
as proved by starch susceptibility to -amylase and pasting properties. The amount of starch hydrolyzed by the
enzyme was slightly higher in PaMR_B, in agreement with its higher swelling ability. Moreover, this product
exhibited a higher viscosity at 95 C (187 BU), as well as after the heating step (239 BU), and at the end of the
test (825 BU) in comparison with PaMR_A (129.5 BU, 195 BU, and 521.5 BU, respectively).
Table 2. Thermal properties of milled rice flour and pasta samples. (Means followed by different letters in a column are
significantly different at p<0.05. To = gelatinization onset temperature; Tp = gelatinization peak temperature; Tc =
gelatinization conclusion temperature; H
TS
= gelatinization enthalpy expressed on total starch content).
To
(C)
Tp
(C)
Tc
(C)
H
TS
(J/g)
MRF 47.8a 56.0a 65.7a 4.3b
PaMR_A 55.4b 63.9b 72.5b 6.1c
PaMR_B 75.2c 78.8c 83.6c 1.1a
Regarding the thermal properties of the experimental pasta (Table 2), sample PaMR_B required a higher
temperature for melting (from 75.2 C to 83.6 C), resulting in a product more stable during heating than sample
PaMR_A. This feature could likely explain pasta behavior during cooking: the strong network assured by the
extrusion-cooking accounted for the limited cooking loss of this product.
Since starch is the major component of the rice kernel, the change of its physicochemical properties during
pasta-making will dominate the characteristics of rice pasta. The cooking behavior and the properties of the
starch matrix obtained from brown rice flour appeared less affected by the processing conditions (Marti et al.,
2009). This trend could be related to the formation of a polysaccharide network involving starch and non-starch
polysaccharides (NSP) molecules: the high amount of fiber and lipids in brown rice flour could interfere with
15
th
101
15
th

starch during the pasta-making process, decreasing the effect of the extrusion temperature on this starch
structure.
6. Understanding starch organization in rice pasta (phase 2b)
In this part of the work several advanced approaches were used to clarify the structural properties of starch and
their relationship with cooking performances. The attention was focused on MRF pasta samples as the effects
related to the extrusion conditions were more evident. Starch organization was investigated before and after
removing the protein fraction from the samples (according to Marti et al., 2010) and after equilibration above
different saturated solutions (MgCl
2
, NaCl, and K
2
SO
4
; corresponding at a
w
value of 0.33, 0.75, and 0.97,
respectively). The ability of glucan-polymer chains to form complex with iodine was used to explore starch
rearrangements in pasta products, before and after cooking. The comparison with semolina pasta was also
considered. In this section only the results related to starch isolated from MRF and the uncooked pasta samples
after equilibration above K
2
SO
4
are presented.
After equilibration above K
2
SO
4
(0.97 a
w
), all the starch samples showed a typical A-type diffraction pattern
with strong reflections at 15 and 23, and an unresolved doublet at 17-18 2 (Figure 2). Moreover, the spectra
showed peaks at 7, 13, and 20 2. These latter are likely related to the crystalline order of single helix
amylose-lipid complexes. The hydrothermal process applied on rice kernels resulted in the formation of
complexes between starch and native lipids, accounting for the V structure detected in rice flour. Although pasta
samples maintained the diffraction pattern detected in rice flour, some changes in the peak intensities occurred.
Regardless the extrusion conditions, the intensity of the peak at 20 2 increased, suggesting that the lipids
naturally present in rice flour can form helical inclusion complexes with amylose during pasta processing, giving
an A+V-type X-ray diffraction pattern. Moreover, the pasta-making process seemed to be responsible for the
slight change in peak at 15 2 that appeared sharper in pasta samples compared to MRF. The different extrusion
conditions affected the starch crystalline packing. After Process B, a general decrease in crystallinity was
observed, highlighted by the decrease of the peaks at 7, 13, and 20 2, suggesting a low single helical type
crystallinity. Despite that, the peak at 182 increased in intensity. Moreover, the peaks at 10 and 11 2
disappeared in PaMR_B.
The arrangement of the amorphous regions in the starchy structure induced by pasta-making process was
evaluated by using iodine as a tool (Saibene and Seetheraman, 2006). Absorption spectra of starch samples
exposed to iodine are presented as absorption/scattering index (K/S). Process B promoted the formation of a
starchy matrix with a higher mobility (higher K/S values) compared to sample PaMR_A (Figure 3). As the
amorphous regions of starch granules are less dense than the crystalline regions, the starch-iodine formation is
more likely to occur in the less organized regions, that appeared more mobile (Saibene et Seetharaman, 2006).
The low amount of the amorphous regions hypothesized in starch from PaMR_A confirmed the information
given by their sharper diffraction peaks in comparison with the pattern of PaMR_B. In the starch extracted from
this pasta, the higher mobility of the polymer chains also affected the amount of water absorbed during the
equilibration period (20.5% and 17.5%, for starch from PaMR_B and PaMR_A, respectively) and the colour of
the samples (data not shown).
After iodine exposure, a loss of starch crystallinity was observed as a consequence of the formation of the
iodine-starch complex (Figure 4). In fact, the intensity of the main diffraction peaks (13, 15, 17, 18
2) decreased. Moreover, the intensity of the peak 20 2 increased with the formation of the complex between
iodine and polymer chains, confirming the presence of starch-iodine complex.
Figure 2. X-ray powder diffraction spectra of starch
samples following equilibration over K
2
SO
4
saturated
solutions (0.97 a
w
).
Figure 3. K/S values of starch samples exposed to
iodine vapor following equilibration over K
2
SO
4
saturated solutions (0.97 a
w
).
15
th
102
15
th

The change in crystallinity promoted by process B was detectable even after iodine exposure. The starch-iodine
complex in fact highlighted the presence of peaks at 7 and 18 2; on the other hand, the peaks at 20 and 23
2 appeared less sharp, highlighting a less ordered structure than the structure present in starch from MRF and
PaMR_A (Figure 4).
7. Optimization of GF pasta formulation (phase 3)
In the last part of the project, texturing ingredients were added in order to improve the cooking behavior of pasta.
For this reason, the formulation of PaMR_A (100% heat-treated milled rice flour) was modified by the addition
of pregelatinized flour, egg- and whey-protein, as summarized in Table 1. Besides the technological role, egg-
and whey-proteins are associated with an important improvement of nutritional value of GF products.
The addition of pre-gelatinized flour and protein sources promoted the decrease in cooking loss. The
pregelatinized flour acted as a binder during the conventional extrusion, containing the leaching phenomenon
during cooking (cooking loss = 6.3%), whereas the soluble proteins strengthened the starchy network due to their
coagulating properties (cooking loss about 7%). Moreover, all the pasta samples showed a higher water
absorption value than pasta PaMR_A. This behavior could be responsible for the decrease in consistency.
8. General conclusions and future perspectives
Starch changes induced by pasta-making process are the key for producing a GF pasta with a good cooking
behavior. The structural and architectural differences in the final products according to the extrusion conditions
were probed by different and multiscale approaches. Understanding starch organization is the starting point to
engineer rice pasta with an effective structure not only for texture but also for nutritional properties.
The hydrothermal process carried out on rice kernels and heat treatments during extrusion-cooking were suitable
for creating an effective starchy network, without the addition of emulsifiers or gums. Nevertheless, the role of
lipids and NSP should be better investigated, also in view of the ever increasing popularity of high-fiber pasta
and of the associated technological problems.
9. References
DEgidio MG, Mariani BM, Nardi S, Novaro P, Cubadda R (1990). Chemical and technological variables and their
relationship: a predictive equation for pasta cooking quality. Cereal Chem 67: 275-281.
Juliano BO, Sakurai J (1985). Miscellaneous products. In Juliano (Ed) Rice: Chemistry and Technology, 2
nd
ed, St Paul: Ass.
Cereal Chemistry, pp 569-618.
Marti A, Caramanico R, Bottega G, Seetharaman K, Pagani MA (2009). Characterization of rice-based pasta: comparison
with conventional semolina pasta. 2nd International Symposium on Gluten-free cereal products and beverages. IWQC-
IV Wheat Science: Challenges & Opportunities.
Marti A, Caramanico R, Seetharaman K, Pagani MA (2010). Starch characterization of rice pasta: comparison between
extrusion-cooking and conventional pasta-making process. 2
nd
International Symposium on Gluten-free cereal products
and beverages.
Pagani MA (1986) Pasta products from non-conventional raw materials. In Pasta and extrusion cooked foods. Mercier C,
Cantarelli C, eds. Elsevier applied science, London, pp 52-68.
Saibene D, Seetharaman K (2006) Segmental mobility of polymers in starch granules at low moisture contents. Carbohydrate
Polymers 64: 539-547.
Figure 4. Effect of iodine on the X-ray powder
diffraction spectra of starch samples following
equilibration over K
2
SO
4
saturated solutions
(0.97 a
w
).
15
th
103
15
th
Evaluation of Antioxidants in Fruits and Vegetables
Rossella Mignogna (rossella.mignogna@unimol.it)
Dipartimento di Scienze e Tecnologie Agroalimentari, Ambientali e Microbiologiche
Universit degli Studi del Molise, Campobasso, Italia
Tutor: Prof. Gianfranco Panfili
This PhD thesis aimed at the evaluation of antioxidants in fruits and vegetables with the scope to characterize
protective compounds of fruits and vegetables. Firstly antioxidant content of differently treated fruits and
vegetables sampled in two different hospital canteens at different seasons and secondly, lutein content and its
forms (bound, esterified and free lutein) of different vegetables are described.
Valutazione degli antiossidanti in frutta e verdura
Questa tesi di dottorato riguarda la valutazione di antiossidanti in prodotti ortofrutticoli allo scopo di
caratterizzare gli specifici componenti salutistici di frutta e verdura. Dapprima, stato valutato il contenuto in
polifenoli e la relativa attivit antiossidante in campioni di frutta e verdura diversamente trattati prelevati presso
due mense ospedaliere diverse in periodi diversi e, in secondo luogo, il contenuto in luteina di diversi vegetali,
analizzando le diverse forme in cui presente nellalimento (luteina legata, esterificata e libera).

Key words: Antioxidant, polyphenols, lutein, fruits and vegetables.
1. Introduction
A large number of epidemiologic studies have shown that fruit and vegetable consumption is associated with a
reduced risk of many cancers and other chronic diseases (Holden et al. 1999; Podsedek, 2007; Faller and Fialho,
2009), since these foods contain large amounts of natural antioxidant molecules, which inhibit lipid peroxidation
processes of polyunsaturated fatty acids and other compounds of cell membranes and can protect human health
(Ninfali and Bacchiocca, 2003).
Among antioxidants, there are a wide range of amphipathic molecules, broadly named phenolics compounds,
vitamin A and E and xanthophylls, like lutein and zeaxanthin.
With regard to polyphenols, they are secondary metabolities, synthesized by higher plants, containing at least
one aromatic ring with one or more attached OH groups, in addition to other substituents (Apak et al. 2007).
Polyphenols comprise over 8000 already identified substances, and they can be divided into groups according to
their chemical structure, such as phenolic acids, stilbenes, coumarins, lignins and flavonoids (Faller and Fialho,
2009). Flavonoids are most common in fruits and vegetables. Food products having the highest flavonoid content
are greenleafed, yellow and red vegetables (e.g., onion, cabbage, broccoli, cauliflower, Brussels sprouts, pulse
seeds, tomatoes, and peppers), fruit (e.g., grapefruits, oranges, berries, red and black currants, dark grapes, and
apples, but also tea (especially green tea) and red wine (Cieslik et al. 2006).
The content of polyphenols in vegetables, like levels of other phytochemicals, can be influenced by various
factors such as varieties, climatic conditions and cultural practices, maturity at harvest, storage conditions
(Podsedek, 2007) and also technological processes of conservation (Ninfali and Bacchiocca, 2003).
Polyphenols and flavonoids have shown certain stability when exposed to high temperatures, a quality that is
reflected in the preservation of their antioxidant capacity.
In the light of close link between nutrition and health, in this activity antioxidants content of differently treated
fruits and vegetables sampled in two different hospital canteens at different seasons are described, because
catering service in hospital is very important like therapeutic and dietary educations tool.
Lutein, and its stereo isomer zeaxanthin, are members of the xanthophylls family of carotenoids. Since they are
highly concentrated in the macula, a small area of the retina responsible for central vision and high visual
activity, they are hypothesized to function as potent antioxidants and effective screeners of high energy blue
light, both in humans and in plants. For this reason they are probably inversely related to the risk for ocular
disease, including age-macular degeneration (AMD) and cataracts (Alves-Rodrigues and Shao, 2004; Perry et al.
2009). Also several studies have been shown that lutein reduces the risk of atherosclerosis and is important for
skin health (Alves-Rodrigues and Shao, 2004; Dias et al. 2009; Updike and Schwartz, 2003). Lutein is contained
in green and yellowish vegetables (spinach, lettuce, broccoli, parsley, pea, squash, cucumber) (Calvo, 2005) and
fruits like mango, orange, watermelon (Stahl and Sies, 1999). Usually lutein is present in fruits and vegetables
both in free form and esterified with fatty acids, but it can also be bound to protein (Calvo, 2005). These bonds
can affect the bioavailability and the activity of lutein. In order to determine by means of HPLC both esterified
and bound lutein, a saponification procedure is needed in order to hydrolyze these forms. Moreover in literature
several studies, which investigated lutein content of different foods, carried out an extraction with solvents
15
th
104
15
th
followed by saponification to eliminate chlorophylls and a chromatographical determination, not considering
lutein bound to matrix. To support epidemiologic studies there is need of reliable data on lutein content in
different vegetables sources, in this PhD thesis, lutein content of different vegetables was evaluated by means of
an extraction method characterized by saponification followed by extraction with solvents and HPLC analysis;
the results were compared with a those obtained with a literature method. Moreover bound, esterified and free
lutein content was evaluated.
2.1 Evaluation of polyphenol content and antioxidant capacity of differently treated fruits and vegetables
In two different hospital canteens (A and B) fruit and vegetable samples, like fresh apple (Malus domestica),
lettuce (Lactuca sativa L.), deep-frozen chard (Beta vulgaris L. var. cicla), courgette (Cucurbita pepo subsp.
pepo), cauliflower (Brassica oleracea L. var. botrytis) were sampled at different seasons in two replicate (1 and
2 sampling). All deep-frozen vegetables were steamed, while apple was cooked in oven. These products were
cut, ground in a laboratory blender and immediately analysed. Polyphenolic compounds were extracted and
determined by the Folin-Ciocalteus method according to Georg et al. (2005), using catechin as a standard. The
results are expressed as mg of catechin/Kg f.w.. On the same extracts antioxidant capacity was evaluated by
means of the TEAC method, described by Re et al. (1999), and results are expressed as mol Trolox
Equivalent/Kg f.w.. All analysis were made in triplicate.
2.2 Evaluation of lutein in vegetables
Some vegetables, like spinach (Spinacia oleracea L.), parsley (Petroselinum crispum L.), broccoli (Brassica
oleracea L. var. italica), lettuce (Lactuca sativa L.), celery (Apium graveolens L. var. dulce) and peas (Pisum
sativum var. sativum), purchased in local stores, were treated with liquid N
2
and ground with a laboratory
blender before analysis. For each vegetables, on three different samples lutein was extracted according to Panfili
et al. (2004) with slight modifications, followed by normal-phase high performance liquid chromatography
determination. In particular the following forms of lutein were determined: 1) total lutein, determined after
saponification of the vegetable matrix followed by extraction with solvents; 2) free lutein, determined after
extraction of vegetable matrix with solvents without saponification; 3) free lutein + esterified (lipidic lutein),
determined on the extract coming from 2 after saponification; 4) esterified lutein, calculated by difference
between lipidic lutein and free lutein; 5) bound lutein, calculated by difference between total lutein and lipidic
lutein. The method choosen for comparison was that of Updike and Schwartz (2003), in which lipidic lutein was
determined. The analysis was conducted in triplicate and the results are expressed as mg/Kg f.w.. For the
recovery procedure 2g of a celery sample was spiked with 400l of a solution of lutein (100g/ml). The sample
was submitted in triplicate to the entire procedure of saponification, extraction and chromatographic
determination.
An analysis of variance (ANOVA) was performed and differences (p<0.05) between means were studied with
the Student-Newman-Keuls test.
3.1 Evaluation of polyphenol content and antioxidant capacity of differently treated fruits and vegetables
The polyphenol content and the antioxidant capacity of differently treated fruits and vegetables sampled in two
different hospital canteens (A and B) are reported in Figure 1 and Figure 2, respectively. Results agree with
literature values (Apak et al. 2007, Duda-Chodak et al. 2007, Pellegrini et al. 2003).
During sampling, a variable trend of both polyphenol content and antioxidant capacity among samples was
found, probably due to different factors like the different variety and the sampling time. Within fresh/deep-
frozen and cooked samples no significant differences on polyphenol content and antioxidant capacity of all
samples in both hospital canteens are shown (p>0.05), probably due to the fact that deep-frozen vegetables
already underwent heat treatment (blanching) before deep-freezing. However antioxidant capacity of
cauliflowers lowers slightly with cooking (25%), probably due to the decrease of no polyphenolic compounds
possessing antioxidant activity.
There are some literature works about the effect of technological processes on fresh vegetables (Ninfali and
Bacchiocca, 2003; Faller and Fialho, 2009) but few studies consider the evolution of antioxidants after cooking
of deep-frozen samples.

15
th
105
15
th

Figure 1 Polyphenol content (mg of catechin/Kg f.w.) (1) and antioxidant capacity (molTroloxEquivalent/Kg f.w.) (2) of
differently treated fruits and vegetable sampled in hospital canteen A.

Figure 2 Polyphenol content (mg of catechin/Kg f.w.) (3) and antioxidant capacity (molTroloxEquivalent/Kg f.w.) (4) of
differently treated fruits and vegetable sampled in hospital canteen B.
The polyphenol content and antioxidant capacity of fresh and deep frozen samples from hospital canteens A and
B are of the same magnitude and present a variability from 19.9 (apple) to 54.4 (lettuce) mg of catechin/Kg for
polyphenols and from 14.2 (caulifower) to 41.3 (courgette) molTroloxEquivalent/Kg for antioxidant capacity.
Moreover, the lowest values of polyphenol content and antioxidant capacity are those of lettuce and courgette,
respectively, while the highest ones are those of apple (Table 1), which presents a low variability during
sampling. This is more evident if we consider the amount given by one portion (INRAN, 2003) of apple and
chard (Table 2).
Table 1 Mean, relative standard deviation, minimum and maximum values of polyphenol content and antioxidant capacity of
fresh and deep-frozen fruits and vegetables sampled in two hospital canteens.

Polyphenols
mg of catechin/Kg f.w.
Antioxidant capacity
mol TroloxEquivalent/Kg f.w.
Mean RSD% Min Max Mean RSD% Min Max
Courgette 226.3 30.5 166.0 299.1 1828.4 41.3 918.4 2654.1
Cauliflower 342.1 28.3 242.8 436.4 2005.3 14.2 1525.0 2256.1
Chard 971.0 33.5 561.5 1342.4 3260.0 25.8 2414.6 4294.9
Apple 1354.0 19.9 1142.8 1737.8 6026.1 22.7 4832.7 7222.3
Lettuce 249.0 54.4 102.1 394.5 2094.5 21.2 1519.4 2601.2
Table 2 Polyphenols content and antioxidant capacity in one portion of different fruits and vegetables.
Polyphenols Antioxidant capacity
g of portion* mg of catechin/portion f.w. molTroloxEquivalent/portion f.w.
Courgette 250 56.6 457.1
Cauliflower 250 85.5 501.3
Chard 250 242.8 815.0
Apple 150 203.1 903.9
Lettuce 50 12.5 104.7
* source: INRAN, 2003
1) 2)
3)
4)
15
th
106
15
th
3.2 Evaluation of lutein in vegetables
Table 3 shows the content of lipidic lutein of different vegetables extracted by the method of Panfili et al. (2004)
reported in Materials and Methods section. Values are compared with those obtained with the method of Updike
and Schwartz (2003). There are no significant differences in values of lipidic lutein extracted by means of the
two tested methods (p>0.05).
Table 3 Lipidic lutein content of different vegetables extracted with the two tested methods (mg/Kg f.w.) (meanSD of three
determinations).
Lipidic lutein
Panfili Updike and Schwartz
Spinach 57.80.34 64.65.24
Parsley 83.90.06 85.50.90
Broccoli 14.01.25 13.90.30
Lettuce 10.20.92 12.41.87
Celery 2.00.15 2.20.01
Peas 7.10.00 8.41.06
In order to verify the validity of the Panfili method a recovery test of lutein was carried out in a sample of celery
subject to the entire procedure of saponification. Table 4 shows relevant results. A quantitative recovery of lutein
of 95% was found with a good repeatability (RSD%=3.2).
Table 4 Analytical recovery of lutein added to a celery sample (mg/Kg f.w.) (meanSD of three determinations).
Theorical
(natural+added)
(mg)
Found
(mg)
Recovery
(%)
Lutein 23.9 22.70.89 953.0
In the light of above results, Panfili et al. (2004) method was used in order to evaluate free, free esterified and
bound lutein of vegetable samples. Table 5 reports the content of the different forms of lutein in vegetables and
Figure 3 shows the per cent content of free and bound lutein. No esterified lutein in all samples was found. With
regard to broccoli and spinach, literature data confirm obtained results (Perez-Galvez and Minguez-Mosquera,
2005), while for the other analysed vegetables there are no sufficient reference data. Literature reports the
presence of esterified lutein in fruits like apple, apricot, mango and in some vegetables like pumpkin and potato
(Perez-Galvez and Minguez-Mosquera, 2005). Most of lutein in analysed vegetables is present in free form,
which represents the 66% of total lutein content on average (F/B>1). Only peas and celery present a higher
content of lutein bound to matrix (F/B<1) (52 and 58% of total lutein, respectively) (Figure 3).
Table 5 Lutein content of different vegetables (mg/Kg f.w.) (meanSDof three samples).
Free lutein Free esterified lutein* Bound lutein** F/B Total lutein
Spinach 74.09.57 0.0 27.00.70 2.7 101.0
Parsley 83.321.3 0.0 53.89.60 1.6 137.1
Broccoli 13.41.58 0.0 7.52.32 1.8 20.8
Lettuce 8.52.59 0.0 3.91.57 2.1 12.5
Celery 1.50.50 0.0 1.60.74 0.9 3.1
Peas 4.70.31 0.0 6.50.82 0.7 11.2
* calculated by difference between lipidic and free lutein; **calculated by difference between total and lipidic lutein

Figure 3 Per cent content of free and bound lutein of different vegetables.
15
th
107
15
th
Results of this PhD thesis confirm that vegetables contain a high content of antioxidant, compared with most
foods. Moreover, each type of vegetable and fruit has a different antioxidant capacity, given by different
antioxidant components. In particular, regarding polyphenols and antioxidant capacity, vegetables with the
highest values per portion are deep-frozen chard and fresh apple, while fresh lettuce and deep-frozen courgette
present the most variability. No cooking effect on polyphenol content and antioxidant capacity was found.
Regarding lutein, the obtained results confirm the need to carry out a saponification step of vegetables followed
by extraction with solvents, in order to obtain more precise data of total lutein content in fruits and vegetables
and consider the amount of lutein bound to matrix. Infact data about bound lutein are not present in literature
works, which reports only results coming from saponification of extracts and not of matrix vegetable. Moreover,
the tested Panfili method proved to be enough reliable and accurate to extract lutein from vegetables and rapid,
with the advantage to cut down time of analysis, to restrict the use of solvents and to obtain more clean extracts.
5. References
Alves-Rodrigues A, Shao A (2004) The scienze behind lutein, Toxicol Lett 150: 57-83.
Apak R, Gl K, Demirata B, zyrek M, elik SE, Bekta!o"lu B, Berker KI, zyurt D (2007) Comparative evaluation of
various total antioxidant capacity assays applied to phenolic compounds with the CUPRAC assay, Molecules 12: 1496-
1547.
Calvo MM (2005) Lutein: a valuable ingredient of fruit and vegetables, Crit Rev Food Sci Nutr 45: 671-696.
Cieslik E, Greda A, Adamus W (2006) Contents of polyphenols in fruit and vegetables, Food Chem 94: 135-142.
Dias MG, Camoes MFGFC, Oliveira L (2009) Carotenoids in traditional Portuguese fruits and vegetables, Food Chem 113:
808-815.
Duda-Chodak A, Tarko T (2007) Antioxidant properties of different fruit seeds and peels, Acta Sci Pol Technol Aliment 6(3):
29-36.
Faller ALK, Fialho E (2009) The antioxidant capacity and polyphenol content of organic and conventional retail vegetables
after domestic cooking, Food Res Int 42: 210-215.
Georg S, Brat P, Alter P, Amiot MJ (2005) Rapid determination of polyphenols and vitamin C in plant-derived products, J
Agri Food Chem 53: 1370-1373.
Holden M, Eldridge AL, Beecher GR, Buzzard M, Bhagwat S, Davis CS, Douglass LW, Gebhardt S, Haytowitz D, Schakel S
(1999) Carotenoid content of U.S. foods: an update of the database, J Food Compos Anal 12: 169-196.
Ninfali P, Bacchiocca M (2003) Polyphenols and Antioxidant Capacity of Vegetables under Fresh and Frozen Conditions, J
Agric Food Chem 51: 2222-2226.
Panfili G, Fratianni A, Irano M (2004) Improved normal phase high-performance liquid chromatography procedure for the
determination of carotenoids in cereals, J Agric Food Chem 52: 6373-6377.
Pellegrini N, Serafini M, Colombi B, Del Rio D, Salvatori S, Bianchi M, Brighenti F (2003) Total antioxidant capacity of
plant foods, beverages and oils consumed in Italy assessed by three different in vitro assays, J Nutr 133: 2812-2819.
Perez-Galvez A, Minguez-Mosquera MI (2005) Esterification of xanthophylls and its effects on chimical behavior and
bioavailability of carotenoids in the human, Nutr Res 25: 631-640.
Perry A, Rasmussen H, Johnson EJ (2009) Xanthophyll (lutein, zeaxanthin) content in fruits, vegetables and corn and egg
products, J Food Compos Anal 22: 9-15.
Podsedek A (2007) Natural antioxidants and antioxidant capacity of Brassica vegetables: a review, LWT-Food Sci Technol
40: 1-11.
Re R, Pellegrini N, Proteggente A, Pannala A, Yang M, Rice-Evans C (1999) Antioxidant activity applying an improved
ABTS radical cation decolorization assay, Free Rad Biol Med 26: 1231-1237.
Stahl W, Sies H (1999) Carotenoids: occurrence, biochemical activities, and bioavailability. In Packer L, Hiramatsu M,
Yoshikawa T (Eds) Antioxidant Food Supplements in Human Health. Academic Press pp 183-201.
Updike AA, Schwartz SJ (2003) Thermal processing of vegetables increases cis isomers of lutein and zeaxanthin, J Agric
Food Chem 51: 6184-6190.
INRAN 2003, Linee Guida: varia spesso le tue scelte a tavola.
Cap 8 published on line http://www.inran.it/648/linee_guida.html.

The first part of this paper was carried out within the project: Sicurezza Alimentare 8.1.f-8.2.e-Sicurezza alimentare e
ristorazione ospedaliera: valutazione dei rischi nella neuro-riabilitazione financed by Istituto Superiore della Sanit.
15
th
108
15
th
Oxidative Stress in Lactobacillus helveticus and Release of Molecules
Associated with Cell Fatty Acids Oxidation
Chiara Montanari (chiara.montanari8@unibo.it)
Dept. Food Science, University of Bologna, Italy
Tutor: Prof. Maria Elisabetta Guerzoni

This PhD thesis research is aimed at studying the behaviour of Lactobacillus helveticus in the presence of oxidative
stress, evaluating the release of molecules related to cellular fatty acid oxidation, also by introducing labelled
precursors. In particular some short chain aldehydes (C6 and C8) , metabolites commonly produced by Lactobacillus
species, belong to the family of oxylipins and in plants and fungi, including yeasts, derive from the oxidation of
cellular unsaturated fatty acids. Their accumulation is associated with the exposure to chemico-physical or biotic
stresses and they can play a role as signaling molecules.
Stress ossidativo in Lactobacillus helveticus e rilascio di molecole associate allossidazione
degli acidi grassi cellulari
Il presente progetto di ricerca si propone di studiare il comportamento di Lactobacillus helveticus in presenza di
stress ossidativo, valutando il rilascio di molecole associate allossidazione degli acidi grassi cellulari, anche tramite
lutilizzo di precursori marcati. In particolare alcune aldeidi a corta catena (C6 e C8), metaboliti comunemente
prodotti da molte specie di lattobacilli, appartengono alla famiglia delle oxilipine e nelle piante e nei funghi
(compresi i lieviti) derivano dallossidazione degli acidi grassi insaturi. Il loro accumulo associato allesposizione a
stress chimico-fisici o biotici e possono svolgere un ruolo come molecole segnalatrici.

Key words: Fatty acids; oxidative stress; oxylipins; aldehydes; lactobacilli.
1. Introduction
In accordance with the PhD thesis project previously described (2009), this poster reports the main results of the
activity concerning:
Study of biosynthetic mechanism of some oxilipins by introducing labelled fatty acids
Evaluation of stress conditions (e.g. H
2
O
2
) on the production of the observed oxilipins
Research of enzymes related with the metabolic pathway of interest
Evaluation of the protein expression in the presence of oxidative stress by two-dimensional gel
electrophoresis (2-DE)
2.1 Choice of fatty acid supplementation and of metabolites to be monitored Lactobacillus helveticus CNBL
1156 was grown as preculture in MRS broth without Tween 80 under anaerobic conditions at 45C. After 24hours
cells were centrifuged and resuspended in a chemically defined medium with 100, 200 or 300ppm of oleic, linoleic
or linolenic acid. After 2 or 24hours cell suspensions were centrifuged and the analysis of volatile compounds by
GC-MS/SPME was performed. The results of these analyses are reported in Table 1 (only linoleic acid data shown).
Among the three principal fatty acids involved in lipoxygenase pathway in plants and indicated previously, linoleic
acid was chosen for being more unsaturated than oleic acid and more present in lactic acid bacteria (LAB)
membranes than linolenic acid. For an easy mass fragmentation ion calculation and the follow-up of the labelled
carbon in hypothetic metabolic pathway, a total
13
C labelled linoleic acid was purchased from Sigma. Then, among
the volatiles compounds, those assumed to be related to lipid oxidation, and hence to a possible lipoxygenase
pathway in LAB, were selected. The list of molecules to be monitored and the relative target ions are reported in
Table 2.
2.2 Samples preparation. Lb. helveticus was grown as described above. Then cells were grown in the same
conditions in MRS broth with 200ppm of
13
C labelled linoleic acid, 200ppm of linoleic acid or without fatty acids
added to the culture medium respectively. After 24 hours, the three different precultures were resuspended in MRS
broth in presence/absence of 5mM of H
2
O
2
for 2 hours at 45C. Then samples were harvested for following analyses.
15
th
109
15
th
2.3 GC-MS/SPME analyses were performed according to Serrazanetti (2008), both in SCAN (analysis of total
volatiles compounds in the sample) and in SIM mode (analyses of the specific selected ions reported in table 2).
2.3 Extraction of extracellular compounds in supernatants Hexane extraction of the supernatants and analyses of
the extracts were performed as described by Gianotti et al. (2008).
2.4 Fatty acid extraction and analyses. Fatty Acids (FAs) methylation and analyses were performed as described in
Sado-Kamdem et al. (2009), both in SCAN and in SIM mode.
2.5 Research of enzyme related to fatty acid oxidation and oxylipin production. A research by alignment of
highly conserved sequences was performed (www.pubmed.com e www.ebi.ac.uk) to identify LOX genes or similar
(plants and fungi homologous). An enzymatic test was also performed, according to Ben-Aziz et al. (1970) to
evaluate the presence of this kind of activity also in lactic acid bacteria. For the preparation of the cell extracts, a 10
ml colture of each strain, grown overnight in proper media at optimum temperature, was centrifuged, washed twice
with sodium phosphate buffer (pH 7.0) and cells were broken by sonication with ice cooling. After sonication, the
liquid was centrifuged and the clear supernatant was collected for the analysis. The assays were performed at pH 7.5,
8.0 and 9.0, diluting the substrate solution (containing linoleic acid and Tween 20) with 0.2M citrate-phosphate
buffer of the desired pH.
For Lactobacillus helveticus some sequences of genes, hypothetically involved in fatty acid catabolism
(lipoxygenase and epoxidase pathways), were searched (www.pubmed.com e www.ebi.ac.uk) and eventually
identified by PCR, after DNA extraction with E.Z.N.A.
TM
Bacterial DNA Kit (Omega Biotek).
For the enzymes of interest, the evaluation of gene expression under oxidative stress in the presence or absence of
fatty acids will be performed by RT-PCR after RNA isolation, as described in Serrazanetti (2008).
2.6 Protein expression by two-dimensional gel electrophoresis (2-DE). Proteomic analyses have been performed
according to Behr et al. (2007) and are still in progress. Lactobacillus helveticus was grown in each condition up to
an optical density at 590 nm (OD590) of 0.6 (exponential phase) and cells harvested by centrifugation and washed
twice with TE buffer. Bacterial cell walls were digested with lysozyme in TE-DTT buffer for 60 min at 37C.
Digested cells were centrifuged and pellet was resuspended in SDS buffer and disrupted by sonication. The
suspension was diluted 3.5-fold with thiourea-chaps lysis buffer and the proteins were solubilized by shaking for 20
min at 4C. The remaining cell wall fragments were removed by centrifugation at 4C for 30 min. The clear
supernatants were stored at -80C until analyses. 2D electrophoresis has been performed with samples from
reference and stress condition as described in Behr et al. (2007).
Table 1. Amount of some volatile compounds (log peak area) after supplementation with linoleic acid compared to the control
(Co) (n.d. = under detection limit)
Compound Co
C18:2 100ppm

C18:2-200ppm

C18:2-300ppm

T24 T2 T24 T2 T24 T2 T24
3-methyl butanal 6.93 n.d n.d n.d n.d n.d n.d
pentanal n.d 7.63 7.89 7.60 7.97 7.85 7.89
hexanal n.d 8.98 9.09 8.87 9.12 9.08 8.93
2-pentenal n.d 6.45 n.d 6.38 n.d n.d n.d
heptanal 6.67 7.38 7.02 7.07 n.d 7.42 n.d
octanal 6.48 7.76 6.86 6.93 6.74 7.88 6.56
2-heptenal n.d 7.99 8.09 8.22 8.20 8.34 8.18
nonanal 7.44 8.04 7.46 7.40 7.20 8.16 7.13
2-octenal 6.07 8.32 8.57 8.51 8.68 8.67 8.62
2-propyl-2-heptenal n.d n.d 7.04 n.d 7.25 n.d 7.53
decanal 7.03 7.52 6.80 7.05 6.76 7.50 6.57
benzaldehyde 7.57 7.57 7.58 7.85 7.75 7.90 7.78
2,6 nonadienal n.d n.d n.d n.d 6.18 6.23 n.d
3-hydroxy-butanal n.d 7.78 6.16 6.73 6.15 8.09 6.41
benzenacetaldehyde 6.63 7.03 n.d 6.18 6.92 7.07 6.96
2-butyl-2 octenal n.d 7.09 8.79 6.87 9.04 7.50 9.39
2,4 nonadienal n.d 7.50 7.26 n.d 7.31 7.84 7.31
2,4 decadienal n.d 7.08 6.76 7.16 6.86 7.39 7.24

15
th
110
15
th
Table 2. List of molecules to be monitored, relative labelled or non labelled target ions (m/z) and qualifier ions for non labelled
compounds

Compound
Labelled target ion
(m/z)
Non labelled
target ion (m/z)
Qualifier ion (non labelled
compounds)
Linoleic acid 281; 236 263; 220 81
Oleic acid 238; 194 222; 180 83
Dehydroster. acid 296; 252 278; 236 69
F
a
t
t
y

a
c
i
d
s

Vernolic acid 297; 311 279; 293 95
Hexanal 61 57 44; 56
Nonanal 106 99 29; 57
2Nonenal 104 97 55; 70
2,4Decadienal 86 81 39; 41
Octanal 91 85 43; 56
2Octenal 89 83 29; 55
Hexanol 90 84 56; 69
Nonanol 135 126 41; 70
2Nonenol 133 124 43; 57
2,4Decadienol 146 136 55; 83
Octanol 120 112 56; 70
2Octenol 118 110 41; 57
3Nonen-2-one 89; 133 83; 125 43; 55
V
o
l
a
t
i
l
e

c
o
m
p
o
u
n
d
s

2Octanone 76; 120 71; 113 43; 58

3. Results
The tracing of labelled carbon from linoleic acid to some oxilipins revealed that it is converted in different
aldehydes depending on the conditions, confirming that it is the precursor or one of the precursors in Lactobacillus
helveticus of these molecules released in the medium, particularly under stress exposure. Most of the aldehydes
reported in Table 1 are produced only in presence of linoleic acid. However only some of these molecules (hexanal,
octanal, nonanal, 2-octenal, octanol; Figure 1) are present as labelled compounds when cells are incubated with
labelled linoleic acid. The comparison of results obtained evidenced also that the oxidative stress exposure induced a
shift from C6 to C8 aldehydes (Figure 1), suggesting the existence of two different mechanisms in the conversion of
linoleic acid, under stress conditions and under standard conditions. Previous results allowed the identification in this
species of others intermediates or final products presumably originated from linoleic acid integrated in the cell
membranes. In particular an epoxide, the vernolic acid, some lactones and two furanones associated with quorum
sensing mechanism were detected under oxidative and heat stresses. It can be supposed that these molecules have a
common origin also if the rationale of their synthesis is not clear. However it is known that Reactive Oxygen Species
are produced under stress exposure causing peroxydation and epoxydation to membrane unsaturated fatty acids The
need of the cells to eliminate, by means of hydrolysis and subsequent conversion, these potentially toxic or
unfunctional fatty acids from the cells can trigger a cascade chain reaction leading to the releases of low molecular
weight molecules analogous to that known as lipoxigenase pathway.
However the pathway from linoleic acid to C6 and C8 aldehydes in Lactobacillus is still unknown and requires the
identification of intermediates, genes or proteins putatively involved.
The extraction and analyses of cellular supernatants did not allow to identified intermediate compounds, presumably
because of their high chemical instability. Cellular fatty acids analyses with labelled compounds showed a decrease
of linoleic acid, with a following increase of oleic and vaccenic acid, suggesting the presence of one or more enzyme
able to saturated the double length. Further analyses with a different GC column on the same samples showed also
the presence of conjugated linoleic acids (CLAs), even if it was not possible to identify which specific isomers were
present, suggesting that linoleic acid could be isomerized before its catabolism.
On the other hand, the results obtained with labelled linoleic acid and its role in the biosynthesis of aldehydes,
belonging to oxylipins family, provided evidence of specific mechanism similar to that observed in the plant tissues
(Figure 2) also in LAB. On the basis of this hypothesis, a research focused on the identifications of LOX genes
15
th
111
15
th
(omologous to plants) in Lactobacillus helveticus was performed with bioinformatic tools, but it did not reveal the
occurrence of these specific genes in its genomes.
For this reason, an enzymatic test, based on the increase of absorbance at 234nm due to the formation of conjugated
dienes in the reaction mixture, was performed on different lactic acid bacteria (18 strains) to assess the presence of
any kind of lipoxygenase or similar activity at different pH. However, all the strains resulted negative to this test,
except the positive control Burkholderia thailandesis, used because known to possess a LOX (Figure 3 and 4, only
data regarding Lactobacillus species at pH 9 and 7.5 respectively are shown).
These results proved the absence of a LOX pathway in Lactobacillus helveticus and in other lactic acid bacteria
belonging to Lactobacillus species (Lb. helveticus, Lb. delbrueckii, Lb. fermentum, Lb. sanfranciscensis, Lb.
plantarum, Lb. casei subsp. casei, Lb. sakei subsp. sakei, Lb. brevis). However a monooxygenase was found in L.
sanfranciscensis.

However an alternative way to metabolize unsaturated fatty acids has to be present since many molecules deriving
from fatty acids oxidation are present (such as aldehyde, hydroxy-fatty acids, etc.), whose synthesis in frequently
reported in LAB.
From the literature it is known that in plants another pathway is the epoxidase pathways, with formation of
epoxidation products as intermediates. Therefore, a research focused on this kind of enzymes was performed on L.
helveticus genome, but only 6 general oxidoreductases (general class including also epoxidases) were found, not
characterized, and thereby not easy to manage, or involved in different metabolic pathways. For these genes the
evaluation of their expression (by RT-PCR) under oxidative stress in the presence or absence of fatty acids is in
progress.

At the same time a proteomic approach was applied, to find out differences in protein expression in the presence of
absence of oxidative stress and precursors like linoleic acid. This approach will allow the individuation of proteins
that are more or less expressed in stress conditions and thereby their excision and identification by mass
0
400
800
1200
1600
T30min T120min T30min T120min
no stress ox stress
P
e
a
k

a
r
e
a
hexanal(A*50)
octanal
nonanal
2-octenal
2-octanone
octanol

Figure 1. Labelled volatile compounds observed in Lb.helveticus in
presence (ox stress) or absence (no stress) of oxidative stress

However an alternative way to metabolize unsaturated fatty acids has to be present since many molecules deriving
0)

Figure 2. Anaerobic lipoxygenase pathway in Chlorella
pyrenoidosa

Figure 3. Relative absorbance at 234nm with reaction mixture
at pH 9.


Figure 4. Relative absorbance at 234nm with reaction mixture
at pH 7.5.


15
th
112
15
th
spectrometric. Since the genome of L. helveticus is available on www.pubmed.com, this could be a suitable way to
find out which enzymes are involved in the metabolic way of interest. These trials are still in progress so currently it
is not possible to establish in which measure this approach is successful to clarify the metabolic pathway from
linoleic acid to aldehydes.
4. References
Behr J, Israel L, Gnzle MG, Vogel RF (2007) Proteomic approach for characterization of hop-inducible proteins in Lactobacillus
brevis. Appl Env Microb 73: 3300-3306.
Ben-Aziz A, Grossman S, Ascarelli I, Budowski P (1970) Linoleate oxidation induced by lipoxygenase and heme proteins. Anal
Biochem 34: 88-100.
Gianotti A, Serrazanetti D, Sado-Kamdem SL, Guerzoni ME (2008) The cell fatty acid (FA) composition of adhered and floating
cells of two Listeria monocytogenes strains, selected on the basis of the biofilm forming ability, was taken into consideration.
Int J Food Microbiol 123: 9-17.
Ndagijimana M, Vallicelli M, Cocconcelli PS, Cappa F, Patrignani F, Lanciotti R, Guerzoni ME (2006) Two 2[5H]-furanones as
possibile signaling molecules in Lb. helveticus. Appl Env Microb 72: 6053-6061.
Sado-Kamdem SL, Vannini L, Guerzoni ME (2009) Effect of !-linolenic, capric and lauric acid on the fatty acid biosynthesis in
Staphylococcus aureus. Int J Food Microbio, 129: 288-294.
Serrazanetti DI (2008). PhD thesis, Faculty of Food Science and Technologies, University of Teramo.
15
th
113
15
th
Characterisation of PDO Cheese Samples Through the Identification of
Biochemical Markers
Lucia Monti (lucia.monti@unimi.it)
Dept. Molecular Sciences, University of Milan, Italy
Tutor: Prof. Stefania Iametti; co-tutor: Dott.ssa Tiziana M.P. Cattaneo

Bitto and Valtellina Casera are semi-hard PDO cheeses produced in Valtellina (Lombardy, Italy) very
appreciated and known all around. Samples of cheese representative of the current productive reality were
analysed in order to study their fine chemical composition: particular attention was paid to protein content and
breakdown products. Protein composition, both from a qualitative and quantitative point of view, and
metabolites such as amino acids and organic acids produced during ripening were investigated. The aim was the
identification of characteristic parameters which could be related to the specific technological process and/or
product.
Caratterizzazione di formaggi DOP attraverso lidentificazione di marker biochimici
Bitto e Valtellina Casera sono formaggi DOP semi-duri prodotti in Valtellina (Lombardia, Italia) molto noti e
apprezzati. Campioni di formaggio rappresentativi della realt produttiva attuale sono stati analizzati per valutare
la loro composizione chimica. Particolare attenzione stata posta alla componente proteica, sia dal punto di vista
qualitativo che quantitativo, e alla degradazione proteica. Inoltre, metaboliti prodotti nel corso della maturazione,
quali amminoacidi e acidi organici, sono stati studiati, con lo scopo di identificare parametri caratteristici del
processo/prodotto.

Key words: cheese, chemical composition, proteins, amino acids, organic acids.
1. Introduction
The diversification of agricultural production as well as the promotion of traditional products are strongly
encouraged by the European Community (EC), which adopted special rules (Council Regulations 509 and
510/2006) to regulate the authenticity of foods whose origin, geographical indication and tradition are certified.
The safeguard of these products represents an effective way to protect our national agriculture as well as an
important source of income and prestige for many producers and disadvantaged areas. The aim of the regulations
is to ensure fair commerce and to enable an easier identification of these products on the market so as to
facilitate controls. PDO (Protected Designation of Origin) products are strongly connected to genuineness and
safety concepts and have a high commercial value. For these reasons, they are often subjected to imitation.
General Food Law (EC Regulation 178/2002) aims to protect consumers from food fraud and illegal practices.
This issue is of concern not only to consumers but also to producers that do not wish to be subjected to unfair
competition from unscrupulous manufacturers who would gain an economic advantage from selling imitations.
Consequently, the authentication of food products is a problem particularly felt.
Most of the milk produced in Italy is used for cheese production, especially for PDO products. Disciplinary
protecting PDO cheeses indicate technological practices which are allowed during cheese making, but in many
cases only few parameters are fixed to characterise standard product, i.e. moisture or fat content expressed on
dry matter (Mucchetti, 2004). Surveys and fraud control would be certainly be more efficient if it could be
possible to refer to model cheeses characterised by a pool of objective parameters, varying in a range of values,
which could consider the natural variability of the product. In this perspective, there is the need to find adequate
analytical techniques and markers characteristic of a specific process/product to characterize and distinguish it.
Bitto and Valtellina Casera are two PDO cheeses produced in Valtellina valley, in the north of Lombardy, Italy.
They are middle-hard, middle-ripened cheeses: their origin and production is strongly rooted in the Alpine area,
since cows are fed using only local forage and pastures and milk is transformed on place. Bitto cheese
production (Ministerial decrees of the Italian Ministry of Agricultural Policies 18/08/2006, GU 202 31/08/2006)
covers a period of 4 months, from the 1
st
June to the 30
th
September. Cheese is produced exclusively in the
mountain in itinerant huts, within 1 hour from milking, using raw full-fat cow milk, with the possibility of
adding a maximum of 10% of goat milk. Curd is cooked at 48-52C for 30 min; ripening starts in the mountain
to conclude in the valley, following natural climatic conditions. Valtellina Casera (Ministerial decrees of the
Italian Ministry of Agricultural Policies 20/02/2006, GU 54 06/03/2006) is a middle-fat cheese produced all year
long in social dairy farms located in the territory using partially skimmed cow milk deriving from two or more
milkings. Either spontaneous acidification of raw milk or starter addition to pasteurized milk and lamb rennet
addition cause milk curdling; then, curd is cooked at 40-45C for 30 min. Cheese ripening is realised in
15
th
114
15
th
controlled conditions (temperature 6-13 C, moisture > 80%). Both kind of cheeses are ripened at least 70 days
before labelling and trading. According to Disciplinary, maximum moisture level and minimum fat content
expressed on dry matter at 70 days of ripening should be respectively 38% and >45% for Bitto cheese and 41%
and >34% for Valtellina Casera. Although very similar, different production and storage conditions lead to
different physical, chemical and microbiological changes in the two types of cheeses during ripening. In
particular, the cooking temperature can influence the microbiology of cheese and the biochemical events that are
associated to them. In order to contribute to a better characterization of these two products, Bitto and Valtellina
Casera cheese samples, representative of the current productive reality, were bought in a 4 years period in the
production area at the Bitto Show, an annual competition which is held in Morbegno (Sondrio, North Italy)
during which the best moulds produced that year are classified by a trained panel of experts and awarded. The
final aim would be to find specific biochemical markers related to the process/product which could be used to
classify, assess quality and assure authenticity of a particular process/product.
! Provision of Bitto and Valtellina Casera cheese samples.
! Evaluation of their chemical composition.
! Study of proteolysis: quantification of nitrogen components after fractionation and deeper analysis of
caseins breakdown by capillary electrophoresis (CE).
! Investigation of metabolites derived from microbial activity such as amino acids and organic acids.
! Statistic evaluation of results to identify specific variables influencing each kind of product and
discriminating between samples.
This work has been realized at the CRA-FLC (Centro di Ricerca per le Produzioni Foraggere e Lattiero-
Casearie) in Lodi, and funded by a Lombardy region research project (ValTec).
Bitto and Valtellina Casera cheese samples were bought during a 4 years period (2006-2009). Their gross
composition was analysed using official methods of analysis, i.e. dry matter (DM) (IDF, 1982), fat (ISO, 1972)
and ash (IDF, 1964). The nitrogen components were separated into different soluble fractions which were
analysed by Kjeldhal method: total nitrogen (NT), soluble N at pH 4.6 as Non Casein Nitrogen (NCN) and 12%
trichloroacetic soluble N as Non Protein Nitrogen (NPN) (IDF, 1964a) were considered. Capillary Zone
Electrophoresis (CZE) in denaturing and reducing conditions was applied to analyse cheese proteins, according
to Recio and Olieman (1996). Free amino acids were analysed by RP-HPLC according to Resmini et al. (1985),
while HPLC analysis of sugars and organic acids was performed according to Bouzas et al. (1991). Principal
Components Analysis (PCA) was performed using Unscrambler (vs. 9.2, CAMO Inc., Oslo, Norway).
4.1 Chemical composition
Cheese samples were analysed to ascertain their gross composition as an index of quality: Figure 1 summarizes
results on moisture, fat, proteins and ash content, both as such and expressed on dry matter and values of NT,
NCN and NPN in Bitto and Valtellina Casera cheese samples.

Chemical data showed a high variability due to the traditional technologies adopted during cheesemaking and to
the different ripening time of samples. Anyway, mean data respected indications stated in Disciplinary both for
moisture and fat/DM content. Valtellina Casera, although produced using partially skimmed milk, showed a fat
Figure 1 Chemical composition of
cheese samples; DM=dry matter;
NT=total nitrogen; NCN=non casein
nitrogen; NPN=non protein nitrogen.
Dot and line indicate Disciplinary
values for moisture and fat/DM both for
Bitto and Valtellina Casera.
0
10
20
30
40
50
60
m
o
i
s
t
u
r
e
f
a
t
p
r
o
t
e
i
n
s
a
s
h
f
a
t
/
D
M
p
r
o
t
e
i
n
s
/
D
M
a
s
h
/
D
M
N
T
N
C
N
N
P
N
N
C
N
/
N
T
N
P
N
/
N
T
g
/
1
0
0
g
Bitto Valtellina Casera
disciplinary values for Bitto cheese disciplinary values for Valtellina Casera cheese
15
th
115
15
th
content unexpectedly high if compared to what is indicated in Disciplinary, nearly at the same level of Bitto
cheese, which is produced using full fat milk. Significant differences (p=0.05), calculated by ANOVA were
observed between cheeses in their moisture, fat/DM, protein/DM and ash/DM content. The pH 4.6-soluble
fraction of cheese (NCN) is very heterogeneous and particularly interesting: it contains whey proteins, proteose-
peptone, a variety of small and medium sized peptides and free amino acids, compounds mainly produced by the
activity of rennet. !-caseins fractions were also detected as interesting degradations for these products, and
derived from plasmin activity. Finally, the NPN fraction contains small peptides and free amino acids mainly
produced by microbial peptidases, and only in small part by rennet (McSweeney and Fox, 1993). Valtellina
Casera showed significantly higher values (p=0.05) of NCN and NPN, which could indicate a more extensive
degradation of caseins if compared to Bitto cheese. The ratios NCN/NT and NPN/NT have been found useful as
indices for the extent of proteolysis in cheese.
4.2 Capillary electrophoresis of cheese proteins
Each cheese variety has its characteristic pattern of breakdown of caseins to peptides and amino acids. The
agents that contribute to proteolysis in cheese are mainly indigenous milk enzymes, especially plasmin, enzymes
from rennet, often chymosin, and proteinases and peptidases from microorganisms colonizing the cheese as
starter colture or secondary microflora, which are released from lysed cells (McSweeney, 2004).
Capillary Zone Electrophoresis (CZE) is a valuable technique to analyse casein components and investigate
mechanisms behind enzymatic hydrolysis of caseins occurring during cheese ripening. Intact caseins and
primary casein hydrolysis products were identified by comparison with the CE patterns of single casein (cn)
fractions, of in vitro digests of "- and #s-cn with either plasmin or chymosin and by comparison with literature
(Figure 2).

Figure 2 Examples of electropherograms of Bitto and Valtellina Casera cheese and comparison with caseins: intact
proteins and degradation products are indicated. P indicates peptides which were interesting to characterise
each product, but that could not be assigned to a particular compound. cn=casein
In accordance with high cooking temperatures used during cheesemaking of Bitto and Valtellina Casera, plasmin
seemed to be the most active endopeptidase in the mechanism of casein digestion, and its contribution to primary
hydrolysis of caseins was more pronounced. An extensive hydrolysis of "-casein into the !-caseins was
evidenced: fragments f29209/106209/f108209 of "-casein, corresponding respectively to !1- /!2- /!3-caseins,
were detected in the CE profile of Bitto and Valtellina Casera cheese. According to literature, in high-cooked
cheese chymosin, which normally operates the hydrolysis of #s1-casein into #s1-I-casein, is extensively or
completely denatured. As shown in Figure 2, #s1-casein was highly degraded and a peak at the same migration
time of #s1-I-casein appeared. This could be explained either by an incomplete inactivation of chymosin, or by
the activity of another acid proteinase, namely cathepsin D, an indigenous enzyme of milk which acts like
chymosin and which was supposed to be responsible for proteolysis in some Swiss-type cheese (McSweeney and
Fox, 1993). CZE analysis of cheese samples was considered a valuable tool to differentiate the two products,
since a few different peaks seemed to characterise the electropherograms of each product. Data were collected
and processed: normalisation of peak area (peak area divided by migration time) was adopted. Electrophoretic
patterns showed a large number of peaks due to the complexity of the samples, so not all peaks were identified or
assigned to a particular compound: some interesting peaks were classified with the letter P. In Figure 2 the most
15
th
116
15
th
interesting ones are indicated. A chemometric study of the electrophoretic profiles was applied to classify
products. Each peak represented a variable and each proteolytic profile represented a sample in a multivariate
data set, which was standardized (scaled) before the analysis, so that each variable had a mean of zero and a
standard deviation of one, and thus gave all variables equal weighting. PCA was performed on these data and the
classification of cheese varieties gave rather successful results (Figure 3).
Use of statistical tools applied to the obtained results allowed a first discrimination, and the identification of
specific variables influencing each kind of product (Coker et al., 2005). As already evidenced, the variables that
more strongly influenced the two products separation in the PC1-PC2 plot were !-caseins content and some
peaks which were characteristic of one cheese if compared to the other. Consequently, electropherograms could
be considered a useful fingerprint for product characterization.

Figure 3 Bi-plot representation of electrophoresis normalised peak areas (area/migration time); variables are para-k
casein, !s2-casein, !s1-casein, !s0-casein, "1- /"2- /"3-caseins, #-B casein, #-A1 casein, #-A2 casein, !s1-I-
casein, !s0-I-casein. P are peptides deriving from casein breakdown which were not identified.
4.3 Amino acids content of cheese samples
Amino acid analysis shows the characteristic composition of a cheese as the result of amino acids release from
defined parts of casein and a specific microbial activity. The presence of free amino acids (FAA) clearly
indicates aminopeptidase activity: starter cells have a diversity of enzymes which are located mainly
intracellularly and are released upon cell death and lysis. The two classes of cheese showed values of free amino
acids which were significantly different (p=0.05) and higher for Valtellina Casera cheese samples (7.394.40
g/100g of proteins in Casera vs 4.032.92 g/100g of proteins in Bitto cheese). These data are in agreement with
higher values of NCN and NPN found in Valtellina Casera and could be considered a valuable parameter to
discriminate between the two products. A good relationship between the FAA content and the NPN/NT ratio was
found both for Bitto (R
2
=0.6193) and Valtellina Casera (R
2
=0.8095). The correlation with NCN/NT was quite
good for Casera (R
2
= 0.6345) but not so good for Bitto, probably because of the more heterogeneous
composition of this fraction. In Valtellina Casera single amino acids showed different values according to cheese
age: younger cheeses were characterized by a higher content of valine, phenylalanine and leucine, while most
aged ones had a higher aspartic and glutamic acid and threonine contents. In Bitto cheese single amino acids
showed a very high variability, probably due to the higher microbial biodiversity which characterises this kind of
product. Anyway, threonine, hystidine, isoleucine and glutamic acid seemed to be most abundant in older cheese
and phenylalanine, leucine and !-aminobutyric acid in younger ones.
4.4 Organic acids content
Organic acids in dairy products originate from the growth of microorganisms, hydrolysis of milk fat, normal
bovine biochemical metabolism and direct addition as acidulants. The roles organic acids play in dairy products
include reducing pH, contributing to flavour attributes, inhibiting spoilage and pathogens growth, and indicating
bacteriological quality. Thus, sugars (lactose, glucose and galactose) and organic acids (citric, pyruvic, succinic,
lactic, formic, acetic, propionic, butyric and pyroglutamic (pGlu)) contents in cheese samples were investigated.
No residues of mono- and disaccharides were found in all samples. Lactose remained in the curd was quickly
metabolised to lactic acid, which is ever the main organic acid produced, even though with a high variability.
During ripening lactic acid can be converted to other compounds: lactate can be oxidized by lactic acid bacteria
(LAB) to acetate, formate, ethanol and CO
2
, which match with the organic acids found in cheese and explain the
thin holes characterising Bitto and Valtellina Casera cheese structure. Acetic acid is an important flavour
compound in many cheese and it may provide an indication of the degree of heterofermentative metabolism that
may have taken place in cheese (Buffa et al., 2004). Minor organic acids were very interesting to differentiate
15
th
117
15
th
between the two products. Bitto cheese was characterised by an higher content of butyric acid. Its is usually
associated to cheese defects, but in this case samples did not evidence cracks, blowing or off-flavours which
usually accompany anaerobic metabolism of lactate to butyrate. The origin of this acid could thus be enzymatic:
some LAB shows intracellular lipolytic enzymes which are released into the cheese matrix after lysis and which
are responsible for the release of important levels of fatty acids during long ripening. This could explain the
negative correlation found between lactic and butyric acids (R
2
=0.5297). Valtellina Casera organic acids profile,
on the contrary, was characterised by an higher level of pyruvic, acetic and pGlu acids. The first two could
derive from citrate metabolism, while pGlu acid origin seems to be mostly enzymatic and strongly associated to
thermophilic LAB used as starters. As already evidenced for other cheese, pGlu concentration, although limited,
showed a linear correlation with cheese age, probably related to bacterial autolysis. Propionic acid was not
detected in any sample.

Although very similar for many aspects, the two considered cheese productions showed characteristic elements
which can help distinguish them. Bitto cheese showed a characteristic protein breakdown and a higher content of
butyric acid, while Valtellina Casera revealed a proteolysis which produced higher NPN, NCN and free amino
acids levels together with higher pyruvic, acetic and pGlu contents. Statistic evaluation of results is still under
elaboration: the final aim is to create a data matrix using all selected variables that were analysed in order to
perform PCA analysis and find the minimum number of factors able to include the maximum of variability for
each type of samples. This can surely help creating a robust model to discriminate between the two classes of
cheese and, in a near future, also to preserve these PDO productions against imitations.
6. References
Bouzas J., Kantt C. A., Bodyfelt F., Torres J.A. (1991). Simultaneous determination of sugars and organic acids in Cheddar
cheese by High Performance Liquid Chromatography. J. Food Sci. 56 (1) 276-278.
Buffa M, Guamis B, Saldo J, Trujillo AJ (2004) Changes in organic acids during ripening of cheeses made from raw,
pasteurized or high-pressure-treated goats milk Lebensm.-Wiss. u.-Technol. 37: 247253.
Coker CJ, Crawford RA, Johnston KA, Singh H, Creamer LK (2005) Towards the classification of cheese variety and
maturity on the basis of statistical analysis of proteolysis data-a review Int Dairy J 15: 631-643.
Council Regulation (EC) No 509/2006 of 20 March 2006 on agricultural products and foodstuffs as traditional specialities
guaranteed Official Journal of the European Union L 93 of 31.3.2006.
Council Regulation (EC) No 510/2006 of 20 March 2006 on the protection of geographical indications and designations of
origin for agricultural products and foodstuffs Official Journal of the European Union L 93 of 31.3.2006.
IDF (1982) Cheese and processed cheese: determination of the total solids content. Standard 4A. Brussels, Belgium.
IDF (1964) Determination of the ash content of processes cheese products. Standard 27. Brussels, Belgium.
IDF (1964a) Protein content of processed cheese products. Standard 25 Brussels, Belgium.
ISO (1972) Cheese-determination of fat content - van Gulik Method. Standard 3433. International Organization for
Standardization.
McSweeney PLH (2004) Biochemistry of cheese ripening Int J Dairy Technol 57: 127-144.
McSweeney PLH & Fox PF (1993) Cheese: Methods of Chemical Analysis, in Cheese: chemistry, physics and microbiology,
Vol 1:General aspects. Edited by P.F. Fox, London, UK. Chapman & Hall.
Mucchetti G, (2004) Le peculiarit qualitative dei formaggi tradizionali e a denominazione di origine: caratterizzazione e
strumenti per la salvaguardia Sci Tecn Latt-Cas, 55: 5-24.
Recio I, Olieman C (1996) Determination of denaturated serum proteins in the casein fraction of heat treated milk by
capillary electrophoresis. Electrophoresis, 17: 1228-1233.
Regulation (EC) No 178/2002 Of The European Parliament And Of The Council of 28 January2002 laying down the general
principles and requirements of food law, establishing the European Food Safety Authority and laying down procedures
in matters of food safety Official Journal of the European Communities L 31 of 1.2.2002.
Resmini P, Pellegrino L, Pazzaglia C, Hogenboom JA (1985) Gli amminoacidi liberi nella tipizzazione del formaggio
Parmigiano Reggiano ed in particolare del prodotto grattugiato. Sci. Tecn. Lat. Cas., 44, 7-19.
Figure 5 Organic acids content of Bitto and
Valtellina Casera cheese samples
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
C
itr
ic
P
y
r
u
v
ic
S
u
c
c
in
ic
L
a
c
t
ic

F
o
r
m
ic
A
c
e
tic

P
y
r
o
g
lu
ta
m
ic
B
u
ty
r
ic
g
/
1
0
0
g
Bitto
Valtellina Casera
15
th
118
15
th
Physical-Chemical Assessment of Innovative Pasta Filata Cheeses
Serena Niro (serena.niro@unimol.it)
Dipartimento di Scienze e Tecnologie Agro-alimentari, Ambientali e Microbiologiche
Tutor: Prof. Gianfranco Panfili

The aim of this PhD project is the realization of pasta filata cheeses at short and medium ripening, innovated in
formulation so as to satisfy present market demands, in respect of traditionality of finished products. For the
food-processing industry the innovation of traditional products is a cultural and market request. The realization
of pasta filata products innovated in formulation is a strong reality in Italy for buffalo cheese. Instead for
cow/ewe cheeses and for cow/goat cheeses a little production is found in Europe depending on milk composition
that influences technology and yield.
In this thesis work pasta filata cheeses were made from cow milk and ewe milk and from cow milk and goat
milk.
Valutazione chimico-fisica di formaggi a pasta filata innovativi
Questo progetto di tesi di dottorato ha come obiettivo la realizzazione di formaggi a pasta filata a breve e media
stagionatura, innovati nelle formulazioni in maniera tale da soddisfare la presente richiesta del mercato, nel
rispetto della tradizionalit del prodotto. Linnovazione di prodotto nel senso della tradizione unesigenza
culturale e di mercato per lindustria alimentare italiana. La realizzazione di prodotti caseari a pasta filata
innovati nelle formulazioni se una realt gi consolidata in Italia per i formaggi bufalini, evidenzia, per i
prodotti realizzati con latte vaccino/ovino e vaccino/caprino, pochissimi casi in Europa, soprattutto in virt della
differente composizione del latte di partenza che ne condiziona la tecnologia di produzione e la resa.
A tale scopo in questo lavoro di tesi sono stati realizzati formaggi misti a pasta filata a partire da latte bovino
miscelato con latte ovino e latte bovino miscelato con latte caprino.

Key words: pasta filata cheese, goat and ewe milk.
1. Introduction
Ewe and goat cheeses have special tastes and flavours, very distinct from ones of cow cheeses. Compositional
differences of ewe and goat milk with respect to cow milk, mainly in proteins and fats, account for the
differences in the sensory characteristic of cheeses (Fox et al. 2004).
Ewe milk is different for chemical-physic composition with technological consequences. It contains a higher
protein and fat content than cow milk. These differences are responsible for different technological properties of
milk, especially for the increase in cheese yield. Ewe milk is distinctive for smaller fat globules with a weaker
membrane easily oxidable. Fat has a higher content of short and medium chain fatty acids that give a
characteristic bitter flavour. Moreover fat globules of ewe milk, for their little size, are easily released from the
curd, thus making cheesemaking difficult. Lipolysis in ewe cheeses, is faster than in cow cheeses with important
flavours development.
Goats produce only approximately 2% of the world total annual milk supply. However, their contribution to
nutritional and economic wellbeing of mankind is important in many countries including developing and tropical
countries. Goat milk differs from cow milk for its higher digestibility, alkalinity, higher buffering capacity, and
certain health effects (Park, 2000). The basic composition of goat milk is similar to that of cow milk, 3.8 vs 3.6%
fat, 3.5 vs 3.3% protein, 4.1 vs 4.6% lactose, respectively, although with a smaller fat globular size (3.5 vs 4.5
!m, respectively) and a whiter colour than cow milk, as goat converts all !-carotene into vitamin A. Goat milk
fat contains > 20 volatile breached chain fatty acid including 4-methiloctanoic and 4-ethyloctanoic acids, which
contribute to mutton-type and goat-type flavour respectively (Sheehan et al. 2009). Goat milk is poor in casein
(21.1 vs 27.0 of cow milk). The textural characteristics of goat milk curd are distinct from those of cow milk
curd produced under the same conditions. The weaker mechanical properties of goat milk curd constrain the
manufacturing procedures used in goat milk cheesemaking and limit the diversity of cheese type.
For these reasons the production of pasta filata cheeses from ewe and goat milk, even if mixed with cow milk,
needs a preliminary study of the correct milk formulations and of the technology to be applied.
Literature data underline that, in Europe (Greece and Iberian Peninsula) there is a little production of ewe and
goat pasta filata cheeses. Moreover, in all East Europe (Bulgaria and ex Yugoslavia) and in Russia, Kashkaval
made from cow, sheep, goat or mixed milk, has different names and is produced with different technologies (Fox
et al. 2004). In Europe there is Metsovone, a semi-hard cheese produced in the Metsovo province of the Ioannina
prefecture, Greece. Metsovone, traditionally produced from cow milk or from a mixture of cow milk and ewe
15
th
119
15
th
milk or goat milk, has a cylindrical shape and a five months ripening time at the end of which it is smoked and
paraffined. The only mentioned Italian product is a Sicilian product: Cofanetto, a typical pasta filata cheese of
Trapani, made from a mixture of cow (70-80%) and ovine milk (20-30%). This cheese, rectangular in shape, is
ripened from 20 days to one year. Its weight varies from 2 to 10 kg.
Raw cow, ewe and goat milk were obtained from local dairy farmers, Barone snc Vinchiaturo (CB).
Cheesemakings were carried out to obtain pasta filata cheeses at short ripening (scamorza) and at medium
ripening time (caciocavallo).
2.1 Cheese manufacture
Scamorza cheeses: the performed experimental test provided 3 lots: SC scamorza cheese made from cow milk;
SE18 scamorza cheese made from mixture of cow and ewe milk (82:18); SP25 scamorza cheese made from
mixture of cow and ewe milk (75:25).
Caciocavallo cheeses: the performed experimental test provided 3 lots: CC caciocavallo cheese made from cow
milk; CE caciocavallo cheese made from mixture of cow and ewe milk (82:18); CG caciocavallo cheese made
from mixture of cow and goat milk (65:35).
On all samples analyses were carried out at time 0, and during ripening at 14 and 28 days for scamorza and 30,
60, 90, 120 days for caciocavallo.
2.2 Analyses
Samples were taken after each time of ripening and held at -20C until analysis. Two cheeses from each cheese
type at each ripening time were sampled. All samples were analyzed in triplicate.
Cheese composition: cheese samples were analysed for fat, protein, moisture, ash (O.J. 229/86), lactose
(Megazyme Kit K-LACGAR 02/05), pH and acidity (O.J. 229/86).
Proteolysis: NPN/NT % (percentage ratio between non proteic nitrogen (NPN) and total nitrogen (TN) were
measured as in O.J. 229/86). Total and individual free amino acids (FAA) were analysed using a Biochrom 30
series Amino Acid Analyzer (Biochrom Ltd. Cambridge Science Park, England) after extraction with the method
of Btikofer and Ard, 1999.
Lipolysis: it was measured in acid degree value (ADV), as descripted by Deeth and Fitz-Gerald, 1976.
Sensory analysis: descriptive analysis was used to determine the sensory profile of the cheese samples. A panel
of trained assessors evaluated cheese samples at half and at the end of ripening (O. B. 24/96).
Scamorza cheese
The pH values do not show significant changes during ripening (table 1). Instead acidity (g/100g of lactic acid)
decreases in all samples, mainly in SE18.

Table 1 Values of pH and acidity at 0, 14 and 28 days.

SC: scamorza made from cow milk, SE18: scamorza made from cow and ewe milk (82:18); SE25 scamorza made from cow and ewe milk (75:25).

The composition of the produced scamorza cheeses is summarised in table 2 at 0 and 28 days. Scamorza cheeses
made from ewe and cow milk (SE18 and SE25) show higher fat value whereas proteins increase in SE25. In all
samples lactose decreases during ripening.

Table 2 Scamorza cheese composition at 0 and 28 days.
Protein Fat Ash Carbohydrate (g/100g d.m.) Moisture
(g/100g d.m.) (g/100g d.m.) (g/100g d.m.) Lactose Galactose (g/100g)
SC time 0 44.1 0.45 47.1 0.18 4.69 0.050 0.35 0.050 1.00 0.020 48.2 0.35
SC 28 days 43.5 0.01 48.3 0.24 4.51 0.460 0.23 0.130 0.93 0.020 38.4 0.40
SE18 time 0 43.4 0.22 51.1 0.27 4.82 0.020 0.33 0.090 1.05 0.020 48.8 0.42
SE18 28 days 43.3 0.60 51.8 0.44 4.73 0.130 0.14 0.080 1.06 0.020 35.7 0.23
SE25 time 0 48.4 0.61 50.9 0.49 4.82 0.000 0.32 0.090 0.94 0.040 47.6 0.07
SE25 28 days 46.9 0.44 49.8 0.34 4.84 0.000 0.19 0.010 0.51 0.010 35.5 0.58
pH Acidity (g/100g d.m.)
SC time 0 5.42 0.020 0.34 0.067
SC 14 days 5.51 0.030 0.32 0.028
SC 28 days 5.53 0.000 0.31 0.026
SE18 time 0 5.48 0.010 0.42 0.047
SE18 14 days 5.49 0.000 0.41 0.007
SE18 28 days 5.52 0.030 0.34 0.000
SE25 time 0 5.52 0.010 0.38 0.008
SE25 14 days 5.53 0.000 0.34 0.012
SE25 28 days 5.50 0.010 0.33 0.011
15
th
2.2 Analyses
Scamorza cheese




SC time 0 44.1 0.45 47.1 0.18 4.69 0.050 0.35 0.050 1.00 0.020 48.2 0.35
SC 28 days 43.5 0.01 48.3 0.24 4.51 0.460 0.23 0.130 0.93 0.020 38.4 0.40
SE18 time 0 43.4 0.22 51.1 0.27 4.82 0.020 0.33 0.090 1.05 0.020 48.8 0.42
SE18 28 days 43.3 0.60 51.8 0.44 4.73 0.130 0.14 0.080 1.06 0.020 35.7 0.23
SE25 time 0 48.4 0.61 50.9 0.49 4.82 0.000 0.32 0.090 0.94 0.040 47.6 0.07
SE25 28 days 46.9 0.44 49.8 0.34 4.84 0.000 0.19 0.010 0.51 0.010 35.5 0.58
SC time 0 5.42 0.020 0.34 0.067
SC 14 days 5.51 0.030 0.32 0.028
SC 28 days 5.53 0.000 0.31 0.026
SE18 time 0 5.48 0.010 0.42 0.047
SE18 14 days 5.49 0.000 0.41 0.007
SE18 28 days 5.52 0.030 0.34 0.000
SE25 time 0 5.52 0.010 0.38 0.008
SE25 14 days 5.53 0.000 0.34 0.012
SE25 28 days 5.50 0.010 0.33 0.011
15
th
2.2 Analyses
Scamorza cheese




SC time 0 44.1 0.45 47.1 0.18 4.69 0.050 0.35 0.050 1.00 0.020 48.2 0.35
SC 28 days 43.5 0.01 48.3 0.24 4.51 0.460 0.23 0.130 0.93 0.020 38.4 0.40
SE18 time 0 43.4 0.22 51.1 0.27 4.82 0.020 0.33 0.090 1.05 0.020 48.8 0.42
SE18 28 days 43.3 0.60 51.8 0.44 4.73 0.130 0.14 0.080 1.06 0.020 35.7 0.23
SE25 time 0 48.4 0.61 50.9 0.49 4.82 0.000 0.32 0.090 0.94 0.040 47.6 0.07
SE25 28 days 46.9 0.44 49.8 0.34 4.84 0.000 0.19 0.010 0.51 0.010 35.5 0.58
SC time 0 5.42 0.020 0.34 0.067
SC 14 days 5.51 0.030 0.32 0.028
SC 28 days 5.53 0.000 0.31 0.026
SE18 time 0 5.48 0.010 0.42 0.047
SE18 14 days 5.49 0.000 0.41 0.007
SE18 28 days 5.52 0.030 0.34 0.000
SE25 time 0 5.52 0.010 0.38 0.008
SE25 14 days 5.53 0.000 0.34 0.012
SE25 28 days 5.50 0.010 0.33 0.011
15
th

Caciocavallo cheese
During ripening all caciocavallo samples show a slight pH decrease and a consequent increase of acidity values.
This increase is more evident in the first 90 days after which it becomes constant (CC) or decreases (CE and CG)
(table 3).
Table 3 Values of pH and acidity at 0, 30, 60, 90 and 120 days.
CC time 0 5.56 0.028 0.35 0.011
CC 30 days 5.51 0.032 0.42 0.010
CC 60 days 5.48 0.035 0.53 0.017
CC 90 days 5.41 0.007 0.52 0.018
CC 120 days 5.36 0.007 0.51 0.020
CE time 0 5.57 0.032 0.37 0.017
CE 30 days 5.39 0.081 0.50 0.037
CE 60 days 5.36 0.032 0.59 0.015
CE 90 days 5.35 0.007 0.57 0.016
CE 120 days 5.30 0.014 0.51 0.014
CG time 0 5.72 0.021 0.37 0.033
CG 30 days 5.59 0.004 0.40 0.036
CG 60 days 5.62 0.018 0.65 0.018
CG 90 days 5.48 0.003 0.44 0.016
CG 120 days 5.59 0.007 0.35 0.027
CC: made from cow milk; CE: made from cow and ewe milk; CG: made from cow and goat milk.
The composition of the caciocavallo cheeses is summarised in table 4 at 0 and 120 days of ripening. Only CG
has significant lower fats. All cheeses have low or no lactose already at the beginning of ripening.
Table 4 Caciocavallo cheese composition.
CC time 0 43.8 0.49 49.9 0.26 6.22 0.250 0.15 0.000 0.70 0.000 46.0 0,42
CC 120 days 43.3 0.27 49.8 0.38 6.92 0.270 0.00 0.000 0.00 0.000 36.8 0.07
CE time 0 42.8 0.49 50.3 0.19 6.87 0.038 0.00 0.000 1.04 0.020 45.4 0.21
CE 120 days 41.8 0.28 50.0 0.25 6.88 0.200 0.00 0.000 0.00 0.000 37.1 0.07
CG time 0 44.4 0.29 44.6 0.55 8.14 0.160 0.00 0.000 1.40 0.020 44.9 0.49
CG 120 days 43.7 0.17 45.1 0.32 8.16 0.077 0.00 0.000 0.00 0.000 39.5 0.19
Proteolysis is expressed by the ripening index NPN/NT (%) that is the percentage ratio between non proteic
nitrogen (NPN) and total nitrogen (TN) (figure 2). This index increases at the end of ripening with values of
18.9%, 19.8% and 7.8% for CC, CE e CG respectively. This behaviour is an index of a low proteolysis in CG
(p< 0,05) and a major proteolysis in CC and CE (p< 0,05). In all productions total free amino acids (FAA)
gradually increase in a different way (figure 3). The highest concentration of total FAA at the end of ripening
was found in CC (2638 157.40 mg/100g TP d.w.), the lowest in CG (1815.6 52.18 mg/100g TP d.w.). In CE
it was 2086.8 96.80 mg/100g TP d.w. These values agree with the ripening index. In caciocavallo made from
cow milk (CC) the major increment is shown between 60 and 90 days of ripening instead for CE the major
increment is shown between 30 and 60 days. CG show a constant proteolytic activity.
In figures 4, 5 and 6 the evolution of FAA profile, (%/total FAA) at 0 and 120 days of ripening is shown for CC,
CE and CG respectively.

0
5
10
15
20
25
0 30 60 90 120 days
N
P
N
/
N
T

(
%
)
CC CE CG

0
1000
2000
3000
0 30 60 90 120 days
m
g
/
1
0
0
g

T
P
CE CG CC

Figure 2 Ripening index NPN/NT (%). Figure 3 Total free amino acids.

15
th
120
15
th

Caciocavallo cheese
During ripening all caciocavallo samples show a slight pH decrease and a consequent increase of acidity values.
This increase is more evident in the first 90 days after which it becomes constant (CC) or decreases (CE and CG)
(table 3).
Table 3 Values of pH and acidity at 0, 30, 60, 90 and 120 days.
CC time 0 5.56 0.028 0.35 0.011
CC 30 days 5.51 0.032 0.42 0.010
CC 60 days 5.48 0.035 0.53 0.017
CC 90 days 5.41 0.007 0.52 0.018
CC 120 days 5.36 0.007 0.51 0.020
CE time 0 5.57 0.032 0.37 0.017
CE 30 days 5.39 0.081 0.50 0.037
CE 60 days 5.36 0.032 0.59 0.015
CE 90 days 5.35 0.007 0.57 0.016
CE 120 days 5.30 0.014 0.51 0.014
CG time 0 5.72 0.021 0.37 0.033
CG 30 days 5.59 0.004 0.40 0.036
CG 60 days 5.62 0.018 0.65 0.018
CG 90 days 5.48 0.003 0.44 0.016
CG 120 days 5.59 0.007 0.35 0.027
The composition of the caciocavallo cheeses is summarised in table 4 at 0 and 120 days of ripening. Only CG
has significant lower fats. All cheeses have low or no lactose already at the beginning of ripening.
Table 4 Caciocavallo cheese composition.
CC time 0 43.8 0.49 49.9 0.26 6.22 0.250 0.15 0.000 0.70 0.000 46.0 0,42
CC 120 days 43.3 0.27 49.8 0.38 6.92 0.270 0.00 0.000 0.00 0.000 36.8 0.07
CE time 0 42.8 0.49 50.3 0.19 6.87 0.038 0.00 0.000 1.04 0.020 45.4 0.21
CE 120 days 41.8 0.28 50.0 0.25 6.88 0.200 0.00 0.000 0.00 0.000 37.1 0.07
CG time 0 44.4 0.29 44.6 0.55 8.14 0.160 0.00 0.000 1.40 0.020 44.9 0.49
CG 120 days 43.7 0.17 45.1 0.32 8.16 0.077 0.00 0.000 0.00 0.000 39.5 0.19
Proteolysis is expressed by the ripening index NPN/NT (%) that is the percentage ratio between non proteic
nitrogen (NPN) and total nitrogen (TN) (figure 2). This index increases at the end of ripening with values of
18.9%, 19.8% and 7.8% for CC, CE e CG respectively. This behaviour is an index of a low proteolysis in CG
(p< 0,05) and a major proteolysis in CC and CE (p< 0,05). In all productions total free amino acids (FAA)
gradually increase in a different way (figure 3). The highest concentration of total FAA at the end of ripening
was found in CC (2638 157.40 mg/100g TP d.w.), the lowest in CG (1815.6 52.18 mg/100g TP d.w.). In CE
it was 2086.8 96.80 mg/100g TP d.w. These values agree with the ripening index. In caciocavallo made from
cow milk (CC) the major increment is shown between 60 and 90 days of ripening instead for CE the major
increment is shown between 30 and 60 days. CG show a constant proteolytic activity.
In figures 4, 5 and 6 the evolution of FAA profile, (%/total FAA) at 0 and 120 days of ripening is shown for CC,
CE and CG respectively.

0
5
10
15
20
25
0 30 60 90 120 days
N
P
N
/
N
T

(
%
)
CC CE CG

0
1000
2000
3000
0 30 60 90 120 days
m
g
/
1
0
0
g

T
P
CE CG CC

Figure 2 Ripening index NPN/NT (%). Figure 3 Total free amino acids.

15
th
121
15
th

Figure 4 Free amino acids profile in CC (%/totFAA).
CE
0
5
10
15
20
25
30
asp thr ser asn glu gln gly ala val met ile leu tyr phe hys lys arg
%
/
t
o
t

F
A
A
time 0 120 days

Figure 5 Free amino acids profile in CE (%/totFAA).

Figure 6 Free amino acids profile in CG (%/totFAA).
Leucine, phenylalanine, lysine and valine, alanine and glutamic acid are the major FAA in the all three
caciocavallo samples at every reported ripening time. Yvon and Rijnen (2001) affirm that leucine, valine and
methionine are the major precursor of flavour compounds in Emmental, Cheddar and Camembert cheese. During
ripening in all samples the percentage of phenylalanine doesnt significantly change instead leucine change from
about 10% to about 22% in all samples. Alanine and glutamic acid decrease in all sample. The percentage of
lysine doesnt change in CE instead halves in CC and CG. Valine tends to decrease only in CC.
At the beginning of ripening (time 0) CE lacks of asparagine, glutamine, tyrosine and histidine, CC of aspartic
acid, asparagine, glutamine, tyrosine, histidine, and methionine, CG of glutamine, tyrosine, histidine and
methionine. These amino acids are absent also in original milk (data not shown). At 120 days these amino acids
reach similar percentages with the exception of tyrosine and histidine that are present only in CE.
In all cheesemakings the major variations of FAA during ripening occur for those amino acids that convert
themselves into other secondary metabolites such as arginine or for those resulting from secondary metabolic
phenomena such as "-amino butyric acid and ornithine. The presence of this amino acids often depends on
different enzymatic and microbiological activities in samples.
Arginine is responsible for unpleasant or bitter taste, therefore it is important that this amino acid does not
increase during ripening time; in all samples it shows low values at the end of ripening. Ornithine, which derives
from degradation of arginine, increase in all samples reaching about 250 mg/100g in CC and CG and 169.4
mg/100g TP in CE.
Regarding "-amino butyric acid it is mainly present in CC (229.8 mg/100g TP at 120 days), with a lower
concentration in CG (104.6 mg/100g TP) while in CE it is 168.9 mg/100g TP. This amino acid derives from
CC
0
5
10
15
20
25
30
%
/
t
o
t

F
A
A
time 0 120 days
CG
0
5
10
15
20
25
30
%
/
t
o
t
F
A
A
time 0 120 days
15
th
122
15
th
glutamic acid and it is representative of producing gas, butyric fermentations in particular. In caciocavallo
cheeses these fermentations are frequent (Resmini et al. 1988).

0
20
40
60
80
100
120
140
30 60 90 120 days
%

CG CC CE

Figure 7. Lipolysis during ripening in caciocavallo cheeses.
Figure 7 shows the lipolysis evolution expressed as percentage increment of ADV during ripening. CG shows an
evident lipolysis phenomena instead CE and CC show lower values of ADV. Cheeses with an evident lipolysis
differ for strong flavours (Fox et al. 2004).
In order to evaluate organoleptic differences after 60 and 120 days a panel test was carried out. CG and CC
reached value similar to control sample (CC) for outer and inner aspect. CG and CC highlighted appreciated
sensorial characteristics with marked odour and taste appreciated in consumer tests too (data not shown).
Partial substitution of ewe or goat milk with cow milk in pasta filata cheeses production had effect in fat and
protein values. CG had the lowest proteolytic activity followed by CE. CC had the highest proteolytic activity.
The concentrations of total FAA, even if with different evolution, generally increased during ripening.
Significantly differences were found in some amino acids which could be considered distinctive. The content
and the relative amounts of free amino acids should be a characterizing parameter of cheeses; these results could
be due either to the different chemical-physical and microbiological composition of the original milk, or to the
different microorganism evolution during ripening.
CG and CE had higher lipolytic activity than CC.
The realised products could be taken into consideration by local dairy farmers in order to have a major product
differentiation to be proposed in the market. Moreover the obtained results could give more insight into the
characterization of those products.
5. References
Btikofer U, Ard Y (1999) Quantitative determination of free amino acids in cheese, Bulletin IDF 337: 24-32.
Deeth HC, Fitz-Gerald CH (1976) Lipolysis in dairy products: a review, Aust J Dairy Technol 6: 53-63.
Fox PF, McSweeney PLH, Cogan TM, Guinee TP (2004) Cheese: chemistry, physics and microbiology. An Aspen
Publication.
Yvon M, Rijnen L (2001) Cheese flavour formation by amino acid catabolism, Int Dairy J 11: 185-201.
Official Journal CE n. 229 02/10/1986: Metodi Ufficiali di analisi per i formaggi.
Official Bullettin n. 24 DD 21/05/1996: Regolamento per il settore latte e latticini.
Park YW (2000) Comparison of mineral and cholesterol composition of different commercial goat milk products
manufactured in USA, Small Ruminant Res 37: 115-124.
Park YW, Jurez M, Ramos M, Haenlein GFW (2007) Physico-chemical characteristics of goat and sheep milk, Small
Ruminant Res 68: 88-113.
Pappa EC, Sotirakoglou K (2008) Changes of free amino acid content of Teleme Cheese made with different types of milk
and culture, Food Chem 111: 606-615.
Resmini P, Pellegrino L, Hogemboom JA, Bertolucci M (1988) Indagine sulla composizione in amminoacidi liberi del
formaggio provolone quale possibile elemento caratterizzante, Sci Tecn Latt-Cas 39: 81-101.
Sheehan JJ, Patel AD, Drake MA, McSweeney PLH (2009) Effect of partial or total substitution of bovine for caprine milk
on the compositional, volatile, non-volatile and sensory characteristics of semi-hard cheeses, Int Dairy J 19: 298-509.

This paper was carried out whitin the project POR MOLISE 2000/06: progetto RE007: Sicurezza alimentare e innovazione tecnologica dei
prodotti caseari freschi a pasta filata.
15
th
123
15
th
Biotechnology,University of Napoli I Federico II, Portici, 15-17 September, 2010

Vacuum impregnation: a process to improve the quality of vegetables
Elisabetta Occhino (eocchino@unite.it)
Department of Food Science, University of Teramo, Italy
Tutor: Prof.ssa Paola Pittia Co-Tutor: Dott. Giancarlo Addario

This presentation describes the results of the activities carried out in this PhD thesis project. At first, some VI process
parameters (vacuum pressure, vacuum time, concentration of solution, relaxation time-post VI at P
atm
) were modelled
and it was studied the effect of each parameter on the final product, in a fruit model system, apple. Secondly it was
studied the effect of vacuum impregnation in zucchini, using external solutions of sugars and salts, with the aim of
improving the quality, in terms of texture and sensory acceptability.

Impregnazione Sottovuoto: un processo per migliorare la qualit dei vegetali

In questa presentazione, sono riportati i risultati degli studi effettuati per questo progetto di dottorato. In una prima fase,
sono stati modellati alcuni parametri del processo VI (pressione di vuoto, tempo vuoto, concentrazione della soluzione
impregnante, tempo di rilassamento a P
atm
) utilizzando la mela, come sistema modello, ed stato investigato l'effetto di
ogni singolo parametro sul prodotto finale. Nella seconda fase, lo studio si focalizzato sullimpregnazione sottovuoto
di zucchine, utilizzando soluzioni di processo a base di zuccheri e sali, con l'obiettivo di migliorarne la qualit,
soprattutto in termini di propriet meccaniche, accettabilit sensoriale.

Key words: Vacuum Impregnation, Process Parameters, Quality, Vegetables, Texture.
1. Introduction
The food industry has a growing interest in fruit and vegetable-based products, especially in the value-added and
minimally processed ones, because of the favorable flavour, color, texture and intact nutrients. The VI technique has a
formulation function, thus providing broad applications in fruit and vegetable processing. Some of the potential
applications include pre-treatments before drying or freezing for improving final product quality, and development of
formulated products by introducing functional food ingredients (Fito et al, 2001)
1.1Vacuum Impregnation
Vacuum Impregnation (VI) is a non-destructive technology, used to introduce external liquids, in the porous structures
due to the action of hydrodynamic mechanism (HDM) promoted by pressure changes (Fito, 1994) and modifying their
original composition.The three phenomena, occurring in VI, are: gas outflow, deformation-relaxation of the solid matrix
and liquid influx. The kinetics of these phenomena are significantly affected by structural characteristics of food
matrices: size and shape of sample; tissue structure (porosity, pores and size distribution); relaxation time of the solid
matrix, a function of the mechanical properties of the material; trasport rate of HDM, a function of the structure (size
and shape of pores) (Lerici et al., 1985; Valdez- Fragoso et al., 2002; Raoult-Wack, 1994; Torreggiani, 1993).
Furthermore, VI process and the quality of final products depend on the various process conditions, including:
temperature; composition and concentration of external solution; vacuum pressure; time under vacuum treatment; time
to restore atmospheric pressure; agitation; solution/sample ratio, as well as on the pretreatments carried out on the
products (Alvarez et al., 1995; Valle et al., 1998)
1.2 Improving the vegetable quality
In fruit and vegetables, which have a great amount of pores (intercellular spaces) occupied by gas and native liquid, the
vacuum impregnation offers the possibility of being impregnated by a determinated solution, improving their
composition by adding specific solutes: sugars, salts, acids, preservatives, special nutrient, firming agents, antioxidants,
antimicrobial ingredients etc. It has been proposed the use of mixed solution, consisting of two or more solutes, to take
advantage of the characteristic of each solution (Raoult-Wack, 1994). It was found that the adding a small quantity of
sodium chloride to a sugar solution has increased the dewatering rate of fruit, avoiding a significant decrease in
organoleptic quality (Sereno, 2001; Sacchetti, 2001).
The calcium treatments in the postharvest of vegetables have been widely used to extend shelf-life and improve the
texture of fruit and vegetable (Rico, 2006). It has been reported that calcium is able to keep the cell structure by
interacting with pectins in the cell wall to form calcium pectate that is implied in molecular bonding at cell wall level
(Dong, 2000). Furthermore, calcium increases also cell turgor pressure and stabilizes the cell membrane (Hernndez-
Munoz, 2006). Different calcium salts have been studied for decay prevention, nutritional enrichment and the
enrichment of fresh fruits and vegetables. Calcium chloride has been widely used as preservative and firming agent to
this aim but it is associated with bitterness and off-flavours. Calcium lactate, calcium propionate and calcium gluconate
15
th
124
15
th

have shown some of the benefits of the use of calcium chloride, such as product firmness improvement, while limiting
sensory changes in the processed product (Yang, 2003).
This oral communication reports the main results of the activities of the PhD thesis project, previously described in
Occhino, 2008 and Occhino 2009, concerning:
A2) Modelling of VI process parameters and the study of the effect that each parameter has on the final product (apple,
cv Golden Delicius).
A3) Effect of VI solution composition on quality and microstructural properties of zucchini. The experiments were
carried out by using mixed solutions made with maltodextrins (MD, DE 7.5-9), NaCl and different calcium salts.
2.1. Experimental Procedures
2. 1. 1 Modelling of VI process parameters and quality of the VI apples
A second-order central composite design (CCD) with 4 factors (sugar concentration, vacuum pressure level, time of
vacuum, time post-VI were apples were kept in the VI solution at P
atm
) at 5 levels was defined to take into account the
individual and interaction effects of the factors. The experimental design included 28 experiments with three
replications of the central point. The actual factor values, corresponding coded values (-2, -1, 0, 1, 2) are given in Table
1.
Variable Level
Coded Value -2 2 0 1 2
Sucrose concentration(%p/v) [C] 10 20 30 40 50
Vacuum Pressure (mbar) [ P ] 25 143,8 262,5 381,3 500
Vacuum Time (min) [ t
v
] 2,5 4,4 6,3 8,1 10
Post vacuum Time at P
atm
(min) [ t
pv
] 2,5 9,4 16,3 23,1 30
Table 1: Vacuum Impregnation variables and experimental design level
Aliquots of 300 g of apple cubes were submerged in external solution; fruit:syrup (w/w) ratio was 1:4. The VI
treatments were carried out at 25C in a Rotavapor system (Buchi, 220, Italy).
Main evaluations: solutes and water mass transfer, textural properties.

2.1.2. Effect of VI solution composition on quality and microstructural properties of zucchini
VI solutions were prepared using maltodextrins (MD, DE 7.5-9) (3-20% p/v), NaCl (0,25-5%) and calcium salts
(lactate, chloride, propionate and gluconate) (0,1-100 mM). Aliquots of 300 g of sliced zucchini were submerged in
external solution; fruit:syrup (w/w) ratio was 1:4. In these experiments VI process conditions were kept constant (P= 25
mbar; t
v
=10 min; tpv
=10 min. Experiments were carried out at 25C in a pilot plant lab-scale equipment, consisting of:
steel rotating vacuum chamber; vacuum pump; vacuum controller /measurer.

2.2. Materials
Apples (Malus Communis Pumil,a var. Golden Delicious) and zucchini (Cucurbita pepo, var. President) were bought in
the local market. Apples, after peeling and coring, the edible portion was cut into 1 cm-side cubes and selected for VI
treatment. Apples were then dipped in a 0.1% citric acid solution to inhibit enzymatic browning. Zucchini, after
washing, were sliced into 10 mm thick-discs, selected and used immediately for the VI treatments..

2.3. Methods
2.3.1 Mass Transfer
In each treatment, the water and soluble solids mass transfer were computed according to the following equations
(Mastrocola et al., 1999):
WL= (ww0)-(wt-wst)/(ws0+ww0)x 100
SG= (wst-ws0)/(ws0+ww0)x100
WR= WL-SG
where SG, WL and WR are the Solids Gain, Water Loss and Weight change, respectively; ww0 is the weight of water and ws0 is the weight of solids
initially present in the fruit; wt and wst are the weight of the fruit and weight of solids at the treatment, respectively.
2.3.2. Moisture content was determined according to the AOAC (1984) method.
2.3.3 Mono-and disaccharides analysis The content of saccharides (fructose, glucose, sorbitol and sucrose) of fresh and
VI apple cubes was determined by Ionic Chromatography according to the method of Messia et al. (2008).
2.3.4 Texture Properties Mechanical properties were evaluated by using a Instron dynamometer mod. 5542-H5036
(Instron Universal testing machine, High Wycombe, UK) equipped with a head cell of 500 N. Different test were applied
to apples and zucchini, in particular:
- Apples:
Analysis were carried out by using a Kramer shear cell at a crosshead speed of 20 mmmin
-1
on 10 g of fresh or VI-
processed apple cubes located in a single layer on the basement of the cell. From the force-deformation curve, the
maximum peak force (F max) and the energy at maximum compression (E max) were considered.
15
th
125
15
th

- Zucchini
Shear test: by using a flat blade probe and a cross head speed of 25 mm min
-1
. From the force-deformation, the
maximum peak force (F max) and the energy at maximum compression (E max) were considered. For each sample at
least 8 slices were tested
Creep Recovery Test: For this test, a single slice of zucchini was compressed by 20% of the initial height with an
aluminium cylinder probe (dia: 60 mm) for a loading time of 60 sec, at a crosshead speed of 100 mm s-1, according to
Njintang et al. (2006).
Relaxation Test: For this test a single slice of zucchini was compressed by 25% of initial height with an aluminium
cylinder probe (diam 66 mm) at a crosshead speed of 10 mm s-1, the deformation was then kept constant for 60 s.
2.3.5 Sensory analysis
Sensory analysis was performed on VI zucchini. A panel of 15 not trained judges, composed by students and
researchers of the Department of Food Science, chosen among habitual consumers of zucchini was enrolled for all the
experiments. Panellists were asked to give evaluation on hardness, juiciness and crispness of the impregnated sliced
zucchini. taken as comparison the fresh, untreated product on a 5 point-scale (1-low; 5 high).
2.3.6 Statistical analysis
For the CCD the studied model was a classical second order polynomial function accounting for the individual and
interactive effects of the five variables of the CCD on the dependent variables. The goodness of fit of the models was
evaluated by using R
2
(Pike 1986), the Fisher F-test (and the derived P values, i.e. the significance levels) and the
standard error of the estimate (s.e.). The three dimensional plot plots of the response surface as a function of two factors
at a time, holding the other factors fixed at the central level, were obtained by calculating from the polynomial model
the values for one factor when the other varied with the constraint of a given dependent variable value.
The statistical treatment of the data was performed using Statistical for Windows (Statsoft, Inc.).
3.1 Modelling of VI Process Parameters in apple
A meaningful effect, single or interactive, of the independent variables on the dependent variables (solid contents, mass
transfer-Water and Solid Gain/Loss- texture properties, saccharide-sorbitol, fructose, glucose and sucrose- content) was
determined and the correspondent polynomial equations have been obtained.
For the aim of this paper, in Table 2, the quadratic polynomial equations related to the effects of different dependent
variables and their interactions on the SG and Sucrose content in the VI apples are reported.

Dependent Variable Quadratic Polynomial Equations R
2
p Standard error
SG
[Solid Loss/Gain] (g/g) = 0,024977+0,002008*(C)-0,000018*(tpv)-
0,000004*(C)*(P)+0,000006*(tpv)*(P)
0,918 <0,00000 0,00378
Sucrose
Sucrose (!%) = 207,0205-0,0018*(P)
2
-0,1858*(C)*(tpv) +0,0229*(C)*(P)
+0,0278*(tpv)*(P)
0,820 <0,0000 2,214
Table 2: Quadratic Polynomial Equations of independent variables, SG (Solid Gain) and sucrose content.

SG, index of the VI mass transfer, is significantly affected by the VI solution concentration as individual term (positive)
and as interactive term with [P] (negative) as well as by [t
pv
] as negative and single factor and interactive (but positive)
with [P]. In all samples a SG was observed and it was higher SG occurred for long [t
pv
] and higher [P] (Fig.1,a). In
these conditions it was possible to promote penetration of the solute due to long period of contact with the external
solution, and to reduce the losses of the other components of plants (at low vacuum values). The high vacuum levels
have (low [P]) favours the WG (water gain), but not significantly the penetration of solids, because of differences
between the diffusive coefficients of water and solutes into the cube apple (Bolin et al. 1983, Spiazzi et al. 1997). The
SG, as opposed to the WG, has influenced less by [P] and [t
v
], in particular more by microstructure of plant tissue (Shi
et al., 1993).

(a) (b)
Fig.1 = Response surface plots showing the interaction effect of [P] and [tpv] on the SG (g/g) (a) and sucrose concentration (! %) (b).

With regard to sucrose, its highest concentration (fig.4 a-b) occurred in the apples processed at medium-low [P] (150-
15
th
126
15
th

300 mbar), high [C] of external solution (> 40%) and long [t
pv
] (20-30 min). Under these conditions could prevail
diffusive mechanisms of solute from the VI solution into the apple cubes due to the difference of concentration and
osmotic pressure while endogenous sucrose losses result to be delayed or inhibited. At very low process [P] (= high
vacuum level) a lower sucrose concentration occurred and this could be related to physical damage induced in the cell
walls of the plant tissue with a lower retention capacity of this sugar in the post-vacuum step.
VI process has caused significant losses of fructose, glucose and sorbitol up to 50-60% in respect to the content present
in the fresh apple. It was noted that the greater decrease of these sugars occurred in process conditions to medium [P]
(150-300 mBar) and when sucrose solutions at medium-high concentration were used. Under these process conditions,
the vacuum level and the physico-chemical conditions could have caused a mechanical and osmotic stress in the plant
cells, causing irreversible physical damages that could have facilitated or induced the endogenous sugars loss.

.
3.2 Effect of VI solution composition on quality and microstructural properties of zucchini

Figure 2: Micrographs of zucchini obtained by cryo-SEM analysis at two different magnifications.

Zucchini is characterised by a dense but very porous matrix as highlighted by the microstructural images in Figure 2. In
order to improve its mechanical properties VI solutions were differently formulated in order to enrich the vegetable
structure with macromolecules and solutes able to affect the matrix structure. For the limited text space only brief
comments on the results are here briefly described and discussed.
When MD were used alone in the VI solution, even if solid and water gain occurred, a decrease in the shear force (index
of cellular integrity) of the zucchini at increasing its concentration, that could be likely related to a breaking up effect of
the low molecular weight components of the MD that could decrease the interactions between cells, the turgor in cells
and thus compromise the overall texture of the product (Mastrocola et al. 1998; Maltin et al., 1993). On the contrary, the
creep recovery values have increased progressively with MD concentration; in fact, in according to Fito (2000) the solid
gain improves the elastic properties of plant structure. VI treatments with aqueous solutions with increasing
concentrations of NaCl leaded to an increase of the shear force of the zucchini. This result may be related to the
capacity of NaCl to interact with pectin of the cell membrane and exert a structuring effect. This effect resulted limited
when the same NaCl concentration was used in combination with MD, for competition phenomena between the two
solutes and the lower penetration of NaCl (Sacchetti et al, 2001). Creep Recovery and Relaxation test results evidence,
on the other hand, that the presence of NaCl is important in determining a more rigid and elastic structure, which tends
to fracture more quickly, corresponding to a more firm but brittle product. As expected , the use of Ca
++
salts in the VI
solutions, besides an effect in the mass transfer with an increased SG, resulted significantly affect the texture of the VI-
zucchini. Moreover, according to Manganaris et al. (2007) the structuring effect showed to increase proportionally with
calcium salts concentration, but inversely to their molecular weight (chloride=110,99 < propionate=186,22 <
lactate=308,30 < gluconate=238,25).The higher firming effect was obtained with CaCl2 at the highest concentration
(100 mM). Microstructural analysis on zucchini, undergone to VI with different composition solution, are ongoing at
the time of editing of this text and the main results will be presented at the Workshop.
4. Conclusion and further perspective
The studies carried out in the 3 years-PhD project allowed to highlight some relevant aspects of the VI technology
applied to vegetables, related to both the process parameters and the formulation of the VI solution.
In relation to the process itself, the experiments carried out in this project evidenced the interactive effects of most of
the parameters (pressure, vacuum time, post-vacuum time in particular) on both the mass transfer and quality of the
vegetable. Thus a proper choice of the VI conditions is needed in order to favour solute/water gain/loss while keeping
or improving the overall quality of the vegetable.
15
th
127
15
th

The formulation of the VI solution results, on the other side, to be of major importance as interaction and competitive
phenomena may occur among the solutes that could limit their technological functionality. This evidences the need of a
proper optimisation of the solution recipe prior to be used in a VI treatment in order to achieve the desired effects and
effectively improve the quality of the processed product.
Finally, this study confirms the potentiality of the VI to be used to improve the quality of fruits and vegetables by
addition of specific solutes of interest (sugars, acids, preservatives, special nutrients, structuring agents, antioxidants,
antimicrobial ingredients etc..). The results obtained in the zucchini are, in fact an example and confirm the possibility
to improve the texture properties of this vegetable aspect that was not yet investigated.
However, limited information is available on the technological functionality of the VI-processed vegetables, their
stability and their suitability to be used as ingredients or half-products in complex formulated food products and this
could open new study opportunities.
9. Selected references
Alandes, L., Perz- Munuera, I., Llorca, E., Quiles, A., Hernando, I. (2009). Use of calcium laccate to improve structure of Flor de inverno fresh-
cut pears. Postharvest Biology and Technology, 53; 145-151.
Alvarez. C. A., Aguerre, R., Gomez, R., Vidales, A., Alzamora, S. M., Gerscheson, L. N. (1995). Air dehydration of strawberries: Effect of blanching
and osmotic pretreatments on the kinetcs of moisture transport. Journal of Food Engineering, 25, 167-178.
Bolin, H. R., Huxsoll, C. C., Jackson, R. (1983). Effect of osmotic agents and concentration on fruit quality. Journal of Food Sciente, 48, 202-205
Dong, X., Wrolstad, R. E., Sugar, D. (2000) Extending shelf life of fresh-cut pears. Journal of Food Science, 65; 181-186.
Fito, P. (1994). Modelling of vacuum osmotic dehydration of food. Journal of Food Engineering, 22, 313328.
Grant, G. T., Morris, E. R., Rees, D. A., Smith, P. J. C., & Thom, D. (1973). Biological interactions between polysaccharides and divalent cations:
the egg-box model. FEBS Letters, 32, 195198.
Fito, P., Chiralt, A., Betoret, N., Gras, M., Chafer, M., Martinez-Monzo, J., (2001). Vacuum impregnation and osmotic dehydration in matrix
engineering: application in functional fresh food development. Journal of Food Engineering, 49, 175-183.
Lerici, C. R., Pinnavaia, G., Dalla Rosa, M., Bartolucci, L. (1985). Osmotic dehydration of fruit: influente of osmotic agents on drying behavior and
product quality. Journal od Food Science, 50, 1217-1219.
Hernndez-Munoz, P., Almenar, E., Ocio, M.J., Gavara, R. (2006). Effect of calcium dips and chitosan coating on postharvest life of strawberries
(Fragaria x Ananassa). Postharvest Biology and Technology, 39, 247-253.
Martn-Diana A.B., Rico, D., Fras, J. M., Barat, J. M., Henehan G. T. M.. Barry- Ryan, C. (2007). Calcium for extending the shelf life of fresh whole
and minimally processed fruits and vegetables:a review. . Trends in Food Science and Techology, 18; 210-218.
Manganaris, G. A., Vasilakakis, M., Diamantidis, G., Magnani, I. (2007). The Effect of postharvest application on tissue calcium concentration,
quality attributes, incidente of flesh browning and cell wall physicochemical aspects of peach fruit. Food Chemistry, 100, 1385-1392.
Njintang, Y. N., Parker, M. L., Moates, K. G., Smith, C. A., & Waldrom, W. K. (2006). Rheology and microstructure of achu, a food based on taro
(Colocasia esculenta L. Schott), as affected by method of preparation. Journal of the Science of Food and Agriculture, 86, 902907.
Occhino, E., Addario, G., Pittia, P (2009). Vacuum Impregnation in Apple (cv. Golden Delicious): Modelling of Process Parameters. XIV Workshop
on the developments in the italin PhD Research on Food Science Technology and Biotechnology. Oristano, 16-18 September.
Raoult- Wack, A. L., Lenart, A., Guilbert S. (1992). Recent advances during dewatering through immersion in concentrated solution. In A. S.
Majumdar (Ed). Drying of solid, 21-52.
Rico, D., Martn-Diana, A. B., Fras, J.M., Henehan, G.T.M., Barry-Ryan, C. (2006). Effect of ozone and calcium lactate treatment on browning and
texture properties of fresh-cut lettuce. Journal of Food Science and Agriculture. 86, 2179-2188-
Sacchetti G., Giannotti A., Dalla Rosa M. (2001). Sucrose-salt combined effects on mass trasfer kinetics and product acceptability. Study on apple
osmotic treatments. Journal of Food Engineering, 49, 163-173
Sereno, A. M., Moreira, R., Martinez, E. (2001). Mass transfer coefficiente during osmotic dehydration of apple in single and combined aqueous
solutions of sugar and salt. Journal of Food Engineering, 47, 43-49.
Shi, X. Q., & Fito, P. (1993). Vacuum osmotic dehydration of fruits. Drying Technology, 11, 14291442
Spiazzi, E., Mascheroni, R. (1997). Mass Transfer maodel for osmotic dehydration of fruits and vegetables- Development of the somulation model.
Journal of Food Engineering, 34, 387-410.
Torreggiani, D. (1993). Osmotic dehydration in fruit and vegetable processing. Food Research International, 26, 59-68.
Valdez- Franoso, A., Mujica-Paz, H., Giroux, F., Welti-Chanes, J. (2002). Resource of sucrose syrup in pilot-scale osmotic dehydration of apple
cubes. Journal of Food Process Engineering, 25, 125-140.
Valle, J. M., Aranguiz, V., & Leon, H. (1998). Effects of blanching and calcium infiltration on PPO activity, texture, microstructure and kinetics of
osmotic dehydration of apple tissue. Food Research International, 31, 557-569.
Yang, H. H. & Lawsless, H. T.(2003) Descriptive analysis of divalent salts. Journal of Sensory Studies, 20, 97-113.
Zhao Y. (2004) Pratical applications of vacuum impregnation in fruit and vegetable processing. Trends in Food Science and Techology. 15; 434-451
15
th
128
15
th
Assessment of Tarocco Orange Fruit Firmness
by Standard and Non-Destructive Tests
Federico Pallottino (fedepall@yahoo.it)
Dept. of Food Science, University of Tuscia, Viterbo, Italy; CRA-ING AgritechLab, Monterotondo, Italy
Tutor: Mauro Moresi; Co-tutor: Paolo Menesatti
This PhD thesis dealt with the assessment of the rheometrical (Poissons ratio, apparent modulus of elasticity,
viscoelastic constants and relaxation time spectrum), chemico-physical (total solid content, titratable acidity,
Magness-Taylor firmness, rind and juice colorimetric analyses and rind thickness), and sensory properties of
Tarocco blood oranges, as well as the real contact surface during fruit compression tests by two innovative
image analysis techniques. An operating tool to grade on-line orange fruits with a resistance per unit diameter
(F/D) ranging from 220 to 420 N m
-1
was identified.
Determinazione della consistenza di arance cv Tarocco
mediante metodi standard e non-distruttivi
Questa tesi di dottorato ha riguardato la determinazione delle propriet reometriche (coefficiente di Poisson,
modulo apparente di elasticit, costanti viscoelastiche e spettro dei tempi di rilassamento), chimico-fisiche (solidi
totali, acidit, consistenza di Magness-Taylor, coordinate CIELAB dellepicarpo e del succo, spessore della
buccia) e sensoriali di arance rosse della variet Tarocco, nonch della effettiva superficie di contatto in test di
compressione uniassiale tramite due tecniche innovative basate sullanalisi dimmagine. stato possibile
individuare uno strumento operativo per la selezione on-line di arance con resistenza specifica (F/D) compresa
fra 220 e 420 N m
-1
.

Key words: Image analysis; mechanical, physical and sensory properties; Tarocco oranges.
1. Introduction
In accordance with the PhD thesis project previously described (Pallottino, 2008), this oral communication
reports the main results of the following activities directed to:
i) review the state of the art and gather existing models to analyze citrus-fruit uniaxial compression tests;
ii) perform a first series of conventional parallel plate compression tests up to rupture to determine engineering
stress (!
Rz
) and strain ("
zR
) at breakage and design stress-relaxation tests at different cross-head speeds (V
T
)
and initial strains ("
z0
) to assess the range of linear viscoelasticity;
iii) determine the contact area (A) of the fruit under squeezing as a function of "
z
for "
z
"
zR
by means of two
different image analysis-based methods to convert the typical force-deformation curves into stress-strain
relationships and thus determine the real orange fruit mechanical properties;
iv) submit a large number of orange fruits to non-destructive compression tests up to "
zR
=0.05 to classify the
specimens into three high-, medium- or low-firmness classes before performing the destructive Magness-
Taylor test and assessing some chemico-physical and sensory properties;
v) analyze the statistical significance of all the measurements to establish a practical rule to sort on-line citrus
fruits.
2. State of the art
Citrus production represents an important share of the Italian fruit market. In the emerging markets of Japan,
North America and Australia, Tarocco cultivars are presently preferred to blond oranges because of their higher
nutraceutical and organoleptic properties. Unfortunately, their lower firmness results in persistent deformation,
especially after long-term shipping, this involving stock rejection once the fruit firmness has been monitored
using the so called Magness-Taylor (MT) test (USDA, 2003). In citrus fruits, the relationship between puncture
force and firmness is concealed by the differences in the tissue types directly under the puncture probe
(Shmulevich et al, 2003). Other techniques based on visible (VIS) or near-infrared (NIRS) spectroscopy,
impaction or acoustic impulse resonance frequency have so far exhibited inaccurate results (Garca-Ramos et al,
2005; Ruiz-Altisent & Ortiz-Canavate, 2005; Valero et al, 2003). Nowadays, just two non-destructive on-line
high-speed systems (i.e., Intelligent Firmness Detector, iFD, Greefa, Trich, NL; Sinclair Internal Quality-
Firmness Tester, SIQFT, Sinclair Systems International, Fresno, CA, USA) have been developed and
15
th
129
15
th
commercialized for testing the firmness of individual fruits by resorting to the so called impact methods, coping
with the free fall of the fruit over a force (piezoelectric) sensor or vice versa. Despite such systems have been
successfully applied to grade several fruits (Howarth et al, 2003; Valero et al, 2003), its application to citrus fruit
sorting is still undocumented. There is therefore an urgent need for novel tests to assess the citrus fruit
mechanical properties in a rapid, objective and reproducible way (Menesatti et al, 2008).
3.1 Raw material, mechanical tests and image acquisition
Citrus fruits cv Tarocco Arcimusa were provided by the experimental farm Palazzelli (Lentini, Siracusa, Italy) of
the Research Centre for Mediterranean Crop of the Agricultural Research Council (CRA-ACM) at the time of
harvest. All mechanical tests were performed using a table-top digital dynamometer, Zwick 1.0 Universal
Testing Machine (Zwick/Roell Testing System, Kennesaw, GA, USA) equipped with a transparent graduated
Plexiglas plate, conventional metal compression plate or 1-cm
2
flat probe, so as to perform uniaxial
compression tests in conjunction with contact area image analyses, non-destructive compression tests or
destructive penetrometric tests, respectively. Based on preliminary trials (Pallottino et al, 2010) and literature
(Ruiz-Altisent et al, 2005), the cross-head speed (V
T
) was set at 15 mm s
-1
. All details about these tests were
previously reported (Pallottino, 2009; Pallottino et al, 2010). Fig. 1 shows the combined system used to perform
compression testing and image acquisition of fruit shape and contact area during the 2008-2009 harvesting
campaign. In the subsequent 2009-2010 campaign, about 150 kg of Tarocco oranges, corresponding to about 400
fruits, were numbered and then compressed by 5% to measure the corresponding fruit resistance (F). After that
they had been ordered with respect to the tension per unit diameter (F/D), they were discriminated into three
different lots, designated as high (HF), medium (MF) or low (LF) firmness one. Any class consisted of 65
specimens, that were randomly subdivided into two subgroups. Forty specimens were sequentially submitted to
rind colorimetric analysis, MT test, and rind thickness measurement along the axes x and y on the equatorial
plane. The MT tests were carried out as previously described (Menesatti et al, 2009). All juices expressed were
assayed for colorimetric analysis, total soluble solids (TSS) using the Abbey refractometer and titratable acidity
(TA) using a NaOH standard solution. Under the supervision of Prof. C. M. Lanza, the remaining 25 fruits were
assayed by 12 skilled panelists of the Laboratory for Sensory Analyses of the Department of Orto-Floro-Arbori-
coltura e Tecnologie Agroalimentari (University of Catania, Catania, Italy), this being certified by UNI ISO
8589 (1990). By referring to an ordinal scale ranging from 1 (absence) to 9 (maximum intensity) (Pagliarini,
2002), each panelist was asked to evaluate 14 different descriptors, namely shape, shape defects, compactness,
ease of peeling, ease of segment separation, typical orange odour, off-odour, juiciness, acidity, sweetness,
bitterness, typical orange flavour, off-flavour, and overall sensory evaluation. The experimental design was
planned to submit two orange fruits randomly selected from any of the three aforementioned lots to any panellist.

3.2 Contact area and fruit size assessment
Three cams [i.e., an AVT Camera Guppy (Allied Vision Technologies, Stadtroda, Germany) and two LifeCams
VX-6000 (Microsoft Corporation, Redmond, WA, USA)] were respectively positioned along the axis lines z , x,
and y to collect a triplet of the projection images X, Y and Z of the fruit under testing (Fig. 1).

Figure 1 Picture of the experimental apparatus equipped with
fixed (lower) and moving (upper) Plexiglas plates and three
web cams, positioned along the axis lines x, y and z to collect
the projection images X, Y and Z of the fruit under testing,
sequentially binarized (A), digitized (B) and finally submitted to
Elliptic Fourier Analysis (C).

Figure 2 Main results of compression testing on
orange fruit samples at V
T
=15 mm s
-1
: Effect of !
z
on
the contact area (A
j
), as acquired by image analyses
using EFA (A
EFA
: !) or bounding-box method (A
BB
:
!), or calculated using the ASABE standard method
(2008) (A
ASM
: ") or assuming the fruit volume
constant (A
V
: #). The continuous line was plotted
0
5
10
15
20
0 5 10 15 20 25
!z
(%)
A
j

(
c
m
2
)

15
th
130
15
th
using Eq. (2), while the broken and dotted lines coincided with their corresponding regression lines.
The fruit size and deformation relative to x or y axis were detected via the y or x camera, respectively. Any size
expressed in pixel was converted into mm by resorting to a pre-calibrated standard metric reference. The effective
contact area was acquired by the vertical (z) camera (Fig. 1). As reported previously (Costa et al, 2009), the
projection images were binarized (Fig. 1-A) and digitized (Fig. 1-B), before submitting their outline coordinates
to Elliptic Fourier Analysis (EFA) to examine the shape changes in the contact surface, as well as its area (AEFA),
as a function of the deformation (H) applied along the z-axis (Fig. 1-C). Knowledge of the effective contact area
(A) allowed the force F-vs.-H curves to be converted into engineering stress (!z) vs. strain ("z) ones:
!
z
=F/A; "
z
= [H
0
H]/H
0
( 1)
where H
0
and H are the initial and current heights of each orange fruit under testing.

3.3 Stress-relaxation tests
Several stress-relaxation tests were performed by setting the initial strain ("
z0
) and cross-head speed (V
T
) to 5, 10,
15 and 20% and 15 mm s
-1
, respectively.
3.4 Statistical analysis of data
All tests were replicated at least 20 times (ASABE, 2008). Mean values of test results are given together with
their corresponding standard deviations. The average responses of the samples tested were compared by One-
Way analysis of variance (ANOVA) and discriminated on the basis of their Least Squares Differences (LSD). A
Students t-test was also applied to test whether the experimental mean values of the contact areas found by
image analysis and Elliptic Fourier Analysis (A
EFA
) or bounding box (A
BB
) were significantly different.

0
50
100
150
200
250
300
0 10 20 30 40 50
! z (%)
F

(
N
)

0
20
40
60
80
100
120
0 10 20 30 40 50
!z
(%)
"
Z

(
k
P
a
)

0
1
2
3
0 10 20 30 40 50
! z
(%)
F
/
D
e
o

(
k
N

m
-
1
)

Figure 3 Main results of the parallel plate compression testing up to rupture performed on 20 orange fruit samples at
V
T
=15 mm s
-1
: a) Average fruit resistance (F) against engineering strain (!
z
); b) Average compressive engineering stress ("
z
)
vs. !
z
; c) Average specific compressive load per unit equivalent diameter (F/D
eo
) vs. !
z
.
4.1 Contact area assessment via image analysis
The effective contact surface area (A
EFA
) for any single sample, as detected by image EFA (Fig 1-C), was found
to be quite irregular, especially at the smaller strains (Costa et al, 2009). Nevertheless, when the average
contours of A
EFA
were calculated, the shape of each contact area was assimilated to quite a perfect ellipse.
Despite an average variation of about 20%, the A
EFA
values appeared to vary linearly with "
z
(Fig. 2):
A
EFA
=(713) "
z
(r
2
= 0.99) ( 2)
By inscribing the images acquired by the z camera in a minimum rectangle (the so called bounding box) having
sides parallel to the axes of the ellipse- or circle-like shape of the acquired contact area, it was possible to
estimate the contact areas (A
BB
), their average values being shown in Fig. 2.
By resorting to the classic inequality of the hypothesis test for means, it was possible to reject any statistical
difference between A
EFA
and A
BB
values at a probability level of 0.01.
By using the camera y or x, it was possible to measure the citrus fruit expansion along x or y axis, when
compressed along the axis z, and then estimate the Poissons ratios
x
and
y
. Their

average values practically
coincided (0.160.09), this confirming the almost homogeneous behaviour of the fruit samples examined.
All the data collected allowed the contact area to be even predicted in accordance with the ASABE standard
method (2009), their mean values (A
ASABE
) being plotted in Fig. 2. Finally, by assuming that the overall volume
of the fruit under compression was constant, it was possible to calculate the cross-sectional area (A
V
) against "
z
(Fig. 2), as previously reported (Pallottino et al, 2009). The estimated A
ASABE
and A
V
values differed from those
derived from image analyses (A
EFA
) by about 45 and 19%, respectively.

4.2 Compression testing up to rupture
Fig. 3a shows the average values and standard deviations of fruit resistance (F) against "
z
up to rupture. By using
a) b)
c)
15
th
131
15
th
Eq. (1), it was possible to convert such a curve into the !
z
-vs.-"
z
relationship (Fig. 3b). Despite the uncertainty in
the estimation of A, especially for "
z
<3%, !
z
exhibited an initial trend of the power-law type that practically
became of the linear type for "
z
increasing from 4% to 24%. Beyond such a strain, !
z
reached a maximum burst
value (10915 kPa) at "
zR
=(283)%, then tended to decline. The linear region in the !
z
-vs.-"
z
curve enabled the
apparent modulus of elasticity of the whole orange fruit to be estimated (3533 kPa, r
2
=0.998).
Since the fruit rind thickness (s) is very small compared to the fruit radius of curvature, the thin shell theory may
be applied and bending effects ignored (Carin et al, 2003). Thus, the resulting stresses in the orange rind may be
replaced by the forces per unit length of a line element in the median plane. In Fig. 3c the average force per unit
equivalent diameter (F/D
eo
) is plotted against "
z
, this plot being referred to 20 orange fruit specimens with
roughly the same equivalent diameter (D
eo
=813 mm), variety and maturity.

4.3 Stress-relaxation testing
To assess the range of linear viscoelasticity, citrus fruits were loaded at V
T
=15 mm s
-1
to generate engineering
strains along the z axis in the range of 5-20%. Once the cross-head had been stopped, the stress relaxation was
monitored for as long as 900 s, this being much longer than the time required (0.2-1.0 s) to deform the samples.
During all tests the dimensionless relaxation modulus G*(t, "
z
), expressed by the ratio between the actual F and
initial F
0
reactions provided that the contact area (A) of the sample tested is constant and independent of time,
exhibited an asymptotically decaying trend with a residual value different from zero whatever the engineering strain
applied. By associating the response of citrus fruit to that of a generalized Maxwell body (a spring in parallel to n
Maxwell elements) (Rao, 1992b), G* may be described as follows:
G*(t, "
z
) = A
0
+
i
n
1
i
t/ -
e A ! ( 3)
where A
i
represents the generic dimensionless viscoelastic coefficient.
By fitting G*-vs.-t data with an initially arbitrary spectrum of relaxation times (Nussinovitch et al, 1989) via the
least squares method, it was possible to reconstruct the time course of G* by accounting for just two statistically
significant Maxwell elements in parallel to an elastic spring element, the latter being characterized by the
following relaxation times: #
1
= 2.0 s, and #
2
= 204 s. It can be noted that the smallest relaxation time (#
1
) was 2
to 20 times greater than the loading times (Rao, 1992a). The corresponding viscoelastic constants (A
i
) resulted to
be approximately constant:
A
0
= 0.42 0.02; A
1
= 0.17 0.02; A
2
= 0.41 0.02
In particular, the elastic component (A
0
), responsible for the equilibrium residual stress, represented about 42%
of the initial relaxation modulus, this confirming that any fruit behaved as a linear viscoelastic solid, at least on
the time-scale and deformation range examined.
The deformation strain up to 20% affected neither the relaxation time spectrum of the delayed elastic
components nor the percentage mass loss (0.040.03%) of any fruit tested. On the contrary, the percentage
volume loss increased from 21 to 61% as "
z
was increased from 5 to 20%.

4.4 Chemico-physical and sensory testing
After assessing the resistance at "
z
=0.05 of about 400 orange fruits, these were discriminated into three different
classes (i.e., high, HF; medium, MF; low, LF, firmness ones), provided that the force per unit diameter (F/D)
ranged from 390 to 420 N m
-1
, from 300 to 320 N m
-1
or from 220 to 240 N m
-1
, respectively.
Within each class, forty specimens were sequentially submitted to rind colorimetric analysis, MT test, and rind
thickness measurement along the axes x and y on the equatorial plane. The variation in the orange rind CIELAB
coordinates (L
r
*=622; a
r
*=382; b
r
*=593) and thickness (s=1.80.5 mm) was found to be statistically
insignificant at the confidence level of 0.01; while the MT firmness, that ranged from 40 to 123 N, was able to
discriminate only the orange fruits in the HF class with MT=7316 N from those belonging to the MF
(MT=599 N) and LF (MT=496 N) ones.
This finding was also confirmed by the CIELAB coordinates (L
j
*=373; a
j
*=132; b
j
*=104) of the orange
juices extracted from HF oranges, that significantly differed from those (L
j
*=423; a
j
*=122; b
j
*=145) of the
juices squeezed by MF and LF oranges. On the contrary, whatever the firmness class of the orange fruits the
resulting juices did not statistically differ in the total soluble solid content (TSS=11.70.5Brix) and titratable
acidity (TA=1.380.04 % w/v of citric acid). This was also congruent with the panel assessment of the great
majority of the sensory descriptors, namely shape (72), shape defects (32), typical orange odour (72), off-
odour (21), juiciness (72), acidity (42), sweetness (52), bitterness (21), typical orange flavour (62), off-
flavour (22), and overall sensory evaluation (62). Moreover, the sensory professionals recognized the greater
compactness (72) and lower peeling (42) and segment separation (42) easiness of the HF oranges, while they
were unable to discriminate the corresponding sensory descriptors (52; 62; 52) pertaining to the orange fruits
grouped in the MF and LF classes.
Therefore, orange fruits differing in a range of MT or (F/D) firmness of 40-86 N or 220-320 N m
-1
, respectively,
15
th
132
15
th
were not discriminated by sensory panellists, even if for the oranges assayed the range of MT or (F/D) firmness
was by far wider (40-123 N or 220-420 N m
-1
).
Two image analysis-based methods (i.e., EFA and bounding box), set up in this PhD thesis, allowed accurate
assessment of the contact area between the plates and specimen during parallel plate compression, this being
quite greater than that estimated using the ASABE standard method (2008). However, none of them can be
recommended as routine procedures to sort on-line citrus fruit, even if they might be useful to for cultivar
characterization.
By resorting to the thin shell theory (Carin et al, 2003), it would be possible to characterise orange fruit firmness
by replacing the stress exerted in the orange rind with the fruit resistance per unit diameter (F/D), as shown in
Fig. 3c. Since Tarocco orange fruits behaved as linear viscoelastic solids for compression strains up to 20%, non-
destructive determination of the fruit resistance at a compression strain of 5% gave rise to negligible fruit mass
(0.040.03%) and limited volume (21%) losses. Thus, such a parameter may be regarded as a sensitive tool to
pilot efficiently industrial high-speed orange fruit sorting lines. Since for all the specimens tested there was no
statistically significant difference in terms of overall sensory evaluation (62), it would be reasonable to grade
only the orange fruits with specific resistance (F/D) varying within a deviation band of 220-420 N m
-1
.
Further work is needed to validate this operating procedure on a continuous pilot-scale sorting line.
6. References
ASABE Standards (2008) Standards Engineering Practices Data. Compression test of food materials of convex shape.
America Society of Agricultural and Biological Engineers, 55th edn., pp. 671-678, ASABE, St. Joseph, MI, USA.
Carin M, Barths-Biesel D, Edwards-Levy F, Postel C, Andrei DC (2003) Compression of biocompatible liquid-filled HAS-
Alginate capsules: determination of the membrane mechanical properties. Biotechnol Bioeng 82: 207-212.
Costa C, Menesatti P, Paglia G, Pallottino F, Aguzzi J, Rimatori V, Russo G, Recupero S, Reforgiato Recupero G (2009)
Quantitative evaluation of Tarocco sweet orange fruit shape using opto-electronic elliptic Fourier based analysis.
Postharvest Biology and Technology 54: 38-47.
Garca-Ramos FJ, Valero C, Homer I, Ortiz-Caavate J, Ruiz-Altisent M (2005) Non-destructive fruit firmness sensors: a
review. Spanish Journal of Agricultural Research 3(1): 61-73.
Howarth MS, Shmulevich I, Raithatha C, Ioannides Y (2003) Online non-destructive avocado firmness assessment based on
low-mass impact technique. In Proceedings V World Avocado Congress (Actas V Congreso Mundial del Aguacate),
pp. 679-685.
Menesatti P, Pallottino F, Lanza G, Paglia G (2008) Prediction of blood orange MT rmness by multivariate modelling of
low alterative penetrometric data set: A preliminary study. Postharvest Biology and Technology 51: 434-436.
Menesatti P, Pallottino F, Lanza G, Paglia G (2009) Prediction of blood orange MT rmness by multivariate modelling of
low alterative penetrometric data set: A preliminary study. Postharvest Biol Technol 51: 434-436.
Nussinovitch A, Peleg M, Normand MD (1989) A modified Maxwell and a nonexponential model for characterization of the
stress relaxation of agar and alginate gels. J Food Sci 54: 1013-6.
Pagliarini E (2002) Valutazione sensoriale: aspetti teorici, pratici e metodologici. Ulrico Hoepli Editore, Milano.
Pallottino, F. (2008) Rheometrical Characterization and Firmness Assessment of Citrus Cultivars by Non-Destructive Tests.
In Proceedings of the 13
th
Workshop on the Developments in the Italian PhD Research on Food Science and
Biotechnology, Alba (Italy), 10-12 September, pp. 554-555.
Pallottino F (2009) Use of image analysis to asses the effective surface area of orange fruit submitted to uniaxial compression
tests. In Proceedings of the 14
th
Biotechnology, Oristano (Italy), 16-18 September, pp. 337-339.
Pallottino F, Costa C, Menesatti P, Moresi M (2009) Compression testing of orange fruit. In Proceedings of the 9
th

International Conference on Chemical and Process Engineering, Roma (Italy), 10-13 May, Chemical Engineering
Transactions 17, 885-890.
Pallottino F, Moresi M, Giorgi S, Menesatti P (2010) Orange fruit rheometrical characterization using stress-relaxation tests.
In Proceedings of the XVII
th
Congress of the International Commission of Agricoltural and Biosystem Engineering
(CIGR), Quebc City, Canada, 13-17 June, pp. 256.
Rao MA (1992a) Measurement of viscoelastic properties of fluid and semisolid foods. In Viscoelastic properties of foods,
MA Rao and JF Steffe (Eds) pp. 207-231, Elsevier Applied Science, London.
Rao VNM (1992b) Classification, description and measurement of viscoelastic properties of solid foods. In Ibidem, pp. 3-47.
Ruiz-Altisent M, Ortiz-Canavate J (2005) Instrumentation and procedures for commercial non-destructive determination of
firmness of various fruit. ASAE Paper n056176.
Shmulevich, I., Galili, N., & Howarth, M.S. (2003) Non destructive dynamic testing of apple for firmness evaluation.
Postharvest Biology and Technology 29: 287-299.
UNI 8589 (1990) Analisi sensoriale Criteri generali per la progettazione di locali destinati allanalisi. Ente Nazionale
Italiano di Unificazione, Milano.
USDA (2003). Agricultural Marketing Service. Available at:
www.ams.usda.gov/AMSv1.0/getfile?dDocName=STELPRDC5050384. Accessed Febr., 15
th
, 2010.
Valero C, Bowerman E, Crisosto CH, Garner D, Slaughter D (2003) Introducing Nondestructive Flesh Color and
Firmness Sensors to the Tree Fruit Industry. Acta Horticolturae 604: 597-600.
15
th
133
15
th
Lipid Oxidation Volatile Compounds in Corn Flakes and Their Impact on
Flavour. How to Prevent Sensory Deterioration?
Vito Michele Paradiso (vito.paradiso@agr.uniba.it)

Different typologies of natural antioxidants were employed in the production of corn flakes, to point out the most
effective in keeping lower levels of off-flavour related volatile compounds after long-term storage. The results
showed that tocopherols better expressed their antioxidant activity than rosemary extract, while ascorbic acid
showed a synergistic activity with tocopherols. This could be attributed to interfacial and phase partitioning
phenomena involving antioxidants, depending on their lipo- or hydrophilicity, in heterogeneous food products.
Acids, n-alkanols, lactones and some aldehydes appeared to have a greater influence on the intensity of the off-
flavours.
Composti Volatili di Ossidazione nei Corn Flakes e Loro Impatto sullAroma. Come
Prevenire il Deterioramento Sensoriale?
Diversi antiossidanti naturali sono stati impiegati nella produzione di corn flakes, allo scopo di individuare il pi
efficace nel rallentare la comparsa di composti volatili responsabili di off-flavour durante la conservazione di
lungo periodo. I risultati hanno mostrato che i tocoferoli sono pi efficaci dellestratto di rosmarino, mentre
lacido ascorbico ha mostrato unattivit sinergica con i tocoferoli. Questo pu essere attribuito a fenomeni
interfacciali e di ripartizione di fase che coinvolgono gli antiossidanti, in funzione della loro lipo- o idrofilicit in
alimenti eterogenei. Acidi, n-alcanoli, lattoni e alcune aldeidi sono sembrati avere una influenza maggiore
sullintensit degli off-flavour.

Keywords: Corn flakes; Natural antioxidants; Off-flavour; Oxidation volatile compounds.
1. Introduction
The oxidative stability during storage is one of the main critical aspects in foods. The unavoidable oxidative
processes, that particularly involve the lipid fraction of foods, are, in fact, responsible of a nutritional and
sensory deterioration that negatively influences the shelf-life of foods (Forss, 1972; Frankel, 1982).
The devices adopted with the aim to restrain such deterioration are various, and involve an appropriate choice of
raw matters, of processing technologies, of packing materials, and of storage conditions.
Nevertheless, it is often necessary to resort to antioxidants that, added to the product, may preserve the lipid
fraction from oxidation. Synthetic antioxidants are still widely used, though existing well-founded concerns
about their safety (Pan et al., 2007), as well as legal restrictions for use in some countries and a growing
suspicion by consumers. Therefore, industry and research turned their interest towards antioxidants with natural
origins. Researchers are considering several classes of natural compounds e.g. tocopherols, organic acids,
phenolic compounds deriving from various antioxidant-rich natural sources (Camire et al., 2005; Pan et al.,
2007). It should be taken in count that the activity of these substances is strongly dependent on the food system
in which they are employed, on the conditions and doses adopted, on possible interactions with other substances,
until they may reverse their action from antioxidant to pro-oxidant (Laguerre et al., 2007; McBride et al., 2007).
In spite of low contents, the fatty fraction in extruded products, such as corn flakes, is affected by some factors
that promote their oxidation: low moisture; high surface/volume ratio, due to expansion and flaking; high iron
levels, due to wearing of the extruder screw and barrel (Camire et al., 2005; 2007; Gray et al., 2008).
The present work was aimed to compare different natural antioxidants, in order to assess the most effective
option in slowing down the onset of sensory deteriorations during the storage of corn flakes. With this aim
natural tocopherols alone, in two different doses, or combined with ascorbic acid and a rosemary extract
were used in the production of corn flakes on industrial scale. Besides, we aimed to investigate about the
relationships involving the sensory properties of the product and its oxidation volatile pattern, by multivariate
analysis.
2.1 Sample preparation
Corn flakes were produced by extrusion cooking technology in an industrial production line. The ingredients
were corn flour, sugar, salt, malt, water. The fat content of the flakes obtained was about 2.5%. These flakes
15
th
134
15
th
(control, C) were compared with four typologies of flakes differing in quality and/or quantity of added natural
antioxidants: a water-dispersible commercial formulate containing 30% of mixed natural tocopherols (125 ppm,
T1; 187.5 ppm, T2); ascorbic acid (400 ppm together with 125 ppm of natural tocopherols, TA); a powdered
rosemary extract (810 ppm, RE). The amounts were established on the basis of the concentrations recommended
by the producer and the results of preliminary trials (data not shown). Antioxidants were added to water before
mixing, being this the handiest and cheapest practice to be introduced in the production of corn flakes on
industrial scale. The flakes were packed in 500 g bags. The package film was a oriented polypropylene/oriented
polypropylene coupled film with permeability to O
2
< 1400 cm
3
m
-2
24h
-1
(25C, 0% R.H.) and permeability to
water 5.5 g m
-2
24h
-1
(38C, 90% R.H.). Three packs for each typology of flakes were sampled and stored at
room temperature and under normal conditions of light for one year. After the storage period samples were
analysed by sensory evaluation and SPME/GC/MS analysis of the volatile oxidation compounds.
2.2 Sensory evaluation
For the sensory evaluation of stored corn flakes some International Standard Organization (ISO) regulations
were used to identify the steps required to implement the sensory analysis of a product. They included: 1) the
identification of the descriptors qualifying flavours and off-flavours that appear in corn flakes during storage; 2)
the arrangement of a form for sensory analysis. The intensity of every attribute was expressed on a 10-cm
unstructured linear scale; 3) the standardisation of a method for the preparation and tasting of samples: at the
beginning of the panel session, each panellist was asked to evaluate the odour descriptors, and then he/she was
asked to assess the taste descriptors. Samples were given, after the opening of the pack, in 200 mL polyethylene
glasses covered with aluminium film; 4) the formation and selection of the panel. The panel group was selected
among researchers and technicians of the research laboratory, undergraduate and Ph.D students, habitual
consumers of corn flakes, after a cycle of lectures on the basic notions of sensory analysis and some tests to
monitor their performance in recognising the off-flavour of corn flakes. Panellists evaluated fresh and aged
flakes to familiarize with flavours and with the vocabulary and the intensity range of the sensory attributes. A
group of 16 people were first selected and then submitted to a further test to monitor their ability: without anyone
knowing, two equal samples were given for tasting in two different sessions. Ten people passed this further test
and were selected as panel members; 5) execution procedure of the panel test. The samples were randomly coded
using a two-digit number.
2.3 Headspace analysis
Volatiles were extracted by Solid Phase Micro-Extraction (SPME) as reported in Paradiso et al. (2008). In
particular, samples were weighed (10 0.05 g) in a 50-mL vial, closed by butylic rubber septa and an aluminium
seal. Before extraction, stabilisation of the headspace in the vial was obtained by equilibration for 30 min at
40C. The extraction was carried out using a DVB/CAR/PDMS 50/30 m SPME fiber assembly (Supelco,
Bellefonte, PA, USA) at 40C for 30 min. The fiber was desorbed for 6 min in the injection port of the gas-
chromatograph, operating in splitless mode. For the SPME analyses an Agilent 6850 gas-chromatograph
equipped with an Agilent 5975 mass-spectrometer was used. Compounds were resolved on a Supelco capillary
column SPB-624 (30 m ! 0.25 mm ! 1.4 m), under the following conditions: injection port temperature,
250C; helium pressure, 30 kPa; oven temperatures, 40C for 2 min then 5C min
-1
to 230C and final
isothermal for 10 min. Mass detector was set at the following conditions: detector voltage, 500V; interface
temperature 250C; source temperature 250C; ionization energy 70 eV; emission 200 , scan range 30-270
amu. Peak identification was performed comparing retention times with those of the standards, by Linear
Retention Index (LRI) and by computer matching with the reference mass spectra of NIST and Wiley libraries.
In some cases identification was performed only by matching with the reference mass spectra. To compensate
for the variation in the performance of the SPME fiber and the MS-detector during the 12-month storage period,
all detector responses of duplicated samples were standardized to the response of an external standard.
Analysis of variance (ANOVA), followed by Tukey Test for multiple comparisons and Dunnet Test for
comparisons with control, and Principal Component Analysis (PCA) were carried out on the experimental data
by the XLStat software (Addinsoft SARL). Partial Least Squares Regression (PLSR) and Hierarchical Cluster
Analysis were performed with Statgraphics Centurion XV Professional (StatPoint Inc., Herndon, VA).
Principal components analysis, performed on the sensory analysis scores and on the analytical data of volatile
compounds grouped in classes, gave the results reported in the loading plot (a) and in the score plot (b) in figure
1. The first two principal components (PC) express 96.39% of the data variability. PC1 explained a great amount
of cumulated variability (almost 84%), pointing out strict correlations among the original variables. It was
positively correlated with all the classes of volatile compounds and with the off-flavour descriptors, and
negatively correlated with the fresh product descriptors and OA.
15
th
135
15
th

Figure 1 Loading plot (a) and score plot (b) of the Principal Components Analysis performed on the data (FPO, fresh
product odour; OA, overall acceptability; FPF, fresh product flavour; RO, rancid odour; PO, pungent odour;
SO, stale odour; RF, rancid flavour).
Alcohols, acids, lactones and FPO, OA, RO, SO, RF descriptors were strictly correlated. PC1 distinguished the
flakes added with tocopherols from those without this addition, attributing positive scores to C and RE and
negative ones to T1, T2, TA. No clear difference appeared on PC1 in this latter group, while RE received a
slightly lower score than C, so most data variability was ascribable to the use of tocopherols, regardless of the
doses and of the use of other antioxidants. The variables that mainly contributed to PC2 are, instead, ketones,
aldehydes, furans, and the sensory descriptors FPO and PO. PC2 allowed to appreciate the effects of different
doses of tocopherols and in special way the combined effects of tocopherols and ascorbic acid, as well as the
difference between C and RE. The use of tocopherols in higher dose or in combination with ascorbic acid and
the employment of rosemary extract determined a slight improvement of the sensory characteristics, higher
levels of ketones, aldehydes and furans, and a lower content of lactones, contributing to 12% of total variability.
The results obtained pointed out that tocopherols were considerably able to slow down the oxidation processes in
the corn flakes, with a recognisable, though limited, dose-effect and a more pronounced result due to the
combined addition of ascorbic acid. On the contrary, the rosemary extract did not significantly influence the
degradation phenomena in the corn flakes. Previous studies pointed out that the effectiveness of an antioxidant is
affected by several factors (Moure et al., 2001), among which the characteristics of the food product are of main
significance (Estvez and Cava, 2006). Frankel (1996), referring to the polar paradox reported by Porter et al.
(1989), highlighted that, due to interfacial and phase partitioning phenomena, in food products with a low
surface/volume (S/V) ratio (e.g. bulk oil), hydrophilic antioxidants (e.g. rosemary extracts) resulted more
effective than lipophilic antioxidants (e.g. tocopherols), while these latter showed a more pronounced activity in
heterogeneous food products, with a high S/V ratio. On this basis, the same Author (Frankel et al., 1996)
reported that the antioxidant activity of a rosemary extract was stronger in corn oil than in an oil-in-water
emulsion system. The lipid fraction of corn flakes should have characteristics similar to the latter case, due to its
low amount, to the high S/V ratio, and to the oil-water interfacial phenomena occurring in the kneading and
extrusion-cooking steps. This could explain the noticeable difference observed between tocopherols and
rosemary extract in inhibiting lipid oxidation in the corn flakes. The enhancing effect of the addition of the
ascorbic acid, observed in this work, could be explained, besides its direct antioxidant effect, by the synergistic
interactions with tocopherols (Frankel, 1996; Vicetti et al., 2005). Hiramoto et al. (2002) reported that, among
various hydrophilic antioxidants, only ascorbic acid showed a synergistic activity with !-tocopherol in a
biphasic system.
With the aim to obtain further information about the relations involving the oxidation volatile compounds and
the sensory characteristics described by panel test, Partial Least Squares Regression (PLSR), with leave-one-out
cross-validation, was performed considering the sensory descriptors as dependent variables and the volatile
compounds as predictors. The lowest levels of residue variance, both in calibration and in validation, were
obtained extracting two components (94.47% and 94.93% of explained variance for predictors and dependent
variables, respectively). A significant adaptation (p < 0.05) was obtained for the models of the defect descriptors,
that revealed, therefore, good explanatory and predictive capabilities. The linear model for OA showed a p value
slightly higher than 0.05. This could probably due to other factors that influenced the overall evaluation of the
flakes and that were different from the volatile lipid oxidation products considered as predictors in this model.
Standardized coefficients allowed to estimate the contribute of predictors to the dependent variable model.
Hierarchical cluster analysis was then performed, in order to group the volatile compounds on the basis of their
contribution to the linear models. Figure 2 shows the scatterplots of the standardized coefficients with the results
of the cluster analysis. High correlations among the standardized coefficients of the different descriptors rose
from the correlations existing among the descriptors themselves.
15
th
136
15
th

Figure 2 Scatterplots of the standardised coefficients of PLSR analysis on the data, with the results of the cluster analysis
(RO, rancid odour; PO, pungent odour; SO, stale odour; RF, rancid flavour; FPF, fresh product flavour; OA,
overall acceptability; FPO, fresh product odour).
No specific relations between individual compounds and certain off-flavours appeared, but rather a close relation
between these undesired sensory properties and the pattern of volatile oxidation products. Among them, those
grouped in the cluster 1, and in smaller extent also those in cluster 2, stood out, since their variations resulted in
more significant variations of intensity of the off-flavours. Cluster 1 included organic acids, lactones, n-alkanols
and three medium-chain aldehydes, while cluster 2 includes 1-octen-3-ol and other medium-chain aldehydes.
The sensory profile of corn flakes affected by off-flavours is, then, particularly linked to these compounds, that
are originated by decomposition of the fatty acid hydroperoxides and, in some cases, by further oxidation of
decomposition products. In particular, pentanoic and hexanoic acids are products of further oxidation of the
respective aldehydes (Palamand and Dieckmann, 1974; Grosch, 1982), deriving from linoleic acid
hydroperoxides; "-hexalactone, in its turn, originates by oxidation of hexanoic acid, as described by Palamand
and Dieckmann (1974). C
8-9
2-alkenals, C
5-7
1-alkanols, 1-octen-3-ol and 2,4-nonadienal mainly derive from
linoleic acid, too; C
7-9
alkanals, 2-decenal and 1-octanol are principally products of oxidation of oleic acid,
instead (Grosch, 1982; Frankel, 1982; Ullrich and Grosch, 1987; Neff et al., 2000).
Abundant literature exists about their sensory significance. Organic acids are correlated to off-flavours described
as rancid, fatty, fishy, pungent, sickening, sweaty, sour, sharp, pungent, cheesy (Guth and Grosch, 1993; Krist et
al., 2006; Mahajan et al., 2004; Paradiso et al., 2008; Takahashi et al., 2004; Triqui and Guth, 2001); C
8-10
2-
alkenals are responsible of odours described as plastic, acrid, rancid, fatty, penetrating (Jacobsen et al., 1999;
Krist et al., 2006; Neff et al., 2000; Reiners and Grosch, 1998); nonanal is associated to waxy, painty descriptors
(Fenaille et al., 2003), heptanal to pungent, penetrating (Heini, 2003; Krist et al., 2006), octanal to fatty (Krist
et al., 2006); n-alkanols are correlated to pungent (Carbonell et al., 2002) and sharp (octanol, in Krist et al.,
2006) perceptions; 1-octen-3-ol is among the compounds responsible of rancid odour in mayonnaise (Jacobsen et
al., 1999); 2,4-nonadienal produces pungent, rancid, fatty sensations (Hgnadttir and Rouseff, 2003; Mahajan
et al., 2004; Valim et al., 2003). On the other hand, 3,5-octadien-2-one came out: it constituted a cluster by itself,
since it showed very low standardized coefficients for all models: Forss (1972) attributed to conjugated
unsaturated ketones generally pleasant odours.
4. Conclusions
In conclusion, experimental tests carried out on corn flakes packed and stored for one year, pointed out the
appearance of pronounced off-flavours ascribable to lipid oxidation. The addition of natural tocopherols resulted
more effective in limiting the levels of the oxidation volatile compounds and the onset of such sensory defects
than an antioxidant-rich rosemary extract. Such different behaviours could be attributed to interfacial and phase
partitioning phenomena that involve antioxidants, depending on their lipo- or hydrophilicity, in heterogeneous
15
th
137
15
th
food products. A 50 % increase in the amount of added tocopherols brought to a further improvement of the
sensory profile and the oxidation level of the product, however somewhat limited and smaller than that obtained
adding also ascorbic acid as a synergist. Multivariate data analysis techniques allowed to identify the volatile
compounds whose variations caused more significant variations in the sensory profile of the product, focusing on
acids, lactones, n-alkanols, (E)-2-alkenals.
5. References
Camire ME, Dougherty MP, Briggs JL (2005) Antioxidant-rich foods retard lipid oxidation in extruded corn. Cereal Chem
82:666-70.
Camire ME, Dougherty MP, Briggs JL (2007) Functionality of fruit powders in extruded corn breakfast cereals. Food Chem
101:765-70.
Carbonell M, Nuez M, Fernndez-Garca E (2002) Evolution of the volatile components of ewe raw milk La Serena cheese
during ripening. Correlation with flavour characteristics. Lait 82:683-98.
Estvez M, Cava R (2006) Effectiveness of rosemary essential oil as an inhibitor of lipid and protein oxidation: Contradictory
effects in different types of frankfurters. Meat Sci 72:348-55.
Fenaille F, Visani P, Fumeaux R, Milo C, Guy PA (2003) Comparison of mass spectrometry-based electronic nose and solid
phase microextraction gas chromatography-mass spectrometry technique to assess infant formula oxidation. J Agric
Food Chem 51:2790-6.
Forss DA (1972) Odor and flavor compounds from lipids. In Holman RT (Ed) Progress in chemistry of fats and oils, Vol.
13, Part 4. New York: Pergamon Press.
Frankel EN (1982) Volatile lipid oxidation products. Prog Lipid Res 22:1-33.
Frankel EN (1996) Antioxidants in lipid foods and their impact on food quality. Food Chem 57:51-5.
Frankel EN, Huang S-W, Aeschbach R, Prior E (1996) Antioxidant activity of a rosemary extract and its constituents,
carnosic acid, carnosol, and rosmarinic acid, in bulk oil and oil-in-water emulsion. J Agric Food Chem 44:131-5.
Gray DA, Bowen SE, Farhat I, Hill SE (2008) Lipid oxidation in glassy and rubbery-state starch extrudates. Food Chem
106:227-34.
Grosch W (1982) Lipid degradation products and flavours. In Morton ID, MacLeod AJ (Eds) Food Flavours, Amsterdam:
Elsevier, pp 325-98.
Guth H, Grosch W (1993) Odorants of extrusion products of oat meal changes during storage. Z Lebensm Unters Forsch A
196:22-8.
Heini RL, Katina K, Wilhelmson A, Myllymki O, Rajamki T, Latva-Kala K, Liukkonen KH, Poutanen K (2003)
Relationship between sensory perception and flavour-active volatile compounds of germinated, sourdough fermented
and native rye following the extrusion process. Lebensm-Wiss Techol 36:533-45.
Hiramoto K, Miura Y, Ohnuki G, Kato T, Kikugawa K (2002) Are water-soluble natural antioxidants synergistic in
combination with !-tocopherol? J Oleo Sci 51:569-76.
Hgnadttir , Rouseff RL (2003) Identification of aroma active compounds in orange essence oil using gas
chromatographyolfactometry and gas chromatographymass spectrometry. J Chromatogr A 998:201-11.
Jacobsen C, Hartvigsen K, Lund P, Meyer AS, Adler-Nissen J, Holstborg J, Hlmer G (1999) Oxidation in fish-oil-enriched
mayonnaise. Eur Food Res Technol 210:13-30.
Krist S, Stuebiger G, Bail S, Unterwger H (2006) Analysis of volatile compounds and triacylglycerol composition of fatty
seed oil gained from flax and false flax. Eur J Lipid Sci Tech 108:48-60.
Laguerre M, Lecomte J, Villeneuve P (2007) Evaluation of the ability of antioxidants to counteract lipid oxidation: Existing
methods, new trends and challenges. Prog Lipid Res 46:244-82.
Mahajan SS, Goddik L, Qian MC (2004) Aroma compounds in sweet whey powder. J Dairy Sci 87:4057-63.
McBride NTM, Hogan SA, Kerry JP (2007) Comparative addition of rosemary extract and additives on sensory and
antioxidant properties of retail packaged beef. Int J Food Sci Tech 42:1201-7.
Moure A, Cruz JM, Franco D, Domnguez JM, Sineiro J, Domnguez H, Nez MJ, Paraj JC (2001) Natural antioxidants
from residual sources. Food Chem 72:145-71.
Neff WE, Warner K, Byrdwell WC (2000) Odor significance of undesirable degradation compounds in heated triolein and
trilinolein. J Am Oil Chem Soc 77:1303-13.
Palamand SR, Dieckmann RH, (1974) Autoxidation of n-hexanal. Identification and flavor properties of some products of
oxidation. J Agric Food Chem 22:503-6.
Pan Y, Zhang X, Wang H, Liang Y, Zhu J, Li H, Zhang Z, Wua Q (2007) Antioxidant potential of ethanolic extract of
Polygonum cuspidatum and application in peanut oil. Food Chem 105:1518-24.
Paradiso VM, Summo C, Trani A, Caponio F (2008) An effort to improve the shelf life of breakfast cereals using natural
mixed tocopherols. J Cereal Sci 47:322-30.
Porter W L, Black ED, Drolet AM (1989) Use of polyamide oxidative fluorescence test on lipid emulsions: contrast in
relative effectiveness of antioxidants in bulk versus dispersed systems. J Agric Food Chem 37:615-24.
Reiners J, Grosch W (1998) Odorants in virgin olive oils with different flavor profiles. J Agric Food Chem 46:2754-63.
Takahashi YK, Nagayama S, Mori K (2004) Detection and masking of spoiled food smells by odor maps in the olfactory
bulb. J Neurol Sci 24:8690-94.
Triqui R, Guth H (2001) Potent odorants in Smen, a traditional fermented butter product. Eur Food Res Techol 212:292-95.
Ullrich F, Grosch W (1987) Identification of the most intense volatile flavour compounds formed during autoxidation of
linoleic acid. Z Lebensm Unters Forsch A 184:277-80.
Valim MF, Rouseff RL, Lin J (2003) Gas chromatographic-olfactometric characterization of aroma compounds in two types
of cashew apple nectar. J Agric Food Chem 51:1010-15.
15
th
138
15
th
Traceability of mountain cheeses: identification and characterization of
biochemical markers
Valeria Pelizzola (valeria.pelizzola@unimi.it)
Dept. Food Science and Technology, University of Milan, Milan, Italy
Tutor: Prof. Ivano De Noni Co-tutor: Dott.ssa Giovanna Contarini

In the last few years several researchers have approached the problem of traceability of dairy products, mainly
by examining volatile compounds that can act as tracers of the animals diet. This PhD thesis focused on the
study of the composition of the non-volatile minor components of the neutral lipid fraction in highland and
lowland cheeses. Hydrocarbons were separated by silica gel column chromatography and analysed by GC/MS.
Within the compounds detected, promising markers for the differentiation of dairy products, according to the
feeding system, were found.
Tracciabilit dei formaggi di montagna: identificazione e caratterizzazione di marker
biochimici
Negli ultimi anni numerosi ricercatori si sono occupati dello studio della tracciabilit dei prodotti lattiero caseari
principalmente esaminando i composti volatili che possono agire in qualit di traccianti della dieta alimentare
degli animali. Il seguente lavoro di dottorato stato focalizzato sullo studio di composti minori, non volatili,
presenti nella frazione lipidica neutra di formaggi di pianura e di montagna. Gli idrocarburi sono stati separati
mediante cromatografia su colonna e analizzati in GC/MS. Tra i composti rilevati sono stati evidenziati markers
utili per differenziare i prodotti lattiero caseari in relazione allalimentazione degli animali.

Key words: Traceability, hydrocarbon fraction, highland and lowland cheeses
1. Introduction
Traceability of dairy products has become of great interest, at all levels of the production process, for
researchers, consumers, industries and policy makers. In the last few years several researchers have approached
the problem of food authenticity and, in the dairy field, many papers dealing with the traceability of the origin of
milk and cheese have been published (De la Fuente et al., 2005; Bosset et al., 1994; Schlichtherle-Cerny et al.,
2004). In particular, studies have been carried out to differentiate between mountain cheeses, produced by
animals feeding on pasture, and cheeses of lowland origin deriving from intensive breeding systems. The
characteristics of milk are affected significantly by moving the animal herd from stabling to grazing and, in
particular, compounds like terpenes and conjugated linoleic acid, tend to increase their concentration in milk
produced by cows grazing on pasture (Bosset et al., 1994; De Noni and Battelli, 2008).
In order to verify if other molecules could be of interest to evaluate dairy product traceability, the PhD thesis was
focused on the investigation of the non volatile hydrocarbons of the neutral lipid fraction. In milk fat, this
fraction is characterized by compounds belonging to the following chemical classes: n-alkanes from C14 to C31
carbon atoms, isoprenoid hydrocarbons, methyl and ethyl esters, esters of isoprenoid alcohols and cholesterol. In
particular n-alkanes and isoprenoid hydrocarbons, that are important components of vegetable wax, could be
potential tracers of animal diets (Flanagan and Ferretti, 1973, Cerbulis et al.,1985, Povolo et al., 2009).
n-Alkanes are inert in the digestive tract, thus they are lightly modified during the digestion and metabolism and
consequently they are directly transferred into milk (Keli et al., 2008). Isoprenoid hydrocarbons are plant
secondary metabolites, biosynthetically formed by condensation of isoprene skeletal units. Squalene and
phytenes derivatives, such as 1-phytene, 2-phytene, phytane, neophytadiene, are the main components of this
fraction in milk fat (Flanagan et al., 1975; Urbach and Stark, 1975). Phytenes derive, through different
biosynthetic pathways, from dietary phytol of chlorophyll by the action of microorganism in rumen liquor
(Body, 1977).
This oral comunication, in accordance with the PhD thesis project previously described (Pelizzola, 2007), reports
the main results of the following activities :
A.3)Identification and characterization of the non volatile hydrocarbon fraction;
A.4)Interpretation of the data obtained by statistical analyses.
2.1 Cheese sampling
Cheese from lowland and highland origin were analyzed. The samples from lowland origin were collected
15
th
139
15
th
directly from companies producing commercial dairy products and were representative of different types of
production technology: hard cheese (3 samples of Grana Padano PDO, 4 samples of Asiago dAllevo PDO),
fresh and ripened pasta filata cheese (Mozzarella and Provolone, 2 and 3 samples respectively) and fresh soft
cheese (3 samples of Crescenza). Taking into account the ripening time of the different types of cheese, the
samples were collected at a time corresponding to the summer (July) milk production. Cows received a diet
composed of silage, grain and concentrate accounting for about 63%, 15% and 22% respectively.
Regarding the highland cheeses, the following traditional Italian cheeses were analysed: Asiago dallevo (48
samples), Toma Piemontese (48 samples) and Bitto PDO (17 samples). The cheeses were produced under
different technological and environmental conditions from local manufacturers on different days during the
month of July. Cows bred in the highland area grazed on pasture. For the production of Asiago dAllevo and
Bitto PDO the cows received no more than 3 kg/cow.day of concentrate. Asiago dAllevo and Toma Piemontese
cheeses were produced from milk of two groups of cows grazing on two different vegetation types: poor fescue
(Festuca rubra, Agrostis tenuis, Potentilla crantzii ) and rich fescue (Agrostis tenuis, Alchillea millefolium,
Trifolium repens, Festuca rubra) for Asiago dAllevo; alpine clover (Trifolium alpinum, Carex sempervirens)
and red fescue (Festuca nigrescens, Agrostis tenuis) for Toma Piemontese. Cheese samples were stored at 20
C until the analyses. The fat fraction of cheese samples was extracted according to Pelizzola (2008).

2.2 Liquid Chromatography (LC)
The hydrocarbon fraction was separated from the whole lipid matrix by column chromatography by using a glass
chromatographic column (40 cm length, 15 mm i.d.) containing 15 g of silica gel 60 extra pure (Merck,
Darmstadt, Germany), prepared as described by Mariani and Fedeli (1986).
400 mg of fat were dissolved in 1 mL of internal standard solution (squalane 0.02 mg mL
-1
n-hexane), and
loaded into the chromatographic column, as described by Pelizzola (2008).

2.3 Gas Chromatography-mass spectrometry (GC/MS)
The GC/MS analysis was performed on a TraceGC coupled with a TraceMS Plus mass spectrometer
(ThermoElectron Corporation) as described by Pelizzola (2008). The identification of the compounds was made
by using the NIST library (2001), the MS data of literature, the injection of authentic standards, when available,
and the comparison of the retention indices with published data. Quantitative determination of the compounds
was calculated by relating the peak abundance (TIC) to that of squalane and the amount was expressed as mg kg
-
1
of fat.
.

3.1 Hydrocarbon fraction of lowland and highland cheeses
Six main groups of compounds were detected in the samples analysed: linear hydrocarbons, fatty acid ethyl
esters, fatty acid methyl esters, isoprenoid hydrocarbons, cholesteryl esters and phytyl esters. In addition traces
of terpenes were also found. Figure 1 shows the GC/MS chromatograms of lowland (A) and highland (B) cheese
samples, whereas Table 1 reports the compounds detected and the type of recognition performed.
As expected, squalene was the most abundant compound. Together with squalene, linear, branched and the other
isoprenoid hydrocarbons (1-phytene, 2-phytene and neophytadiene) were detected, and this result was in
accordance with the findings of Flanagan and Ferretti (1973) and Urbach and Stark (1975) in dairy fat.
Peak n33 and 35 were identified as phytil esters of C16 and C18 fatty acids by using the NIST library, literature
data (Reiter and Lorbeer, 2001; Ischebeck et al., 2006) and synthesized phytyl esters (Povolo 2009). These
compounds, to our knowledge had never been detected in dairy products. Two reasonable hypotheses can be
formulated to explain the presence of these molecules in milk fat: direct transfer from grass, since they had been
detected in vegetable matrices (Reiter and Lorbeer, 2001), and/or endogenous (rumen or mammary cells)
esterification product between fatty acids and free (E)-phytol.
Among all the compounds detected 1-phytene, 2-phytene and neophytadiene were able to discriminate cheese
obtained from the mountain pastures from those produced in the plain, under an intensive breeding system.
Highland cheeses were characterized by higher amounts of these molecules than those of lowland origin and
differences between the two feeding systems were always statistically significant at a high level (p < 0.01). The
isoprenoid hydrocarbons were preferred to the phytyl ester, even if their amounts in highland cheeses were
higher than lowland products, because the latter could be increased by the presence of high amounts of free fatty
acids during the cheese ripening. Figure 2 reports the distribution of the values of 1-phytene, 2-phytene,
neophytadiene for each group of samples, as box plot chart. Each box indicates: the smallest observation, lower
quartile, mean, median, upper quartile and largest observation.
The relationship between the concentration of these compounds and the feeding system was demonstrated by
literature data, in different matrices. Urbach and Stark (1975) observed that the level of 1-phytene and
neophytadiene in butterfat decreased when the animal feeding changed from grass pasture to chopped lucerne
hay and concluded that the precursor of 1-phytene and neophytadiene was the neophytadiene present in the
15
th
140
15
th
pasture. Larick et al. (1987) observed similar results studying the hydrocarbon fraction of beef fat: feeding the
animals with forage produced a beef fat richer in diterpenoids than that obtained from a grain diet.

Figure 1 GC/MS profiles of the hydrocarbon fraction of lowland (A) and highland (B) cheeses. Peaks are numbered as in
Table 1. Boxes (C) and (D) show the enlarged views of the time range where the isoprenoid hydrocarbons elute
for the profiles (A) and (B) respectively.

12 16 20 24 28 32 36 40 44 48 52
Time (min)
B
1 3
2
4-5 6
7
8
9
10
15
16
17
19
20
21
22
28
30
27
26
25
24
23
18
29 IS
35
34
33
32
31
A
b
u
n
d
a
n
c
e
10
14
15
11
12
13
D
16,0 16,4
16,8
17,2
Time (min)
12 16 20 24 28 32 36 40 44 48 52
Time (min)
A
b
u
n
d
a
n
c
e
A
32
33
34
35
36
37
38
39
29
IS
30
31
28 26
23
22
25
19
21
20 17
18
12
4
6
7
8
9
10
16
16,0 16,4 16,8
Time (min)
11
10
C
12
13
15
14
17,2
10
12
13
15
14
15
10
12
13
15
14
11
12 16 20 24 28 32 36 40 44 48 52
Time (min)
B
1 3
2
4-5 6
7
8
9
10
15
16
17
19
20
21
22
28
30
27
26
25
24
23
18
29 IS
35
34
33
32
31
A
b
u
n
d
a
n
c
e
10
14
15
11
12
13
D
16,0 16,4
16,8
17,2
Time (min)
12 16 20 24 28 32 36 40 44 48 52
Time (min)
A
b
u
n
d
a
n
c
e
A
32
33
34
35
36
37
38
39
29
IS
30
31
28 26
23
22
25
19
21
20 17
18
12
4
6
7
8
9
10
16
16,0 16,4 16,8
Time (min)
11
10
C
12
13
15
14
17,2
10
12
13
15
14
15
10
12
13
15
14
11
15
th
141
15
th
Table 1 Compounds detected in the neutral lipid fraction of cheese fat.
Peak Compound (KI)
Identification
method
Peak Compound
Identification
method
Hydrocarbons Methyl esters
2 tetradecane MSa 9 methyl myristate (1727) Msa/PI
4 pentadecane MSa 17 methyl palmitate (1927) Msa/PI
7 hexadecane MSa 21 methyl stearate (2130) Msa/PI
8 heptadecane MSa Sesquiterpenes
12 octadecane MSa 3 !-cariophyllene (1426) Msa/PI
16 nonadecane MSa 5 unknown (1501)
20 heneicosane MSa Isoprenoid hydrocarbons
24 tricosane MSa 10 1-phytene (1790) MSr/PI
25 tetracosane MSa 13 phytane (1811) MSa
26 pentacosane MSa 14 neophytadiene (1842) MSr/PI
27 hexacosane MSa 15 2-phytene (1849) MSr/PI
28 heptacosane MSa 29 squalene (2857) MSa
30 nonacosane MSa Cholesteryl esters
31 hentriacontane MSa 32 cholesteryl butyrate MSa
Ethyl esters 34 cholesteryl hexanoate MSa
1 ethyl decanoate (1396) Msa/PI 36 cholesteryl octanoate MSa
6 ethyl laurate (1595) Msa/PI 37 cholesteryl decanoate MSa
11 ethyl myristate (1795) Msa/PI 38 cholesteryl laurate MSa
18 ethyl palmitoleate (1976) 39 cholesteryl myristate MSa
19 ethyl palmitate (1996) Msa/PI Phytyl esters
22 ethyl oleate (2172) PI 33 phytyl C16 MSa
23 ethyl stearate (2197) Msa/PI 35 phytyl C18 sat/unsat MSa
a
Confirmation of the identification: MSa = mass spectra of authentic compounds (authentic compounds had the same
Retention Indexes as the molecules detected in the samples); MSr = comparison with mass spectra reported in literature; PI =
Published Indexes, comparison of KI calculated with published indexes.

0
10
20
30
40
50
60
mean
median
1-phytene neophytadiene 2-phytene
L H
L H L H

Figure 2 Box-plot of 1-phytene, neophytadiene and 2-phytene of highland (H) and lowland (L) cheeses.
3.2 Discrimination of two productions of Asiago dAllevo and two productions of Toma Piemontese
produced from milk grazing on different pastures
The evaluation of the non volatile hydrocarbon fraction could be an interesting application able to discriminate
cheeses produced with milk obtained by cows grazing on different pasture types. The two facies types involved
in the two experimentations were: poor fescue (M) and rich fescue (P) for Asiago dAllevo; alpine clover (T) and
red fescue (F) for Toma Piemontese. The isoprenoid hydrocarbon compounds selected to differentiate between
lowland and highland cheeses were not able to discriminate the two groups of cheeses (M,P; T,F) either for
Asiago dAllevo or Toma Piemontese. Hence some ratio of isoprenoid hydrocarbons and n-alkanes have been
evaluated in order to discriminate the two groups of cheeses for each production. The ratio 1-phytene/2 phytene
allowed a good discrimination between the two groups of Asiago d'Allevo cheeses as shown in figure 3A. This
15
th
142
15
th
ratio presents values less or equal to 1 for facies M and higher to 1 for facies P. Instead the ratio n-nonacosane/n-
heptacosane (C29/C27) was chosen as index to discriminate the two productions of Toma Piemontese (figure
3B). In this case the discriminant value is equal to 1,3.
2007 2007 2008 2008
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P P
P
P
P
P
M
M
M
M
M
M
M M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
0.6
0.7
0.8
0.9
1
1.1
1.2
1.3
1.4
1.5
1.6
A
F
F
F
F
F
F
F
F
F
F
F
F
F
FF
F
FF F
F
F FF
F
T
T
T
T
T
T
T
T
T
T
T
T
T
T
T
T
T
T
T
T
TT
T
T
0,40
0,70
1,00
1,30
1,60
1,90
2,20
2,50
2007 2007 2008 2008
B

Figure 3 Discrimination between two different productions of Asiago dAllevo (A) and Toma Piemontese
(B)
Several authors have proposed the volatile terpenes, aliphatic compounds originating from the secondary
metabolism of plants, as markers for tracing mountain cheeses and able to differentiate them from lowland
cheeses. The analysis of volatile compounds is a complex problem due to the chemical physical characteristics of
the analytes and quantitative data are often very difficult to be obtained. In this research a novel approach,
consisting of the evaluation of the non-volatile minor components of the neutral lipid fraction, seems to be a
promising tool for the distinction of dairy products according to different animal feeding systems.
8. References
Body DR (1977) Characterization of bovine rumen liquor isoprenoid hydrocarbons with reference to dietary phytol, Lipids,
12: 204-207.
Bosset J O, Btikofer U, Gauch R, Sieber R (1994) Caractrisation de fromages dalpages subalpins suisses: mise en
vidence par GC/MS de terpnes et d'hydrocarbures aliphatiques lors de lanalyse par Purge and Trap des armes
volatils de ces fromages, Schweiz. Milchwirt. Forsch., 23: 37-41.
Cerbulis J, Flanagan VP, Farrell HM (1985) Composition of the hydrocarbon fraction of goats milk, J. Lipid Res., 26: 1438-
1443.
De la Fuente M A, Juarez M (2005) Authenticity assessment of dairy products, Crit. Rev. Food Sci. Nutr., 45: 563-585.
De Noni I, Battelli G Terpenes and fatty acid profiles of milk fat and Bitto cheese as affected by transhumance of cows on
different mountain pastures (2008) Food Chem., 109: 299-309.
Flanagan V P, Ferretti A, Schwartz D P, Ruth J M (1975) Characterization of two steroidal ketones and two isoprenoid
alcohols in dairy products, J. Lipid Res., 16: 97-101.
Flanagan VP, Ferretti A (1973) Hydrocarbons and polychlorinated buphenyls from the unsaponifiable fraction of anhydrous
milk fat, J. Lipid Res., 14: 306-311.
Ischebeck T., Zbierzak, A. M., Kanwischer, M., Drmann, P. (2006) A salvage pathway for phytol metabolism in
Arabidopsis. J. Biological Sci., 281 (5): 2470-2477.
Keli A., Mayes R. W., De Vega A. (2008) In vitro studies of the metabolism of [
14
C]-n-alkanes using ruminal fluid of sheep
as substrate, Animal, 2:12, 1748-1752.
Larick, D. K., Hedrick H. B., Bailey M. E., Williams J. E., Hancock D. L., Garner G. B., Morrow R. E. (1987) Flavor
constituents of beef as influenced by forage- and grain-feeding. J. Food Sci., 52 (2): 245-251.
Mariani C, Fedeli E (1986) Individuazione di oli di estrazione in quelli di pressione. Nota 1, Riv. Ital. Sostanze Grasse, 63: 3-
18.
Pelizzola V (2007) Traceability of mountain cheeses: identification and characterization of volatile and not volatile lipophylic
compounds, In Proc.s of the Workshop on the Developments in the Italian PhD research on food science technology
and biotechnology, Reggio Calabria (Italy), 12-14 settembre, 2007.
Pelizzola V (2008) Study on the non-volatile hydrocarbon fraction of lowland and highland dairy products, In Proc.s of the
Workshop on the Developments in the Italian PhD research on food science technology and biotechnology, Alba
(Italy), 10-12 settembre 2008, pp 430-431.
Povolo M, Pelizzola V, Ravera D, Contarini G (2009) Significance of the nonvolatile minor compounds of the neutral lipid
fraction as markers of the origino of dairy products, J. Agric. Food Chem., 57: 7387-7394.
Reiter B, Lorbeer E (2001) Analysis of the wax ester fraction of olive oil and sunflower oil by gas chromatography and gas
chromatography-mass spectrometry, J. Am. Oil Chem. Soc., 78 (9): 881-888.
Schlichtherle-Cerny H., Imhof M, Fernandez-Garcia E, Bosset J. O (2004) Changes in terpene composition from pasture to
cheese, Mitt. Lebensm. Hyg, 95: 681-688.
Urbach G, Stark W (1975) The C-20 Hydrocarbons of Butterfat, J. Agr. Food Chem., 23: 20-2
15
th
143
15
th
Characterization of volatile substances in wines obtained from Piedmont
grape varieties. The effect of different winemaking techniques on
norisoprenoids content.
Maurizio Petrozziello(maurizio.petrozziello@unito.it)
CRA-Centro di Ricerca per lEnologia, Asti/ DIVAPRA, Universit degli studi di Torino, Italy
Tutor: Antonella Bosso, Vincenzo Gerbi.

The aim of this work was the assessment of the effect of some winemaking techniques on the content of aromatic
substances in wines derived from Albarossa and Cornarea grapes. The reported results are part of a more
extensive investigation about wines derived from typical Piedmont grapes, whose compositive peculiarities have
been explored. Here are presented the results about two trials carried out during 2008 and 2009 vintages on the
effect of pre-fermentative cold maceration and post-fermentative hot maceration techniques, focused on the !-
ionone and !-damascenone content and evolution in wines.
Caratterizzazione delle sostanze volatili di vini ottenuti da vitigni piemontesi. L'effetto di
alcune tecniche di vinificazione sul contenuto in norisoprenoidi.
Lo scopo di questo lavoro la valutazione degli effetti di differenti tecniche di vinificazione sul contenuto di
sostanze aromatiche nei vini provenienti da uve Albarossa e Cornarea. I risultati riportati fanno parte di
un'indagine pi ampia riguardante lo studio delle peculiarit compositive di vini ottenuti da uve tipiche
piemontesi. Qui sono presentati i risultati di due sperimentazioni svolte nel corso delle vendemmie 2008 e del
2009 focalizzate sull'effetto della macerazione prefermentativa a freddo e sulla macerazione postfermentativa a
caldo sul contenuto e sullevoluzione di !-ionone e !-damascenone.
1. Introduction
Wine sensory quality is directly dependent on aroma composition. Several hundreds of odorous molecules have
been identified in wines, but only a small portion of them can change in a powerful and recognizable way the
aromatic profile of wines. This characteristic depends both on the absolute concentration of a substance in wine
and on its perception threshold; besides, wine macromolecular composition can directly influence the volatility
of these compounds. Norisoprenoids are a large group of molecules derived from carotenoids breakdown. Some
of them, with a basic structure of 13 carbon atoms, are strong aromas with an important impact on the smell of
many foods. Two of them, in particular, are very important, especially in young red wines: !-damascenone and
!-ionone. These molecules have a pleasant aroma and can give expression and originality to the wines due to
their very low perception threshold (2 and 7 ng L
-1
respectively, determined in water). They are present in
relative large amounts in non-floral grapes and can positively influence the aroma of wines coming from these
varieties both directly, with their own typical odor, or indirectly as fruity aroma enhancer (Escudero A. et al.
2007, Pineau B. et al. 2007). Their concentration in wine depends both on the variety (Kotseridis et al 1999a,
Kotseridis et al 1999b) and on the winemaking technology (Silva Ferreira et al, 2003). The first aim of this work
was the assessment of the effect of some different maceration techniques on the concentration of these
compounds in wines. Our interest was also focused on wines obtained from minor varieties, whose peculiarities
should arise not only from their rarity but also from their chemical and physical composition. This is the case of
Albarossa and Cornarea, two red varieties obtained by Giovanni Dalmasso in the Thirties by crossing Chatus or
Nebbiolo di Dronero with Barbera (Mannini et al., 2004). They proved to be varieties with good agronomic and
enological aptitudes; therefore they were included in 1977 in the Catalogo Nazionale delle Variet di Vite. In
2001 Albarossa was included in the list of cultivable varieties in Piedmont. Cornarea was included in the same
list in 2004. These two grape varieties, in spite of their genetic affinity, have a very different aroma composition
and high norisoprenoids content (Petrozziello, 2009).
2 Materials and Methods
2.1 Samples and vinification
The trials were carried out during 2008 and 2009 vintages. Vitis vinifera var. Albarossa and Cornarea grapes
were picked up manually in the vineyards of the Centro Sperimentale Tenuta Cannona (Carpeneto, AL).
On the same day the grapes were carried to the CRA-Centro di Ricerca per lEnologia, split up in three
homogeneous lots, and finally crushed. All fermentations were conducted in 300L thermo-conditioned tanks
provided from Parsec Srl (Sesto Fiorentino, Firenze, Italy), the temperature was controlled by SAEn5000
software. For each experiment 200 kg of grapes were used.
15
th
144
15
th
Control (C): grapes were crushed and destemmed, the must was treated with SO
2
(5 g/hL of potassium
metabisulphite) and fermented using a Saccharomyces cerevisiae inoculum (20 g/L of active dry yeast). From
this moment on, two punch-downs without air per day were done. After having reached 6% alcohol, two
pumping-overs with air per day were carried out. The temperature of fermentation was then kept at 28C until
the end of fermentation. The wine was racked off when the total concentration of reducing sugars was < 2 g/L.
Pre-fermentative Cold Maceration (CM): grapes were crushed, destemmed and added with SO
2
(5 g/hL of
potassium metabisulphite). The must was kept at 4C for 18-20 hours, then was heated up to 28C; from this
moment on, and until the end of fermentation, the protocol was the same as for thesis C.
Post-fermentative Hot Maceration (HM): the protocol was the same as for thesis C until the end of alcoholic
fermentation. When reducing sugars were completely fermented, 10 mg L
-1
of SO
2
were added to the wine, the
tank was hermetically closed and the temperature was increased up to 40C for 24 h. The day after, the
temperature was reduced at 25C, the tank was opened and the wine racked off.
The length of the maceration was 15 days for all the treatments. After racking off, the wines were racked twice
before the malo-lactic fermentation (MLF). At the end of MLF all wines were racked again, added of SO
2
(50
mg L
-1
of potassium metabisulphite), and stored at 4C for one month in stainless steel tanks. Finally, the wines
were clarified with albumin (20 g/hL), filtered and bottled.
The pomace was pressed in a Willmes pneumatic press (sigma 260 kg capacity) under a pressure of 0,5 bar; the
resulting wine was analyzed and finally blended to the free-run wine.

2.2 Wine and must Analysis
Musts were analyzed after crushing and pH, Brix, titratable acidity and density were determined.
Wines were analyzed at racking off, after MLF and after 6 month of storage. The following parameters were
determined:
Polyphenolic composition total anthocyanins, monomer anthocyanins, total flavonoids,
proanthocyanidins, flavans reactive to vanillin.
Color: E
420
+ E
520
(intensity), E
420
/E
520
(hue).
Free volatile compounds, namely !-ionone, !-ionone and !-damascenone.

2.3 Analysis of free volatile compounds
The analyses were carried out at crushing, before heating (only for HM theses), at racking off, on the press wine
and, finally, on the wine after 6 months of aging.
SPE extraction . 30 mL of wine were diluted 3-fold and added of 300 L of 1-heptanol (51.43 mg L
-1
) and 30 L
of 3,4-dimethylphenol (43.64 mg L
-1
) as internal standards; the mixture was loaded onto a reversed-phase C18
EC cartridge, 1 g (Biotage AB, Uppsala, Sweden) previously activated with 5 mL of methanol and 5 mL of
water (obtained from a MilliQ purification system, Millipore Bedford, MA, USA). After sample application the
cartridge was washed with 5 mL of water and the free volatile substances were eluted by 6 mL of
dichloromethane HPLC grade. The organic phase was dried with the addition of anhydrous sodium sulphate,
concentrated about 50-fold by evaporation, and analyzed by GC-MS.
GC-MS analysis. GC-MS analysis was carried out by an Agilent 6890 Series gas chromatograph equipped with
an Agilent 5973N Mass Selective Detector (MSD). The samples (2L of extract) were manually injected in the
split-splitless injector set at 250C in splitless mode. The analysis was performed using a HP-INNOWAX,
polyethylene glycol, 30m, 250 "m, 0.25 "m. The oven temperature was held at 45C for 2 min, then raised to
60C at a rate of 30C min
-1
, from 60 to 230C at a rate of 2C min
-1
, and held at 230C for 20 min. The carrier
gas was Helium with a constant flow of 1mL min
-1
. The transfer line was set at 230C. Ionization voltage was 70
eV, the quadrupole was set at 230C and the source at 300C. The acquisition of mass spectra for the analysis of
free compounds was carried out in total ion current mode (TIC) and a 29-300 m/z range was recorded. The
acquisition for the quantitative determination of !-damascenone #-ionone and "-ionone was simultaneously
performed in Single Ion Monitoring mode (SIM) using 100s of dwell time for all the ions. Quantifier ion for !-
damascenone was m/z 121, and qualifier ions 190 and 175 m/z; quantifier ion for !-ionone was 121 m/z, and
qualifier ion 136 and 175 m/z; quantifier ion for !-ionone was 177 m/z, and qualifier ion 192 m/z. All
compounds were identified comparing recorded mass spectra with those of the Wiley database and retention
index with those of an authentic standard, where available. Standards were purchased from Sigma-Aldrich at the
maximum available grade of purity. !-damascenone was kindly provided from Firmenech (Genve,
Switzerland). Statistical Analysis were carried out using SPSS (SPSS Inc., Chicago, IL) for Windows, version
15.0. All the analyses were done in duplicate.
3 Results and discussion
3.1 Chemical-physical composition of Albarossa e Cornarea musts.
Table1 reports the average must composition for Cornarea and Albarossa. Titratable acidity, pH, reducing sugars
and density were quantified. In 2008 Cornarea reached a low ripeness degree (higher total acidity and lower
sugar concentration), therefore the must in this experiment was supplemented with 35 g L
-1
of saccharose. On the
15
th
145
15
th
contrary, Albarossa reached good sugar content in both years and no corrective treatments were required (table
1). In 2009 both Cornarea and Albarossa reached a better ripeness degree, but grapes were partially infected by
Botritys cinerea.
Table 1: Average composition of musts at crushing

3.2 Wine aroma composition, 2008 vintage.
In 2008, at racking off, wine aroma analysis was carried out only for the control and hot post-macerated thesis.
Albarossa and Cornarea wines showed a well distinct aromatic profile. In particular, Cornarea had a greater
content in benzenoid compounds (namely vanillin, tyrosol, ethylvanillate and benzoic acid) than Albarossa
wines; moreover, Cornarea showed a higher concentration of ethyl esters of short and medium chain fatty acids
(data not reported). Statistical significant differences in norisoprenoids content between Albarossa and Cornarea
wines were observed (table 2). The content of !-ionone in Albarossa was higher than in Cornarea, and in both
wines the concentration of this molecule is several times higher than its threshold in water (OAV>60). Cornarea
wines showed higher concentrations of !-damascenone. No differences in norisoprenoids content due to the
winemaking technique were observed.
Table 2: Concentrations of norisoprenoids at racking off in 2008. The OAVs reported (odor activity value) were calculated
as a ratio between concentration and odor threshold in water (data reported in literature, Kotseridis et al 1999).
!-damascenone (g L
-1
) OAV #-ionone (ng L
-1
) OAV !-ionone (ngL
-1
) OAV
C 2.710.015 1355 1458.16 0,363 45111.6 64,4
Albarossa
HM 2.450.116 1225 1433.47 0,358 42412.1 60,6
C 3.960.249 1980 1259.53 0,313 30714.1 43,9
Cornarea
HM 3.850.772 1925 1224.01 0,305 29610.8 42,3

3.3 Wine aroma composition, 2009 vintage.
Table 3 reports some of the volatile compounds determined at racking off in 2009 vintage (in total, 57
compounds were identified), together with their average concentration. The differences between the wines
observed in 2008 vintage were confirmed. As regards 2009, Cornarea showed clearly a higher concentration in
benzylic compounds (ethyl vanillate and benzylic alcohol), in C6 alcohols derived from lipid oxidation (hexanol,
trans-3-hexenol), as well as in methionol, geranic acid, isobutyric acid, 3-hydroxy-4-phenyl-2-butanone and 4-
methyl-1-pentanol. As in 2008 vintage, benzaldehyde, farnesol and decanoic acid were again more concentrated
in Albarossa than in Cornarea. As regards norisoprenoid compounds, Cornarea confirmed to have a higher
content in !-damascenone (2294-2892 ng L
-1
), while no significant differences in !-ionone content between the
cultivars were found.

3.4 Effect of maceration techniques on wine aroma composition at racking off.
At racking off the wines didnt show any significant difference in trans-3-hexenol, trans-2-hexenol, cis-3-
hexenol content. In contrast with some previous results (Bosso, data not published) the content of 1-hexanol was
higher in MC wines than in controls. This difference may be explained by the different way to carry out the cold
maceration technique (with or without dry ice). Statistically significant differences among the theses were
noticed for the following compounds: 4-methylpentanol, ethyl octanoate, benzaldehyde, N-acethylglicine ethyl
ester and monoethylsuccinate. The lower varietal aroma content in CM wines could be explained by a worse
extraction from the grape skins, confirmed by the lower content of many compounds like vanillin, !-ionone,
linalool, farnesol, zingerone and !-damascenone (not statistically significant differences). Moreover, the lower
concentration in monoethyl succinate could be due to the slowdown of the evolution reactions caused by the
lower temperature during the first day of maceration. This hypothesis was confirmed by the lower concentrations
of #-terpineol (data not reported) and diethylsuccinate measured in CM, although these differences are not
statistically significant. The overall composition of wines did not show big differences between control and hot
post-macerated theses; however, a statistically significant decrease of the more volatile compounds was
observed, namely for: isoamylacetate, hexylacetate, 4-methyl-1-pentanol, 3-methyl-1pentanol. HM theses
showed clearly a greater concentration in monoethylsuccinate, and this agreed with the observed higher
evolution of these wines. It is interesting to point out the effect of HM on the !-ionone content both in Albarossa
and Cornarea. Unlike what we observed in 2008, the HM technique seemed to play a positive role on the
concentration of these compounds in wines; this difference, besides, was confirmed 6 months later.
Harvest date 16/10/2008 20/10/2009
Cornarea Albarossa Cornarea Albarossa
pH 2,87 2,90 3,11 3,13
Tot. ac. (g L
-1
) 12,9 9,9 7,8 6,4
density 1,082 1,108 1,101 1,113
Bx 19,0 24,9 23,2 26,2
15
th
146
15
th

3.5 Evolution of norisoprenoids content during aging
Table 4 reports the trend of the norisoprenoids content through maceration and aging of Albarossa wines. !-
ionone concentration tended to decrease in all theses, starting from the racking off. Both in Albarossa and in
Cornarea, the concentration of !-ionone in the free-run wine was higher in HM than in C and CM. Surprisingly,
!-damascenone content tended to increase (with a rate of about 140 ng per month) during aging: this was in
contrast both with some results reported in literature (Silva, Ferreira et al. 2003) and with our experience (Bosso
et al. 2009) and could suggest the presence of a great amount of varietal precursors in these wines. Figure 1
reports the content of !-damascenone and !-ionone in free-run and press wines in 2009. In all cases, the amount
of norisoprenoids in free-run wines was higher than in the press ones. More important differences between the
two wines were observed as regards !-damascenone.
Table 3: Volatile compounds quantified in Albarossa and Cornarea wines at racking off (2009 vintage). All the
concentrations are expressed in g L
-1
.
a
Retention Index are calculated in a polar column.
b
n.s. ANOVA= not significant.

* =
ANOVA, p ! 0.05.

** = ANOVA, p ! 0.01 *** = ANOVA, p ! 0.001.

Means with the same letter do not differ significantly
by Tukeys test (p < 0,05).
c
Interaction between the factors maceration and variety.
Maceration Effect Varietal Effect Int
c
RI
a
COMPOUNDS Sig.
b
C CM HM Sig. A C Sig.
-- isoamyl acetate ** 576b

577b 515a *** 412 700 **
1230 ethyl hexanoate ** 98.9a 123.4b 98.6a ** 95.1 119.5 **
1263 hexyl acetate *** 3.18b 4.42b 3.08a *** 1.89 5.23 **
1304 4-methyl-1-pentanol ** 33.6b 26.9a 29.4a *** 26.4 33.5 ns
1315 3-methyl-1-pentanol ** 70.1b 68.9b 64.9a *** 60.9 74.9 ***
1334 ethyl lactate ns 31.5 31.8 31.6 *** 40.0 23.3 **
1345 hexanol * 669a 758b 695a *** 576 839 ns
1356 trans-3-hexenol ns 23.9 21.6 20.1 *** 14.7 29.0 ns
1379 cis-3-hexenol ns 8.24 7.82 7.8 *** 9.0 6.9 ns
1414 trans-2-hexenol ns 3.0 2.7 2.9 *** 2.17 3.65 *
1432 ethyl octanoate * 77.3ab 81.0b 60.7a ns 75.0 71.0 ns
1512 benzaldheyde ** 5.96ab 5.20a 8.00b ** 7.65 5.12 ns
1547 linalool ** 10.7b 8.71a 10.9b ** 9.48 10.77 *
1555 1-octanol *** 20.2c 16.0c 17.7b *** 13.0 22.9 ***
1571 isobutyric acid ns 30.2 30.7 30.3 ** 28.0 35.5 ns
1605 terpin-4-ol ns 5.5 4.6 4.6 *** 2.12 7.70 *
1619 ethyl-2-furoate *** 4.24b 3.54c 4.89a ns 2.1 7.7 *
1673 isovaleric acid ns 185 183 175 *** 162 200 *
1711 methionol ns 67.8 67.0 70.1 * 63.9 72.7 ns
1849 hexanoic acid ** 636a 843b 709a ** 810 650 *
1871 benzylic alcohol ns 8.23 7.8 9.1 ** 5.45 11.33 ns
1968 trans-2-hexanoic acid ** 13.2a 24.2b 14.4a * 15.8 19.5 **
2154 N-acetylglycine ethyl ester ** 12.62a 13.29a 9.94b *** 14.0 9.8 ns
2187 4-vinylguaiacol ns 41.9 40.3 36.3 *** 27.5 51.5 *
2245 3-hydroxy-4-phenyl-2-butanone ns 38.5 31.4 32.6 *** 27.7 40.6 ns
2264 ethyl-2-hydroxy-3-phenylpropanoate ** 225b 191a 231b *** 196 236 **
2278 decanoic acid ns 184 204 206 ** 217 179 ns
2341 geranic acid ns 72.1 68.8 70.0 ** 63.2 77.4 ns
2356 farnesol ns 15.7 14.1 14.8 * 18.2 11.6 ns
2388 monoethylsuccinate ** 380b 322a 405b ns 366 372 ns
2426 benzoic acid *** 6.89a 9.98a 32.26b *** 6.7 26.0 ***
2558 vanillin *** 2.85b 2.04a 2.84b ** 2.31 2.84 **
2603 methylvanillate ** 43.6b 39.55b 29.28a *** 19.3 42.2 *
2632 ethyl vanillate ns 201 175 200 *** 73.4 310.5 ns
These data show clear differences between these cultivars in the content of volatile compounds. The results,
confirmed that the cultivar has a strong influence on the effectiveness of different maceration techniques on the
content in wine volatile compounds. Although it is not possible to point out any univocal effect in different
vintages, it appears clear that the technology employed could have a crucial role in determining the evolution
and the concentration of some aroma compounds. This is the case of !-ionone, in fact its concentration seems to
be higher in hot post-macerated 2009 wines. However, it is necessary to remember that the warming of the wine,
15
th
147
15
th
when not fully controlled, can lead to losses of the more volatile compounds, and this could explain some
differences between 2008 and 2009 vintages.
As regards crio-macerated wines, the analysis of volatile compounds at racking off, during 2009 vintage,
revealed a higher content in ethyl esters (namely ethyl octanoate and ethyl hexanoate in Cornarea) and hexanol;
furthermore, an overall decrease in varietal aromas extraction was pointed out.
Damascenone concentration tends to increase during aging for Albarossa and Cornarea wines. Given the
complexity of the reactions leading to the formation and degradation of this molecule in wine, as well as the
importance of aromatic norisoprenoids, more researches about the phenomena that lead to their extraction from
grapes, and their transformation in wines, are needed.
Table 4: Norisoprenoids content (ng L
-1
) in wines between crushing and 6 months of aging.

b
e
f
o
r
e

H
M

r
a
c
k
i
n
g

o
f
f

6

m
o
n
t
h
s

l
a
t
e
r

b
e
f
o
r
e

H
M

r
a
c
k
i
n
g

o
f
f

6

m
o
n
t
h
s

l
a
t
e
r

b
e
f
o
r
e

H
M

r
a
c
k
i
n
g

o
f
f

6

m
o
n
t
h
s

l
a
t
e
r

HM 17335 1705222 2677279 1391 8018.0 1163.4 3126.6 2526.4 22815.8
CM 176930 1635132 250753 1210.7 789.3 1003.4 27110.8 2035.7 1772.4
C 177582 193975 2661299 12810.7 690 1180 25516.3 2082.7 19314.9
Av.
!
-
d
a
m
a
s
c

175941 1760156 2615193
#
-
i
o
n
o
n
e

1297.4 7610.7 1116.6
!
-
i
o
n
o
n
e

27920.9 22117.3 19919.3

0
50
100
150
200
250
300
HM CM C
_-ionone

0
500
1000
1500
2000
2500
HM CM C
_-damascenone

Figure 1: mean content of "-damascenone and "-ionone in free-run and press Albarossa wines, 2009 vintage
5. References
Bosso A, Panero L, Guaita M, Petrozziello M,(2008). La tecnica della macerazione prefermentativa a freddo con
neve carbonica nella vinificazione in rosso di alcune cultivar italiane. In Proc.s of XXX OIV world
congress Budapest (Hungary) 10-16 June 2007.
Escudero A, Campo E, Faria L, Cacho J, Ferreira V (2007) Analytical Characterization of the Aroma of Five
Premium Red Wines. Insights into the Role of Odor Families and the Concept of Fruitiness of Wines J.
Agric. Food Chem. 55 (11): 4501-10.
Kotseridis Y, Baumes R, Bertrand A, Skouroumonis K. (1999a) Quantitative determination of -ionone in red
wines and grapes of Bordeaux using a stable isotope dilution assay. J. Chromatogr. A, 848: 317-325.
Kotseridis Y, Baumes R, Bertrand A, Skouroumonis K. (1999b) Quantitative determination of free an
hydrolytically liberated -damascenone in red grapes and wines using a stable isotope dilution assay. J.
Chromatogr. A, 849: 245-254.
Mannini F, Rolle L, Gerbi V, Zeppa G, Boccacci P (2004) Caratterizzazione genetica e fenolica degli incroci
Albarossa e Cornarea (Vitis vinifera L.). Vignevini, 31(11): 123-127
Petrozziello M. (2008). Study of varietal aroma compounds in wines made from non-floral Italian grapes.
Influence of the vinification techniques. In Proc.s of the 13
th
Workshop on the Developments in the
Italian PhD Research in Food Science, Technology & Biotechnology, Alba (Italy), 12-15 September,
2008 pp
Pineau B, Barbe JC, Van Leeuwen C, Dubourdieu D (2007) Which impact for beta-damascenone on red wines
aroma? J. Agric Food Chem. 55(10):4103-8.
Silva Ferreira AC, Guedes de Pinho P, Nor-isoprenoids profile during port wine ageing--influence of some
technological parameters (2003) Analytica Chimica Acta, 513(1): pp 169-176. Papers presented at the 3
rd

Symposium In Vino Analytica Scientia Aveiro (Portugal), 10-12 July 200
15
th
148
15
th
Mitigation strategies of heat-induced toxic molecules in foods: the case of
furfurals removal from roasted coffee by vacuum treatment
Barbara Quarta (barbara.quarta@uniud.it)
Dept. Food Science, University of Udine, Italy
Tutor: Prof. Monica Anese

This PhD thesis deals with the identification and development of potential strategies able to reduce the levels of
heat-induced toxic molecules, i.e. acrylamide and furfurals, in foods. Among these, one possible process
intervention is represented by the employment of the vacuum technology. In particular, the physical removal of
furfurals (e.g. 5-hydroxymethylfurfural and furfural) from roasted coffee by means of vacuum treatments has
been studied.
Strategie di mitigazione di sostanze tossiche indotte dai trattamenti termici negli
alimenti: il caso della rimozione di furfurali da caff tostato attraverso trattamento sotto
vuoto
Questa tesi di dottorato ha riguardato lidentificazione e lo sviluppo di potenziali strategie efficaci nel ridurre i
livelli di molecole tossiche, quali acrilammide e furfurali, che si formano negli alimenti in seguito a trattamenti
termici. Tra questi, uno dei possibili interventi di processo rappresentato dallimpiego della tecnologia del
vuoto. In particolare, stata studiata la rimozione fisica di furfurali (5-idrossimetilfurfurale e furfurale) da caff
tostato, tramite lapplicazione di trattamenti sotto vuoto.

Key words: HMF; furfural; roasted coffee; vacuum treatments.
1. Introduction
As is known, heat-based processes may be responsible for the formation of toxic molecules in foods, such as
acrylamide and furfurals, e.g. 5-hydroxymethylfurfural (HMF) and furfural. Due to their potential cancerogenity
for humans (IARC, 1994; IARC 1995) efforts have been carried out to develop strategies able to reduce the
formation of these molecules in foods. The research carried out within this PhD thesis was focused on the study
of different technological interventions that can be potentially exploited to reduce acrylamide, HMF and furfural
content in foods. These include physical and biological pre-treatments (i.e low temperature-long time heating of
wheat flour; use of asparaginase in biscuit dough), formulation changes (i.e. addition of salts to biscuit
formulation; substitution of the lipid fraction with monoglyceride-oil-water gel), process interventions. In
particular, the latter consisted of the application of vacuum treatments for HMF and furfural removal. In fact,
previous studies demonstrated that this strategy can represent a tool for removing acrylamide from finished foods
by exploiting its physico-chemical properties (Zhaoyang, 2003; Anese et al., 2010).
HMF and furfural, furans with oxygenated substituents, are present in a large variety of foods obtained at the
industrial level or during domestic preparations, among which are honey, dried fruits, cereal derivatives, fruit
juices, milk and coffee (Morales, 2009). They are generated under heating by reducing sugar caramelization,
which undergoes 1-2 enolization, dehydration and cyclization reactions, or by Maillard reaction (Friedman,
1996; Kroh, 1994). Furfurals occur in the volatile fraction of all heated foods and, for years, HMF has been
considered a quality indicator of excessive thermal treatment. HMF and related substances are suspected to have
genotoxic and mutagenic effects (EFSA, 2005). In vitro HMF can be bioactivated becoming the mutagenic 5-
sulphoxymethylfurfural (Surh and Tannenbaum, 1994) and promote colon cancer in rats. However, at present,
neither chronic carcinogenic studies nor epidemiological data on potential association of HMF with cancer risk
in humans are available (Lee and Shibamoto, 2002; Glatt and Sommer, 2006).
With regard to the applicability of strategies, able to reduce furfurals presence in foods, different aspects have to
be considered. Firstly, due to the ubiquitous character of HMF and furfural and their importance in influencing
the flavour of heat-treated foods (Maga, 1979), it is very difficult to reduce their content without affecting the
sensory properties of foods. Moreover, the efficacy of the vacuum treatment was greatly affected by the food
matrix and water content.
The aim of this study was to investigate the possibility to apply vacuum treatments in order to remove HMF and
furfural from roasted coffee, by exploiting their high volatility. In particular, the efficacy of the vacuum
treatments was initially studied on HMF and furfural model solutions. Afterwards different combinations of
pressure and time were considered in order to find optimal conditions for furfurals removal from coffee. This
matrix was chosen for its high furfurals content.
15
th
149
15
th
0
10
20
30
40
50
60
70
80
90
100
0 2 4 6 8 10
Time (min)
R
e
m
o
v
a
l

(
%
)
HMF
furfural
Weighed Petri dishes containing 5 g of 4.4x10
-4
M HMF solution (Sigma-Aldrich, Milano, Italy) or 5 g of
8.4x10
-4
M furfural solution (Fluka, Milano, Italy) were treated under vacuum.
Both commercial anhydrous coffee and previously hydrated coffee samples were also subjected to the vacuum
treatment. To obtain hydrated samples, weighed Petri dishes containing 4 g of ground roasted coffee were
introduced in vacuum desiccators saturated with water vapour and left at ambient temperature to hydrate until
they reached a water activity value of around 0.7. After hydration, samples were subjected to the low pressure
treatments. The kinetics of furfurals release from hydrated coffee were evaluated also at ambient pressure. Also
in this case the ground coffee samples were left to hydrate in the presence of water vapours as described above.
At regular interval times up to 24 h the samples were weighed and analysed for furfurals content.
Vacuum treatments were carried out by using an apparatus consisting of an oven (5Pascal, VS-25 SC, Trezzano
S/N, Milano, Italy), connected to a rotary vacuum pump (BOC Edwards, E2M40, Crawley, West Sussex, UK)
able to achieve a pressure of 0.001

Torr in few seconds. The samples, previously weighed in Petri dishes, were
introduced into the oven once the desired temperature was reached. Afterwards, the rotary pump was
immediately switched on. The computation of treatment duration started once the set pressure value was
achieved. The model solutions were treated at 20 Torr up to 9 min. The coffee samples were treated at pressure
values ranging from 5 Torr to 140 Torr for 10 min, or at 5 Torr and 20 Torr up to 30 min and 9 min, respectively.
The hydrated samples were vacuum treated at 20 Torr and 100 Torr up to 15 min and 120 min, respectively. All
the treatments were carried out at a constant temperature of 60 C.
HMF and furfural determinations were carried out by liquid chromatography analysis according to the method of
Garca-Villanova et al. (1993) slightly modified. Water activity (a
w
) was determined by means of a dew-point
measuring instrument (AQUA LAB, Decagon, Pullman, WA, USA) at 25 C. Total solid content was
determined by gravimetric method (AOAC, 1995). HMF and furfural concentrations were determined by means
of mass balance calculations because during the ambient pressure hydration process, as well as the vacuum
treatments, not only their level but also the water content may change. Concerning the statistical analysis, the
results reported here are the average of at least three measurements on two replicated sets of experiments.
Coefficients of variation, expressed as the percentage ratio between the standard deviations and the mean values,
were lower than 12 and 15 for HMF and furfural analyses, 10 for water content and activity determinations. One-
way analysis of variance was carried out and differences among means were assessed by using the Tukey test
(STATISTICA for Windows, 5.1, Statsoft Inc., Cary, NC, USA). Means were considered significantly different
at P<0.05.
The influence of vacuum treatments on HMF and furfural removal was first studied on aqueous model solutions.
Figure 1 shows the percentage of HMF and furfural removal from HMF and furfural model solutions subjected
to a treatment at 20 Torr and 60 C as a function of time. It is possible to observe that the treatment was effective
in reducing the level of the toxic molecules. In particular, the removal of furfural was much higher than that of
HMF, probably because of its lower molecular weight. In fact, the molecular weights of HMF and furfural are
126 Da and 96 Da respectively and, as is known, the higher the molecular weight, the lower the extent of
removal (Goubet et al., 1998). As a consequence furfural could evaporate faster than HMF.

Figure 1 Percentage of HMF and furfural removal from HMF and furfural aqueous solutions subjected to a treatment at 20
Torr as a function of time

In order to verify if the vacuum process could favour HMF and furfural removal also from a real food system, a
complex matrix such as coffee was examined. Table 1 reports the HMF and furfural concentrations of coffee
samples subjected to a vacuum treatment at 20 Torr for increasing lengths of time. As can be noted, the
15
th
150
15
th
0
10
20
30
40
50
60
70
80
90
100
0 5 10 15 20 25
Time (h)
R
e
m
o
v
a
l

(
%
)
HMF
furfural
concentration of the two toxic molecules did not significantly change compared to the control, indicating that the
vacuum treatment may not have been effective on coffee. Table 2 shows HMF and furfural concentrations in
coffee samples subjected to the treatments at different pressure values (from 5 Torr to 140 Torr) for 10 min. Also
in this case neither HMF nor furfural concentration significantly changed. The same result was obtained also by
carrying out the vacuum treatment at a lower pressure (5 Torr) for prolonged time (30 min) (data not shown).
These results are in agreement with those of Anese et al. (2010), who studied the effect of vacuum treatments on
acrylamide removal from potato and cereal derivatives.

Table 1 HMF and furfural concentrations in coffee Table 2 HMF and furfural concentrations in coffee samples
samples subjected to vacuum treatment at 20 Torr subjected to different vacuum treatments at 60 C for 10 min
at 60 C up to 9 min

Data are the mean of at least three repetitions made on two
replicated sets of experiments sd
Data are the mean of at least five repetitions made
on three replicated sets of experiments sd

It is possible to assume that the glassy state of the coffee was responsible for the retention of the toxic molecules.
Also, the constituents of the food matrix could affect the release of volatiles. In particular, it was demonstrated
that such a retention was greater in lipid-containing foods, like coffee (Van Lancker et al., 2009).
In order to verify the possible influence of water on the furfurals removal, the kinetics of HMF and furfural
release from coffee, exposed to 100% relative humidity up to 24 hours, were studied (Figure 2).

Figure 2 HMF and furfural removal from coffee samples during exposure to saturated water vapour as a function of time

It is possible to observe that the furfurals removal increased with the increasing of the exposure time to water
vapours, which corresponded to a greater sample hydration. According to the literature, water may have an
important role on the retention of volatiles in food matrices (Flink and Karel, 1970; Rosenberg et al., 1990).
In this case, the increase in water content induced a change of the physical state of the coffee, i.e. a transition
from the glassy to a rubbery state, that could be responsible for the volatile compounds release. Moreover, the
furfural removal was greater than that of HMF (100% furfural removal against 37% HMF removal after 24 h of
hydration). As already pointed out this could be attributable to differences in the molecular weights between
HMF and furfural. Having higher molecular mass than furfural, HMF is likely to diffuse more slowly through
the food matrix compared to furfural.
Due to the important role of water on the HMF and furfural release, vacuum treatments at different pressure
values for different lengths of time were carried out on previously hydrated coffee samples to a a
w
value of
approximately 0.7.
Figures 3 and 4 represent the percentage of HMF, furfural and water removal from the hydrated coffee samples
treated at 20 Torr and 100 Torr for increasing lengths of time.

Pressure
(Torr)
HMF
(mg/g
dm
)
Furfural
(mg/g
dm
)
Control 0.369 0.032
a
0.062 0.009
a

5 0.433 0.009
a
0.075 0.009
a

20 0.404 0.008
a
0.074 0.008
a

80 0.410 0.010
a
0.076 0.009
a

140 0.364 0.025
a
0.070 0.007
a

Time
(min)
HMF
(mg/g
dm
)
Furfural
(mg/g
dm
)
0 0.325 0.039
a
0.036 0.006
a

0.5 0.304 0.005
a
0.032 0.002
a

1 0.302 0.006
a
0.031 0.001
a

3 0.305 0.008
a
0.032 0.001
a

7 0.312 0.008
a
0.032 0.001
a

9 0.328 0.032
a
0.035 0.002
a

15
th
151
15
th
0
10
20
30
40
50
60
70
80
90
100
0 5 10 15
Time (min)
R
e
m
o
v
a
l

(
%
)
HMF
furfural
water
0
10
20
30
40
50
60
70
80
90
100
0 20 40 60 80 100 120
Time (min)
R
e
m
o
v
a
l

(
%
)
HMF
furfural
water

Figure 3 HMF, furfural and water removal from coffee samples hydrated and subsequently treated under vacuum at 20 Torr
and 60 C as a function of time

Figure 4 HMF, furfural and water removal from coffee samples hydrated and subsequently treated under vacuum at 100
Torr and 60 C as a function of time

These treatments proved to be effective in removing HMF and especially furfural, whose removal was higher
than that of HMF, as previously noted.
It is worthy noting that the same maximum level of HMF and furfural removal (approximately 12% for HMF
and 55% for furfural) was achieved by applying the two vacuum treatments, although more time was requested
at the highest pressure. Moreover, this removal has to be considered in addition to the previous removal,
attributable to the hydration of the samples, equal to 10% for HMF and 55% for furfural.
As is possible to observe from Figures 3 and 4, during the treatments at 20 Torr and 100 Torr coffee dehydration
proceeded very fast and at similar rates. Within the first 3 min of treatment, moisture fell down to 4%, to which
corresponded a
w
values between 0.30-0.33. At this moisture and a
w
, coffee is in the glassy state (Cardelli et al.,
1996). Nevertheless, the HMF and furfural removal mainly occurred after these water content and activity values
were surpassed. It is plausible that the matrix sites left by furfurals as a consequence of the hydration process
were not more available when coffee underwent transition to a rubbery state during the vacuum step. Therefore,
they were easily removed under the vacuum action. This hypothesis is supported by the fact that the same
maximum amount of HMF and furfural was removed after the application of both treatments. Also, the HMF and
furfural removal followed a behaviour similar to that observed for the model solutions (Figure 1), indicating that
their release was not affected by the matrix.
The employment of vacuum treatment seems to be a very promising process intervention for furfurals removal
from coffee. In particular, relatively short treatments at 20 Torr of hydrated samples seem to be the very
efficient. It would be interesting to study the effect of this strategy on different food matrices, particularly rich in
furfurals. The next step will be the study of the most favourable conditions in order to maximize the HMF and
furfural removal, while minimizing volatile loss. Thinking to a possible application at industrial level, this
technology may be inserted in a production process arranging for a hydration step followed by a vacuum step,
after the thermal treatment of the product.
15
th
152
15
th
5. References
Anese M, Suman M, Nicoli MC (2010) Acrylamide removal from heated foods. Food Chemistry 119: 791-794.
Antal Jr. MJ, Mok WS, Richards GN (1990) Mechanism of formation of 5-(hydroxymethyl)-2-furaldehyde from D-fructose
and sucrose. Carbohydrate Research 199: 91-109.
Cardelli CF, Glasenapp N, Labuza TP (1996) Influence of oxygen, water activity and temperature on the shelf life of coffee.
IFT Annual Meeting: Book of Abstracts, 25-26.
Flink J, Karel M (1970) Retention of organic volatiles in freeze-dried solutions of carbohydrates. Journal of Agricultural and
Food Chemistry 18: 295-297.
Friedman M (1996) Food browning and its prevention: an overview. Journal of Agricultural and Food Chemistry 44: 631-
653.
Garca-Villanova B, Guerra-Hernndez E, Martnez-Gmez E, Montilla J (1993) Liquid chromatography for the
determination of 5-(Hydroxymethyl)-2-furaldehyde in breakfast cereals. Journal of Agricultural and Food Chemistry
41: 1254-1255.
Glatt H, Sommer Y (2006) Health risks of 5-hydroxymethylfurfural (HMF) and related compounds. In Acrylamide and other
hazardous compounds in heat-treated foods. (Skog K, Alexander J, Eds.), Abington, Cambridge, UK: Woolhead
Publishing Ltd, pp. 329-357.
Goubet I, Le Quere J-L, Voilley AJ (1998) Retention of aroma compounds by carbohydrates : influence of their
physicochemical characteristics and their physical state. A review. Journal of Agriculture and Food Chemistry 46:
1981-1990.
IARC (1994) Acrylamide. In Monographs on the Evaluation of Carcinogenic Risks to Humans, International Agency for
Reasearch on Cancer 60: 389-443
IARC (1995) Dry cleaning, some chlorinated solvents and other industrial chemicals. In Monographs on the Evaluation of
Carcinogenic Risks to Humans, International Agency for Reasearch on Cancer 63: 394-407
Kroh LW (1994) Caramelisation in food and beverages. Food Chemistry 51: 373-379.
Lee K-G, Shibamoto T (2002) Toxicology and antioxidant activities of non-enzymatic browning reaction products: review.
Food Reviews International 18: 151-175.
Maga JA (1979) Furans in foods. Critical Review in Food Science and Nutrition 11: 355400.
Morales FJ (2009) Hydroxymethylfurfural (HMF) and related compounds. In Process-induced food toxicants. (Stadler RH,
Lineback DR, Eds.), New York: John Wiley & Sons, Inc., pp. 135-174.
Opinion of the Scientific Panel on food additives, flavourings, processing aids and materials in contact with food (AFC)
related to Flavouring Group Evaluation 13 (FGE.13) (2005) Furfuryl and furan derivatives with and without additional
side-chain substituents and heteroatoms from chemical group 14. In EFSA Scientific Documents (online). Parma, Italy:
European Food Safety Authority, http://www.efsa.europa.eu/en/scdocs/scdoc/215.htm.
Rosenberg M, Kopelman IJ, Talmon Y (1990) Factors affecting retention in spray-drying microencapsulation of volatile
materials. Journal of Agricultural and Food Chemistry 38: 1288-1294.
Surh YJ, Tannenbaum SR (1994) Activation of the Maillard reaction product 5-(hydroxymethyl)furfural to strong mutagens
via allylic sulfonation and chlorination. Chemical Research in Toxicology 7: 313-318.
Van Lancker F, Adams A, Owczarek A, De Meulenaer B, De Kimpe N (2009) Impact of various food ingredients on the
retention of furan in foods. Molecular Nutrition and Food Research 53: 1505-1511.
Zhaoyang L (2003) Process and apparatus for reducing residual level of acrylamide in heat processed food. Patent No
US2003/0219518 A1

15
th
153
15
th
Factors affecting astringency induced by phenolic compounds
Annamaria Recchia (annamaria.recchia@unifi.it)
Dept. Agricultural Biotechnology, University of Florence, Via Donizetti, 6, Florence, Italy
Tutor: Prof. Erminio Monteleone

Individual sensory responses determine eating behaviour. Two groups responding differently to phenolic
astringent stimuli (Low Responding, LR, and High Responding, HR) were identified based on the ability to
maintain constant salivary characteristics after repeated stimulation. A twin study showed that genetic factors
account for differences in physiological salivation response to oral stimulations affecting individual
responsiveness to astringent stimuli.
HR/LR status effect on liking for phenol containing vegetable juices spiked with tannic acid was examined.
Individual differences related to physiological salivation response to oral stimulations affected responses to
astringent stimuli and influence the acceptability of phenol containing foods.

Fattori che influenzano la percezione dellastringenza indotta dai composti fenolici
La sensibilit sensoriale individuale determina il comportamento alimentare. Due gruppi con diversa sensibilit a
stimoli fenolici astringenti (soggetti con bassa, LR, e con alta sensibilit, HR) sono stati identificati in base alla
capacit di mantenere costante le caratteristiche salivari dopo stimolazioni ripetute. Uno studio condotto sui
gemelli ha mostrato che i fattori genetici spiegano le differenze di salivazione dopo stimolazioni orali, ed
influenzano la sensibilit individuale agli stimoli astringenti.
E stato investigato leffetto dello stato HR/LR sulla preferenza per succhi vegetali il cui contenuto fenolico
stato modificato aggiungendo acido tannico. Le differenze individuali di salivazione fisiologica in seguito a
stimolazioni orali influenzano laccettabilit di alimenti ricchi in fenoli.

Key words: sensory evaluation, salivary characteristics, food preference, food familiarity, genetic factors
1. Introduction
The ingestion of phenol-rich plant foods and beverages induces the perception of astringency, a tactile sensation
described as drying and puckering in the oral surfaces. Various anti-nutritional effects have been reported for
phenols (Mueller-Harvey, 2006) and it has been proposed that the sensation of astringency represents a sensory
warning cue that would discourage the ingestion of foods which contain high concentrations of these
compounds. In fact, astringency is perceived as a negative attribute responsible for the lowering of acceptability
for some plant food products. Astringency raises from the interaction of dietary tannins with lubricating salivary
proteins (Najak & Carpenter, 2008; Dinnella et al 2010). A two step salivary protein/dietary tannin interaction
has been hypothesized; the first one involving proteins with the highest tannin binding affinity (PRPs, cystatins
and hystatins) that exert a sequestering and protecting role and a second step might be based on phenol
interactions with the adsorbed glycoprotein layer with the consequent oral cavity delubrication, friction
increasing and astringency elicitation.
Genetic factors affect individual differences in psychophysical responses to oral sensations (Duffy, 2007).
Differing expression degrees of 6-n-propylthiouracil (PROP) receptor genes result in individual sensitivity
variation to the bitterness of these compounds (Reed et al., 1999). PROP taster status has been demonstrated to
deeply influence ingestive behaviours by affecting the acquisition of food preference, the liking for bitter
vegetable foods and beverages (Keller et al., 2002). Inherited sweet taste preference has been demonstrated
(Keskitalo et al., 2007). Based on the relation between perceived sweetness intensity and hedonic response, two
population groups have been identified of sweet likers and dislikers (Looy and Weingarten, 1991). The liking
and the use frequency of sweet food items resulted significantly correlated (Lahteenmaki et al., 1994).
The ability to perceive the thermal taste (a phantom taste evoked by tongue thermal stimulation) was associated
with relatively higher responsiveness to 5 prototypical taste stimuli (Green and George, 2004) and it is
considered as a further marker of individual sensitivity variation to oral sensations.
Physiological individual variation of saliva characteristics is a well recognised factor modulating the sensitivity
to astringency induced by phenolic stimuli (Horne et al., 2002, Condelli et al., 2006). Two population groups of
Low Responding (LR) and High Responding (HR) subjects to phenolic astringent stimuli have been identified
based on the ability to maintain constant salivary characteristics after repeated oral stimulation (Dinnella et al.,
2009). A nearly constant salivary protein concentration and profile after both masticatory and
taste/somatosensory system stimulations characterize the subject group with lower sensitivity to astringency
(LR), while a strong depletion of glycosylated salivary proteins was found in the more sensitive group (HR)
(Dinnella et al. 2010). Hypotheses related to physiological differences in protein secretory pathways as well as
15
th
154
15
th
Table 1 Correlations (r) within pairs of the
individual salivary protein components in
monozygotic (MZ) and dizygotic (DZ) twins.
morphological characteristics of the parotid glands can explain the different behavior of LR and HR groups after
protracted oral stimulation.
The aim of the present work was to evaluate whether astringency perception and related properties of saliva are
genetically determined. The relationships between astringency sensitivity and both food preferences and dietary
habits were also considered.
2. Materials and methods
One hundred and eighty Finnish twin individuals (21-25 year of age, 84 males, 94 females), including full 22
MZ and 49 DZ pairs, participated in the first experiment:
1. Collection of mechanically evoked saliva after abstention from salivation stimuli (first saliva collection)
2. Astringency data for two tannic acid (TA) fortified apple juices (0 and 1.5 g/l tannic acid)
3. Collection of mechanically evoked saliva after tasting tannic acid sample (second saliva collection)
4. Saliva characterization in terms of flow rate, protein content (SP), phenol content (Ph), protein reactivity with
tannic acid solution (haze forming capacity-HFC), SDS-electrophoresis protein profile.
Seventy-seven Italian subjects (21-33 year of age, 33 males, 44 females) took part to the second experiment
designed in several sessions:
Development of a questionnaire on choice of, preference for, and familiarity with phenol-rich food items
Development of fruit and vegetable stimuli with increasing phenolic content providing different levels of
perceived astringency within a similar intensity range
Selection of LR (n=20) and HR (n=20) groups from a population of 77 subjects based on salivary protein
characteristics after repeated oral stimulation
Evaluation of LR/HR status effect on sourness, bitterness and astringency intensities and liking for juices at
different astringency levels
3.1 Genetic factor effect on Low Responding and High Responding status
In order to evaluate the impact of genetic effects of the astringency perception, the saliva compositions in
monozygotic (MZ) and dizygotic (DZ) twins were investigated. In the individual protein components of the
saliva the correlations within pairs were discovered to be higher in MZ twins (Table 1). The present data show
that differences in physiological salivation response to oral stimulations affecting individual responsiveness to
astringent stimuli are influenced by genetic factors.

3.2 Subjects grouping
SPs D-values were recently demonstrated to relate to individual responsiveness to phenolic astringent stimuli
(Dinnella et al., 2009). Subjects were grouped according to three levels of variation (low, L; medium,M; high, H)
of SPs D values. Characteristic values of a percentile distribution (first and third quartiles) were used to define
three groups: Low Responding (LR, n=20, SPs D-value=-0.260.17), Medium Responding (MR, n=37 SPs D-
value=-0.790.14) and High Responding (HR, n=20, SPs D-value=-2.540.42) subjects (Dinnella et al., 2010).
Responsiveness to phenolic astringent stimuli of the three groups was evaluated on the ratings from the 1.4 g/l
TA sample tasted immediately after the second saliva collection. Astringency, bitterness and sourness ratings
were independently submitted to one-way ANOVA model to estimate the group effect (three levels: LR, MR,
HR subjects). Subject groups differed significantly for the intensity of perceived astringency (F
2;74
=8.48;
p<0.001). Mean astringency ratings from HR subjects (35.742.04) were significantly higher than those from the
other two groups while no differences were found comparing LR (20.982.04) and MR (18.481.50) ratings
(Dinnella et al.,2010).
The sensory results confirm that subjects capable of maintaining constant salivary protein concentration after
both mechanical and chemical stimulation (LR group) were less responsive to astringent stimuli than subjects in
which the same stimulations induced a significant lowering of salivary protein concentration (HR group).

3.3 Effect of individual astringency responsiveness on liking for vegetable juices
Responsiveness of the LR and HR groups to astringency, bitterness and sourness of pure and TA spiked juices
was investigated. The modification of perceived intensities induced by adding TA to juices was computed as
Salivary protein class
rMZ (n=22) rDZ (n=49)
Amylase 0.77 0.31
Prolin Rich Proteins 0.58 0.31
Histatin 0.11 0.29
Cystein 0.46 0.34
Mucin 0.44 0.13
15
th
155
15
th
arithmetic difference between astringency, bitterness and sourness rated in TA2 and in pure juices (dIntensity=
Intensity T2 - Intensity T0). Astringency, bitterness and sourness dIntensity values were independently
submitted to a two-way ANOVA to estimate the group (two levels: LR and HR subjects) and the juice (three
levels: apple, grape and carrot) effects.
The results confirmed that groups differed significantly for the intensity of perceived astringency (F
1; 114
=8.78;
p=0.004). A significant effect of juice on astringency dIntensity values was found (F
2; 114
=5.38; p=0.006). No
significant effect was found for groupxjuice interactions (F
2;114
=0.027; p=0.97). No significant group effect for
bitterness (F
2;114
=1.77; p=0.185) and sourness (F
2;114
=1.29; p=0.258) dIntensity values was found.
Un-paired t test were computed independently for each juice on dIntensity astringency values to further
investigate HR and LR group effect. dIntensity value for astringency resulted higher in HR than that in LR
subjects (apple:t
38;2.02
=1.73; p=0.09, grape:t
38;2.02
=1.69; p=0.09, carrot:t
38;2.02
=1.73; p=0.09), meaning that TA
induces a higher increasing of astringency in HR than in LR subjects.
The liking for pure and TA2 juices was also computed as arithmetic difference between liking for TA2 and T0
samples (dLiking= Liking T2 - Liking T0). dLiking values were submitted to a two-way ANOVA to estimate the
group (two levels: LR and HR subjects) and the juice (three levels: apple, grape and carrot) effects.
Significant group and juice effects on dLiking values were found (F
1; 114
=9.87; p=0.002; F
2; 114
=18.73; p0.001).
No significant effect for groupxjuice interactions (F
2; 114
=0.58; p=0.541) was found.
HR and LR group effect on liking for vegetable juices was further investigated by performing un-paired t test on
dLiking values computed for each juice (Figure 1). TA adding induces a higher liking decreasing in HR than in
LR both for apple and grape juices (t
38;2.02
=-2.27; p=0.03; t
38;2.02
=-1.89, p=0.06, respectively). No significant
variation of liking for carrot was found when comparing data from HR and LR groups (t
38;2.02
=-1.17; p=0.247).

3.4 Effect of Low Responding and High Responding status on preference for phenol-rich foods
Variation in sensitivity to oral sensations can influence on ingestive behaviour via food/beverage preference.
The intensity modification induced by juices with different astringency level was lower in LR than in HR group
(apple:t
38;2.02
=1.73; p=0.09, grape:t
38;2.02
=1.69; p=0.09, carrot:t
38;2.02
=1.73; p=0.09), meaning that TA induces a
higher increasing of astringency in HR than in LR subjects. Thus, LR and HR status affect astringency intensity
also when it is induced by complex stimuli where several oral and olfaction sensations are simultaneously
perceived.
The general negative effect of astringent sensation on food acceptance is enhanced in HR in respect to LR group.
In fact HR showed a higher decrease in liking than LR subjects for both apple and grape juices spiked with
increasing concentration of tannic acid (t
38;2.02
=-2.27; p=0.03; t
38;2.02
=-1.89, p=0.06, respectively). No significant
variation of liking for carrot was found (t
38;2.02
=-1.17; p=0.247). Hedonic response to food product with a low
acceptability seems not to be affected by the intensity of perceived astringency, this could explain the lack of a
significant effect of HR and LR status on carrot juices liking.
Preference for and familiarity with 37 phenol-rich food items, as well as preference for 14 phenol-rich foods and
beverages, each paired with a less astringent counter-product, were also collected.
Preference data for phenol-rich food were analysed by means of an Internal Preference Map (Figure2). The less
preferred products are positioned on the left side of the first dimension of the score plot and consist of carrot
juice, soy milk, raw chicory, coffee without sugar, tea without sugar. Wines, positioned on the right of the map,
represent the most preferred products. Based on the preference patterns three product subgroups were identified.
Subgroup 1 consisting of extremely ripe fruit products is positioned on the bottom of the second dimension of
the score plot. These products are potentially less astringent than unripe fruit, that are positioned on the upper
Figure 1. dLiking value (Liking T2 -
Liking T0) induced by adding TA to
juices computed for Low
Responding (LR, n=20) and High
Responding (HR, n=20) subject
groups.
Bars represent standard errors.
*p0.1.

-4
-3
-2
-1
0
1
apple grape carrot
d
L
i
k
i
n
g
High
Low
*
*
15
th
156
15
th
- Carrot

- Coffee without milk
- Red wine
- Raw vegetable
- Cooked vegetable
- Aged
red wine
- Raw chicory
- Black tea
- Black coffee
- Milk chocolate
- Tea with sugar
- Coffee with sugar
- Ripe pear
- Ripe fruit
- Ripe banana
- White wine
- Chocolate with 70%of cocoa
- Cooked radicchio
- Grapefruit
- Soy milk
- Grape juice
- Apple juice
- Bilberry

- Unripe banana
- Unripe pear
- Dark chocolate
- Young red wine
- Coffee with milk
- Cooked chicory
- Endive
- Tonic water
- Sanbitter
- Raw radicchio
- Cooked artichoke
- Raw artichoke
- Unripe fruit
- Chocolate with 99%of cocoa

-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
SUBGROUP 1
SUBGROUP 2
SUBGROUP 3
side of the second dimension of the score plot. Also subgroup 2 and 3 positioned on the opposite sides of the
score plot were identified. Subgroup 2 is positioned on the upper left of the score plot. These products are
characterized by a high potential astringency. Subgroup 3 is positioned on the lower right of the bi-dimensional
product space. These products are characterized by a low potential astringency.
A 2-way ANOVA model was performed on preference scores independently for each food subgroup using
subject groups (2 levels: HR and LR) and products (3 levels) as factors.
No subject group (F
1,114
=0.078; p=0.781), product (F
2,114
=0.104; p=0.902) or subject group x product interaction
(F
2,114
=0.104; p=0.902) effects were found for food subgroup 1.
A significant subject group effect was found in both food subgroup 2 and 3 (F
1,114
=4.721; p=0.032; F
1,114
=3.212;
p=0.076, respectively), no significant product (F
2,114
=0.417; p=0.660; F
2,114
=1.389; p=0.253, respectively) or
subject group x product interaction (F
2,114
=0.074; p=0.929; F
2,114
=0.345; p=0.709, respectively) were found.
Mean preference scores from HR subjects resulted lower for products with the most astringency potential
(subgroup 2) and higher for product with the least astringency potential (subgroup 3) than LR subjects. For these
pairs sensory differences among items are mainly driven by astringency, bitterness and sourness.

Figure 2. Internal preference map computed on preference scores for 37 phenol containing food products from 77 subjects.
A significant effect of LR/HR status on familiarity with the most astringency potential foods within the pairs was
found (
2
=2.85; p=0.09), LR resulted more familiar than HR subjects.
These products were then grouped into five categories: coffee/tea (coffee without sugar, tea without sugar, coffee
without milk); chocolate (dark, with 70% and 90% of cocoa); vegetable (raw vegetable, raw artichoke, raw
chicory, raw radicchio), fruit (unripe fruit, unripe pear, unripe banana) and wine (red wine, aged red wine), and
for each category the number of familiar (familiarity scores=5) and unfamiliar subjects (familiarity scores4)
were counted. The number of subjects who regularly consume these products (F subject) resulted higher in HR
than LR group (Table 2). No LR/HR status effect was found on wine category, probably because other factors,
such as social and cultural factors, affect the red wine consumption.
HR/LR status affected the frequency of consumption of both product categories with high nutritional properties
and largely represented in the daily Italian diet (fruit and vegetable) and non-essential food products (coffee, tea,
chocolate).
Questionnaire data showed that HR/LR status determines the acceptability for coffee and tea with varying
astringent potential. For these drinks extremely popular, the intensity of unpleasant sensations may be easily
modulated by individual consumption patterns.

15
th
157
15
th
Table 2 Pearson's chi-square test (
2
) computed on the familiar (F) and unfamiliar subjects (UF)
number in HR and LR group.
High Responding Low Responding
Category
F UF F UF

2
p
Coffee/Tea 18 42 26 34 2.30 0.130
Chocolate 7 53 20 40 8.08 0.001
Vegetable 15 45 22 38 2.60 0.100
Fruit 10 50 17 43 2.30 0.120
Wine 21 19 16 24 1.23 0.260
4. Conclusions
This study reported that the phenotypic variation associated to the responsiveness to astringent stimuli are
genetically determined, as well as in the case of other tastants (Bartoshuk et al. 1994; Mennella et al. 2005;
Hayes et al. 2008).
Results from this study show, for the first time, that individual differences related to physiological salivation
response to oral stimulations significantly affect responsiveness to astringent stimuli and influence the overall
acceptability of selected phenol-rich food items. The higher the increasing of perceived astringency intensity, the
higher is the liking decreasing induced by adding TA to complex stimuli in High Responding subjects.
Physiologic HR/LR status seems to be affect the eating behaviour of foods with high phenolic content, whose
intake is recommended for a balanced diet.
5. References
Bartoshuk LM, Duffy VB, Miller IJ. 1994. PTC/PROP tasting: anatomy, psychophysics, and sex effects. Physiol
& Behav 56(6): 1165-1171.
Condelli N, Dinnella C, Cerone A, Monteleone E, Bertuccioli M. 2006. Prediction of perceived astringency
induced by phenolic compounds II: Criteria for panel selection and preliminary application on wine sample.
Food Qual Pref. 17: 96-107.
Dinnella C, Recchia A, Vincenzi S, Tuorila H, Monteleone E. 2010. Temporary modification of salivary protein
profile and idividual responses to repeated phenolic astringent stimuli. Chem Sens. 35: 75-85.
Dinnella C, Recchia A., Fia G., Bertuccioli M., Monteleone E. 2009. Saliva Characteristics and Individual
Sensitivity to Phenolic Astringent Stimuli. Chem Sens. 34 (4): 295-304.
Duffy VB. 2007. Variation in oral sensation: implications for diet and health. Curr Opin Gastroent. 23: 171-177.
Green BG, George P. 2004. Thermal taste predicts higher responsiveness to chemical taste and flavour. Chem
Sens. 29: 617-28.
Hayes JE, Bartoshuk LM, Kidd JR, Duffy VB. 2008. Supertasting and PROP bitterness depends on more than
the TAS2R38 gene. Chem Sens 33(3): 255-265.
Horne J, Hayes J, Lawless HT. 2002. Turbidity as a measure of salivary proteins reactions with astringent
substances. Chem Sens. 27: 653-659.
Keller KL, Steinman L, Nurse RJ, Tepper BJ. 2002. Gentic taste sensitivity to 6-n-propyltiouracil influences
food preference and reported intake in preschool children. Appetite. 38: 3-12.
Keskitalo K, Tuorila H, Spector TD, Cherkas LF, Knaapila A, Silventoinen K, Perola M. 2007. Same genetic
components underlie different measures of sweet taste preference. Am J Clin Nutr. 86: 1663-1669.
Lahteenmaki L and Tuorila H, 1994. Attitudes towards sweetness as predictors of liking and use of various
sweet foods. Eco Food Nutr. 31: 161-170.
Looy H, Weingarten HP. 1991. Effects of metabolic state on sweet taste reactivity in humans depend on
underlying hedonic response profile. Chem Sens. 16: 123-130.
Mennella JA, Pepino MY, Reed DR. 2005. Genetic and environmental determinants of bitter perception and
sweet preferences. Pediatrics 115(2): 216-222.
Mueller-Harvey I. 2006. Unravelling the conundrum of tannins in animal nutrition and health. J Sci Food Agric.
6 (13): 20102037.
Nayak A. and Carpenter G.H. 2008. A physiological model for tea induced astringency. Physiol & Behav 95:
290-294.
Reed DR, Nanthakumar E, North M, Bell C, Bartoshuk LM. 1999. Localization of a gene for bitter taste
perception to human chromosome 5p15. Am J Hum Genet. 64 :1478-80.
15
th
158
15
th
Innovative Systems for the Improvement of Food Quality and Safety
Gian Franco Regnicoli (gianregnicoli@libero.it)
Dept. Economic and Food Science, University of Perugia, Italy
Tutor: Prof. Paolo Fantozzi, Co-Tutor: Dr. Giuseppe Perretti

This PhD thesis dealt with the study of the possibility to use innovative hardware and software systems, like
RFID and time-temperature sensors, for the improvement of food safety and quality.
Sistemi innovativi per il miglioramento della sicurezza e della qualit dei prodotti agro-
alimentari
Questa tesi di dottorato ha riguardato lo studio della possibilit di utilizzo di sistemi innovativi hardware e
software, quali RFID e sensori tempo-temperatura, per il miglioramento della sicurezza e della qualit dei
prodotti agroalimentari.

Key words: Food quality and safety; traceability; RFID.
1. Introduction
In accordance with the PhD thesis project previously described (Regnicoli, 2009), this oral communication
reports the main results of the following three activities directed to:
(A1) The choice of the industrial productions to consider as the object of the study.
(A2) The definition of quality management methods, the methods of examination, preservation, storage and
transport.
(A3) The analysis of the operators needs, also through interviews of representative leaders among the food
chain.

1.1 State of the art
Today, the food safety assurance is a prerequisite from which we cannot escape. In confirmation of this, there are
several documents in matters of food law, starting from the European legislation till the voluntary ISO
22000:2005 concerning food safety management systems. The importance of this topic is widespread in all the
world. From the USA, with the Food and Drug Administration (FDA), till China, Australia, New Zealand and
then the developing countries.
Nevertheless, despite the several mandatory and voluntary measures for food safety, some difficulties still exist
in realizing such efforts, as, for example, the lack of a common language able to allow the diffusion and sharing
of information at all the levels of the food chain.
This situation leads up the operators to choose from several useful systems to track the product in the internal
process. Sometimes these systems are not compatible with one another.
In the actual context, the present paper studies innovative tools for the tracking and tracing (T&T) of foods able
to collect and to manage the information relative to position and quality conditions by means of advanced and
innovative instruments of hardware and software.
The core of the innovative solutions is the use of a mature technology already spread in other contexts, but not so
for food productions; in this work we study the possibility of the use of sensors linked to a RFID active unit able
to send a message by necessity, like for example the alarm in event of not satisfactory conditions of maturation
or conservation of a food. The management of the proposed hardware also for the food safety concerns is the
most important innovative aspect in this work.
1.1.1 RFID
RFID (Radio Frequency Identification) are technologies able to recognize in the distance objects, animals and
people by the use of radio waves.
In recent years, this mature technology has received significant coverage, mainly because of the considerable use
of this technology made by private companies such as Wal-Mart (USA), Tesco (UK),by the Department of
Defence (USA) and proposed by the Food and Drug Administration (FDA) (McMeekin et al., 2006).
1.1.2 Active and intelligent packaging
The active packaging has been defined by Kerry et al. (2006), as packaging that changes the condition of the
packed food to extend shelf-life or to improve safety or sensory properties, while maintaining the quality of
packaged food. Examples of active packaging are the O
2
scavengers, the humidity or SO
2
emitters, the ethylene
or CO
2
scavengers and emitters and the films with antimicrobial activity.
15
th
159
15
th
Instead, intelligent packaging has been defined as packaging systems which monitor the condition of packaged
foods to give information about their quality during transport and storage. In this category are included the
Time Temperature Indicators (TTI), the indicators of oxygen, the CO
2
indicators and the microbial growth
indicators (Kerry et al., 2006).
1.1.3 Nanotechs
Nanotechnology is the science and technology dealing with particles of size from 1 to 100 nm. It is an interesting
science that in recent times is having a development and attention. Its study and its understanding can help also
in developing innovative tools for making food safer and more stable (Sorrentino et al., 2007).
2. Methodology of Study
The choice of the industrial productions as the object of the study was done considering the importance of the
principles of the well known food pyramid and of the economical value of the food productions.
The definition of quality management methods, the methods of examination, preservation, storage and transport
are actually in progress.
With the aim to highlight how the utility of traceability and its opportunities are perceived among the food chain
actors, it was useful to combine the results of a set of interviews with the results of a deep bibliographic study of
international level.
The exploration of the needs and the degree of involvement of the actors of the different classes of business of
the Italian agri-food chain was considered as case study for this work. The Italian scenario was regarded like a
representative case study because of its characteristic of typical Mediterranean example, sensible to the main
themes of food quality and safety. For this propose, leaders among the actors operating at different levels of the
Italian food chain (transformation, distribution and logistics) were interviewed.
Topics like the need for services, the possibility to use RFID and other innovative hardware, the awareness of the
Active / Intelligent packaging, the opportunities for investments, the possible kind of support to adopt, which
parameters to consider for the data collection, which critical point to track in the food chain, and of what
minimum sell unit may be useful to have trace, were discussed.
The data collected were studied and discussed in function of the international literature state of the art, and the
results are here reported.
At the present state of the research, the main example of industrial production to consider as reference for the
application of the studied innovative tools are singled out. The first choice was for the cereal based productions,
considering the importance of the role of this food category as constituent of the basis of the food pyramid, as
confirmed by the actual guidelines for a correct nutrition.
Among the other food products, the products of animal origin were considered. Along with these, coverage is
high for cold cuts; this is due to the high value-added (in economical terms) that this kind of food products can to
aspire, and also because the cold cuts have a determinant role in the representation of the Italian foods in the
world.
For this kind of production, the relative methods of preservation, stocking and transport in the food production
chain are still in examination.
As regards the analysis of needs, in terms of tools for the quality assurance and food safety, the first interviews
with actors involved in the agri-food sector have been conducted.
From the data obtained with such interviews, from the bibliographic material and from the elaboration of the
actual data it is possible to draw some considerations about the possibilities to improve the food quality and
safety by the means of innovative hardware and software tools (mobile phone, internet, barcodes, RFID Radio
Frequency Identification and others).
It was observed how the RFID technology results of high interest among the instruments and the technologies
able to realize the traceability (the ability to trace and follow food, feed, and ingredients through all stages of
production, processing and distribution). The use of RFID tags promise to be a useful tool to warrant the
consumers health. In fact, the use of this technology can allow to certify of the products and to make more
efficient the management process (production, warehouse, distribution) with advantages that the actual reference
technology (the bar code) cannot to reach.
Among the tools of active and intelligent packaging, it was observed how, the TTIs (Time Temperature
Indicators) stand out for the interest their reserved.

15
th
160
15
th
Figure 1 Example of an RFID tag

Figure 2 Example of a common barcode

3.1 Needs analysis
Interesting points of contiguity stand out from the study of the interviews with personalities of the Italian agri-
food chain. As expected, all the actors have always in common the interest for the economical motivation. The
interest for the potentials of the innovative applications in matters of T&T is spread, especially for the high
quality products, characterized by a high margin of gain, or for delicate and sensible to temperature products, as
those typical of the cold chain.
The choice to adopt a T&T system is commonly seen as a useful management innovation, as well as a kind of
assurance against potential injuries, that is clearly traduced in a reduction of costs.
From the study of the interviews, we can highlight that the applications able to bring a sensible economic
advantage convertible in a greater competitiveness are generally well accepted. In those cases in which such
benefits are not so evident the actors prefer to adopt solutions for the management of batches cheaper and easier
to use as the standard GS1-128.
In spite of the potentials expressed by the innovative hardware and software instruments, some difficulties for
the management, as, for example, the problem of batches definition and their composition, still remain. In this
sphere, the necessity to adopt a common language that should be respected and shared from farm to table is
presented by all the actors of the agri-food chain.
The step of the row material production is considered by the processors as one of the most critical points for the
batch definition, considering that the legislation pressure is higher on the final producer that gives own brand.
In our research we found that, with regard to the need of services, for processors there is a need for key
solutions, which are able to ease the bureaucratic management of the companies.
Among the other services that could help to ensure the improvement of the existing systems of T&T, are also
indicated the economic aids, such as any tax cuts or funding for research.
In the area of food safety, with particular need for T&T, the interviewed actors are current and prove susceptible
to RFID technology. In some cases the actors are already studying applications of this technology on food
production (Regattieri et al., 2007).
More specifically, the use of management systems of the products fluxes based on RFID technology,
characterized by a remarkable versatility in the adaptation, is of high interest among the processors.
It was observed that RFID technology can provide to other applications too, for example to the physical
monitoring of the operators. This option may offer a considerable resource, such as an increase of safety at work.
Another significant aspect is the ability to transfer to the consumer the benefits above mentioned, because
customers are able to associate with relative ease using sensors / tags to a guarantee of safety and better quality
of the marketed product (Van Rijswijk et al., 2008).
Regarding the Active / Intelligent Packaging (packaging able to prolong the life of foodstuffs or to react when
they have gone off, for example by changing colour) it was observed from the interviewed actors a quite
different approach: who would eventually see their use confined to the productions characterized by the cold
chain and those who adopt it ordinary for some productions, so much to consider the adoption of this technology
as a mandatory requirement for their suppliers.
The actors quite agree about the maximum expense that is possible to support for innovative systems of T&T;
these values are generally around 0.10 US$ for Trade unit, a threshold under which this technology may start to
be a priority and not just a possibility.
This indicative value should be verified for the single products: for an image product (top quality) as it might be
a packaged smoked salmon or a Parmigiano Reggiano cheese, the maximum increases of expense for the
producer can be higher and fixed around 2, 3 or up to 4% of the total costs (Regattieri et al., 2007).
Among the support types of RFID tags or sensors listed as good for the interviewed actors, stickers are included,
15
th
161
15
th
of shape and size similar to a credit card and more or less rigid/flexible. However, the actors are open to
alternative sizes.
In general, there is a greater sensitivity toward the innovative sensors able to track quality indices of the shelf life
such as temperature, pH, humidity inside the packaging, and, for particular preparations such as intermediate
humidity bakery packed products (snacks), even the ethanol concentration in the atmosphere inside the package.
Certainly, all the actors are required to track the product until the trade unit, or until the sell unit.
However, some producers are trying to go further legal requirements, becoming open to the evaluation of
information management systems able to follow the product until the final consumer (the consumer unit).
The actual results are only partially correspondent with our expected values, because the difficulty of
achievement of the RFID device gave delay in the test of this hardware in the real productive chain. In the
following table are reported the operative conditions of the prototype of hardware projected for the achievement
of our results:

Table 1 Specifications of the proposed smart RFID label

Humidity sensor
Range, resolution 10% 90% RH, 1% RH
Maximum current consumption 20 !A
Temperature sensor
Range, resolution -40 C 80 C, 0.2 C
Light intensity sensor
Range, resolution 1000 W=m2, 2 W=m2
A/D converter
Input range peak-peak differential 1 V
Resolution 10 bits
RFID transceiver
Operating frequency 13.56 MHz
Standard ISO 15693
Rectifying antenna
Output voltage, current @ recharging 3.3 V, 100 !A
Output voltage, current @ transmission 1.8 V, 150 !A
Power management
Regulated output voltage 1.8 V
Output current 200 !A

When the hardware will be tested in the next months the original aim of tracing and tracking of food products
along the food chain will be verified.

Figure 3 Block diagram of the proposed smart RFID label

15
th
162
15
th
4. Conclusions
The food chain traceability, mandatory in Europe with the EC Reg. n. 178/2002, has the goal to raise the actual
level of control of food safety to protect consumers health and to minimize the risks relatives to nutrition (The
European Parliament & The Council of the European Union, 2002).
An efficient traceability system can be realized for these propose only through an efficient documental system
and a detailed information system for the management of all the data of the productive process from the field to
the table.
A traceability management system is composed by all the instruments and technologies (software, hardware,
mobile phone, internet, bar code, RFID, TTI, and more) that allow to realize the tracking and tracing.
In this study, how RFID tags can be a useful instrument to ensure consumers safety has been shown. It can
certify the quality of products and make more efficient the management process (production, storage and
distribution).
The active and intelligent packaging can ensure ideal conditions of hygiene and food safety. Moreover, with
these devices is possible to transmit information about product identification, about its origin, and about all the
productive chain.
It is useful to remember that the nanotech can give important benefits for the producers and for the consumers
(e.g. assurance of food quality, the preservation of sensory quality, food safety) (Siegrist et al., 2007; Siegrist et
al., 2008) but it is necessary a deep evaluation of the risks from the Authorities before that their utilization
became widespread, because it involves the possible contact with food and the consequent risk of
contaminations.
So this study suggests that it will be possible in a close future to ensure food safety not only with the actual
visible bar code, but also through RFID technology and chemical devices or with other new technologies not
used yet
This study shows how the traceability instrument can play a role key in promoting the value of origin (e.g.
Mediterranean products, Protected Designation of Origin, typical products), but also that this opportunity is not
exploited at best by the relative food chains. From the interviews emerges that although all stakeholders feel the
food traceability as an item of high value, they still tend to regard it as an obligation to comply. Instead, the
Organized Retail, which because of its structure is more motivated to promote projects of advanced traceability,
is highly interested.
The literature is in agreement with this interpretation, and technology providers seem very sensitive in this sense,
which bring already available technology for the implementation of tracking by the use of RFID (Fritz and
Schiefer, 2009) and GPS, GPRS, UMTS, Wi-Fi and WiMAX (Baos, 2006).
For the future perspectives, it will be useful to test the applications of the studied hardware in the real productive
chain to confirm the values till now have simulated.
5. Selected References
Baos J (2006) RFIDs in the context of other wireless technologies (interplay between wireless applications, security and
privacy aspects, etc.), Workshop RFID Frequency Spectrum Requirements And recommendations 2 June 2006,
Brussels, Renaissance Hotel, Rue du Parnasse 19, 1050 Brussels.
Fritz M, Schiefer G (2009) Tracking, tracing, and business process interests in food commodities: A multi-level decision
complexity. Int J Prod Econ 117: 317329.
Kerry JP, OGrady MN, Hogan SA (2006) Past, current and potential utilization of active and intelligent packaging systems
for meat and muscle-based products: A review. Meat Sci 74: 113-130.
McMeekin TA, Baranyu J, Bowman J, Dalgaard P, Kirk M, Ross T, Scmid S, Zwietering MH (2006) Information systems in
food safety management, International J Food Microbiol 112: 181-194.
Regattieri A, Gamberi M, Mancini R (2007) Traceability of food products: General framework and experimental evidence. J
Food Eng 81: 347-356.
Siegrist M, Cousin ME, Kastenholz H, Wiek A (2007) Public acceptance of nanotechnology foods and food packaging: The
influence of affect and trust. Appetite 49: 459-466.
Siegrist M, Stampfli N, Kastenholz H, Keller C (2008) Perceived risks and perceived benefits of different nanotechnology
foods and nanotechnology food packaging. Appetite 51: 283-290.
Sorrentino A, Gorrasi G, Vittoria V (2007) Potential perspectives of bio-nanocomposites for food packaging applications.
Trends Food Sci Technol 18:84-95.
The European Parliament and the Council of the European Union (2002) Regulation (EC) No. 178/2002, Official Journal of
the European Communities, L31/1-L31/24.
Van Rijswijk W, Frewer LJ, Menozzi D, Faioli G (2008) Consumer perceptions of traceability: A cross-national comparison
of the associated benefits. Food Qual Prefer 19: 452-464.
15
th
163
15
th
Natural patrimony of old Cinque Terre vineyards as yeasts source able
to improve the features of originary cultivar
Rossana Romaniello (rossana.romaniello@unibas.it)
Dept. Biologia, Difesa e Biotecnologie Agro-Forestali, University of Basilicata, Italy
Co-Tutor: Dott. Angela Capece
Tutor: Prof. Patrizia Romano
Molecular techniques, such as RAPD-PCR analysis with different primers, and technological characterization
such as resistance to ethanol, sulphur dioxide and copper, enzymatic activities, were employed in order to
evaluate the biodiversity of S. cerevisiae strains isolated from old Cinque Terre vineyards. Some strains, as
representatives of the different phenotypes/biotypes found, were submitted to micro-fermentations in the same
must of the isolation grape cultivar in order to individuate strains able to optimize the individual features of
isolation cultivar.
Il patrimonio naturale dei vigneti antichi delle Cinque terre come risorsa di ceppi di
lievito in grado di esaltare le caratteristiche del vitigno di origine
Tecniche molecolari, quali analisi RAPD-PCR con diversi primers, e test di caratterizzazione tecnologica, quali i
test per la valutazione della resistenza a etanolo, anidride solforosa, rame ed i test per attivit enzimatiche di
interesse enologico, sono state utilizzate per analizzare la biodiversit di lieviti S. cerevisiae isolati da antichi
vigneti delle Cinque Terre. Alcuni ceppi, rappresentativi dei diversi fenotipi/biotipi individuati, sono stati
sottoposti a prove di microvinificazioni in mosto ottenuto da uve della stessa variet dei campioni di isolamento,
al fine di differenziare i ceppi scelti ed individuare quelli in grado di valorizzare la tipicit varietale della cultivar
in esame.
Key words: S.cerevisiae wine strains; molecular characterization; technological characterization.
1. Introduction
This oral communication reports the main results of the following activities:
(A1) identification by restriction analysis of ITS region of 219 yeasts, isolated from grapes collected in
vineyards cultivated at high slope and at different altitude in the Cinque Terre National Park.
(A2) Technological characterization of S. cerevisiae isolates: resistance to ethanol, sulphur dioxide and copper,
enzymatic activities, hydrogen sulphide production.
(A3) Molecular characterization of wild S. cerevisiae strains by PCR analysis with minisatellites AGA1, SED1,
DAN4 and delta primers, and Restriction Analysis of the mitochondrial DNA (mtDNA-RFLP).
(A4) Fermentation tests: inoculated fermentation at lab-scale and gas-chromatographic analysis of wines.
(A5) Microvinification test: inoculated fermentation with 4 selected strains in 2 litres of grape must, gas-
chromatographic analysis of experimental wines, molecular traceability of inoculated strains by using PCR
amplification with delta primers;
(A6) Pilot scale test: inoculated fermentations at cellar level, gas-chromatographic and sensorial analysis of
experimental wines
With the current understanding of the yeast ecology of wine fermentation, winemakers are seeking to enhance
the flavour diversity and appeal of wines by controlled fermentation with multiple yeast species or strains (Fleet,
2003). The wide use of starter cultures, mainly applied to reduce the risk of spoilage and unpredictable changes
of wine quality, can ensure a balanced wine aroma, but it may also cause a loss of characteristic aroma and
flavour determinants. The study and the conservation of wine yeasts biodiversity have recently become objects
of growing interest. Molecular techniques allow not only the correct and fast identification of yeast species, but
also to analyze strain biodiversity. Until few years ago, karyotyping and RFLP analysis on mitochondrial DNA
were considered the reference method for S. cerevisiae strain typing. Recently, PCR amplification of
sequences has been improved, resulting a discriminative tool such as karyotyping or mitochondrial DNA
restriction analysis. This molecular technique has been used to study S. cerevisiae population in a given
environment grape or winery and to follow dynamics of S. cerevisiae population during the fermentation process
(Le Jeune et al., 2006).
Genetic and technological characterization of wild yeasts represents an useful tool to utilize natural biodiversity
for strain selection. Cinque Terre is a particular wine-producing area of Northen Italy characterized by a
viticulture at high slope. The maintenance of biological patrimony is essential to individuate suitable strains for
15
th
164
15
th
optimizing the development of typical varietal flavour and aroma (Romano and Capece, 2007). In fact, the
beneficial contribution of yeast increases when selected starter cultures for winemaking are able to complement
and optimize grape quality and individual cultivar characteristics (Romano et al., 2003).
2.1 Sampling and identification assays
The first part of this activity was performed on 219 autochthonous wine yeasts. The yeasts were previously
isolated from spontaneously fermented grapes (Bosco variety), collected from 8 vineyards cultivated at high
slope in the Cinque Terre National Park at three different altitudes (5TA= high altitude, 5TM= middle altitude,
5TB=low altitude). In addition, yeasts were isolated from a sample, composed by grapes collected in all the
sampled vineyards (sample M). Identification at species level was achieved by restriction analysis of ITS region,
following the method reported by Esteve-Zarzoso et al. (2000).
2.2 Technological characterization
Sulphur dioxide, ethanol and copper resistance assays. The sulphur dioxide and ethanol resistance were
determined in agarized sterile grape must, added with increasing amounts of the antimicrobial compounds. The
copper tolerance was evaluated on SD medium (glucose 2 %, YNB 0.67%, agar 2%), adding increasing amount
of copper sulphate. The media were inoculated with fresh yeast cultures and plates were incubated at 26C for
48h. Strain resistance was expressed as the maximum amount at which strain growth was significant.
-glucosidase activity assay: this screening was performed on agar plates containing YNB (Yeast Nitrogen Base
without amino acids) ammonium sulphate (0.67%), arbutin (0.5%), agar (2%), FeNH4 citrate(4%), HCL 1N,
NaOH 1N, by following the protocol reported by Manzanares et al. (2000). The pH was adjusted to 5.5. The
medium was inoculated with fresh yeast cultures and the plates were incubated at 26C for 48h. The presence
of the activity was indicated by the browning of colonies.
-D- xylosidase activity assay: the screening was carried out on agar plates containing 1.7 g YNB (Yeast
Nitrogen Base without amino acids and ammonium sulphate), 5 g ammonium sulphate, 5 g xylose and 20 g agar
per litre. The pH was adjusted to 5.5. 4-Methylumbelliferyl-b-D-xyloside (MUX) was spread on the surface of
the agar plates, yeasts were point-inoculated on the agar surface and the plates incubated at 26C for 24 h. The
hydrolysis of MUX by the action of b-D-xylosidase activity resulted in the release of 4-methylumbelliferone
(MU), which can be visualised under UV illumination as fluorescent halos surrounding yeast colonies.
Hydrogen sulphide production (H
2
S). Strains were grown on BIGGY agar medium to evaluate H
2
S production.
Fresh yeast cultures were point-inoculated on the medium and, after 48h of incubation at 26C, the browning
degree of the yeast colonies was evaluated. The browning degree is directly related to H
2
S production (yeasts
forming dark colonies are considered the highest H
2
S producers).
Decarboxylase activity. A screening plate method was employed in order to detect biogenic amine-producer
yeasts. Yeast precultures of 48 h on YPD (Yeast extract 1%, Peptone 2%, Dextrose 2%, Agar 2%, w/v) were
spotted on Petri dishes with a synthetic medium containing bromocresol purple as a pH indicator, pyridoxal-5-
phosphate as cofactor for the decarboxylase reaction and precursor amino acids of different biogenic amines (2%
w/v). Spotted medium was incubated at 26C for 72 h. The same medium without amino acids was used as a
control. The strains possessing decarboxylase activity were identified by the appearance of a purple halo around
their culture and tyramine positive strains by a clear halo.
All the data obtained from technological characterization were statistically analyzed, by converting these data
into adimensional values. The value 0 was assigned to the parameters exhibited by the strains at the low level,
value 1 at middle levels, value 2 at the high level. Similarity values were calculated using the Wards method
and the dendrogram was generated using Euclidean coefficient by the software Statistics for Windows, version
6.0 (Statsoft).
2.3 Molecular characterization
The genetic variability was evaluated among 40 strains by PCR analysis. The strains were submitted to
amplification of AGA1, DAN4, SED1 genes using the protocol described by Marinangeli et al. (2004 a,b). All
the strains were also analysed by inter- PCR using the protocol described by Le Jeune el al. (2006), modified in
some steps, and by restriction analysis of mtDNA (RFLP-mtDNA). Total DNA was isolated by following the
protocol reported by Jeyaram et al. (2008), modified in some initial steps. Hinf I was used as the most suitable
restriction endonuclease to differentiate among S.cerevisiae strains. Similarities among combined fingerprints
were calculated using the Pearson productmoment correlation coefficient. Cluster analysis of the pairwise
values was generated using Wards method with the software Statistics for Windows, version 6.0 (Statsoft).
2.4 Fermentation tests
Two different white musts from Bosco (Cinque Terre) and Greco di Basilicata varieties were used to
evaluate strain fermentative performance. The fermentation tests were carried out in 95 ml grape must added of
50 ppm SO
2
, inoculated with 5 ml of 24h pre-cultures in the same must. The determination of weight loss (daily
monitored) was used as a parameter to follow the fermentation process. The samples were incubated at 25C
until the CO
2
evolution ceased, then refrigerated for 1 day at 2C, racked and stored at -20C until required for
15
th
165
15
th
analysis. The experimental wines were analyzed for the content of some secondary compounds, such as
acetaldehyde, ethyl acetate and higher alcohols. The wines were analyzed by injection of 2 l of fermented
samples, as reported by Romano et al. (2003a) into a 180 cm x 2 mm glass column packed with 80/120
Carbopack BAW 5% Carbowax 20M (Supelco). An Agilent 7890 gas chromatograph, equipped with a flame
ionization detector was used. The column was run from 70 C to 150 C at a rise rate of 4C/min. The carrier gas
was nitrogen at a flow rate of 20 ml/min. The results were elaborated by Agilent Chemtation software. Data
were underwent to statistical analysis by descriptive Box plots, using the software Statistics for Windows,
version 6.0 (Statsoft).
2.5 Microvinification test
Four selected strains were tested in five microvinifications. Inoculated fermentations were performed by the
four selected S. cerevisiae indigenous strains as single starter, whereas the last one was inoculated by mixed
starter, composed by an equal amount of each indigenous strain. The fermentation tests were carried out in 2
litres of Bosco grape must added with 50 ppm SO
2
, inoculated with 100 ml of 24h pre-cultures in the same
must. Three repetitions of each assay were performed. The arithmetic means and standard deviations were
calculated. A 1-way analysis of variance (ANOVA), along with the Tukey Kramer honestly significant
difference (HSD) were carried out using R 2.2.0. The determination of weight loss was used as a parameter to
follow the fermentation process. The samples were incubated at 25C until the CO
2
evolution ceased. The
experimental wines were submitted to gas-chromatographic analysis, as previously described. The molecular
traceability of the inoculated strains was performed, by using amplification of delta region, as previously
described.
2.5 Pilot scale test
Inoculated fermentations with two indigenous strains (one isolated from Cinque Terre vineyards, one isolated
from Nero dAvola grapes) and one commercial strain were performed in Cinque Terre wine cellar. Samples
were collected at different intervals (beginning, middle, end of the process) and the isolated colonies were
submitted to PCR amplification of sequences in order to evaluate the implantation capacity of the inoculated
strains. The wines were submitted to gas-chromatographic analysis (as previously described) and to sensorial
evaluation.
3.1 Identification assays
Among the 219 isolates analyzed, 132 isolates were ascribed to S. cerevisiae and 87 to non-Saccharomyces
(Hanseniaspora uvarum, Issatchenkia terricola, Torulaspora globosa, Candida stellata, T. delbrueckii,
Debaryomyces hansenii, Metschnikowia pulcherrima, Zygosaccharomyces bailii). A correlation between S.
cerevisiae species distribution and isolation area was found: 56% of S. cerevisiae were isolated from grapes
collected in vineyards at low altitude, 41% in vineyards at middle altitude and only 3% in vineyards at high
altitude.
3.2 Technological characterization
The wild S. cerevisiae strains were characterized for some parameters of technological interest. The results
obtained seem to indicate
the existence of a
significant level of
technological variability, as
shown in dendrogram
reported in figure 1. The
strains were distributed in
three main groups. The
group A includes the
strains characterized by
low copper and sulphur
dioxide resistances and
high decarboxilase activity;
furthermore, these yeasts
were isolated mainly from
the vineyards at middle
altitude. The group B
includes the strains with
high copper resistance
(300-500 M CuSO
4
),
middle sulphur dioxide
resistance and middle
5
T
M
6
3
3
5
T
M
6
3
0
5
T
M
6
2
9
5
T
M
6
2
6
5
T
M
6
4
0
5
T
M
6
2
8
5
T
M
6
2
4
5
T
M
6
3
5
5
T
M
6
3
4
5
T
M
6
2
5
5
T
M
6
2
3
5
T
M
6
2
2
5
T
M
6
4
4
5
T
M
6
4
3
5
T
M
6
2
1
5
T
B
8
3
8
5
T
B
8
3
7
5
T
B
8
2
3
5
T
B
8
1
0
5
T
B
8
8
0
M
2
6
5
T
B
8
2
2
5
T
B
8
6
6
M
1
9
5
T
B
8
3
9
5
T
B
8
2
8
5
T
B
8
7
8
5
T
B
8
2
7
5
T
B
8
4
0
5
T
B
8
3
5
5
T
B
8
2
9
5
T
B
8
6
3
5
T
B
8
3
0
5
T
B
8
2
6
5
T
B
8
7
9
5
T
B
8
6
1
5
T
B
8
5
4
5
T
B
8
2
5
5
T
B
8
2
4
M
4
1
5
T
B
8
6
8
5
T
B
8
6
7
M
2
5
5
T
B
8
4
7
5
T
B
8
6
5
M
2
2
5
T
B
8
6
0
M
7
3
M
5
9
5
T
B
8
9
M
2
9
5
T
B
8
6
2
M
1
5
M
4
2
M
1
3
5
T
M
6
2
0
5
T
M
6
1
9
5
T
M
6
1
8
5
T
M
6
1
7
5
T
M
6
1
5
5
T
M
6
1
4
5
T
M
6
1
3
5
T
M
6
1
2
5
T
M
6
1
1
5
T
A
5
5
5
T
A
5
4
5
T
M
6
1
6
5
T
M
6
1
0
5
T
M
6
9
5
T
A
5
3
5
T
B
8
7
0
5
T
B
8
5
5
T
B
8
6
4
5
T
B
8
7
3
5
T
B
8
7
2
5
T
B
8
6
9
5
T
B
8
3
6
5
T
B
8
2
1
5
T
B
8
2
0
M
6
5
5
T
M
6
3
9
5
T
M
6
3
2
5
T
M
6
3
1
5
T
M
6
2
7
5
T
B
8
7
7
5
T
B
8
7
1
5
T
B
8
5
9
5
T
B
8
5
3
0
10
20
30
40
50
60
L
i
n
k
a
g
e

D
i
s
t
a
n
c
e
C B A
Figure 1 Dendrogram based on data obtained from technological characterization of
wild S. cerevisiae
15
th
166
15
th
decarboxilase activity; these S. cerevisiae were isolated from vineyards at low altitude. The isolates
characterized by low copper resistance, high (300 ppm) sulphur dioxide resistance (300 ppm) and low
decarboxilase activity were included in the group C. On the basis of the results obtained by tecnological
characterization, 40 S. cerevisiae strains were selected for further characterization.
3.3 Molecular characterization
The 40 selected S. cerevisiae strains were submitted to molecular characterization. Cluster analysis of combined
molecular profiles obtained by amplification of AGA1, DAN4, SED1 genes, interdelta regions and mtDNA
restriction yielded dendrogram reported
in figure 2. The strains were distributed
in three main groups. The group A
includes strains isolated from grapes
collected in middle and high vineyards.
The group B includes strains showing
the same profile and isolated from mixed
sample (M). The group B represents the
most heterogeneous cluster, including
strains yielding different profiles, all the
stains belonging to this group were
isolated from grapes of low vineyards,
except M65 ad M5 strains. On the basis
of our results, PCR analysis of interdelta
region resulted the best method for S.
cerevisiae strains discrimination, as it
was fast and it showed a very high
discriminative power, so this technique
will be used for the subsequent analysis.
3.4 Fermentation tests
The 40 S. cerevisiae strains were submitted to fermentation assay. At the end of the process, the experimental
wines were analysed for the content of some by-products related to wine organoleptic quality. The determination
of the levels of the metabolites showed significant differences in the obtained wines (figures 3, 4), in particular
significant variability in the levels of acetic acid, d-amyl alcohol, n-propanol and acetaldehyde was found. These
results demonstrate that the production level of each compound is function of the strain performing the
fermentative process and also demonstred the combined influence of the strain metabolic characteristics and the
grape must composition, as reported for other strains and grape varieties (Fleet 2003; Romano et al. 2003;
Romano et al. 2008).
aceti c aci d
aceti c aci d
i soamyl al cohol
i soamyl al cohol
acetal dehyde
acetal dehyde
-200
0
200
400
600
800
1000
1200
1400
1600
1800
2000
2200
m
g
/
l
Mean SD Mi n-Max
G
G
G
B
B
B

3.5 Microvinification test:
On the basis of the previous molecular and technological characterizations, 4 strains were selected for inoculated
fermentations. Five fermentation trials were performed, four by inoculating
the four S. cerevisiae selected indigenous strains and one fermentation was
conducted by mixed starter. The implantation ability of each strain, both in
single and in mixed fermentations, was analyzed by using amplification of
delta region of yeasts colonies isolated during the process. In the 4
fermentations inoculated with one single strain, all the colonies isolated
showed the same profile of the starter. The results obtained for colonies
isolated during the mixed fermentation are shown in table 1. At the time 0,
the profiles of all the inoculated strains were found among the analyzed
colonies. Most of the colonies isolated in the middle of the process showed
the profile of 5TB8 60 and 5TM6 13 strains. At the end of fermentation all
the colonies isolated showed the profiles of 5TB8 60 and 5TM6 13 strains.
5
T
M
6

4
0
5
T
M
6

2
2
5
T
M
6

2
0
5
T
M
6

1
0
5
T
M
6

3
2
5
T
M
6

1
7
5
T
M
6

1
3
5
T
M
6

3
4
5
T
M
6

2
5
5
T
A
5

5
5
T
A
5

3
M
5
9
M
4
1
M
2
9
M
2
5
M
2
2
M
1
5
5
T
B
8

2
8
5
T
B
8

2
7
5
T
B
8

9
5
T
B
8

6
2
5
T
B
8

6
8
5
T
B
8

6
1
5
T
B
8

6
0
5
T
B
8

7
8
5
T
B
8

7
3
5
T
B
8

7
1
5
T
B
8

7
0
5
T
B
8

5
3
5
T
B
8

3
7
5
T
B
8

2
3
5
T
B
8

2
2
5
T
B
8

3
5
5
T
B
8

3
0
5
T
B
8

2
9
5
T
B
8

2
0
5
T
B
8

5
M
6
5
M

5
0
1
2
3
4
5
6
7
8
L
i
n
k
a
g
e

D
i
s
t
a
n
c
e
C A B

ethyl acetate
ethyl acetate
n-propanol
n-propanol
isobutanol
isobutanol
D-amyl alcohol
D-amyl alcohol
0
20
40
60
80
100
120
140
160
180
m
g
/
l
Mean SD Min-Max
G
G
G
G
B
B
B B
Figure 2 Wards cluster analysis of combined molecular profiles obtained
by amplification of AGA1, DAN4, SED1 genes, interdelta regions and
mtDNA restriction.

Figures 3-4
Level of secondary
compounds
determined in Greco
di Basilicata (G) and
Bosco (B)
experimental wines
produced by 40 S.
cerevisiae strains

Strains
0* 5* 7* 20*
5TB8 60 6 10 10 10
5TB8 30 2 2
- -
5TB8 20 5 1 1
-
5TM6 13 6 7 9 10
showing patterns of strains
included in mixed starter
*Isolat ion phase
No. of colonies
Table 1 Distribution of profiles
of colonies isolated from mixed
fermentations
15
th
167
15
th
The results obtained by gas-chromatographic analysis of experimental wines are shown in table 2.

Strains
Acetaldehyde***
(mg/l)
Ethyl acetate**
(mg/l)
Propanol***
(mg/l)
Isobutanol
(mg/l)
Acetic acid***
(mg/l)
D-amyl alcohol*
(mg/l)
Isoamyl alcohol**
(mg/l)
mista 20.51 0.42 73.60 0.69 52.28 0.23 63.57 1.23 556.10 17.61 59.04 5.83 260.48 4.55
5TB8 60 19.54 1.37 70.72 1.82 50.14 0.63 63.91 4.85 550.14 67.41 45.55 3.42 232.42 18.29
5TB8 20 18.96 0.45 70.71 0.42 51.70 0.17 58.77 0.86 422.58 45.45 55.18 0.47 225.64 2-86
5TB8 30 17.52 1.41 74.42 1.46 51.53 0.41 62.72 2.85 1019 77.07 54.51 7.30 237.41 13.84
5TM6 13 24.88 0.90 70.30 0.99 54.30 0.34 64.16 1.51 740.95 26.41 53.96 1.14 258.91 5.07
F ratio 23.05 0,34 1,88 0,09 2,50 0,17 0,28

Table 2 Main secondary compounds determined in experimental wines.
0.10 <P < 0.05; * P < 0.05; ** P < 0.01; ***P < 0.001. Values are reported as means.

Analysis of variance (ANOVA) showed the presence of strain-specific difference (p 0.05) among the isolates
for all the compounds, except for the isobutanol, for which no significant differences among the wines produced
with different starters were found.
3.6 Pilot scale test
The strain 5TB8 60 was chosen for inoculated fermentation at pilot scale, in comparison with a commercial
starter and a selected indigenous strain, isolated from another area. The implantation ability of each strain, was
tested by using amplification of delta region, as previously reported. Both 5TB8 60 and commercial strains
showed a very high implantation ability (96 and 98%, respectively). Otherwise, the other indigenous strain
exhibited a very low implantation capacity; in fact, only 6% of colonies showed profiles of the inoculated strain,
11 different molecular patterns were found among analyzed colonies and, among these, one profile was
dominant (60%). In this case, the fermentation might be conducted by a strain different from the inoculated
starter. In added gas-chromatographic analysis of the wines were conducted.
4. Conclusions
The results of the present study provided an overview of the yeast community of Cinque Terre vineyards, which
was shown to be complex and rich in different microbial species and strains.
The polyphasic approach utilized in this PhD thesis, based on molecular and phenotypic analyses, revealed an
high diversity of the indigenous Cinque Terre S. cerevisiae strains, among which it was possible to select
strains as starter cultures. In addition, the results obtained by the evaluation of implantation ability of yeast
starters, revealed the importance of the inoculated fermentation monitoring. These results emphasize that, in
order to assure the final quality of wine, the capacity of a selected isolate to dominate the inoculated
fermentation represents an important feature to be evaluated in all wine yeast selection programmes.
4. References
Esteve-Zarzoso B, Gostncar A, Bobet R, Uruburu F, Querol A (2000) Selection and molecular characterization of wine
yeasts isolated from the El Peneds area (Spain). Food Microbiol 17:553-562.
Fleet, G.H. (2003) Yeast interactions and wine flavour. Int J Food Microbiol 86: 1122.
K. Jeyaram , W. Mohendro Singh , Angela Capece , Patrizia Romano. (2008) Molecular identification of yeast species
associated with Hamei- A traditional starter used for rice wine production in Manipur, India. Int J Food Microbiol
124: 115-125.
Le Jeune C, Erny C, Demuyter C, Lollier M. (2006) Evolution of the population of S.cerevisiae from grape to wine in a
spontaneous fermentation. Food Microbiol 23: 709716
Manzanares P, Rojas V, Genovs S, Velles S. (2000) A preliminary search for the anthocyanin- -D- glucosidase
activity in non-Saccharomyces wine yeasts. Int J Food Sci Tecnol 35: 95-103
Marinangeli P, Angelozzi D, Ciani M, Clementi F, Mannazzu I. (2004) Minisatellites in Saccharomyces cerevisiae
genes encoding cell wall proteins: a new way towards wine strain characterisation. FEMS Yeast Res 4: 427-435.
Romano P, Fiore C , Paraggio M, Caruso M, Capece A. (2003) Function of yeast species and strains in wine flavour
diversity. Int J Food Microbiol 86: 169-180.
Romano P. and Capece A. (2007) Yeast/Vine interaction as selection tool to optimize wine typicality, Acta
Horticulturae 754: 125-132.
Romano P, Capece A, Serafino V, Romaniello R, Poeta C. (2008) Biodiversity of wild strains of
Saccharomyces cerevisiae as tool to complement and optimize wine quality. World J Microbiol Biotechnol
24:17971802
R Development Core Team: R: A language and environment for statistical computing. 2005 [http://www.R-project.org].
R Foundationfor Statistical Computing, Vienna, Austria.
15
th
168
15
th
Research on Filterability Characteristics of Beer and Optimisation of
Filtration Process
Michele Sensidoni (sensidoni.michele@yahoo.it)
Tutor: Prof. Paolo Fantozzi

This Phd research project is aimed at the identification and the analytical evaluation of the existing correlations
between the filterability characteristics of beer and the several stages of beer and malt production, trough
different technological trials on malting, brewing and beer filtration on pilot-scale plants.
Ricerca sulle caratteristiche di filtrabilit della birra e ottimizzazione del processo di
filtrazione
Questo progetto di dottorato si pone come obiettivo quello di identificare e valutare le correlazioni esistenti tra le
caratteristiche di filtrabilit della birra e le fasi di processo della sua produzione e della produzione delle sue
materie prime, attraverso lo svolgimento di prove tecnologiche di maltazione,birrificazione e filtrazione
tangenziale su scala pilota.

Key words: Beer filtration; beer filterability; crossflow filtration.
1. Introduction
This oral communication reports the main results of the following four activities:
A1) Installation of a malting pilot plant and execution of several malting trials with different cultivars of barley.
A2) Execution of several analysis over the malts obtained in order to quantify the most important compounds
associated with filtration efficiency (e.g. !-glucan).
A3) Production of beer on a pilot-scale plant experimenting different brewing methods and process parameters to
determine their influence on filtration performance and efficiency.
A4) Beer filtration on pilot-scale plants with different filtration technologies, testing several process parameters.
Filtration flux, quality and chemical composition of the filtrate was evaluated.
2. Beer filtration
Nowadays brewing industries have a strong necessity to improve and to optimise filtration processes during the
wort production stage and before the bottling process.In fact filtration is considered the bottle-neck stage in beer
production. This unit operation is critical for the quality level of the final product, with a relevant impact on
process management (Back et al., 2007). All along, these two factors have conditioned the research of different
solutions which could help controlling this stage and predicting potential problems linked with the beer filtration
(Annemueller et al., 2001). Beer filtration with kieselghur filters is currently the most common technology
adopted by beer industries. However kieselghur is regarded as carcinogen when inhaled (Hansen, 2001), because
of its content of crystalline silica. Furthermore this filter aid is not re-generable and its disposal as a waste after
the filtration process is difficult and expensive because of the organic residuals (Christofer, 2003).
For these reasons, beer industry started implementing alternative kieselghur-free filtration technologies like
membrane filtration and cross-flow filtration. The filterability describes the attribute of wort or beer to influence
the filtration process (Raible, 1990), therefore quality parameters are rise of the pressure at the filter entrance and
the turbidity of the filtrate. It is assured that high molecular ingredients influence filterability; these are
polysaccharides, proteins, polyphenols, yeast. Malt polysaccharides like "-glucan, pentosane and above all !-
glucan may cause various difficulties during filtration (Allosio-Ouarnier et al.; 2005). It is proven that the risk of
filtration problems rises with a higher amount of high molecular polysaccharides (Kreisz, 2001), but the intensity
of their influence may change during the filtration process.
3.1 Installation and start-up of a micro-malting plant
A micromalting plant to produce up to 32 kilograms of malt was installed. During the development of the
machine one barley variety from a single production lot was used, in order to be able to minimize variations due
to raw material and to single out the variations due to the process. The second phase of development of the
15
th
169
15
th
machine involved the identification of a steeping program suitable for Italian barley crops. Six varieties were
selected: Barke, Cheri, Henley, Puffin, Regina and Scarlett. Different analysis were carried out on the barley
samples, including the content of -glucan (Megazyme Test Kit). The !glucans content found in barley is
reported in Table 1.

Table 1. !-glucan content of barley and malt samples
Barley Malt
Variety sample
!-glucan
%w/w
sd
!glucan
%w/w
sd
!-glucan
reduction %
BARKE 445 2.85 0.07 0.64 0.01 77%
CHERI 446 3.71 0.10 1.11 0.01 70%
HENLEY 447 3.24 0.14 0.78 0.02 75%
PUFFIN 448 2.94 0.08 1.25 0.03 57%
REGINA 449 3.00 0.04 1.32 0.12 56%
SCARLETT 450 4.11 0.10 0.62 0.07 85%

Concerning the !-glucan reduction during steeping and germination, the barley sample 450 showed the highest
reduction (85%), although the corresponding barley sample had the highest !-glucan content. This can be
explained with a larger !-glucanase enzyme activity, which is synthesized during the germination phase.
Samples 445 and 447 also demonstrated a good reduction.

3.2 Beer production on a pilot-scale plant
the malts obtained were used for beer production on a pilot plant to produce 110 liters of wort. The program for
the mashing and fermentation parameters used are reported in Table 2 and Table 3.

Table 2: brewing process parameters Table 3: fermentation parameters
WORT PRODUCTION FERMENTATION
Temperature (
o
C) Time (min) Phase Temperature (
o
C) Time (day) Phase
52 20 Protease 12 6 Fermentation
65 30 Beta-amylase 14 2 Dyacetil Rest
72 20 Alfa-amylase 2 15 Lagering
76 15 Saccharification 2 15 Storage

The beers produced were standard lager recipe, with an original gravity of 11-12P, an alcohol content from 4.5
to 5.1 % v/v and a colour from 6 to 8 EBC units (Table 3). During beer production several parameters were
monitored, including the !-glucan content of the final product, which is reported in Table 4.

3.3. Beer filtration on a pilot scale plant
For the activity on the filtration of beer was taken into account the tangential membrane filtration technology.
Several type of membranes were tested on a pilot-scale filtration plant.
For the first two tests (Figure 1 and 2) a polypropylene membrane was used, with a nominal porosity of 0.25 m
and a filtration surface area of 0.9 m
2
, formed by 350 capillaries with an internal diameter of 1.8 mm. During the
test the transmembrane pressure was maintained around 2.0 bars. The first test was carried out with a
recirculation flow around values of 5 m
3
/h, corresponding to a crossflow velocity on the membrane of 1.55 m/s.
As shown in Figure 1, pressure changes between the two sides of the membrane (transmembranic pressure),
corresponding with changes in flow recirculation occurred and resulted in a progressive decrease in the permeate
flow.
The final turbidity of the filtrate was found to be 0.4 EBC (Table 4), a value that can be judged positively
considering modern membrane filters specifications.
For the second test (Figure 2) with polypropylene membrane, the parameter of the recirculation flow was
maintained at 4 m
3
/h. The speed reduction of the flow on the membrane resulted in a more regular trend of the
filtration run. The most evident effect of this uniformity is the flow rate of the permeate (L/h/m
2
) that appears to
be constant for more than half the entire brewing cycle. Even the parameter of the transmembrane pressure was
stable at values of 0.8 1.0 bar, remaining steady during the filtration trial. All these factors have contributed to
prolonging the filtration efficiency of the membrane preventing premature occlusion of its porosity.

15
th
170
15
th

Figure 1 Trend of the first trial of crossflow filtration with a polypropylene membrane.

Trial 2: filtration with a polypropylene membrane
0
1
2
3
4
5
6
0' 10' 20' 30' 40' 50' 60' 70' 80' 90' 100'110' 120' 130' 140' 150' 160' 170' 180' 190' 200'210'
Time (min)
0
10
20
30
40
50
60
70
Crossflow rate Transmembrane pressure (bar)
Plato (P) Grado Plato
Permeate flow (L/h/m2) Total permeate

Figure 2 Trend of the second trial of crossflow filtration with a polypropylene membrane.

The second membrane tested (Figure 3 and 4) was a ceramic membrane (aluminum oxide) with a nominal
porosity of 0.8 m and a filtering surface area of 0.8 m2, consisting of 290 capillaries with an inner diameter of 3
mm. In the first filtration run (Figure 3), due to the bigger nominal porosity of the membrane, the permeate flow
is initially high (125 L/h/m
2
). This value, however, decreases rapidly due to fouling and occlusion of the pores.
This phenomenon is reflected in the values of the permeates turbidity, which amounted to around 2 EBC, while
the permeate flux was around values of 15 L/h. Figure 3 shows how the occlusion of the pores has increased the
transmembrane pressure which reached a peak of 5.2 bar and then stabilized until the end of the trial around
values of 4 bar. In the second filtration trial (Figure 4) with ceramic membrane the recirculation flow was
maintained at values of 7.0 m
3
/h. This has led to an increase of transmembrane pressure. Despite the application
of these different process parameters, the permeate flow showed the same trend, starting from 125 L/h/m
2
and
decreasing rapidly to 12 15 L/h/m
2
.

Trial 3: filtration with a ceramic membrane
0
1
2
3
4
5
6
0' 15' 30' 45' 60' 75' 90' 105' 120' 135' 150' 165' 180'
Time (min)
0
20
40
60
80
100
120
140
Crossflow rate Transmembrane pressure (bar) Turbidity (EBC)
Plato (P) Permeate flow (L/h/m2) Totali permeate

Figure 3 Trend of the first trial of crossflow filtration with a ceramic membrane

15
th
171
15
th
Trial 4: filtration with a ceramic membrane
0
1
2
3
4
5
6
7
8
0' 10' 20' 30' 40' 50' 60' 70' 80' 90' 100'110' 120' 130' 140' 150'160' 170' 180' 190' 200'210' 220230
Time (min)
0
20
40
60
80
100
120
140
Turbidity (EBC) Plato (P)

Figure 4 Trend of the second trial of crossflow filtration with a ceramic membrane

The third membrane tested is made of polyvinylidene (PVDF), with a spiral layout. The nominal porosity of the
membrane is 0.30 m, with a filtering surface area of 1.5 m2. In the first test with the PVDF membrane the
recirculation flow was set at 2 m3/h and the transmembrane pressure was 1 bar. The permeate flow rate (L/h/m2)
of the membrane was found to be lower than those experienced before. Despite this, high persistence over time
of this parameter allowed to carry out filtration tests extended over time and obtaining a total amount of
permeate comparable with other tests. In the second test (Figure 5) the same process parameters were adopted,
but the trial was extended for further 70 minutes to check the performance of membrane over time. Figure 5
shows how even in this test the parameters of the permeate flow rate and its turbidity kept consistent.

Trial 6: filtration with a polyvinyldene membrane
0
0.5
1
1.5
2
2.5
3
3.5
0' 15' 30' 45' 60' 75' 90' 105'120'135'150'165'180'195'210'225 240 255270285300
Time (min)
0
20
40
60
80
100
Turbidity (EBC) Plato (P)

Figure 5 Trend of the second trial of crossflow filtration with a polyvinyldene membrane
15
th
Table 4 Analysis of unfiltered and filtered beer samples.

Plato
Degree
Alchol
%vol.
Apparent
Extract
Real
Extract
Colour
Total
Nitrogen
Viscosity Turbidity !-glucan
Unfiltered Beer 11,4 5,1 1,9 3,5 6,7 938,0 1,5 14,8 203,0
T
r
i
a
l

1

Filtered Beer 11,1 4,5 1,7 3,3 5,7 855,0 1,4 0,4 175,0

Unfiltered Beer 12,6 5,7 1,9 3,9 8,8 970,0 1,6 39,5 214,0
P
o
l
y
p
r
o
p
i
l
e
n
e

T
r
i
a
l

2

Filtered Beer 12,2 5,6 1,7 3,7 7,7 910,0 1,4 0,3 88,0

Unfiltered Beer 11,6 5,1 2,0 3,8 6,2 947,0 1,5 15,6 206,0
T
r
i
a
l

3

Filtered Beer 11,0 4,6 2,3 4,0 6,1 851,0 1,5 1,4 179,0

Unfiltered Beer 12,2 5,2 2,5 4,4 7,0 1045,0 1,6 19,0 212,0
C
e
r
a
m
i
c

T
r
i
a
l

4

Filtered Beer 11,9 4,9 2,8 4,5 7,0 987,0 1,5 1,6 158,0

Unfiltered Beer 11,8 4,7 3,0 4,7 6,2 887,0 1,5 26,4 222,0
T
r
i
a
l

5

Filtered Beer 11,1 4,5 2,6 4,3 5,2 758,0 1,5 0,2 87,0

Unfiltered Beer 12,4 5,2 2,6 4,5 7,8 1047,0 1,5 31,9 301,0
T
y
p
e

o
f

m
e
m
b
r
a
n
e

P
V
D
F

T
r
i
a
l

6

Filtered Beer 12,1 4,4 2,5 4,4 7,4 1043,0 1,4 0,6 96,0

Beer filtration strongly influences the quality of the final product. Nowadays brewing operations are required to
improve and to optimise filtration processes in order to assure a consistent product and to prolong its shelf-life.
This unit operation is critical for the costs associated with it and has a significant impact on the overall process
management. These issues have promoted investigations into improved control of this stage giving significant
incentives to explore the implementation of alternative kieselguhr-free filtration technologies such as cross-flow
filtration. Cross flow filtration using polypropilene (PP), polyvinildenfluorure (PVDF) or ceramic membranes is
commercially available and shows potential to supersede kieselguhr filtration.
The economic viability of these types of membranes is due to their improved cost efficiency, the reduction of
disposal costs of process aids and other process efficiencies. Nevertheless, there is scope for research into the
most suitable process parameters to employ with cross-flow filtration of beer. The aim of this work was to single
out the effect of variation of the different process parameters on the efficiency of filtration and on the quality of
filtered beer. Aspects of beer quality are impaired in membrane filtration early in the run and also if the
membrane becomes fouled beyond a certain tolerable level. There is a need to minimise this effect, in order to
make beer quality at least as good as other filtration techniques. This study quantifies these effects and should
enable improved operation of filters and specifications of membranes.
5. References
Allosio-Ouarnier N, Boivin P (2005) Arabinoxylans and filtration capability. In Proc.s of the 30th Congress of the European
Brewery Convention, Prague.
Annemueller G, Marx R, Gottkehaskamp L (2001) A particle meter for verification of filtration quality. J Brauwelt
International 19 :187-191.
Back W, Gast M, Hartmann K, Herrmann M, Keler M, Kreisz S, Krottenthaler M, Mezeger R, Schneeberger M, Zarnkow M
(2007) Analitycal monitoring methods for optimisation of technological processes part.!!. Brauwelt Int. 3::316-322.
Christofer G (2003) The impact of Diatomite filter aid on beer flavour. J M. B. A. A. 40(4): 290-292.
Hansen NL (2001) From filter presses over centrifuges to cross flow and vibrating membrane filtration. Technical-Quaterly,
Master Brewers-Association of the America 38(2): 117-121.
Kreisz S, Hartamann K, Back W (2001) Influence des polysaccharides de levure et de bacterier sur la filtrabilt du mout et de
la biere. EBC congress in Budapest.
Raible K, Heinrich Th, Niemsch K (1990) Eine einfache neue Methode zur Bewertung der filtrationseigenschaften von bier.
Msch Brauwiss 43: 65-260.
15
th

Plato
Degree
Alchol
%vol.
Apparent
Extract
Real
Extract
Colour
Total
Nitrogen
Unfiltered Beer 11,4 5,1 1,9 3,5 6,7 938,0 1,5 14,8 203,0
T
r
i
a
l

1

Filtered Beer 11,1 4,5 1,7 3,3 5,7 855,0 1,4 0,4 175,0

Unfiltered Beer 12,6 5,7 1,9 3,9 8,8 970,0 1,6 39,5 214,0
P
o
l
y
p
r
o
p
i
l
e
n
e

T
r
i
a
l

2

Filtered Beer 12,2 5,6 1,7 3,7 7,7 910,0 1,4 0,3 88,0

Unfiltered Beer 11,6 5,1 2,0 3,8 6,2 947,0 1,5 15,6 206,0
T
r
i
a
l

3

Filtered Beer 11,0 4,6 2,3 4,0 6,1 851,0 1,5 1,4 179,0

Unfiltered Beer 12,2 5,2 2,5 4,4 7,0 1045,0 1,6 19,0 212,0
C
e
r
a
m
i
c

T
r
i
a
l

4

Filtered Beer 11,9 4,9 2,8 4,5 7,0 987,0 1,5 1,6 158,0

Unfiltered Beer 11,8 4,7 3,0 4,7 6,2 887,0 1,5 26,4 222,0
T
r
i
a
l

5

Filtered Beer 11,1 4,5 2,6 4,3 5,2 758,0 1,5 0,2 87,0

Unfiltered Beer 12,4 5,2 2,6 4,5 7,8 1047,0 1,5 31,9 301,0
T
y
p
e

o
f

m
e
m
b
r
a
n
e

P
V
D
F

T
r
i
a
l

6

Filtered Beer 12,1 4,4 2,5 4,4 7,4 1043,0 1,4 0,6 96,0

5. References
15
th
172
15
th

Plato
Degree
Alchol
%vol.
Apparent
Extract
Real
Extract
Colour
Total
Nitrogen
Unfiltered Beer 11,4 5,1 1,9 3,5 6,7 938,0 1,5 14,8 203,0
T
r
i
a
l

1

Filtered Beer 11,1 4,5 1,7 3,3 5,7 855,0 1,4 0,4 175,0

Unfiltered Beer 12,6 5,7 1,9 3,9 8,8 970,0 1,6 39,5 214,0
P
o
l
y
p
r
o
p
i
l
e
n
e

T
r
i
a
l

2

Filtered Beer 12,2 5,6 1,7 3,7 7,7 910,0 1,4 0,3 88,0

Unfiltered Beer 11,6 5,1 2,0 3,8 6,2 947,0 1,5 15,6 206,0
T
r
i
a
l

3

Filtered Beer 11,0 4,6 2,3 4,0 6,1 851,0 1,5 1,4 179,0

Unfiltered Beer 12,2 5,2 2,5 4,4 7,0 1045,0 1,6 19,0 212,0
C
e
r
a
m
i
c

T
r
i
a
l

4

Filtered Beer 11,9 4,9 2,8 4,5 7,0 987,0 1,5 1,6 158,0

Unfiltered Beer 11,8 4,7 3,0 4,7 6,2 887,0 1,5 26,4 222,0
T
r
i
a
l

5

Filtered Beer 11,1 4,5 2,6 4,3 5,2 758,0 1,5 0,2 87,0

Unfiltered Beer 12,4 5,2 2,6 4,5 7,8 1047,0 1,5 31,9 301,0
T
y
p
e

o
f

m
e
m
b
r
a
n
e

P
V
D
F

T
r
i
a
l

6

Filtered Beer 12,1 4,4 2,5 4,4 7,4 1043,0 1,4 0,6 96,0

5. References
15
th
173
15
th
Study of Innovative Methods of Control in the Cereal Productive Chain for
the Production of Beer and Spirits
Valeria Sileoni (e-mail: vale.sileoni@tiscali.it)
Dept. Economical and Food Science, University of Perugia, Italy
Tutor: Dr. Giuseppe Perretti

This PhD thesis research project is aimed at assessing innovative applications of Near-Infrared Spectroscopy in
Reflectance (NIR) in the production chain of beer. The purpose is to measure, through this rapid, non-destructive and
reliable method, the "malting quality" (MQ) parameter of barley, to predict whether if its germination will be rapid
and uniform, to monitor the malting process and to know if a certain type of barley is suitable for the production of
beer and spirits. Moreover, NIR will be applied to monitor the brewing process, by finding correlations between NIR
spectra of beer and analytical and process parameters.
Studio di metodiche di controllo innovative nella filiera cerealicola per la produzione di
birra e distillati
Questa tesi di dottorato di ricerca finalizzata a valutare applicazioni innovative della spettroscopia NIR nella catena
di produzione della birra. Lo scopo quello di misurare, attraverso questo metodo rapido, affidabile e non distruttivo,
la "qualit di maltazione" (MQ) dell'orzo, di prevedere se la sua germinazione sar rapida e uniforme, di monitorare
il processo di maltazione e di capire se un certo tipo di orzo adatto per la produzione di birra e distillati. Inoltre, il
NIR verr applicato al monitoraggio del processo di fermentazione, trovando correlazioni tra gli spettri NIR della
birra e dati sia analitici che di processo.

Key words: NIR spectroscopy; calibration; barley malt; malting and brewing.
1. Introduction
In accordance with the PhD thesis project previously described (Sileoni, 2008), this oral communication reports the
main results of the following five activities directed to:
A1) Definition and determination of the barley and maize main quality parameters, according to the official
analytical methods.
A2) Acquisition of NIR spectra on barley and maize samples (grains, gritz or flour) and elaboration of calibrations
with data collected as illustrated in point A1.
A3) Use of barley samples in micro-malting pilot plant. Monitoring the process through on-line analytical
determinations, that will be related to NIR spectra. Assessment of malt quality, following the official analytical
methods, and development of calibration between NIR spectra and quality parameters.
A4) Search for a correlation between the quality of malt and the barley NIR spectra.
A5) Use of samples of malt in micro-brewing pilot plants. Monitoring the process through on-line analytical
determinations that will be related to the NIR spectra of wort and beer sampled during the process. Assessment of
beer quality, following the official analytical methods, and development of calibration between NIR spectra and
quality parameters.
2. NIR Spectroscopy
The near-infrared spectroscopy in reflectance (NIR) is a non-destructive, rapid and effective technology for
predicting simultaneously multiple components in food products (Huang et al., 2008). Because of their
characteristics, cereals are extensively investigated by means of NIR spectroscopy and many calibrations to assess
their composition are been developed (Maertens et al., 2004). Moreover, due the capability of NIR spectroscopy to
measure quickly, easily and reliably the amount of water and organic molecules, such as starch, proteins, oils, fibres,
ashes, acids, sugars and ethanol, this analytical technique is considered suitable to be applied to beer production
chain. In particular, concerning the production of beer, NIR spectroscopy has found implementation in the analysis
of raw materials (Nielsen et al., 2002), intermediates (Sjholm et al., 1996) and finished products (Inon et al., 2006),
and in process control (McLead et al., 2009).
15
th
174
15
th
Various types of brewing barley, differing for varietal, agronomic and environmental factors, were produced in the
experimental fields of the Faculty of Agriculture of Perugia. These barley samples were malted by a micro-malting
pilot-plant (Custom Product Laboratory, UK). Other malt samples were supplied from different industrial malt-
houses and mills from 2006 to 2010, and they can be considered representative of the ones available on the Italian
market as well as maize samples. Some of the malt samples were processed in a pilot scale plant (Braumaister,
Feltre, I) programmed in order to produce 25 liters of wort suitable for pilsner beer type. NIR spectra were
recorded on all the different kind of samples (barley, green-malt, malt, maize, wort and beer) by means of a Vector
22/N FT-NIR spectrometer system, equipped with tungsten source, RocksolidTM interferometer, fiber-optic module
equipped with Ge-Diode detector and an integrating sphere module equipped with PsS detector for spectra
acquisition in diffuse reflectance (Bruker Optics, Milan, Italy). All spectra were recorded on a quartz-bottomed cup
placed on the integrating sphere optics and, to compensate for the lack of homogeneity, the sample was spinning
during the measurement (10 rpm). Absorption spectra were collected at room temperature against a gold-coated
background by means of OPUS software (version 5.5 or 6.5, Bruker Optics) in the in the spectral range of 11,500
4,000 cm
1
with a resolution of 8 cm
1
using 64 scans for averaging (the same number of scans was also used for the
background). The standard methods from the Analytica European Brewery Convention (A-EBC) were used as
reference analyses. All operations involving the calibration model (spectral data pretreatments, selection of the
spectral dataset, construction of PLS regression model and its validation) were carried out by MATLAB software
(version 7.6) and in-house routines or OPUS software (version 5.5 or 6.5, Bruker Optics).The predictive performance
of the calibration model was quantitatively evaluated through the correlation coefficient (R) between the true
values (x
i
) chemically determined, and the values predicted by the model (y
i
), calculated as described in Equation
(1), where N is number of the samples in the calibration or validation-set. Another important parameter for the
evaluation of a calibration model is the Root Mean Square error of Prediction (RMSEP) calculated as described in
Equation (2).

(1)

(2)
4.1 Raw Materials Barley and Maize
Concerning the analysis of raw materials (Objectives A1 and A2) reasonable calibration models have been developed
to determine the parameters of interest on malting barley and maize.
About the maize, NIR spectra of gritz and flour samples were acquired and correlated with the relative humidity and
fat content by PLS algorithm (Partial Least Squares). The calibration models were developed using the software
OPUS 6.5, which through the OPTIMIZE tool allows the choice of the pretreatment and the spectral range most
suitable for obtaining the best correlation with the parameter of interest. Then, by choosing the proper number of
principal components to describe the spectral matrix, and through the identification and the elimination of outliers,
we obtained good calibrations, which have been validated by both cross-validation leave-one-out (CV loo) and test
set validation by eliminating 33% of samples in calibration and using these samples to calculate the error of
prediction (TS 33% out). In addition, these calibration models were validated using the methodology described in the
manual UNICHIM 2001. For this reason, 10 spectra of the same sample were acquired, and the calibration models
have been applied on these spectra to determine the parameters of interest. First, it was verified that the average
predicted values fell within the range defined by the value chemically determined and the expanded uncertainty of
the method. Subsequently, the standard deviations calculated on the 10 predicted values were compared using
Fisher's test with the reference methods one, with good results (Marte et al., 2009; Sileoni et al., 2010a). The
calibration models relative to maize gritz are characterized by lower values of R

and higher values of the RMSEP
(both CV and TS) parameters than the ones obtained from the finely ground cereals. This behaviour, which is
observed for all the analytes, can be understood by considering that the light beam can have a better interaction with
all the parts of the seeds when they are milled and of course the samples in form of flour are more homogeneous than
the whole grains. All the results are shown in Table 1.
15
th
175
15
th
Table 1 Results of NIR calibrations for the determination of the quality parameter of maize.

Maize Flour Maize Gritz
Parameter Range
RMSEP CV loo
(TS 33% out)
R CV loo
(TS 33% out)
RMSEP CV loo
(TS 33% out)
R CV loo
(TS 33% out)
Moisture % 12.42415.213 0.074 (0.080) 0.99 (0.98) 0.127 (0.152) 0.97 (0.96)
Total Lipids % as is 0.4721.306 0.042 (0.044) 0.96 (0.95) 0.065 (0.066) 0.92 (0.90)
Total Lipids % dry matter 0.5511.525 0.054 (0.055) 0.95 (0.94) 0.070 (0.079) 0.93 (0.90)

Concerning malting barley, NIR spectra were acquired on 20 samples of whole grains and used to develop
calibrations able to correlate these spectra with the parameters of relative humidity, total nitrogen content and weight
of a thousand grains. The process followed to develop the calibrations was the same adopted for the calibrations on
maize. The results were satisfactory, with coefficients of determination always greater than 0.87.

4.2 Malt quality and monitoring the malting process.
Then, as regards the objective A3, a process control using NIR spectroscopy applied to malting process has been
implemented. During malting process, the spectra were collected daily on samples of green malt at-line, i. e. outside
the production line but during the process, in real time. At the same time of the spectra acquisition, the green malt
water content was determined. Subsequently, a calibration model was developed to relate the spectra acquired on
green malt with their moisture. The calibration model, obtained using 228 spectra and as many corresponding
relative humidity values, was generated by PLS algorithm and validated by cross validation, showing a good degree
of predictability. Indeed, the value of R was 0.92 and the prediction error was lower than 2%. This result suggests
that it is possible, during the malting process, measure the moisture content on germinating barley using an at-line,
accurate and not destructive NIR method. Furthermore, calibration models were developed to monitor other
important parameters to evaluate the performance of malting barley by NIR spectra. These models were developed
on the assumption that some important parameters for the assessment of malt quality, which analytically are
determined on the dried malt, are "visible" to the NIR already on the green malt. Then, the spectra of green malt
collected during the last day of germination were correlated with some analytical parameters determined on the
corresponding malts after drying by PLS algorithm. Again, the OPUS software was used for the purpose and the
procedure was the same used for maize and barley. The calibration models obtained were validated through cross-
validation (CV) and allowed a good prediction performance. Specifically, the best calibrations were obtained for
FAN (Free-Amino-Nitrogen, mg/l), Kolbach Index, fermentability (%) viscosity (cP) and friability (%) with R values
greater than 0.90 (Sileoni et al., 2009a). The results shown in Table 2 are very encouraging and will be deepened in
the last year, also extending the study to the earlier days of germination, to verify the feasibility of using NIR
monitor the germination process by assessing how they are evolving the most important quality parameters of malt.
This possibility would be extremely important for maltsters, which could change the process causing acceleration or
deceleration of germination varying the parameters of humidity and temperature.

Table 2 Results of NIR calibrations for the determination of the quality parameter of green malt.

Fine
Extract
(% as is)
Fermentability
(%)
Hartong
Extract
(%)
Total
Nitrogen
(% as is)
Soluble
Nitrogen
(% dm)
Kolbach
Index
FAN
(mg/l)
Friability
(%)
Viscosity
(cP)
Range 70.9-77.7 76.4-83.6 23.1-46.9 1.60-1.85 0.53-0.75 29.8-47.7 101-193 39.1-89.5 1.44-2.33
R 0.82 0.91 0.95 0.88 0.71 0.90 0.95 0.90 0.97
RMSEP CV 0.7 0.8 2.7 0.03 0.05 1.7 6 5.5 0.70

Still inside the objective A3, several calibration models were developed to allow a full assessment of the malt quality
by NIR spectroscopy. The spectra were acquired on flour and whole grains of more than 200 samples of malt, always
using diffuse reflectance and quartz cuvette placed on rotating sample holder. The spectra acquired on both matrices
were used to develop calibrations for determining the classic parameters of interest on malt, such as moisture and
total nitrogen content. The predictability of the calibration models obtained was good (Table 3), and also the
repeatability of the methods developed was comparable with the one of the primary methods (Marte et al., 2009;
Sileoni et al., 2010a).

15
th
176
15
th
Table 3 Results of NIR calibrations for the determination of the moisture and total nitrogen content of barley malt.

Malt Flour Malt Grain
Parameter Range
RMSEP CV loo
(TS 33% out)
R CV loo
(TS 33% out)
RMSEP CV loo
(TS 33% out)
R CV loo
(TS 33% out)
Moisture % 0.521 7.155 0.097 (0.100) 0.989 (0.991) 0.132 (0.165) 0.979 (0.976)
Total Nitrogen % as is 1.234 1.930 0.026 (0.042) 0.964 (0.924) 0.043 (0.048) 0.883 (0.848)
Total Nitrogen % dry matter 1.296 2.034 0.024 (0.029) 0.970 (0.950) 0.046 (0.053) 0.854 (0.843)

In addition, various calibration models have been developed for the determination of other malt quality parameters.
Compared to the models of the first year of PhD (Sileoni et al., 2009b), the calibrations have been improved
implementing new spectra acquired during 2008, 2009 and 2010 and especially using advanced chemometric
methods that have allowed refinement of the models, mainly concerning the selection of the spectral bands (interval-
PLS algorithm) and new spectral pretreatments (Extended Multivariate Scattering Correction). These techniques
have been acquired during the stage abroad, at the University of Copenhagen, Faculty of Life Sciences, Department
of Food Science, Quality and Technology, spectroscopy and chemometrics group. The calibration models were
developed through PLS algorithm, using the software MATLAB 7.6 R2008a. The different pretreatments or
combinations of them were compared manually. The choice of spectral range has been performed applying the
interval-PLS algorithm (PLS-toolbox). The identification of outliers was conducted using four different tests. Once
developed, the various models have been validated through cross-validation leave-one-out. The results are shown in
Table 4.

Table 4 Results of NIR calibrations for the determination of quality parameters of barley malt.

Fine Extract
(% dm)
Fermentability
(%)
Coarse Extract
(% dm)
Viscosity
(cP)
Soluble Nitrogen
(% dm)
FAN
(mg/l)
Friability
(%)
pH
Range 72.1-80.1 75.4-84.6 73.3-79.3 1.45-1.61 0.55-0.79 99-186 77.6-99.4 5.84-6.23
R 0.73 0.72 0.8 0.73 0.82 0.91 0.85 0.78

In addition, the acquisition of a greater number of spectra allowed dividing the calibration data set into groups,
including the spectra acquired during the different years. In this way, it was possible to exclude from time to time
samples belonging to each year and calculate the corresponding error of prediction. This strategy allows obtaining a
true estimate of the real predictive power of the method applied on unknown samples in future years (Sileoni et al.,
2010b; Sileoni et al., 2010c).

4.3 Malting Quality of barley
Regarding the objective A4, correlation models between the NIR spectra acquired on the ground samples of barley
and the quality parameters of the corresponding malt was searched. The calibration models obtained using OPUS
showed a good degree of predictability, even if these models have been developed using just 20 samples. The results
shown in Table 5 are very encouraging and will be deepened in the last year, including more samples in calibration.
However, determining these parameters directly on barley as "potential" of malt futures can be difficult, perhaps
because they are too related to the process. We could therefore develop a calibration that is suitable for a
standardized process, but may not be suitable for a different process.

Table 5 Results of NIR calibrations for the determination of malting quality of barley

Fine Extract
(% dm)
Fermentability
(%)
Total Nitrogen
(% dm)
Soluble Nitrogen
(% dm)
FAN (mg/l) Friability (%) pH
Range 70.9-77.7 76.4-83.6 1.60-1.85 0.53-0.75 101-193 76.4-83.6 5.84-6.23
R 0.77 0.89 0.89 0.73 0.82 0.80 0.84
RMSEP cv 0.3 0.5 0.03 0.03 6 4.1 0.03

4.3 Beer quality and monitoring the beer process.
Regarding the objective A5 or control by NIR of beer fermentation, it was decided to assess the content of alcohol
(% v/v), pH, and the apparent original extract (P). These parameters were then correlated with the spectra of
15
th
177
15
th
samples of the fermenting wort acquired off-line in parallel with analytical determinations in diffuse reflectance
through quartz cuvette and reflective gold.
Again, these correlations between the analytical and spectroscopic data were generated using PLS algorithm and
validated through cross-validation, resulting in calibration with a good degree of predictability. Indeed, in all three
cases the value of R was greater than 0.997 prediction error of less than 2%.
The calibration models developed during this PhD thesis research project allows innovative applications of near-
infrared spectroscopy in reflectance (NIR) in the production chain of beer.
For example, it is possible to check the quality of the raw materials like barley, maize and barley malt using a rapid,
lnon-destructive and reliable method, with a low error of prediction and with a repeatability comparable with the one
of the reference method (UNICHIM). Then, these new calibration models allow to monitoring the malting process,
measuring the moisture content and other quality parameters during germination. Moreover it is possible to obtain an
estimate of the "malting quality" (MQ) of barley, to predict whether if its germination will be rapid and uniform and
if a certain type of barley is suitable for the production of beer and spirits. Finally, the NIR technique can be applied
to monitor the brewing process, using correlations between NIR spectra of beer and analytical parameters. These
innovative results are potentially very useful for the actors involved in the beer production chain, especially the
calibration models suitable for the control of the malting process and for the assessment of the malting quality of
barley, which need to be deepened in future studies.
6. References
Huang H, Yu H, Xu H, Ying Y (2008) Near infrared spectroscopy for on/in-line monitoring of quality in foods and beverages: A
review. J Food Eng 87: 303-313.
Inon FA, Garrigues S, de la Guardia M (2006) Combination of mid- and near-infrared spectroscopy for the determination of the
quality properties of beers. Anal Chim Acta 571: 167-174.
Maertens K, Reyns P, De Baerdemaeker J (2004) On-line measurement of grain quality with NIR technology. Trans ASAE 47:
1135-1140.
Marte L, Belloni P, Genorini E, Sileoni V, Perretti G, Montanari L, Marconi O (2009) Near infrared reflectance models for the
rapid prediction of quality of brewing raw materials. J Agri Food Sci 57: 326333.
McLeod G, Clelland K, Tapp H, Kemsley EK, Wilson RH, Poulter G, Coombs D, Hewitt CJ (2009) A comparison of variate pre-
selection methods for use in partial least squares regression: A case study on NIR spectroscopy applied to monitoring beer
fermentation. J Food Eng 90: 300-307
Nielsen J. P., Bro R., Larsen J., Munck L. (2002) Application of Fuzzi Logic and Near Infrared Spectroscopy for Malt Quality
Evaluation. J Inst Brew, 108 (4): 444-451.
Sileoni V (2008) Study of innovative methods of control in the cereal productive chain for the production of beer and spirits. In
Proc.s of the 13th Workshop on the Developments in the Italian PhD Research on Food Science Technology and
Biotechnology,University of Turin (Italy) 10-12 September 2008.
Sileoni V, Della Sera R, Marconi O, Perretti G, Fantozzi P (2009a) Malting process parameters evaluation by near-infrared
spectroscopy in reflectance (NIR). 32
nd
Congress of the European Brewery Convention, Hamburg (Germany) 10-14 May
2009.
Sileoni V, Marconi O, Perretti G, Buiatti S, Fantozzi P (2010b) Development of a NIR calibration model for malt extract
determination and validation of its long-term stability. 9th edition of the international symposium Trends in Brewing,
Ghent (Belgium), 13-16 April 2010.
Sileoni V, Perretti G, Marconi O, Fantozzi P (2009b) Evaluation of malt quality by near-infrared spectroscopy in reflectance. 32
nd

Congress of the European Brewery Convention, Hamburg (Germany) 10-14 May 2009.
Sileoni V, Perretti G, Marte L, Marconi O, Fantozzi

P (2010a) Near-Infrared spectroscopy for proficient quality evaluation of malt
and maize in beer industry. J Inst Brew 116 (2) in press
Sileoni V, van den Berg F, Marconi O, Perretti G, Fantozzi P (2010c) Validation strategies for long term effects in NIR calibration
models. J Agri Food Sci, submitted.
Sjholm K, Tenhunen J, Tammisola J, Pietil K, Home S (1996) Determination of the fermentability and extract content of
industrial worts by NIR. J Am Soc Brew Chem 54 (3): 35-140.

15
th
178
15
th
Influence of organic viticulture on non-Saccharomyces wine yeast
populations

Gianluca Ciro Telera (g.telera@libero.it)
Dept. of Food Science, University of Teramo, Mosciano SantAngelo (TE), Italy
Tutor: Prof.ssa G. Suzzi

This study is the final part of my PhD research project on the phenotypic and genetic characteristics of non-
Saccharomyces yeasts from natural grape musts. The main aim of this part was the study of the non-
Saccharomyces wine yeast populations during spontaneous fermentations of organic musts (Montepulciano
dAbruzzo and Trebbiano). In addition the screening of different non-Saccharomyces strains for their suitability
to must fermentation was carried out with the aim to investigate a formulation of autochthonous starters
combining Saccharomyces and non-Saccharomyces selected strains, to provide the aroma and typicalness of
these wines.
Influenza della viticoltura biologica sui popolazioni di lieviti non-
Saccharomyces

Questo studio la parte finale della mia tesi di dottorato di ricerca basato sulle analisi delle caratteristiche
genetiche e fenotipiche dei lieviti non-Saccharomyces a partire da differenti mosti duva. Il principale obiettivo
di questa parte stato lo studio della popolazione di lieviti da vino non-Saccharomyces durante le spontanee
fermentazioni di mosto biologico (Montepulciano dAbruzzo e Trebbiano). In aggiunta stato effettuato lo
screening di differenti ceppi non-Saccharomyces per la loro adattabilit alla fermentazione con lo scopo di
investigare sulla formulazione di starter autoctoni combinando ceppi selezionati di Saccharomyces e non-
Saccharomyces in grado di conferire caratteristiche sensoriali e tipiche a questi vini.

Key words: organic musts, yeast, D1/D2 domain; organic acids, mixed starters.
1. Introduction
In accordance with the PhD thesis project previously decribed ,this oral communication reports the main results :
A1) Isolation and identification of non-Saccharomyces species, their diversity and dynamics during
spontaneous fermentation of Montepulciano dAbruzzo and Trebbiano musts by molecular techniques.
A2) Oenological characterisation of some representative strains from each species of nonSaccharomyces
yeasts from Montepulciano to select strains useful for typical wine flavours.
A3) Selection of mixed cultures of S. cerevisiae and non-Saccharomyces strains to produce particular starters
for Montepulciano dAbruzzo.

2. Organic viticulture

Organic grapes come from vineyards grown under organic farming methods, as defined at European level, by
the Council Regulation (EC) No 834/2007 and No 889/2008 on organic production. In particular the
International Federation of Organic Agriculture Movement (IFOAM) defines organic agriculture including
viticulture and wine-making as a holistic production management system which promotes and enhances agro-
ecosystem health, including biodiversity, biological cycles, and soil biological activity. It emphasizes the use of
management practices in preference to the use of off-farm inputs, taking into account that regional conditions
require locally adapted systems (Hofmann , 2009). Nevertheless, the yeasts present on grapes berries and must
from organic vineyards could have a particular composition and the indigenous yeasts impart a distinct regional
and desired characteristic to wines. In fact, traditionally, wine has been produced by the spontaneous
fermentation of grape juice by the yeasts that originate from grapes and winery equipment. The variety and
proportion of different yeasts in grape berries and in musts depend on many different factors among which
geographic location of the vineyard , climatic conditions (Fleet et al. 1984) grape variety (Pretorius et al. 1999),
vinification technology (Charoenchai et al. 1997) and grape sanity (Prakitchaiwattana et al. 2004). A study on
yeast populations residing on healthy or Botrytis-infected grapes from a vineyard showed a larger population and
greater diversity of non-Saccharomyces (NS) yeasts (Nisiotou and Nychas 2007). In recent years numerous
studies have evaluated the NS species present in wine ecosystem and recent researches have demonstrated the
15
th
179
15
th

impact of grape conditions on NS populations (Fernandez et al. 1999;Gonzlez et al. 2007). The role of NS
yeasts in wine production has been debated extensively and several researchers showed that NS yeasts survived
during fermentation and could reach cell concentrations similar to those reached by S. cerevisiae (10
6
to 10
8

cells/mL) (Fleet et al. 1984). Infact, there is growing evidence that NS yeasts play an important role in wine
quality as suggested by several authors (Toro and Vazquez 2002; Ciani et al. 2006).
A total of 543 yeast colonies were isolated, 190 from LM, 254 from WLN agar and 99 from YPD. According to
Pallman et al. (2001). The WLN medium was used to monitor yeast population diversity during fermentations.
This medium was proved useful for wine yeast identification since colonies of different species grow on it with a
distinguishable morphology and colour (Cavazza et al. 1992; Pallmann et al. 2001). Identification of the isolates
was performed by PCR-RFLP of ITS1-5.8S rDNA-ITS2 region as described by Esteve-Zarzoso et al. (1999).
Sequencing of the D1/D2 domain of the large subunit (26S) ribosomal DNA was carried out according to
Kurtzman and Robnett (1998). Sixty-four isolates were identified as NS yeasts . Microfermentations in white
Trebbiano must were performed in laboratory in duplicate according to Ciani et al. 2009. On the basis of NS
strain oenological properties evaluated during this fermentation (such as growth kinetics, fermentation power,
higher alcohol production, ethanol content, titratable acidity, residual sugars) two strains, Hanseniaspora uvarum
256 and Candida zemplinina 272, were selected and used together with S. cerevisiae S615 strain as mixed
starter for the fermentation of Montepulciano Abruzzo must. The strains of the starter were used in different
combinations: Test 1: H. uvarum 256 (1a), C. zemplinina 272 (1b), S. cerevisiae S615 (1c) were inoculated at
5% concentration and used as control. Test 2: H. uvarum 256 and S. cerevisiae S615 were inoculated together at
5% concentration. Test 3: C. zemplinina 272 and S. cerevisiae S615 were inoculated together at 5%. Test 4: C.
zemplinina 272, H. uvarum 256, S. cerevisiae S615 were inoculated together (5%). Test 5: It was performed by
inoculating 10
6
cells

/ ml of strain S. cerevisiae S615 and 10
3
cells / ml of strains C. zemplinina 272 and H.
uvarum 256. Test 6: the two NS strains were inoculated together (5%), and after consumption of 5 g of
sugar/100 ml, S. cerevisiae S615 was added at 10
6
cells/ml. Moreover, in the obtained wines, organic acids,
residual sugars, fructose and glucose were analyzed. Organic acids and sugars were determined by HPLC (Lopez
et al,1996).
4.1 Yeast dynamics during organic musts fermentation
To study the dynamics of yeast populations during fermentations of organic musts of Montepulciano and
Trebbiano cultivars, yeasts were enumerated at different times and at the end of the fermentation process. The
size of the yeast populations in grapes was greater than the size of yeast population in must samples. The
spontaneous fermentations of Montepulciano and Trebbiano organic musts started after 7 days and proceeded
slowly for 30 days. At this time Trebbiano fermentation was concluded and was characterised by a low content
of residual sugars, whereas Montepulciano fermentation was not stopped, probably due to the high content of
initial sugars without the help of a starter (Tables 1 and 2). Total counts of organic grape berries of Trebbiano
resulted in about 3.1 x 10
4
CFU/ml, whereas the fresh grape juice exhibited a total yeast count on WLN medium
of 9.0 x 10
2
CFU/ml and a maximum number of 1.58 x 10
7
CFU/ml on day 14. Viable counts on LM showed a
similar general trend as detected on WLN medium. In fresh grape juice, NS yeasts were present at value of 6.0 x
10
2
CFU/ml and reached the maximum number on day 14 (1.52 x10
7
CFU/ml)Total yeasts of Montepulciano
organic fresh must on WLN medium (Table 2) were 1.0 x 10
5
CFU/ml and reached a maximum number of 8.3 x
10
6
CFU/ml after day 14.On grapes NS yeasts were present at 9.4 x 10
6
CFU/ml, decreased during the first phase
of fermentation and then increased up to 9.4 x 10
6
CFU/ml on day 14. This behaviour could be explained by the
presence of ethanol resistant NS strains, such as C. zemplinina.
Table 1 : Viable counts of yeast population during the fermentation of Trebbiano grapes

15
th
180
15
th
Table 2 : Viable counts of yeast population during the fermentation of Montepulciano grapes

4.2 Identification and molecular characterization of NS yeasts
A total of 543 yeast colonies were isolated, 190 from LM, 254 from WLN and 99 from YPD medium that were
selected according to colony shape, colour, surface feature and frequency. A total of 64 isolates representatives
of all the morphologies detected were selected in order to apply the RFLP analysis for their identification. Seven
different 5.8S-ITS PCR-RFLP patterns were detected among all the yeast isolated( data not shown). Moreover,
to attribute the correct species assignation, the D1/D2 domain of 26S rRNA gene from 51 isolates were
sequenced and subsequently compared with those available in the EMBL nucleotide sequence database. Most of
the sequences obtained displayed similarity values ranging from 99 to 100% to reference sequences (Fig.1). The
D1/D2 26S rDNA sequence of some strains could not be ascribed to a any known species. The strains NS181
and NS185 showed the highest similarity value (94 and 83%, respectively) with the strain Hanseniaspora spp.
HTLMLZ1A. According to the phylogenetic results, determined by partial 26S rRNA gene sequence analysis, as
reported in figure 1, the unidentified strains of Hanseniaspora were not assigned to the species of this genus
frequently isolated in must and wine, such as Hanseniaspora osmophila or Hanseniaspora guilliermondii.

Figure 1: Comparison of 26S rDNA D1/D2 sequences of strains identified with sequences in database.

Isolate P181
P185
Isolate P205
Isolate P206
Isolate P175
isolate P174
Isolate P246
Isolate P204
isolate P249
Hanseniaspora uvarum HTMLZ1A EU004082
isolate P173
Isolate P179
Isolate P178
Isolate P243
Isolate P251
Isolate P203
H.uvarum AL3 EU441885
H.uvarum GSKE2 EU004081
Isolate P192
Isolate P211
Isolate P247
Isolate P177
Isolate P202
Isolate P176
Isolate P255
Isolate P187
Isolate P252
Isolate P260
Isolate P259
Isolate P184
Hanseniaspora clermontiae CBS 8821 AJ512452
Isolate P183
Isolate P172
Isolate P212
Isolate P256
Isolate P250
Isolate P186
Isolate P258
Isolate P254
Isolate P257
Isolate P253
Isolate P244
Hanseniaspora meyer i CBS 8815 AJ512458
Hanseniaspora opuntiae H6S1K8 FM180549
Hanseniaspora guilliermondii T Y14 FJ972216
H.uvarum SY4C-1 EU809447
Hanseniaspora sp.CBS 8772 AJ512455
H. sp.SYMMTV -1 EU809457
Candida oleophila CBS 2223 AF178047
C.oleophil a CECT 11891 AJ539362
Candida zeylanoides CBS 1922HFFN554768
Candida Krisii CECT11881T AJ539355
Pichia barkeri U75735
Isolate P261
P.barkeri CECT1391 DQ409162
Pichia nakasei U75728
Pichia kluyveri U75736
P.kluyveri SYHZ2 -4 EU285539
P.kluyveri var. Kluyvery NX2GEF564399
Issatchenkia terricola B EU441910
I.terricola D4G2 EU441901
Isolate P188a
Isolate P190
Issatchenkia hanoiensis AY163900
Issatchenkia orientalis IMAU3Y088 FJ770560
I.orientalis QD15 EU543688
Isolate P248
Pichia kudriavzevii FSMP -Y20 FJ7627976
I.orientalis GSQCH8 EF564419
Metschnikowia fructicola DGR3 EU441891
Isolate P157
Metschnikowia sp.NRRLY -6148 AF017401
Metschnikowia chrysoperlae ATCCMYA -4304 FJ614652
M. sp.A -5- 1 EU441894
M. sp.NCAIM Y.00393 GQ017401
Candida bombi CBS 9017 AF406929
Candida stellata CBS 843 EF452199
C.stellata PYCC3044 AY394855
Candida zemplinina CECT11969 EF452215
Isolate P272
Isolate P270
C.zemplinina SB511 DQ872872
C.zemplinina NCAIM 00402 EF452217
Isolate P304
C.zemplinina CBS 6100 EF452197
Isolate P309
C.stellata XGL3 EU350186
Isolate P325
C.zemplinin a CBS 1713 EF452193
C.zemplinina CBS 2779 EF452195 46
5
0
0
0
97
60
100
74
91
55
45
100
100
100
99
30
95
76
36
99
68
100
45
54
100
72
61
100
97
91
65
69
70
100
65
47
45
44
42
16
14
28
0.05
Isolate P181
P185
Isolate P205
Isolate P206
Isolate P175
isolate P174
Isolate P246
Isolate P204
isolate P249
isolate P173
Isolate P179
Isolate P178
Isolate P243
Isolate P251
Isolate P203
Isolate P192
Isolate P211
Isolate P247
Isolate P177
Isolate P202
Isolate P176
Isolate P255
Isolate P187
Isolate P252
Isolate P260
Isolate P259
Isolate P184
Isolate P183
Isolate P172
Isolate P212
Isolate P256
Isolate P250
Isolate P186
Isolate P258
Isolate P254
Isolate P257
Isolate P253
Isolate P244
Isolate P261
Isolate P188a
Isolate P190
Isolate P248
Isolate P157
M. sp.A -5- 1 EU441894
M. sp.NCAIM Y.00393 GQ017401
Isolate P272
Isolate P181
P185
Isolate P205
Isolate P206
Isolate P175
isolate P174
Isolate P246
Isolate P204
isolate P249
isolate P173
Isolate P179
Isolate P178
Isolate P243
Isolate P251
Isolate P203
Isolate P192
Isolate P211
Isolate P247
Isolate P177
Isolate P202
Isolate P176
Isolate P255
Isolate P187
Isolate P252
Isolate P260
Isolate P259
Isolate P184
Isolate P183
Isolate P172
Isolate P212
Isolate P256
Isolate P250
Isolate P186
Isolate P258
Isolate P254
Isolate P257
Isolate P253
Isolate P244
Isolate P261
Isolate P188a
Isolate P190
Isolate P248
Isolate P157
M. sp.A -5- 1 EU441894
M. sp.NCAIM Y.00393 GQ017401
Isolate P272
Isolate P270
C.zemplinina SB511 DQ872872
C.zemplinina NCAIM 00402 EF452217
Isolate P304
C.zemplinina CBS 6100 EF452197
Isolate P309
C.stellata XGL3 EU350186
Isolate P325
C.zemplinin a CBS 1713 EF452193
C.zemplinina CBS 2779 EF452195 46
5
0
0
0
97
60
100
74
91
55
45
100
100
100
99
30
95
76
36
99
68
100
45
54
100
72
61
100
97
91
65
69
70
100
65
47
45
44
42
16
14
28
0.05
15
th
181
15
th

4.3 Enological characterisation of non-Saccharomyces yeasts
All the strains evaluated in the present study, belonging to the species H. uvarum, M. fructicola, C. zemplinina,
I. terricola and I. orientalis, were tested for fermentation power and organic acid consumption in Trebbiano
must. The values of residual sugars ranged from 4.9 to 10.9 Brix. The percentage of H. uvarum strains and other
NS yeasts varied accordingly with the residual sugar content of Trebbiano wine. The 4-7% of NS population
were able to ferment sugars with a residual content less than 5 Brix, whereas most of them (56-72%) showed a
fermentative capability with residual sugar content ranging from 8 to 10 Brix. Among the different species 20
strains were selected on the basis of fermentation performance. By considering the effect of NS yeasts on
organic acid wine content ,sixteen of the twenty strains studied have more than 0.60 g/l
-1
of acetic acid, with a
mean of 0.77 g/l
-1
, ranging from 0.09 g/l
-1
for I. orientalis P110 to 0.91 g/l
-1
for H. uvarum P244.At the end on
the basis of strains oenological properties ,such as good fermentation performance, low production of acetic acid,
partial capacity to degrade malic acid and low residual sugar, two NS strains, C. zemplinina 272 and H. uvarum
256 were selected.

4.4 Formulation of autochthonous mixed starter cultures
Two NS strains , C. zenplinina 272, H. uvarum 256 were combined with S. cerevisiae S615 in different Tests as
reported in Material and Methods. The fermentative kinetics, residual sugars, glucose and fructose consumption
of the Tests 1c-2-3-4-5 showed a regular and similar trends except for the control of NS yeasts and Test6 where
the sugars were not totally consumed (Figure 2, 3, 4). As regard organic acids, malic acid was not consumed and
acetic acid ranged in a tolerable amounts (Table 3). On the basis of these results and on the viability of the
different strains during the fermentation (data not shown) the combination of Test 5 was taken in consideration
as the best one and useful for further analysis.

.

Figure 2: CO
2
produced during the fermentation process

Table 3: Organic acids

CITRIC TARTARIC MALIC ACONITIC ACETIC FUMARIC
Negative Control 0,15 5,77 0,40 NR(<0.003) NR(<0.05) NR(<0.001)
Test 1a H. uvarum 256 0,14 5,24 0,43 NR(<0.003) 0,68 NR(<0.001)
Test 1b C. zemplinina 272 0,20 5,83 0,42 0,010 0,61 0,003
Test 1c S. cerevisiae S615 0,16 5,50 0,48 NR(<0.003) 0,64 NR(<0.001)
Test 2 H. uvarum /S. cerevisiae S615 0,15 6,53 0,46 NR(<0.003) 0,53 NR(<0.001)
Test 3 C. zemplinina /S. cerevisiae S615 0,16 5,69 0,38 NR(<0.003) 0,74 NR(<0.001)
Test 4 S. cerevisiae S615/C. zemplinina/H. uvarum 0,16 5,30 0,46 NR(<0.003) 0,82 NR(<0.001)
Test 5 different concentration 0,15 5,33 0,40 NR(<0.003) 0,72 NR(<0.001)
Test 6 scale fermentation 0,13 5,45 0,40 NR(<0.003) 0,77 0,003
15
th
182
15
th

Figure 3: Residual sugars Brix Figure 4: Residual concentrations of Fructose and Glucose
The main objective of the present work was to analyse the native NS populations of the red Montepulciano
dAbruzzo and white Trebbiano musts obtained from organic grapes, fermented in two hundred litre vessels and
processed by applying old traditional methods without SO
2
addition, in order to elucidate the impact of these
populations on organic must spontaneous fermentations.The results provided an overview on the NS community of
organic musts, which was shown to be complex and rich in different microbial species and strains. Some of them
presented particular and interesting characteristics from an oenological point of view, as proposed also by Ciani et
al.(2009). In recent years there has been considerable interest in spontaneous fermentation using indigenous yeasts
and it is noteworthy that NS populations possess interesting enzymatic activities that may affect the flavour of
wine and its quality. The idea was then to use a combination of mixed NS strain starters (H. uvarum 272 -C.
zemplinina 256) with a selected indigenous strain of S.cerevisiae S615 to obtain organic wines with a specific
aromatic profile, similar to those obtained by spontaneous fermentations. Co-fermentation with autochthonous
strains selected of Saccharomyces and NS yeasts could be considered an important quality factor by exploiting
different metabolic yeast activities and with the aim then to optimize positively the final product.
6. References
Charoenchai C, Fleet GH, Henschke PA, Tood BEN (1997) Screening of non-Saccharomyces wine yeasts for the presence of
extracellular hydrolytic enzymes. Aus. J Grape Wine Res 3:2-8
Ciani M, Comitini F, Mannazzu I, Domizio P (2009) Controlled mixed culture fermentation: a new perspective on the use of
non-Saccharomyces yeasts in wine making. FEMS Yeast Res 56:1567-1364
Esteve-Zarzoso B, Belloch C, Uruburu F, Querol A (1999) Identification of yeasts by RFLP analysis of the 5.8S rRNA gene
and the two ribosomal internal transcribed spacers. Int J Syst Bacteriol 49:329-337
Fernndez MT, Ubeda JF, Briones AI (2000) Typing of non-Saccharomyces yeasts with enzymatic activities of interest in
winemaking. Int J Food Microbiol 59:29-36
Fleet GH, Lafon-Lafourcade S, Ribreau-Gayon P (1984) Evolution of yeasts and lactic acid bacteria during fermentation
and storage of Bordeaux Wines. Appl Environ Microbiol 48:1034-1038
Gonzlez SS, Barrio E, Querol A (2007) Molecular identification and characterization of wine yeast isolated from Tenerife
(Canary Island, Spain). J Appl Microbiol 102:1018-1025
Kurtzman CP, Robnett CJ (1998) Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large-subunit
(26S) ribosomal DNA partial sequences. Antoine van Leeuwenhoek 73:331-371
Lpez E, Teixeira E and Buxaderas S(1996)Organic Acids, Sugars, and Glycerol Content in White Winemaking Products
Determined by HPLC: Relationship to Climate and Varietal Factors Am. J. Enol. Vitic.,; 47: 193 - 198.
Nisiotou A, Nychas GJE (2007) Yeast populations residing on healthy or Botrytis-infected grapes from a vineyard in Attica,
Greece. Appl Environ Microbiol 73:2765-2768
Prakitchaiwattana CJ, Fleet GH, Heard GM (2004) Application and evaluation of denaturing gradient gel electrophoresis to
analyse the yeast ecology of wine grapes. FEMS Yeast Res 4:865-877
Pretorius IS, van der Westhuizen TJ, Augustyn OPH (1999) Yeast biodiversity in vineyards and wineries and its importance
to the South African wine industry. S Afri J Enol Vitic 20:61-74
Toro ME, Vazquez F (2002) Fermentation behaviour of controlled mixed and sequential cultures of Candida cantarellii and
Saccharomyces cerevisiae wine yeasts. World J Microbiol Biotechnol 18:347-354

15
th
183
15
th
Natural Compounds: Effects on Food-related Microorganisms and
Potential Use in Fermented Meats
Luca Tipaldi (luca.tipaldi@unimol.it)
Dipartimento di Scienze e Tecnologie Agroalimentari, Ambientali e Microbiologiche
Tutor: Prof. Raffaele Coppola

The aim of this PhD thesis was to identify natural substances, alternative to chemical additives used in the
fermented meat industry, able to inhibit the growth of undesirable microorganisms without affecting useful ones.
The effect of natural compounds on the microbial growth and the protein expression of food-related
microorganisms was investigated. In vitro tests were carried out to define different mixtures of natural
compounds with the best efficacy. Finally the in situ effectiveness of the assayed mixture was ascertained
directly in the preparation of fermented sausages through the use of a pilot plant.

Composti naturali: effetto antimicrobico sui microrganismi di interesse alimentare e
potenziale applicazione nella preparazione di prodotti carnei fermentati

Le azioni condotte attraverso la presente tesi di dottorato hanno inteso individuare sostanze naturali, alternative
agli additivi chimici tradizionali, in grado di inibire lo sviluppo di microrganismi indesiderati senza condizionare
quello dei microrganismi utili nella preparazione di prodotti carnei fermentati. Pertanto, sono stati
preliminarmente valutati lefficacia e lo spettro di azione di 8 differenti composti naturali. Quindi, al fine di
comprendere i possibili meccanismi alla base della sensibilit/resistenza esibita dai microrganismi rispetto alle
sostanze, stata valutata la variazione dellespressione delle proteine totali di differenti microrganismi coltivati
in presenza delle sostanze naturali oggetto dello studio. Le prove condotte in vitro hanno consentito di definire
una miscela di sostanze naturali in possesso di attivit antimicrobica selettiva ed ottimale. Infine, lefficacia di
tale miscela nella preparazione di insaccati fermentati stata validata in prove condotte su scala pilota.

Key words: Natural compounds; chemical additives; fermented meat; antimicrobial activity; food-related microorganisms.
1. Introduction
The use of natural compounds may represent an important innovation in the food preservation, also considering
the consumer demand, that requires safe foods in terms of reduction in the use of chemical additives (Holley and
Patel 2005). Several spices and essential oils may be utilized as natural additives alternative to chemicals, thanks
to their strong antimicrobial activity (Nychas, 1995; Tassou et al. 2000). There are many scientific reports that
highlight antimicrobial effects of many natural compounds on pathogenic or spoilage bacteria (Delaquis et al.
2002; Kim et al. 2001). At the present, the available data show interesting results on their effectiveness on gram
positive bacteria, which seems to be higher than that exerted on gram-negative ones (Mangena and Muyima
1999; Holley and Patel 2005). However the literature is very pour in studies focusing on the activity against both
undesirable and useful microorganisms. This aspect have to be contemplated, considering that the presence of
many food-related microorganisms assumes a key role in the production of fermented foods. Microorganisms
are able to react in different ways to the presence of natural compounds, but the mechanisms of response, in
terms of susceptibility or resistance, are still not completely identified. Several studies (Burt, 2004; Bakkali et al.
2008) evidenced that the antimicrobial action produced by essential oils, i.e. the susceptibility of some bacteria,
is due to the damages to cellular proteins. However, to date studies focusing on the microbial resistance to
essential oils or natural compounds are very rare. Since several Authors (Brul et al. 1999; Bakkali et al. 2008)
demonstrated that the microbial response to stress conditions involves the induction of specific proteins, we can
only suppose that a similar mechanism could be adopted by microorganisms to protect themselves against
natural compounds, whose presence could be considered as a stress condition for the microbial cell. In this PhD
study different natural compounds were studied in order to assess their ability to inhibit spoilage bacteria without
affecting the growth of useful ones. Moreover, the mechanism of action of eight natural compounds on different
food-related bacteria was studied.
In accordance with the PhD thesis previously described (Tipaldi, 2009), this oral communication reports the
main results of four activities directed to:
A1) study and quantify the antimicrobial activity of natural compounds;
A2) study cell whole proteins and their modification in the presence of natural compounds;
A3) formulate antimicrobial natural mixtures;
A4) test in situ vegetal mixtures in the production of fermented sausages.
15
th
184
15
th

2.1 Bacterial strains and growth conditions
Five undesirable microrganisms (Clostridium sporogenes DSM 795
T
, Pseudomonas fluorescens DSM 50090
T
,
Enterococcus faecium DSM 20477
T
, Brochothrix thermosphacta DSM 20171
T
, Staphylococcus aureus DSM
20714
T
) and three useful ones (Lactobacillus sakei DSM 20017
T
, Staphylococcus xylosus DSM 20266
T
and
Kocuria varians DSM 20033
T
) were used in this study. Strains were stored at 4 C in proper media and were o.n.
revitalised in proper broths, at optimal time/temperatures of incubation, before their use.
2.2 Natural compounds and mixtures
Natural compounds used in this study were extracted by Carica papaya, Citrus compositum, Malpighia
punicifolia, Medicago composita, Propolis, Raphanus niger, Rosmarinus officinalis, Spirulina pacifica,.
Substances, supplied from Bioma (Swiss), were assayed for their antimicrobial activity. Their mixtures were
formulated and furnished by the same supplier on the basis of data obtained in this study.
2.3 Detection of antimicrobial activity
The presence/absence of antimicrobial effects and the spectrum of action produced by natural compounds was
detected by the agar well diffusion assay. The effectiveness of natural compounds was detected evaluating the
microbial growth in meat broth added of different concentrations of natural compounds.
2.3.1. Agar well diffusion assay test
The inhibitory action of each compound was assessed by the agar well diffusion assay as described by Tremonte
et al. (2007). After incubation at right time/temperature, plates were checked for zones of inhibition/stimulation.
Clear zones around the wells were described as a low (L < 5 mm), moderate (M between 5 and 8 mm) or strong
(S > 8 mm) inhibitory effect. The presence of growth around the well was considered as absence of inhibition
(N, neutral).
2.3.2 Detection of effectiveness expressed by natural compounds
The antimicrobial effectiveness was detected by the evaluation of the growth of each microorganism inoculated
in meat broth added of natural compounds at concentrations of 0.1%, 0.5% and 1%. The initial inoculum was 10
4

cfu/ml of each bacterium. After incubation for 24 h at right temperatures, the bacterial growth was quantified to
evaluate the antimicrobial activity as !LOG UFC/ml considering the difference of bacterial growth between 24
of incubation and time zero. The antimicrobial activity was described as low (!LOG < -0.5), moderate (!LOG
between -0.5 and -1), or strong (!LOG > -1). Values of !LOG > 0 were considered as absence of inhibition.
2.4 Detection of the effect of natural compounds on whole-cell protein
Bacterial strains were inoculated in proper growth media in the presence of eight natural compounds at 2%
concentration. Broths without natural compounds were used as control. After incubation for 72h, whole cell
proteins were extracted and protein patterns were separated and analysed by electrophoresis with innovative
microfluidic techniques. Data, virtual gels and electropherograms, were analysed and compared with the bio-rad
experion system software tools (BIO-RAD, USA).
2.5 Formulation of vegetal mixtures and evaluation in vitro of their antimicrobial effect
The vegetal mixture (NC) was defined on the basis of the results obtained by analyses described in the section
(2.3). Its effectiveness was assayed as reported in the section 2.3.2
2.6 In situ test to evaluate the effectiveness of the vegetal mixture
Four different batches of fermented sausages (ripening time 30 days) were prepared in pilot scale as follows:
Batch NN: produced with the traditional Naples style salami recipe, i.e. with nitrate/nitrite and a starter culture
purchased by the trade (L. sakei, L. plantarum, S. xylosus, Sacco srl, Italy);
Batch NC: produced as described for batch NN, with vegetal mixture NC (5mL/Kg) instead of nitrate/nitrite;
Batch NN+NC: produced as described for batch NN with the addition of both nitrate/nitrite and the vegetal
mixture NC (2.5 mL/Kg);
Batch C (control): produced as described for batch NN, without the vegetal mixture NC nor nitrates/nitrites.
Physical-chemical (pH and aw) and microbiological analyses were performed during the ripening time of
fermented sausages. Analyses were performed at 0, 3, 7, 15, 21 and 30 days of ripening. And the results were
expressed as the mean of three determinations performed on three different samples for each batch.
Potentiometric measurement of pH was performed by inserting the probe of the pH-meter (Crison 2001) directly
into each sample. Activity water was determined by using the Water Activity Meter AQUALAB CX-2.
Microbiological analyses were performed to evaluate the variation of useful/undesirable microorganisms. In
detail, Lactic Acid Bacteria, Coagulase Negative Cocci, enterococci, total and faecal coliforms, Eumycetes, B.
thermosphacta, Pseudomonas and Clostridium spp. were determined according to Tremonte et al. (2005).
3.1 Antimicrobial activity
The results of the agar well diffusion assay are summarized in Table 1 and they show the spectrum of activity
regarding each assayed vegetal compound. The results evidenced different effects of the assayed vegetal
extracts. C. papaya, Propolis and R. niger showed a low (L) antimicrobial activity, exerted only against C.
sporogenes and B. thermosphacta. R. officinalis, C. compositum and M. composita were characterised by the
15
th
185
15
th
largest spectrum of activity, producing an inhibitory action against both undesirable bacteria and useful ones. S.
pacifica and M. punicifolia showed an intermediate antimicrobial activity, but interestingly M. punicifolia
produced inhibition only on undesirable microorganisms, without affect useful ones.
Table 1 Results of the Agar Well diffusion Assay. Clear zones around the wells indicate different levels of inhibition.
(Low, L<5 mm), (Moderate, M between 5 and 8 mm) , (Strong, S > 8 mm). The presence of growth around the well indicates
absence of inhibition (Neutral, N).
Useful microorganisms
Natural extract L. sakei S. xylosus K.varians C. sporogenes B. thermosphacta E. faecium P. fluorescens S. aureus
Carica papaia N N N L L N N N
Citrus compositum M M M H H H H M
Malphiglia punicifolia N N N M H N H L
Medicago compostita L L H M L L L L
Propolis N N N L L N N N
Raphanus niger N N N L L N N N
Rosmarinus officinalis H H H H H L H H
Spirulina pacifica M M M M H N N L
Undesirable microorganisms

In detail, this effect was also highlighted in the presence of the lowest concentration of this compound (0.1%), as
evidenced in Figure 1. Among the other assayed extracts, whose effectiveness was previously described
(Tipaldi, 2009), C. compositum and R. officinalis showed a promising application (Figure 1), exerting their
inhibitory activity at the lowest concentration (0.1%) against C. sporogenes and B. thermosphacta without
affecting useful bacteria. Overall, it is possible to confirm that Gram positive bacteria were more sensitive to
natural compounds than gram negative ones (Zaika, 1988; Mourey and Canillac, 2002).
Figure 1 Antimicrobial effect expressed by M. punicifolia, C. compositum and R. officinalis on different useful and undesirable microorganisms
inoculated in meat broth.(!LOG < -0.5, low; !LOG between -0.5 and -1, moderate; !LOG > -1, strong; !LOG > 0 absence).
3.2 Effect of natural compounds on whole-cell protein
The electrophoretic profiles and the electropherograms obtained from the whole-cell protein analyses of strains
cultivated in presence/absence of natural compounds highlighted appreciable differences. The results, in
accordance with other studies (Brul et al. 1999; Bakkali et al. 2008), evidenced that microorganisms, in presence
of stress conditions such as natural compounds with antimicrobial activity, could modify their protein
expression. In this brief report only data which better explain this phenomenon were described. Particular
attention was given to the behavior of C. sporogenes, that was chosen as non-pathogenic microorganism instead
of pathogenic C. botulinum, because of their similar features of growth in meat products (Girardin et al. 2005).
Moreover the attention was focused on those strains, such as S. aureus, which were weakly inhibited by the
presence of some natural compounds and which showed the ability to react to the stress through a protein
adaptation. C. sporogenes resulted strongly inhibited by natural compounds assayed in this study. In detail, the
profile related to its cultivation in presence of M. punicifolia (Figure 2, lane 2) showed the disappearance of
three protein bands with molecular weight between 50 and 100 KDa, which were well visible in the profile
related to the cultivation of the same strain in the medium without the substance (Figure 2, lane 1). These
differences resulted appreciable by the comparison (Figure 3) of the two electropherograms (between 35 and 5
second of migration) related to the growth of C. sporogenes in absence of the natural compound, characterised
by the presence of five peaks, and that related to the growth of C. sporogenes in presence of the natural
compound (no evident peak). The same results were obtained when C. sporogenes, as well as other assayed
bacteria which resulted strongly inhibited by natural compounds, were cultivated in their presence or absence
(data not shown). In this case, the degradation/non-expression of high molecular weight proteins was observed.
Different results were appreciated when the growth of strains was only restrained but not completely inhibited by
natural compounds. This case is well explicated by electrophoretic profiles (Figure 4) and by electropherograms
(Figure 5) of whole-cell of S. aureus proteins cultivated in absence or presence of M. punicifolia.
15
th
186
15
th

Figure 2 Whole-cell protein profiles of C. sporogenes cultivated in
absence (1) and in presence (2) of Malpighia punicifolia.
Figure 3 Elecropherograms of whole-cell proteins of C. sporogenes
in absence (---) and in presence of Malpighia punicifolia (---).
In Figure 4 profiles resulted substantially similar in absence and in presence of the assayed natural compound,
but the appearance of a new protein band with high molecular weight was evidenced in the profile related to the
whole-cell protein of S. aureus in presence of the natural compound. This result was better evidenced by the
electropherograms: two new peaks (between 50 and 55 seconds of migration) were observed in that related to S.
aureus cultivated with M. punicifolia. Given these results, we can assert that some strains, weakly inhibited by
the presence of natural compounds, are able to react to the stress through the synthesis of new undefined
proteins. In fact, similar results were evidenced whenever assayed strains resulted weakly inhibited by other
natural compounds (L, Table 1).

Figure 4 Whole-cell protein profiles of S aureus cultivated in absence
(1) and in presence (2) of Malpighia punicifolia.
Figure 5 Elecropherograms of whole-cell proteins of S. aureus in
absence (---) and in presence of Malpighia punicifolia (---).
Finally, the study highlighted that strains not inhibited by natural compounds, such as those reported as neutral
(N) in Table 1, produced similar protein patterns and electropherograms in presence or absence of the assayed
natural compound (data not shown).On the basis of these results we can assert that natural compounds are able to
affect not only the microbial growth but also the expression of the microbial protein pattern.
3.3 Formulation of vegetal mixtures and evaluation in vitro of their antimicrobial effect
Previous results allowed to define 5 natural mixtures. In this report, only results related to the mixture (NC) are
described. The mixture was formulated by the combination of C. compositum, R. officinalis and M. punicifolia
(patent in progress). In vitro tests evidenced a promising antimicrobial activity, in particular against undesirable
gram positive bacteria such as C. sporogenes and B. thermosphacta (Figure 6 and 7). The results also evidenced
that the best concentration of NC to be used in meat products should be 1.0% or 0.5%. In fact, these
concentrations allowed a strong inhibition of some undesirable microorganisms without affect (in particular
0.5%) the growth of useful ones (LAB and CNC). The mixture NC exerted a moderate inhibition on
Pseudomonas spp. and on E. faecium. A weak inhibition was produced on S. aureus (data not shown).

Figure 6 C. sporogenes growth in presence of nitrites (NO
2
)
or vegetal mixture (NC) at different concentrations.
Figure 7 B. thermosphacta growth in presence of nitrites (NO
2
)
or vegetal mixture (NC) at different concentrations.
15
th
187
15
th
3.4 In situ test to evaluate the effectiveness of the vegetal mixture
The 0.5% concentration of the vegetal mixture NC was chosen to assess its effectiveness in situ, i.e. in the production of
fermented sausages in pilot scale, comparing the results to those of batches produced by adding NO
2
(NN) or NO
2
plus the
vegetal mixture NC (NN+NC). LAB, which resulted the main microbial group during the entire period of ripening of
fermented sausages, did not show different behaviors in the different batches (data not shown). It means that LAB were NO
2
-
resistant as well as NC mixture-resistant. The trend of CNC evidenced an increase in all batches during the first period of the
ripening (data not shown). Interestingly, in the batch produced with the addition of both NO
2
and vegetal mixture NC
(NN+NC) this microbial group evidenced a more pronounced growth. Clostridium spp. was undetectable in all the batches,
while other undesirable microorganisms, such as Pseudomonas spp. (Figure 8A) and B. thermosphacta (Figure 8B),
evidenced an appreciable decrease in counts during the ripening. However, differences were registered among the samples
from the different batches. In detail, the batches prepared with the addition of natural mixture (NC and NC+NN) showed a
strong inhibition on B. thermosphacta comparable to that registered in the batch produced with NO
2
addition. As for
Pseudomonas, batch NC+NN showed results similar to those evidenced by batch NN.

0
1
2
3
4
5
6
7
8
0 3 7 15 21 30
Time (days)
C NN NC NN+NC

0
1
2
3
4
5
6
0 3 7 15 21 30
Time (days)
C NN NC NN+NC
Figure 8 A, B Behaviour of Pseudomonas spp. (A) and B. thermosphacta (B) during the ripening of different batches of
sausages produced in pilot plant.
The research produced promising results which open new horizons on the possibility to produce innovative products without
chemical additives or with their reduction. Moreover, the data suggest that natural compounds could be used not only in the
production of fermented meats, but also for the preservation of other foods in order to control the growth of undesirable
microorganisms. However, in our opinion the most important scientific enrichment produced by this study is attributable to
data which describe the relationship between the sensitivity/resistance of microorganisms to natural compounds and their
whole-cell protein expression.
5. References
Bakkali F, Averbeck S, Averbeck D, Idaomar M (2008) Biological effects of essential oils. Food Chem Toxicol 46: 446475.
Burt S (2004) Essential oils: their antibacterial properties and potential applications in foods. J Food Microbiol 94: 223-253.
Brul S, Coote P (1999) Preservative agents in foods Mode of action and microbial resistance mechanisms, Review. Int J Food Microbiol
50: 117.
Carson C, Riley T (1995) Antimicrobial activity of the major components of the essential oil of the Melaleuca alternifolid. J
Appl Bacteriol 78: 264-269.
Delaquis PJ, Stanich K, Girard B, Mazza G (2002) Antimicrobial activity of individual and mixed fractions of dill, cilantro,
coriander and eucalyptus essential oils. Int J Food Microbiol 74: 101-109.
Girardin H, Morris CE, Albagnac C, Nguyen C (2005) The Behaviour of the pathogen surrogates Listeria innocua and
Clostridium sporogenes during production of parsley in fields fertilized with contaminated amendments. FEMS
Microbiol Ecol 54: 287295.
Holley RA and Patel D (2005) Improvement in shelf-life and safety of perishable foods by plant essential oils and smoke
antimicrobials. Food Microbiol 22: 273-292.
Kim HY, Lee YJ, Hong KH, Kwon YK, Sim KC, Lee JY, Cho HY, Kim IS, Shin I-S, Cho JS (2001) Isolation of
antimicrobial substances from natural products and their preservative effects. Food Sci Bioth 10: 59-71.
Mangena T, Muyima NYO (1999) Comparative evaluation of the antimicrobial activities of essential oils of Artemisia afra,
Pteronia incana and Rosemarinus officinalis on selected bacteria and yeast stains. Lett Appl Microbiol 28: 291-296.
Mourey A, Canillac N (2002) Anti-Listeria monocitogenes activity of essential oils component of confiners. Food Contr 13: 289-292.
Nychas GJE (1995) Natural antimicrobials from plants, in G.W. Gould, New methods of food preservation pp. 58-89
London: Blackie Academic Professional.
Tassou C, Koutsoumanis K, Nychas GJE (2000) Inibition of Salmonella enteritidis and Staphylococcus aureus in nutrient
broth by mint essential oil. Food Research Int 33: 273-280.
Tipaldi L (2009) Antimicrobial activity expressed by natural compounds, In Proc.s of the 14th Workshop on the Developments in the Italian
PhD Research on Food Science and Technology, Oristano (Italy), 16-18 September, 2009, pp. 361-362.
Tremonte P, Succi M, Reale A, Di Renzo T, Sorrentino E, Coppola R (2007) Interaction between strains of Staphylococcus
xylosus and Kocuria varians isolated from fermented meats. J Appl Microbiol, 103: 743-751.
Tremonte P, Sorrentino E, Succi M, Reale A, Maiorano G, Coppola R (2005). Shelf-life of fresh sausages stored under
modified atmospheres. J Food Prot 68: 2686-2692.
Zaika LA (1988) Spices and herbs: their antimicrobial activity and its determination. J Food Saf 9: 97-118.
Zhou G H, Xu XL, Liu Y (2010) Preservation technologies for fresh meat A review. Meat Sci (Published on line).
A
B
15
th
188
15
th
Technical Innovation in Winemaking and Winegrape Analysis to Enhance
Varietal Characteristics and Increase the Shelf Life of Wines
Fabrizio Torchio (fabrizio.torchio@unito.it)
Dept. Exploitation and Protection of the Agricultural and Forestry Resources, University of Turin,
GRUGLIASCO (TO), Italy
Tutor: Prof. Vincenzo Gerbi
This PhD thesis dealt with the assessment about possible technical innovation to improve winemaking process of
sweet aromatic sparkling wine based on white Muscat (Asti Spumante DOCG) and Brachetto grapes (Brachetto
dAcqui DOCG).
In addition the search for a simple technical to assess of the secondary metabolites (aroma and phenol
compounds) is necessary for a rapid and low expensive grape evaluation. The FT-NIR techniques offer this
possibility for the application on weighbridge or in-field.
Innovazioni della tecnica enologica e nellanalisi delle uve per esaltare le caratteristiche
varietali ed aumentare la shelf life dei vini
Questa tesi di dottorato ha riguardato lo sviluppo di tecnologie innovative del processo produttivo di vini
spumanti dolci ottenuti con uve Moscato bianco e Brachetto. Inoltre stata valutata la possibilit di sviluppare
una tecnica analitica rapida per lanalisi della componente fenolica utilizzando la tecnica FT-NIR. Unanalisi
diretta in vigneto o al conferimento permetterebbe, infatti, di classificare e suddividere luva conferita in cantina
in lotti omogenei su cui adeguare la vinificazione alle caratteristiche della materia prima.
Key words: phenolic maturity, FT-NIR, whole berries, grape homogenate, Barbera, Nebbiolo.
1. Introduction
In accordance with the PhD thesis project previously described (Torchio, 2007), this oral communication reports
the main results of one (1) of the following four activities directed to:
1) study the application of FT-NIR (Fourier transform-near infrared spectrometry) to analysis of
technological and phenolic maturity in homogenate grapes and intact berries;
2) study the application of FT-IR (Fourier transform-infrared spectrometry) to analysed terpene-glycoside
compounds in Muscat grape extract;
3) study the effect of the addition of glutathione and caffeic acid to increase the shelf life of Asti DOCG
wine (cv White Muscat), monitoring by periodical sensorial evaluation and determination of aromatic
compounds and color ;
4) study the shelf life of Brachetto dAcqui DOCG (red sweet sparkling wine) produced at different levels of
alcohol, monitoring periodically sensorial profile, aroma composition and color (CIEL*a*b*,
anthocyanins content and composition, tannins proprieties). Setting the test was based on Central
Composite Design method and the result was evaluated by Response Surface Methodology.
2. FT-NIR analysis of grape
The assessment of the oenological aptitude of wine grapes is related to an appropriate definition of grape quality
which depends on the choice of the harvest date. The evaluation of the technological ripeness, expressed by
analytical parameters such as sugar and acids is not sufficient to completely predict grapes oenological
potentialities. The choice of the harvest date is also important as it influences the final wine quality. Biosynthesis
and concentration of phenols in red grapes depends on the cultivar, management vineyard practices, climatic
conditions, soil features and crop load (Downey, 2006). Quantitative and qualitative modification of tannins and
anthocyanins were observed during the ripening of the grapes (Ortega-Regules et al., 2008). Accumulation of
anthocyanins in skins starts at the veraison and should reach the maximum around harvest, but the final total
content and profile depend on fruit ripeness and harvesting date. Skin proanthocyanidins, instead, are mainly
accumulated before veraison, but the literature reports contrasting results on whether their amount and degree of
polymerization (mDP) increase or decrease during maturation (Kennedy et al., 2002). The highest flavanol
concentrations in the seed is reached at veraison, after they declined slowly until the maturity, hence they remain
relatively constant (Kennedy et al., 2002).
Many studies have been conducted, aimed to define the index which the index that best represents the concept of
15
th
189
15
th
easy transfer of color from the skin. The cellular maturity index (EA%) is currently one of the most used indexes
to assess the extractability of anthocyanins (Ortega-Regules et al., 2006). The analysis of grape parameters is
also fundamental in assessing the quality of the crop for remuneration. Analytical methods of analysis must be
rapid and not expensive. Rapid methods of analysis that employ analytical techniques to assessing the main
components (sugar content, anthocyanin concentration and acidity) are already known..
Titratable acidity, pH, sugar and readily assimilable nitrogen in must and wine can be determinated by FT-IR.
Australian researchers have investigated an application of vis-NIR technology for the evaluation of TSS (total
soluble solids), pH and total anthocyanin content in grapes using homogenate and whole berries (Cozzolino et
al., 2004; Gishen et al., 2005). In other Countries, further rapid analytical methods were developed for the
quantification of sugar content in white and red grapes by FT-NIR spectroscopy technology (Herrera et al.,
2003; Arana et al., 2005).
Near infrared (NIR) radiation covers the range of the electromagnetic spectrum between 780 and 2500 nm. In
NIR spectroscopy, the product is irradiated with NIR radiation, and the reflected or transmitted radiation is
measured. While the radiation penetrates the product, its spectral characteristics change through wavelength in
dependence of scattering and absorption processes.
This change depends on the chemical composition of the product, as well as on its light scattering properties
which are related to the microstructure. Advanced multivariate statistical techniques, such as partial least squares
(PLS) regression are then applied to extract the required information from the usually convoluted spectra.
NIR spectroscopy was first used in agricultural applications to measure moisture in grain. Since then it has been
used for rapid analysis of mainly moisture, protein and fat content of a wide variety of agricultural and food
products (Nicolai et al., 2007).
The aim of this work is to test the applicability the FT-NIR technology to current analyses of phenolic and
technological maturity on whole berries and grape homogenate. A simple exploitable on weighbridge or in-field
method was studied.
For this reason, the study was carried out under conditions that more closely approached those of a winery
laboratory. Pre-treatment of FT-NIR spectra and the selection of the best regression analysis with tested
parameters were carried out by the use of a software supplied by Buchi (CH).
5.1 Grape samples
During 2008 and 2009 vintage seasons in the region of Piedmont, in North West of Italy, five grapes varieties,
were collected and analyzed. During harvest period 1000 berries were randomly handpicked, from bunch
fragments in the medium part of the cane or the cordon excluding those in the first rank of the parcel for each
sample (Carbonneau et al., 1991).
5.2 References analysis
All analysis was performed in two replicates. The average mass of the berries was determined from a sample of
200 berries by technical balance. Sugar, titratable acidity and pH were determined through traditional destructive
tests. 200 berries for each samples were pressed to obtain must. Determination of sugar content was carried out
by an electronic densimeter DMA 48 (Anton Paar, Vienne, A), whereas acidity and pH were assessed by FT-IR
technology (WineScann, Foss).
Concentration and ease of release of phenolic substances was tested by the modified Gloriess index method
(Glories and Agustin, 1993; Cagnasso et al., 2008). 200 berry was homogenised for 1 min. X g of the
homogenate (corresponding to 50 mL density [gmL
-1
]) were added to 50 mL of pH 3,2 solution (22 mLL
-1
NaOH 1N, 5 gL
-1
tartaric acid corrected to pH 3,2 with acid or base) and stirred for 4 hours. Another X g of the
homogenate (corresponding to 50 mL density [gmL
-1
]) were added to 50 mL of pH 1 solution (25 mL of HCl
1N and 25 mL of solution of 4 gL
-1
of Na
2
S
2
O
5
) and stirred for 4 hours. After 4 hours, both extracts were
centrifuged for 15 at 4000 rpm.
Determination of anthocyanidin (A), flavonoid (F) and total phenol (A280) indices was performed on the pH 1
and pH 3,2 extracts using spectrophotometric methods (Di Stefano et al., 1989; Ribereau-Gayon, 1970). All the
measurement were carried out with a UV-1650PC Shimadzu spectrophotometer, using quartz or glass cell with
10 mm path lengths. The phenolic maturity indices calculated, are those defined by Glories Method: potential
anthocyanins (A1), easy extractible anthocyanins (A3,2), cell maturity index (EA%) and seed maturity index
(Mp%). The latter was determined by taking the medium ratio (TAR) into total phenol (expressed as the
absorbance at 280 nm) and total anthocyanin content of the skins (gL
-1
). This value is considered of 40 for
Cabernet sauvignon and Barbera. For the Nebbiolo grapes, the TAR index used was 70 (Cagnasso et al., 2008).
5.3 FT-NIR analysis
The analysis of the sample was performed on fresh and undamaged berries within one day from the sampling in
15
th
190
15
th
the vineyard. All analysis was performed at the room temperature (20C1).
For the whole berries (ca 260 samples) the FT-NIR scans were made in reflectance mode using a NirFlex N500
(Buchi, CH) equipped with optic fibber. The spectra were collected in the range of 4000-10000 cm
1
with
NIRCal 5.1 operative software. For each berry were taken 8 scan with a nominal resolution of 4 cm
-1
. The
random sample of 25 berries was placed on a test tube stand and scanned on the side face, in order to minimize
variability of results (data not reported).
For the analysis on grape homogenate (ca 500 samples) the samples were tested in high performance cup in
quartz. The FT-NIR scans (reflectance mode) were made using a NirFlex N500 (Buchi, CH) equipped with a
rotative solids module. The spectra were collected in the range of 4000-10000 cm
1
with NIRWare operative
software. For each homogenate were taken 3 scans (average of 32 spectra), with a nominal resolution of 4 cm
-1
.
5.4 Data manipulation
The FT-NIR spectra were pre-treated with NIRCAL 5.1 (Buchi, CH). Were taken the averages spectra of 25
scanned berries or 3 homogenate spectra for each samples.
The averages spectra were randomly divided into two sets: ca 75% were used for the calibration set and ca. 25%
for the validation set.
6.1 References analysis
Table 1 show the mean standard deviation and range for the grape samples determined by reference analysis.
The 2008 and 2009 vintages are characterized by heterogeneous level of the grape maturity. The samples have a
wide range of content of sugar, acidity and phenol compounds.
Table 1 Results of references analysis in 2008 and 2009 vintage
Parameters Results
min max average
Sugar Brix 16,2 28,7 24,0
pH 2,58 3,43 3,04
Acidity gL
-1
tartaric acid 4,1 17,6 8,7
A1 mgL
-1
malvidine-3-glucoside chloride 278 1753 654
A3.2 mgL
-1
malvidine-3-glucoside chloride 115 781 367
A280 Absorbance (10 mm path length) 39,7 93,0 62,3
EA% 20,5 71,1 43,3
Mp% 20,5 91,6 61,8
6.2 FT-NIR analysis
The natural variation in degree of ripeness both between and around the surface of intact berries and the
variation in skin colour could also contribute to variability in spectra response (Figure 1).
The variability spectra FT-NIR in three repetitions for the grape homogenate of same sample is lower than whole
berries (Figure 2). In fact the homogenisation of berries offers the possibility to work with more representative
sample, but is necessary wait at least ten minutes to eliminate the air bubbles incorporate with homogenisation.
Figure 1 FT-NIR spectra of 25 whole berries of two
different samples
Figure 2 FT-NIR spectra of 3 repetitions of grape
homogenate of two different samples
Pretreated Spectra
All Spectra
Wavelengths
R
e
f
l
e
c
t
a
n
c
e
4000 6000 8000 10000
0.00
0.02
0.04
0.06
0.08
0.10
0.12
0.14
0.16
N
IR
C
a
l : fib
ra
o
ttic
a
.n
ir u
n
n
a
m
e
d
1
0
/0
5
/2
0
1
0
1
7
.3
7
.5
7
A
d
m
in
is
tra
to
r
Calibration Spectra
Validation Spectra
B
Original Spectra
All Spectra
Wavelengths
R
e
f
l
e
c
t
a
n
c
e
4000 6000 8000 10000
0.00
0.05
0.10
0.15
0.20
N
IR
C
a
l : T
R
A
S
F
L
E
T
T
A
N
Z
A
.n
ir u
n
n
a
m
e
d
1
0
/0
5
/2
0
1
0
1
7
.5
1
.2
1
A
d
m
in
is
tra
to
r
Calibration Spectra
B
15
th
191
15
th
6.3 Data manipulation
To minimise the effect of different levels of maturity were used the average spectrum of 25 scanned berries
(Figure 3). Indeed is not indispensable work by average spectra for the homogenate samples but is suitable to
simplify the data set of 500 samples (Figure 4).
The spectra elaboration was performed by automatic procedures of NirCal software. For each pre-processing
sequences (e.g. spectral region, path length correction, smoothing and derivatization), the PLS method was used
to develop a calibration procedure.
6.3 Spectra elaboration
Results of chemometric analysis and calibration development for the grapes homogenate are reported in Table 2.
Good results were obtained with the FT-NIR technique that show correlation coefficients > 0.90 for the sugar
and pH, suggesting that either instrument could be used to effectively evaluate technological ripeness. Validation
with external data set for anthocyanins and phenols show lower correlation coefficients (r <0.83), but the SEP is
acceptable for the analysis routine. When the elaboration are performed on one cultivar (ex. Nebbiolo grapes) the
results are better in particular in anthocyanin content.
Table 2 Results of PLS models for technological parameters and phenolic maturity indexes of grape homogenate
(samples: 250 Nebbiolo, 220 Barbera, 30 other Cabernet sauvignon, Merlot, Dolcetto).
Parameters All samples Nebbiolo samples
R SEP range R SEP range
Sugar 0,970 0,40 17,8-27,4 0,962 0,30 21,0-26,2
pH 0,854 0,08 2,68-3,36 0,902 0,06 2,81-3,31
Acidity 0,904 1,03 5,4-17,0 0,836 0,70 5,5-11,3
A1 0,782 148 328-1487 0,816 70 328-894
A3.2 0,715 67 168-656 0,708 49 212-506
A280 0,676 7,6 41,2-88,3 0,732 5,1 40,7-72,7
EA% 0,764 6,9 23,7-65,1 0,559 4,6 25,3-46,7
Mp% 0,873 7,0 29,9-87,2 0,820 5,6 31,1-68,1
Results of calibrations of whole berries are reported in Table 3. When comparing the calibrations for whole or
homogenised grape samples (Table 2, Figure 5), the R and SEP (error of prediction using a external data set of
sample) obtained are worst than homogenised samples in all parameters. The lower accuracy obtained when
scanning whole grapes might be balanced by improved efficiencies for laboratories needing to measure large
numbers of samples in specific applications such as streaming samples for harvest scheduling in the vineyard.
Figure 3 Average FT-NIR spectra of 25 whole berries of
two different samples
Figure 4 Average FT-NIR spectra of 3 repetitions of
grape homogenate of two different samples
Original Spectra
All Spectra
Wavelengths
R
e
f
l
e
c
t
a
n
c
e
4000 6000 8000 10000
0.00
0.05
0.10
0.15
0.20
N
IR
C
a
l : T
R
A
S
F
L
E
T
T
A
N
Z
A
.n
ir u
n
n
a
m
e
d
1
0
/0
5
/2
0
1
0
1
7
.5
2
.4
1
A
d
m
in
is
tra
to
r
Calibration Spectra
B
Original Spectra
All Spectra
1/cm
R
e
f
l
e
c
t
a
n
c
e
4000 5000 6000 7000 8000 9000 10000
0.04
0.06
0.08
0.10
N
IR
C
a
l : u
n
n
a
m
e
d
1
0
/0
5
/2
0
1
0
1
7
.3
9
.5
8
A
d
m
in
is
tra
to
r
Calibration Spectra
B
15
th
192
15
th
The use of FT-NIR technology could potentially increase in speed and frequency of technological and phenolic
maturity (Glories indexes) analysis.
The analysis of whole berries was compared with that conducted the homogenate, since may offer advantages in
further to investigate on-farm application. The results of this work showed again an higher SEP respect to
homogenate grapes.
In the homogenate samples the SEP indicate a good possibility to export the calibrations to other cultivar.
Nebbiolo grape have a particular anthocyanins profile and different phenol distribution in the berry. For this
cultivar is necessary to calculate specify calibration to obtained good prediction in all parameters investigated.
7. References
Arana I, Jaren C, Arazuri S, (2005) Maturity, variety and origin determination in white grapes (Vitis vinifera L.) using near
infrared reflectance technology. Near Infrared Spectrosc 13: 349-357.
Cagnasso E, Rolle L, Caudana A, Gerbi V (2008). Relation between grape phenolic maturity and red wine phenolic
composition. Ital J Food Sci 19: 101-109.
Carbonneau A, Moueix A, Leclair N, Renoux JL (1991) Proposition d'une mthode de prlvement de raisins partir de
l'analyse de l'htrognit de maturation sur un cep. Bull OIV 64: 679-690.
Cozzolino D, Esler MB, Dambergs RG, Cynkar WU, Boehm DR, Francis IL, Gishen M (2004) Prediction of colour and pH
in grapes using a diode array spectrophotometer (400-1100 nm). J Near Infrared Spectrosc 12: 105-111.
Di Stefano R, Cravero MC, Gentilini N (1989) Metodi per lo studio dei polifenoli dei vini. LEnotecnico 25: 83-89.
Downey M, Dokoozlian NK, Krstic MP (2006) Cultural practice and environmental impacts on the flavonoid composition of
grapes and wine: A Review of recent research Am J Enol Vitic 57: 257-268.
Gishen M., Dambergs RG, Cozzolino D (2005) Grape and wine analysis enhancing the power of spectroscopy with
chemometrics. A review of some applications in the Australian wine industry. Austr J of Grape and Wine Researcher,
11: 296-305.
Gloryes Y, Agustin M (1993) Maturit phnolique du raisin, consquences technologiques: applications aux millsimes 1991
et 1992. C.R. Colloque "Journe technique du CIVB", Bordeaux (France), pp 56-64.
Herrera J, Guesalaga A, Agosin E (2003) Shortwave-near infrared spectroscopy for non-destructive determination of maturity
of wine grapes. Meas Sci Technol 14: 689-697.
Kennedy JA, Matthews MA, Waterhouse A (2002) Effect of maturity and vine water status on grape skin and wine
flavonoids Am J Enol Vitic 53: 268-274.
Nicolai BM, Beullens K, Bobelyn E, Peirs A, Saeys W, Theron KI, Lammertyn J (2007) Nondestructive measurement of fruit
and vegetable quality by means of NIR spectroscopy: a review. Posth Biol Tech 46: 99-118.
Ortega-Regules A, Romero Cascales I, Ros Garcia JM, Bautista Ortin AB, Lopez Roca JM (2008) Anthocyanin and tannins
in four varieties (Vitis vinifera L.). Evolution of their content and extractability. J Int of Vine and Wine Sciences 42: 3,
147-156.
Ortega-Regules A, Romero-Cascales I, Ros-Garca JM, Lpez-Roca JM, Gmez-Plaza E, (2006) A first approach towards
the relationship between grape skin cell-wall composition and anthocyanin extractability Anal Chim Acta 563:2632.
Ribereau-Gayon P (1970) Les dosages des composs phnoliques totaux dans le vin rouges Chimie Anal 52: 627-632.
Table 2 Results of PLS models for technological
parameters and phenolic maturity indexes of whole grape
(samples: 200 Barbera, 50 Nebbiolo, 10 other Cabernet
sauvignon, Merlot, Dolcetto).
Predicted Property vs. Original Property
All Spectra
Original Property AT pH 1
P
r
e
d
i
c
t
e
d

P
r
o
p
e
r
t
y

A
T

p
H

1
0 500 1000 1500 2000
0
200
400
600
800
1000
1200
1400
1600
N
IR
C
a
l : A
1
A
v
e
ra
g
e
fib
ra
o
ttic
a
.n
ir A
T
p
H
1
, 0
.1
4
4
4
, 1
-8
./1
0
, 4
4
4
0
-9
0
0
0
. 1
0
/0
5
/2
0
1
0
1
7
.1
4
.5
9
A
d
m
in
is
tra
to
r
Calibration Spectra f(x)=0.5842x+336.7268 r=0.7643 r2=0.5842 Sdev(x-y)=180.8167 BIAS(x-y)= 0 range(x)=322.7 .. 1655 n=163
Validation Spectra f(x)=0.6404x+280.4512 r=0.7017 r2=0.4924 Sdev(x-y)=169.1382 BIAS(x-y)=7.986 range(x)=334.2 .. 1327 n=55
Calibration Spectra
Validation Spectra
B
Parameters All samples
R SEP range
Sugar 0,917 0,75 19.2-27.1
pH 0,751 0,08 2.68-3.18
Acidity 0,897 1,1 6.2-16.9
A1 0,702 169 334-1327
A3.2 0,724 83 198-764
A280 0,773 6,6 46.3-91.9
EA% 0,728 6,4 30.8-74.1
Mp% 0,847 5,5 41.1-91.6
Figure 5 Correlation between total anthocyanins content
(A1) original and predicted
15
th
193
15
th

Effect of climatic changes on the quality of Sicilian wines:
chemical and sensory characterization of Nero dAvola in relation to the
soil salinity.
Gianluca Tripodi

(gitripodi@unime.it)
Dep. of Organic and Biological Chemistry, University of Messina, Italy
Tutor: Prof.ssa Antonella Verzera

This PhD thesis research project is a part of a larger project conducted by Istituto Regionale della Vite e
Vino (Palermo, Sicily) which aims at enhancing the production of native Sicilian vineyards which are suitable
for the pedo-climatic changes currently occurring. Here we refer on the influence of the increased soil salinity
on the vineyard productivity and the quality of Nero dAvola wine production mainly in terms of chemical
composition, volatile aroma compounds and sensory characters. The agronomic data showed that the vineyard
productivity, such as the grape yield, the average weight of the grape bunches and the number of grape
bunches per plant, decreased with increasing soil salinity. The chemical data, statistically processed and useful
for the characterization of this well-known and appreciated red Sicilian wine, evidenced differences in relation
to the different salinity zones even if acceptable in terms of sensory properties.
Effetti dei cambiamenti climatici sulla qualit di vini siciliani:
caratterizzazione chimica e sensoriale del Nero dAvola in relazione alla salinit del
suolo.
La ricerca svolta allinterno di questa tesi di dottorato parte di un pi ampio progetto condotto dall Istituto
Regionale della Vite e del Vino (Palermo, Sicilia) che mira a potenziare la produzione di quei vigneti
autoctoni siciliani che meglio si adattano ai cambiamenti climatici. Qui riferiamo sullinfluenza
dellincremento della salinit del suolo sulla produttivit e sulla qualit delle produzioni del vino Nero d'Avola
in termini di composizione chimica, composti volatili responsabili dellaroma e caratteristiche sensoriali. I dati
agronomici dimostrano che la produttivit del vigneto (resa in uva, peso medio dei grappoli, numero di
grappoli per pianta), diminuisce con laumento della salinit del suolo. I dati chimici, analizzati statisticamente
ed utili per la caratterizzazione di questo ben conosciuto e apprezzato vino rosso siciliano, evidenziano
differenze compositive dei vini in relazione alla differente salinit dei suoli; tali differenze, tuttavia,
determinano variazioni accettabili del profilo sensoriale.

Key words: Soil salinity, Nero dAvola wine, aroma compounds, sensory analysis.
1. Introduction
The progressive salinization of land, a consequence of climate change, is one of the most severe worldwide
problems in agriculture production (Sidari et al., 2008; Pandey and Thakares, 1997). In Sicily, the total area of
saline soils is about 600,000 ha, mainly concentrated in the southern and western part of the island; in this
region the wine sector represents one of the main economic realities for agriculture and agro-industry. Vitis
vinifera L. is considered moderately sensitive to salinity stress and its physiological and metabolic responses to
the increased soil salinity were widely studied (Maas et al., 1977; Hawker and Walker, 1978; Shani et al., 1993;
Walker et al., 2002); on the contrary, the international literature is lacking in information regarding the quality
of the wines produced from vineyards undergo to a salinity stress.
At the best of our knowledge, this research correlate for the first time the influence of the soil salinity on the
quality of wine production, in terms of chemical composition, volatile aroma compounds and sensory
characters. For our research, we selected Nero dAvola wine since it is one of the most appreciated red
Italian wine, well known all over the world but little studied (Ruberto et al., 2008, Esti and Tamborra, 2006).
The analytical approach used for the extraction of aroma volatile compounds was the SPME followed by
capillary GCMS; the sensory analyses were carried out following three steps: visual inspection, smelling and
tasting in the mouth.
2.1 Sampling
The samples of the wines analyzed were produced in a Nero dAvola vineyard located in Santa Margherita
Belice (Agrigento, Sicily, Italy) at 280m above sea level; the clime is Mediterranean with dry period from May
15
th
194
15
th

to September and rainy period in the winter months; the soil was defined as sodic, vertical and calcixerepts,
with 55-60% clay content and a pH of 8.1-8.3; in summer, irrigation using rainwater is sometime required. The
salt content of the soil increased along the rows from top to bottom, thus the vineyard was divided into three
zones of different salinity:
zone 1: negligible saline content, ECe 0.7 dS/m (average value up to a depth of 105 cm);
zone 2: average saline content, ECe 1.2 dS/m (average value up to a depth 55 cm) and 2.1 dS/m

(average
value from 55 to up to a depth of 105 cm);
zone 3: high saline content ECe 1.0 dS/m (average value up to a depth 55 cm) and 7.6 dS/m (average
value from 55 to up to a depth of 105 cm).
The grapes from the three zones of the vineyard were harvested separately in September 2007 and 2008 and
immediately transferred to an experimental winery of the Istituto Regionale della Vite e del Vino in Marsala
(Sicily, Italy). Altogether twenty-four sample wines were considered; twelve samples for each production year,
four samples for each zone, from two different fermentations. (For each fermentation, 200-300 Kg of grapes
were considered). Each sample was analyzed in duplicate. The winemaking is reported in Figure 1.

2.2 Chemical analysis
Physicochemical parameters were carried out on the grape musts and, after fermentation, in the wines before
bottling, according the EEC Official Method (Regulation (EC) No 2676/90).
2.3 Analysis of aroma compounds
The extraction and analysis of volatile compounds was carried out as previously reported (Lanza et al., 2010).
2.4 Sensory Analysis
The sensory profile (UNI 2003) was made using a panel of ten expert judges. The final set consisted of 17
descriptors: two referring to appearance (color intensity, purple reflexes), 11 referring to aroma (fruity, citrus,
wild berries, fruit in the spirit, cherry in the spirit, ripened fruit, dried fruit (nut, hazelnut), floral,
vegetative/herbaceous, spicy, vanilla), and four referring to oral perception (acid, salty, bitter and astringent).
2.5 Statistical Analysis
zone 1 zone 2 zone 3
vineyard productivity
grapes (Kg for plant)

2.050c

1.736b 1.304a
weight of the bunch (g)

202c 193b 188a
nof bunchs for plant

10.1c 7.9b 6.5a
musts
Babo

16.9 17.4 17.6
titratable acid (g/L)

7.4 6.6 6.9
pH

3.23 3.17 3.35
wines
alcohol (% vol.)

12 12.5 12.5
titratable acid (g/L) 6 6.7 6.4
pH 3.63 3.49 3.51
tartaric acid (g/L

) 3.19a
b
3.61b 4.16c
lactic acid (g/L

) 1.1 1.3 1.1
total dry extract (g/L) 27.2a 28.2b 28.7b
total polyphenols (mg/L) 1336a 1491b 1659c
total anthocyanins (mg/L) 270a 295b 329c
total flavonoids (mg/L) 852a 960b 1165c
sulphates (mg/L) 635a 648b 704b
colour intensity
(A420+A520+A620)
7.8a 9.3b 9.5b
colour hue (A420/A520) 0.52b 0.44a 0.42a
Figure 1 Winemaking stage
Table 1 Average data of vineyard productivity and
physicochemical parameters

of the analysed musts and wines.
a
Different letters in the same row represent significant differences at
P < 0.05 by Duncans multiple range test.
15
th
195
15
th

Chemical and sensory data were submitted to ANOVA, Duncans multiple-range test and PCA (Statgraphic
Plus software ver. 5.1).

The productivity results showed that the grape yield, the average weight of the grape bunches and the number
of grape bunches per plant decreased with increasing soil salinity (Table 1), in agreement with Walker (1994)
which denoted that soil salinity affected plant productivity limiting shoot and root growth. (Prior et al.,
1992a,b,c; Walker, 1994, Walker et al., 1996; Ben-Asher et al., 2006). The physicochemical parameters of the
musts showed no significant differences between the three zones; on the contrary, a significant increase in
tartaric acid, polyphenols, anthocyanins flavonoids, sulfates, color intensity and hue was observed with
increasing salinity. With regard to the volatile fraction (Table 2 and Figure 2A), fifty-four components were
identified with ethyl octanoate (banana, fruit, fat), ethyl hexanoate (apple peel, fruit) ethyl decanoate (grape,
fruity) and linalool (fresh, lavender) the main components in all the samples. The ANOVA showed significant
differences in the average content of most of the components and classes of substances in samples from the
three different zones (Table 3). The sensory analysis (Figure 3) showed significative differences just for color
intensity, purple reflexes, fruit in the spirit, citrus and salty descriptors that were highest in zone 3
marked by an high saline content.
Compounds LRI
a
ethyl butanoate 1038
ethyl 2-methylbutanoate 1052
ethyl 3-methylbutanoate 1067
isoamyl acetate 1119
sabinene 1139
!-pinene 1144
myrcene 1166
limonene 1198
isoamyl alcohol 1208
ethyl hexanoate 1231
"-terpinene 1239
hexyl acetate 1271
terpinolene 1284
3-methyl-1-pentanol 1324
ethyl heptanoate 1333
1-hexanol 1350
(Z)-3-hexen-1-ol 1382
ethyl octanoate 1438
acetic acid 1453
isopentyl hexanoate 1458
ethyl geranyl ether 1472
2-ethyl-1-hexanol 1486
hotrienol 1505
linalool 1513
butyl octanoate 1551
1-octanol 1554
methyl decanoate 1595
ethyl decanoate 1640
isoamyl octanoate 1659
!-farnesene 1661
diethyl succinate 1675
(Z)-ethyl-4-decenoate 1691
!-terpineol 1692
(Z)-ethyl-3-decenoate 1704
#-muurolene 1724
$-cadinene 1769
methyl dodecanoate 1798
!-phenylethyl acetate 1815
!-damascenone 1821
ethyl dodecanoate 1841
geranilacetone 1854
methyl-3-butyl butanoate 1860
ethyl succinate 1899
!-phenylethyl alcohol 1912
(E)-nerolidol 2001
(Z)-nerolidol 2036
ethyl tetradecanoate 2056
octanoic acid 2056
ethyl pentadecanoate 2149
ethyl esadecanoate 2250
decanoic acid 2265
(E)-ethyl-9-esadecenoate 2278
1

Table 2 Volatile compounds identified in Nero dAvola wine samples.
a
Linear Retention Index calculated on CP-WAX 52 CB column.
Figure 2 SPME-GC-MS Chromatogram (A = TIC, B = SIM m/z
93.0+121.0+136.0) of a Nero dAvola wine sample.
Figure 3 Sensory profile of the samples analysed.
1
2
3
4
5
Color intensity
Purple reflexes
Fruity
Citrus
Wild berries
Fruit in the spirit
Cherry in the spirit
Ripened fruit
Dried fruit (nut, huzelnut) Floral
Herbaceous/vegetative
Spicy
Vanilla
Acid
Salty
Bitter
Astringent
Zone 1 Zone 2 Zone 3
15
th
196
15
th

All the chemical variables, both volatile constituents and physicochemical parameters, were thus submitted to a
Principal component analysis (PCA). The first three principal components accounted for 89% of total variance
(68.6% of total variance for PC1, 17.6% for PC2 and 2.8 for PC3) (Figure 4); the compounds most strongly
correlated with the first three principal components are listed in Table 4. PC1, which evidenced that the wines
from three zones were clearly distinct each other, displayed a strong correlation with most of esters, colour
intensity, isoamyl alcohol, polyphenols, colour hue and anthocyanins. PC2 separated zone 2 wines from the
others; the variables correlating most strongly with this axis were !-phenylethyl alcohol, decanoic acid and (Z)-
nerolidol; while !-pinene, hotrienol, #-muurolene and !-damascenone on PC3 (Table 4).
Volatile esters, whose amount increased from zone 1 to zone 3, are responsible for the fruity character of
fermented beverages and thus constitute a vital group of aromatic compounds in wine. The different amount of
esters in the wines from the three zones could be due to a different precursor (free fatty acids) availability; in
fact, it has been demonstrated that provision of medium-chain fatty acids to the fermentation medium causes a
strong increase in the formation of the corresponding esters (Saerens et al., 2008). Polyphenols and
anthocyanins, in agreement with previously studies in other red grape varieties (Hardie and Considine, 1976;
Matthews and Anderson, 1988; Koundouras et al., 1999), increased from zone 1 to 3, too. The different amount
of anthocyanins among the three zones was in agreement with the visual sensory descriptors and chemical data,
such as colour intensity and hue. Isoamyl alcohol and !-phenylethyl, that most contributed to the PC1 and 2,
respectively, can be related to the content and proportions of free amino acids in the must. In fact, !-phenylethyl
alcohol is derived from phenylpyruvate, the direct precursor of phenylalanine, while isoamyl alcohol derives
from leucines (Clarke and Bakker, 2004). The primary aromas, both monoterpene and sesquiterpene
hydrocarbons and C
13
-norisoprenoids most contributed to PC3. A large number of terpenes have been identified
for the first time in Nero dAvola wine (Figure 2B); they have a very pleasant aroma and very low olfactory
thresholds, and are therefore perceived during wine tasting even in low concentrations, also due to several
synergic and antagonist effects observed among them and can be correlated with the citrus descriptor. They
are mainly derived from the grapes (Pena et al., 2005), synthesized during maturation, and qualitatively and
quantitatively influenced by the cultivar, soil, climate and viticulture practices. Also the fruit-derived C
13
-
norisoprenoids, such as !-damascenone (sweet, apple) and geranilacetone (fresh, rose, floral), are important
odorants in wines and originate from carotenoid degradation.

zone 1 zone 2 zone 3
PC1
ethyl dodecanoate (g/L)

13.03a
a
23.12b 25.65b
methyl dodecanoate

(g/L) 1.68c 0.89b 0.54a
ethyl decanoate

(g/L) 205.45a 327.45b 336.38b
colour intensity
(A420+A520+A620)
7.8a 9.3b 9.5b
ethyl octanoate

(g/L) 580.83a 767.71b 871.68c
isoamyl exanoate (g/L)

3.75a 4.38b 4.89b
isoamyl alcohol (mg/L) 161.86a 182.65b 197.03c
total polyphenols (mg/L) 1336a 1491b 1659c
hexyl acetate

(g/L) 3.75a 9.80b 16.42c
ethyl butanoate (g/L)

4.77a 7.93b 8.02b
color hue (A420/A520) 0.52b 0.44a 0.42a
total anthocyanins (mg/L) 270a 295b 329c
PC2
!-phenylethyl alcohol (mg/L) 44.73a 75.38c 57.20b
decanoic acid (mg/L) 0.27a 2.67c 1.22b
(Z)-nerolidol

(g/L) 4.21a 6.33b 4.93a
(Z)-4-ethyl decenoate (g/L) 8.99a 18.59c 14.15b
diethyl succinate

(g/L) 55.67a 61.98b 102.57c
methyl decanoate

(g/L) 0.85a 2.02c 1.54b
ethyl eptanoate (g/L)

2.67a 4.62c 3.68b
PC3
!-pinene (g/L)

0.12a 0.12a 0.32b
hotrienol (g/L) 3.92a 4.31b 5.83c
#-muurolene (g/L)

0.34b 0.28b -
b
a
!-damascenone (g/L)

0.64b 0.58b 0.41a
geranilacetone

(g/L) 5.25a 6.46b 7.29c
classes of substances zone 1 zone 2 zone 3
esters (g/L) 1150.19a 1717.09b 1885.10c
alcohols (mg/L) 214.35a 269.11b 265.10b
acids (mg/L) 5.93a 12.07c 8.67b
terpenes (g/L) 18.38a 22.46b 24.46c
C13-norisoprenoidi (g/L) 5.89a 7.04b 7.70b
Table 3 Average composition as classes of substances for
the Nero dAvola wine samples.
PC1
P
C
2
P
C
3
-6
-3
0
3
6
9
-3.5
0.5
4.5
8.5
-2.2
-1.2
-0.2
0.8
1.8
2.8
3
2
1
PC1
P
C
2
P
C
3
-6
-3
0
3
6
9
-3.5
0.5
4.5
8.5
-2.2
-1.2
-0.2
0.8
1.8
2.8
3
2
1
Figure 4 Principal component (PC) analysis of chemical
composition data of Nero dAvola wine samples.
Projection of the wine samples analyzed in the space
formed by the PC1, PC2 and PC3. 1=zone 1; 2=zone
2;3= zone 3.
Table 4 Average data of variables most strongly correlated
in the PCA.
a
Different letters in the same row represent significant differences
at P < 0.05 by Duncans multiple range test.

15
th
197
15
th

4. Conclusion
From the statistical elaboration of the data, it is possible to affirm that the soil salinity influenced the wine
composition, and thus the whole grape composition. In fact the amounts of polyphenols, anthocyanins, primary
aroma compounds and C
13
-isoprenoids, which are derived from the grapes, was found significantly different
with increasing soil salinity. Fermentation aromas, such as esters and !-phenylethyl alcohol and isoamyl alcohol,
were influenced by the soil salinity, too; the different amount of these volatile constituents can be due to their
precursor availably in the musts, such as aminoacids and fatty acids. The compositive differences observed
among the samples little influenced the sensory characteristics; interestingly, the increase in soil salinity
enhanced color intensity, purple reflexes, salty, citrus and fruit in the spirit aroma. Moreover, the
wines from medium and high saline soil content were positively appreciated by wine tasty experts while those
from negligible salinity were defined flat and dull. From our data, a strong saline content substantially reduced
the plant productivity but moderately the quality of the wine in terms of chemical composition and sensory
characteristics. This result is of great importance in the field of viticulture, given the need to augment the
cultivation of those vine varieties which adapt well to the climate changes.
5. References
Ben-Asher J, Tsuyuki I, Braudo B, Sagih M (2006) Irrigation of grapevines with saline water I. Leaf area index, stomatal
conductance, transpiration and photosynthesis, Agric. Wat. Man. 83(1-2): 13-21.
Clarke RJ, Bakker J (2004) Wine flavour chemistry. Blackwell Publishing Ltd, Oxford UK.
Esti M, Tamborra P (2006) Influence of winemaking techniques on aroma precursors. Anal. Chim. Acta 563: 173179.
Hardie WJ, Considine JA (1976) Response of Grapes to Water-Deficit Stress in Particular Stages of Development Am. J.
Enol. Vitic. 27(2): 55-61.
Hawker JS, Walker RR (1978) The effect of sodium chloride on the growth and fruiting of Cabernet Sauvignon vines. Am. J.
Enol. Vitic. 29: 172-176.
Koundouras S, van Leeuwen C, Seguin G, Glories Y (1999) Influence of water status on vine vegetative growth, berry
ripening and wine characteristics in Mediterranean zone. J. Int. Des Sci. Vig. Vin. 33, 149-160.
Lanza CM, Mazzaglia A, Scacco A, Tripodi G, Dima G, Verzera A (2010) Correlation between aroma compounds and
sensory properties of Passito Malvasia wines producer in Sicily. Am. J. Enol. Vitic. 61: 260-265
Maas EV, Hoffman GJ (1977) Crop salt tolerance-current assessment. J. Irrig. Drain. Div. ASCE 103: 115-134.
Matthews Mark A, Anderson Michael M (1988)Fruit Ripening in Vitis vinifera L.: Responses to Seasonal Water Deficits Am.
J. Enol. Vitic. 39(4): 313-320.
Pandey AN, Thakares NK (1997) Effect of chloride salinity on survival and growth of Prosopis chilensis seedlings. Trop.
Ecol. 3: 145-148.
Pena RS, Barciela J, Herrero C, Garcia-Martin S (2005) Optimization of solid-phase microextraction methods for GC-MS
determination of terpenes in wine. J. Sci. Food Agric. 85: 1227-1234.
Prior LD, Grieve AM, Cullis BR (1992a) Sodium chloride and soil texture interactions in irrigated field grown sultana
grapevines. I. Yield and fruit quality. Austr. J. Agric. Res. 43: 1051-1066.
Prior LD, Grieve AM, Cullis BR (1992b) Sodium chloride and soil texture interactions in irrigated field grown sultana
grapevines. II. Plant mineral content, growth and physiology. Austr. J. Agric. Res. 43: 1067-1083.
Prior LD, Grieve AM, Slavich PG, Cullis BR (1992c) Sodium chloride and soil texture interactions in irrigated field grown
sultana grapevines. III. Soil and root system effects. Austr. J. Agric. Res. 43: 1085-1100.
Ruberto G, Renda A, Amico V, Tringali C (2008) Volatile components of grape pomaces from different cultivars of Sicilian
Vitis vinifera L. Biores. Technol. 99: 260268.
Saerens SMG, Delvaux F, Verstrepen KJ, Van Dijck P, Thevelein JM, and. Delvaux FR (2008) Parameters affecting ethyl
ester production by Saccharomyces cerevisiae during ermentation Appl. Environ. Microbiol. 74(2): 454461.
Shani U, Waisel Y, Eshel A, Xue S, Ziv G (1993) Responses to salinity of grapevine plants with split root systems. New
Phytol. 124: 695-701.
Sidari M, Santonoceto C, Anastasi U, Preiti G, Muscolo A (2008) Varations in four genotypes of lentil under NaCl-salinity
stress. Am. J. Agric. & Biol. 3(1): 410-416.
Van den Dool H, Kratz PD (1963) A generalization of the retention index system including linear temperature programmed
gas-liquid partition chromatography. J. Chromatogr. 11: 463-471.
Walker RR (1994) Gravevine responses to salinity. Bulletin de l'OIV 67: 634-661.
Walker RR, Blackmore DH, Clingeleffer PR (1996) Salinity-vine vigour interactions and their effects on fruitfulness and
yield of saltana on Ramsey rootstock and own roots. Austr. Dried Fruits Assoc. News. 16-18.
Walker RR, Blackmore DH, Clingeleffer PR, Correll RL (2002) Rootstock effects of salt tolerance of irrigated field-grown
grapevines (Vitis vinifera L. cv. Sultana) 1. Yield and vigour inter-relationships. Aust. J. Grape Wine Res. 8: 3-14.

15
th
198
15
th
Innovative Technologies for Intact and Fresh-cut Fruit and Vegetables
Processing
Urszula Tylewicz (urszula.tylewicz@unibo.it)
Tutor: Dr. Pietro Rocculi; Co-tutor: Drs. Santina Romani

This PhD thesis dealt with the investigation of quality characteristics changes and physiological responses of different
plant matrix submitted to some traditional (with some improvements) or innovative technologies for minimal
processing and/or freezing procedure. All these techniques were aimed to obtain a final product with qualitative
characteristics as much as possible similar to those of the fresh raw material.
Tecnologie innovative per la produzione di ortofrutticoli interi e lavorati al minimo
La presente tesi di Dottorato ha riguardato principalmente lo studio delle modificazioni di alcune caratteristiche
chimico-fisiche di prodotti vegetali e dei fenomeni responsabili di tali cambiamenti, causati dai processi di
trasformazione (tradizionale ed innovativo) e/o congelamento. Nellottica della trasformazione industriale, tali
interventi hanno lo scopo di permettere lottenimento di un prodotto finale con caratteristiche qualitative che si avvicino
a quelle del prodotto fresco.

Key words: Osmotic dehydration; freezing; mass transfer; minimal processing.
1. Introduction
In accordance with the PhD thesis project previously described (Tylewicz, 2008 and 2009), this scientific report covers
the main results of the following three principal activities:
(A1) mass transfer, state of water and quality characteristics of two cultivar of kiwifruit submitted to osmotic
dehydration process;
(A2) application of SAFES (systematic approach to food engineering systems) methodology to experimental data of
osmotic dehydrated kiwifruit;
(A3) improvement of freezing process:
a) application of ultrasounds during freezing of potato cubes;
b) vacuum impregnation of whole strawberries with some cryoprotectans.

The (A1) activity was carried out on two cultivar of kiwifruit: green-fleshed Hayward (Actinidia deliciosa) and yellow-
fleshed Hort-16A (Actinidia chinensis) commercially note as Zespri
TM
Gold. The osmotic dehydration was carried out
in a solution at 61.5% of sucrose. A ratio of 1:4 (w/w) of kiwifruit:solution was used. The temperatures of dewatering
were 25, 35 and 45C and the treatment time has been varied from 0 to 300 min (0, 5, 15, 30, 60, 120 and 300 min). The
solution temperature has been maintained at constant values by a thermostatically controlled water bath. On osmotic
dehydrated samples the following determinations were carried out: weight loss, water content, shrinkage, total soluble
solid, a
w
, hardness and colour. In order to study the water state inside the fruit samples DSC and NMR measurements
were performed.
In the second activity (A2) a new systematic approach to food engineering system SAFES (Fito et al., 2007) was
applied to experimental data obtained through osmotic dehydrated kiwifruit experiments, in the following order:
! Description of the traditional process flow chart and unit operations;
! Analyses of the operations and estimation of stage of changes ending when the behaviours change (critical
points);
! Definition of the phases, compounds, aggregation state and thermodynamic variables (V, P, T);
! Description of the product (descriptive Matrix) before and after each stage of changes;
! Estimation of the Matrix of changes of each operation;
! Analyses of the Matrix of changes describing fluxes, transitions, chemical and biochemical reactions and
behaviours (with circles, rows and colours);
The research activity of the third stage (A3) can be divided into two parts. The first concerning freezing of potato cubes
(20 ! 20 mm), applying ultrasounds to the supercooled potato cube samples. Ultrasounds were applied when the
temperature of the geometrical centre of the potato cubes was in the - 0.1C to - 3.0C range. The cooling curves
obtained by immersion freezing of potatoes with or without ultrasound application were analyzed and the following
15
th
199
15
th
characteristic factors of the freezing process were evaluated: nucleation (NT) and initial freezing (IFT) temperatures;
time of nucleation (Ntime), transition phase (TPtime) and global freezing process (Ftime).

The second part of the A3 activity included the vacuum impregnation of whole strawberries with substances acting as
cryoprotectant, such as trehalose and antifreeze protein. Three different solutions were prepared: 12% (w/w) trehalose;
0.2% (w/w) antifreeze protein and combination of 12% (w/w) trehalose with 0.2 % (w/w) antifreeze protein. The
vacuum infusion was carried out at 20C in a chamber connected to a vacuum pump. The strawberries (70 g) were
immersed in one of the solutions for 14 min. After the infusion, the strawberries were frozen in liquid nitrogen for 25 s.
The samples were then immediately thawed at room temperature (20C) for 2 h. The solid gain determination was
performed on vacuum impregnated samples while drip loss, texture and cell viability analysis were carried out on
thawed samples. The assessment of cell viability of strawberry tissue was performed by fluorescence microscopy, using
dye fluorescent diacetate (FDA).
Results of the first stage (A1) showed that higher water loss values than those of solid gain in both Hayward and Hort
16A kiwifruit varieties were obtained. In particular, during the first treatment hours, the highest water loss rate occurred
because of a greater dehydration driving force (figure 1).
Overall the results showed that osmotic treatment was more effective for cultivar Hort 16A. In particular the best results
in terms of highest water loss were observed at a treatment temperature of 45C, even if at this temperature there was
also a notable but acceptable mass loss. The highest dehydration efficiency index (WL/SG) for Hort 16A was obtained
at a treatment temperature of 45C for 120 min (Tylewicz et al., 2009), while for Hayward at the temperature of 45C
for 15 min (Rz"ca et al., 2009). In all cases the dehydration efficiency index values of Hort 16A were almost double
than those of Hayward. In fact the behaviour of Hort 16A kiwifruit during the process was characterized by a more
intense water loss during osmotic treatment and by a lower solid gain.
A greater change in colour of Hayward kiwifruit compared with Hort 16A was observed. This may be due to the fact
that the chlorophyll molecules are converted easily into olive-brown compounds in the acid environment created during
kiwifruit processing. The chlorophyll degradation is even accelerated by heating (Nishiyama, 2007). On the contrary the
yellow-fleshed kiwifruit Hort 16A has kept the same colour of untreated sample, probably because the carotenoids are
chemically more stable than chlorophyll and thermal processing had a minimal effect on this class of compounds
(Tylewicz et al., 2010).
The water status investigation was provided by DSC and NMR measurements. DSC measurements permitted to
evaluate the change, during the osmotic treatment, of two important parameters related to the product stability: the end
point of freezing and the unfreezable water content. Generally DSC results showed a decrease of the dehydrated
tissue freezing point and of its freezable water content with the increase of the amount of sugar into the fruit. NMR
analysis allowed the individuation of two main water populations with a different degree of mobility, that changed its
amount and proportion with the proceeding of the osmotic treatment (figure 2). The results confirmed that DSC and
NMR techniques offer a general but complementary response in the study of water in food dynamics.

Figure 1. Application of the Peleg model to mass transfer data of Actinidia deliciosa at 35C: total mass change (dM), water mass
change (WL) and soluble solids mass change (SG).

15
th
200
15
th

Figure 2. Intensities and T
2
of Hayward kiwifruit proton pools during the osmotization treatment at 35C: vacuoles (empty circles),
cytoplasm (filled circles), cell walls and extracellular spaces (empty triangles), non exchangeable sites of the biopolymers (filled
triangles). To help visualizing the data trends, the points are fitted to mono-exponential curves, presented as dashed lines.

The application of SAFES methodology (activity of A2 stage) to the experimental data of osmotic dehydrated kiwifruit
showed the complexity of the osmotized kiwifruit system, describing it in the simplest possible way through the
consideration of its structural, thermodynamic and physico-chemical parameters. In table 1 the descriptive matrix for
the raw material is showed. Along the osmotic treatment, the SAFES methodology was proved to be a useful tool to
quantify mass fluxes from each phases and volume changes promoted by pseudo-diffusional mechanisms, mostly acting
at short processing times.

In a further phase of research work (activity of A3 stage) the study was aimed to improve freezing process on potato
cubes and whole strawberries; some obtained results are following described:
a) the application of ultrasound during immersion freezing of potatoes modified important freezing parameters. The best
results were obtained when the ultrasounds at the frequency of 35 kHz were applied to the potatoes supercooled until
-2C. This caused the significant reduction of total time of freezing,
b) the solution type during the vacuum impregnation of strawberries had a great effect on the solid gain of strawberry
tissue; however all the studied solutions resulted in an increase of samples solid gain. Strawberry samples absorbed up
about 10 % of solids when impregnated only with antifreeze protein, while the combination of trehalose and antifreeze
proteins resulted in highest solid gain of about 19% after vacuum impregnation. Vacuum impregnation pre-treatments
reduced drip loss of frozen strawberries after thawing. Drip loss in strawberries impregnated with trehalose and
antifreeze protein separately, was about 25%, while it was 33% for untreated strawberries. The best results in term of
drip loss reduction (less than 10%) were obtained using a combined trehalose-antifreeze protein solution.

15
th
201
15
th
Table 1. Fresh kiwifruit descriptive matrix (M0,0), from SAFES methodology.

Figure 3. Results of microscopic observations using FDA (fluorescence diacetate) to identify viable cells. Viable cells are
distinguished by bright fluorescence.

Results of cells viability before and after the treatments are showed in figure 3. In particular, we can observed that the
freezing and thawing process (without any pre-treatment) destroyed all of the cells, that means the cells viability was
practically absent. Applying vacuum impregnation with a solution of trehalose, some improvements in cells viability
was observed; however the cells close to the surface (until 4 mm from surface) resulted death. A further improvement
was noted using a combination of trehalose and antifreeze protein in solution; in this case viable cells was observed
already at 2 to 2.5 mm from the surface.

The last part of the research concerned the study of physiological responses of Kim variety apple slices to vacuum
impregnation (VI) process. Apples were washed in cold water, hand-peeled and rectangle slices of 10!40 mm, selected
from inert tissue, were cut. The vacuum infusion was carried out at 20
C in a chamber connected to a vacuum pump,

using isotonic and hypotonic sucrose and trehalose solution. Moreover the dye FM4-64 with or without a drug
Chloroquine were infused together with the sugars in the solution. Samples were analysed using fluorescence
microscope Nikon with blue excitation light, and magnification of 10x and 20x.
15
th
202
15
th
Finally in order to better understand the effect of VI treatment on the amount of remained air in vegetable tissue the
GASMAS (gas in scattering media absorption spectroscopy ) and TOF (Time of Flight) techniques were applied.
Actually some of these experiments are still in progress.
4. References
Fito P, LeMaguer M, Betoret N, Fito PJ (2007) Advanced food process engineering to model real foods and processes: The SAFES
methodology. J Food Eng 83: 173-185.
Nishiyama I (2007) Fruits of the actinidia genus. Adv Food Nutr Res 52: 293-324.
Rz"ca M, Witrowa-Rajchert D, Tylewicz U, Dalla Rosa M (2009) Mass exchange in osmotic dehydration process of kiwi fruits
!YWNO"#. Nauka. Technologia. Jako$% 6(67): 140-149.
Tylewicz U (2008) Systematic approach for the study of transfer phenomena occurring during processing and storage of minimally
processed fruit and vegetables. In Proc.s of the 13th Workshop on the Developments in the Italian PhD Research on Food
Science Technology and Biotechnology,University of Turin (Italy) 10-12 September 2008 pp. 580-581,
Tylewicz U (2009) Systematic approach for the study of transfer phenomena occurring during processing and storage of minimally
processed fruit and vegetables. In Proc.s of the 14th Workshop on the Developments in the Italian PhD Research on Food
Science Technology and Biotechnology,, University of Sassari, Oristano (Italy), 16-18 September 2009, pp. 369-371,.
Tylewicz U, Rz"ca M, Rocculi P, Cocci E, Dalla Rosa M (2009) Mass transfer phenomena during osmotic dehydration of yellow
kiwifruit (Actinidia chinensis cv. Hort16A). Industrie Alimentari 48(494): 50-55.
Tylewicz U, Rz"ca M, Rocculi P, Romani S, Dalla Rosa M (2010) Evolution of quality characteristics of Hayward and Hort16A
kiwifruit during osmotic dehydration. Fruit Processing, in press.
15
th
2
nd
Year PhD Student
Poster Communications
15
th
205
15
th
Phenolic profile of some selected spontaneous herbs from the Alps
Lavinia Alexandru (lavinia.alexandru@uniud.it)
Dept. Food Science and Technology, University of Udine, Italy
Tutor: Prof. Lanfranco Conte
The present study summarizes the main research activity obtained in the first two years of the PhD project. The
main scope of the thesis is the chemical characterization of the secondary metabolites contained in some
spontaneous and cultivated herbs from the Alps (Cicerbita alpina, Asparagus acutifolius,, Levisticum officinale,
Silene cucubalus , Valerianella olitoria, Spirea Aruncus , Chenopodium bonus henricus L), the interest being
focused on the phenolic compounds. These spontaneous herbs are being used from old times in the traditional
gastronomy of Friuli Venezia-Giulia region. Since these spontaneous herbs are protected by law, the attention is
concentrated on their cultivation and the aim of this study is also to investigate if there is a homogeneity in the
phenolic content within the same species grown in different areas and in different conditions (spontaneous and
cultivated).
Caratterizzazione del profilo fenolico di alcune piante spontanee delle Alpi
La presente comunicazione riassume le principali attivit di ricerca volte alla caratterizzazione chimica dei
metaboliti secondari, in particolare i composti fenolici, presenti in diverse piante, sia spontanee sia coltivate,
tipiche delle Alpi (Cicerbita alpina, Asparagus acutifolius, Levisticum officinale, Silene cucubalus , Valerianella
olitoria, Spirea Aruncus, Chenopodium bonus henricus L). Date le caratteristiche spontanee, la raccolta di queste
erbe viene salvaguardata dalla legge. Visto anche il largo utilizzo che da molto tempo queste piante hanno nella
cucina tradizionale del Friuli Venezia-Giulia, si cercher di valutare, mediante questo progetto di dottorato, una
possibile omogeneit del profilo fenolico tra le diverse specie sia spontanee sia coltivate in aree geograficamente
diverse.
Keywords: Polyphenols, factorial design, herbs, LC-MS.
1. Introduction
The main aims of the first two years of the PhD activity previously reported in the 14
th
Workshop on the
Developments in the Italian PhD Research on Food Science Technology and Biotechnology have been
accomplished with slight inherent modifications. The first step in this study was the sample preparation. Prior to
the extraction of the major phenolic compounds the plant samples to be analysed were freeze-dried and ground
to a fine powder. We have used an innovative extraction technique-MAE (microwave-assisted-extraction). In
order to optimize the method of extraction, the main parameters such as solvent nature (or mix of solvents),
extraction time and temperature have been tested (Ong, 2004). The assays used for the analysis of polyphenols
content were the Folin Ciocalteu method and HPLC-MS, which provides good information for the polyphenol
analysis in crude extracts (Fang et al., 2007). Moreover, the flavonoid content was determined by using the UV
absorbance of the resulting complex with aluminium chloride. Considered the obtained results we considered
necessary to focus our attention to the study of the extracts that furnished the most interesting preliminary
results.
The extraction of plant material for the determination of phenolic compounds was performed using a microwave
solvent extraction closed-vessel system supplied by CEM Corporation. For the optimization of the microwave
assisted extraction (MAE) process, the effect of solvent composition, extraction temperature and matrix
characteristics are the most important for plant materials (Huie, 2002). The best conditions that proved a good
extraction yield of polyphenols were chosen by applying a full factorial 2
3
experimental design. The
determination of the total phenolic content was made using a Folin Ciocalteu micromethod which permitted us to
establish the limits of the reaction parameters: methanol concentration 4%, reaction time 20min, temperature
40C, 5% sodium carbonate solution (Cicco et al., 2009). The absorbance was measured with a UV-visible
spectrophotometer at 765nm. Previously, there has been made a calibration curve using gallic acid, obtaining the
regression equation y= 0.1045x+0.0219, R
2
= 0.9995. Total flavonoids were measured by adding a solution of
AlCl
3
to the extract and the pH of the mixture was adjusted to 3 (Matyushchenko, Stepanova, 2003). Rutin was
used in order to make the calibration curve for the determination of total flavonoids (regression equation
y=0.0031x+0.0878; R
2
=0.9857). The absorbance of this solution was then measured at 323nm. All the
separations were performed on a Nova-Pak C
18
column, 4m (150x3.9mm I.D) and a CH
3
OH:H
2
O gradient
(0.19ml/min) in 75min was used. The samples and the solvents have been acidified with formic acid 0.2%. A
15
th
206
15
th
Finnigan LXQ linear trap (Thermo Electron Corporation) was used for ESI-MS
n
analysis in the negative ion
mode.
3.1 Extraction of phenolic compounds from the herbs
In order to establish optimum polyphenol extraction conditions, nineteen runs were carried out to cover all the
possible combination between the four variables and the results were expressed by two responses: total phenolic
content and total normalized peak areas. Optimized MAE parameters: t (5min), T (90C), Solvent ratio
(H
2
O:CH
3
OH /50:50), Sample quantity (3g).
3.2 Determination of total phenolic content
Figure 1 shows the variations for both phenolic and flavonoid content between the studied species, but also the
differences within the same species grown in different areas and in different conditions (spontaneous and
cultivated). Considering the high phenolic content obtained for the cultivated Cicerbita alpina (Piani di Vas), we
considered interesting to report detailed data about it. Depending on the different areas of growth, results
highlighted a total phenolic content of 25.7mg gallic acid x g
-1
freeze-dried herb for the spontaneous one and
145mg gallic acid x g
-1
freeze-dried herb for the cultivated one. For the flavonoid content 93.5mg rutin x g
-1

freeze-dried herb were obtained for the cultivated herb and 1.54mg rutin x g
-1
freeze-dried herb for the
spontaneous one.

Figure 1 Correlation graph between total phenolic and flavonoid content for the studied herbs mg/g dry weight.
3.3 Tentative LC-MS identification of the cultivated Cicerbita alpina extract
The LC-ESI-MS examination of the aqueous methanolic extracts in negative mode resulted in the detection of
the following phenolic compounds: Quinic acid apiosyl glucoside, Caffeic acid-pentose, Chlorogenic acid,
Caffeic acid, Apigenin-pentose, 1-O-b-D-glucopyranosil sinapate, Acido caffeico apiosyl glucoside, Eriodictyol
glucuronide, Caffeic acid apiosyl glucoside, Luteolin-3
,
7-di-O-glucoside, Ferulic acid, Chlorogenic acid-hexose,
Luteolin glucuronide, Luteolin glucoside, Luteolin rhamnoglucoside, Quercetin glucoside, Apigenin-7-O-
glycoside, Apigenin glucuronide, Luteolin acetil glucoside, Luteolin acetil glucoside. The tentative identification
was based on chromatographic behaviour, mass spectra obtained under electron spray ionisation (ESI)
conditions, UV-vis spectra, comparison with reference compounds and scientific publications (Justensen et al,
1997). Ionization of phenolic compounds in negative mode gave the highest sensitivity and selectivity.
4. References
Cicco N., Lanorte M. , M. Paraggio , M. Viggiano (2009), A reproducible, rapid and inexpensive Folin-
Ciocalteu micro-method in determining phenolics of plant methanol extracts , Microchemical Journal 91
107-109
Ong E.S (2004), Extraction methods and chemical standardization of botanicals and herbal preparations, Journal
of Chromatography B, 23-33
Fang Z., M. Zhang, L. Wang (2007), Food Chemistry 100, 846
Huie C. W. (2002), A review of modern sample preparation techniques for the extraction and analysis of
medicinal plants, Anal Bioanal Chem 373, 26
Matyushchenko N. V., Stepanova T. A (2003), Quantitative determination of the total content of flavonoids in
the phytopreparation Elima, Pharmaceutical Chemistry Journal, 37, 42-44
Justensen U., Pia Knuthsen and Torben Leth (1997), Determination of plant polyphenols in Danish foodstuffs by
HPLC-UV and LC-MS detection , Food and cancer prevention 114 , 165-167
0
20
40
60
80
100
120
140
160
A
s
p
a
r
a
g
u
s

S
i
s
t
i
a
n
a
A
s
p
a
r
a
g
u
s
L
i
g
n
a
n
o
C
h
e
n
o
p
o
d
i
u
m

C
a
b
i
a
C
h
e
n
o
p
o
d
i
u
m

V
a
l

V
e
n
z
o
.
.
.
C
h
e
n
o
p
o
d
i
u
m

C
u
r
i
e
d
i
L
e
v
i
s
t
i
c
u
m

T
a
r
c
e
n
t
o
C
i
c
e
r
b
i
t
a

C
o
l
l
i
n
a
C
i
c
e
r
b
i
t
a

P
i
a
n
i

d
i

V
a
s
S
p
i
r
e
a

P
e
d
r
o
s
a
S
p
i
r
e
a

S
a
u
r
i
s
S
i
l
e
n
e

S
a
u
r
i
s
S
i
l
e
n
e

G
o
l
o
m
e
t
t
o
S
i
l
e
n
e

T
a
r
c
e
n
t
o
S
i
l
e
n
e

L
u
s
e
v
e
r
a
S
i
l
e
n
e

T
r
a
m
o
n
t
i
V
a
l
e
r
i
a
n
a

S
.
M
a
r
g
h
e
r
i
t
a
V
a
l
e
r
i
a
n
a

G
o
l
o
m
e
t
t
o
C
o
n
c
e
n
t
r
a
t
i
o
n

p
h
e
n
o
l
i
c

c
o
m
p
o
u
n
d
s

(
m
g
/
g

D
W
)
Flav onoids mg rutin/g DW
Poly phenols mg GAE/g DW
15
th
207
15
th
Distribution of Furan Fatty Acids in the Lipid Classes of Adriatic
Crayfish
Michele Balzano (m.balzano@univpm.it)
Dipartimento di Scienze Alimentari, Agro-Ingegneristiche, Fisiche, Economico-agrarie e del Territorio,
Universit Politecnica delle Marche, Ancona, Italy
Tutor: Prof. Francesca Clementi - Co-Tutor: Prof. Natale Giuseppe Frega

Crayfish represents one of the main food source of furan fatty acids (F-acids). The aim of this work was to
analyze the distribution of F-acids in the lipid classes of the edible part of crabs (Liocarcinus vernalis), caramote
prawns (Penaeus kerathurus) and mantis shrimps (Squilla mantis) of the Adriatic Sea in order to understand if F-
acids are preferentially accumulated onto neutral lipids (triacylglycerols, cholesterol esters) or polar lipids
(phospholipids).
Distribuzione degli Acidi Grassi Furanici nelle classi lipidiche di alcune specie di
crostacei dellAdriatico
I crostacei costituiscono una delle fonti alimentari principali di acidi grassi furanici. Nel presente lavoro stata
analizzata la distribuzione degli acidi grassi furanici nelle diverse classi lipidiche della parte edibile di alcune
specie di crostacei caratteristiche del Mare Adriatico (granchi, Liocarcinus vernalis; mazzancolle, Penaeus
kerathurus; pannocchie, Squilla mantis) al fine di comprendere se gli acidi grassi furanici vengono
preferenzialmente accumulati nella frazione dei lipidi neutri (trigliceridi, esteri del colesterolo) o polari
(fosfolipidi).
Key words: Furan fatty acids, phospholipids classes, neutral lipids, Adriatic crayfish.
1. Introduction
The favorable effects of a diet rich in fish or fish oils on certain chronic diseases is considered to be related to the
presence of both 3 PUFA and furan fatty acids (F-acids) (Spiteller, 2005). F-acids prevent the oxidation of
linoleic acid and exert inhibitory effects on blood platelet aggregation, on bacterial urease activity and show a
potential antitumor activity. F-acids are characterized by a furan ring, carrying an unbranched fatty acid chain
with 9,11 or 13 carbons atoms in one position and a short straight alkyl chain with 3 or 5 carbons atoms in the
other position. The furan ring can be substituted with just one methyl group in position adjacent to the
aliphatic chain or with two methyl groups. Fishes assume both 3 PUFAs and F-acids from algae, plancton and
other marine sources and incorporate them as phospholipids, triacylglycerols and cholesterol esters. Three
crayfish species fished in the Adriatic Sea were sampled in order to investigate the presence of F-acids and their
distribution in the lipid classes. Each lipid class was cleaned up using Solid Phase Extraction (SPE) and the
corresponding fatty acid methyl esters (FAMEs) were analyzed by means of Gas Chromatography/quadrupole
mass spectrometry (GC/MS).
Three species of crayfish, Liocarcinus vernalis (crab), Squilla mantis (mantis shrimp) and Penaeus kerathurus
(caramote prawn) were purchased in a local fish market. Three individuals from each species were chosen. After
removal of the exoskeleton, an aliquot (30 g) of the edible part of each species was homogenized in chloroform-
methanol (1:2, v/v) in order to extract the lipid fraction. Total lipids were isolated as described by Bligh and
Dyer (1959) and were separated into lipid classes using a SPE aminopropyl minicolumn (500 mg). Briefly, total
lipids (20 mg) dissolved in 150 l of hexane:chloroform:methanol (95:3:2, v/v/v) were loaded onto the column.
Neutral lipids (NL) were eluted with 5 ml chloroform; free fatty acids were eluted with 5 ml diethylether:acetic
acid (98:2, v/v). Then, phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS) and
phosphatidylinositol (PI) were sequentially eluted with 30 ml of acetonitrile:n-propanol (2:1, v/v), 10 ml of
methanol, 7.5 ml of isopropanol:metanolic 3N HCl (4:1,v/v) and 17.5 ml of chloroform:methanol:HCl 37%
(20:10:0.1, v/v/v), respectively (Perz-Palacios et al, 2007). FAMEs were obtained from each lipid fraction with
base-catalysed transesterification (Suter et al, 1997). The identification of furan fatty acids was confirmed by
GC/MS as described by Pacetti et al. (2010).
15
th
208
15
th
Total lipids of different species contained the saturated F-acids, such as 10,13-epoxy-11-methyloctadeca-10,12-
dienoic [MonoMe(9,5)], 12,15-epoxy-13,14-dimethyloctadeca-12,14-dienoic [DiMe(11,3)] and 12,15-epoxy-
13,14-dimethyleicosa-12,14-dienoic [DiMe(11,5)] acids. The ion mass spectrum of [DiMe(11,5)] was reported
in Figure 1. The characteristic fragments of identified F-acids are summarized in Table 1. The base peak resulted
from -cleavage of the saturated carboxylic chain (with 9 and 11 carbon atoms). Fragment A (Table 1) derived
from -cleavage of the aliphatic chain (with 3 or 5 carbon atoms) and fragment B derived from -cleavage of
both chains giving the furan moiety. The F-acids pattern changed according to the different species and the lipid
classes (Table 2). The [MonoMe(9,5)] and [DiMe(11,3)] characterized the F-acids fraction of the caramote
prawns and the crabs, whereas they were absent in the mantis shrimp lipids. Saturated F-acids were not
accumulated in phospholipids. In detail, [MonoMe(9,5)] was exclusively distributed in neutral lipids, whereas
[DiMe(11,3)] was displayed only in total lipids. [DiMe(11,5)] showed a different trend: in the mantis shrimp it
was accumulated only in the NL, whereas it was present only in the total lipids of caramote prawns and crabs.
Table 1: F-acids fragmentation pattern Table 2: F-acids distribution in the lipid classes

Figure 1 Mass spectrum of the peak at Rt 63.5 min assigned to
[Dime(11,5)].

During the next year the work will be focused on extending the sample number and sampled species in order to
study the significance of differences in the distribution of F-acids. More information on the molecular structure
will be obtained by means of bi-dimensional gas chromatography.
4. References
Boselli E, Grob K and Lercker G (2000) Determination of Furan Fatty Acids in Extra Virgin Olive Oil, J. Agric.
Food Chem. 48: 2868-2873.
Frega NG, Mozzon M,.Pacetti D (2002) Composizione degli acidi grassi in pesci e molluschi edibili del mare
Adriatico, Riv. It. Sost. Grasse Vol. LXXIX; 79:301-305.
Pacetti D, Alberti F, Boselli E, Frega NG (2010) Characterization of Furan fatty Acids in Adriatic Fish, Food
Chemistry 122: 209-215
Perz-Palacios T, Ruiz J, Antequera T (2007) Improvement of a solid phase exaction method for separation of
animal muscle phospholipid classes, Food Chemistry 102: 875-879.
Spiteller G (2005) Furan Fatty Acids: Occurrence, Synthesis, and Reactions. Are Furan Fatty Acids Responsible
for the Cardioprotective Effects of a Fish Diet?, Lipids 40: 755-771.
Saturated F-acids fragmentation
FFA M
+
Base Peak A B
MonoMe 9,5
322 165 265
109
DiMe 11,3
336 151 307
123
DiMe 11,5
364 179 307
123
Saturated F-acids

MonoMe
9,5
DiMe
11,3
DiMe
11,5
Caramote
Prawn
NL x
PC
PE
PS
PI
TL x x x
Crab
NL x
PC
PE
PS
PI
TL x x x
Mantis
Shrimp
NL x
PC
PE
PS
PI
TL x
15
th
209
15
th
Application of NIR-AOTF to study grape ripening and dehydration
Federico Emanuele Barnaba (federicobarnaba@hotmail.it)
Dept. Food Science and Technology, University of Tuscia, Viterbo, Italy
Tutor: Prof. Fabio Mencarelli

The first activity of the PhD thesis project is described. PLS regression models were developed to estimate, by
means NIR-AOTF, the main organic constituents of Sangiovese grape during ripening. Models were built for
instrument application on the berries and on the musts. Further different pre-statistic treatments were evaluated.
Applicazione del NIR-AOTF per studiare la maturazione e la disidratazione delluva
La prima attivit del progetto di tesi di dottorato descritta. Modelli di regressione PLS sono stati sviluppati per
stimare, mediante lo strumento NIR-AOTF, i principali costituenti organici delluva Sangiovese nel corso della
maturazione. Modelli sono stati costruiti per lapplicazione dello strumento sugli acini e sui mosti. Inoltre sono
stati valutati differenti trattamenti pre-statistici.

Key words: NIR-AOTF, PLS regression models, ripening, grape, organic constituents.
1. Introduction
In accordance with the PhD thesis project previously described (Barnaba 2009), this poster reports the main
results of the first activity concerning:
(A1) Development of PLS regression models to predict grape composition during ripening.
In the season 2009, in a vineyard of Sangiovese grape site in Nipozzano farm (Firenze), Marchesi d
Frescobaldi, were collected 48 grape samples from early September to harvest. Each sample was constituted by
100 berries. Spectral detection was carry out with a Luminar 5030 Miniature Hand-held NIR Analyzer
(Brimrose, Baltimore, MD), based on the AOTF-NIR principle. Two different measurements were performed on
each berry, using the diffuse reflectance method of detection. Detection was conducted in the 1100-2300 nm
range, with 2 nm wavelength increment. After spectra acquisition, the samples were crushed and the musts were
centrifuged. Supernatants were analyzed by WineScan FT 120 (Foss, Italy, PD). The parameters measured are
reported in Table 1. On some sample, raw spectra were acquired on the must too, by means a probe of
instrument, using transflectance method of detection. At the end of vintage, all the data were statistically treated.
Raw spectra were pre-treated for absorbance transformation using SNAP! 2.03 software (Brimrose). The
absorbance data were mean normalized and respectively treated by Standard Normal Variation (SNV),
Multiplicative Scattering Correction (MSC), first order of Savitzky-Golay filter or second order of Savitzky-
Golay filter. Partial Least Squares (PLS) regression models were developed on the full spectrum (1110-2300 nm)
and was applied an internal full cross validation. The performance of models was evaluated by standard error of
calibration (SEC), standard error of cross validation (SECV), coefficient of determination for calibration (R
2
),
coefficient of determination for cross validation (r
2
), latent variable (LV). The residual predictive deviation
(RPD) was calculated to evaluate how well model can predict chemical data (Cozzolino et al 2008). Statistical
pre-treatments and PLS models were performed by Unscrambler v9.2 software (CAMO ASA, Oslo, Norway).
3.1 PLS regression models
The main results are reported in table 1 and table 2. PLS models elaborated for musts showed higher r
2
than
those for berries, except for pH and tartaric acid. About berries, were obtained models with r
2
greater than 0.80
for Brix, total sugars, glucose, fructose, density, total acidity and tartaric acid. r
2
was included between 0.70 and
0.80 for Babo, assimilable Nitrogen and pH. Low values of correlation were observed for other parameters and
in particularly for malic acid and anthocyanins. Regarding musts all models developed for sugars parameters
showed r
2
greater than 0.97, values that are an index of excellent quantitative information as suggested by Shenk
and Westerhaus (1996). r
2
values greater than 0.80 were observed for total acidity, assimilable Nitrogen and
polyphenols. PLS models for anthocyanins and gluconic acid showed a no much high prediction capacity, but
better than those elaborated for berries. No good model was obtained to malic acid in this case too. For each
parameter analyzed was individuated the most appropriate statistic pre-treatment. In must case were obtained the
15
th
210
15
th
best results, except for anthocyanins, applying PLS regression directly on the raw spectra. About berries the best
models were obtained by means first order Savitzky-Golay for sugars parameters and polyphenols while the
normalization was suitable to built prediction models for pH, tartaric and gluconic acid, anthocyanins. Good
values of RPD were observed for prediction models of sugars in the musts. RPD was around 2 for prediction of
total acidity, polyphenols, assimilable nitrogen in musts and of density, fructose and Brix in berries. A model
with an RPD greater than 2.5 or 3 has a good and excellent prediction accuracy respectively, between 2 and 2.5 a
coarse prediction is possible, between 1.5 and 2 can discriminate low from high value (Nicolai et al 2007). In our
case, low values of RPD result from a narrow samples variation for analyzed parameters.
Table 1 The best PLS regression models obtained to application of NIR-AOTF on the berries
Parameter Statistical
pre treatments
R
2
r
2
SEC SECV LV RPD
Brix 1
st
der Savitzky-Golay 0.97 0.84 0.25 0,55 11 1.83
Babo 1
st
der Savitzky-Golay 0.95 0.78 0.26 0.56 10 1.58
Total sugars (g/L) 1
st
der Savitzky-Golay 0.96 0.83 3.25 7.05 11 1.75
Glucose (g/L)
Fructose (g/L)
Density (g/ml)
Total acidity (g/L)
Tartaric acid (g/L)
pH
Malic acid (g/L)
Gluconic acid (g/L)
Anthocyanins (mg/L)
Polyphenols (mg/L)
Assimilable Nitrogen (mg/L)
1
st
der Savitzky-Golay
1
st
der Savitzky-Golay
1
st
der Savitzky-Golay
SNV
Normalization
Normalization
SNV
Normalization
Normalization
1
st
der Savitzky-Golay
MSC
0.97
0.97
0.97
0.94
0.99
0.91
0.37
0.77
0.46
0.69
0.91
0.83
0.87
0.85
0.81
0.83
0.71
0.23
0.58
0.32
0.54
0.79
1.41
1.68
0.001
0.17
0.09
0.019
0.15
0.05
37.32
86.21
10.13
3.20
3.65
0.002
0.31
0.34
0.036
0.16
0.07
40.35
100.91
16.06
11
11
11
9
15
12
3
8
4
3
8
1.76
2.02
2.50
1.71
1.79
1.39
1.06
1.29
1.05
1.19
1.60
Table 2 The best PLS regression models obtained to application of NIR-AOTF on the musts
Parameter Statistical
pre treatments
R
2
r
2
SEC SECV LV RPD
Brix Not 0.99 0.98 0.17 0.32 5 5.82
Babo Not 0.99 0.98 0.16 0.29 5 5.87
Total sugars (g/L) Not 0.99 0.97 2.40 4.83 5 4.36
Glucose (g/L)
Fructose (g/L)
Density (g/ml)
Total acidity (g/L)
Tartaric acid (g/L)
pH
Malic acid (g/L)
Gluconic acid (g/L)
Anthocyanins (mg/L)
Polyphenols (mg/L)
Assimilable Nitrogen (mg/L)
Not
Not
Not
Not
Not
Not
Not
Not
SNV
Not
Not
0.99
0.99
0.99
0.92
0.90
0.72
0.51
0.90
0.70
0.89
0.90
0.98
0.98
0.98
0.86
0.70
0.66
0.44
0.70
0.63
0.83
0.83
1.06
1.07
0.0008
0.20
0.21
0.039
0.1
0.02
25.87
75.66
12.62
1.98
2.14
0.001
0.28
0.38
0.04
0.1
0.05
28.83
95.38
16.04
5
5
5
4
5
3
1
5
13
3
4
5.58
5.66
8.27
2.04
1.34
1.42
1.20
1.41
1.49
1.80
1.79
4. References
Shenk JS, Westerhaus MO (1996), Calibration the ISI way. In A.M.C. Davies & P.C. Williams (Eds). Near
infrared spectroscopy: The future waves, Chichester: Nir Pubblication, pp.198-202.
Nicolai BM, Beullens K, Bobelyn E, Peirs A, Saeys W, Theron KI, Lammertyn J (2007), Nondestructive
measurement of fruit and vegetable quality by means of NIR spectroscopy: A review, Postharvest Biology
and technology 46:99-118.
Cozzolino D, Cynkar WU, Dambergs RG, Meagan D, Mercurio D, Smith PA (2008), Mesurement of condensed
tannins and dry matter in red grape homogenates using near infrared spectroscopy and partial least
squares, J Agric Food Chem 56: 7631-7636.
Barnaba FE (2009), Use of NIR AOTF and other non-destructive techniques to study grape ripening and
dehydration, In Proc.s of the 14
th
Workshop on the Developments in the Italian PhD Research in Food
Science, Technology & Biotechnology, Oristano (Italy), September 16-18, 2009.
15
th
211
15
th

Biodiversity analysis of Saccharomyces cerevisiae strains isolated from
Franciacorta and Oltrepo Pavese to improve sparkling wine production
made by champenois method
Shirley Mireya Barrera Crdenas (shirley.barrera@unimi.it)
Department of Food Science Technology and Microbiology University of Milan, Italy
Tutor: Prof. Roberto Foschino; Co-tutor: Dr. Claudia Picozzi

This PhD research project is aimed to the identification, typing and selection of Saccharomyces cerevisiae
strains to evaluate the interspecific biodiversity and the potential use as new starters in the sparkling wine
production made by Champenois method. Indigenous yeasts were isolated in Franciacorta (BS) and Oltrepo
Pavese (PV) and some S. cerevisiae strains were tested for their proper attitudes for winemaking.
Valutazione della Biodiversit di Ceppi di Saccharomyces cerevisiae isolati in
Franciacorta e Oltrepo Pavese per il miglioramento della produzione di vino spumante
metodo classico
Questo progetto di tesi di dottorato mira allidentificazione, tipizzazione e selezione di ceppi di Saccharomyces
cerevisiae per valutare la biodiversit interspecifica e il potenziale uso come nuovi starters nella produzione di
vino spumante metodo classico. Ceppi autoctoni di lievito sono stati isolati in Franciacorta e lOltrep Pavese e
alcuni appartenenti alla specie S. cerevisiae sono stati saggiati per identificare quelli con adeguata attitudine alla
vinificazione.

Keywords: Saccaromyces cerevisiae, indigenous strains, biodiversity, sparkling wine, typing.
1.Introduction
The study of biodiversity within microbial populations involved in wine-making have recently become an object
of growing interest due to the possibility of obtaining new strains with useful capabilities for the wine industry.
The first step towards the development of new starters is the clonal selection of the wild yeasts isolated from
natural environments associated with the wine-producing areas (Giudici et al.,1992). Starters currently used in
Lombardy have been isolated from French territories on the basis of the quality characteristics of Champagne
wine. Moreover a biodiversity analysis of yeasts populations in vinery districts of Lombardy has not still carried
out.
2.1.Identification and typing of yeasts
Samples of vineyard air, must before SO
2
addition and wine at the end of spontaneous or controlled fermentation
have been collected in different Franciacorta and Oltrep territories. The following techniques were used for the
identification and typing of the isolates: Restriction Fragment Lenght Polymorphism (RFLP) of ITS (Esteve-
Zaezoso et al.,1999), D1/D2 of 26S rDNA sequence analysis (White et al., 1990) and Interdelta analysis (!-PCR)
(Legras et al., 2002). Electrophoretical patterns have been analyzed through software Bionumerics (Applied
Maths, Belgium). Dendrograms were constructed by the unweighted pair group method using arithmetic
averages (UPGMA).
2.2.Fermentation tests of selected S. cerevisiae strains
Sixteen indigenous S. cerevisiae strains were selected on the basis of typing and geographical origin. Two
starters S. cerevisiae IOC 18-2007 strain and S. bayanus EC-1118 strain were used as controls. Two different
media were used in the fermentation tests: synthetic must (Guerra et al.,1999) and sterile white must
(Pignoletto). Yeast cultures were inoculated at a concentration of 1x10
6
cell/ml in 100 ml flasks, stoppered by
valves, statically incubated at 18C (Guerra et al.,1999). At the end of fermentation aliquots of wine samples
were centrifuged at 4500 g and the supernatants were analysed. Ethanol, glycerol and acetic acid were
determined by enzymatic protocols. Sniffing tests of wines were realized with a taster panel (scores from 0 to
10). Statistical analysis of data was carried out through ANOVA (Statgraphics Centurion Plus 5.1).

15
th
212
15
th

3.1.Biodiversity of yeast populations
The identification of yeast populations are reported
in Table 1. S. cerevisiae was found in 3 samples of
Oltrep air, whereas it was not isolated in
Franciacorta. In 24 must samples S. cerevisiae
predominated in both areas but Z. bailii and I.
occidentalis were commonly present. In 11 wines of
Oltrep S. cerevisiae was predominant, instead a
great biodiversity was detected in 13 Franciacorta
samples.
Figure 1 Example of electrophoretic run of S.cerevisiae
Interdelta analysis

The analysis of interdelta profiles of S. cerevisiae
isolated from musts and wines in Franciacorta
showed the formation of six clusters with a
percentage of similarity varying from 43% to 100%.
On the other hand the Oltrep strains isolated from
air, must and wine grouped in eight different
clusters with a percentage of similarity starting from
15% to 100% by interdelta analysis. Table 1. Yeast identification and incidence
3.2.Technological and quality characters of S. cerevisiae strains
The indigenous strains selected in this work showed an alcohol production comparable with the starters.
Particularly in synthetic must ethanol ranged from 9,5 to 13,2 % v/v for Franciacorta strains, whereas from
13,0 to 13,8 % v/v for those isolated in Oltrep. In Pignoletto must the alcohol production varied from 9,7 to
10,9 % v/v for Franciacorta strains, and from 9,8 to 12,0 % v/v for those isolated in Oltrep. This finding could
be caused by nutritional deficiencies, given the characteristics of Pignoletto must, which affected the metabolism
of yeast. As regards quality characters all strains proved to produce glycerol in quantity comparable to starters,
however at a lower level (0,08 to 0,25 g/L) . Acetic acid production was limited for all strains ( 0,17 to 0,37 g/l).
Samples of wine obtained from fermentation assays were subjected to sniffing test. Pleasantness and intensity
were evaluated: results obtained by ANOVA revealed that strains were significantly different (p < 0,05) and
four of them showed the best performances.
5.References
Esteve-Zaezoso B, Belloch C, Uruburu F, Querol A (1999) Identification of yeasts by RFLP analysis of the 5.8S
rRNA gene and the two ribosomal internal transcribed spacers. International Journal of Systematic
Bacteriology 49:329-337
Giudici P, Zambonelli C (1992) Criteri di selezione dei lieviti per enologia. Vignevini 9: 29-34
Guerra E, Mannazzu I, Sordi G, Tangherlini M, Clementi F, Fatichenti F (1999) Characterization of indigenous
Saccharomyces cerevisiae from the Italian region of Marche : hunting for new strains for local wine quality
improvement .Annali di Microbiologia ed Enzimologia 49:79-88.
Legras J, Karst F (2002) Optimisation of interdelta analysis for Saccharomyces cerevisiae strain characterisation;
FEMS Microbiology Letters 221: 249-255
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungi ribosomal RNA genes
for phylogenetics. Innis MA, Gelfand DH, Sninsky 325-322
FRANCIACORTA
Samples (n) Isolates (n) Yeast identification
Aureobasidium pullulans 50%
Air (12) 8
Cryptococcus laurentii 50%
Saccharomyces cerevisiae 60%
Zygosaccharomyces bailii 26% Must (13) 42
Issatchenkia occidentalis 14%
Pichia membranifaciens 16%
Pichia fluxum 6%
Zygosaccharomyces bailii 4%
Issatchenkia orientalis 1%
Wine (13) 56
Torulaspora delbueckii 1%
OLTREPO
Samples (n) Isolates (n) Yeast identification
Aureobasidium pullulans 11%
Air (11) 9
Zygosaccharomyces bailii 14%
Hanseniaspora uvarum 4%
Candida zemplinia 4%
Must (11) 27
Candida diversa 4%
Wine (11) 55 Saccharomyces cerevisiae 100%
15
th
213
15
th
Allergenicity of Different Tomato Ecotypes
Mariangela Bencivenni (mariangela.bencivenni@nemo.unipr.it)
Department of Organic and Industrial Chemistry - University of Parma - Parma, Italy
Tutor: Prof. Stefano Sforza, Prof. Rosangela Marchelli
An evaluation of the potential allergenicity of different tomato ecotypes, carried out in the framework of the PhD
project, is presented. Twelve tomato ecotypes were assessed through a proteomic approach, using pools of sera
of allergic people from different regions, in order to identify the major allergens and evaluate differences in IgE
binding properties of the tomato cultivars. Different reactive proteins were identified, which were already known
as tomato allergens. Moreover, our findings showed that allergenic patterns were serum-specific, indicating that
the allergenic properties of different tomato ecotypes are defined by the specific proteins to which the patient is
sensitized.
Propriet allergeniche di ecotipi di pomodoro
In questo lavoro sono descritte le attivit del progetto di dottorato correlate alla valutazione della potenziale
allergenicit di ecotipi di pomodoro. E stato effettuato uno screening di dodici ecotipi mediante un approccio
proteomico, utilizzando pool di sieri di pazienti provenienti da regioni diverse, al fine di identificare i principali
allergeni e valutare differenze nelle propriet allergeniche delle cultivar considerate. Sono state identificate
differenti proteine reattive, gi note in letteratura come allergeni del pomodoro. emerso che i profili allergenici
sono siero-specifici, per cui le propriet allergeniche di ciascun ecotipo sono definite dalle specifiche proteine a
cui il paziente sensibilizzato.
Key words: tomato allergens, proteomic, mass spectrometry
1. Introduction
Tomato is one of the essential food of the Mediterranean diet. In the last few years tomato allergies are ever-
increasing and could represent a potential threat for consumers safety. Although it is not included in the EU
directive which regulates food labelling, tomato may be considered one of the major emerging allergens. A
possible solution to this problem may be the use of varieties showing a lower expression of allergenic proteins.
In this study twelve tomato ecotypes typically used by food industries in the Campania region were analyzed: 1:
Ventura Determinato, 2: Tondino Determinato, 3: Principe Borghese Indeterminato, 4: Sorrento Globoso Rosato
Indeterminato, 5: San Marzano Murano, 6: San Marzano Cilindrico, 7: Tondo Liscio Indeterminato, 8: Tondino
Indeterminato, 9: Pisanello, 10: Sorrento Tondo Liscio Rosato Indeterminato, 11: Principe Borghese
Determinato, 12: San Marzano Morini. Protein extracts were obtained by precipitation with cold acetone and
pellet extraction in a phosphate-buffered saline solution. At first protein extracts were separated by mono and bi-
dimensional SDS-PAGE; separated proteins were tested with pools of sera belonging to people from two
different Italian regions (Campania and Emilia Romagna) by Western Blotting. Spots corresponding to reactive
proteins were in gel-digested by trypsin and the obtained peptides were analyzed by LTQ-Orbitrap and Maldi-
TOF mass spectrometers. The molecular masses and sequences of the recovered peptides were matched against
UniProt database and the corresponding proteins were identified.
3. Result and discussion
As reported in figure 1, incubation with pooled sera of patients from the Campania region showed a band at
about 14 kDa. LTQ-Orbitrap analysis identified peptides belonging to Profilin (figure 2), a well-known tomato
allergen referred as Lyc e 1 (Westphal et al., 2004). Quite interstingly, immunological response of three ecotypes
Tondino Determinato (TD), Ventura Determinato (VD) e San Marzano Cilindrico (SMC) was less intense
showing potential difference in IgE binding properties of these ecotypes and thus a potential ipoallergenicity for
the subjects who provided the sera used for the experiment. MS analysis allowed to identify peptides belonging
to two of the three known isoforms of Profilin, but no correlation was found between the distribution of the
detected Profilin isoforms and the IgE response in these individuals.
15
th
214
15
th
pH 3 4 5 6 7 8 9 10
pH 3 4 5 6 7 8 9 10
M 1 2 3 4 5 6 7 8 9 10 11 12 M 6 5 4 3 2 1 12 11 10 9 8 7
14 kDa
21 kDa
175.2262
1
1+
y
1218.2465
11
1+
b
458.3832
4
1+
y
1210.4745
11
1+
y
506.9547
4
1+
b
295.0419
2
1+ b
605.9896
11
2+ y
635.1805
5
1+
b 821.1878
7
1+
b
393.8414
3
1+
b
1111.5302
10
1+
y
998.4033
9
1+
y
684.3473
6
1+
y
870.4050
8
1+
y
752.7982
200 400 600 800 1000 1200 1400
m/z
0
1000
2000
3000
In
te
n
s
ity

[c
o
u
n
ts
]
M Y V I
Q
E G
E P I V A
Figure 1. SDS-PAGE (on the left) and
corresponding immunoblotting (on the right) of
ecotypes with sera of patients from the
Campania region
Figure 2. Example of the peptide
obtained by LTQ-Orbitrap
ms/ms analysis. Sequence:
YMVIQGEPEAVI; expected
molecular mass: 1503,77 Da;
observed molecular mass:
1503,59.
R
On the other hand, incubation with pooled sera of patients from the Emilia Romagna region gave a different
immunological response, with a band at about 45 kDa, and scarce differences in the IgE binding properties of
tomato ecotypes were observed. LTQ-Orbitrap analysis of tryptic digest from mono-dimensional gel recognized
peptides belonging to three different tomato proteins, two of which were already known as tomato allergens:
suberization-associated anionic peroxidase (Weangsripanaval et al., 2003), pectin methylesterase (Kondo et al.,
2001) and mannan endo-1,4-beta-mannosidase. In order to identify the protein really involved in the IgE
recognition, an immunoblotting on a bidimensional gel electrophoresis of total extracts was performed (figure
3). The reactive spot was subjected to trypsin digestion and the tryptic peptides analyzed by Maldi-TOF
spectrometer were shown to belong to the tomato suberization-associated anionic peroxidase (Table 1),
confirming already published data.
Figure 3. 2D SDS-PAGE (on the left) and corresponding
immunoblotting (on the right) of ecotypes with sera of
patients from the Emilia Romagna region
Sequence
Expected
molecular mass
Observed
molecular mass
NFTLR 649.3 649.3
MGASLIR 746.4 746.4
LGGQTYSVALGR
AVVDSAIDAETR
EMVALAGAHTVGFAR
MGDLPPSAGAQLEIR
1220.6
1245.6
1528.7
1553.7
1220.7
1245.6
1528.8
1553.8
Table 1. Sequences, expected exact masses and observed
exact masses of peptides identified by Maldi-TOF analysis
These results showed that the IgE-binding patterns of tomatoes is highly serum-specific, and, albeit differences
exist among the different ecotypes, the potential hypoallergenicity of each cultivar is strictly related to the
specific protein recognized by patients immunoglobulins.
4. References
Westphal S, Kempf W, Foetisch K, Retzek M, Vieths S, Scheurer S (2004) Tomato profilin Lyc e 1: IgE cross-
reactivity and allergenic potency, Allergy 59: 526-532.
Weangsripanaval T, Nomura N, Moriyama T, Ohta N, Ogawa T (2003) Identification of suberization-associated
anionic peroxidase as a possible allergenic protein from tomato, Bioscience Biotechnology & Biochemistry 67:
1299-1304.
Kondo Y, Urisu A, Tokuda R (2001) Identification and characterization of the allergens in the tomato fruit by
immunoblotting, International Archieves of Allergy and Immunology 126: 294-299.
15
th
215
15
th
Shelf-life of vacuum packaged fresh mussel (Mytilus galloprovincialis):
microbiological and quality attributes
Tiziana Bongiorno (bongiornotiziana@tiscali.it)
Dept. Animal Science and Food Science, University of Udine, Udine, Italy
Tutor: Dr.ssa Francesca Tulli
Cotutor: Prof. Alessandro Sensidoni

The aim of this paper is to show some preliminary results of the activities planned and developed during the PhD
thesis project. In particular, it was assessed an innovative packaging solution that is able to prolong fresh
mussels (M. galloprovincialis) shelf-life, maintain hygiene and protects quality attributes of the product. To
evaluate the effect of vacuum storage on M. Galloprovincialis shelf-life, chemical, physical and microbiological
parameters together with sensorial and histological characteristics were considered.
Shelf-life di mitili freschi (Mytilus galloprovincialis) conservati sottovuoto: aspetti
microbiologici e qualitativi
In questo lavoro vengono riportati alcuni risultati preliminari delle attivit previste e svolte per la tesi di
dottorato. In particolare stato valutato un sistema innovativo di packaging che permette un prolungamento della
shelf-life dei mitili freschi (M. galloprovincialis), mantiene la sicurezza igienica e tutela gli attributi di qualit
del prodotto. Per la valutazione delleffetto del metodo di conservazione sottovuoto sulla shelf-life in M.
galloprovincialis sono state prese in esame sia le caratteristiche chimico fisiche, microbiologiche, che sensoriale
ed istologiche.
Key words: M. galloprovincialis, mussel, vacuum packaging, shelf-life.
1. Introduction
In accordance with the PhD project (Bongiorno, 2009), this document reports the main results of the three
planned and described activities :
(A1) Study of a new evaluation method for product freshness in order to evaluate the structural-sensorial
characteristics during fresh mussel shelf-life.
(A2) Study of innovative fresh mussel storage methods to prolong shelf-life
(A3) Practical application and preliminar product stability evaluation through physical, chemical,
microbiological, sensorial and histological tests.
2.1 Byssus removal effect on mortality and on microbiological attributes of vacuum and conventional
packaged fresh mussels
About 2500 specimens of M. galloprovincialis of commercial size, reared in Trieste Gulf, were brushed, washed
and purified for 24 hours in seawater (12C, 24 salinity) and divided into 3 groups of 780 individuals. Each
group was respectively named with the following initials: RT (plastic net with byssus), SVDB (vacuum
packaging without byssus) e SVBS (vacuum packaging with byssus). RT ndividuals were packed in plastic net
bags of 15 mussels each, closed with a paper clip and stored at 3C 1C. After byssus manual removal for
individuals of group SVDB, both SVBS and SVDB were packed in vacuum plastic bags, with an approximal
weigh of 15g, containing 15 mussels each. The bags were subjected to a pressure of -0.9 bar with a vacuum
packing machine ORVED VM-53. Mussels were transported to the Animal Sciences Department and stored
there at 3C for 13 days. Daily, 4 packs of each of the storage solutions (RT, SVBS, SVDB) were tested for the
following parameters: relative mortality, inter-valvar liquid released in the pack, soft parts homogenate pH; for
SVBS and SVDB groups, also microbiological evaluations regarding Total Bacterial Count (TVC),
Enterobacteriaceae, Lactic Acid bacteria, Clostridia sulphite reducing anaerobes and aerobes, Pseudomonas spp.
after 2, 6 and 13 days of storage.
2.2 Effect of storage conditions on mortality and chemical, physical, microbiological, physiological and
histological features of fresh mussels
Based on the results obtained in the tests described above and at the same conditions, the effect of new
conservation vacuum method versus the conventional one (net plastic bags) was evaluated on fresh mussels with
byssus chilled to 3C 1C. The effect was assessed in terms of chemical, physical, microbiological, sensorial
and histological parameters. The test lasted 16 days and every 3 days, in addition to the parameters mentioned in
15
th
216
15
th
the preceding tests, also the following were evaluated: Water Holding Capacity (WHC), method proposed by
Olsson et al. (2003), sensory characteristics, histological features.
3.1 Byssus removal effect on mortality and on microbiological attributes of vacuum and conventional
packaged fresh mussels
The results show that during storage the group SVBS presents a lower mortality compared to both groups
preserved with the conventional method (RT) and the vacuum method after byssus removal (SVDB).
The bacterial and pH of the soft parts homogenate, although modified during storage, does not reveal significant
differences between groups SVBS and SVDB (data not shown). The byssus removal could cause injuries to other
organs connected to it, compromising mussels vital functions.

3.2 Effect of storage conditions on mortality and chemical, physical, microbiological, physiological and
histological features of fresh mussels

Mortality and released liquid in packaging
Mortality begins earlier for RT group at the 6th storage day, while for SVBS it starts only from day 9th. The
ability to withstand adverse environmental factors is a peculiarity of intertidal species that are able to implement
physiological responses to prevent desiccation during low tide:bivalves are able to completely close their shells
and remain inactive for days or to breathe anaerobically while they are closed (Mitchell et al., 1988).It is also
interesting to note that mortality rates were lower in SVBS compared with RT during the storage period.
During the storage period the mussels tend to lose inter-valvar liquid with both storage methods, but in the RT
group a higher release was observed from 0 to 34.7% while in the SVBS it reaches 25.4% after 16 days
conservation. This is clearly linked to the premature mortality recorded in RT group.
pH and microbiological evaluations
The pH for both thesis, during the storage period, is maintained within a range between 5.99 and 7. From day 13,
pH in RT group is lower (6.0) than SVBS (6.4) till the 16th day. TVC, although always higher in the RT group
(mean= 5.4 log cfu/g SD= 1 log cfu/g) versus SVBS (mean= 4.3 log cfu/g SD= 0.5 log cfu/g) remains constant
over time. Sulphite reducing bacteria have a lower charge to 10 cfu/g in both groups and throughout the storage
period. Lactic acid bacteria and Pseudomonas are kept constant and similar values in both groups during the
storage period (data not shown). While they tend to increase in enterobacteria SVBS group after 13 days of
storage (from 1.15 log cfu/g 13 days to 2.51 log cfu/g at 16 days). The evolution of pH is usually related to
bacterial activity. During storage at low temperatures, the mussels, while slowing its metabolism, keep breathing,
producing catabolites; later, with the beginning of mortality phenomenon, alternative methabolic pathways are
activated that determine lactic acid accumulation that makes pH decrease. In our case, after 13 days of storage
the pH of the SVBS stands at higher values than the RT group, this is not attributable to decreased glycolytic
activity,but to the development of enterobacteria group SVBS producing ammonia which maintain the pH to
higher values.
Water Holding Capacity (WHC)
In RT group there is a reduction of WHC (4.6%) from day 6, while in group SVBS same parameter begins to
decrease from 13th day but on a higher value (8.4%). In both cases, after reaching a minimum value, we
observed a subsequent increase in the WHC: in RT it reaches a value of 10.3% (9th day) and in SVBS 10% (16th
day). This could be linked with lowering the pH in post-mortem.
Sensory and histological analysis
Sensory analysis plays a key role in assessing the quality of fresh fish. A sensory scheme under development in
order to describe the time course evolution in M. galloprovincialis associated to microbiological and physico-
chemical parameters of freshness. In our case, the evaluation of some sensory attributes highlighted differences
between the two methods (data not shown). Results from sensory analysis were confirmed by ctenidia
histology: we can see degeneration and loss of cellular boundaries of group RT compared to SVBS. Hystological
analysis for the assessment of freshness of the new product therefore appears to be a good method, especially if
associated with other analysis.
Bongiorno T (2009)Processing aquaculture products: Research and Development. In Proc.s of the XIV
Biotechnology, Oristano (Italy),16-18 September, 2009, pp 384-385.
Mitchell LG, Mutchmor JA, Dolphin WD (1988) Zoology, pp 574-601.
Olsson GB, Ofstad R, Ldemel JB Olsen RL (2003a) Changes in water-holding capacity of halibut muscle
during cold storage Lebensm.wiss. U.-Technol. 36: 771-778.
15
th
217
Using of minisatellites to confirm intraspecific yeast hybrids
Silvio Boveri (silvio.boveri@unimore.it)
Department of Agricultural and Food Science (DipSAA), University of Modena and Reggio Emilia
42122 v. Amendola 2, Reggio Emilia, Italy
Tutor: Prof. Andrea Pulvirenti

The aim of this research was the using of two different minisatellites regions (SED1 and AGA1) to apply in
molecular confirmation of intraspecific yeast hybrids (S. cerevisiae x S. cerevisiae), obtained by spore to spore
conjugation. With these minisatellites was possible to confirm our hybrids strains, exploiting the high
polymorphism characteristic of these elements, and studying directly the comparison between the different
polymorphic variants and also their restriction analysis using specific endonuclease. In the confirmed yeast
hybrids, each new strains presented both polymorphic variants, one from each crossing parental strain, and so
summed profile under electrophoretic analysis.

Impiego di minisatelliti per confermare lieviti ibridi intraspecifici
La ricerca ha avuto come scopo la conferma molecolare di lieviti ibridi intraspecifici (S. cerevisiae x S.
cerevisiae) ottenuti tramite incrocio delle spore sessuali, amplificando due regioni minisatellite (SED1 e
AGA1). Con i minisatelliti testati si potuto confermare la natura ibrida dei nostri lieviti, sfruttando le
caratteristiche di alto grado di polimorfismo di questi elementi genetici, sia direttamente dalla comparazione
delle varianti amplificate ottenute con metodo PCR sia dalla loro restrizione con endonucleasi specifiche. Negli
ibridi confermati, lereditariet delle varianti polimorfiche stato di tipo sommatorio, presentando entrambe le
varianti derivanti dai ceppi parentali incrociati.

Key words: minisatellites, intraspecific yeast hybrids, PCR, spore to spore conjugation
1. Introduction
This poster reports the main results obtained in this research activity:
(A1) obtaining the monosporial cultures (parental strains) from the wild type strains selected for good quality
traits, by micromanipulation dissection of their asci to isolate the sexual spores.
(A2) testing the two minisatellites SED1 and AGA1 by PCR reaction for all selected parental strains to establish
the polymorphism level and then spore to spore conjugation to obtain potential hybrids.
(A3) comparing the inheritance of both minisatellite (SED1 and AGA1) variant between parental strains and
related potential hybrids.
Asci dissection, spore isolation and spore to spore mating were carried out using a micromanipulation as
described by Winge and Lausten (1938). To make sure only pure cultures were used, cells from a colony
(monosporial cultures and potential hybrids) of about 1 mm diameter were picked up and suspended in 25 l of
sterile water. The cell suspension was purified through isolation by micromanipulator of only one cell, to be sure
obtaining a pure culture. PCR reaction was performed directly on the colony by heat treatment (Ciani, 2003)
without extracting DNA. The heated suspension of cells consisted in the template for the follow PCR reactions. 2
l of the above templates was added to the PCR reaction mix with the two couples of primers SED1f (5-
ATGAAATTATCAACTGTCCTATTATCTGCCGG-3), SED1r(5-
TTATAAGAATAACATAGCAACACCAGCCAAACC-3), AGA1f (5-
GTGACGATAACCAAGACAAACGATGCAA-3) and AGA1r (5-
CCGTTTCATGCATACTGGTTAATGTGCT-3) and applied the PCR condition described by Mannazzu (2002)
and Mariangeli (2004b).
The PCR amplicons were analyzed by electrophoresis on a 1.4% agarose gel in 0.5 X TBE buffer stained with
ethidium bromide. The restriction fragments length polymorphism (RFLP) analysis of the SED1 and AGA1
minisatellites was performed with two restriction enzymes HpaII (BioLabs, New England) for SED1 and AluI
(BioLabs, New England) for AGA1. The reaction mix was incubated for two hours and , and analyzed on 2%
agarose gel.
The sexual yeast spores crossing tecnique is an important procedure of genetic improvement to obtain yeast
hybrids (Rainieri, 2002, Giudici, 2005). Interspecific hybrids resulting from spore to spore conjugation present
the sum of both parental genomes which means that they present the sum of the different RFLP profiles of a
given gene (Giudici, 1998; Pulvirenti, 2000; Pulvirenti 2002). Using the PCR protocols for SED1 and AGA1
(Mannazzu,2002;Mariangeli, 2004a ), we obtained for each parental strains the polymorphism level (Fig.1).
Only the monosporial cultures with differences in polymorphism level were used for sexual spores crossing to
obtained intraspecific yeast hybrids. The hybrids were confirmed studying the inheritance of the polymorphic
15
th
218
variants of SED1 and AGA1 derived from both parental strains (Fig.2 a), that in these cases present a summed
profiles. Another confirm of real hybrids was made by restriction analysis with suitable restriction enzymes
HpaII for SED1and AluI for AGA1(Fig.2 b).

Figure 1 SED1 and AGA1
electrophoretic profiles of the
selected parental strains
(Saccharomyces cerevisia). L:
ladder 100 bp (Fermentas)

Figure 2 a) polymorphism comparison between
parental strain and related hybrids b) restriction
analysis of SED1 (HpaII) and AGA1 (AluI) of
the parental strains and related hybrids. L: ladder
100bp (Fermentas)

4. References
Ciani M, Mannazzu I, Marinangeli P, Clementi F, and Martini A (2003) Contribution of winery-resident Saccharomyces
cerevisiae strains to spontaneous grape must fermentation. Antonie van Leeuwenhoek 85: 159-164
Giudici, P., Solieri, L., Pulvirenti, A., Cassanelli, S. 2005. Strategies and perspectives for genetic improvement of wine
yeasts. Appl. Microbiol. Biotechnol. 66: 622-628
Giudici P, Caggia C, Pulvirenti A, Zambonelli C, and Rainieri S (1998) Electrophoretic profile of hybrids between
cryotolerant and non-cryotolerant Saccharomyces strains. Lett Appl Microbiol 27: 31-34
Mannazzu, I., Simonetti, E., Marinangeli, P., Guerra, E., Budroni, M., Thangavelu, M., Bowen, S., Wheals, A.E. and
Clementi, F. (2002) SED1 gene length and sequence polymorphisms in feral strains of Saccharomyces cerevisiae.
Appl. Environ. Microbiol. 68, 54375444.
Marinangeli, P., Angelozzi, D., Ciani, M., Clementi, F. and Mannazzu, I. (2004a) Minisatellites in Saccharomyces
cerevisiae genes encoding cell wall proteins: a new way towards wine strain characterisation. FEMS Yeast Res. 4,
427435.
Mariangeli, P., Clementi, P., Ciani, M., Mannazzu, I.( 2004b). SED1 polymorphism within the genus Saccharomyces. FEMS
Yeast research. 5: 73-79.
Pulvirenti A, Caggia C, Restuccia C, Giudici P, and Zambonelli C (2000) Inheritance of mitochondrial DNA in interspecific
Saccharomyces hybrids. Ann Microbiol 50: 61-64
Pulvirenti A, Zambonelli C, Todaro A, and Giudici P (2002) Interspecific hybridisation by digestive tract of invertebrates as
a source of environmental biodiversity within the Saccharomyces cerevisiae. Ann Microbiol 52: 245-255
Rainieri, S., Pretorius, I.S. 2000. Selection and improvement of wine yeast. Annals of Microbiol. 50: 15-31.
Winge O, Lausten O (1938) Artificial species hybridization in yeast. CR Trav Lab Carlsberg Ser Physiol 22: 235
15
th
219
15
th
New data on bioavailability and catabolism
of green tea flavan-3-ols in humans
Luca Calani (luca.calani@nemo.unipr.it)
Human Nutrition Unit, Department of Public Health, University of Parma, Italy
Tutor: Prof. Daniele Del Rio
Aim of this study was to investigate green tea flavan-3-ol catabolism, plasma pharmacokinetic and urinary
excretion to evaluate their bioavailability. Twenty healthy humans ingested 400mL of a ready to drink green tea,
plasma and urine were collected for 4 and 24 hours, respectively, and 39 catabolites were identified by means of
tandem mass spectrometry. The calculated bioavailability was equal to 39% and it is interesting to notice the
great variability in urinary excretion of colonic metabolites among participants. This study demonstrates that
green tea catechins are more bioavailable than previously observed when colonic ring fission metabolites are
taken into consideration.
Nuovi dati sulla biodisponibilit e catabolismo dei flavan-3-oli del t verde nelluomo
Lo scopo di questo lavoro stato studiare il catabolismo, la cinetica plasmatica e lescrezione urinaria dei
flavan-3-oli del t verde per valutare la loro biodisponibilit. Venti soggetti sani hanno ingerito 400 mL di t
verde freddo. Plasma e urine sono stati raccolti rispettivamente per 4 e 24 ore e 39 cataboliti sono stati
identificati mediante spettrometria di massa tandem. La biodisponibilit calcolata stata pari al 39% ed
interessante notare la grande variabilit fra i partecipanti nellescrezione urinaria dei metaboliti colonici. Questo
studio dimostra che le catechine del t verde sono pi biodisponibili rispetto a quanto osservato in precedenza se
si tengono in considerazione i loro composti di degradazione intestinale.

Keywords: green tea, flavan-3-ols, bioavailability, colon microflora, mass spectrometry
1. Introduction
Green tea is one of the major sources of dietary polyphenols, catechins (or flavan-3-ols) being the main
polyphenolic subclass present in tea leaves. Epidemiological evidence is mounting describing the protective
effects of green tea consumption against the risk of cardiovascular diseases and mortality (Grassi et al., 2008;
Alexopoulos et al., 2008). Bioavailability studies with green tea or green tea extracts have shown very different
and controversial results (Manach et al., 2005), with urinary excretion ranging from unquantifiable traces to
values close to 10% of the ingested amount (Chow et al., 2005; Stalmach et al., 2009). Therefore, in this study
we have investigated green tea flavan-3-ol catabolism, plasma pharmacokinetic and urinary excretion with the
aim of estimating the bioavailability of these molecules in detail, by taking into account all the known and some
unknown catabolites deriving from their interaction with the gastrointestinal tract and its hosted microflora.
Two hundred mL bottles of ready-to-drink (RTD) green tea beverage were supplied by Soremartec Italia S.r.l.
(Alba, CN, Italy). Pure ()-epicatechin, ()-epigallocatechin, ()-epigallocatechin-3-gallate, ()-epicatechin-3-
gallate and gallic acid standards were obtained from Sigma (St. Louis, MO, USA). All the solvents and reagents
were purchased from Carlo Erba Reagenti (Milano, Italy). The feeding study was carried out on 20 healthy
human volunteers selected according to several exclusion criteria. The volunteers were 26 5 years old (mean
SD) and with an average BMI of 23 3 kg/m
2
. Each volunteer signed an informed consent and the study
protocol was approved by the Ethics Committee for Human Research of the University of Parma. For two days
prior to, and 24 h after the ingestion of tea, the subjects followed a diet almost deprived of flavonoids and
phenolic compounds by avoiding fruit and fruit juices, chocolate, nuts, vegetables, tea and any kind of herbal tea,
coffee, wine and dietary antioxidant supplements. To check for compliance, the volunteers were asked to fill a 3-
day weighed food record during the two days before the study and the study day. On the day of the study, after
an overnight fast, each subject drank 400 mL of the tea beverage. Urine was collected before the volunteers
drank the tea and in 0-4, 4-7, 7-10 and 10-24h collection periods after ingestion. The volume of urine collected
during each period was measured and stored at 80C. Suitable aliquots of urine samples were filtered with
0.45!m nylon filter (Waters, Milford, MA, USA ) and directly analyzed by HPLC-MS/MS that is Waters 2695
Alliance separation module equipped with a Micromass Quattro Micro Api mass spectrometer fitted with an
electrospray interface (Waters, Milford, MA, USA) without further processing. In 5 volunteers, blood was
collected before and 1, 2, 3 and 4h after green tea ingestion and flavan-3-ols metabolites were extracted as
described by Mata-Bilbao and colleagues (2007) with some modification, and then analyzed in the same mode of
15
th
220
15
th
urine. Unmetabolised flavan-3-ols were quantified using the appropriate standard, while metabolites of
epicatechin and epigallocatechin were quantified using the aglycones. Instead, glucuronide, methyl and sulphate
metabolites of the ring-fission metabolites of tea catechins (namely, "-valerolactones) were quantified as
epicatechin equivalents.
The total flavan-3-ols provided from 400 mL of RTD green tea were 403.9 9.4 mol (mean SD). We have
identified several urinary metabolites of (epi)catechin (EC) and (epi)gallocatechin (EGC), and several colon
microflora derived metabolites, that are 5-(3,4-dihydroxyphenyl)-"-valerolactone (M6), 5-(3,5-
dihydroxyphenyl)-"-valerolactone (M6) and 5-(3,4,5-trihydroxyphenyl)-"-valerolactone (M4) in their
conjugated forms. In fact, (epi)catechin and (epi)gallocatechin can be conjugated at the small intestine level by
human enzymes, as UDP-glucuronosyltranferases, sulfotransferases and catechol-O-methyltransferase. The
absorbed fraction subsequently comes across a series of similar hepatic conjugating enzymes, and further
transformation can occur in the kidneys (Lambert et al., 2007; Benoit-Biancamano et al., 2009). Instead, the
unabsorbed fraction could reach the colon undergoing an extensive metabolism by the local microflora. It is
interesting to note that the sum of EC- and EGC-conjugates excreted in urine was equal to the 3% of total flavan-
3-ols ingested with tea, whereas the conjugated valerolactones reached a 36% of the total flavanol ingestion.
Contrary to what occurred for EC and EGC, epigallocatechin-3-O-gallate (EGCG) and epicatechin-3-O-gallate
(ECG) were not recovered in urine but only in plasma as aglycones, as previously reported and probably as a
consequence of the presence of the 3-O-galloyl moiety. Moreover, in a single subject, we have monitored the
excretion of urinary flavan-3-ols and "-valerolactones for 54h. Most of the flavanol conjugates were excreted
before the 4th hour and were undedectable at later timepoints. Contrarily, the "-valerolactones showed a
complementary excretive profile, in good agreement with their generation and absorption in the large intestine,
reaching their excretion peak at 24h and being continuously excreted up to 54h after ingestion of tea. Evaluating
the excreted "-valerolactones in all 20 volunteers, it must be noted that M6-sulphate was the main excreted
valerolactone, but a great variability occurred in urinary excretion of colonic metabolites among participants,
probably related to differences in their own colonic microflora. This study demonstrates that green tea catechins
are more bioavailable than previously observed when colonic ring fission metabolites are taken into
consideration (39% of the amount ingested). Moreover, the excretion profile of colonic valerolactones clearly
continues after the 24
th
hour. This observation is consistent with a further underestimation of the true
bioavailability value for flavan-3-ols as consumed through RTD green tea. Future research is needed to fully
understand the relation occurring between colon microflora and catechin metabolism and new experiment should
be focused on the bioactivity colon derived valerolactones, as they are more abundant in vivo and their half life
in the human body seems to be remarkably long.
4. References
Alexopoulos N, Vlachopoulos C, Aznaouridis K, Baou K, Vasiliadou C, Pietri P, Xaplanteris P, Stefanadi E,
Stefanadis C (2008) The acute effect of green tea consumption on endothelial function in healthy
individuals. Eur J Cardiovasc Prev Rehabil 15: 300-5.
Benoit-Biancamano MO, Connelly J, Villeneuve L, Caron P, Guillemette C (2009) Deferiprone glucuronidation
by human tissues and recombinant UDP glucuronosyltransferase 1A6: an in vitro investigation of genetic
and splice variants. Drug Metab Dispos 37: 322-9.
Calani L (2009) Bioavailability and catabolism of polyphenols in humans. In Proceedings of the 14
th
Workshop
on the Developments in the Italian PhD Research on Food Science Technology and Biotechnology;
Oristano, 16-18
th
September 2009, pp. 388-390.
Chow HH, Hakim IA, Vining DR, Crowell JA, Ranger-Moore J, Chew WM, Celaya CA, Rodney SR, Hara Y,
Alberts DS (2005) Effects of dosing condition on the oral bioavailability of green tea catechins after single-
dose administration of Polyphenon E in healthy individuals. Clin Cancer Res 11: 4627-33.
Grassi D, Aggio A, Onori L, Croce G, Tiberti S, Ferri C, Ferri L, Desideri G (2008) Tea, flavonoids, and nitric
oxide-mediated vascular reactivity. J Nutr 138: 1554S-1560S.
Lambert JD, Sang S, Yang CS (2007) Biotransformation of green tea polyphenols and the biological activities of
those metabolites. Mol Pharm 4: 819-25.
Manach C, Williamson G, Morand C, Scalbert A, Rmsy C (2005) Bioavailability and bioefficacy of
polyphenols in humans. I. Review of 97 bioavailability studies. Am J Clin Nutr 81: 230S-242S.
Mata-Bilbao Mde L, Andrs-Lacueva C, Roura E, Juregui O, Torre C, Lamuela-Ravents RM (2007) A new
LC/MS/MS rapid and sensitive method for the determination of green tea catechins and their metabolites in
biological samples. J Agric Food Chem 55: 8857-63.
Stalmach A, Troufflard S, Serafini M, Crozier A (2009) Absorption, metabolism and excretion of Choladi green
tea flavan-3-ols by humans. Mol Nutr Food Res 53: S44 S53.
15
th
221
15
th
Influence of the presence of different fibers
on gluten-free dough and bread properties
Carola Cappa (carola.cappa@unimi.it)
Dipartimento di Scienze e Tecnologie Alimentari e Microbiologiche, Universit degli Studi di Milano, Italia
Tutor: Prof. Mara Lucisano; Co-tutor: Dr. Manuela Mariotti

This PhD project has the purpose to identify the formulation and to define the process conditions that most
influence the quality and shelf-life of gluten-free (GF) baked products. In accordance with the PhD thesis project
previously described (Cappa, 2009), in the second year of the research different activities related to the
characterization of raw materials (A1) and to the optimization of the various steps of bread production (A3) have
been performed. Among them, the effects -here reported- of the addition of two different fibers on dough and
bread properties (A4) have been investigated.
Influenza della presenza di fibre di diversa origine
sulle propriet di impasti e pani gluten-free
Questa ricerca ha lo scopo di individuare le materie prime e di definire le variabili di processo che maggiormente
influenzano la qualit e la shelf-life dei prodotti da forno gluten-free (GF). In accordo con il progetto
precedentemente descritto (Cappa, 2009), durante il secondo anno di dottorato sono state affrontate diverse
attivit relative alla caratterizzazione delle materie prime (A1) e allottimizzazione delle condizioni di processo
(A3) per la produzione di pane GF. Parallelamente sono stati investigati gli effetti -qui riportati- della presenza di
due diverse fibre sulle propriet di impasti e pani GF (A4).
1. Introduction
This paper reports the main results of the activities concerning the effects of a different combinations of Psyllium
(Psy) and sugar beet (SB) fiber on the leavening behaviour of doughs characterized by different consistencies
that make them suitable to be poured into moulds or to be shaped by hand or with an industrial forming machine.
The next PhD year will be focused on the setting up of different treatments aimed to improve the technological
and nutritional properties of the raw materials (A2) and on the optimization of the bread-making conditions by
using GF sourdough (A3). Particular attention will be paid to bread shelf-life (A4).
Chemical-Physical Characterization of Raw Materials (A1)
The following raw materials were considered: Corn starch (CS); Psyllium (Psy); Rice flour (RF); Rice protein
(RP); Rice starch (RS); Sugar beet fiber (SB). The following parameters were determined: moisture content
(AACC 44-15A, 2000), protein content (N*6.25, AOAC 920.87, 1999), total starch (TS) and damaged starch
(DS) (Total/Damage Starch Assay Kit by Megazyme International Ireland Ltd).The method outlined by
Anderson et al. (1969) was used to determine the water absorption index (WAI). The pasting properties were
measured using a Brabender Micro-Visco-Amylograph (Brabender OHG, Germany). All these determinations
were made at least in duplicate (n!2).
Bread-baking Trials (A3) and Bread Quality Evaluation (A4)
The bread formulation included: the above mentioned raw materials, margarine, sugar, yeast, HPMC and salt.
Bread-making was performed as reported by Mariotti (2004). Two combinations of Psy and SB (percentage on
flour base) and two dough consistencies (Brabender Unit -BU) were tested: Bread A200: 2.5%Psy, 0.5%SB-200
BU; Bread A500: 2.5%Psy, 0.5%SB-500 BU; Bread B200: 1.5%Psy, 1.5%SB-200 BU; Bread B500: 1.5%Psy,
1.5%SB-500 BU. The dough mixing properties were examined with the Brabender Farinograph (Brabender
OHG, Germany). Dough development during leavening and CO
2
production and retention were measured with
the Chopin F3 Rheofermentometer (Chopin SA, France). Bread crumb softness was investigated trough a
compression test using a TA-HDplus Texture Analyzer (Stable Micro Systems, UK) on fresh and stored bread
(20C, 60% RU for 72h; paper bags); crumb holes distribution was investigated by Image Analysis (Image Pro-
Plus v. 4.5.1.29). For each test, four replicates were performed (n!4).
Raw Materials (A1)
The raw materials showed different chemical composition (Table 1) and pasting properties (Fig.1), and a lower
15
th
222
15
th
retrogradation of rice starch (RS) in comparison to corn starch (CS) was observed. Moreover, SB and Psy
exhibited extremely different WAI values (9.482.13 gH
2
O/g db and 48.292.77 gH
2
O/g db, respectively); this
parameter greatly influences the water amount to be added during the bread-making process.
Table 1 and Figure 1. Raw materials properties. Abbreviation: TS, total starch; DS, damaged starch; Tp, viscoamylographic
temperature profile; CS, corn starch; RF, rice flour; RS, rice starch.

Bread-baking Trials (A3) and Bread Quality Evaluation (A4)
The presence of a higher amount of Psy determined, in particular for doughs having a 200BU consistency, an
increase of water absorption (85% for 2.5%Psy vs. 74% for 1.5%Psy) and of dough height and CO
2
production
during the leavening phase. Doughs having a 500BU consistency were characterized by a reduced dough
development and gas retention (95% vs. 99% for the 200BU doughs) during proofing; nevertheless Bread
A500 presented a considerable volume increase during baking (Tab.2 and Fig.2). Breads obtained from dough
having a lower consistency (200BU) showed, as expected, a high moisture content, good softness (low
compression force) and high specific volume and height (Tab.2). All these parameters had an impact on crumb
porosity, as can be appreciated in Fig.2. As regards bread shelf-life, a limited decrease (2-5%) in crumb moisture
was observed, whereas the slice moisture changed more evidently (916%). Significant differences (p<0.05) in
crumb softness (Tab.2) between the two 200BU breads were found (7.430.82 N, Bread A200 vs. 10.630.59 N,
Bread B200); these differences were more evident after 3 days of storage (21.711.34 N vs. 37.562.57 N,
respectively) indicating a higher anti-staling effect of Psy fiber in comparison to SB fiber.
Table 2. Fresh bread
properties. Abbreviation:
n.d., not detectable.
Note: values followed by
the same letter in the
same column are not
significantly different
(P<0.05).

Figure 2. Bread appearance and porosity: 0.2 " x < 0.5mm
2
; 0.5 " x < 1mm
2
; 1 " x < 5mm
2
; 5 " x< 10mm
2
; x ! 10mm
2
.
4. References
AACC (American Association of Cereal Chemists) (2000) Approved Methods of the AACC, 10th ed. St Paul,
MN, USA.
Anderson RA, Conway HF, Pfeifer VF, Griffin EL (1969) Gelatinization of corn grits by roll and extrusion
cooking. Cereal Sci. Today 14: 4-12.
AOAC (Association of Official Analytical Chemists) (1999) Official Methods of Analysis, 16th ed.
Gaithersburg, MD, USA.
Cappa C (2009) Gluten-Free Baked Products: Optimization of Formulation and Process Conditions. In Proc.s of
the 14th Workshop on the Development in the Italian PhD Research on Food Science Technology and
Biotechnology, Oristano (Italy), September 16-18, 2008, pp. 391-392.
Mariotti M (2004) Valorizzazione tecnologica di avena e grano saraceno. PhD Thesis in Food Biotechnology,
Universit degli Studi di Milano, Italy.
Raw
materials
Moisture
(g/100g)
Protein
(g/100g db)
TS
(g/100g db)
DS
(g/100g db)
Rice flour 11.47 0.26

7.86 0.03 85.16 1.91 5.80 0.28
Rice protein 6.90 0.30 87.44 2.34 4.58 0.19 n.d.
Rice starch
10.35 0.13
n.d.
90.73 1.53
12.0
1
0.37
Corn starch 11.05 0.03 n.d. 97.97 1.30 1.08 0.03
Psyllium 8.46 0.05 3.69 0.11 n.d. n.d.
Sugar Beet 9.58 0.25 9.30 0.32 1.32 0.04 n.d.
Crumb
moisture
Slice
moisture
Height
Specific
volume
Force
Bread
(g/100g) (g/100g) (mm) (mL/g) (N)
A200 52.84 0.04
d
46.17 0.30
d
52.4 1.1
c
2.40 0.17
c
7.43 0.82
a

A500 44.94 0.13
b
37.50 0.43
a
61.3 2.1
d
2.74 0.26
d
12.14 1.72
b

B200 50.06 0.05
c
42.34 0.31
c
48.0 1.3
b
2.11 0.12
b
10.63 0.59
b

B500 44.77 0.13
a
38.48 0.21
b
39.4 1.5
a
1.79 0.16
a
n.d.
0
360
720
1080
1440
1800
0 15 30 45 60 75 90 105
Time (min)
V
i
s
c
o
s
i
t
y

(
B
U
)
0
20
40
60
80
100
T
e
m
p
e
r
a
t
u
r
e

(
C
)
RS
CS
RF
Tp
A200
1

c
m

0
20
40
60
H
o
l
e
s

s
i
z
e

d
i
s
t
r
i
b
u
t
i
o
n

(
%
)
0
20
40
60
H
o
l
e
s

s
i
z
e

d
i
s
t
r
i
b
u
t
i
o
n

(
%
)
0
20
40
60
H
o
l
e
s

s
i
z
e

d
i
s
t
r
i
b
u
t
i
o
n

(
%
)
0
20
40
60
H
o
l
e
s

s
i
z
e

d
i
s
t
r
i
b
u
t
i
o
n

(
%
)
A500 B200 B500
15
th
223
15
th

Bread making aptitude of Italian waxy wheat
Rosita Caramanico (rosita.caramanico@unimi.it, rosita.caramanico@entecra.it)
1
Dipartimento di Scienze e Tecnologie Alimentari e Microbiologiche, Universit di Milano, Italia
2
CRA-SCV S. Angelo Lodigiano (LO)
Tutor: Prof.ssa M. Ambrogina Pagani
1
Co-Tutor: Patrizia Vaccino
2

The aim of this PhD thesis is the analysis of the properties and role in the textural characteristics of bread and
bakery products from waxy (amylose-free) hexaploid wheat, WHW (Triticum aestivum L.). In the second year the
bread making aptitude of the lines under study was evaluated by means of the rheological and technological tests
commonly used in the sector. In addition, a complete agronomic description of the lines was performed.

Attitudine alla panificazione di linee Italiane di frumento tenero waxy

Scopo di questo progetto di dottorato lo studio delle caratteristiche di pane e prodotti da forno ottenuti da
frumento tenero waxy (privo di amilosio). In questo secondo anno stata valutata lattitudine alla panificazione
delle linee in esame, per mezzo dei principali test reologici e tecnologici. Delle medesime linee stata inoltre
effettuata una descrizione agronomica completa.

Key words: T. aestivum, wheat, starch, amylose, waxy, bread-making.
1. Introduction
In accordance with the PhD thesis project previously described (Caramanico, 2009), this work reports the main
results of the following activities:
A1) Determination of amylose content.
A2.2) Pasting properties of WHW flour.
A3.1) WHW flour chemical and physical analysis.
A3.2) Rheological properties of dough from WHW flour.
A4) Agronomic characterization.
Materials consisted of 18 waxy bread wheat lines derived from a breeding program set up to develop waxy lines
adapted to the Italian environment from partial-waxy cultivars identified in Italian germplasm. Two waxy wheat
lines (BHWX14-7, hard type, and BHWX2-2a, soft type), kindly provided by C. Morris (Washington State
Univ., Pullman, WA) (Morris and Konzak, 2001) and the cv Salgemma were added as controls. The genotypes
were grown in St. Angelo L. (Italy) during the 2008-09 growing season. The following agronomic characteristics
were recorded: grain yield (t ha
-1
), plant height (cm), heading, resistance to powdery mildew (Blumeria
graminis), brown rust (Puccinia recondita), and Septoria tritici blotch (Septoria tritici), test weight (kg hL
-1
),
thousand kernel weight (g; TKW, ISO 520). After milling the grain with Bona Labormill (Bona, Monza, Italy),
the following small-scale analyses were performed: protein content (PC, %dm; AACC39-11) and hardness
(AACC39-70A) by a NIR System Model 6500 (FOSS NIRSystems, Laurel, MD); amylose content by an
enzymatic kit (Megazyme Int., Wicklow, Ireland Ltd); SDS sedimentation volume (SSV, mL; Preston et al.,
1982), Gluten index (AACC 38-12) by the Glutomatic 2200 (Perten Instruments, Stockholm, Sweden), Falling
Number (FN, s; Esetek Instr. Srl, Roma, Italy) according to ISO 3093. Pasting properties of flours were
analysed by Rapid Visco Analyser (RVA, Newport Sci., Sidney, Australia) according to ICC162. Rheological
properties were evaluated by Chopin Alveograph (ICC 121-1992) and Brabender Farinograph (ICC 115-D).
Leavening test of small dough, confined to Petri dishes, was monitored by Image Analysis techniques (Riva et
al., 2004). A commercial flour of high bread-making quality was used as control for all technological analyses.
15
th
224
15
th

A1) Determination of amylose content. The waxy wheat lines showed an average amylose content of 1.4%,
similar to the waxy standard ones; the lowest value was registered for line Wx124 (0.7%).
A2.2) Pasting properties of WHW flour. All waxy lines had similar profiles, clearly differentiated from the
commercial controls. By grouping the lines in waxy and controls, differences are evident for peak viscosity
(2301 cP vs 1787 cP, respectively) and setback viscosity (329 cP vs 931 cP) indicating that in waxy wheat starch
gelatinizes quickly and it is more resistant to retrogradation (Van Hung et al., 2006).
A3.1) WHW flour chemical and physical analysis. The protein content ranged from 12.3% to 17.2%. For
Wx70, Wx107, Wx118 and Wx128 a high protein content was associated to high Gluten Index and SSV values,
indicating a good gluten quality. The average value of FN was much lower (on average 65 1 s) than those of
the control (581 s). Such results, typical of waxy wheat, seem not to be related to alpha-amylase activity, but
only dependent on waxy starch characteristics (Graybosch et al., 2000).
A3.2) Rheological properties of dough from WHW flour. Waxy lines showed in general high values for the
farinograph water absorption, ranging from 70.3% to 78.7%, but very low values of stability (Fig. 1): only four
lines had stability higher than 4 min, the minimum value for eligibility to ordinary bread making wheat
according to Italian Synthetic Quality (ISQ) classification. Considering the alveograph W (Fig. 2) and fixing a
threshold level of 200 J*10
-4
for eligibility to ISQ classification, a high heterogeneity can be seen. Lines Wx70,
Wx123 and Wx128 had very high strength All the lines have an extremely high alveograph P/L value, indicating
an excessive tenacity. By considering the relative increment of radial surface derived from the leavening test
(A
t
/t
0
), waxy lines ranged from 4.0 to 4.6 in 150-180 min, slightly higher than the wx standards ones.
A4) Agronomic characterization.
Grain yield ranged from 2.58 t/ha (Wx50) to 4.06 t/ha (Wx123) with a mean value of 3.54 t/ha, higher than the
values registered for the waxy standards (BHWX14-7: 2.53 t/ha; BHWX2-2a: 3.07 t/ha) and for cv Salgemma
(3.45 t/ha). All the waxy lines were relatively tall (from 70 cm to 89 cm): this could make them more susceptible
to lodging. As far as the growth cycle is concerned, Italian waxy lines resulted on average early-flowering, the
earliest one (Wx50) with a heading date of 32 days. The average value of test weight was high (80,5kg/hL), all
the lines exceeding 75kg/hL which is the minimum value for wheat to be sold for breadmaking, according to
ISQ. These results, together with the values registered for thousand kernel weight (34.2 g on average), are
indicators of good kernel filling levels. As regards disease resistance, particularly interesting were lines Wx70,
Wx71, Wx116 and Wx118, which were completely resistant to both powdery mildew and brown rust.

Figure 1 Brabender farinograph: stability (min) Figure 2 Chopin alveograph: W (J*10
-4
)

4. References
Graybosch RA, Guo G, Shelton DR (2000) Aberrant falling numbers of waxy wheats independent of !-amylase activity.
Cereal Chem 77: 1-3.
Morris CF & Konzak CF (2001) Registration of hard and soft homozygous waxy wheat germplasm. Crop Sci 41: 934-935.
Preston KR, March PR, Tipples KH (1982) An assessment of SDS-sedimentation test for prediction of Canadian bread
wheat quality. Can. J. Plant Sci 62: 545-553.
Riva M, Pagani MA, La Prova M (2004) Un approccio innovativo per lo studio della lievitazione di impasti da pane:
lAnalisi dImmagine. Tecnica Molitoria 55: 629-650.
Van Hung P, Maeda T, Morita N (2006) Waxy and high-amylose wheat starches and flours- characteristics, functionality and
application. Trends in Food & Technology 17: 448-456.
Van Hung P, Maeda T, Morita N (2007) Dough and bread qualities of flours with whole waxy wheat flour substitution. Food
research international 40: 273-279.
15
th
225
15
th
Impregnation Techniques for Aroma Enrichment of Apple Sticks: a
Preliminary Study
Patrizia Comandini (patrizia.comandini2@unibo.it)
Tutor: Dr. Tullia Gallina Toschi
An activity of the PhD thesis project, represented by flavouring impregnation of apple sticks, is described.
Different impregnation techniques, including impregnation at atmospheric pressure, vacuum impregnation,
impregnation assisted by ultrasound, and the combination of vacuum plus ultrasound technologies were
compared. The highest impregnation levels were obtained under vacuum conditions, mainly at 5 min. The
volatiles of external flavouring (esters and alcohols) shown different evolutions during treatment times.
Confronto di tecniche di impregnazione per larricchimento aromatico di stick di mela:
uno studio preliminare
Una delle attivit svolte durante il mio progetto di tesi di dottorato stata la messa a punto ed il confronto di
tecniche di impregnazione di aromi, quali immersione a pressione atmosferica, impregnazione assistita da
ultrasuoni, vacuum impregnation e combinazione delle tecniche di vacuum impregnation e sonicazione. Le pi
elevate impregnazioni sono state ottenute con le tecniche che prevedevano lapplicazione del vuoto, dopo 5 min
di trattamento. I componenti dellaroma (esteri ed alcoli) presentavano diversi andamenti di impregnazione.
Key words: Apple sticks; impregnation; ultrasound; vacuum.
1. Introduction
Four impregnation technologies represented by immersion at atmospheric pressure (AI), vacuum impregnation
(VI), impregnation assisted by ultrasound (USI), and the combination of vacuum plus ultrasound technologies
(VUSI) were compared. The global aroma amount penetrated inside apple sticks and the aromatic profile of
samples were evaluated at different treatment times in order to select the best procedure.
A fructose isotonic solution containing ascorbic acid and dry, food-grade green apple flavouring (0.5% w/w) was
used to impregnate apple sticks (fruit to syrup ratio, 1:17). Impregnation treatments are described in Table 1.
Table 1 Impregnation conditions of stick apples with green apple flavouring.
Treatment Impregnation steps
Step 1
(5.0 min)
Step 2
(1.5 min)
Step 3
(2.5/5.0/12.5 min)
AI Atmospheric pressure Atmospheric pressure Atmospheric pressure
VI Vacuum pressure (280 mbar) Restoring atmospheric pressure Atmospheric pressure
USI Atmospheric pressure Atmospheric pressure Ultrasound treatment (35 kHz)
VUSI Vacuum pressure (280 mbar) Restoring atmospheric pressure Ultrasound treatment (35 kHz)
Volatiles extraction and analysis were realized with a SPME-GC/MS procedure. A semiquantitative analysis was
made and the relative amounts (RAs) of volatiles were determined (Comandini et al., 2010). RAs of the overall
aroma penetrated inside apples and of the main volatile components of external flavouring (ethyl 2-
methylbutanoate, 3-methylbutylacetate, hexyl acetate, and hexan-1-ol) were calculated. Two-way analysis of
variance was carried out and Fishers least significant differences test was applied (p<0.05).
3.1 Overall green apple flavouring impregnation
Significant differences were detected between treatments and times for green apple flavouring impregnation. As
detailed in Table 2, VI and VUSI gave the highest impregnation, mainly at 5.0 min. USI treatments, were not
different from AI, and it was assumed that the higher RAs obtained for VUSI were closely related to the vacuum
effect. The higher volatile impregnation obtained in VI and VUSI was due to the fraction of isotonic solution that
penetrated inside the apple sticks by a hydrodynamic mechanism. In fact, VI and VUSI samples had a variation
15
th
226
15
th
in weight of about 14%; no significant differences in weight were detected for AI and USI.
Table 2 RAs (g
1
) of the overall flavouring impregnations. Values are means standard deviations (n=3). Different
letters in rows show statistically significant differences between treatments (p< 0.05). Different letters in columns
show statistically significant differences between times (p < 0.05).
Treatment Time
2.5 min
b
5.0 min
a
12.5 min
a
AI
b
0.150.04 0.230.04 0.240.03
USI
b
0.190.04 0.240.04 0.230.03
VUSI
ab
0.200.04 0.360.03 0.270.03
VI
a
0.210.06 0.350.06 0.360.03
3.2 Evolution of esters and alcohols impregnation
As shown in Figure 1, esters and alcohols had different impregnation behaviours. The RAs of ethyl 2-
methylbutanoate, 3-methylbutyl acetate, and hexyl acetate increased until 5.0 min of impregnation with all
treatments. The decreasing RA of ethyl 2-methylbutanoate, 3-methylbutyl acetate, and hexyl acetate after 5.0
min of impregnation with VUSI and USI might be explained by a progressive reduction of flavour in isotonic
solutions. Possible causes were the breakdown by fruit metabolism, the preferential evaporation of some
components, or the hydrolytic breakage of volatile molecules.
The RA of hexan-1-ol showed a different evolution during the relaxation time: it increased until 5.0 min in AI
and USI samples, after which the RA was constant, and no significant differences were detected between 5.0 and
12.5 min. The impregnation of hexan-1-ol in VI and VUSI increased up to 12.5 min. The low relative volatility
of hexan-1-ol, which is about 100 times less than those of several esters (Ali et al., 2003), together with other
physicochemical properties, such as polarity and functional groups, could have led to slower depletion of the
alcohol from the isotonic solution and a longer impregnation time to reach saturation of the product.
Further studies are necessary to explain these results, as well as the reduction of some volatiles after a few
minutes of treatment.
Figure 1 Impregnation of ethyl 2-methylbutanoate (A), 3-methylbutyl acetate (B), hexyl acetate (C), and hexan-1-ol (D) at
different relaxation times (2.5, 5.0, and 12.5 min).
4. References
Ali F, Dornier M, Reynes M. (2003) Evaluating transfers of aroma compounds during the concentration of sucrose solutions
by osmotic distillation in a batch-type pilot plant. J. Food Eng 60: 1-8.
Comandini P, Blanda G, Mujica-Paz H, Valdez-Fragoso A, Gallina Toschi T (2010) Impregnation techniques for aroma
enrichment of apple sticks: a preliminary study. Food Bioprocess Tech DOI 10.1007/s11947-010-0385-6.
15
th
227
15
th
Nanoparticles to extend the shelf life of ready to use fruit and vegetables
Cristina Costa (c.costa@unifg.it)
Dept. Food Science, University of Foggia, Foggia, Italy
Tutor: Dott.ssa Amalia Conte; Co-tutor: Prof. Matteo Alessandro Del Nobile

The aim of the Ph-D project is the application of nanoparticles to prolong fresh-cut produce shelf life. To this aim,
during the second year, the main spoilage microorganisms from different ready to use fruit and vegetables were isolated
and identified. Secondly, the antimicrobial activity of different silver nanoparticles was tested in vitro. Among the
tested nanoparticles, the best antimicrobial activity was found by using silver-montmorillonite (Ag-MMT) prepared by
ion exchanged reaction. Therefore, Ag-MMT were embedded in different polymer matrices for realizing a new active
packaging system to be applied to fresh-cut produce.
Nanocoparticelle per prolungare la shelf life di prodotti ortofrutticoli pronti alluso
Questo progetto di tesi si pone lobiettivo di applicare nanoparticelle per prolungare la shelf life di prodotti ortofrutticoli
pronti alluso. A tale fine, sono stati isolati ed identificati i principali microorganismi di spoilage di alcuni prodotti
ortofrutticoli pronti alluso. L'attivit antimicrobica di differenti nanoparticelle di argento stata testata in vitro sui
microrganismi precedentemente isolati. Tra le nanoparticelle testate, il complesso argento-montmorillonite (Ag-MMT)
ha mostrato una migliore attivit antimicrobica. Pertanto, le particelle di Ag-MMT sono state intrappolate in diverse
matrici polimeriche per realizzare un nuovo sistema di imballaggio attivo da applicare ai prodotti ortofrutticoli pronti
alluso.
Key words: Silver nano-particles, antimicrobial activity, active packaging.
1. Introduction
In accordance with the PhD thesis project previously described (Costa, 2009), this work reports the main results of the
first activities concerning:
(A1) the isolation and microbiological identification of the principal spoilage microorganisms of different ready to use
fruit and vegetables;
(A2) antimicrobial activity of different silver nanoparticles on spoilage microbial groups;
(A3) antimicrobial activity of the most effective silver nanoparticles embedded in different polymer matrices.
Characterization of microorganisms: from different fruit and vegetables (strawberries, kiwi, grape, green beans,
asparagus, tomatoes, broccoli and artichokes), purchased in local markets, presumptive mesophilic spoilage
microorganisms were isolated. The colonies were isolated, purified and identified from Plate Count Agar (PC agar)
(Oxoid) at 30 C. In particular, the isolated microorganisms were subjected to Gram staining, catalase test, oxidase test,
and biochemical test (API 20E, 50 CH and 20 C Aux -Bio-Merieux Milano, Italy).
Antimicrobial activity: silver-montmorillonite (Ag-MMT), prepared by ion exchanged reaction in collaboration with the
Institute of Composite and Biomedical Materials (CNR, Naples, Italy) and two commercially available nano-silver-
based particles, silver colloidal (Ag-coll) (BBInternational, Cardiff, UK) and silver nano-powder (Ag-NP) (MKnano,
Mississauga, Canada), were tested in concentration of 200, 300 and 400 mg/L. To this aim, growth experiments on a
mix of Pseudomonas spp. were carried out to test the antimicrobial effects of the selected nanoparticles. PC broth
(Oxoid) was used as culture medium. A cocktail of overnight cultures strains was prepared by mixing 1% of different
cultures. Serial dilutions in sterile saline solution were prepared to obtain approximately a final concentration of 10
3

CFU/ml. The control and active samples were incubated at 25 C for 70 h. Periodically, aliquots of 1 ml were taken
from each tube for microbiological analyses by plate count. Serial dilutions of sample were plated on Pseudomonas
Agar Base (PAB) (Oxoid), modified by adding Pseudomonas CFC selective supplement after autoclaving and
incubated at 25C for 48 h.
Antimicrobial activity of silver nano-particles embedded in different polymer matrices: the Ag-MMT nanoparticels
were embedded into agar, zein and poly-caprolatone (PCL). Zein solution was obtained dissolving 5 g of zein (MW =
38 kDa) into 16 ml of ethanol (96%) at 50 C and after 1 g of glycerol was added. Agar-water mixture was obtained
dissolving 8 g/L of agar (Oxoid) into distilled water at a temperature of 121C for 15 min. 10 g of PCL were dissolved
in 100 ml of dichloromethane using a mechanical stirrer. After cooling to room temperature, aliquots (5 ml) of zein
solution, agar solution and PCL solution were added with different amount of Ag-MMT (10, 15 and 20 mg). Each
active solutions was put in a sonication bath for 5 min, then cast in a tube and cooled at ambient temperature under
laminar flow hood (about 24 h). As control, zein, agar and PCL solutions without nanoparticles were also prepared. In
15
th
228
15
th
order to test the antimicrobial activity of the active polymeric matrices the growth experiments on a mix of
Pseudomonas spp., were carried out as previously described for the single nanoparticles.
The isolated microorganisms were characterized by the 63.02% of Pseudomonas spp., 9.37% Aeromonas spp., 9.37
yeasts, 6.25 Bacillus spp., 6.25% Acinetobacter spp., 3.12% Erwinia spp. and 2.82 % other microorganisms. According
to literature data, among the microorganisms isolated from different fruit and vegetables, Pseudomonas spp. was the
dominant bacterial group (Ahvenainen, 1996).
In order to test the antimicrobial effectiveness of the different silver nanoparticles (Ag-MMT, Ag-coll, and Ag-NP),
growth experiments were carried out on Pseudomonas spp., being the main representative spoilage microbial group of
fresh-cut produce, as recorded in the previous experimental step. Figure 1 shows the cell load concentration for the
tested silver nanoparticles at different concentrations, after 48 h. As can be inferred, a significant antimicrobial activity
was obtained by using the sole Ag-MMT nano-particles prepared by ion exchanged reaction at all the tested
concentrations. The Pseudomonas spp. generally showed resistance to most essential oils and to all known
antimicrobials and antibiotics, due to a very restrictive outer membrane barrier. The hydrophilic cell wall structure of
Gram-negative bacteria is constituted essentially of lipopolysaccharides that block the penetration of hydrophobic oil
and avoids the accumulation of essential oils in the target cell membrane (Bezic et al., 2003). In the case under study,
the negative charges on lipopolysaccharides attract towards the weak positive charge available on silver ions or
nanoparticles, thus allowing the silver-based antimicrobial particles to be effective.
As the use of silver highly filled systems represents a viable approach to avoid the direct contact with food, Ag-MMT
nano-particles were embedded in different polymer matrices, agar, zein and PCL. Figure 2 illustrates the evolution of
Pseudomonas spp. cells load, in contact with control samples and with the agar-based nano-particles, plotted as a
function of time. The curves are the best fit of the re-parameterised Gompertz equation to the experimental data. Data
show an increase from 10
2
to 10
9
CFU/g during the 70 h monitoring for the control samples. On the contrary, it has
been proved that the Ag-MMT nano-particles embedded in agar are effective in inhibiting the microbial growth. After
24 h the cell loads for all the active samples decreased significantly as the silver content increased. For zein and PCL
active films no significant antimicrobial effectiveness was recorded, most probably due to the limited hydrophilic
character of zein and PCL. Differently, the efficiency of the Ag-MMT embedding in agar was ascribed to the fact that
silver ions release is governed by water transport properties of the coating (Kumar and Munstedt, 2005).
In the future step of the Ph-D thesis, the developed active packaging system will be applied to ready to use fruit and
vegetables to prolong the shelf life.

4. References
Ahvenainen R. (1996) New approaches in improving the shelf life of minimally processed fruit and vegetables, Trends
Food Sci. Tech. 7:179-187.
Bezic N, Skocibusic M, Dinkic V, Radonic A (2003) Composition and antimicrobial activity of Achillea clavennae L.
essential oil, Phytother. Res. 17:1037-1040.
Costa C (2009) Nanocomposites to extend the shelf life of ready to use fruit and vegetables. In Proc.s of the 14
th

Workshop on the Developments in the Italian PhD Research on Food Science and Technology, Oristano (Italy),
16-18 September, 2009, pp. 395-396.
Kumar R, and Munstedt H (2005) Polyamide/silver antimicrobials: effect of crystallinity on the silver ion release,
Polym. Int. 54:1180-1186.
Figure 1 Cell load concentration of Pseudomonas
spp. for all tested silver nano-particles at different
concentrations, after 48 h.
Figure 2 Evolution of Pseudomonas spp.
viable cell concentration plotted as a function
of time for all tested samples of agar-based
nanocomposites.
15
th
229
15
th
Selection of reference genes for quantitative RT-PCR normalization in
Oenococcus oeni
Antonella Costantini (coanto@hotmail.com)
CRA-Centro di Ricerca per lEnologia, Asti/ DIVAPRA, Universit degli studi di Torino, Italy
Tutor: Emilia Garcia-Moruno, Luca Cocolin

The phD project focuses on the analysis of gene expression in Oenococcus oeni. The approaches of the project
are: the development of a chip for the application of the microarray technology and the use of Reverse
Transcription- quantitative PCR (RT-qPCR) technique for validation of the data obtained.
The second year of PhD is aimed to the study of the gene expression using different culture media to identify
possible differentially expressed genes with particular attention to the genes related to the main metabolic
pathways, genes related to stress response and the production of undesired metabolites.
In this work a procedure is described for selection and validation of reference genes to employ in the study of
rehydration of a O. oeni commercial starter in two different rehydration media.
Selezione di geni di riferimento per la normalizzazione dei dati in studi di quantitative
RT-PCR in Oenococcus oeni
Il progetto di dottorato incentrato sullanalisi dell espressione di Oenococcus oeni. Si intendono seguire due
approcci: lo sviluppo di un chip per lapplicazione della tecnologia microarray e lutilizzo della tecnica Reverse
Transcription- quantitative PCR (RT-qPCR) per la validazione dei dati ottenuti.
Nel secondo anno di dottorato si vuole studiare lespressione utilizzando diversi mezzi di coltura al fine di
individuare possibili geni differenzialmente espressi, ponendo particolare attenzione ai geni correlati alle
principali vie metaboliche, ai geni relativi alla risposta allo stress e alla produzione di metaboliti indesiderati.
In questo lavoro si vuole descrivere la selezione e la validazione di geni di riferimento da utilizzare in uno studio
sulla reidratazione di uno starter commerciale di O. oeni in due mezzi diversi.

Key words: RNA, Oenococcus oeni, RT-qPCR, Housekeeping/ reference genes, gene expression
1. Introduction
Gene expression analysis has become increasingly important in biological research.
Normalization is important in real-time qRT-PCR analysis because of the need to compensate for intra- and
inter-kinetic RT-PCR variations (Bustin 2004). Such variations may be due, for example, to the difference in
amount of starting material between the samples, RNA integrity, cDNA sample loading variation, or difference
in RT efficiency.
The most frequently used approach in real time PCR is to normalize the expression level of specific mRNA of
interest against that of one or more reference gene. The expression of the genes used for normalization in real-
time PCR experiments should remain constant under all the different conditions tested; otherwise, it can lead to
erroneous results; in fact if inappropriate reference genes are used for normalization, the experimental results
obtained can differ greatly from those using a validated reference gene.
In this study we report the validation of housekeeping genes to identify the most suitable internal control gene
for normalization of real-time PCR data in Oenococcus oeni during rehydration of dry preparations. Using three
distinctive algorithms: Bestkeeper (Pfaffl et al., 2004); geNorm (Vandesompele et al.,2002) and Norm Finder
(Andersen et al., 2004) a total of ten reference genes were analyzed in two different rehydration media.
Commercial starter O. oeni MLD strain (Lallemand) was used in this study. It was rehydrated using two different
rehydration media: distilled water and MRS broth (VWR).
0.1 g of dry starter was resuspended in 2 mL rehydration medium, vortexed for 10s and incubated at 30C
(according to manufacturers instructions). Samples were taken at time 0 and then at 5, 10, and 20 min. Each
sample was instantaneously frozen in liquid nitrogen.
RNA extraction was carried out using a commercial kit (Agilent technologies). RNAs were diluted to a
concentration of 50 ng/!l before performing the reverse transcription with the Iscript select cDNA synthesis kit
(Biorad). qPCR reactions were performed with iCycler (Biorad) using SybrGreen supermix (Biorad).
Ten reference genes were tested: lactate dehydrogenase (ldh), RNA polymerase beta subunit (rpoB), DNA
polymeraseI (dpo), D alanyl-alanine synthetaseA (ddl), DNA gyrase subunit B (gyrB), transketolase (tkt), DNA
polymeraseIII (dpoIII), dnaG primase (primG), phosphoglucomutase (pgm), purine biosynthesis
15
th
230
15
th
phosphoribosylaminoimidazole carboxylase II (purK). Specific primers were designed on these sequences found
in geneBank. PCR data were analyzed with Bestkeeper, geNorm and Norm Finder.
RNA extracted had a good quality. All the primer tested were specific, this was verified by melting curve
analysis. The gene purK amplified very late in the experiments (ct 35) so it was excluded in the subsequent
studies.
As described, the expression stability of the analyzed genes was estimated by three different statistical
approaches.
The first analysis on raw Ct values of each gene was performed using the software BestKeeper (Pfaffl et al.,
2004); genes showing high variance between the analyzed samples should be avoided as controls. In this
approach the standard deviation (SD) and the coefficient of variance CV for each gene were computed to allow
for a straightforward assessment of the most suitable reference genes that had a narrow Ct range over all the
conditions analyzed. The authors suggest to consider only the genes having a SD lower than 1. In this study all
the considered genes were good candidates (fig.1).

ldh rpoB dpo ddl gyrB tkt dpoIII primG pgm
HKG 1 HKG 2 HKG 3 HKG 4 HKG 5 HKG 6 HKG 7 HKG 8 HKG 9
geo Mean [CP] 20,58 24,27 18,48 21,02 19,80 23,64 21,11 24,04 19,33
ar Mean [CP] 20,58 24,28 18,49 21,03 19,80 23,65 21,12 24,05 19,33
min [CP] 19,60 23,10 17,60 20,40 18,90 22,40 20,40 23,40 18,60
max [CP] 21,50 25,40 19,50 21,90 20,90 24,90 22,60 24,50 20,50
std dev [ CP] 0,48 0,51 0,39 0,33 0,50 0,59 0,43 0,25 0,34
CV [% CP] 2,31 2,09 2,11 1,55 2,51 2,48 2,05 1,06 1,78
Fig. 1. Bestkeeper analysis showing the variability of the studied reference genes.
In the second and third approaches the stabilities among the samples of the candidate reference genes were
evaluated by the software programs geNorm, version 3.4 (Vandesompele et al.,2002) and NormFinder
(Andersen et al., 2004) according to the author's recommendations. For both programs raw Ct values were
transformed to relative quantities.
The results obtained from geNorm analysis indicated that ddl and gyrB genes were the most stable genes.
The analysis performed with NormFinder gave as the best candidate ddl gene.
The present research represents the first screening aimed to the identification and the validation of reference
genes for gene expression studies in O. oeni, in particular for qRT-PCR analyses.
Results obtained with the three different methods were ranked and the three best candidate genes resulted ddl,
primG and pgm.
In literature the works aimed on this matter are very few. Some authors used ldh gene (Desroche et al., 2005;
Olgiun et al., 2009) as internal control in RT-qPCR studies but after the study presented in this work it was
shown that there are better candidate genes.
We consider that the genes evaluated in this study will be very useful for future applications in gene expression
analysis of target gene of particular interest during O. oeni rehydration phase.
4. References
Andersen CL, Jensen JL, rntoft T F (2004) Normalization of Real-Time Quantitative Reverse Transcription-
PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization,
Applied to Bladder and Colon Cancer Data Sets, Cancer Res 64 5245-5250
Bustin SA (2004) Quantification of Nucleic Acids by PCR In: A-Z of Quantitative PCR. Bustin SA, editor. La
Jolla: International University Line, pp. 546.
Desroche N, Beltramo C, Guzzo J (2005) Determination of an internal control to apply to RT-qPCR to study
stress response in the lactic acid bacterium Oenococcus oeni. J Microbiol Meth 60: 325-333.
Olgiun N, Borbons A, Reguant C (2009) Influence of ethanol and pH on the gene expression of the citrate
pathway in Oenococcus oeni. Food Microbiol 26: 197-203
Pfaffl MW, Tichopd A, Prgomet C, Neuvians T P. (2004) Determination of stable housekeeping genes,
differentially regulated target genes and sample integrity: BestKeeper Excel-based tool using pair-wise
correlations. Biotechnology Letters 26: 509-515
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. (2002) Accurate
normalization of qRT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3:
research0034.
15
th
231
15
th
Volatile markers of Extra Virgin Olive Oil quality and typicality
Dorotea Anna Della Medaglia (dellamed@unina.it)
Department of Food Science, University of Naples Federico II, Naples, Italy
Tutor: Prof. Raffaele Sacchi
In accordance with the PhD thesis project, this poster reports the main results of the HS-SPME-GC/MS analysis
of aroma compounds in EVOOs and the first results by PLS data processing by sensory and instrumental
analysis. The analysis of sensory and GC/MS data could allow to find some possible molecular markers to
identify and protect the typicality of Protected Denomination of Origin (PDO) extra virgin olive oils. Some
typical aromas in VOO from traditional varieties could be enhanced through the modulation of agronomic and
technological practises, to obtain PDO olive oils with improved and controlled sensory quality.
Composti volatili marcatori della qualit e tipicit dellolio extra vergine di oliva
In conformit con il progetto di tesi di dottorato, questo poster riporta i risultati principali dell'analisi HS-SPME-
GC/MS dei composti responsabili dellaroma dellolio extra vergine di oliva ed i primi risultati ottenuti
dallanalisi PLS dei dati sensoriali e strumentali. L'analisi sensoriale ed i dati GC/MS potrebbero consentire di
identificare possibili markers molecolari per individuare e proteggere la tipicit degli oli extra vergini di oliva a
denominazione di origine (DOP). Alcuni aromi tipici di variet autoctone potrebbero essere enfatizzati attraverso
la modulazione delle pratiche agronomiche e tecnologiche, per ottenere oli extra vergini di oliva DOP con una
migliore e controllata qualit sensoriale.

Keywords : extra virgin olive oil (VOO), PDO, sensory quality, volatile compounds, SPME-GC/MS.
1. Introduction
Virgin Olive Oil (VOO) is a lipid fruit juice obtained from fresh olive fruits, by means of purely mechanical
and physical processes. VOO is unique among edible vegetable oils because of its antioxidant properties, its
delicious taste and aroma and its key-role in Mediterranean food habits. The aroma of VOO is attributed to
aldehydes, alcohols, esters, hydrocarbons, ketones, furans, terpenes, phenols and other as yet unidentified
volatile compounds. The major volatile compounds reported in virgin olive oils are the C6 and C5 compounds,
deriving from the lipoxygenase pathway and correlated with positive flavour (Angerosa et al., 2004; Luna et al.,
2006). In accordance with the PhD thesis project, this poster reports the main results of the HS-SPME-GC/MS
analysis of aroma compounds in VOOs and the first results obtained by PLS processing of sensory and
instrumental analysis data.
Protected Denomination of Origin (PDO) oils and oils from traditional Italian olive varieties were collected at
the Department of Food Science (Portici, Naples) during the 2008/09 and 2009/10 seasons. Sensory evaluation
was carried out by a trained panel according to the EC method (EEC Reg. 2568/91 and its updates). The volatile
compounds were evaluated by HS-SPME-GC/MS analysis. Statistical multidimensional evaluation of the data
(Partial Least Square, PLS) was performed using the software XLSTAT 2007 (Addinsoft, Paris, France).
HS-SPME-GC/MS analysis of oil. The volatile compounds were extracted and concentrated by SPME with a
50/30 mm DVB-CAR-PDMS fibre (Supelco, Bellefonte, USA) and analyzed by a GC/MS system (Vichi et al.,
2003). The desorbed compounds were separated on a Shimadzu gas chromatograph (QP5050A) with mass
spectrometer detector (E.I. 70eV) (Shimadzu, Milan, Italy) equipped with a Supelcowax TM 10 (Supelco,
Bellefonte, USA). Compounds identification was based on comparison of their mass spectra of the NIST mass
spectra library search. Quantification was carried out using Isobutyl Acetate as internal standard.
The sensory profiles of extra virgin olive oils produced in geographical areas corresponding to some Protected
Denomination of Origin (PDO) and of monovarietal VOOs obtained from traditional Italian olive varieties
showed some typical sensory notes like tomato, spices (rosemary, oregano, etc), bitter almond,
artichoke (data not shown). In Figure 1 some examples of SPME GC/MS chromatograms are reported. Clear
differences can be observed among GC/MS profiles for many aldehydes, alcohols and terpenoids. A typical
VOO from the PDO Bruzio showed an abundance of C6 alcohols (hexanol and trans-2-hexenol) and the
relevant presence of beta-linalool (Fig. 1a). The PDO Penisola Sorrentina VOOs, obtained from the Minucciola
15
th
232
15
th

olive variety and characterized by the spices sensory notes, are mainly differentiated by the presence of
limonene, eucalyptol and other terpenoids (Fig. 1d). Oils characterized by the sensory notes of tomato (coming
from the Ravece and Biancolilla olive variety) showed a high amounts of cis-3-hexenal (Fig. 1b e 1c). In Figure
2 the PLS performed on volatiles and sensory data of VOOs obtained from Ravece, Ortice, Rotondella, Coratina,
Munucciola Cassanese and Tonda olive varieties is showed. Ravece samples appear related to cis-3-hexenal and
tomato flavour. Only Minucciola samples appear related to terpenoid compounds (D-limonene, eucalyptol, beta-
phellandrene, beta-pinene). Cassanese samples, characterized by the sensory notes of green grass and sweet,
appear related to several C6 compounds resulting from the lipoxygenase pathway.

4. Conclusions
The analysis of sensory and GC/MS data could allow to find some possible molecular markers of typicality of
Protected Denomination of Origin (PDO) extra virgin olive oils. The identification of the key-molecules linked
to peculiar sensory attributes could also allow to enhance some characteristic oil aromas through the modulation
of agronomic and technological practices to obtain a product with improved sensory quality. Moreover, a
suggestive hypothesis comes from these preliminary data and observations. It is well known that plants respond
to arthropods with an induced emission of volatiles such as green leaf volatiles and terpenoids. These herbivore-
induced plant volatiles can attract predators and parasites. The combination of eco-physiological and sensory
studies, could contribute to understand not only the indirect plants defence functions and the interactions
between variety and environment conditions, but also the basis of the sensory typicality.
5. References
Angerosa F, Servili M, Selvaggini R, Taticchi A, Esposito S, Montedoro G (2004) Volatile compounds in virgin
olive oil: occurrence and their relationship with the quality. Journal of Chromatography A 1054: 17-31.
European Economic Community Regulation 2568/91, Off. J. Eur. Communities 1991, L 248.
Luna G, Morales MT, Aparicio R (2006) Characterization of 39 varietal virgin olive oils by their volatile
compositions. Food Chem. 98:43-252.
Vichi S, Castellote AI, Pizzale L, Conte LS, Buxaderas S, Lpez-Tamames E (2003) Analysis of virgin olive oil
volatile compounds by headspace Solid-Phase MicroExtraction coupled to gas chromatography with mass
spectrometric and flame ionization detection. Journal of Chromatography A 983: 19-33.
Figure 2 Partial Least Square (PLS) performed on volatiles
and sensory data.

b
c
a
d
Figure 1 SPME GC/MS chromatograms of the headspace of some oils:
a) PDO Bruzio, b) Biancolilla variety (Sicily), c) Ravece variety (PDO
Irpinia-Colline dellUfita), d) Minucciola variety (PDO Penisola
Sorrentina). Peak identification of the main volatile compounds: 7)
ethanol, 15) 3 pentenone, 19) hexanal, 20) beta-pinene, 21) beta-
phellandrene, 22) trans-2-pentenal, 23) beta-myrcene, 24) cis-3-
hexenal, 25) D-limonene, 26) 3-methyl butanol, 27) Eucalyptol, 28)
trans-2-hexenal, 30) beta-ocimene, 31) n-hexyl acetate, 36) cis-3-
hexenyl acetate, 41) hexanol, 42) trans-3-hexenol, 43) cis-3-hexenol,
46) trans-2-hexenol, 52) beta-linalool.

15
th
233
15
th
Influence of rootstock on aroma profile and sensory characters of
honeydew melon (Cucumis melo L. var. inodorus).
Dima G. (gdima@unime.it)
Dept. Organic and Biological Chemistry, University of Messina, Italy
Tutor: Prof. Antonella Verzera
Firstly, an analytical HS-SPME-GC-MS method was developed for the extraction and analysis of the aroma
volatile compounds in honeydew melon fruits; thus, the method was applied to samples obtained from plants
grafted on different rootstocks previously selected for disease resistance, productivity and fruit quality and
qualitative and quantitative results were obtained. Sensory analysis was performed, too. Secondly, all the data
were statistically elaborated to verify the influence of rootstocks on aroma profile and sensory characters. Our
results aligned well with those of agronomic performance and disease resistance allowed to select the rootstock
most interesting for grafting melon applications.
Influenza del portainnesto sul profilo aromatico e sulle caratteristiche sensoriali del
melone honeydew (Cucumis melo L. var. inodorus).
E stato sviluppato un metodo HS-SPME-GC-MS per lestrazione e lanalisi dei costituenti volatili responsabili
dellaroma del melone; il metodo, applicato a frutti di Cucumis melo L. var. inodorus ottenuti da piante innestate
su diversi portainnesti, precedentemente selezionati per resistenza a malattie, produttivit e qualit dei frutti, ha
consentito di ottenere interessanti dati qualitativi e quantitativi. Gli stessi campioni sono stati sottoposti ad
analisi sensoriale. Tutti i dati, elaborati statisticamente per verificare linfluenza dei portainnesti sul profilo
aromatico e sulle caratteristiche sensoriali, supportati da quelli agronomici e di resistenza alle malattie,
consentono di selezionare il portainnesto pi idoneo in termini di resistenza, di produttivit e qualit dei frutti.

Key words: Cucumis melo L., rootstocks, aroma compounds, sensory analysis.
1. Introduction
This PhD thesis research project is aimed to assess the influence of rootstocks, previously selected for disease
resistance, productivity and fruit quality (Crin et al. 2007) on aroma profile and sensory characteristics of
honeydew melon (Cucumis melo L. var. inodorus) fruits. An analytical HS-SPME-GC-MS method was firstly
developed for the extraction and analysis of the aroma volatile compounds which allowed to obtain qualitative
and quantitative results; quantitative results are important since the aroma contribution of a particular substance
is assessed by knowledge of the ratio between its amount and odour threshold level. Even if melon volatiles have
been widely studied using different extraction technique also including SPME only semiquantitative data,
expressed as peak area or percentages (Obando-Ulloa et al., 2008), or obtained by a single external standard
(Beaulieu, 2005), are reported in literature. Sensory analysis was, thus, performed on the melon fruits; all the
data both chemical and sensorial were submitted to statistical elaboration in order to verify the grafted melons
which were more similar to those of the plants grown on their own roots. Information on agronomic performance
and disease resistance and chemical and sensory data, altogheter considered, allowed to selected the rootstock
most interesting for grafting melon applications.
Honeydew melon samples grafted on the following rootstocks (5 interspecific hybrids of Cucurbita maxima L. x
Cucurbita moschata L. and 2 genotypes of melon) were considered. The plants were grafted and cultivated in an
experimental field located in Pachino, Sicily (Italy); rootstocks have been breed or selected by ENEA (Agency
for New Technologies, Energy and the Environment) for disease resistance. The fruits were collected in July
2008, transported to the laboratory under low temperature and immediately analysed. All the analysis were
carried out in duplicate. A HS-SPME-GC-MS method was optimized and validated in terms of linearity,
precision (intraday repeatability and intralaboratory reproducibility studies), detection and quantification limits
for aroma volatile constituents (Verzera et al., submitted to Food Anal. Chem.). The sensory profile was
constructed following UNI 10957, 2003. Chemical and sensory data were submitted to ANOVA, Duncans
multiple-range test and PCA (Statgraphic Plus soft. ver. 5.1).

15
th
234
15
th
Figure 2 Principal component (PC)
analysis of chemical and sensory data.

Table 1 Qualitatively parameters of the analysed melon fruits (average values).In brackets rootstock information.
Rootstocks
w
1
.
(g)
l. d.
2
(cm)
e.d.
3

(cm)
ep.
th.
4
(cm
)
pulp
th.
5
(cm
)
l. d.seeds
cavity
6
(c
m)
e. d. seeds
cav.
7
(cm)
TSS
8
(Brix)
TA
9

(%)
Incas (ungrafted) 2,51 20,9
3
15,9
5
1,15 3,33 14,05 6,23 15,40 1,21
Energia (Cucumis melo)
Cucumis melo
2,58 20,2
8
16,4
0
1,10 3,50 13,27 6,58 14,15 1,23
Sting (Cucumis melo) 2,5 21,1
3
15,8
2
1,05 3,87 13,68 5,87 15,22 1,33
Polifemo (C. maxima x C. moschata) 2,79 21,5
7
16,5
8
1,10 3,73 14,03 6,67 14,30 1,11
Elsi (C. maxima x C. moschata) 2,47 21,0
3
16,0
3
1,03 3,78 13,53 6,15 14,13 1,30
AS 10 (C. maxima x C. moschata) 2,84 22,0
8
16,5
0
1,15 3,93 14,50 6,23 16,02 1,46
P 360 (C. maxima x C. moschata) 2,43 20,5
7
16,0
0
1,18 3,55 13,03 6,32 13,20 1,21
RS 841 (C. maxima x C. moschata) 2,49 20,4
0
15,8
3
0,97 3,50 13,60 6,08 14,95 1,07
1
weight;
2
longitudinal and
3
equatorial diameter;
4
epicarp thickness;
5
pulp thickness;
6
longitudinal and
7
equatorial diameter seeds
cavity;
8
soluble solid (Brix);
9
acidity.

The developed method made possible to identify and quantify a large number of compounds (forty-one) which
are well-known as fruit volatile constituents (Figure 1). Alcohols and aldehydes containing a straight nine-carbon
chain dominate the volatile profile, in agreement with the literature data (Perry et al, 2009). Sensorial and
chemical data were statistically processed (PCA: 46,3% of total variance for PC1, 16.1% for PC2 and 10.6 for
PC3- Figure 2); the variables, volatile constituents and sensory descriptors, most strongly correlated with each
principal components, seem to be in agreement if the odour of each substance is considered. From the chemical,
agronomical and disease resistance data, the rootstock RS841 were resistant to race 1,2 F. oxysporum f. sp.
melonis, was the best genotypes capable of significantly improving the productivity (RS 841 8,14, Incas,
ungrafted 7.05 Kg fruit m
-2
)

with a positive effects on fruit quality (TA% and TSS) but also showed a similar
aroma volatile composition and sensory profile. This information are essential in determining the potential use of
the different rootstock in grafting applications.

1= carbon disulfide; 2= dimethyl sulfide; 3= propanal; 4= 2-methylpropanal; 5= ethyl acetate; 6= 3-methylbutanal; 7= 2-methylbutanal; 8= ethanol; 9= methyl butanoate; 10=
methyl-2-methyl butanoate; 11= ethyl butanoate; 12= ethyl 2-methyl butanoate; 13= hexanal; 14= !-pinene; 15= 1-penten-3-ol; 16= heptanal; 17= limonene; 18= 2-methyl-
1-butanol; 19= (E)-2-hexenal 20= octanal; 21= ethyl heptanoate; 22= 6-methyl-5-hepten-2-one; 23= 1-hexanol; 24= nonanal; 25= ethyl octanoate; 26= 1-octen-3-ol; 27= (Z)-
6-nonenal; 28= furfural; 29= 2-ethyl-1-hexanol; 30= benzaldehyde; 31= (E)-2-nonenal; 32= 1-octanol; 33= (Z,Z)-2,6-nonadienal; 34= methyl benzoate; 35= methyl benzoate;
36= (Z)-3-nonen-1-ol; 37= (Z)-6-nonen-1-ol; 38= (Z,Z)-3,6-nonadien-1-ol; 39= methyl dodecanoato; 40= geranyl acetone; 41= benzyl alcohol.
4. References
Beaulieu JC (2005) Within-season volatile and quality differences in stored fresh-cut cantaloupe cultivars J. Agric. Food
Chem. 53: 8679-8687.
Crin P, Lo Bianco C, Rouphael Y, Colla G, Saccardo F, Paratore A (2007) Evaluation of rootstock resistance to Fusarium
wilt and gummy stem blight and effect on yield and quality of a grafted inodorus melon. Hort. Sci. 42(3): 521-525.
Perry PL, Wang Y, Lin J (2009) Analysis of honeydew melon (Cucumis melo var. inodorus) flavour and GCMS/MS
identification of (E,Z)-2,6-nonadienyl acetate Flavour Frag. J. 24: 341-347.
Obando-Ulloa JM, Moreno E, Garca-Mas J, Nicolai B, Lammertync J, Monforte AJ, Fernandez-Trujillo JP (2008) Aroma
volatiles associated with the senescence of climacteric or non-climacteric melon fruit. Posth. Biol. Technol. 49, 2737.
Scacco A, Lanza CM, Mazzaglia A, Tripodi G, Dima G, Verzera A. (2010) Correlation between Aroma Compounds and
Sensory Properties of Passito Malvasia Wines Produced in Sicily. Am. J. Enol. Vitic. 61:2:260-265.
Verzera A, Dima G, Tripodi G, Ziino M, Lanza CM, Mazzaglia A Fast quantitative determination of aroma volatile
constituents in melon fruits by headspace-solid-phase microextraction and gas chromatography-mass spectrometry
(submitted to Food Analytical Methods).
Figure 1 HS-SPME-GC-MS chromatogram (TIC) of an
honeydew melon sample.

15
th
235
15
th
Individualization and Characterization of Oxidative Degradation Products of
Secoiridoids in Virgin Olive Oil by Innovative Analytical Techniques
Ilona Di Maio (ilonadimaio@libero.it)
Dept. Economic and Food Sciences, University of Perugia, Italy
Tutor: Prof. Maurizio Servili

The aim of this research is the characterization of the oxidation products of several hydrophilic phenols of virgin
olive oil (VOO), such as hydroxytyrosol (3,4-DHPEA), tyrosol (p-HPEA) and dialdehydic form of decarboxymethyl
elenolic acid linked to 3,4-DHPEA (3,4-DHPEA-EDA) and, their identification in the product during storage. This
work is aimed at finding analytical indicators that can be used both as molecular markers of VOO freshness and
for the evaluation of the shelf life of the product itself. Two oxidation systems were examined for the oxidation of p-
HPEA, 3,4-DHPEA and 3,4-DHPEA-EDA: enzymatic oxidation and Fenton oxidation. Reaction products were
identified as quinones, dimers, and acids.
Individuazione e caratterizzazione dei prodotti di degradazione ossidativi dei secoiridoidi
contenuti nellOlio Vergine di Oliva mediante tecniche analitiche innovative
Lo scopo di questo lavoro di tesi la caratterizzazione dei prodotti di ossidazione di diversi fenoli idrofili contenuti
nellolio vergine doliva come idrossitirosolo, tirosolo e la forma dialdeidica dellacido decarbossimetil elenolico
legato allidrossitirosolo e, la loro identificazione nel prodotto durante la conservazione. Lobiettivo della ricerca
trovare degli indici analitici che possono essere usati sia come marker di freschezza dellolio vergine di oliva sia
nella valutazione della shelf life del prodotto stesso. Due sistemi di ossidazione sono stati usati per ossidare le
molecole sopracitate: ossidazione enzimatica e ossidazione di Fenton. I prodotti di ossidazione sono stati identificati
come chinoni, dimeri e acidi.

Key words: Virgin olive oil; oxidation; phenol; antioxidants.
1. Introduction
In accordance with the PhD thesis project described in the Gantt chart, this poster reports the main results concerning
the following activities:
(A2) Enzymatic oxidation and Fenton oxidation of phenolic standards such as 3,4-DHPEA, p-HPEA and 3,4-
DHPEA-EDA;
(A4) Individualization and characterization of enzymatic and Fenton reactions oxidation products by LC-MS and
LC-MS/MS.
(A5) LC-MS confirmation of 3,4-DHPEA oxidation products in rectified oil with 3,4-DHPEA previously added.
Reagents. Reagents used in this study were supplied as follows: 3,4-DHPEA by Cayman Chemical LTD (USA), p-
HPEA, 3,4-Dihydroxyphenylacetic acid, FeSO
4
7H
2
O, H
2
O
2
30%, Ammonium acetate and Acetic acid by Sigma-
Aldrich (Milan, Italy), Tyrosinase from mushroom (EC 1.14.18.1), HPLC grade methanol and water by Fluka
(Milan, Italy).
Phenolic Extraction. The phenolic extract of virgin olive oil from drupes of Coratina cultivar was obtained
following the procedure described in a previous paper (Montedoro et al., 1992).
Preparative HPLC Separation of 3,4-DHPEA-EDA.
The HPLC system used was composed of a Varian chromatograph equipped with a Pursuit XRs 5u C-18 250x10 mm
semipreparative column coupled with a Varian diode array detector working in the UV region of the electromagnetic
spectrum; furthermore a sample loop of 200 L capacity was used. The peak corresponding to 3,4-DHPEA-EDA
was recovered using a Gilson Model 201 fraction collector.
Samples. Rectified oil was purchased from MONINI SPA (Perugia, Italy). Free acidity and PV were 0.23 and 2.0
(mequiv of O
2
/Kg) respectively.
Rectified oil autoxidation. Rectified oil (60 g), which had 3,4-DHPEA (15.0 mg/Kg) added previously, was put in a
glass vessel and kept in a heater for several days at 60C. Every 5 days, Peroxides Value was performed according to
15
th
236
15
th
the official method of European Commission (European Community, Commision Regulation 1989/2003 of 6
November 2003 amending Regulation No. 2568/91). The phenolic extract obtained from the oily matrix was
analysed by HPLC-ESI-MS to confirm 3,4-DHPEA oxidation products (Lerma-Garca et al., 2009).
The oxidation of p-HPEA, and 3,4-DHPEA (data for 3,4-DHPEA-EDA are in progress) was monitored over time by
liquid chromatography coupled to UV-Vis diode array and ESIMS detection. Spectral data and fragmentation
patterns for starting materials and oxidation products are summarized in Table 1 and 2.

Table 1 Retention Times, UV Absorbance Maxima, MS and MS/MS ESI negative Fragmentation Patterns of starting materials
and enzymatic oxidation products.
major fragments ESI negative
Peak Compounds name t
r
(min) _
max
(nm) [M - H]
-
[M + 2H2O ]
-
[M + CH3COOH]
-
[M + CH3OH]
-
Product ionScanExperiments
1 p-HPEA
a
19,0 222/276 137 197 137_ 119_ 106
2 3,4-DHPEA
a
14,8 219/278 153 153_ 123
3 quinone of 3,4-DHPEA
b
12,1 217/254/400 151 151_ 133_ 123_ 122
4 dimer of quinone-p-HPEA
b
28,6 217/267/435 288 324 320 288_ 151; 288_ 137*
5 dimer of quinone-quinone
b
27,5 208/260/346 303 302_ 284_ 272_ 254_ 223_ 162_ 151_ 122_ 121
6 dimer of quinone-quinone
b
31,5 210/262/343 303 302_ 284_ 272_ 254_ 223_ 162_ 151_ 122_ 121
8 dimer of quinone-3,4-DHPEA
b
35,2 218/255/289 304 304_ 153_ 123
304_ 151; 304_ 153*
17 oxidationproduct of 3,4-DHPEA 7,0 224/278 169 169_ 151_ 123
20 3,4-dihydroxyphenylacetic acid
a
16,8 217/280 167

a
Identified by comparison with standard compounds.
b
Tentatively identified by PIS and
*
SRM experiments.

Table 2 Retention Times, UV Absorbance Maxima, MS and MS/MS ESI positive/negative Fragmentation Patterns of starting
materials and Fenton oxidation products.
` major fragments ESI positive
Peak Compounds name
t r (min) _max (nm) [M+H]
+
[M-OH]
+
Product ion Scan Experiments
9 unknown 17,3 217/268/384 305
10 unknown 19,2 217/295/365 344 327 344 _ 327 _ 283 _ 177_ 133
11 unknown 21,0 weak 388 371
12 unknown 22,6 217/280/363 432
13 unknown 24,0 weak 476 459
14 unknown 25,4 weak 525
21 oxidation product of 3,4-DHPEA 12,8 weak 217
major fragments ESI negative
Peak Compounds name t
r
(min) _max (nm) [M - H]
-
[M + CH3COOH]
-
Product ion Scan Experiments
1 p-HPEA
a
19,0 222/276 137 197 137 _ 119 _ 106
2 3,4-DHPEA
a
14,8 219/278 153 153 _ 123
3 quinone of 3,4-DHPEA
b
12,1 217/254/400 151 151 _ 133 _ 123 _ 122
5 dimer quinone-quinone
b
27,5 208/260/346 303 302 _ 284 _ 272 _ 254 _ 223 _ 162 _ 151 _ 122 _ 121
6 dimer quinone-quinone
b
31,5 210/262/343 303 302 _ 284 _ 272 _ 254 _ 223 _ 162 _ 151 _ 122 _ 121
15 unknown 26,2 218/249/439 605
16 unknown 27,4 weak 649
17 oxidation product of 3,4-DHPEA 7,0 224/278 169 169 _ 151 _ 123
18 oxidation product of 3,4-DHPEA 12,0 weak 163
19 oxidation product of 3,4-DHPEA 13,8 218/282 167 167 _ 149 _ 123
22 oxidation product of 3,4-DHPEA 15,8 219/278/326 207

a
Identified by comparison with standard compounds.
b
Tentatively identified by PIS experiments.
4. References
Montedoro GF, Servili M, Baldioli M, Miniati E (1992) Simple and hydrolyzable phenolic compounds in virgin olive oil. 1. Their
extraction, separation, and quantitative and semiquantitative evaluation by HPLC. J Agric Food Chem 40: 1571-1576.
Lerma-Garca MJ, Herrero-Martnez JM, Sim-Alfonso EF, Lercker G, Cerretani L (2009) Evaluation of the oxidative status of
virgin olive oils with different phenolic content by direct infusion atmospheric pressure chemical ionization mass
spectrometry. Anal Bioanal Chem 395: 1543-1550.

15
th
237
15
th
Shelf-life optimization of the orange fruit and juice (cv. Belladonna)
Giuseppina Dorato (gdorato@unirc.it)
Dept. of Biotechnologies for Agricultural Food and Environmental Monitoring
Mediterranean University of Reggio Calabria, Italy
Tutor: Prof. Vincenzo Sicari

Co-tutor: Prof. Angelo Maria Giuffr

After the standard orange fridge-storage, a complete characterization of the juice was effectuated, assessing
bioactive compounds tendency by the time, in order to obtain results that can be tools for quality improvement.
The concerned parameters were: acidity, formol index, soluble solids, flavonoids, ascorbic acid, total
polyphenols antioxidant capacity of juices obtained from native oranges stored in frigorific chamber at 6C and
80% of Relative Umidity (RH) assessing their progress in the time.
Ottimizzazione della shelf-life del frutto e del succo di arancia (cv. Belladonna)
A partire dalla frigo-conservazione standard delle arance, sar eseguita una caratterizzazione completa del succo
valutando landamento dei composti nutraceutici nel tempo, per ottenere risultati che possano essere strumento
di miglioramento della qualit.
Sono state determinate lacidit, lindice di formolo, i solidi solubili, i flavonoidi, lacido ascorbico, i polifenoli
totali e la capacit antiossidante, di succhi ottenuti di arance autoctone conservate in cella frigorifera a 6C a
80% di umidit relativa valutandone landamento nel tempo.

Key words: Orange fruit, bioactive compounds, shelf-life.
1. Introduction
During fridge storage, a series of pathologic manifestations that have chemico-physical origin- happen inducing
the loss of the qualitative characteristic those make the product suitable for consumption (Davis et al., 1973).
The present poster represents the main results of the first part of the research activity:
(A1) Evaluation of pH, acidity content and formol index and solids soluble content.
(A2) Evaluation of polyphenol content, antioxidant capacity as DPPH, ascorbic acid content and flavonoids
content.
Belladonna cultivar oranges were harvested in March, 2010 at Villa San Giuseppe in the Reggio Calabria
province (South Italy), they were immediately stored in a frigorific chamber at 6C and 80% of RH and were
subjected to physico-chemical analysis intended to the principle qualitative parameters evaluation.
Each week, the above cited analyses have been repeated on the juice obtained from orange squeezing, evaluating
parameters tendency during the time and according to fruits storage temperatures.
The following analyses have been effectuated: soluble solids, total acidity, formol index, antioxidant capacity
(expressed as DPPH), total polyphenols, ascorbic acid, total flavonoids (Davis Method), flavanones glucosidic
(HPLC method). Particularly, the content of soluble solids was measured by the refractometric method and
expressed as Brix (percentage of sugar content), total acidity, formol index, ascorbic acid (vitamin C), total
flavonoids (Davis Method), glucosidic flavanones (HPLC method) were determined according to the official
methodologies of the International Federation of Fruit Juice producers, (IFU), total polyphenols were determined
according to the colorimetric method Folin-Ciocalteu (FC), (Singleton et al., 1999), antioxidant capacity was
determined according to the method of Brand-Williams et al. (1995).
Juice composition characteristics are reported in table 1 and 2.
According to the obtained results, all chemical parameters remained almost constant during fruits storage. It can
be noted a slight degradation even after prolonged storage periods, except for the values reported in table 2.
As regard to flavonoids and ascorbic acid tendency, it is clear that while ascorbic acid oxidative degradation
appears to be modest even after prolonged storage periods (ascorbic acid content decreased from 540,28 to
498,06 mg/L during 42 days of storage at 6C). We found a slight decrease in the total flavonoids concentration,
unlike for singular flavonoids. We also found an abrupt decrease of narirutin, varying from an initial value of
371 mg/kg to 35 mg/kg in the juice after just seven days of storage, even under refrigeration. Instead, a reverse
tendency can be observed for the hesperidins as it vary from an initial value of 68 mg/kg, to reach after seven
days of storage a value of 131 mg/kg, and 377 mg/kg at the test made in the thirtieth day.
15
th
238
15
th

This can be explained, such as polyphenols present in citrus juice (mainly hesperidins and narirutin) have a
marked protective effect against ascorbic acid (Miller and Rice Evans, 1997). In other words, in the presence of
oxidative stress, the phenolic fraction is oxidized first, protecting, within certain limits, ascorbic acid.
Antioxidant activity values present a quite constant tendency in the juice obtained from squeezing oranges stored
under refrigeration. This tendency can be explained by the fact that oxidation is slowed by flavonoids antioxidant
activity, which in turn play a role in defending against vitamin C that continues to mark its antioxidant activity
throughout the whole fruits storage period.
Table 1
Days

pH
TTS
(Brix)
Titratable
acidity (g/L of
citric acid
anidro)
Titratable acidity
(g/L of citric acid
idrate)
Formol index (g/L)
0 3.250.02
g
12.60.03
e
11.400.02
c

12.470.01
c

18.430.04
c

7 3.490.02
b
13.00.00
d
8.340.05
g

9.130.03
g

18.730.53
b

14 3.390.01
e
13.30.10
c
10.090.02
f

11.040.01
f

17.780.01
d

21 3.320.02
f
14.00.00
a
11.790.01
a

12.890.01
a

17.120.01
e

28 3.450.02
c
13.80.10
b
11.630.02
b

12.720.01
b

19.820.01
a

35 3.420.02
d
12.50.00
f
10.440.02
e

11.420.00
e

15.640.01
f

42 3.610.02
a
13.30.00
c
10.580.01
d

11.570.01
d

17.640.01
d

Sign. ** ** **
** **

Table 2
Days
Flavonoids (mg/Kg)
Total
Flavonoids
(mg/L hesp)
narirutin. hesperidin.
Ascorbic acid
(mg/L)
Total poliphenols
(mg/L)
Antioxidant
capacity
(-OD
-3
min
-1

g dm
-1
)

0 3711.00
a
681.00
f
540.281.38
a
13117.51
c
2.460.20
a
139225.145
a

7 351.00
e
1311.00
c
522.686.76
b
128526.29
c
1.60.17
c
10501.000
e

14 271.15
f
1711.00
b
493.204.12
c
15957.07
a
1.640.62
c
9871.000
f

21 421.00
c
1111.00
d
505.4912.51
c
128331.56
c
2.40.57
a
10711.000
d

28 401.00
d
991.00
e
505.835.20
c
145617.69
b
2.220.25
a
11261.000
c

35 581.00
b
3771.00
a
475.3016.80
d
14252.00
b
1.740.26
b
12591.000
b

42 341.00
e
581.00
g
498.060.00
c

Sign. ** ** ** ** n.s. **
Changes in main chemical parameters of orange juice during storage at 6C and 80% RH. *Significance at P<0.05;
**Significance at P<0.01; n.s. not significant. Means in each column with the same letter do not differ significantly according
to Duncan's multiple range test. Data are the means of three replicates. Values are means S.D.
4. References
Brand-Williams W, Cuvelier ME, Berset C, (1995) Use of a free radical method to evaluate antioxidant activity.
Lebensm Wiss U Technol 28: 25-30.
Davis PL, Roe B, Bruemmer J, (1973) Biochemical changes in citrus fruits during controlled atmosphere
storage. J Food Sci 38: 225-229.
IFU, Methods of Analysis and Microbiological Methods. Website: http://www.ifu-fruitjuice.com/ifu-methods
Miller N J and Rice-Evans C A, (1997) The relative contributions of ascorbic acid and phenolic antioxidants to
the total antioxidant activity of orange and apple fruit juices and blackcurrant drink. Food Chem 60: 331-
337.
Singleton VL, Orthofer R, Lamuela-Raventos RM, (1999) Analysis of total phenols and other oxidation
substrates and antioxidant by means of Folin-Ciocalteu reagent. Methods Enzymol 299: 152-178.
15
th
239
15
th
Free and hidden fumonisins in corn: occurrence and masking mechanism
Claudia Falavigna (claudia.falavigna@nemo.unipr.it)
Department of Organic and Industrial Chemistry, University of Parma, Parma, Italy
Tutor: Dott.ssa Chiara DallAsta, Prof. Gianni Galaverna

In this study the behaviour of hidden fumonisins during gastrointestinal digestion and their masking mechanism
in raw maize were investigated. Firstly, an in vitro gastrointestinal digestion model has been applied to raw
maize samples and maize-based product to evaluate the bioaccessibility of fumonisins in the small intestine and
the probable release of masked forms from matrix due to enzymatic activity. Afterwards, masking mechanism
has been studied by fit-for-purpose modification of the same experimental assay, in order to identify which
macromolecules in corn are able to interact with target compounds.
Fumonisine libere e mascherate nel mais: incidenza e meccanismo di mascheramento
In questo lavoro sono stati studiati il comportamento delle fumonisine nascoste durante la digestione
gastrointestinale e i meccanismi coinvolti nel loro mascheramento. Inizialmente campioni di mais grezzo e
prodotti a base di mais sono stati sottoposti ad esperimenti di digestione gastrointestinale in vitro al fine di
valutare la bioccessibilit delle fumonisine nel piccolo intestino e la possibile liberazione delle forme nascoste
dovuta allattivit enzimatica. In un secondo momento, stato studiato il meccanismo di mascheramento
utilizzando i medesimi esperimenti allo scopo di individuare quali frazioni del mais sono in grado di interagire
con le fumonisine e la forza dellinterazione stessa.

Key words: hidden fumonisins, bioaccessibility, in vitro digestion model, masking mechanism.
1. Introduction
Hidden fumonisins are forms that easily escape conventional techniques of analysis since they are covalently or
not-covalently linked with various food macroconstituents (Galaverna et al. 2009). Such compounds are
detectable only through the application of a hydrolysis step and could be released from food matrix during
technological treatments or digestion, thus exerting a toxic effect. This poster reports the main results
concerning:
- The application of an in vitro digestion model on raw maize and maize based product to evaluate the
hidden fumonisins bioaccessibility in small intestine after digestion.
- The experiments performed in order to investigate the masking phenomenon in corn.
2. Material and methods
The in vitro digestion assay used for the present study was based on Versantvoort et al. (2004). The preparation
of digestive artificial juices (saliva, gastric juice, duodenal juice and bile) was performed according to the
original protocol. The digestion started by adding 3 ml saliva to 2 g of ground sample. After 5 min 6 ml gastric
juice were added and the mixture was incubated for 2 hours. Finally, 6 ml duodenal juice, 3 ml bile and 1 ml
bicarbonate solution (1 M) were added simultaneously to the mixture and a final incubation step of 2 hours was
performed. During the in vitro digestion, the mixture was stirred by a magnetic stirrer and temperature was
maintained at 37C. At the end of the experiment the digestion tubes were centrifuged, yielding the chyme (the
supernatant), in which the concentration of fumonisins was determined after a desalting step through Sep-Pak
C18 cartridges prior to LC-ESI-MS/MS analysis. LC-ESI-MS/MS analyses were performed as reported by
DallAsta et al (2009).
3.1. In vitro digestion of raw maize samples and maize-based products
The digestion assay was firstly applied to some maize samples. The results were compared with those achieved
by a common extraction procedure and also with those obtained through the application of an alkaline hydrolysis
step on matrix ( Figure 1 Comparison between the data obtained through in vitro digestion with those achieved
by a common extraction procedure and after an hydrolysis step.

15
th
240
15
th

Figure 1 Comparison between
the data obtained through in
vitro digestion with those
achieved by a common
extraction procedure and after
an hydrolysis step.

As shown, total FBs after digestion are higher than those found by the conventional analysis. The results are
rather similar to those obtained after hydrolysis: these data show that the enzymes present in the gastrointestinal
tract are likely able to destroy the interaction between fumonisins and the matrix, thus releasing the masked
forms. Afterwards, the digestion protocol has been applied to several maize-based product in order to evaluate
the probable bioaccessibility of fumonisins in the small intestine. The levels of total FBs after digestion have
been compared with those referred to extractable fumonisins, showing that the amount of contaminants available
for intestinal absorption is generally higher than that estimated by a common techniques (Figure 2 In vitro digestion
of maize-based product: bioaccessibility of hidden fumonisins after gastrointestinal digestion.

Figure 2 In vitro
digestion of maize-based
product: bioaccessibility
of hidden fumonisins
after gastrointestinal
digestion

3.2. Recovery experiments from raw maize, corn starch and corn zein
In order to investigate the role of corn macromolecules in masking phenomenon, recovery experiments of target
compounds from blank raw maize, corn starch and corn zein were performed. After spiking with FB1 at the
same contamination level (2 !g/g), each sample underwent to the routine extraction for extractable fumonisins
and to the digestion assay for total FBs determination. Each experiment was performed in duplicate and the
blank matrices were checked also in the digestion assay in order to avoid overestimation due to the occurrence of
hidden fumonisins. Results are reported in Table 1. As first observation, both starch and zein are able to hide
fumonisins but, while FB1 can be recovered after starch digestion, in the case of zein even the enzymatic
treatment is capable to release the masked fraction. This observation suggests that the masking phenomenon is
mainly ascribable to the proteic fraction. Moreover, the data obtained strongly support the hypothesis of an
associative masking mechanism since spiked samples have been incubated at room temperature, thus covalently
interactions have been not encouraged.
Table 1 Recovery data obtained after spiking blank raw maize, corn starch and zein.
Blank Raw maize Corn starch Corn zeins
Spiking level (ppb) - 2000 2000 2000
Extractable FBs (ppb) n.d. 952 84 1702 258 693 193
FBs after digestion (ppb) n.d. 1598 192 2215 56 595 15
4. References
Galaverna G., DallAsta C., Mangia M., Dossena A., Marchelli R. (2009). Masked Mycotoxins: an Emerging
Issue for Food Safety, Czech J. Food Sci. 27, S90-S92.
Versantvoort C.H.M., Oomen, A.G., Van de Kamp, E., Rompelberg, C.J.M., Sips, A.J.A.M. (2005).
Applicability of an in vitro digestion model in assessing the bioaccessibility of mycotoxins from food,
Food Chem. Toxicol. 43, 3140.
DallAsta C., Mangia M., Berthiller F., Molinelli A., et al. (2009). Difficulties in fumonisin determination: the
issue of hidden fumonisins. Anal. and Bioanal. Chem. 395, 13351345.
0
10000
20000
30000
40000
1 2 3 4
C
o
n
c
e
n
t
r
a
t
i
o
n

(
p
p
b
)
Extractable FBs Total FBs after hydrolysis Total FBs after digestion
0.00
500.00
1000.00
1500.00
2000.00
2500.00
3000.00
C
o
r
n

F
l
a
k
e
s

A
C
o
r
n

F
l
a
k
e
s

B
C
o
r
n

F
l
a
k
e
s

C
C
o
r
n

F
l
a
k
e
s

D
C
o
r
n

F
l
a
k
e
s

F
C
o
r
n

F
l
a
k
e
s

G
C
o
r
n

f
l
o
u
r

A
C
o
r
n

f
l
o
u
r

B
C
o
r
n

f
l
o
u
r

C
C
o
r
n

f
l
o
u
r

D
C
r
a
c
k
e
r
s

A
C
r
a
c
k
e
r
s

B
C
h
i
p
s

1
C
h
i
p
s

2
P
a
s
t
a

C
o
n
c
e
n
t
r
a
t
i
o
n

(
p
p
b
)
Extractable FBs Total FBs afer digestion
15
th
241
15
th
Evaluation of the Phthalate contamination in packaged meals
Evelina Fasano (evafas@libero.it)
Dept. Food Science, University of Naples, Portici, Italy
Tutor: Prof. Renata Cocchieri Amodio

The PhD thesis research project regards the detection of DEHP and DBP in foodstuffs and meals from a catering
industry in Naples to study the phthalate contamination and the role of the packaging process. In according to the
scheme proposed last year the sampling, the preparation of analytical samples, the analytical method correggere
dimensione carattere

Valutazione dei livelli di ftalati in pasti confezionati
Questo progetto di dottorato riguarda la ricerca ed il dosaggio del DEHP e del DBP in alimenti ed in pasti pronti
preparati presso un centro cottura della Provincia di Napoli, indagando sui livelli di contaminazione e sul ruolo
svolto dal confezionamento. Secondo lo schema elaborato durante il primo anno di dottorato, sono stati effettuati
il campionamento, la preparazione analitica dei campioni, la messa a punto del metodo e una prima serie di
determinazioni analitiche.

Key words: DEHP, DBP, foodstuffs, packaged meals.

1. Introduction
This study is aimed to evaluate the levels of contamination of DEHP and DBP in foodstuffs and in packaged
ready meals since the packaging of the meals can be a source of PAE contamination as suggested by the studies
by Tsumura et al., 2001 and 2002.
This poster shows the results about the foressen activities concerning the sampling, the preparation of analytical
samples, the optimization of analytical method and the first food analyses. In particular:
- Sample collection. It was carried out in a catering industry that prepares meals for nursery and primary
schools in Naples, where meal packages consisted in aluminium dishes thermal weld by an aluminium/PET foil.
- Analysis. The analytical method (Tsumura et al., 2001) was optimized by LOD and LOQ and the recovery
evaluations. DEHP and DBP detections were carried out on foodstuffs and, partially, on ready meals before and
after packaging.

2.1 Sampling
In according to initial program the sampling was carried out from November 2009 to February 2010. Each food
used in training meals was sampled twice, and because every week (five days) the menu changed, four diverse
weekly meals were collected during one month. In this way, almost 60 food samples and about 60 serving
portions, before and 60 after packaging, were obtained.
About foodstuffs (pasta, rice, potato dumpling, legumes, fish, vegetables, meat, oil, milk and cheese), an
adequate amount was put in glass jars and transported to laboratory. 200 g of each food were homogenized,
aliquotated (5 g) and, if perishable, lyophilized.
About meals, that were composited by first course, second course and vegetables (Tab.1), they were collected
before (T0) and after packaging (T1). About T0 samples, they were put in glass jars and carried to laboratories,
where they were codified, homogenized, aliquots of 5 g and then freeze dried. Besides for the packaged meals
were sampled the dishes, that were put in a caulk bag to simulate time and temperature of conferring to schools.
When the time was achieved the dishes were opened, the weight was signed and the sample was homogenized,
aliquotated (5 g) and than lyophilized until analyses.
Table 1. Typical composition of the diet sampled.

Packaged Servings Characteristics

first course Pasta or rice with different tomato sauce (cooked ham and
mushroom, olives and capers etc..) or legumes or vegetables; potato
dumpling; gateau.
second course Meat, fish products, dairy products and different cold cuts
vegetables Pea, potatos, carrots, spinachs, green beans, maize.
15
th
242
15
th

2.2 DEHP and DBP detection
The PAEs are ubiquitarius, so during each phase of the study many precautions were adopted. During the
sampling foods were put into glass jars cleaned with n-hexane and acetone to remove possible PAE residuals, all
glassware using in laboratory were clean up accurately also with n-hexane and acetone. During analyses a blank
was carried out together with samples and the blank value was detracted; all chemicals were a special grade to
avoid residue contamination.
Table 2. DEHP and DBP levels on ng/g (mean sd, median and range) in foodstuffs.

PAEs
FOODSTUFFS
mean sd median
(min-max)
DEHP 52.3559.77 25.04
(5.00-205.67)
DBP 20.3523.64 8.70
(7.50-127.90)

The calibration curves were made using DEHP and DBP standard solutions at three different levels, 2.5, 5.0 and
10 !g/ml for DEHP and 1.25, 2.5 and 5.0 !g/ml for DBP. Almost 20 blanks, obtained submitting to the
analytical procedure only the reagents, were analyzed and LOD and LOQ values were obtained considering the
LOD as mean of blank+3sd of blank values; LOQ as mean of blank+10sd of blank values.
In this way LODs were 5.0 ng/g for DEHP and 7.5 ng/g for DBP, while the LOQs were 15.0 ng/g for DEHP and
22.5 ng/g for DBP.
To evaluate accuracy and validity of the method, the recoveries of DEHP and DBP from various spiked foods
and meals were assessed. As certified matrixes to do PAEs recovery dont exit, some samples, representative of
different foodstuffs and serving portions, were submitted to analytical procedures. This includes extraction of the
lipidic fraction with acetonitrile, clean up by column chromatography with florisil, bondesil and anhydrous
Na
2
SO
4
and detection by capillary gas chromatography with flame ionization (GC/FID) (Tsumura et al., 2001).
Foods and meals with lowest DEHP and DBP levels were contaminated with 1 ml of DEHP and DBP standard
solution at three different levels of concentration (10.0, 20.0 and 40.0 !g/ml for DEHP; 5.0, 10.0 and 20.0 !g/ml
for DBP). The recoveries were 80.33.5% for DEHP and 102.8 4.4% for DBP.

The first results obtained about ingredient analyses are showed in Tab. 2. DBP values in these foods were always
lower than DEHP levels. The range of values for two contaminants was much wide, in fact, DEHP levels varied
from 5.00 (frozen spinaches and tomato) to 205.67 ng/g (frozen green beans); while for DBP, they varied from
7.50 (frozen spinaches, carrots and pumpkin, tomato, milk, cheese and egg) to 127.90 ng/g (dried lentils).
However, the medians levels were always lower than maximum value obtained, in particular they were 25.04
ng/g and 8.70 ng/g for DEHP and DBP, respectively.
Analyses about meals sampled before and after packaging will be developed by using the above mentioned
method.

4. Further study
In the next months the study, at first, will regard the analysis of sampled meals.
By study of results obtained it will be possible know the levels of contamination of DEHP and DBP in foods
most consumed using as ingredients to have a knowledge about levels of contamination by PAEs in the principal
food categories.
Statistical analysis of meal results will carry out, so it will be possible to value differences in PAE concentrations
in meals before and after packaging, to value if the process influence the levels of DEHP and DBP in the meals.
Besides among first course, second course and vegetables it will possible evaluate if the DEHP and DBP trend of
accumulation is different and can depend by foods matrix analyzed.

5. References
Tsamura Y, Ishimitsu S, Saito H, Kobayashi Y, Tonogai Y (2001) Eleven phthalate esters and di(2-ethylhexyl)
adipate in one-week duplicate diet samples obtained from hospitals and their estimated daily intake. Food
Addit Contam, 18:44960.
Tsamura Y, Ishimitsu S, Kaihara A, Yoshii K, Tonogai Y (2002) Phthalates, Adipates, Citrate and some of the
other plasticizers detected in Japanese retail fodds: a survey. Journal of Health Science 48 (6):493502.

15
th
243
15
th
Modelling cake performances as a function of fat quantity and quality
Ilaria Ferrari (ilaria.ferrari@unimi.it)
Dipartimento di Scienze e Tecnologie Alimentari e Microbiologiche, Universit degli Studi di Milano, Italy
Tutor: Prof. Margherita Rossi
Co-tutor: Prof. Mara Lucisano

The aim of this PhD thesis is to study the technological role of fats in bakery products, developing the possibility
of enhancing healthy properties without compromising quality and shelf-life of the final product. In this first
phase, the effects of the quantity and quality of fat on cake performances were modelled and an optimized
formulation was chosen. Furthermore, the relation between palm olein content and slip melting point of fat
blends was studied.
Modellazione delle propriet di un prodotto tipo cake: effetto di quantit e tipo di grasso
L'obiettivo di questo progetto di dottorato lo studio del ruolo tecnologico dei grassi nei prodotti da forno,
sviluppando la possibilit di migliorarne le propriet salutistiche senza alterare la qualit finale del prodotto e la
sua conservabilit. In questa prima fase, stata effettuata una modellazione degli effetti di quantit e tipo di
grasso nella produzione di un alimento tipo cake; stata poi scelta una formulazione ottimizzata. Inoltre stata
studiata la relazione tra contenuto di oleina di palma e punto di scorrimento delle miscele di grasso.
1. Introduction
Fat is a key ingredient in cake formulations, as it contributes to textural, nutritional and sensory properties of the
product. In the literature, impact of lipids on cake characteristics by a systematic approach has not yet been
studied. In the present poster, in accordance with the PhD thesis project previously scheduled (Ferrari, 2009), the
main results of the modelling of the effect of fat quantity and quality on cake performances are reported.
Reference cake formulation was: 37% soft wheat flour type 00 (Molino Quaglia, PD), 22% pasteurized liquid
whole egg product (Cascina Italia, BG), 22% white granulated sugar (Sdzucker, Manheim, D), 18% butter
(Galbusera, LC), 1% baking powder (PaneAngeli, BS). In the experimental formulations, butter was replaced by
blends of refined palm oil and bi-fractionated palm olein (IGOR, BS). Fat blends were produced with different
palm olein/palm oil ratios, and their slip melting points (SP) were measured (NGD, 1989). For their preparation,
blends (700 g per batch) were heated to 48C and poured into a scraped surface chilling unit (Simac 5000) for
crystallization. The material was extracted from the chilling unit when T = T
SP
15C and gently stirred in a
mixer (Hobart, USA) at 20C for 5 min. Crystallized fats were stored at 20C in a closed container until use.
For the preparation of cakes, fat and sugar where whipped in a mixer (Hobart, USA) for 8 min; then whole egg
product was added and mixed for 5 min. After replacing the whip with a flat beater, premixed dry ingredients
(flour and baking powder) were added and mixed for 5 min. The batter was put in plum-cake moulds (250 g
each) and baked in a forced convention oven (Moretti, PU) for 30 min at 180C (15C).
To study the effect of the quantity and quality of fat in cakes, a two-factor, five level central composite design
(CCD) was used. The two factors considered were quantity of fat (from 9 to 27%) and percentage of olein in the
fat blend (from 50 to 85%); fat quantity was varied maintaining constant proportions among the other
ingredients. Cakes produced in each of the 13 runs resulting from the CCD (Table 1) were analyzed for weight
loss after baking, moisture content, water activity, volume, height, densitometric and morphologic characteristics
by image analysis, colour and texture, as reported by Mariotti (2004). Data were analyzed by response surface
regression method for a second order polynomial model. An overall desiderability function was also constructed
as multi-objective optimization (Alamprese, 2007). CCD generation, data analysis and optimization were
performed using Design Expert 8 (Stat Ease Inc., USA).
Table 1 Fully randomized experimental order with fat (% in batter) and olein (% in fat blend) levels.
Run Order 1 2 3 4 5 6 7 8 9 10 11 12 13
Fat (%) 30.7 5.3 18 18 18 9 18 18 18 27 18 27 9
Olein (%) 67.5 67.5 42.7 67.5 92.2 85 67.5 67.5 67.5 50 67.5 85 50

15
th
244
15
th
0
5
10
15
20
25
30
35
40
45
0 20 40 60 80 100
Olein (%)
S
l
i
p

m
e
l
t
i
n
g

p
o
i
n
t

(
C
)
y = 38.42 (3.48e-05)x
3
R
2
=0.96

! experimental points
" predicted equation
- - - conf. interval (95%)
Results of the analysis of effects carried out on experimental data are shown in Table 2.
Table 2 Analysis of effects (fat
% in batter; olein % in fat blend)
for selected responses. NS stands
for not significant.

It can be noticed that fat quantity had a more significant effect on cake performances than olein content. Both fat
quantity and quality reduced cake consitency: in particular, a higher fat quantity resulted in a softer cake but with
lower specific volume, whereas olein content had no significant influence on cake volume (Figure 1).

Figure 1 Response surfaces for (left) cake specific volume (cm
3
/g) and (right) load at 25% strain (N).
In order to identify a cake formulation optimised for texture and volume characteristics, a desiderability function
was constructed, following specifications reported in Table 3, chosen on the basis of results obtained by the
reference formulation produced with butter.
Table 3 Desiderability function values and weight for each variable considered.
Response variable Aim Lower Target Upper Weight
Specific Volume (cm
3
/g) Target 2.18 2.23 2.28 1
Load at 25% strain (N) Minimize 5.5 / 10 1

The identified optimum corresponds to a formulation containing 19.7% fat at 92% olein (desiderability = 0.87).
Concerning fat blends characteristics, an interesting relation between slip melting point and olein content was
observed (Figure 2).

Up to 40% olein, SP is barely affected; on the contrary, at
higher olein contents, small olein increases definitely
lower SP values. This means that relatively low olein
contents cannot destabilize the structure of high melting
triglycerides deriving from palm oil.

Figure 2 Experimental and predicted values of slip melting
points depending on olein content.

4. References
Alamprese C, Datei L, Semeraro Q (2007) Optimization of processing parameters of a ball mill refiner for
chocolate. J Food Eng 83: 629636.
Ferrari I (2009) Study of the technological and functional role of fats in bakery products using a modellistic
approach. In Proc.s of the 14
th
Technology. Oristano (Italy), September 16-18, 2009, pp. 403-405.
Mariotti M (2004) Valorizzazione tecnologica di avena e grano saraceno. PhD Thesis, University of Milan, Italy.
NGD (1989) Determinazione del punto di scorrimento in capillare aperto. Method Db 11.

Moisture
content
Specific
Volume
Young
modulus
Load at 25%
strain
Fat
- - -
(p<0.001)
- -
(p<0.01)
- - -
(p<0.001)
- - -
(p<0.001)
Olein NS NS
-
(p<0.05)
-
(p<0.05)
15
th
245
15
th

Survival of Saccharomyces cerevisiae var. boulardii cells microencapsulated

Mariangela Gallo (m.gallo@unifg.it)
Department of Food Science, University of Foggia, Italy
Tutor: Dott.ssa Maria Rosaria Corbo

The purpose of this study was to assess the survival of Saccharomyces cerevisiae var. boulardii
microencapsulated in sodium alginate, dipped in a CaCl
2
(0.5%) solution and stored at different temperatures (4-
15 and 30C). The data showed that the encapsulation yield was 50-80% and cell concentration remained at
values higher than 6 log

CFU/g for more than 100 days. Thus, the capsules proposed in this paper could be used
successfully as a carrier of Sacch. cerevisiae var. boulardii to be released in appropriate places.

Sopravvivenza di cellule di Saccharomyces cerevisiae var. boulardii microincapsulate

Lobiettivo del presente studio stato quello di valutare la sopravvivenza di cellule di Saccharomyces cerevisiae
var. boulardii microincapsulate in alginato di sodio, immerse in una soluzione di CaCl
2
(0,5%) e stoccate a
differenti temperature (4-15 e 30C). Dai dati ottenuti stata osservata unefficienza di incapsulazione del 50-
80% ed una concentrazione cellulare superire a 6 log

CFU/g, per tutta la durata della sperimentazione (100
giorni). Quindi, le capsule oggetto di questo studio possono essere usate con successo come carrier di Sacch.
cerevisiae var. boulardii per il suo rilascio nei siti appropriati.

Key words: microencapsulation, sodium alginate, capsules, Saccharomyces cerevisiae var. boulardii.

1. Introduction

Microencapsulation has been defined as a technology of packaging solid, liquid and gaseous active ingredients in
small capsules that release their contents at controlled rates over prolonged periods of time (Champagne and
Fustier, 2007). Microcapsules dimension are: size 1 !m-2 mm, thickness 0.1-200 !m and weight of the
membrane 3-30% of total weight. Several methods of microencapsulation have been reported: spray drying,
extrusion, emulsion and phase separation. Microencapsulation of microorganisms in a gel matrix of alginate is
the most common system of immobilization reported and was used for biotechnological purposes (Kailasapathy,
2002). This technology protects the microorganisms from environmental stresses, extends the cores shelf life
and provides a sustained and controlled release (Kailasapathy, 2002; Rokka and Rantamaki, 2010).
Saccharomyces cerevisiae var. boulardii is the only probiotic yeast, used in many countries both as preventive
and therapeutic agent for diarrhea and other gastrointestinal disorders (Czerucka et al, 2007).


Sacch. cerevisiae var. boulardii ATCC MYA-796 (America Type Culture Collection) was used in this study.
Before each assay, the strain was grown in YPD broth incubated at 30C for 12, 24 or 48 h.
Cell cultures (20 ml) were centrifuged at 3,000 rpm for 10 min; then, the supernatant was discarded and 20 ml of
sterile distilled water were added to the pellet. The beads were prepared as follows: 18 ml of cell suspension
were added with 2 g of Na-alginate (Fluka, Milan, Italy) and mixed gently for 1-2 min. Then, the gel was
manually extruded through a sterile 50-ml-syringe and the capsules (ca. 2x3 mm) dipped in a CaCl
2
solution
(0.5%) (J.T. Baker, Milan, Italy) for ca. 5 min and then air-dried for 30 min on blotting paper.
Both cell suspensions (cell in distilled water) and alginate beads were analyzed for the evaluation of
encapsulation yield or encapsulation efficiency (EY). In particular, 5 g of beads were diluted with 45 ml of a
sterile saline solution (0.9% NaCl) and homogenized through a laboratory blender at 15.000 rpm for 5 min; then,
the homogenates and cell suspensions were serially diluted in the saline solution and the viable count evaluated
through the pour plate method on YPD agar and incubated at 30C for 48 h. The analyses were performed on
two independent batches; for each batch, the experiment were performed in duplicate.
EY was evaluated as follows (eq. 1):

eq. (1)

where N
bead
(cfu/g) and N
suspension
(expressed as cfu per gram of solution) are respectively the viable counts in the
beads and in cell suspension.
100 *
!
!
"
#
$
$
%
&
=
suspension
bead
N
N
EY
15
th
246
Alginate beads were stored at 4-15 and 30C and analyzed periodically for the evaluation of the viable count.
The experiments, for each assay, were performed on two independent batches through the pour plate method on
YPD agar incubated at 30C for 48 h.
The data of the determination of the viable cells microencapsulated were modeled with the equation of Geeraerd
et al (2000), through the software GInaFiT (Geeraerd et al, 2005):
( ) ( )
( )
( ) [ ] ( )
res res
N
t k SL k
SL k
t k N N N +
! ! +
! ! =
max max
max
max 0
exp 1 exp 1
exp
exp
eq. (2)
where: N is the dependent variable (population number) expressed as log(CFU/g); N
0
, the initial population
number (log(CFU/g)) and N
res
is the residual cell concentration; k
max
, the maximal death rate (log(CFU/g)/day);
SL, the shoulder length (the time before the beginning of the exponential death rate) and t, the time (days).


In the first step the efficiency of the method proposed in this study was evaluated. The efficiency was defined by
the parameter EY (encapsulation yield) and was calculated using the exponential values of cell counts. It was 50-
80%; Graff et al (2008) reported an efficiency of ca. 50% for alginate microsphere containing Sacch. cerevisiae
var. boulardii. Thus, EY of the system proposed in this work can be considered as good and fits with the values
reported in the literature. In the second step, the variables under investigation were the age of cell cultures (12,
24 or 48 h) and the viability of cells entrapped in the microcapsules; as an example, figure 1 shows the viability
of microencapsulated cells, produced from 12 h-culture and stored at 4C. The model was able to fit
satisfactorily the data, as the regression coefficient was 0.951, thus it underlines the significance of kinetic
parameters. In this picture, the shoulder length (SL) was ca. 30 days; then, cell trend experienced a phase of
exponential death, with a decrease of cell number from 7.24 to 6.27 log CFU/g, followed finally by a tail phase
for the entire running time. Cells produced from cultures of 24 and 48 h and then microencapsulated showed a
similar kinetic, with a significant difference in the initial phase, as they did not show a SL (data not shown). In
conclusion, the results of this paper showed at least 3-key-points: a) the microencapsulation of Sacch. cerevisiae
var. boulardii in sodium-alginate is efficient; b) this method could assure a cell number of the probiotic at
interesting levels (i.e. at least 6 log CFU/g) for more than 100 days; c) it is possible to control the death of
entrapped cells through the age of the culture used for strain reviving, as the use of a 12 h-culture assured a
prolonged SL. Thus, the data results agree with the expected ones and the original PhD thesis project can
proceed without any substantial amendment.

4. References

Champagne CP, Fustier P (2007) Microencapsulation for the improved delivery of bioactive compounds into
foods. Curr Opin Biotech; 18:184-90.
Czerucka D, Piche T, Rampal P (2007) Review article: yeast as probiotics Saccharomyces boulardii. Aliment
Pharmacol Ther 26:767-778.
Kailasapathy K (2002) Microencapsulation of probiotic bacteria: technology and potential applications. Curr
Issues Intest Microbiol; 3:39-48.
Geeraerd AH, Herremans CH, Van Impe JF (2000) Structural model requiremens to describe microbial
inactivation during a mild heat treatment. Int J Food Microbiol 59:185-209.
Geeraerd AH, Valdramidis VP, Van Impe JF (2005) GInaFiT, A freeware tool to assess non-log-linear microbial
survivor curves. Int J Food Microbiol 102:95-105.
Graff S, Hussain S, Chaumeil JC, Charrueau C (2008) Increased intestinal delivery of viable Saccharomyces
boulardii by encapsulation in microspheres. Pharmaceut Res Vol, 25, No 6.
Rokka S, Rantamaki P (2010) Protecting probiotic bacteria by microencapsulation: challenges for industrial
applications. Eur Food Res Technol; 231:1-12.

Figure 1. Viability of the Sacch.
cerevisiae var. boulardii cells,
microencapsulated in beads of the
sodium alginate and storage at 4C
(pre-culture of the 12 h).

15
th
247
15
th
Purification and Characterization of Chitinase Isoforms
from Manzoni Bianco Grape Juice
Diana Gazzola (diana.gazzola@unipd.it)
CIRVE, University of Padua, via XXVIII Aprile 14, Conegliano (TV), Italy

As first step to develop a method alternative to bentonite fining to prevent protein haze-formation in white
wines, chemical-physical characteristics of single purified heat unstable wine proteins were preliminarily
studied. In this paper, attention has been paid to chitinases which have been recently described as the protein
components most susceptible to precipitation during storage of white wines.
Purificazione e caratterizzazione di isoforme di chitinasi in mosto Manzoni Bianco
Come primo passo per individuare un metodo alternativo al trattamento con bentonite per prevenire gli
intorbidamenti proteici nei vini bianchi, sono state studiate preliminarmente le caratteristiche chimico-fisiche
delle singole proteine purificate dal vino responsabili della formazione di torbidit. In questo lavoro, maggiore
attenzione stata posta nei confronti delle chitinasi che recentemente sono state descritte come i componenti del
vino maggiormente suscettibili alla precipitazione durante la conservazione dei vini bianchi imbottigliati.

Key words: Grape proteins, Chitinases, Grape juice, Electrophoresis, Glycol chitin.
1. Introduction
The problem of protein haze formation in white wines is still unsolved, despite wine hazing could be a serious
quality defect because consumers perceive hazy wines as faulty products.
Protein haze is caused by the presence of relatively low concentrations (from 15 to 300 mg L
-1
) of pathogenesis-
related (PR) proteins, namely thaumatin-like proteins and chitinases (Ferreira et al., 2002; Waters et al., 2005).
Chitinases are the most represented protein components in grape juice (over 50% of the total protein content,
Waters et al., 1998) and also the most active in causing wine turbidity (Falconer et al., 2010; Marangon et al.,
2010). Chitinases survive the winemaking process and remain in the finished wine, being stable at acidic pH and
resistant to proteolytic enzymes, as most of the PR proteins (Waters et al., 1996). Moreover, their isolation,
separation and characterization is a difficult task due to their low concentration and strong interaction with
endogenous polyphenols and other non-protein compounds (Ferreira et al., 2002).
According to the first objective of the PhD thesis, focused on the study of single purified proteins involved in
white wine haze-formation, this poster presents the purification and characterization of chitinase isoforms from
Manzoni Bianco grape juice. This preliminary basic research is needed for further investigations about the role
played in wine by ionic strength, sulphate, temperature fluctuations, pH and redox potential in the aggregation of
wine chitinases (in part underway).
Extraction of grape juice proteins: 15 kg of Manzoni Bianco grapes (vintage 2008) were crushed and treated
with 7.5 g kg
-1
polyvinylpolypyrrolidone, 15 g 100 kg
-1
ascorbic acid and 37.5 g 100 kg
-1
potassium
metabisulfite. The grape juice (10 L) was treated with 3 g hL
-1
of pectolytic enzymes, centrifuged (5000 rpm, 20
min, 4C), dialysed (3.5 kDa cutoff) against distilled water, concentrated by ultrafiltration (3.5 kDa cut off) and
freeze dried, giving 2.6 g of protein powder. Protein separation by chromatography: chromatographic
separations were performed by an KTA purifier FPLC (GE-Healthcare) equipped with an UV detector in two
steps. The first was Anion Exchange Chromatography (AEC: Tricorn MonoQ 5/50 GE-Healthcare column),
which was followed by Hydrophobic Interaction Chromatography (HIC: HIC BioSuite TM Phenyl 10 m
column) (Van Sluyter et al., 2009). SDS-PAGE (Laemmli, 1970) was performed in both reducing and non
reducing conditions. Gels were stained with Coomassie Brilliant Blue R-250. Chitinolytic activity detection on
SDS-PAGE gels (Trudel and Asselin, 1989) was performed by incorporating glycol chitin in the gels at 0.01 or
0.05 % (w/v.). Protein identification by Mass Spectrometry: electrophoretic bands were excided, subjected to
trypsin cleavage and analyzed using a MALDI-TOF/TOF 4800 Analyzer. MS/MS data were searched using the
Mascot search engine against the MSDB database.
15
th
248
15
th
3.1 Protein separation by chromatography.
The fractionation of grape juice macromolecules (> 3.5 kDa) using AEC (Fig. 1) allowed to obtain a fraction
enriched in chitinases but still contaminated by
other proteins (not shown). By combining the
chitinase-containing peaks (CHI in Fig. 1) from
15 chromatographic runs, each starting from 50
mg of protein, a sufficient amount of freeze
dried sample was recovered. HIC of the protein
peaks CHI from AEC gave six fractions
differing in surface hydrophobicity (Fig. 2).

Fig. 1 - Fractionation of the grape juice macromolecules (> 3.5 kDa) by anion exchange chromatography (AEC).
Fig. 2 - Fractionation by hydrophobic interaction chromatography (HIC) of the protein peak CHI obtained by AEC.

3.2 Anomalous electrophoretic behaviour of chitinase isoforms in glycol chitin-containing SDS-PAGE gels.
HIC fractions were analysed by SDS-PAGE (not shown), showing to contain several protein bands, differing in
both relative mobility (Mr) and staining intensity. Bands with Mr of about 30 kDa (corresponding to those of the
grape chitinases) were detectable in fractions 3-4 and 5 (Fig. 3A). Coomassie staining of HIC fractions 3-4 and 5
in SDS-PAGE gels containing increasing amounts of glycol chitin (0.01% and 0.05%) under non reducing
conditions showed a progressive shift in the Mr of almost all the bands except for a faint band in fraction 5. The
retarding effect of glycol chitin suggests that the proteins could be chitinases (Vincenzi and Curioni, 2005).
Surprisingly the Mr shift regarded also a 50 kDa band present in both fractions. In contrast, the same samples,
analysed in reducing conditions showed the same migration pattern independently of the quantity of glycol chitin
incorporated into the gel. The disappearance of 50 kDa band in reducing conditions suggests they can be dimers
of chitinases linked by S-S bonds. All the bands showed chitinolytic activity after staining the gels (Trudel and
Asselin, 1989), confirming fractions 3-4 and 5 as being
composed exclusively of chitinases (bands at 31-34 kDa
and 50 kDa).

Fig. 3 - SDS-PAGE analysis of the proteins from HIC fractions 3-
4 and 5 under reducing (R) and non-reducing (NR) conditions.
Gels contained 0 (3A), 0.01 (3B), 0.05% (3C) glycol chitin.
Molecular weight standard proteins are in lanes M. The
arrowheads indicate the band retarded in the presence of glycol
chitin.

3.3 Bands identification by MALDI-TOF/TOF MS.
Five chitinase bands showing different Mr (from gel 0% GC) and one band (from gel 0.01% GC) whose Mr was
unaffected by glycol chitin, were analysed by MS after trypsin cleavage. All bands were found to belong to Vitis
vinifera class IV chitinases (Mascot database), corresponding to two possible isoforms (accessions O24530 and
Q7XAU6). However the low percentage of sequence coverage did not allow to assign an identification with
certainty. A reasonable hypothesis to explain the lack of differences between the isoforms is that they are
fragments with different MW deriving from the same original protein. Some partial degradation of the chitinases
could happen during juice preparation, producing fragments of different size (Waters et al., 1998). Moreover,
chitinases seem to be present in the grape juice also in the form of S-S-linked dimers, whose significance and
effects remain to be established. To clarify this aspect other analyses are now in progress.

Van Sluyter SC, Marangon M, Stranks SD, Neilson KA, Hayasaka Y, Haynes PA, Menz RI, Waters EJ (2009) J Agric Food Chem 57:
11376-11382.
Ferreira RB, Picarra-Pereira MA, Monteiro S, Loureiro VB, Teixeira AR (2002) Trends Food Sci Technol 12: 230-239.
Waters EJ, Alexander G, Muhlack R, Pocock KF, Colby C, ONeill BK, Hj PB, Jones P (2005) Aust J Grape Wine Res 11: 215-225.
Waters EJ, Hayasaka Y, Tattersall DB, Adams KS, Williams PJ (1998) J Agric Food Chem 46: 4950-4957.
Falconer RJ, Marangon M, Van Sluyter SC, Neilson KA, Chan C, Waters EJ (2010) J Agric Food Chem 58: 975-980.
Waters EJ, Shirley NJ, Wallace W, Williams PJ (1996) J Agric Food Chem 44: 3-5.
Vincenzi S and Curioni A (2004) Electrophoresis 26: 60-63.
Marangon M, Van Sluyter SC, Chan C, Waters EJ, Falconer RJ (2010) In: Book of abstract of Macrowine 2010, Torino (Italy), 2010, p. 94.
Trudel J. and Asselin A (1989) Anal. Biochem 178: 362-366.
Laemmli U.K. (1970) Nature 227: 680-685.

Manual run 3:10_UV Manual run 3:10_Cond Manual run 3:10_Fractions
0
50
100
150
200
250
mAU
0 20 40 60 80 100 120 ml
1 2 3 4 5 6 7 8 9 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 Waste
FT
TAU
LTP
P
250
200
150
100
50
0
0 20 40 60 80 100 120
Elution time (mL)
CHI
Fig. 1 Elution time (mL)
Manualrun5:10_UV Manual run5:10_Cond Manual run5:10_Conc Manualrun5:10_Fractions
Manualrun5:10_Inject
0
100
200
300
400
500
600
mAU
15.0 20.0 25.0 30.0 35.0 40.0 ml
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33
1
2
3 - 4
5
6 - 7
8
0
100
200
300
400
500
600
15 20 25 30 35 40
Fig. 2
15
th
249
15
th
An Effort to Improve the Lipid Fraction Quality of Taralli Using Extra
Virgin Olive Oil
Mariagrazia Giarnetti (mgiarnetti@hotmail.com)
Tutor: Prof. Francesco Caponio

This study regarded the possibility of increase the lipid fraction quality of taralli using extra virgin olive oil. The
data obtained pointed out that the taralli manufactured with extra virgin olive oil were significantly more
appreciated for visual appearance and odour than those manufactured with refined palm oil. Moreover, the use
of extra virgin olive oil led to significantly lower levels of the volatile oxidation compounds of the lipid fraction
than refined palm oil.
Tentativo di Miglioramento della Frazione Lipidica dei Taralli Mediante lImpiego di
Olio Extra Vergine di Oliva
Scopo del lavoro stato quello di valutare la possibilit di migliorare la qualit della frazione lipidica dei taralli
mediante luso di olio extra vergine di oliva. I risultati ottenuti hanno messo in evidenza che i taralli prodotti con
olio extra vergine di oliva risultavano significativamente pi apprezzati di quelli preparati con olio di palma
raffinato in termini di aspetto visivo ed odore. Inoltre, luso di olio extra vergine di oliva determinava livelli
significativamente pi bassi di composti volatili di ossidazione.

Keywords: Consumer test; Extra virgin olive oil; Taralli; Volatile compounds.
1. Introduction
The increased awareness towards consumer health has created growing expectations in terms of food quality
standards and safety, and nowadays big efforts are needed to improve the overall quality of products, without
affecting taste and other important characters (e.g. texture and colour) already known and appreciated by
consumers. Taralli are an traditional Apulian food. The oils typically used in taralli making are olive oil, olive-
pomace oil and refined palm oil, which are obtained by a refining process. Extra virgin olive oil, instead, which
is obtained only by mechanical means, is rarely used and, in any case, never alone but mixed with olive oil or
olive-pomace oil. The aim of this study was, therefore, to assess the quality of taralli formulated with extra
virgin olive oil, by investigating on the lipid fraction degradation and evaluating the acceptability by consumers.
Taralli were made mixing flour (1 kg), water (0.4 L), oil (0.2 kg), salt (0.02 kg), and spices (seeds of Foeniculum
vulgare, 0.005 kg). Two different trials were performed using refined palm oil (RPO) and extra virgin olive oil
(EVOO), respectively. Each trial was done in duplicate. In order to assess some critical parameters, a consumer
test (preference ranking) was performed on the products. Participants (n = 80) were selected among the people
who regularly consumed taralli (i.e., 1-3 times a week). For the ranked consumer test data, scores of 1 (most
liked) and 2 (least liked) were assigned. Statistical analysis of the consumer test data was performed according to
Basker method (Basker, 1988). Head Space Solid Phase Microextraction (HS-SPME) technique coupled with
GC-MS analysis of taralli was carried on to evaluate the presence of volatile compounds associated with
oxidation products and off-flavour phenomena. One-way ANOVA was used for compare the data of volatile
oxidation compounds.
In order to assess the effectiveness of the use of extra virgin olive oil in the dough for taralli making, a consumer
test was performed. In figure 1 the mean scores and the results of the statistical analysis of consumer test are
reported. Analysis of the data suggests that with regard to the visual appearance the taralli made with EVOO
were significantly more well-liked than those made with RPO, while for the odour the products made with
EVOO were significantly more appreciated than those prepared with RPO. Other indicators registered no
significant differences. The results emphasize that the replacement of the refined palm oil, generally used in
these kind of formulations, with extra virgin olive oil characterized by the presence of polyphenolic substances
that confers a characteristic sensory impression did not affect the structural characteristics of the product but
were also more appreciated by consumers.
15
th
250
15
th
0.0
0.5
1.0
1.5
2.0
Visual appearance
Odour
Tast e Friabilit y
Accet t abilit y
(a)
(b)
(b)
(a) (a)
A
0.0
0.5
1.0
1.5
2.0
Visual appearance
Odour
Tast e Friabilit y
Accet t abilit y
(a)
(b)
(b)
(a) (a)
0.0
0.5
1.0
1.5
2.0
Visual appearance
Odour
Tast e Friabilit y
Accet t abilit y
(a)
(b)
(b)
(a) (a)
A
0.0
0.5
1.0
1.5
2.0
Visual appearance
Odour
Tast e Friabilit y
Accet t abilit y
1
(a)
(a)
(a)
(a) (a)
B
0.0
0.5
1.0
1.5
2.0
Visual appearance
Odour
Tast e Friabilit y
Accet t abilit y
1
(a)
(a)
(a)
(a) (a)
0.0
0.5
1.0
1.5
2.0
Visual appearance
Odour
Tast e Friabilit y
Accet t abilit y
1
(a)
(a)
(a)
(a) (a)
(a)
(a)
(a)
(a) (a)
B

Figure 1 Consumer test data and statistical analysis (see section 2) of the taralli made with extra virgin olive oil (A) and
with refined palm oil (B). Indicators with the same letters are not different (p > 0.05).
The assessment of the oxidation level of an oil can therefore be made by examining some compounds deriving
from the decomposition of hydroperoxides of the main fatty acids: oleic, linoleic and linolenic acids. The HS-
SPME/GC-MS analysis of volatile fraction of taralli prepared with extra virgin olive oil and refined palm oil,
immediately after production, allowed to identify 25 different volatile compounds. With the exception of furan
derivatives, pyrazines and pyrrole derivatives, resulting from Maillard reaction (Kochhar, 1996), main volatile
compounds present in the headspace were aldehydes and ketones (Table 1).
Table 1 Mean values (!g g
-1
), standard deviation and results of statistical analysis (p < 0.05) of aldehydes and ketones
detected in taralli samples made with extra virgin olive oil (EVOO) and with refined palm oil (RPO) by means of
HS-SPME/GC-MS analysis.
Volatile compounds
a
EVOO RPO
Acetaldehyde 1.93 0.03 b 2.55 0.10 a
2-Methyl-propanal 20.96 0.16 b 29.63 0.32 a
2-Methyl-butanal 6.60 0.27 a 7.14 0.18 a
3-Methyl-butanal 23.69 0.15 a 19.73 0.20 b
2-Butenal 0.38 0.03 b 2.55 0.07 a
Hexanal 1.78 0.13 b 7.66 0.29 a
Phenylacetadehyde 1.68 0.06 b 2.18 0.05 a
2-Butanone 2.29 0.08 a 2.42 0.08 a
2,3-Butanedione 10.63 0.04 b 15.29 0.27 a
2,3-Pentanedione 2.80 0.10 b 4.68 0.17 a
Total volatile compounds 196.47 0.72 b 245.37 1.68 a
a
The relative concentrations of individual compounds were determined by normalizing the
peak area of the compounds in chromatogram with that of internal standard (1-propanol)
As shown, taralli manufactured with RPO presented generally significantly higher amounts of volatile oxidation
compounds than those prepared with EVOO. As for aldehydes, 2-methyl-propanal, 2-methyl-butanal and
3-methyl-butanal are Streckers aldehydes coming from valine, isoleucine and leucine respectively. These
aldehydes are very volatile substances and are well known to be odour active compounds, responsible for
malty/chocolate notes. Likewise, phenylacetaldehyde comes from phenylalanine and is responsible for a
honey/rose odour. Moreover, some volatile compounds, coming from lipid degradation pathway, were observed,
such as acetaldehyde and hexanal, coming from the degradation of linoleic acid, and 2-butenal resulting from
linolenic acid (Angerosa et al., 2004). Regarding ketones, 2,3-butanedione and 2,3-pentanedione are natural
byproducts of fermentation and are responsible for a butter taste; additionally, 2-butanone has a sharp, sweet
odour reminiscent of butterscotch and acetone.
In conclusion, the experimental research evinced that it is possible to use extra virgin olive oil for preparing
taralli instead of the refined palm oil frequently used, obtaining products with good sensory properties and
texture. Moreover, the HS-SPME/GC-MS have shown that the oxidation of the taralli with extra virgin olive oil
was significantly limited than the ones with refined palm oil.
4. References
Angerosa F, Servili M, Selvaggini R, Taticchi A, Esposto S, Montedoro GF (2004) Volatile compounds in virgin
olive oil: occurrence and their relationship with the quality. J Chromatogr A 1054:17-31.
Basker D (1988) Critical values of differences among rank sums for multiple comparisons. Food Techology
42:80-4.
Kochhar SP (1996) Oxidative pathways to the formation of off-flavour. In Saxby MJ (Ed) Food taints and off-
flavour, London: Blackie Academic & Professional, chapter 6
th
.
15
th
251
15
th
Changes induced by prolonged and discontinuous heat treatment on fatty
acids of frying oils
Anella Giordano (anella-g@libero.it)
Dept. Food Science and Technology, University of Naples - Federico II, Portici (NA), Italy
Tutor: Prof. Raffaele Romano

The first two activities of the PhD thesis project are described. Firstly, three lipidic matrices, with different
saturated/unsaturated fatty acid ratios (S/I), were subjected to a prolonged and discontinuous heat treatment. The
acidity, hydroperoxides concentration, total polar compounds (TPC) and acidic composition were determined.
Secondly trend of octanoic acid (C8:0) and of neo-formation trans fatty acids were studied. Trans fatty acids
showed a good correlation with TPC.
Modificazioni indotte dal trattamento termico prolungato e discontinuo sugli acidi grassi
di oli di frittura
Le prime 2 attivit del progetto di tesi di dottorato sono descritte. Sono stati sottoposti a trattamento termico
prolungato e discontinuo tre matrici lipidiche con diverso rapporto acidi grassi saturi/insaturi (S/I). Sono state
determinate l acidit, la concentrazione di idroperossidi, i composti polari totali (CPT) e la composizione
acidica. E stato studiato landamento dellacido ottanoico (C8:0) e degli acidi grassi trans di neoformazione che
hanno mostrato una buona correlazione con i CPT.

Keywords: lard, olive oil, sunflower seed oil, TPC, acidity, peroxide number, fatty acid composition
1. Introduction
In accordance with the PhD thesis project previously described this poster is based on comparison of three oils,
olive oil (S/I 0.17), lard (S/I 0.66), and sunflower oil (S/I 0.15), in order to assess the stability of a frying
medium and to identify a possible marker of the oxidation state of triglycerides correlating with TPC. Each oil
was chosen for a specific purpose. The olive oil, for its low amount of polyunsaturated fatty acids, shows a good
stability during frying. The lard with its high content of saturated fatty acids and low proportion of
polyunsaturated fatty acids could be an ideal frying medium, but its cholesterol content does not make it the most
used frying bath. Sunflower oil is the most common frying oil. In olive oil the C8:0 showed a particular trend,
firstly increased in oil extracted from potatoes, then it was the same in frying oil and in the one extracted and, at
the end of heat treatment, the C8:0 was present only in frying bath. The octanoic acid is one of the most
significant products of fatty acids oxidation so it should be considered as a possible marker. In potatoes fried in
lard the main result was the high trans fatty acids concentration and their good correlation with TPC (R
2
0.953).
Trans fatty acids could be considered as good markers because they already appeared at 8 hours of frying in all
three frying oils. In sunflower oil there was a good correlation between saturated fatty acids (SFA) and TPC
(0.903) for frying bath and a good correlation between polyunsaturated fatty acids (PUFA) and TPC (0.929) for
oil extracted from potatoes.
The three fatty matrix were subjected to a prolonged and discontinuous thermal treatment at 180C for 8 hours at
day for a total of 48 hours. Every day about 100mL of fresh oil was added to frying bath. Frozen pre-fried
potatoes were used with a solid/liquid ratio of 1:10 (2L of oil and 200g of potatoes). The total samples obtained
(thermo-oxidated oil, frying oil and oil extracted from potatoes) were stored at -20C and subjected to the
following analytical determinations: acidity (EEC, 1991), peroxide value (AOCS, 1989), fatty acid composition
(by HRGC-FID), total polar compounds (TPC) (Hein et al., 1998).
The maximum limit of 25% of TPC was exceeded in olive oil and in sunflower oil after 32 hour of thermo-
oxidation and at 48 hour in lard. TPC were not exceeded for the frying oils. The oil extracted from potatoes
showed an higher concentration of TPC. About acidic composition, the C8:0 is important in olive oil. The
octanoic acid is originated from 9-hydroperoxides of oleic, linoleic and linolenic acids that are the major
unsaturated fatty acids in edible fats and oils. This short chain fatty acid remain bound to the original
triglyceride. The C8:0 showed a good correlation (R
2
0.8426) with TPC in thermo-oxidated olive oil (Fig. 1A).
In frying bath, the C8:0 not always showed an increased trend because part of octanoic acid was absorbed by
15
th
252
15
th
potatoes. At 32
nd
hour the C8:0 concentration was similar in both oil and, at the 48
th
hour it was disappeared in
fat extracted from potatoes and was increased in frying oil (Fig. 1B)
In lard, trans fatty acids showed a good correlation (0.9531) with TPC (Fig. 2). This suggest that the trans fatty
acids should be considered as a valid marker to evaluate the thermal oxidation also because they already appear
at 8 hours of frying in all three frying oils. In sunflower oil the SFA and PUFA should be proposed as alternative
to the TPC, respectively with a correlation index of 0.9039 (Fig. 3A) and 0.9292 (Fig. 3B) in frying bath and in
fat extracted from potatoes. About other fatty acid it was showed an increase in the concentration of palmitic
acid (C16:0) and fatty acid with trans isomers versus a significant reduction of oleic and linoleic acids. In
particular, the C16:0 increases in olive oil and in lard, respectively of 27 and 9% compared with a decrease of
C18:1. In sunflower oil the C18:2n6cis was degraded for the C16:0 that was increased of 12%. The initial
research project has been confirmed for next year by expanding the program with two new matrices: palm oil
and soya beans oil and adding analysis to determine volatile organic compounds (VOCs) and neo-formation
compounds by mass spectrometry (MALDI-TOF).

Figure 1 (A) Correlation between C8:0 and TPC in thermo-oxidated olive oil. (B) The C8:0 trend in olive oil in
thermo-oxidated oil, in frying bath and in the extracted fat from potatoes.

Figure 2 Correlation between trans fatty acids and TPC in lard extracted from potatoes.

Figure 3 (A) Correlation between SFA and TPC in frying sunflower oil. (B) Correlation between PUFA and TPC in
sunflower oil extracted from potatoes.
4. References
AOCS. Official Methods and Recommended Practices of the American Oil Chemists Society. 1989; (4
th
ed.),
Vol. 1, Peroxide value. AOCS Press: Champaign, IL.
Commission Regulation (EEC) No 2568/91 of 11 July 1991 on the characteristics of olive oil and olive-residue
oil and on the relevant methods of analysis (OJ L 248, 5.9.1991, p.1).
Hein M, Henning H, Isengard HD (1998) Determination of total polar parts with new methods for the quality
survey of frying fats and oils. Talanta, 47: 447-454.
TRANS vs TPC
y = 0,0647x- 0,9121
R
2
= 0,9531
0,0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8
0 5 10 15 20 25 30
TPC %
T
R
A
N
S
C8:0 (B)
0,0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0 8 16 24 32 40 48
time (h)
%
thermo-ox. frying french fries
THERMO-OXIDATED OLIVEOIL (A)
y = 0,0107x+ 0,0272
R
2
= 0,8426
0,0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0 10 20 30 40
TPC (%)
C
8
:
0
SFA VS TPC (A)
y = 0,1772x+ 8,199
R
2
= 0,9039
0
2
4
6
8
10
12
14
0 5 10 15 20 25
TPC %
S
F
A
PUFA VS TPC (B)
y = -0,3801x+ 61,036
R
2
= 0,9292
51
52
53
54
55
56
0 5 10 15 20 25 30
TPC %
P
U
F
A
15
th
253
15
th
Proteomic and metabolomic approaches for the characterization of meat
typical products
Liberata Gualtieri (liberatagualtieri@libero.it)
Dept. Food Science, University of Naples, Federico II, Portici, Italy

The aim of the PhD thesis project is to characterize the metabolites formed during ripening of fermented meat
products, in particular to define the structural and aromatic differences between industrial product and artisanal
ones. To this aim, proteomic analysis has been carried out on sarcoplasmic fraction of Naples-type salami,
followed by metabolomic analysis of lipid and aromatic components. The analysis has been carried out at
different steps of production, from raw material (meat) to final products (salami), using a series of purification
methods through chromatographic techniques coupled to mass spectrometry.
Caratterizzazione molecolare di prodotti carnei mediante approcci proteomici e
metabolomici
Lo scopo del progetto di tesi di dottorato quello di caratterizzare i metaboliti generati durante la maturazione
dei salumi, valutando, in particolare, le differenze strutturali e del profilo aromatico tra un prodotto industriale e
uno artigianale. Lanalisi proteomica stata condotta sulla frazione proteica sarcoplasmatica del salame tipo
Napoli, poi stata effettuata lanalisi metabolomica delle componenti lipidiche e aromatiche.
Key words: Naples-type salami, proteomics, metabolomics, mass spectrometry.
1. Introduction
1. The structural characteristics define the nutritional and organoleptic quality of the Naples-type and other
typical salami. These properties are imparted by the degradation events (proteolysis, lipolysis) occurring during
the maturation of salami. This study reports the main results of the two years activities concerning:
- The characterization of sarcoplasmic proteins and peptides using a series of purification and
characterization methods based on chromatographic techniques coupled to mass spectrometry;
- The analysis of volatile and semivolatile compounds using HS-SPME and gas-chromatographic
techniques coupled to mass spectrometry.
Two sets of Naples-type salami productions at different steps of ripening were analysed: industrial and artisanal
that differ in amount of pepper added (0.5% and 0.2% respectively), and in the use of starter. The sarcoplasmic
protein (1mg/ml H
2
O+ 0.1%TFA) and peptide extracts were loaded on to a 218TP54, 5 m reversed-phase C
18
,
250 x 4.6 column (Vydac, Hesperia, CA, USA) using a HPLC modular system HP 1100 (Agilent). Mass spectra
were acquired on a Voyager DE-Pro spectrometer (PerSeptive BioSystems, Framingham, MA) equipped with a
N2 laser (!=337nm). The aromatic compounds were extract with HS-SPME tecnique through a
PDMS/DVB/CAR fiber. Analyses were carried out using gas chromatograph (Agilent Technologies) equipped
with a split/splitless injector coupled to a mass spectrometer HP 5973N with a source electron-impact (70 eV).
3.1 Analysis of protein and peptide fractions

Figura1 MALDI-TOF spectra: a-fresh meat, b- industrial
salami after 30 days of ripening, c- artisanal salami sfter 30 days
of ripening

Fig.1 shows the comparison between MALDI-TOF spectra of sarcoplasmic protein of fresh pork (panel a) and
MALDI-TOF spectra of sarcoplasmic protein of salami samples after 30 days of ripening, respectively an
15
th
254
15
th
industrial salami (panel b) and artisanal one (panel c). The final protein pattern of industrial salami resulted
different from the artisanal one because essentially endogenous muscle enzymes, such as calpains and
cathepsins, act during ripening of artisanal salami together with enzymes of Fig (1)MALDI-TOF spectra of the
samples: a) fresh meat, b)industrial salami after 30 days of ripeninginside microflora. These differences can be
evidenced by creation of data bank could be achieved to quickly identify and safeguard typical products. The
proteins less susceptible to proteolysis and common to both salami were carbonic anidrase, glyceraldehyde-3-
phosphate dehydrogenase (G3PD) and triose phosphate isomerase. In industrial salami, after 30 days of ripening
the proteolysis degree was higher; the peptides derived mainly from G3PD, pyruvate kinase and fructose
bisphosphate aldolase A. Some peptides were common to different ripening times, such as the peptide at 2209.9
Da (284-304) of calpastatin and the peptide at 2479.5 Da (87-107 of creatine kinase), while another peptide at
1357.7 Da (1-13 of G3PD) was present in the samples at 21 and 30 days of ripening. The persistence of these
peptides was justified either by the fact that they were quite resistant to proteolysis or because they were
continuously formed during ripening. In artisanal salami the proteolysis was less pronounced with respect to the
industrial one and the peptides derived from the hydrolysis of proteins differed from those of the industrial
product. This difference was due to the use of microbial starter in the industrial salami, which broke down the
sarcoplasmic proteins faster than the endogenous microflora acting on the artisanal one. Moreover some peptides
common to industrial samples after 7, 21 and 30 days of ripening, have been identified and some other common
to artisanal salami in order to use them as molecular markers as indicators of manufacturing and technological
processes. Furthermore the characterisation of the peptides formed during ripening could be used to evaluate the
degree of proteolysis in a given meat sample as well as to correlate the rheological and sensory characteristics
with formation of typical compounds.
3.2 Analysis of volatile compounds

Figura2 TIC chromatograms of GC-MS analysis of: a- methanolic
extract and b- HS-SPME extract

In Fig 2 were showed the TIC chromatograms of GC/MS analysis of: the methanolic extract (a) and of those
obtained by HS-SPME-GC/MS analysis (b). The aromatic profile of industrial Naples-type salami resulted more
complex and quantitatively rich than artisanal one for the use of starter cultures. In fact the presence of starter
produced a greater concentration of odorous compounds such as ethyl esters and methyl ketones related to
activity of S. xylosus and S.carnosus species. Short chain fatty acids such as octanoic, decanoic and dodecanoic
acids were present with a major amount in the industrial salami than artisanal one for a more pronounced
lipolytic process. Pepper compounds were quantitatively the largest group of odorous compounds in particular
majority terpens and sesquiterpens; these compounds were less abundant in artisanal salami because half amount
of pepper than industrial one was added during its manufacturing. The characterization of sarcoplasmic proteins
and peptides as well as the analysis of aromas could be used for identification of molecular markers of quality
and typicality in order to obtain the Protected Designation of Origin (P.D.O.) mark and to differentiate an
artisanal salami from an industrial one. Future research perspectives can be: the evaluation of correlation
between peptide formation and meat taste, as di- and tripeptides are the precursors of different taste active
compounds (flavor); the discrimination of meat colour variations due to alteration of chromogenic proteins
(globins), since meat colour is largely related to the relative proportions of oxymyoglobin (bright red),
myoglobin (dark red) and metamyoglobin (grey-brown); the identification of compounds characteristic of
different species to allow traceability of the products.
4. References
Berdague L, Talon R (1993) Effects of starter cultures on the formation of flavour compounds in dry sausage.
Meat Science 35:275-287.
Demeyer J, Hoozee H (1974) Specifity of lipolysis during dry sausage ripening. J. Food Science 39: 293-296.
Di Luccia A, Picariello G, Cacace G, Alviti G, Spagna Musso S (2005) Proteomic analysis of water soluble and
myofibrillar protein changes occuring in dry-cured hams. Meat Sci. 69:47.
Picariello G, Mamone G, Ferranti P, Addeo F, Di Luccia A (2006) Proteomic study of muscle sarcoplasmic
proteins using AUT-PAGE/SDS-PAGE as two-dimensional gel electrophoresis. J. Chroma B, 833:101-108.
15
th
255
15
th
Innovative Active Packaging for Food Products: Research and
Developments
Matteo Gumiero (matteo.gumiero@uniud.it)
Dept. Food Science, University of Udine, Udine, Italy
Tutor: Prof. Alessandro Sensidoni
The present work describes the first part of the PhD thesis project which is aimed to the study and the
development of an active packaging with specific properties (for example, antioxidant and/or preservatives). In
particular, the film properties related to surfaces characteristics and the presence of active substances added
during production process will be investigated. Surface properties were studied by scanning electron microscope
(SEM) and contact angle measurements, while the identification of the active compound was performed by
liquid chromatography-mass spectrometry (LC-MS). Results will lead to the identification of a rational
procedure for increase film performances and for optimising technological conditions in the second step of this
PhD project.
Studio e realizzazione di un sistema di confezionamento innovativo: allestimento di un
film flessibile per active packaging
Il presente lavoro riporta la prima parte del progetto di tesi di dottorato che si prefigge di studiare e realizzare
uno specifico active packaging. In particolare, si vuole chiarire come le propriet del packaging siano legate alle
caratteristiche superficiali del film ed allaggiunta, in fase di processo, di uno specifico sale dellacido ascorbico
(componente attivo). A tale scopo, sono state effettuate la microscopia elettronica a scansione (SEM) e la misura
dellangolo di contatto. Gli stessi campioni sono stati poi sottoposti allanalisi LC-MS al fine di verificare la
presenza nel film del componente attivo e di eventuali sottoprodotti. La comprensione di questi aspetti risulta
indispensabile per la successiva fase di ottimizzazione dellactive packaging prima della sua applicazione su un
prodotto reale.
Key words: food packaging, contact angle, SEM, LC-MS, active packaging
1. Introduction
In accordance with the aims of the PhD project described last year, this communication reports the first results of
a packaging innovation to increase foods shelf-life. In particular, the film properties related to surfaces
characteristics and the presence of active substances added during production process were investigated. As
reported in the literature, the technology of active packaging is based on deliberate interactions with food or food
environment that permit the extension of the shelf-life and the maintenance of food quality and sensorial tipicity
(Dainelli et al., 2008). Microbial growth and oxidation reactions occurring on food surface are two of the main
causes of food deterioration. The introduction of specific substances inside the material concentrates them at the
product surface, but that occur often in particular elements associated (e.g. sachets, labels, bottle caps, pads) or in
multilayer structures (Guillard et al., 2009): thus, the introduction of active substances directly in the material
would be able to simplify the industrial process (Dainelli et al., 2008). Also the intrinsic properties (e.g. surface
affinity for water, chemical groups exposed, strain or deformations depending by process conditions) of the
polymer used as packaging are very important for functionality (Vogler, 1998). The investigation by contact
angle measurements and SEM provides a useful tool to assess the surface properties (Karbowiak et al., 2006).
The active film was prepared through a two-step process. The first step consists of an automatic blending of the
polymeric matrix in pellets (HDPE, CaCO
3
, TiO
2
etc.) with the active substance (powder of calcium ascorbate)
by using an internal hopper. Finally, the active film was obtained by feeding the mix pellets-active substance into
an industrial extruder for blown film extrusion. Extruder had a tube die equipped with an injection air system.
Film surfaces were observed using environmental scanning electron microscopy (ESEM, model XL 30, Phillips).
The contact angle of film was measured with a goniometer equipped with image analysis software (Drop Shape
Analysis, Kruss Gmbh, Germany). For qualitative purposes, active film was analyzed by LC-ESI MS.
Blown film extrusion generally has a better balance of mechanical properties than cast: it is drawn in both the
transverse and machine directions and also requires lower melting temperatures (and, consequently, lower stress
15
th
256
15
th
for active substance). However, blown film has a less effective cooling process: thus, the film absorb more heat
with less change in the substance temperature, that cause difficult to control film thickness and, consequently,
shear strain (Chang et al., 2002). Figure 1 shows the film surface after the process of blown film extrusion
analyzed by SEM. It can be observed that internal (1B) and external (1A) surface have not presented strain or
deformations. Figure 1C show a zoom of the blown external surface. A qualitative analysis was performed to
define chemical elements exposed: a large amount of C, Ca, O and Ti were identified.

Figure 1 ESEM micrographs of external (1A-1C) and internal (1B) blown film at 200! (1A-1B) and 1600! (1C)
magnification factor.
Contact angle measurements are often used to compare different surfaces, as an indicator of the surface
hydrophobicity or the wettability of polymers. The phenomenon of spreading off the liquid over the surface
depends on the relative magnitude of cohesive and adhesive molecular forces that exist respectively within the
liquid and between the liquid and the solid. Thus, the value of the contact angle " with water (ideally, from 0 up
to 180) indicates how hydrophobic the surface is (Vogler, 1998). As we can see from Table 1, the comparative
study at time 0 (figure 2A) and time 60 s (figure 2B) shows that active film exhibits hydrophobic characteristics
because its water contact angle is well above 90, much higher than other synthetic polymers (e.g. HDPE, PP).

Figure 2 Drop shape of 0 s (A) and 60 s (B) active film for contact
angle measurement.
These results show that active film has non-absorbent surfaces: in fact, after deposition of water drop, no
apparent modification of the film surface (such solvation, hydration or swelling) occurred; only a slight decrease
between 0 and 60 s due to evaporation was assessed (Karbowiak et al., 2006). Moreover, there are no significant
differences between external and internal surface of blown film. These information will lead to a different
approach by the use of some techniques (e.g. coating, coupling, bio films enrichment) for increasing barriers
properties in the second part of the PhD project. Mass spectra obtained by LC-ESI MS gave some information
about the active substance extracted by a methanolic solution (a solution 100:0 v/v was chosen after a necessary
optimization of the extraction method). Amounts of dehydroascorbic acid and ascorbate ion were identified:
however, the concentrations of the substances and their migration have to be evaluated.
4. References
Chang AC, Chum SP, Hiltner A, Baer E (2002) Mechanisms of ductile tear in blown film from blends of
polyethylene and high melt strength polypropylene. Polymer, 43: 6515-6526.
Dainelli D, Gontard N, Spyropoulos D, Zondervan-van den Beuken E, Tobback P (2008) Active and intelligent
food packaging: legal aspects and safety concerns. Trends in Food Science & Technology, 19: S103-S112.
Guillard V, Issoupov V, Redl A, Gontard N (2009) Food preservative content reduction by controlling sorbic
acid release from a superficial coating. Innovative Food Science and Emerging Technologies, 10: 108-115.
Karbowiak T, Debeaufort F, Champion D, Voilley A (2006) Wetting properties at the surface of iota-carragenan-
based edible films. Journal of Colloid and Interface Science, 294: 400-410.
Vogler EA (1998) Structure and reactivity of water at biomaterial surfaces. Adv. Colloid Interface Science, 74:
69-117.
Film Side "t0
()
"60
()
PP 76.8 2.7 72.1 1.1
HDPE 80.0 2.6 76.3 1.9
Active film int 96.0 2.7 90.2 2.0
ext 98.3 2.6 92.0 2.2
Table 1 Contact angle at time 0 s ("t0
) and
60 s ("t60
). The results are the mean of 5
measurements standard deviation.

15
th
257
15
th
Innovative approaches and instruments in modelling and monitoring the
shelf life of packaged perishable foods
Pietro Lamiani (pietro.lamiani@unimi.it)
Dept. Food Science and Technology, Universit degli Studi di Milano, Via Celoria 2- 20133 Milano, Italy
Tutor: Prof. Luciano Piergiovanni

The activities planned for the second year of the PhD thesis project are described. 1) The product was chosen,
and its package was characterized. 2) The measurement and acquisition system has been designed, set up, and
calibrated. 3) The chosen product (Fetta biscottata, a typical Italian bakery product) has been characterized in
terms of water activity (a
w
), moisture content, and sorption/desorption isotherm. 4) The measurement system has
been used to record the moisture changes inside the package and the product. The data obtained have been used
to verify the assumption on which the main moisture depending shelf life prediction models are based.
Approcci e strumenti innovativi nella modellazione e nel controllo della shelf life di
prodotti deperibili confezionati
Le attivit previste per il secondo anno di dottorato sono di seguito descritte. E stato scelto il prodotto e sono
state determinate le caratteristiche dellimballaggio. Il sistema di misura stato progettato, costruito e calibrato.
Il prodotto selezionato (Fetta biscottata) stato caratterizzato in termini di attivit dellacqua (a
w
), contenuto
umido e isoterma di assorbimento/desorbimento. In ultimo il sistema di misura stato usato per rilevare la
diffusione di umidit allinterno della confezione e del prodotto. I dati raccolti sono stati utilizzati per verificare
lassunzione teorica su cui sono basati i modelli di previsione della shelf life per prodotti umidit dipendenti.

Key words: humidity sensors, bakery products , shelf life modelling.
1. Introduction
According to the project previously described (Lamiani, 2009) the following activities were developed:
A1) Identification and selection of the product to be used for the experiments.
A2) Measurement system assembly and calibration.
A3) Characterization of the product by moisture content, a
w
, and sorption/desorption isotherm construction.
A4) Verification and validation of the existing models and development of new models.
The fourth activity was previewed overlapped on the second and third year; only the first part with the data
collection was done and reported in the present work.
The a
w
of fetta biscottata was measured instrumentally at 38C; the moisture content determined in a oven at
130C for 1.5 h. Rigid EPS trays with capacity of 1400 and 1030 cm
3
sealed with a OPP 20 Dm film have been
used as model package systems. The water vapor transmission rate (WVTR) of the package has been
determined, by a gravimetric method, as equal to 1.520.02 g pack
-1
24h
-1
(38C and 98% GRH).
Fetta biscottata have been packed inside the trays in different quantities, using room air. Humidity sensors have
been placed inside the product and in the headspace, in order to record the relative humidity in different points of
the package and of the product. The packages were stored in a cell at 380.5C and 98% RH.
Fetta biscottata has been chosen for the regular shape and geometry, and for the uniformity among different
packages. The acceptable maximum moisture content will be determined with a sensorial test in a following step.
The acquisition system composed by humidity sensors and a specific acquisition software to record moisture
values has been built in collaboration with RDE Company srl. It has been calibrated using saturated salt
solutions at different relative humidity values: 0-11-23-32-44-52-79-92-97-100% (Bell and Labuza, 2000a).
The moisture content, water activity, and the sorption/desorption isotherm have been determined for fetta
biscottata. The water activity was equal to 0.2490.003 and the moisture content to 3.710.27 g/100g. The
sorption/desorption isotherm was constructed at relative humidity values of 11-23-32-44-52-66-75-86-92%
(Wolf et al, 1985). Different quantities of the dry product (fetta biscottata) have been packaged in the two type
of trays, obtaining the combinations summarized in table 1.
During the accelerated storage the moisture adsorption by fetta biscottata and the moisture increase in the
15
th
258
15
th
headspace of the packages have been measured and recorded every 30 minutes for each combination. In figure 1
the moisture change for sample 1 is shown. The experiments were repeated at least two times for each sample.
The Headspace curve represents the moisture diffusion in the headspace, while the Product curve represents
the moisture adsorption by fetta biscottata. For all the samples the difference between the curves can be
considered constant in the RH range considered and shows the delay of the products in adsorbing the moisture.
Experiments conducted until 95% RH demonstrated that the two curves joint after a quite long time.
To analyze the differences among the samples, the ratio between the headspace volume and the product weight
was related to the difference (in average) between the headspace and the product RH values. The data in the last
column of table 1 show that the higher the ratios, the bigger the differences.
In figure 2 the differences in RH values are plotted versus the volume/weight ratio, showing a clear trend and an
increasing uncertainty in the measures. This trend is very likely correlated to the composition and to the texture
of the product used and must be checked with other moisture sensitive products.
From our data, obtained combining different weights of fetta biscottata and different headspace volumes, it can
be concluded that the relative humidity of the headspace of the packaging (which changes for the water vapour
permeability) is not immediately in equilibrium with the product. The theoretical assumption generally used in
the shelf life modeling (Fava et al, 2000) has not been verified for this product and in the third year it will be
studied how these differences influence the shelf life prediction for fetta biscottata and for other moisture
depending products and different packages.

Table 1: packaging combinations and RH differences among packaging solutions.
Sample
number
Number of fetta
biscottata
Product
weight [g]
Product volume
[cm
3
]
Tray volume
[cm
3
]
Headspace
volume [cm
3
]
Headspace
volume/Product
weight [cm
3
g
-1
]
,%RH
1 4 32.48 182.8 1030 847.2 26.1 4.50.7
2 4 32.48 182.8 1400 1217.2 37.5 5.60.8
3 6 48.72 274.2 1030 755.8 15.5 2.70.7
4 6 48.72 274.2 1400 1125.8 23.1 4.20.9
5 8 64.96 365.6 1030 664.4 10.2 1.40.4
6 8 64.96 365.6 1400 1034.4 15.9 2.70.4
7 12 97.44 548.4 1400 851.6 8.7 1.20.2
4. References
Bell LN, Labuza TP (2000) Moisture sorption: practical aspects of sorption isotherm measurement and use. 2nd
ed. St. Paul (USA): American Association of Cereal Chemists, pp. 33-39.
Fava P, Limbo S, Piergiovanni L (2000) La previsione della shelf life di prodotti alimentari sensibili agli scambi
di umidit. Industrie Alimentari 39:121-126.
Lamiani P (2009) Innovative approaches and instruments in modeling and monitoring the shelf life of packaged
perishable foods. In Proc.s of the 14
th
Workshop on the Developments in the Italian PhD Research on Food
Science and Technology, Oristano (Italy), 16-18 September, 2009, pp. 411-412.
Wolf W, Speiss WEL, Jung G (1985) Standardization of isotherm measurements (COST-PROJECT 90 and
90bis). In Properties of Water in Foods. D. Simatos and J.L. Multon (Eds.) Martinus Nijhoff Publishers;
NATO ASI Series E: Applied Science N. 90, Amsterdam (Netherlands): Marins Nijhoff Publ, p. 661.
Figure 1: moisture change in sample 1
Figure 2: relationship between headspace volume and G%RH
15
th
259
15
th
Partial and total dealcoholization of wines
Loredana Liguori (lliguori@unisa.it)
Dept. Chemical and Food Engineering, University of Salerno, Italy
Tutor: Prof.ssa Marisa Di Matteo

The present work describes the second year activities of the PhD focused on the dealcoholization of wines by
direct osmosis. A lab-scale plant has been set up using a membrane contactor and pure water as stripping agent.
The dealcoholization tests were carried out by hydroalcoholic solutions at 10, 12.5, 15% vol. The influence of
process parameters (different flow rates and temperatures, number of dealcoholization cycles) on the
effectiveness of lowering in alcohol content was investigated. Results were reported as removed alcohol
percentage as a function of number of dealcoholization cycles.
Dealcolazione parziale e totale dei vini
Il presente lavoro descrive le attivit del secondo anno di dottorato che hanno riguardato lapplicazione della
tecnica di osmosi diretta alla dealcolazione di vini. stato realizzato un impianto su scala di laboratorio
utilizzando un contattore a membrana e acqua pura come agente di strippaggio. Le prove di dealcolazione sono
state effettuate utilizzando soluzioni idroalcoliche al 10, 12.5, 15% vol. Linfluenza dei parametri di processo
(differenti valori della portata delle correnti di alimentazione, della temperatura e del numero di cicli di
dealcolazione) stata valutata sullefficacia dellallontanamento del contenuto alcolico. I risultati sono stati
riportati come percentuale di alcol rimosso in funzione del numero di cicli di dealcolazione.

Key words: dealcoholization, membrane contactor, direct osmosis, wine.
1. Introduction
In recent years a high interest in the production of low- and reduced-alcohol beverages has been observed. Many
processes (spinning cone, CO
2
supercritical extraction, membrane processes) were applied to produce these
drinks, as reported in literature (Pickering, 2000). Membrane processes including reverse osmosis, vacuum
membrane distillation, pervaporation, require a high energy consumption for conditioning the suitable operating
pressure and provide products with low quality (Varavuth et al., 2009). An alternative membrane process is
direct osmosis which operates at low temperature and atmospheric pressure. The selective removal of ethanol
from alcoholic beverages (Hogan et al., 1998) can be efficiently realized by this technology which has the
advantage of avoiding thermal damages to components and gives low energy consumption (Varavuth et al.,
2009). In previous tests carried out during the first PhD year, different microporous hydrophobic membrane
modules were evaluated (capillary, hollow fibers, plate & frame). Because of high packing density in hollow
fibers membranes, a higher alcohol removing effectiveness than the other membrane modules was found
(Liguori, 2009). For this reason, dealcoholization experiments were performed by direct osmosis using a
microporous hydrophobic hollow fibers membrane. Due to the hydrophobicity of the membrane material (i.e.
PP, PTFE), neither feed nor stripping streams enter membrane pores and a thin gas (air) layer is entrapped within
the pores forming the so called gas membrane. In dealcoholization process, the driving force is the ethanol
vapour pressure difference between the membrane sides. The transport mechanism of ethanol through the
membrane was described in Gostoli (1999). Moreover, it is possible to set-up an easy and profitable plant using
pure water as stripping agent (Varavuth et al., 2009).
Laboratory scale plant was set up using a microporous hydrophobic membrane (0.5 x 1 micromodule Liqui-cel,
Membrana-Charlotte) made of polypropylene/epoxy and with a surface area of 100 cm
2
. Feed and stripping
streams, contained into their respective tanks, were fed to the module in cross flow direction by two peristaltic
pumps (Miniplus 3, Gilson). The temperatures of inlet and outlet streams were controlled by thermostatic water
bath and measured by K-type thermocouples. The feed streams were hydroalcoholic solutions at 10, 12.5 and
15% vol. and were prepared from 99.9% (v/v) absolute ethanol (J.T.Baker). Distilled water was used as stripping
agent. Dealcoholization experiments were performed in cycles by recycling only the retentate stream; generally
more than four cycles were carried out in order to reduce the ethanol content at least of 50%; each trial was
executed in triplicate. At the end of each cycle, samples were taken from both streams and their alcohol content
was evaluated according to AOAC methods (1995). The process parameters which affect on the dealcoholization
plant effectiveness, i.e. feed (Q
f
) and stripping (Q
s
) stream flow rate, number of cycles, temperature and ethanol
content of feed solution (C
f
)

were investigated. The feed and stripping flow rates were changed in the range of
15
th
260
15
th
0.6-8.6 ml/min (laminar flow regime). In order to study the effect of temperature on the dealcoholization
performance, the temperature was adjusted between 20C and 35C.
The first set of trials has concerned the study of the effect of the stripping stream flow rate on the ethanol
removal at room temperature. The feed stream was hydroalcoholic solution at 10% vol. The influence of
different Q
s
(1.2-8.6 ml/min) on the alcohol removal at Q
f
of 1.2 and 2.4 ml/min were reported in fig 1a and 1b
respectively. The highest alcohol removal was obtained by a feed flow rate equal to 1.2 ml/min and a stripping
flow rate of 2.4 ml/min (fig.1a). In these conditions, a 75% reduction of ethanol content after 5 cycles was
detected. By stripping flow rate higher than 2.4 ml/min, an higher alcohol content in retentate was found. No
significant differences in alcohol reduction were observed increasing Q
s
with a feed flow rate equal to 2.4
ml/min (fig.1b). The effect of different feed flow rates ranging from 0.6 to 5.6 ml/min, at Q
s
2.4 ml/min, on the
dealcoholization process effectiveness was investigated too (fig.1c). A remarkable alcohol decrease (up to about
2% vol.) in retentate was observed by smaller feed flow rates (0.6 ml/min; 1.2 ml/min), thanks to the higher
residence time in the membrane.
Moreover, the influence of the initial ethanol content (C
f
= 10, 12.5, 15% vol.) in the feed solution, at Q
s
= 2.4
ml/min and at Q
f
= 1.2 m/s (fig.2a) was investigated. The results highlighted that the highest ethanol reduction
during the five cycles was found for ethanol content equal to 10% vol., while no differences were observed for
alcoholic solutions at 12.5 and 15% vol. The latter is due to the differences in mass transport through the
membrane at different ethanol concentration in the feed.
Finally, the effect of two temperatures (20; 35C) on the alcohol removal was investigated with the following
hydrodynamic parameters: Q
f
= 1.2 ml/min; Q
s
= 1.2, 2.4, 3.6 ml/min (fig.2b). According to the Antoines
equation (Varavuth et al., 2009), a significant alcohol content reduction at 35C was observed owing to the
exponential increase of vapour pressure with temperature. Anyway, it is relevant to note that at 35C with a Q
s
=
2.4-3.6 ml/min, in 4-5 cycles, the ethanol content in retentate was lower than 0.5% vol.
In conclusion, the research activity carried out during the second year of this PhD project has allowed to
characterize some hydrodynamic conditions for an effective dealcoholization process in a lab-scale plant.
Dealcoholization cycle
0 1 2 3 4 5 6
E
t
h
a
n
o
l

c
o
n
t
e
n
t

(
%

v
o
l
.
)
0
2
4
6
8
10
12
Qs = 1.2 ml/min
Qs = 2.4 ml/min
Qs = 3.6 ml/min
Qs = 5.6 ml/min

0 1 2 3 4 5 6
E
t
h
a
n
o
l

c
o
n
t
e
n
t

(
%

v
o
l
.
)
5
6
7
8
9
10
11
12
Qs = 2.4 ml/min
Qs = 5.6 ml/min
Qs = 8.6 ml/min

0 1 2 3 4 5 6
E
t
h
a
n
o
l

c
o
n
t
e
n
t

(
%

v
o
l
.
)
0
2
4
6
8
10
12
Qf =0.6 ml/min
Qf =1.2 ml/min
Qf =2.4 ml/min
Qf =3.6 ml/min
Qf =5.6 ml/min

Figure 1 Decrease in ethanol content (% vol.) vs dealcoholization cycle: (a) Q
f
= 1.2 ml/min; Q
s
= 1.2-5.6 ml/min; (b) Q
f
=
2.4 ml/min; Q
s
= 2.4-8.6 ml/min; (c) Q
s
= 2.4 ml/min; Q
f
= 0.6-5.6 ml/min. C
f
= 10% vol.; T = 20C.
0 1 2 3 4 5 6 7 8
E
t
h
a
n
o
l

l
o
s
s

(
%
)
0
20
40
60
80
100
Cf =10%vol.
Cf =12.5%vol.
Cf =15%vol.

0 1 2 3 4 5 6
E
t
h
a
n
o
l

l
o
s
s

(
%
)
0
20
40
60
80
100
120
Qs =1.2ml/min; T=20C

4. References
AOAC (1995) Official methods of analysis of AOAC International 16
th
ed. Arlington
Gostoli C (1999) Thermal effects in osmotic distillation, J of Membr Sci, 163: 7591
Hogan PA, Canning RP, Peterson PA, Johnson RA, Michaels AS (1998) A new option: osmotic distillation,
Chem Eng Prog, July
Liguori L (2009) Oenology innovation: partial and total dealcoholization of wines. In Proc.s of the 14
th

Biotechnology, Oristano (Italy), 16-18 September, pp. 413-414
Pickering GJ (2000) Low- and Reduced-alcohol wine: a review. Journal of Wine Research, 11(2): 29-144
Varavuth S, Jiraratananon R, Atchariyawut S (2009) Experimental study on dealcoholization of wine by osmotic
distillation process, Sep and Purif Technol 66: 313321
a b
c
b a
Figure 2 Ethanol loss (%) vs
dealcoholization cycle: (a) Q
f
= 1.2 ml/min;
Q
s
= 2.4 ml/min at C
f
= 10, 12.5, 15% vol.; T
= 20C; (b) Q
f
= 1.2 ml/min; Q
s
= 1.2-3.6
ml/min; T = 20; 35C at C
f
= 10% vol.
15
th
261

15
th
Identification of molecular markers for the characterization of
hazelnut oil

Sabrina Lucchetti (lucchetti@inran.it)
Area di Scienze degli Alimenti, Istituto Nazionale di Ricerca per gli Alimenti e la Nutrizione, via
Ardeatina 546, 00178 Rome, Italy
Tutor: Prof. Nicol Merendino

The purpose of this PhD project is to establish a molecular traceability method for hazelnut (Corylus
avellana) oil to assure quality and discourage fraud. Although a few molecular analyses of hazelnut
are already available in the literature, the application of the methods to a different and more
problematic matrix such as oil is not an easy task. In order to achieve this goal, we have optimized a
DNA extraction method, chosen suitable microsatellites for cultivar characterization and identified the
correct amplification conditions on hazelnuts, with the aim to transfer information to oil matrix. The
molecular characterization of five hazelnut cultivars is in progress.

Identificazione di markers molecolari per la caratterizzazione dellolio di
nocciola

Lo scopo di questo progetto di dottorato quello di ricostruire una tracciabilit molecolare nellolio di
nocciola (Corylus avellana) al fine di garantirne la qualit e scoraggiare le frodi. Nonostante siano gi
noti in letteratura studi relativi alla caratterizzazione del nocciolo, lanalisi di una matrice pi
complicata come quella dellolio rappresenta un problema di difficile soluzione. A tale scopo abbiamo
ottimizzato un metodo per lestrazione del DNA da nocciole, al fine poi di utilizzarlo sulla matrice
olio; sono stati scelti i microsatelliti per caratterizzarne le cultivar ed individuarne idonee condizioni
di amplificazione. Sono in corso analisi relative alla caratterizzazione delle cultivar di nocciole.
1. Introduction
As described previously, this project was developed in four steps:
(A1) Testing and comparing different DNA extraction methods on different hazelnut cultivars.
(A2) Identifying and designing convenient primers for a qualitative and quantitative DNA evaluation.
(A3) Analyzing and studying all hazelnut SSR s (Simple Sequence Repeats) already identified in the
Data Bank. Choosing the best microsatellites for fingerprint studies (high allele number).
(A4) Selecting the right PCR condition for DNA quality and microsatellites analysis.
2.1 Plant material and DNA extraction
Hazelnuts from five different cultivars were analyzed (Mortarella, Tonda Gentile Romana-TGR,
Tonda Gentile delle Langhe-TGL, Tombul, Tonda di Giffoni-TG). The samples, received from
different companies in Lazio, were homogenized under liquid nitrogen with a Waring Blendor
homogenizer. Total DNA was extracted using either different commercial kits (QIAmp DNA stool-
Qiagen, Genomic DNA from Food-Macherey-Nagel,Gene Elute Plant-SIGMA) or a traditional
method (Ayed et al., 2009) with some modification. DNA concentration was determined with the
spectrophotometer for micro samples quantification (NanoDrop).
Specific hazelnut primers DNA quality check were designed at the boundary of the intron/exon
junction to avoid RNA amplifications interference. LOX, LOX1, LOX3 primers, designed on the
lipoxygenase gene, were varyingly homologous also to other different organisms while ADH primers
were designed and specific for a dehydrogenase hazelnut gene (tab. 1). Instead AJ810086 primers
corresponded to portion of a glucanase olive gene (table 1). Nine SSR loci, CAC-A014a, CAC-B028,
CAC-B029b, CAC-B111 (Bassil et al., 2005), CaT-B107, CaT-B502, CaT-B504, CaT-B507, CaT-B508
(Boccacci et al., 2005), were chosen for fingerprint analysis.

2.2 PCR conditions
PCR was performed in a total volume of 25 l containing 1X PCR buffer, 2,5 mM MgCl2, 0,8 mM
dNTPs, 0,5M of each primer and 1U Taq polymerase Gold (Applied Biosystem). Gene amplification

15
th
262

15
th
Table1 Primers used for DNA quality check
___________________________________________________________________________________________
_SSR locus Primers Forward (5-3) __ Primers Reverse (5-3)________________Ta_____
LOX TGGCTGGAGTAAACCCTGTC TTCAATCACCAATGGCTTCA 55C
LOX1 CCCAAAGGCTTTCAACCATA CTTTTTGTTCCCGTCATCGT 55C
LOX3 CCGTACCTGAGGCGAATAAA CTGGCGTGAACACTTTGCTA 55C
ADH TGAATGTTGCAAAACCGAAA CAGCAGCCTAATCACAACGA 50C
AJ810086 GTCCCAGTTCGAATTTGGC TCCCCTGTTGATGGAGGATAC 60C

conditions were: an initial denaturation cycle of 95C for 10 min, 35 cycles of denaturation at 95C
for 30 s, right annealing temperature for 30 s and extension at 72C for 30 s. A final cycle at 72C for
7 min. Microsatellites were analyzed according to an initial cycle at 95C for 10 min, 28 cycles at
95C for 30 s, right annealing temperature for 45 s and elongation step at 72C for 90 s. At the end a
cycle at 72C for 45 min. The amplifications were performed in a Biorad termocycler. Each of them
was observed on 2% agarose gel stained with Gel Red (Biotium ). The definitive fragment size data
on TGR, TGL, Tombul and TG DNAs were carried out on a capillary electrophoresis (Applied
Biosystems, mod. 3730) using Forward primers were labeled with 6FAM.
Several DNA extraction methods were checked on the Tonda Gentile Romana (TGR) hazelnut
cultivar, with the aim of selecting the most efficient, economic and simple one. Every method required
some modification in respect to normal protocol, concerning caotropic salts and/or raw material
homogenization and/or DNA elution. To evaluate the efficiency of different extraction systems, we
observed the quality and quantity of extracted DNAs through spectophotometric and PCR
methodologies.
The preliminary examination performed through NanoDrop allowed us to choose the best champions.
Secondly, DNAs were also analyzed through PCR methodology. In order to perform this check, there
were many tests conducted. From these studies, two important points became clear. Firstly, it is
important not to use too many primers that can introduce non-specific amplifications, and secondly, to
utilize the right DNA quantity. In regard to the latter, an excessive DNA quantity probably inhibits or
limits the PCR reaction for introduction of inhibitors contained in the genomic preparations.
The primers used and designed for amplification studies allowed us to verify the best PCR conditions
(LOX3) and the fragmentation level of DNAs (primers LOX1 and LOX). The amplicons of 250bp and
500bp demonstrate that the DNAs tested contain acceptable fragmentation, which are usable for
fingerprint analysis. With ADH primers, instead, it was possible to observe the specificity of the
amplifications. The amplicons were present in hazelnut samples but absent in olive samples (another
angiosperm). In this way it was possible to identify DNA contamination by other plants during
genomic extraction. Also with AJ810086 primers we wanted check the purity of DNAs. As we
observed, no amplification demonstrated the absence of DNA contamination. Furthermore, the DNAs
extracted by Macherey-Nagel (M-N) kit were demonstratably best in terms of quality, simplicity of
extraction and prize, which is consistent with the spectrophotometric data.
DNAs extracted by M-N were used for further microsatellite analyses. Also in this case, it was
necessary to select the correct PCR conditions, again.
Champions chosen for the fingerprint analysis, TGL, two pools of TGR, Tombul and TG hazelnuts
were extracted with M-N kit and DNAs analyzed under the conditions selected with preliminary
investigations. As with the tester DNA, the TGR, TGL, Tombul and TG DNAs were analyzed to
demonstrate that genomic material is not too fragmentated nor contaminated by exogenous DNAs, and
therefore good for SSR analysis.
A preliminary examination of microsatellites, as observed in cultivars using agarose gel, seems to
confirm their relative size in view of the literature on microsatellites. Currently capillary
electrophoresis analysis is in progress for an accurate evaluation of microsatellites size.
4. References
Ayed RB., Grati-Kamoun N., Moreau F., Rebai A. (2009) Comparative study of microsatellites
profiles of DNA from oil and leaves of two Tunisian olive cultivars, Eur Food Technol 229: 757-762.
Boccacci P., Akkak A., Bassil NV., Mehlenbacher SA., Botta R. (2005) Characterization and
evaluation of microsatellite European hazelnut (Corylus avellana L.) and their transferibility to other
Corylus species, Molecular Ecology Notes 5: 934-937.
Bassil NV, Botta R., Mehlenbacher SA (2005) Microsatellite markers in hazelnut: Isolation
characterization, and cross-species amplification, J. Amer. Soc. Hort. Sci. 130 (4): 543-549.
15
th
263
15
th
Biotechnology, University of Napoli-Federico II, Portici, 15-17 September, 2010
Packaging optimization to prolong the shelf-life of minimally processed
vegetables
Annalisa Lucera (a.lucera@unifg.it)
Dept. Food Science, University of Foggia, Foggia, Italy
Tutor: Prof. Matteo Alessandro Del Nobile
The PhD thesis project is based on the optimization of packaging systems to prolong the shelf-life of fresh-cut
produce. To this aim, different minimally processed vegetables, such as green beans, zucchini and broccoli were
studied. In the following, the case study of broccoli was presented. Initially, several polymeric films,
characterized by different permeability, were used. Afterward, the films having the barrier properties that best fit
the respiration requirements of minimally processed vegetable were selected to evaluate the influence of
headspace conditions on product quality.
Ottimizzazione del confezionamento per prolungare la shelf-life di vegetali
minimamente processati
Il progetto della tesi di Dottorato si basa sullottimizzazione di sistemi di confezionamento per prolungare la
shelf-life di prodotti fresh-cut. A tale scopo, sono stati presi in esame diversi vegetali minimamente processati
quali fagiolini, zucchine e broccoli. In seguito, stato riportato il caso studio dei broccoli. Inizialmente, sono
stati usati diversi film polimerici caratterizzati da differenti valori di permeabilit. In seguito, i film con le
propriet barriera che meglio si adattavano alla velocit di respirazione del vegetale sono stati selezionati per
valutare linfluenza delle condizioni dello spazio di testa sulla qualit del prodotto.
Key words: Fresh-cut vegetables, shelf-life, packaging.
1. Introduction
The choice of the appropriate packaging system is a relevant aspect to be taken into great account for
maintaining the quality of horticultural commodities (Del Nobile et al., 2009). Different headspace conditions
can be achieved in the package, depending on the interactions between respiratory activity of the packaged
produce and gas transfer through the polymeric matrix. Therefore, the choice of film is a key factor to obtain
optimum modification of the atmosphere surrounding the vegetable. In this work the optimization of the
packaging system for broccoli was achieved through two subsequent steps. During the first one, a rough
optimization process was performed; in fact, commercially available packaging films were screened to find those
that best fit the respiration requirements of the investigated fresh-cut broccoli. The second step was aimed to
obtain a refined packaging optimization by assessing the influence of the headspace gas composition on produce
shelf-life.

2.1 Step I
Fresh broccoli heads (Brassica oleracea L., var. Italica) were harvested in a local farm (San Michele, Poggio
Imperiale, Italy), immediately transported to the laboratory and processed. Heads were selected for absence of
visual defects and uniform color and separated in single florets using a sharp knife. The florets broccoli were
washed in tap water to remove residuals, dipped for 1 min in chlorinated water (20 mlL
-1
) and rinsed by
immersion in tap water, then air-dried for 10 min at room temperature (~23C). Amounts of about 100 g of
broccoli florets, obtained as previously described, were packaged in different polymeric bags made up of three
oriented-polypropylene films OPP20, OPP40, OPP80, respectively (Icimendue, Marcianise, Italy), and five anti-
fog polypropylene films (PP, thickness 30 !m) kindly provided by CartonPack (Rutigliano, Italy) with different
micro-perforations: 50 (PP50), 20 (PP20), 12 (PP12), 9 (PP9) and 7 (PP7) micro-holes (diameter 70 !m) for
package. All bags were hermetically sealed by a thermal sealer (Dongfeng Packaging, China) and then stored at
5C. For the selection of the more suitable packaging films for broccoli, the headspace gas concentrations were
measured by using a gas analyzer (PBI Dansensor, Checkmate 9900, Ringsted, Denmark).
2.2 Step II
Fresh-cut broccoli (about 100 g), obtained as previously described, were hermetically sealed in the OPP20,
PP20, PP7 bags. In addition, unpackaged fresh-cut broccoli (FC-CNT) and intact broccoli wrapped in polyvinyl
chloride (PVC, thickness 12 !m) (W-CNT) were also used as the control. During storage at 5C, headspace gas
composition, sensorial quality and spoilage microbial growth were monitored. Experimental data were fitted by
using a modified version of a Gompertz equation (Conte et al., 2009; Gammariello et al., 2009).
15
th
264
15
th
Biotechnology, University of Napoli-Federico II, Portici, 15-17 September, 2010
3.1 Step I
The gas trends in all the bags reflect the influence of the film mass transport properties and respiration rate on
the headspace composition. The Figure 1 (a, b) shows the behaviors during storage of O
2
and CO
2
in the
headspace of OPP20, PP20 and PP7 bags. The other OPP films were similar to OPP20, and the other PP films
were ranged between PP20 and PP7, except the PP50 that maintained ordinary atmosphere conditions. As can be
observed in the figure, for broccoli packaged in OPP20 film the O
2
concentration fell rapidly to zero within the
first day of storage, whilst the CO
2
concentration increased above 15%. As reported in the literature, low level of
O
2
(about 0.5%) and high level of CO
2
(higher than 10%), induce off-odor generation (Forney and Rij, 1991),
thus reducing the product acceptability. On the other hand, for broccoli packaged in PP20 bag the O
2

concentration slowly decreased during the first 3 days and then reached an equilibrium value of about 16%. An
atmosphere characterized by about 10% O
2
and 9% CO
2
was created in the PP7 bag. Therefore, these last two
micro-perforated films were selected for the subsequent experimental trial.

3.2 Step II
In Table 1 the microbial acceptability limit values (MAL
Mesophilic bacteria
) intended as the time at which the fresh-
cut produce is no more marketable from a microbiological point view, the sensory acceptability limit for the
overall quality (SAL
O.Q.
), intended as the time at which the investigated fresh-cut produce was no more
marketable from a sensory point of view and the shelf-life of product packaged in PP20, PP7 films, together with
the controls (FC-CNT and W-CNT) were reported. As can be observed, the SAL
O.Q.
values coincide with fresh-
cut produce shelf-life, as the microbial load was always found below the selected threshold (5x10
7
UFC/g). In
particular, SAL
O.Q.
of fresh-cut broccoli packaged in the two micro-perforated films was higher than both the
controls that became rapidly unacceptable, mainly due to yellowing and wilting phenomena. Therefore, shelf-life
of fresh-cut broccoli packaged in PP7 film was prolonged by approximately 50% respect to the W-CNT. The
results confirmed that the mass transport properties of the packaging film strongly influenced the headspace gas
concentration, thus suggesting that the selection of the proper packaging is of crucial importance to create
conditions able to guarantee the maintenance of quality characteristics.
Table 1 MAL, SAL and shelf-life values.
Samples MAL
Mesophilic bacteria
(day) SAL
O.Q.
(day) Shelf-life (day)
FC-CNT >10 6.221.29
a
6.221.29
a

W-CNT >14 9.741.14
b
9.741.14
b

PP20 >21 13.900.87
c
13.900.87
c

PP7 >24 19.852.34
d
19.852.34
d

Mean values standard deviation.
a-d
Mean in the same column followed by different superscript letters differ significantly (p<0.05).

4. References
Conte, A, Scrocco, C, Brescia, I, Del Nobile, MA (2009) Packaging strategies to prolong the shelf life of
minimally processed lampascioni (Muscari comosum), J. Food Eng. 90: 199-206.
Del Nobile, MA, Conte, A, Scrocco C, Brescia, I, Speranza, B, Sinigaglia, M, Perniola, R, Antonacci, D (2009)
A study on quality loss of minimally processed grapes as affected by film packaging, Postharvest Biol.
Technol. 51: 21-26.
Forney, CF, Rij, RE (1991) Temperature of broccoli florets at time of packaging influences package atmosphere
and quality, HortScience 24:1301-1303.
Gammariello, D, Conte, A, Di Giulio, S, Attanasio, M, Del Nobile, MA (2009) Shelf life of Stracciatella cheese
under modified-atmosphere packaging. J. Dairy Sci. 92: 483-480.
Figure 1 Evolution of oxygen (a)
and carbon dioxide (b) headspace
concentration of fresh-cut florets
broccoli packaged in OPP20 (!),
PP20 (!) and PP7 (") bags.

15
th
265
Setting up of culture independent methods to study acetic acid bacteria of
vinegars
Dhouha Mamlouk (dhouha.mamlouk@unimore.it)
Dept. Agricultural and Food Science, University of Modena and Reggio Emilia, Reggio Emilia, Italy
Tutor: Dr Maria Gullo

In this work a culture-independent approach based on 16S rRNA gene analysis by PCR/DGGE and sequencing
was applied to evaluate the acetic acid bacteria diversity of vinegars. Therefore, the optimization of genomic
DNA extraction was performed on characterized samples. The optimized DNA extraction protocol was
validated by the inoculation of AAB type strains into vinegars matrix. Genomic DNA was then used to perform
PCR/DGGE using different primers pairs.

Key words: DNA extraction, Acetic acid bacteria, Culture-independent, PCR/DGGE.
1. Introduction
In accordance with the PhD thesis project, this work reports the results of the main activities concerning:
1) The optimization of DNA extraction protocol from vinegars; 2) The improvement of group-specific PCR
primers for the analysis of the AAB diversity of vinegars; 3) Culture independent analysis of vinegars by
PCR/DGGE and sequencing of 16S rRNA gene.
The reference strains of acetic acid bacteria (AAB) used in this study were cultivated on GY (glucose 1%, yeast
extract 1%) medium for 3-5 days at 28 C. Samples were collected from a vinegar company and the following
physic-chemical parameters were determined: pH; acetic acid and soluble solids. To extract genomic DNA from
vinegars, 7 different methods (Table 3) were modified and tested on type strains and vinegars samples. 16S
rRNA PCR/DGGE analysis was performed on genomic DNA using primers listed in Table 2. To analyse the
AAB community, in silico analysis of suitable primers was performed. 16S rRNA gene sequences of type strains
of the genera Acetobacter, Gluconobacter and Gluconacetobacter were retrieved from EMBL database and
sequences analysed by Chromas 1.41. The number of target and not-target matches of the primers was tested in
silico using PROBE MATCH function within the RDP-II database (http://rdp.cme.msu.edu). Primer pairs
Alf28modf/Alf684modr were designed on the basis of class specific primers Alf28f/Alf684r (Muhling et al.
2008). 16S rRNA PCR/DGGE was performed by DCode Universal Mutation Detection System (Biorad). DGGE
run of PCR products was performed on an 8% (w/v) polyacrylamide gel with urea and formamide as
denaturants. The denaturing gradients variation was between 40% and 60%. Electrophoresis was performed in
1X Tris-acetate EDTA (TAE) buffer at 60C at constant voltage of 200 V for 4 h. Subsequently, gel was stained
with ethidium bromide (50 !g/ml) in 1X TAE buffer, destained and photographed under UV light.
Representative bands were excised from gels, reamplified and automated sequenced. Sequences contigs were
assembled using CHROMASPro (Version 1.41), and similarities searched using BLAST program.

Samples analyzed in this study were vinegars at different acetification stages as showed by the acetic acid
content, pH and soluble solids values in Table 1. In the application of culture independent approach to study
AAB from vinegars, one of the first hurdles is the recovery of total, representative microbial genomic DNA
suitable for PCR-based applications (Jara et al. 2008). Another already recognized drawback is due to
polyphenolic and polysaccharides compounds that may get co-purified and interfering with DNA detection and
measurement, and inhibit various enzymes including DNA polymerase. On the basis of the data already
acquired, eight different extraction methods, combining physical and chemical protocols were tested (Table 3).
High yield and purity of DNA was obtained using protocol 7 as showed by the values of the ratio 260/280
(around 1.8) for all the type strains and vinegar samples. Genomic DNA extracted with protocol 7 was
successfully amplified and allowed to obtain DGGE amplicons. This protocol is a modification of the CTAB
protocol of Porebski et al (1997) set up for DNA extraction of plants. All the other protocols tested provided low
yield or DNA with contaminants as showed by the values of 260/280 ratio in all the case below 1.8 and
inhibition of PCR reaction was observed. To control the efficiency of the protocols, culture of type strains were
inoculated into vinegar samples and were successfully co-extracted. The sequencing of excised bands from
DGGE gel confirmed the suitability of protocol 7 for the genomic DNA extraction from vinegars. The
application of combined primer pairs targeting the Alphaproteobacteria class and AAB group allowed an in deep
15
th
266
analysis of vinegar community.

Table 1 Samples and physic chemical characterization

Table 2 Primers used in this study
Primer Sequence (5-3) E. coli
position
Reference
Alf28f ARCGAACGCTGGCGGCA 28-44 Ashelford et al., 2002
Alf684r TACGAATTTYACCTCTACA 684-702 Mhling et al., 2008
Alf28fmod AGCGAACGCTGGCGGCA 28-44 This study
Alf684rmod TACGAATTTCACCTCTACA 684-702 This study
WBAC1 GTCGTCAGCTCGTGTCGTGAGA
WBAC2 CCCGGGAACGTATTCACCGCG 1366-1386
Lopez et al., 2003
Table 3 DNA extraction methods tested in this study
Genomic DNA extraction method Basis
1) SDS Triton Use of detergent.
2) DNA clean kit Lysis by chemicals and enzymes (denaturing agents, detergents and proteinase
K); silica membrane in a spin column format.
3) Phenol Chloroform Remove of proteins.
4) Chelex Incorporation of chelating agent.
5) CTAB-PVP

Lysis by chemicals and enzymes (CTAB and proteinase K). Phenols
absorption (PVP).
6) Porebski Lysis by chemicals and enzymes (CTAB and Proteinase K). Use of surfacting
agent (B-mercaptoethanol). Phenols absorption (PVP). Remove of
polysaccharides by salt precipitation. Remove of proteins (Phenol
Chloroform).
7) Porebski modified Addition of washing step with saline EDTA/PVP before first step. Reduced
incubation time.

4. References
Muhling M, Woolven-Allen J, Colin Murrell J, Joint I (2008). Improved group-specific PCR primers for
denaturing gradient gel electrophoresis analysis of the genetic diversity of complex microbial communities. The
ISME Journal 2, pp 379392.
Jara C., Mateo E, Guillamon JM, Torija MJ, Mas A. Analysis of several methods for the extraction of high
quality DNA from acetic acid bacteria in wine and vinegar for characterization by PCR-based methods.
International Journal of Food microbiology, 128(2) pp 336-41, 2008.
Porebski S, Bailey GL., Baum BR. Modification of a CTAB DNA Extraction Protocol for Plants Containing
High Polysaccharide and Polyphenol ComponentsPlant Molecular Biology Reporter 15 (1), 1997.
Lopez I, Ruiz-Larrea F., Cocolin L, Orr E, Phister T, Marshall M, VanderGheynst J,. Mills DA. Design and
Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel
Electrophoresis. APPLIED AND ENVIRONMENTAL MICROBIOLOGY, pp 68016807, 2003.
Ashelford KE, Weightman AJ, Fry JC. (2002). PRIMROSE: a computer program for generating and estimating
the phylogenetic range of 16S rRNA oligonucleotide probes and primers in conjunction with the RDP-II
database. Nucleic Acids Res 30: 34813489.
5. Acknowledgment
This research was supported by a grant of Manodori Foundation, Italy. The authors thank the F. Cavalli vinegar
factory for providing samples and factory technical assistance.
Sample pH Acetic
acid (%)
Soluble
solids (%)
Cit K 2,69 6,65 28
7B
Acetifying grape cooked must for traditional balsamic
vinegar production 2,92 5,28 28
161 2,98 4,68 29
12 3,04 5,09 29
1 3,11 4,70 29
A
Acetifying grape cooked must for condiments
production
2,99 5,85 28
15
th
267
15
th
Study of Chemical and Molecular Information Related to NIR and IR
Spectroscopic Data for Processes and Products Control
Laura Marinoni (laura.marinoni1@unimi.it)
Dept. Molecular Sciences, University of Milan, Milan and CRA-FLC, Lodi, Italy
Tutor: Prof. Stefania Iametti; co-tutor: Dott.ssa Tiziana M.P.Cattaneo

This PhD project was scheduled divided in three main activity items. The first two (a; b) are here described. a)
Comparison between FT-NIR and FT-IR spectroscopy calibration systems for fat determination in not
homogenized raw milk samples; b) NIR spectroscopy prediction power in monitoring the milk-whey
fermentation by evaluating the lactose degradation and the lactic acid formation.
Interpretazione su Base Chimica e Molecolare delle Informazioni Contenute in Dati
Spettroscopici nel Medio e Vicino Infrarosso per lo Studio di Processi e Prodotti
Si riportano le prime due attivit del progetto di tesi di dottorato. Sono stati confrontati i sistemi di calibrazione
delle spettroscopie FT-NIR ed FT-IR nella determinazione del contenuto di grasso in latte crudo non
omogeneizzato. E stata inoltre verificata lapplicabilit della spettroscopia NIR nel monitoraggio del processo
fermentativo del siero di latte, valutando la degradazione del lattosio e la conseguente produzione di acido
lattico.

Key words: FT-NIR spectroscopy, FT-IR spectroscopy, scattering phenomenon, whey fermentation.
1. Introduction
In accordance with the PhD thesis project previously described (Marinoni, 2005), this poster reports the main
results of the realised activities concerning:
(A1) determination of fat in raw cow milk samples by MIR and NIT (Near Infrared Transmission)
spectroscopy and comparison of the two respective results on the basis of scattering phenomenon;
(A2) monitoring of milk-whey fermentation by NIT spectroscopy.
Individual raw milk samples (#173) were collected from 78 cows of three different breeds from 6 farms. Milk
composition was determined by using a Milkoscan FT2 (FOSS Italia, Padova) in the MIR spectral range, 926-
5000 cm
-1
, with 45 m pathlength cuvette. Transmission spectra (32 scan; resolution = 8 cm
-1
, 3 replicates)
were collected by using an FT-NIR NIRFlex N-500 (Buchi Italia, Assago, Milano) in the whole NIR spectral
range with 200 m pathlength cuvette. All measurements were performed at 40+1C. Whey fermentation was
performed on reconstituted whey (7%) with the addition of 1% of Lactobacillus plantarum colture (Remagni et
al., 2010). Aliquots were collected at fixed times. One hundred samples were analyzed by HPLC procedure for
lactose and lactic acid contents (Bouzas et al., 1991) and transmission spectra were collected at 30+1C as
previously reported. Spectral data processing was performed using Matlab R2009a (The Mathworks Inc., USA)
and PLS Toolbox 5.8 (Eigenvector, USA).
3.1 Determination of milk fat with MIR and NIT spectroscopy
PLSR (2 LV) was applied to spectral and chemical data obtained by Milkoscan (reference method) in order to
estimate the NIR ability in predicting fat content in milk samples. The best performance was obtained without
any spectra pretreatment (Fig. 1; R
2
val=0,97; SEP=0,14g/100g). VIP (Variable Importance in Projection) scores
were calculated for both MIR and NIR calibrations in identifying the most relevant variables (Fig. 2). Using
MIR, fat related wavenumbers were: 1750, 2860 e 2929 cm
-1
according to Williams (2001). In the case of NIT,
and on the basis of VIP scores without pretreatments, it was impossible to determine specific wavenumbers
related to milk fat. When EMSC algorithm (Enhanced Multiplicative Scatter Correction) was used as spectra
pretreatment, peaks at 4330 and 5216 cm
-1
were found as ascribable to the stretching of C-H and C=O groups
characteristic of milk fat (Williams, 2001). A possible explanation of this evidence is that fat globules are present
in milk as emulsion, with a size from 3 to 10 m, and generate scattering phenomena interfering in the NIR
range from 1000 and 2500 nm, causing a light dispersion in all directions (Cattaneo et al., 2009). This
phenomenon modifies milk spectrum in relation to the fat concentration.
15
th
268
15
th

The EMSC algorithm removes the contribution due to the scattering allowing a spectral interpretation on the
basis of the signal modification of the specific constituent. We can assume that in the case of milk fat, NIT
calibrations use the scattering phenomenon in spite of specific wavenumbers. These results were confirmed also
by two-dimensional correlation analysis (2D NIR-MIR; data not shown).

Figure 2 VIP scores for fat in MIR (a) and NIR region (b).
3.2 Monitoring of whey fermentation by NIR spectroscopy
By using chemical data obtained by HPLC procedure, PLSR was applied in order to estimate the NIT prediction
power for the determination of lactose and lactic acid contents in fermented milk-whey samples. In both cases
very good correlation was found after SNV (Standard Normal Variate) and 2
nd
derivative as pretreatments
founding R val=0.98 for the lactose and R val= 0.986 for lactic acid respectively (Fig. 3). RER (Range Error
Ratio) and RPD (Ratio Performance in Deviation) values obtained indicate that these results can be applied in
quality control for lactose determination and in protocols of screening for lactic acid (Williams 2001)

Figure 3 Correlation and validation curves for lactose (a) and lactic acid (b)
4. References
Bouzas J, Kantt CA, Bodyfelt F, Torres JA (1991) Simultaneous determination of sugars and organic acids in
Cheddar cheese by high-performance liquid chromatography, J. Food Sci. 56: 276-278.
Cattaneo TMP, Cabassi G, Profaizer M, Giangiacomo R (2009) Contribution of light scattering to near infrared
absorption in milk, J. Near Infrared Spectrosc.17: 337-343.
Marinoni L (2009) Biochemical matrices, intra and inter-molecular interactions, selective contributions of
absorption of milk constituents in NIR region. In Proc.s of the 14th Workshop on the Developments in the
Italian PhD Research on Food Science and Technology, Oristano (Italy), 16-18 Sept, 2009, pp. 417-418.
Remagni MC, Marinoni L, Ghiglietti R, Cattaneo TMP, Sviluppo di tecniche rapide per il monitoraggio di
processi fermentativi operati da L.plantarum per un miglior utilizzo di reflui di caseificio. In Proc.s of the
4 Simposio Italiano di Spettroscopia nel Vicino Infrarosso NIR ITALIA 2010, Sestri Levante (Italy), 13-14
May 2010, pp. 93-99.
Williams PC (2001) Near infrared technology in the agricultural and food industries. 2nd ed. Am, Ass. Cereal
Chemists, St. Paul MN.
Figure 1 Correlation and validation between
determination of fat content in milk samples by reference
method (Milkoscan) and NIR transmission spectroscopy.
a b
b a
15
th
269
15
th
Study of the compounds responsibles some quality in the coffee drink
Giovanni Mastronardi (giovanni.mastronardi@uniud.it)
Dept. Food Science and Technology, University of Udine, Italy
Tutor: Prof. Roberto Zironi

The aim of the present PhD thesis is to set the analitical methods in order to identify and quantify the main
aromatic precursors and the compounds responsible of cup off-flavours. The qualitative and quantitative
research of the mentioned compounds in the raw coffee, and that will be studied in the roasted coffee also, will
be useful to understand their possible combinations and their interactions according to different roast
technologies applied. Furthermore through the sensory analysis, it will be possible to understand their
organoleptic impact hightlighting how defects are responsible for the decreasing of quality coffee brew.

Key words: caffeine, chlorogenic acids, trigonelline, carboxylic acids

Studio dei composti responsabili della qualit nel caff tostato
Il presente progetto di tesi di dottorato mira a mettere a punto metodiche di analisi in grado di individuare e
quantificare i principali composti responsabili della qualit nel caff tostato. La ricerca qualitativa e
quantitativa di questi composti nel caff verde, che in seguito verranno ricercate nel tostato, sar utile per
comprendere il motivo delle loro possibili combinazioni e interazioni secondo diversi processi di tostatura.
Inoltre attraverso lanalisi sensoriale si potr capire il loro impatto organolettico mettendo in evidenzia possibili
difetti in tazza.

1. Introduction

Coffee is a drink that expresses its rich peculiar organoleptic characteristic into its sensory profile. Precisely one
of the most important criteria used for assessing coffee quality is based on cup sensory analysis. The coffee
aroma is the sensory characteristic that comes from a combination of positive and negative odours and tastes
conferred by interaction of specific chemical substances (Ramalakshmi K, et al., 2007). An important
contribution to the taste of coffee beverages is the amount of free acidity, bitter and astringency in the solutions
which varies in particular with the origin, botany, altitude, age of beans, degree of roasting of beans, and type of
fruit processing. The present study aims to understand also which roasting technique is possible to use in order to
eliminate partially or totally the compounds responsibles for of off-flavours and hopefully to develop the
formation of compounds responsibles of typical coffee.
In accordance with the PhD thesis project previously the poster reports the main results of the first two activities
concerning:
(A1) new procedures for determination of acids in coffee extracts (MOKA) by HPLC
(A2) new procedures for determination of pH and titratable acidity in coffee drink


The raw coffee sampling was performed in the Bahia State, in Brazil, during the 2008 harvest; raw coffees under
different post harvesting conditions were collected. The roasted samples will be analysed in order to identify
attributes (marker of quality and not quality) of coffee brew potentialy defective. For the carboxylic acids
analysis a solid-phase extraction (SPE) method was adapted to perform brewed coffee sample clean-up for
different organic acids. And determination by exchange cationic UV hight performance liquid chromatography.
A SAX anion-exchange sorbent was used for clean extract required prior to HPLC analysis. Column AMINEX
87HPX with temperature 65C conditioning and pressure 0.7mL/m were used. The pre-treatment with SAX
cartridge was tested with the aim of separating the acids ones. The cartridge (3mg/500mg) was preliminarily
conditioned with methanol (3mL) and redistilled water (3mL). Then the sample (0.5ml) adjusted to pH 9-10 with
1N NaOH. It was loaded and slowly eluted (0.5mL/min) throught cartridge. The acids were eluted with 0.5mL of
1N HCl (5 times). The fraction acidic compounds were diluited with the mobile phase to a final volume of 5mL,
filtered throught 0.22 m membrane and after injected in the HPLC with wavelength detector a 210Nm.
The misure of the pH and titratable acidity were determinated CRISON apparatus. The pH meter used was
calibrated at pH 4.0 and 7 with appropriate commercial buffer solutions. To determine the titratable acidity, 40
ml of coffee were neutralized with 0.05 M NaOH up to pH 7 using the automatic potentiometric titrator. The
40mL of coffee sample extracted MOKA was degassed under vacuum for 5 minutes with continuos agitation
and after the pH was monitored
15
th
270
15
th
3.1 Determination of the main carboxylic acids
Ion-exclusion chromatography is recognized as a useful technique for the separation of organic and inorganic
weak acids (Tanaka et al., 1999; Ohta et al., 1996; Klampf et al; 1997). Typically, resin-based polystyrene-
divinylbenzene columns in the H
+
form are used, combined with aqueous solutions of sulphuric acid as eluent.
For organic acids, the best separation was obtained with 0.0025M sulphuric acid. Using these conditions the six
compounds were separated in less than 20 minutes.
For each sample coffee green and roast, the mean content of the identified organic acids is reported in Table 1.
Table 1 Mean content of carboxylic acids in commercial coffee green and roast
Sample Citric acid Malic acid Quinic acid Succinic acid Lactic acid Acetic acid
(g/L) (g/L) (g/L) (g/L) (g/L) (g/L)
Coffee green A 1.95 0.89 ! 1.0 1.20 7.92
Coffee green B 1.72 0.80 ! 1.2 1.00 7.45
Coffee green C 1.65 0.76 ! 1.4 1.24 7.86
Coffee roast A 0.10 0.70 6.0 0.2 0.6 6.34
Coffee roast B 0.12 0.68 6.5 0.18 0.55 6.30
Coffee roast C 0.14 0.65 5.8 0.16 0.54 6.25
The concentration of Acetic acid is very high and is possible to express the acidity in g/L Acetic acid.
3.2 Determination Titratable acidity and pH
The pH of a coffee has been found to correlate with the perceived acidity in coffee the titratable acidity produces
a good correlation to perceived coffee acidity. Fig. 1 shows the experimental titratable acidity with different
samples with and withouth carbon dioxide in coffee.

Total acidity of a coffee brew, which is expressed by titratable acidity, has been demonstrated to show better
correlation with sourness and pH. The former calculated that, at pH 7, at least 99% of the coffee acids are
significant in the dissociated form. A correlation of acid taste with pH and titratable acidity was made using 8
brews roasted coffees and a good correlation coefficient (r
2
) of a linear regression of 0.96 with samples
withouth CO2, and 0.92 samples with CO2. A good correlation existed between acid taste and titrated (r
2
= 0.87).


Franca, A.S., Juliana C.F. Mendonca, Oliveira, S.D. (2005) Composition of green and roasted coffees of
different cup qualities (Brazil): LWT 38, 709-715.
Farah A., Monteiro M.C., Calado, V., Franca, A.S., & Trugo, L.C. (2006) Correlation between cup quality and
chemical attributes of Brazilian coffee. (Brazil): Analytical, Nutritional and Clinical Methods, 98, 373-380.
Nakabayashi, T. (1978a) Chemical studies on the quality of coffee. Changes in organic acids and pH of roasted
coffee. Food Science Technology ., 25, 142-6.
Ramalakshmi K, Kubra I.R., and Rao L.J.M. (2007) Physicochemical Characteristics of Green Coffee:
Comparison of Graded and Defective Beans. Journal of Food Science Vol 72, Nr.5.
Toci, T.; Farah, A. (2008) Volatile compounds as potential defective coffee beans markers. Food Chemistry 108,
pp. 1133-1141.
Figure 1: Effect of presence CO2 in different
samples and influence in total acidity expressed
meq/L NaOH 0,05M
15
th
271
15
th
Biotechnology, University of Napoli Federico II, Portici, 15-17 September, 2010

Effect of main ingredient on physical properties of fat-based filling
Nicoletta Antonella Miele (nicolettaantonella.miele@unina.it)
Dept. Food Science and Technology, University of Naples, Federico II, Portici, Italy
Tutor: Prof.ssa Silvana Cavella

The first activities of the PhD thesis project are described. The effect of main ingredients on physical properties
of fat-based fillings were studied. Whipping ability was also evaluated.
Effetto degli ingredienti principali sulle propriet fisiche di farciture
Le prime attivit del progetto di tesi di dottorato sono descritte. stato studiato leffetto degli ingredienti
principali sulle propriet fisiche di farciture. La possibilit di areare il prodotto stata anche valutata.

Key words: Filling, fat, sugar, rheological properties, squeezing
1. Introduction
In accordance with the PhD thesis project previously described (Miele, 2009), this poster reports the main
results obtained:
A1) Identification of foodstuffs;
A3) Model systems evaluation.
The aim of my PhD project is to develop healthy foodstuffs: fat-based filling. Generally, fat filling content is
between 30% and 60% (Birkett, 2009). In the last years partially-hydrogenated filling fats have been replaced
by blends of palm fractions (Talbot, 2009). Margarine has a lower saturated fatty acids content than palm oil
and a lower caloric value for its water content (30%). The partial replacement of fat could improve the
nutritional content of many products, even though could modify their rheological and sensory properties. Sugar
is the main ingredient of fat-based fillings. Sucrose and dextrose are the most used sugars in this type of
foodstuffs, they have the same caloric value but different sweetness. Sugar replacing enables a variety of
nutritional claims to be made. The aeration of filling helps to providing lower calorie alternatives (Birkett,
2009). In this work the effect of main ingredient on rheological properties, a
w
and whipping ability of fat-based
filling was investigated.
Samples were prepared using margarine (M) (Foglia Oro) or fractionated palm oil (P) (Master Martini);
dextrose monohydrate (D) (J.T. Beker) and/or powdered sucrose (S) (Eridania) (100, 75, 50, 25 and 0% of
dextrose, the complement was sucrose); with or without deionised water (W); soy lecitine (Lecinova). For each
sample fat/sugar ratio was equal to 0,73. The mixing was made using an emulsifier (Stephan electronic 2011
UMC 5), at 1500 rpm for 25 minutes at 20C. Water activity was measured by Rotronic HygroPalm (Rotronic
Co. Ltd., mod. AW1). Squeezing flow measurements, on samples of about 10mm height, were performed by
Instron Universal Machine (Instron Ltd., mod. 4467) at constant crosshead rate of 10 mm/min. The aeration
was made by whipping through a mixer (Phillips HR 1453) at the highest speed for 5 minutes and overrun was
evaluated (Bazmi et al., 2007). For each analysis five replication were performed.
3.1 Effect of main ingredients on rheological properties and water activity
Squeezing flow results are reported in figures 1 and 2. Sugar do not chemically react with fats, but they impart
products rheological characteristics (Helstad, 2006). Sugar addition to fat phase with a very low water content,
always determined an increased consistency of the product (Fig. 1a). When water was added, only 100%
dextrose samples presented a high consistency (Fig. 1b). Dextrose monohydrate gave a very compact structure
to the samples also in margarine-based samples; the sucrose, alone or mixed with dextrose, had a low
structuring effect (Fig 2a). Water had a negative effect also on margarine-based formulations according to
Wells (2009) (Fig. 2b). Rheological results suggest that dextrose and sucrose cannot be replaced by the same
substitutes. Water activity affects both filling stability and its compatibility with other foodstuff components.
Samples with sucrose had lower a
w
than samples with dextrose, when prepared both with margarine (0.8-0.9)
and palm oil (0.6-0.7).
3.2 Effect of main ingredients on whipping ability
Sugar reduced overrun both in palm and in margarine-based samples. Margarine-based samples with a high
15
th
272
15
th
Biotechnology, University of Napoli Federico II, Portici, 15-17 September, 2010

percentage of dextrose monohydrate had the highest overrun (40-55%), high percentage of sucrose determined
lower overrun values (20-30%). All palm-based samples had the same overrun values (20-30%). Water did not
affect overrun of samples.

Figure 1 Effect of main ingredients on palm oil-based samples.

Figure 2 Effect of main ingredients on margarine-based samples.
4. References
Bazmi A, Duquenoy A, Relkin P (2007) Aeration of low fat dairy emulsions: Effects of saturated-unsaturated
triglycerides. International Dairy Journal 17: 1021-1027.
Birkett J (2009) Fat-based centres and fillings. In Talbot G (Ed) Science and technology of enrobed and filled
chocolate, confectionery and bakery products, Cambridge: WP & CRC Press, pp 101-122.
Helstad S (2006) Ingredient Interaction: Sweeteners. In Gaonkar AG & McPherson A (Eds) Ingredient
Interactions: Effects on Food Quality, 2
th
ed, NW: CRC Press, pp 167-194.
Miele NA (2009) Healthy Food: Effect of Reduction or/and Substitutions of Some Ingredients on Structure and
Properties of Foodstuffs In Proc.s of the 14
th
Workshop on the Developments in the Italian PhD
Research on Food Science and Technology, Oristano (Italy), 16-18 September, 2009, pp. 423-424.
Talbot G (2009) Fats for confectionery coatings and fillings. In Talbot G (Ed) Science and technology of
enrobed and filled chocolate, confectionery and bakery products ,Cambridge: WP & CRC Press, pp 53-
79.
Wells M (2009) Controlling the rheology of chocolate and fillings. In Talbot G (Ed) Science and technology of
enrobed and filled chocolate, confectionery and bakery products, Cambridge: WP & CRC Press, pp 255-
284.
a
P PD
PS
P50D5
0S
P75D2
5S
P25D7
5D
0
500
1000
1500
2000
2500
3000
3500
0 0.001 0.002 0.003 0.004 0.005 0.006 0.007
displacement(m)
s
t
r
e
s
s

(
k
N
/
m
2
)
b
PW PDW PSW
P50D5
0SW
P75D2
5SW
P25D7
5SW
0
500
1000
1500
2000
2500
3000
3500
0 0.001 0.002 0.003 0.004 0.005 0.006 0.007
displacement (m)
s
t
r
e
s
s

(
k
N
/
m
2
)
a
)
b)
a
M
MD MS
M50D
50S
M75D
25S
M25D
75S
0
500
1000
1500
2000
2500
3000
3500
0 0.001 0.002 0.003 0.004 0.005 0.006 0.007
displacement (m)
s
t
r
e
s
s

(
k
N
/
m
2
)
b
MW
MDW MSW M50D
50SW
M75D
25SW
M25D
75SW
0
500
1000
1500
2000
2500
3000
3500
0 0.001 0.002 0.003 0.004 0.005 0.006 0.007
displacement (m)
s
t
r
e
s
s

(
k
N
/
m
2
)
a
)
b)
15
th
273
15
th
Quality Parameters of Crude Frying Oils Blends Available in the Italian
Market
Daniela Natale (daniela.natale2@unibo.it)
Tutor: Dr. Maria Teresa Rodriguez-Estrada

The activity carried out during the first PhD year, is here described. The aim was to investigate the key
parameters that can define the quality traits of crude vegetable oil blends, in particular those from the Italian
Market that are daily used for food frying. The oxidative and hydrolytic status of each oil blend was
characterized and defined, as well as the smoke point and the percentage of total polar compounds.
Parametri qualitativi degli oli da frittura presenti sul mercato italiano
In questo ambito viene riportata la prima parte del progetto di tesi di dottorato la quale ha avuto come obbiettivo
quello di indagare i parametri chiave capaci di definire lo stato qualitativo di miscele di oli vegetali presenti sul
mercato italiano e normalmente impiegate per la frittura degli alimenti. Ognuna delle miscele stata
caratterizzata al fine di individuare gli elementi compositivi ed stato monitorato sia il profilo ossidativo che
quello idrolitico. Per ognuna di esse stato determinato anche il punto di fumo ed stata rilevata la percentuale
di composti polari.

Key words: Quality; oxidative stability index; peroxide value; diacylglycerols; acidity value; total polar
compounds; smoke point.
1. Introduction
Deep-frying is one of the most popular food cooking techniques. In the first century A.C., the Roman writer
Pliny already described egg frying (Morton, 1998). This cooking techniques is widely used at industrial, small
and large restaurant, catering and domestic levels. The peculiar characteristics that frying provides to food (such
as texture, flavour and fragrance), lead to a very high consumers acceptability. Frying implies food immersion
in an oil bath kept at high temperatures (between 160C and 180C), in contact with air. This type of food
processing operation causes a series of physico-chemical modifications in both oil and food, which depend on
the nature of the oil, the type of food, the amount of food to be fried and the processing conditions (temperature,
time, holding conditions, oil exchange). Hydrolysis, thermoxidation and polymerization are the main reactions
that occur during frying, which induce a gradual decrease of the initial oil quality. These modifications can
generate a series of chemical compounds with adverse nutritional implications and potentially hazardous effects
for human health. Therefore, the evaluation of the quality of crude vegetable oil blends is a key approach, in
order to identify the most suitable strategies to delay their deterioration. In fact, refined vegetable oils with a
poor antioxidant content, are more prone to oxidative deteriorations during storage, marketing and, subsequently,
during deep-frying.
The aim of this paper was to evaluate some of the most important qualitative parameters in crude frying oil
blends available in Italian market and destined to home frying, in order to have an overall picture of their initial
quality status.
All crude oil blends for domestic frying that are available in the Italian market (seven), were purchased at
supermarkets. Table 1 reports the single oil that constitute the blends and their corresponding codes.
The oxidative stability of the commercial oil blends were measured with an eight-channel Oxidative Stability
Instrument (OSI, Omnion, IL) at 110C and 150 mL/min of flow rate under atmospheric pressure (Jebe et al.,
1993); the results are expressed as OSI time (in hours), which corresponds to the induction time period. Peroxide
value (PV) was determined according to NGD C35 (1979) and was expressed as meq O
2
/kg of oils. The acidity
value (AV) was determined according to NGD C10 (1976), and was expressed as percentage of oleic acid.
The fatty acid (FA) composition was determined according to the European Commission Regulation (EC, 2002).
Oils were transmethylated with 2 N KOH solution in methanol, added with tridecanoic acid methyl ester (C13:0)
as internal standard and analyzed by gas chromatography-flame ionization detector (GC-FID) as fatty acid
methyl esters. The determination of the diacylglycerol content (DAG) was carried out according to
Bortolomeazzi et al. (1990). Si-SPE fractionation was performed, adding dihydrocholestane as internal standard;
the last two eluted fractions were combined, taken to dryness, silylated (Sweeley et al., 1963) and injected into
15
th
274
15
th
GC-FID. Smoke point was measured with the Cleveland Instrument, according to NGD C77 (1989). Total polar
compounds (TPC) of crude frying oils were determined at 180 C using an oil sensor kit (Testo 265, Lenzkirch,
Germany); the instrument was immersed in hot oil at the frying temperature and TPC were measured as
percentage of polar compounds.
Table 1 Single vegetable oils that constitute the blends and their corresponding code.
CRUDE FRYING OILS COMPOSITION CODE
Sunflower oil, soybean oil, palm oil SO/SBO/PO
High-sunflower oil, sunflower oil SOHO/SO
Sunflower oil, hazelnut oil SO/HO
Sunflower oil, peanut oil SO/PeO
Palm oil, soybean oil, sunflower oil PO/SBO/SO
High-sunflower oil, rapeseed oil, sunflower oil HOSO/RO/SO
Palm oil, sunflower oil PO/SO

Frying oils had an OSI time that varied from 7 to 22 h, where PO/SO and SO/HO exhibited the highest OSI
value; this could be related to the elevated percentage of monounsaturated fatty acids (58 and 76% of total FA,
respectively) of these two blends. Most samples had a PV below 2 meq O
2
/kg of oil, except for 3 samples
(SOHO/SO, PO/SO, SO/HO), whose PV did not exceed 6 meq O
2
/kg of oil, though. AV of all crude frying oils
was below 0.5%, which is characteristic of refined oils. DAG ranged from 1.1 to 4.8, where PO/SO and
PO/BO/SO blends displayed the highest DAG percentage (4.8%); the latter is related to the extraction
technology of palm oil (Berger, 2005), which was used for the formulation of these frying oils. The smoke point
varied from 230 to 252, as related the FA composition of each frying oil. TPC varied from 9% to 18%, which
seems to be related to the DAG content (Bansal et al., 2010).

4. References
AOCS Official Method Cd12b.92. Oil Stability Index. The American Oil Chemists Society. Champaign (IL, USA).
Bansal G, Zhou W, Barlow JP, Lo HL, Neo FL (2010) Performance of palm olein in repeated deep frying and controlled heat
process. Food Chem 121: 338-347.
Berger K.G. (2005). The use of palm oil in frying. In: Frying Oil Series Malaysian Palm Oil Promotion Council.
Bonoli M, Caboni MF, Rodriguez-Estrada MT, Lercker G (2007) Effect of feeding fat sources on the quality of precooked
ready-to-eat fried and composition of lipids chicken patties. Food Chem 101: 1327-1337.
Bortolomeazzi R, Frega N, Lercker G (1990) Rapid determination of free and esterified sterols using prepacked silica
columns. Ital J Food Sci 2: 265-268.
EC (2002) European Commission. Regulation L128/14 2002 Official Journal of European Commission. May 15
th
2002.
Jebe TA, Matlock MG, Sleeter RT (1993) Collaborative study of the oil stability index analysis. J Am Oil Chem Soc 70:
1055-1061.
Morton ID (1998) Geography and history of the frying process. Grasas y Aceites 49: 247-249.
Norme Grassi e Derivati (NGD) (1979). Stazione Sperimentale degli Oli e dei Grassi, Milano. Metodo NGD C10 1976.
Sweeley CC, Beutley R, Mokita M, Wells WW (1963) Gas-liquid chromatography of trimethylsilyl derivatives of sugars and
related substances. J Am Oil Chem Soc 85: 2497-2507.

15
th
275
15
th
Release of aroma compounds in aqueous model systems containing
saccharides of different molecular complexity
Pierpaolo Piccone (ppiccone@unite.it)
Dept. Food Science, University of Teramo, Italy
Tutor: Prof.ssa Paola Pittia
Co-Tutor: Prof. Dario Compagnone
Rilascio di aromi in sistemi modello acquosi preparati con saccaridi a diversa
complessit molecolare
Nel presente lavoro sono brevemente descritti i risultati delle prime sperimentazioni previste nel progetto di
dottorato. Sono state messe a punto alcune tecniche per la valutazione della diffusivit di quattro esteri volatili in
sistemi modello binari (acqua-disaccaride-aroma, acqua-maltodestrine-aroma) e ternari (acqua-disaccaride-
maltodestrine-aroma) che presentano differenti caratteristiche chimiche e chimico-fisiche.
1. Introduction
The release of volatile compounds from food matrices is governed by kinetic and thermodynamic phenomena
(Cayot et al., 2008; Voilley & Souchon, 2006); both of them are affected by several compositional and
environmental factors as already described in Piccone (2009).
This poster is focused on the results of the study on the release kinetics of four volatile esters added to binary or
ternary model systems made with mono- or disaccharide and maltodextrins to evaluate the effects of physical
(viscosity) and physico-chemical (in particular, a
w
) properties.

2.1 Model systems
Sucrose, trehalose and glucose, maltodextrines (MD, DE 7-9), deionised water were used in different
concentrations to make up binary (water-sugar) and ternary (water-sugar-maltodextrin) model systems having
similar water activity values but different viscosity. Moreover, the ternary systems were prepared in order to
keep the same molarity of the mono- or disaccharide as in the correspondent binary system. For their
preparation, the sugar (trehalose, T, sucrose, S or glucose, G) and maltodextrins (MD) (only in the ternary
systems) were added to deionised water at 50C;. the solution was then mixed for 20 min. Upon cooling (20C)
an aliquote of a flavour compounds containing 4 esters at different molecular weight and hydrophobicity (ethyl
acetate-EA, ethyl butirate-EB, isopentyl acetate-IA, and ethyl hexanoate-EE) were added from a stock solution.
The final concentration of each aroma compound in the solution was 0,01% v/v for EA, EB and IA and 0,005%
v/v for EE.

2.2 Head Space-GC analysis (HS-GC) and computation of the index of aroma release kinetic
1 ml of solution was placed in a 10 ml airtight glass vial. A volume of 500 l of HS was taken at different times
after vial closure and analyzed by GC (PerkinElmer, model AutoSystem XL, Boston, MA, USA) connected with
a FID detector; a capillary column MegaWAX (PerkinElmer, Boston, MA, USA; inner diameter: 250 !m; length
25 m; particle size: 0,1-0,15 !m) was used; The gas carrier was H
2
with a pressure of 14 bar. Run conditions
were as follows: 40C for 2 min. and an increase of 5Cmin
-1
until a final temperature of 55C. Compounds
identification was carried out for comparison with standards. Measurements were done in triplicate.
For each aroma compound and model system, a GC-area vs equilibration time graph was obtained and data were
then fitted using the model proposed by Anese et al. (1999):

a A
a
!
= "

were ! represents here a coefficient of the aroma-matrix interactions (Pittia et al., 1997), a is the peak area of the
aroma at the time t and A is the peak area of the same aroma at equilibrium. For each volatile compounds, !
values were then reported as function of time and the angular coefficient of the interpolated straight line allowed
to obtain an index of the kinetic of the aroma release from the specific model system into the gas phase.

15
th
276
15
th
2.2 Viscosity measurement
Viscosity (") measurement were carried out by a falling ball viscosimeter (Thermo Haake Viscosimeter Falling
Ball C) . The kinematic viscosity of the solutions was calculated by the viscosity to density ratio and expressed
as centiStokes (10
6
m
2
s
-1
).
3. Results and discussions
Binary (G-water) model systems made with mono- and di-saccharides with a concentration up to 50% of solute
vary their water activity values from 0.999 to 0.946 and 0.950 for T and S and to 0.876 for G. Meanwhile, the
viscosity resulted to increase at increasing solute concentration and at similar saccharide content, G solutions
showed a viscosity lower than those of T and S in agreement with literature data (Chirife & Buera, 1997). The
presence of MD in the ternary systems did not meaningfully affected the water activity of the binary system
made with the same sugar whilst it significantly increased their viscosity.
The GC peak area as a function of time showed to fit the model proposed by Anese et al. (1999) (r
2
> 0.99) and
this allowed us to determine the kinetic index of the release in the gas phase (d) of the aroma compounds in the
various model systems. In general, the rate of the aroma release and the d values resulted to be influenced by the
molecular complexity and concentration of the saccharide as well by the viscosity and water activity of the
model systems. In binary solutions made with increasing concentration of T or S, where limited aw decrease and
viscosity increase occurred, only EE and EA showed a slower release rates, while EB and IA were not affected.
On the other hand, binary systems made with increasing concentration of MD besides a negligible aw change
(from 1: H2O to 0.991: 50% MD) showed a a significant decrease in the release rate (Figure 1) of all the esters.
This result could be related to the marked increase of viscosity but also to interactions occurring between the
MD and the aroma compounds that could limit their overall release. In ternary model systems were aromas were
in presence of both the saccharide and MD, competitive or sinerigistic effects occurred in increasing or
decreasing the rate of aroma release.
Glucose in the binary and ternary glucose solutions affected the release of the aroma compounds to a different
extent in respect to the model systems made with S or T at similar composition. This could be due to a higher
water binding capacity of this monosaccharide.

Figure 1: Index of aroma release kinetics (d) of the four esters and viscosity of MD binary model systems as a
function of the aw value
Anese M., Gormley R., Lerici C.R. (1996). Ricerca sulleffetto crioprotettivo di alcuni derivati lattiero-caseari in
relazione alla loro interazione con lacqua. Ricerche e innovazioni nellindustria alimentare. Vol. 2
Chiriotti Editore, Torino, 891-899.
Cayot N, Dury-Brun C, Karbowiak T, Savary G, Voilley A (2008). Measurement of transport phenomena of .
volatile compounds: A review. Food Res. Int., 41, 349-362.
Chirife J, Buena MP (1997). A Simple Model for predicting the Viscosity of Sugar and Oligosaccharide
Solutions. J. Food Eng., 33, 221-226.
Pittia P., Gambi A., Lerici C.R. Hygrometric measurements for the evaluation of the stability of model food
emulsions. Food Res. Int., 30, 177-184.
Voilley A, Souchon I (2006). Flavour retention and release from food matrix: an overview. Flavour in foods.
Cambridge: Woodhead Publishing Ltd, 31, 305 316.
15
th
277
15
th
Biotecnology, University of Naples-Federico II, Portici, 15-17 September, 2010
Wine yeast immobilization on food-like matrix for inoculated
fermentation
Rocchina Pietrafesa (rocchina.pietrafesa@unibas.it)
Dept. Biologia, Difesa e Biotecnologie Agro-Forestali, University of Basilicata, Italy
Tutor: Prof. Patrizia Romano
Co-Tutor: Dr. Francesco Cellini

The first two activities of the PhD thesis project are described. Firstly, setting up of spray-drying conditions such
as inlet and outlet air temperature, growth phases of yeasts and protective agents to use during the treatment.
Secondly, evaluation of cell viability in time after spray-dryer treatment and immobilization of fresh and dried S.
cerevisiae cells on Ca-alginate support in order to evaluate fermentative performance and production of
secondary compounds by biocatalyst.
Immobilizzazione su matrici food-like di lieviti di interesse enologico per la
fermentazione inoculata
Le prime due attivit del progetto di tesi del dottorato hanno riguardato la messa a punto delle condizioni di
essiccamento (spray-drying), quali la temperatura di ingresso e di uscita del ciclone, la fase di crescita dei lieviti
e gli agenti protettivi da usare durante il trattamento. Si studiata la vitalit cellulare nel tempo dopo il
trattamento di essiccamento, e limmobilizzazione di cellule fresche e secche di S. cerevisiae su supporti di
alginato di calcio per valutare lattivit fermentativa e la produzione dei composti secondari dei biocatalizzatori.

Key words: S. cerevisiae, immobilization, food-like support, inoculated fermentation.

1. Introduction
In accordance with the PhD thesis project, this poster reports some results of the first two activities concerning:
A1) Spray-drying for the dehydration of 11 S. cerevisiae strains and the optimization of drying conditions
(such as inlet and outlet air temperature) in order to assure the survival and activity of tested yeasts;
A2) Combined treatment of spray-drying and immobilization of yeast cells. Dried cells of the different yeast
strains will be immobilized on Ca-alginate support and, in comparison to their dried forms, were tested for:
assessment of cell viability in time after spray-dryer treatment (A2.1); efficacy of yeast immobilization by
evaluating the percentage of free cells in immobilized yeast samples after the treatment and during the time
(A2.2); fermentative performances of biocatalyst in synthetic grape must (A2.3). The expected results of
this phase are the selection of S. cerevisiae strains resistant to dehydration/immobilization treatments for the
successive steps.

Mini Spray-dryer B191 of Buchi was used to dry S. cerevisiae strains under study. The instrument settings: inlet
temperature, feed rate, spray air flow and aspirator flow are arranged to influence the product parameters:
temperature load, final humidity, particle size, yield (Luna-Solano et al., 2005). One selected strain was used as a
model to setting up the drying conditions. Parameters tested were: yeast growth phases (24, 48, 72 h) in YPD
liquid at 26C; protective agents (3% v/v): maltose, lactose, mannitol, starch, skim milk, prepared in aqueous
solution at 10%; inlet and outlet air temperature: 105-55C and 120-60C. After these preliminary tests, 10 S.
cerevisiae strains, chosen in function of different technological traits and of different origin, were submitted to
spray-drying treatment. The dried yeasts were rehydrated in 5% glucose aqueous solution for 30 min at 26C.
Cell viability was determined after plating on YPD agar and colony forming units (CFU) were counted. The
viability was determined immediately after dried treatment and during 6 months. Dried yeasts were stored in
vacuum packaging at low temperature (4C). Four strains of S. cerevisiae were chosen for immobilization
process. For immobilization, the experimental procedures of Ferraro et al., 2000 were used. The efficacy of
yeast immobilization was determined by plating sterile water of bead washing on YPD agar. Immobilized and
free cells were tested in inoculated fermentation in 100 ml of grape must. All fermentations were carried out at
26C. Experimental wine samples were collected and stored at -20C. By-products were determined by gas-
chromatography (GC Agilent 7890A), using a column packed with Carbopack BAW 5% and Carbovax 20M.
Helium was used as carrier gas at 20 ml/min. The column temperature was programmed from 70C to 160C .
The results were analyzed by Agilent Chemtation. Analysis of variance (ANOVA) was carried out using R 2.2.0
15
th
278
15
th
Biotecnology, University of Napoli Federico II, Portici, 15-17 September, 2010

Spray-drying treatment. The test was carried out on the selected strain used as a model, by varying physical
conditions of spray drying; protective substances and growth time. The results are shown in the figures 1and 2.
After spray-drying treatment, cells of 72 h exhibited the highest viability in skim milk as protective.
1,00E+00
1,00E+02
1,00E+04
1,00E+06
1,00E+08
1,00E+10
maltose lactose mannitol starch S.Milk
U
F
C
/
m
l
fresh cells dryed cells

Figures 1-2 Viability of fresh and dried cells in function of growing time (1) and protective agent (2).
Eleven S. cerevisiae strains were submitted to spray drying
treatment at 12060C and 105-55C, as inlet and outlet
temperatures, using two different protective agents: maltose
and skim milk. Cell viability was evaluated in time, after
different months of storage in the dry form (fig.3). Cell
viability differed in function of the strain: CD2-6sc2 showed a
low viability after two months in the dry form in comparison
to F15, RHONE2323, RB3-7sc2, SC2-37, SB5-18. Some
strains exhibited good cell viability in maltose, others in skim
milk. The temperatures used for the spray-drying treatment
resulted very important for cell viability and final humidity.
Inlet temperature of 120C and outlet of 60C produced dried
cells with a low final humidity (8%). As regards the protective
agents, maltose determined good results in cell viability during
storage time, but it underwent to caramelize. For this reason, skim milk was chosen for further tests, also for its
low cheap cost. On the basis of the results of the first phase, 4 strains were chosen in function of cell viability at
two storage months and regional origin: 4LBI3 from Basilicata; SC2-37 from Tuscany, RB3-7sc2 from Sicily
and F15 as commercial strain. These strains were submitted to dryer/immobilization in Ca-alginate treatment.
Fermentative performance. Fermentative vigour (FV) was measured at the 3
rd
day, fermentative power (FP) at
the 14
th
day of fermentation. All dried-immobilized strains showed low fermentative vigour. Strain behaviour in
the different forms (free, immobilized,
dried cells and combinations of the
forms) was evaluated by analyzing the
experimental wines for the content in
some by-products, related to the
organoleptic quality.
Analysis of by-products. Analysis of
variance (ANOVA), reported in table 1,
showed the existence of strain-specific
differences (p0.05) among the
experimental wines. The results of this
part underline the considerable influence
not only of the strain used in inoculated
fermentation, as expected, but also of
cell formulation of the starter.

4. References

Ferraro L, Fatichenti F, Ciani M (2000) Pilot scale vinification using immobilized Candida stellata cells and Saccharomyces
cerevisiae. Process Biochemistry, 35: 1125-1129.
Luna-Solano G, Salgado-Cervantes MA, Rodriguez-Jimenes GC, Garda-Alvarado MA (2005) Optimization of brewers yeast
spray drying process. Journal of Food Engineering, 68: 9-18.

Table1 ANOVA on by-products in function of the variables

0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
af ter treatment 2 months 4 months 6 months
S. MILK 120-60 S.MILK 105-55 MALTOSE120-60 MALTOSE105-55
Figure 3 Cell viability (%) in time: function of
protective agent and temperature.
15
th
279
15
th
Yeast populations in new vineyard in Linosa Island
Giuseppe Polizzotto (gambit1978@libero.it)
Dipartimento di Biotecnologie per il Monitoraggio Agro-alimentare ed Ambientale, Universit Mediterranea di
Reggio Calabria, Italia
Tutor Universitario: Dott. Onofrio Corona
Tutor IRVV: Dott. Daniele Oliva

The first two and part of the third activities of the PhD thesis have been described. A study of oenological
interest yeast population in experimental vineyard planted on Linosa island in 2008 year it has been carried out.
Isolation and first recognition were made by microbiological techniques through the use of culture media such as
WL Nutrient Agar and Lysine Medium. It was constituted a new collection of 400 different yeast isolates and 26
different yeast colonies morphologies at the microbiological level were identified. Molecular analysis for species
recognition by PCR-RFLP are currently underway
Popolazioni di lieviti in Campi Sperimentali di Nuovo Impianto sullIsola di Linosa
Si descrivono le prime due attivit e parte della terza del progetto di tesi di Dottorato. Estata effettuata
un'indagine delle popolazioni di lievito di interesse enologico in campi sperimentali impiantati nel 2008
sullisola di Linosa. Lisolamento ed un primo riconoscimento stato effettuato con tecniche microbiologiche
attraverso lutilizzo di terreni di coltura quali WL Nutrient Agar e Lysine Medium. E stata costituita una nuova
collezione di lieviti comprendente 400 isolati e 26 differenti morfologie della colonia sono state identificate a
livello microbiologico. Le analisi molecolari di riconoscimento delle specie tramite PCR-RFLP sono attualmente
in corso.

Key words: yeast, wine, microbiological techniques, PCR-RFLP.
1. Introduction
My PhD project aims to study yeast populations of oenological interest, particularly to the Saccharomyces genus,
in vineyards in a situation of geographical isolation, which limits the possibility of contamination by industrial
yeasts: to accomplish this, vineyard of Linosa Island was chosen.
In accordance with the PhD thesis project previously decribed (Polizzotto, 2009), this poster reports the main
results of the first two and a part of the third activities:
(A1) Development of techniques for microbiological and molecular analysis
(A2) Isolation and first recognition with microbiological techniques
(A3) PCR-RFLP ribosomal DNA
In the first six months of the PhD thesis project, my study was aimed to develop techniques for enological yeasts
microbiological investigation and methods of molecular analysis for a reliable determination of species and
strains. They are the PCR-RFLP of rDNA ITS regions for species identification and the analysis of
mitochondrial DNA restriction fragments length polymorphism (mtDNA-RFLP) for identification of strains. The
next six months of the project were dedicated to collect grape samples in Linosa and to realize micro-
fermentations and microbiological analysis. Finally, after forming a new yeast collection, for each colony
morphology one sample was subjected to PCR-RFLP for species assignment.
During July and August 2009, in two experimental vineyards and old plants in Linosa Island, 5 sampling for a
total of 15 samples, with weekly frequency, has been achieved. The grapes were stored in sterile bags, kept cold
and transferred to the IRVV laboratories (Palermo). The samples were weighed and pressed to obtain an
homogeneous must, 30 mL of juice were transferred to sterile tubes and left to ferment spontaneously at 28C
until they showed effervescence. The final residual sugar was assayed by Diabur-Keto-Test 5000 (Roche) kit.
In Linosa, spontaneous fermentations of harvested grapes were also performed and samplings were made both at
the beginning and at the end of fermentation. Both for must just pressed in the laboratory and for spontaneous
fermentations, appropriate serial must dilutions in 0.1% (w/v) peptone were spread onto WL Nutrient Agar
(Oxoid, Hampshire, UK) plates and onto Lysine Medium (Oxoid, Hampshire, UK) plates both with the 0.75%
biphenyl addition to slow the mold growth. After 5 days of incubation at 28C, plates with between 20-250
colonies were selected and counted by colony morphology and colour (Cavazza et al. 1992; Pallman et al. 2001;
15
th
280
15
th
Romancino et al. 2008). Different morphologies were observed to determine the per cent composition of the
yeast population. Afterwards a representative number of colonies was purified by streaking onto WL Nutrient
Agar plates until 30-100 isolates for sampling if possible. After 5 days of incubation at 28C collection tubes
were prepared by slant technique for storage at 4C. One sample for each morphology was analyzed by PCR-
RFLP (Granchi et al. 1999). PCR products were digested with appropriate restriction enzymes, HinfI, HaeIII,
DdeI (New England BioLabs, Hertfordshire, England). Restriction fragments and PCR products were solved
respectively on 2.0% and 1.5% (w/v) agarose gels electrophoresis in TBE buffer (44.5 mM Tris-HCl, 44.5 mmol
-
1
boric acid, 1 mmol
-1
EDTA; pH 8.0) at 100 V for approx. 3 h in a sub-cell GT DNA electrophoresis cell (Bio-
Rad Laboratories, Hercules, CA, USA). Gels were stained in 0.5 mg ml
-1
ethidium bromide solutions, destained
in water and photographed under UV transillumination using a Gel Doc 2000 (Bio-Rad Laboratories).
A total of 400 collection tubes were obtained and maintained at 4C to maintain viable yeast pupulations found
in the Linosa vineyards or related fermented musts. Colonies have been described based on several
characteristics such as color, elevation, surface, texture and cell morphology (Cavazza et al. 1992; Cavazza and
Poznanski, 1998; Pallman et al. 2001; Romancino et al. 2008). The description of the various morphologies on
WL was also enriched by the observation of their cells under a microscope. 26 different morphologies were
identified by Roman numerals. For each morphology one sample was subjected to PCR-RFLP for the genus
attribution. The most abundant morphologies observed are the I, II, III, VIII and XIV. The morphology I consists
of 40 isolates and it was observed both in new vineyards and in the old vines but not in spontaneous
fermentations carried out in Linosa. It has been detected in just pressed and never in the fermented must and
often, except in one case, it is the only morphology found in the samples. On WL this morphology present light
green color, smooth surface and convex elevation. The morphology II consist of 73 isolates and it was found in
old vines of the 1st, 2nd and the 5th sampling in just pressed but not in the fermented must. In spontaneous
fermentation realized in Linosa it appears both at the beginning and at the end of fermentation in different
percentages. This morphology on WL shows cream color, smooth surface, and convex elevation; the texture is
very creamy. The morphology III consists of 130 isolates and it was found in old vines at 2nd, 3rd and 5th
sampling both in just pressed and in the fermented musts. In spontaneous fermentation carried out in Linosa it
seems to disappear but two similar morphologies (XVI and XVII) are present. On WL this morphology typically
shows colonies contours irregular, flat elevation and deep green color as Hanseniaspora. The surface is smooth,
opaque and buttery texture. The morphology VIII was detected only in old vines and in just pressed must of 2nd
sampling. On WL this morphology typically shows regular contours, circular shape, flat elevations and white-
cream color. Surface is smooth, bright and creamy. The morphology XIV consists of 45 isolates and was found
in old vines at the 4th sampling both in just pressed and fermented musts and at the beginning of spontaneous
fermentation carried out in Linosa. On WL this morphology typically shows irregular contours, circular, convex,
darker green center and a lighter green edge. The surface is rough, opaque and buttery texture.
Preliminary data by PCR-RFLP identify morphology II and III as Saccharomyces and Hanseniaspora genera
respectively. The work will go on by PCR-RFLP analysis of enough colonies representative of population and by
strain identification of Saccharomyces isolates according to PhD thesis project.
4. References
Cavazza A, Grando MS, Zini C (1992). Rilevazione della flora microbica di mosti e vini. Vignevini 18(9): 17-20.
Granchi L, Bosco M, Messini A, Vincenzini M (1999) Rapid detection and quantification of yeast species during
spontaneous wine fermentation by PCR-RFLP analysis of the rDNA ITS region. J Appl Microbiol 87: 949-956.
Pallman J, Christina L, Brown James A, Olineka Tammi L, Cocolin Luca, Mills David A. e Bisson Linda F.
(2001). Use of WL medium to profile native flora fermentations. Am J Enol Vitic 52(3): 198-203.
Polizzotto G (2009). Studio delle popolazioni di lieviti in campi sperimentali di nuovo impianto sullIsola di
Linosa e loro impiego enologico. PhD thesis project dissertation. Dottorato di Ricerca in Biologia Applicata ai
sistemi Agroalimentari e Forestali XXIV Ciclo. Universit degli Studi Mediterranea di Reggio Calabria.
Romancino DP, Di Maio S, Muriella R, Oliva D (2008) Analysis of non-Saccharomyces yeast populations
isolated from grape musts from Sicily (Italy). J Appl Microbiol 105(6):2248-54.

15
th
281
15
th
Applications of catalytic transfer hydrogenation and dehydrogenation for
the synthesis of products of biological relevance
Elisabetta Putignano (Elisabetta.putignano@uniud.it)
Dept. of Chemical Sciences and Technologies, University of Udine, Via Cotonificio 108, Udine, Italy
Tutor: Prof. P. Rigo, Prof.W. Baratta
The results of the first two years work of the PhD thesis are described. The project deals with the utilization of
Ru(II) and Os(II) complexes, licensed by the working group, and the development of new catalytic systems for
the catalytic reduction of ketones, aldehydes and esters, and the alcohol dehydrogenation to ketones in order to
obtain products and intermediates of interest in food chemical and pharmaceutical industry.
Applicazioni dei processi catalitici di trasferimento di idrogeno e di deidrogenazione per
la sintesi di prodotti di interesse biologico
Sono descritti i risultati dei primi due anni di lavoro della tesi di dottorato di ricerca. Il progetto di ricerca
concerne lutilizzo di complessi di Ru(II) e Os(II), gi brevettati dal gruppo di lavoro, e lo sviluppo di nuovi
sistemi catalitici per la riduzione di chetoni, aldeidi ed esteri, e per la deidrogenazione catalitica di chetoni al fine
di ottenere prodotti e intermedi di interesse nellindustria alimentare e farmaceutica.

Key words: ruthenium, osmium, transfer hydrogenation, dehydrogenation, alcohols, ketones.
1. Introduction
In accordance with the PhD thesis project previously described (Putignano, 2009), this poster reports the main
results of the first two activities concerning:
(A1) the study of a new class of Ru(II) and Os(II) catalysts for the transfer hydrogenation (TH) of ketones to
alcohols;
(A2) the application of another class of Ru(II) and Os(II) catalysts, which were found extremely active in the
hydrogenation of ketones (Baratta et al., 2010), in the dehydrogenation (DH) of alcohols to ketones and
3-hydroxy steroids.

1.1. Transfer hydrogenation and dehydrogenation reactions
Alcohols and ketones are important components or precursors of food aromas, flavours and vegetal essences. A
fundamental reaction which was extensively investigated is the reduction of ketones and aldehydes to alcohols.
Hydrogen transfer reactions are widely used since they are operatively simple and safe using a hydrogen source
such as 2-propanol, which is cheap, non toxic and environmentally friendly (compared to THF or formic acid or
methanol). The catalytic dehydrogenation of alcohols leading to hydrogen (H
2
), is another attracting process,
entailing alcohols as feedstocks for energy production. By this way it is also possible to synthetize biologically
important substrates such as steroidal hormones and aromas (ketones and derivates).
All reactions were carried out under an argon atmosphere using standard Schlenk techniques. The solvents, the
ketones, and the alcohols were carefully dried by standard methods and distilled under argon before use.

2.1 Transfer hydrogenation of ketones
The in situ generated pincer complexes [general formula MCl(CNN')(PP), M = Ru and Os, PP = chiral
diphosphines)] were obtained by refluxing a 2-propanol solution of Ru(II) or Os(II) precursors with (R,S) chiral
diphosphines and (S) ligands. Typical procedure for the catalytic TH reaction: Ru(II) or Os(II) isolated complex
was dissolved in 2-propanol or the solution of the in situ catalyst was prepared. The ketone was dissolved in
2-propanol and the solution heated to 60 C under argon. By addition of base (NaOiPr) and the appropriate
volume of the solution of catalyst in 2-propanol, the reduction of the ketone starts immediately and the yield was
determined by GC (Varian GP-3380 gas chromatograph equipped with a MEGADEX-ETTBDMS-! chiral
column).

2.2 Dehydrogenation of alcohols and steroids
Typical procedure for the catalytic DH reaction: Ru(II) or Os(II) isolated complex [general formula
MCl
2
(PP)(diamine), M = Ru and Os, PP = achiral diphosphine: dppf], was dissolved in t-BuOH or in t-BuOH
15
th
282
15
th
and toluene. By addition of the substrate and KOtBu the solution was heated at 130 C for alcohols or 145C for
steroids under argon. The dehydrogenation reaction starts immediately and the yield of the product was
determined by GC and by
1
H NMR analysis.
In this study two classes of Ru(II) and Os(II) complexes has been investigated for TH and DH reactions. In
transfer hydrogenation, catalytic reactions were carried out first with the in situ generated catalysts, then with the
isolated complexes of general formula MCl(CNN')(PP) synthetized with the 2-naphthyl ligand (S) on account of
the high activity and enantioselectivity achieved. The Ru(II) and Os(II) complexes were found to efficiently
catalyze the enantioselective reduction of alkyl-aryl ketones to alcohols with high rate (TOF 10
4
-10
5
h
-1
) and ee
(up to 99 %), using a low amount of catalyst. Some alcohols obtained are of biological interest such as (R)-1-
phenylethanol, an aromatic ketone, (R)-3,5-bistrifluoromethyl phenyl ethanol, a pharmaceutical compound. In
the second part of this work, Ru and Os complexes of general formula MCl
2
(dppf)(diamine), isolated in our
group, were used in the acceptorless dehydrogenation of alcohols and 3-hydroxy-steroids to ketones and the
corresponding 4-en-3one derivates. In DH of "-tetralol, OsCl
2
(dppf)(diamine) and RuCl
2
(dppf)(diamine)
resulted extremely active as just observed in the reverse hydrogenation reaction (Baratta et al., 2010). In Table 1
are showed some of the most relevant results achieved.
Table 1 Catalytic DH of steroids (0.41 M) with the systems RuCl
2
(DPPF)(en) (Ru = 0.8 mol%), OsCl
2
(DPPF)(en)
(Os = 0.8 mol%) and Potassium-tert-butoxide (4 mol%) in t-BuOH (2 mL), toluene (1 mL) at 145 C

a
The conversion was determined by GC and
1
H NMR analysis;
b
turnover frequency (moles of alcohol converted into ketone
per mole of catalyst per hour) at 50 % conversion.

By this way were obtained a food additive, pharmaceutical agents, flavouring, and agrochemicals compounds.
Moreover, steroid hormones and their analogues are biological regulators, widely used in human, veterinary
medicine and in pharmaceutical industry. Some of this interesting products (ex. cholest-4-en-3-one), were
isolated with high yield and finally characterized by GC and
1
H and
13
C NMR analysis.
In summary, the Ru(II) and Os(II) catalysts described in the first system were active in the reduction of ketones
with very low loading (subtrate/catalyst ratio = 20000/1), and high enatioselectivity (up to 99% ee). Besides the
second system gave the dehydrogenation of several alcohols to ketones and 3-hydroxy-steroids with good yields.
Both allowed the synthesis of some of industrially relevant products on small and medium scale.
4. References
Almeida M L S, Kocovsky P, Backvall J-E (1996) Ruthenium-catalyzed Oppenauer-type oxidation of 3!-
hydroxy steroids. A highly efficient entry into the steroidal hormones with 4-en-3-one functionality, J. Org.
Chem. 61: 6587-6590.
Baratta W, Barbato C, Magnolia S, Siega K, Rigo P (2010) Chiral and nonchiral [OsX
2
(diphosphane)(diamine)]
(X:Cl, OCH
2
CF
3
) complexes for fast hydrogenation of carbonyl compounds, Chem. Eur. J. 16 : 3201.
Putignano E, (2009) Synthesis of biological and agrochemical products assisted by metal complexes. In Proc.s of
the 14
th
Workshop on the Developments in the Italian PhD Research on Food Science and Technology,
Parma (Italy), 16-18 September, 2009, pp. 429-430.
Bauer K, Garbe D, Surburg H (2001) Common fragrance and flavour materials, Weinheim (Germany): WILEY-
VCH.
Alcohol Conv. [%]
a
Time [h] TOF [h
-1
]
b
Conv. [%]
a
Time [h] TOF[h
-1
]
b

HO
99 20 15 99 20 15
HO
O

87 20 11 94 20 25
HO
86 36 3.5 95 20 7.5
15
th
283
15
th
Monitoring of Deoxynivalenol (DON), Ochratoxin A (OTA), Aflatoxin B1
(AFB1) in Italian commercial dry pasta showing a marketing for children
Assunta Raiola (assuntaraiola@hotmail.com)
Tutor: Prof. Alberto Ritieni

The project of PhD is focused on food safety and the exposure to mycotoxins by dry pasta addressed to childs is
described in this communication. In particular, 27 types of commercial dry pasta characterized by marketing for
children were analyzed, for quantifying Deoxynivalenol (DON), Ochratoxin A (OTA), Aflatoxin B1
(AFLAB1), widespread in durum wheat. Detected levels respect the limits for adults established by Reg. CE
n.1881/2006, but exceed limits fixed for children, in the case of DON, until to 225%. This work intends to
focus the attention on legislative ambiguity that defines children the consumers until only 3 years old.
Monitoraggio di Deossinivalenolo (DON), Ocratossina A, (OTA), Aflatossina B1
(AFB1) in pasta secca commerciale italiana rivolta al consumo per i bambini
Il progetto di dottorato focalizzato sulla sicurezza alimentare e in questa comunicazione descritta
lesposizione alle micotossine dalla pasta secca indirizzata ai bambini. Sono stati analizzati 27 tipi di pasta
secca commerciale con marketing per bambini, per quantificare Deossinivalenolo (DON), Ocratossina A (OTA
A), Aflatossina B1 (AFLA B1), diffuse nel grano duro. I livelli rilevati rispettano i limiti per gli adulti stabiliti
dal Reg CE n.1181/2006, ma superano quelli fissati per i bambini, nel caso del DON, fino al 225%. Questo
lavoro intende focalizzare lattenzione sullambiguit legislativa che definisce bambini i consumatori fino a
soli 3 anni det.
Key words: Deoxynivalenol , Ochratoxin A, Aflatoxin B1, pasta, children, legislative limit
1. Introduction
Deoxynivalenol, ochratoxins and aflatoxins are the mycotoxins most diffuse in durum wheat, produced mostly
by Fusarium graminearum, Aspergillus ochraceus, Aspergillus flavus. They have immunosoppresive,
haemorrhaging and carcinogenic effects. Reg. (CE) n.1881/2006 fixed limits for mycotoxin in baby foods and
cereals products for adults equal to: 200-1750!g/kg for DON, 0,5-3 !g/kg for OTA and 0,10-2 !g/kg for
AFB1. This communication describes: a) the analytic methods for the analysis of cited mycotoxins in samples
of Italian dry pasta showing small size and a marketing for children; b) the risk that can derive by ambiguity of
legislation: overtaking of security threshold, because of lower bodily weight in children and the different ability
to metabolize toxic compounds.
The extraction of DON was performed by adding CH
3
CN/H
2
O (84:16, v/v) to the grounded dry pasta. The
obtained phase was homogenized for 2 min at 2000 rpm by Ultraturrax and then filtered; the filtrate was
evaporated using a centrifugal evaporator and redissolved in CH
3
OH/H
2
O (70:30, v/v) before LC-S/MS
analysis (Santini et al, 2009). LC system consisting of two micropumps (Series 200, PerkinElmer, Waltham,
MA, USA); Gemini column (3 !m C
18
, 110 A, 150 x 4,60 mm; Phenomenex, USA) heated to 50C was used
and the flow rate was set to 0,8 ml/min. Mobile phase A was H
2
O/CH
3
OH (90:10, v/v) containing 5 mmol/l
ammonium acetate, while mobile phase B was CH
3
OH/H
2
O(90:10, v/v), containing 5 mmol/l ammonium
acetate. A binary gradient was applied: initial condition 10% B; 0-7 min, 35% B; 7-9 min, 80% B; 9-13 min
constant at 80% B; 13-15 min 100% B, returning to the initial conditions in 3 min. MS/MS data were obtained
using an API 3000 triple-quadrupole mass spectrometer (Applied Biosystems, Ontario, Canada). The
acquisition was conduced by selected reaction monitoring (SRM) both in the negative and positive ion mode.
The limit of detection (LOD) for DON was 1,00 !g/kg
.
OTA extraction was performed by adding CH
3
CN/H
2
O
60/40 (v/v) to the grounded dry pasta (Winnie et al, 2009). The obtained mixture was homogenized by
Ultraturrax and centrifuged. Surnatant was collected and diluted with PBS solution and the dilute extract was
filtered through RC 0,20 !m and then passed through the Ochratest (VICAM) column. Then, purified water
was passed through the OchraTest column, then eluted with methanol before HPLC analysis. The extraction of
AFB1 was obtained by adding CH
3
OH/H
2
O 80/20 (v/v) and NaCl to the grounded dry pasta. The obtained
mixture was homogenized by Ultraturrax and centrifuged. Surnatant was collected and dilute with purified
water. Dilute extract was filtered through RC 0,20 !m and passed through the Aflatest (VICAM) column. Then,
purified water was passed through the Aflatest column, then eluted with methanol before HPLC analysis.
15
th
284
15
th
HPLC (Shimadzu-Japan) was equipped with an autosampler SIL-20A, two pumps LC-20AD and a fluorimetric
detector RF-20AXL (OTA: "
ex
: 360 nm; "
em
: 460 nm, AFB1: "
ex
: 360 nm, "
em
: 440 nm). For OTA analysis, an
Onyx Monolithic column (3!m C18, 100 x 3,0 mm) (Phenomenex, USA) was used. Mobile phase was
isocratic: 65% A (H
2
O 1% CH
3
COOH), 35% B (CH
3
CN 1% CH
3
COOH). The flow rate was set to 1 ml/min.
For AFB1 analysis, a Gemini column was used. Mobile phase was isocratic: 95% A (H
2
O), 5% B
(CH
3
CN/CH
3
OH, 50/50 v/v). The flow rate was set to 1 ml/min. The limit of detection (LOD) was 0,05 !g/ kg
for OTA and 0,01 !g/ kg for AFB1.
The table shows the levels of mycotoxins sought in each sample of dried pasta. Regarding the DON, none of
the samples analyzed were above the legal limit set for the pasta addressed to adults. The highest level was
450,00 !g / kg, 7 samples exceeded the limit for children for more than 100% and 4 the samples analyzed were
above 100,00 !g / kg. Further 11 samples were contaminated at levels below 100,00 !g / kg, while 5 samples
were below LOD. These experimental results suggest that durum wheat used for pasta production for children
over 3 years is the same used for adults. Should consider two important aspects in this regard: the metabolism
of immature children over 3 years and reduced body weight in children than in adults, the same toxic substance
shows amplified in children. OTA was present in all samples, except one, at levels of 0,09 !g / kg 0,50 !g /
kg and were therefore below the legal limits for children, while AFB1 was absent in all samples. Over the next
year of the research project will study the bioavailability of mycotoxins mentioned in the dough as a child,
simulating the digestive enzyme system. In conclusion, it is necessary to clearly define the scope of the
regulation and should uniquely identify the term "children", which can not be attributed only to the youngest 3
years. Therefore it is desirable that the regulation imposes a limit on interim result of appropriate studies of
toxicity studies in each category of consumers.
Table Levels (!g/kg) of DON, AFB1 and OTA in 27 samples of commercial dry pasta

Sample Deoxynivalenol Ochratoxin A Aflatoxin B1
Factory 1 350,00 0,12 < 0,01
Factory 2 387,00 0,11 < 0,01
Factory 3 371,00 0,20 < 0,01
Factory 4 41,30 0,25 < 0,01
Factory 5 134,00 0,50 < 0,01
Factory 6 270,00 0,09 < 0,01
Factory 7 9,90 0,32 < 0,01
Factory 8 121,00 0,12 < 0,01
Factory 9 61,20 0,17 < 0,01
Factory 10 62,00 0,32 < 0,01
Factory 11 51,70 0,24 < 0,01
Factory 12 73,80 0,35 < 0,01
Factory 13 35,10 0,14 < 0,01
Factory 14 58,50 0,14 < 0,01
Factory 15 61,80 0,21 < 0,01
Factory 16 299,00 0,25 < 0,01
Factory 17 39,80 0,10 < 0,01
Factory 18 106,00 0,18 < 0,01
Factory 19 176,00 0,23 < 0,01
Factory 20 98,00 0,37 < 0,01
Factory 21 240,00 0,14 < 0,01
Factory 22 450,00 < 0,05 < 0,01
Factory 23 < 1,00 0,15 < 0,01
Factory 24 < 1,00 0,13 < 0,01
Factory 25 < 1,00 0,12 < 0,01
Factory 26 < 1,00 0,21 < 0,01
Factory 27 < 1,00 0,18 < 0,01
4. References
Reg. (CE) n. 1881/2006, 19 December 2006
Santini A., Ferracane R., Aragn A. and Ritieni A. (2009) Multitoxin extraction and detection of
trichothecenes in cereals; an improbe LC-MS/MS approach. J. Sc. Food Agric., 89: 1145-1153
Winnie NG, Mankotia M., Pantazopoulos P., Neil R.J., Scott P.M. and Lau B. P. (2009) Survey of dry pasta for
Ochratoxin A in Canada. J. Food Protect., 72: 890-893
15
th
285
15
th
Phytoestrogens: characterization and biological effects
Silvia Ricci (silviaricci.sr@libero.it)
Dept. of Ecological and Sustainable Economic Development, University of Tuscia, Italy

In this presentation, the results of the third activities planned within this PhD thesis project will be described. In
order to evaluate the biological effects of phytoestrogens (in particular of lignans), the effects of metabolite of
lignans in vitro on the human colonic cancer cells were investigated. The cytotoxicity and the antiproliferative
effects were evaluated than the cell cycle arrest and its relative protein expression were analyzed.

Fitoestrogeni: caratterizzazione ed effetti biologici

In questa presentazione, sono stati descritti i risultati della terza attivit prevista nel progetto di dottorato. Con lo
scopo di studiare gli effetti biologici dei fitoestrogeni (in particolare di lignani), si analizzato leffetto dei
metaboliti dei lignani in vitro su linee cellulari tumorali di colon. Dapprima sono stati valutati la citotossicit e
leffetto sulla proliferazione cellulare e successivamente sono stati analizzati il ciclo cellulare e lespressione di
alcune proteine ad esso correlate.

Key words: Phytoestrogens, lignans, functional food, antiproliferative effects, cell cycle.

1. Introduction
The Lignans are one of major class phytoestrogenic compounds. They are present in a wide range of oilseed
plants, vegetables and fruits. Nutritional intervention studies in humans and animals suggest that dietary
phytoestrogens have protective effects against menopausal symptoms and a variety of disorders, including
cardiovascular disease, cancer, hyperlipidemia, osteoporosis, and various forms of chronic renal disease. This is
supported by some animal, human and in vitro studies (Heinonen et al., 2001). This poster is addressed to the
evaluation of the biological effects of phytoestrogens (in particular of lignans) in accordance with PhD thesis
project previously described (Ricci, 2009). The main results of the third activities concerning the study of the
effect of different lignans in vitro on human cell lines.

2.1 Cell Lines, treatments and cell growth assay. HT29 and HCT8 human colon carcinoma cell lines with
colorectal and ileo-cecal oringin respectively, were obtained from ATCC. For the experiments, cells were seeded
onto plates and allowed to adhere for 24h. Lignans (Sigma Chemical), SECO (secoisolariciresinol), MAT
(matairesinol), END (enterodiol), ENL (enterolactone), SDG (secoisolariciresinol diglucoside) was dissolved in
DMSO (250 mmol/L) and stored at -20C. Then the medium was replaced with fresh medium supplemented
with 150 mol/L of lignans. The effects of this compound on cell proliferation were determined by the BrdU
cell proliferation kit (Roche). The technique is based on the incorporation of the pyrimidine analogue BrdU into
the DNA of proliferating cells. After its incorporation into DNA, BrdU is detected by an immunoassay. Bound
anti-BrdU-POD is detected by a substrate reaction, then quantified by a microplate reader (Tecan Infinite F200,
Germany).
2.2 Cytotoxicity assay. The viable and nonviable cells were discriminated by tripan blue dye exclusion. The
viable cell numbers in treated cells were compared with that in vehicle controls.
2.3 Cell cycle analysis. Cell cycle was analyzed by iodure propidum (PI). The floating and trypsinized adherent
cells were collected and washed with PBS. The cell pellets were resuspended in 300 L of PBS and finally the
cells were stained with 0.5 l/ml of PI solution for 30 min and incubated at 4C. Fluorescence intensity was
analyzed by a FACScalibur flow cytometer (Becton-Dickinson).
2.4 Western blot analysis. Triton lysis buffer was used to extract protein from treated cells. Protein
concentration was measured by spectrophotometer (BioRad Protein Assay Dye Reagent Concentrate). Cell
proteins was electrophoresed on 12% SDS polyacrylamide gels and transferred to pure nitrocellulose membrane.
The membrane was blocked in 5% non-fat dry milk overnight at 4C and washed with 0.5% PBS- tween 6 times
for 5 min each time. The membrane was incubated with rabbit polyclonal IgG against cyclin D1 and then with
another specific IgG P21 (Santa Cruz Biotechnology) for 1 h at room temperature. The control used was
GADPH. After washing, the membrane was incubated in anti-rabbit IgG of cyclin D1, P21 and GDPH for 1 h at
room temperature. Bands were detected by a photograph plate.

15
th
286
15
th
2.5 Statistical analysis.
All values were given as mean SD. Differences between two groups were analyzed by unpaired Students t-
test. Values of P < 0.05 were considered significant.

Figure 1 shows the effect of treatment with lignans at 150 mol/L for 24 and 48h on the growth of HT29 and
HCT8 cells. It can be observed that treatment decreases in cell numbers compared with the control. The
inhibition increased in HCT8 cell because they are in a different state of differentiation compared with HT29.
The reduction in cell numbers did not seem to be due to toxicity because cell viability was not changed by any of
the treatments, as shown by trypan blue assay (Data not shown). The concentrations of lignans used in this study
are high relative to plasma levels in humans or animals (Hausott et al. 2003). We can justify the high
concentration used because they are also physiological. In fact levels of lignans metabolites in plasma are low
because of their efficient enterohepatic circulation. High concentration of metabolite lignans therefore, might be
achievable in the enterocytes of the gut lumen where lignans are hydrolyzed by intestinal flora and then absorbed
(range M). This is the first report to document that lignans inhibit proliferation and induce the arrest of cell
cycle in HT29 and HCT8 cells.

Figure 1 Effects of 150
!mol/L lignans on the
growth of HT29 and
HCT8 cells. Values are
means SD of 4
different experiments,
results are significant P
0.05.

Figure 2 shows the percentage of cells HT29 and HCT8 in G1 phase after treatment with lignans at 150 !mol/L
and various times of exposure. DNA flow cytometry profiles indicated that G1-phase was significantly increased
with lignans treatment. It can be observed for in the human colonic cancer cell lines HT29 and HCT8. Hence, the
effect of lignans on cell cycle regulatory molecules that are operative in the G1 phase of cell cycle is examined.
G1 to S cell cycle progression is controlled by several CDK complexes, including cyclinD1/CDK4 and
cycline/CDK2. The activities of these complexes, are dependent on the balance of cyclins and CDK inhibitors
(CKI), such p21 and p27. In this experiments, we decided to observe the behaviour of cyclin D1 and p-21
proteins. Figure 3 shows the level of cyclin D1 was lower in cells treated with lignans 150M in HT29 and
HCT8 cells in relation to the control sample. P-21 protein level resulted increased in cells treated with lignans,
especially in HT29 cells.
Figure 2 Effects of 150
!mol/L Lignans on cell cycle
arrest in HT29 and HCT8
cells at G1 phase. Values are
means SD of 4 different
experiments, results are
significant P 0.05.
Figure 3 Effects of 150 !mol/L Lignans on cyclin D1 and P21 protein levels in HT29 and HCT8 cells. Values are means
SD of 4 different experiments, results are significant P 0.05.

4. References
Hausott B, Greger H, & Marian B (2003) Naturally occurring lignans efficiently induce apoptosis in colorectal tumor cells J.
Cancer Res. Clin. Oncol. 129: 569576.
Heinonen S, Nurmi T, Liukkonen K (2001) In vitro metabolism of plant lignans: New precursors of mammalian lignans
enterolactone and enterodiol. J Agric Food Chem; 49(7):3178-86.
Ricci S (2009) Phytoestrogens: characterization and biological effects. In Proc.s of the 14
th
Italian PhD Research on Food Science Technology and Biotechnology, Oristano (Italy), 16-18 September, 2009, pp. 431-432.
HT29
0
0,2
0,4
0,6
0,8
1
24 h 48 h
ABS
CTR
END
ENL
MAT
SECO
SDG
HCT8
0
0,2
0,4
0,6
0,8
1
24 h 48 h
ABS
CTR
END
ENL
MAT
SECO
SDG
HT29
0
20
40
60
80
100
120
140
160
24 h 48 h
%
G
1
-p
h
a
s
e
Ctr
END
ENL
MAT
SECO
SDG
HCT8
0
20
40
60
80
100
120
140
160
24 h 48 h
%
G
1
-
p
h
a
s
e
Ctr
END
ENL
MAT
SECO
SDG
HT29
0
0,2
0,4
0,6
0,8
1
Cyclin D1 P21

G
A
P
D
H
/
P
r
o
t
e
i
n

t
a
r
g
e
t
Ctr
END
ENL
MAT
SECO
SDG
HCT8
0
0,2
0,4
0,6
0,8
1
Cyclin D1 P21

G
A
P
D
H
/
p
r
o
t
e
i
n

t
a
r
g
e
t
Ctr
END
ENL
MAT
SECO
SDG
15
th
287
15
th
Characterization and technology of beer obtained from emmer malt
(Triticum dicoccum)
Selene Salvi (s.salvi@univpm.it)
Dept. S.A.I.F.E.T., Marche Polytechnic University Ancona, Italy
Tutor: Prof. N.G. Frega
The preliminary part of this PhD project provides the study of the evolution of the basic chemical parameters as
a tool to optimize the production process of an innovative type of craft beer obtained from 100% organic emmer
wheat (Triticum dicoccum). A light and a double malt beer were produced using two ecotypes of emmer wheat,
grown and malted in the region of Marche and processed in a local microbrewery. The chemical-analytical and
sensory profile of beers (together with the phenolic and -glucan content) was compared with industrial and craft
beers.
Caratterizzazione e tecnologia della birra ottenuta da malto di farro dicocco
(Triticum dicoccum)
La parte preliminare della tesi di dottorato prevede lo studio
dellevoluzione dei parametri chimici di base come strumento per
ottimizzare il processo di produzione di uninnovativa tipologia di
birra artigianale ottenuta dal 100% di farro dicocco (Triticum
dicoccum). Sono state prodotte una birra light ed una birra doppio
malto utilizzando due ecotipi di farro dicocco coltivato e trasformato
nelle Marche. Il profilo chimico-analitico e sensoriale delle birre da
farro (compreso il contenuto di polifenoli e di -glucani) stato
confrontato con quello di altre birre, sia industriali che artigianali.
Key words: emmer wheat, beer, food analysis, sensory analysis.
1. Introduction
Emmer wheat (Triticum dicoccum) is a widely spread cereal crop in
the Central Apennines (Italy), due to its low agronomic requirements
and adaptability to the cool climate of the hilly and marginal areas of
the region of Marche. The use of emmer wheat for beer production
in Marche has been studied both from the analytical and processing
point of view.
In accordance with the PhD thesis project previously described, this
poster reports the main results of the activities concerning brewing
of a 100% emmer wheat beer in the frame of a regional project (LR
37/99):
Operative conditions of the malting process of ecotypes in a pilot
malting plant (20 q)
Craft brewing of two different ecotypes of emmer wheat malt in a
microbrewery.
Monitoring the phenolic and -glucan content during the brewing
process and beer conditioning and storage (up to 95 days)
Sensory analysis
Comparison of emmer wheat beers with conventional beers
Two different ecotypes of emmer wheat were tested as possible raw
materials for beer production (Monterosso select and Zefiro). The
brewing process is summarized in Fig.1. Malt samples were
collected and characterized to identify their brewing aptitude
according to Analytica-EBC (2008). After top fermentation (5 days
at 18-20 C), the beer was stored at 0C in stainless steel tanks under
its CO
2
atmosphere without pasteurization. The sensory analysis was
performed both by a non-trained and trained panel.
Fig 1. Flow-sheet of the beer production and
sampling plan (S).
Emmer wheat
Steeping
(24h; 20/25C)
Wet emmer wheat
Green malt
pilsen malt
Germination
(5 days 18/22C)
Kilning
(20h; 45/78C)
Water
Air
Foams
Waste water
Cold air
Heat
CO2
Hot air
Moisture
Hot air
Grain
husks
Water
Hop
Milling
Mashing
3.5 hours (45/78C)
Sparging
Boiling1 hour 100C
Cold conditioning (16C)
grist
Water
Green beer
Transfer in a secondary vessel
S. cerevisiae
Spent yeast
(dregs )
Beer
Top fermentation
5d (18/20C)
Keg storage (0 C)
Wort areation
Secondary fermentation or maturation
Spent
grain
Filtration
s
s
s
s
Whirlpool
Wort
s
s
s
15
th
288
Emmer wheat is permitted as a raw material for brewing according to Italian legislation (Law n. 1354 of
16/08/1962) since beer may be produced with any type of cereal.
3.1 Emmer wheat and malt analysis
The two ecotypes of emmer wheat (EW) showed a germinative energy similar to that of barley (higher than
85%) and are therefore both suitable for the malting process. The protein content of EW was similar or high
(ranging from 11.1% w/w of hulled EW to 16.2% dehulled EW) compared to that usually reported for barley
(from11.25% to12.5%) (Lewis MJ, 2006). The diastatic power of EW pilsen malt was in the range recommended
by EBC (from 220 to 600 WK). From these results it may be concluded that EW can be a good raw material for
the production of a 100% EW malt beer.
3.2 Chemical characterization and sensory analysis of emmer wheat beers
a
b
c
d
Fig. 2. a, b evolution of -glucans and phenolic compounds during brewing and conditioning, c, d comparison of EW light
beer and EW double malt (dm) beer to other conventional beers.
Two types of EW beer were produced, a light (2.9% v/v;
10.7P) and a double malt (dm) beer (5.4%v/v; 15.9P).
The -glucans content decreased during brewing and
conditioning in both EW beers, whereas the phenolic
compounds showed a fluctuating trend. The double malt beer
showed a higher amount of both these components. The
sensory panel judged EW dm beer more bitter, astringent and
acid than a Weiss (wheat) beer, but the chemical analysis
showed a bitterness value (IM) double in Weiss beer than EW
dm beer (11.8 BU and 5.4 BU, respectively) due to the
different hops content. EW dm beer was also less fruity, honey
and sweet than Weiss beer. The amount of total carbohydrates
was higher in Weiss beer than dm beer (32 g/L and 27 g/L,
respectively). Future work will be devoted to improving the
sensory quality of EW beer by testing different blends of EW and barley malt. Further analysis will be performed
in order to identify and quantify volatile and phenolic compounds in EW beers.
4. References
European Brewery Convention (2008 ) Analytica-EBC Hans Carl, Nuremberg, Germany.
Law n. 1354 of 16/08/1962 amended by law 329/74 and 141/89, by DL 109/92 and by DPR n. 272/98.
Lewis MJ, Bamforth CW (2006) Essays in brewing science. Springer, Berlin, Germany.
L.R. 37/99, Regione Marche, Italy, Progetto di ricerca e sperimentazione n. 1- Birra da farro
0
1000
2000
3000
4000
5000
m
g
/
L
-glucans
EW dm EW light
0
20
40
60
80
100
120
m
g
/
L
phenolic compounds
EW dm EW light
0
1000
2000
3000
4000
m
g
/
L
-glucans
0
50
100
150
200
m
g
/
L
phenolic compounds
0,0
5,0
10,0
fruity
honey
sweet
yeast
malt
acid
bitterness
astringent
foam
sensory analys
double malt emmer wheat beer weiss beer
Fig. 3. Sensory profile of dm EW beer compared to
Weiss beer (trained panel)
Emmer wheat is permitted as a raw material for brewing according to Italian legislation (Law n. 1354 of
16/08/1962) since beer may be produced with any type of cereal.
3.1 Emmer wheat and malt analysis
The two ecotypes of emmer wheat (EW) showed a germinative energy similar to that of barley (higher than
85%) and are therefore both suitable for the malting process. The protein content of EW was similar or high
(ranging from 11.1% w/w of hulled EW to 16.2% dehulled EW) compared to that usually reported for barley
(from11.25% to12.5%) (Lewis MJ, 2006). The diastatic power of EW pilsen malt was in the range recommended
by EBC (from 220 to 600 WK). From these results it may be concluded that EW can be a good raw material for
the production of a 100% EW malt beer.
3.2 Chemical characterization and sensory analysis of emmer wheat beers
a
b
c
d
Fig. 2. a, b evolution of -glucans and phenolic compounds during brewing and conditioning, c, d comparison of EW light
beer and EW double malt (dm) beer to other conventional beers.
Two types of EW beer were produced, a light (2.9% v/v;
10.7P) and a double malt (dm) beer (5.4%v/v; 15.9P).
The -glucans content decreased during brewing and
conditioning in both EW beers, whereas the phenolic
compounds showed a fluctuating trend. The double malt beer
showed a higher amount of both these components. The
sensory panel judged EW dm beer more bitter, astringent and
acid than a Weiss (wheat) beer, but the chemical analysis
showed a bitterness value (IM) double in Weiss beer than EW
dm beer (11.8 BU and 5.4 BU, respectively) due to the
different hops content. EW dm beer was also less fruity, honey
and sweet than Weiss beer. The amount of total carbohydrates
was higher in Weiss beer than dm beer (32 g/L and 27 g/L,
respectively). Future work will be devoted to improving the
sensory quality of EW beer by testing different blends of EW and barley malt. Further analysis will be performed
in order to identify and quantify volatile and phenolic compounds in EW beers.
4. References
European Brewery Convention (2008 ) Analytica-EBC Hans Carl, Nuremberg, Germany.
Law n. 1354 of 16/08/1962 amended by law 329/74 and 141/89, by DL 109/92 and by DPR n. 272/98.
Lewis MJ, Bamforth CW (2006) Essays in brewing science. Springer, Berlin, Germany.
L.R. 37/99, Regione Marche, Italy, Progetto di ricerca e sperimentazione n. 1- Birra da farro
0
1000
2000
3000
4000
5000
m
g
/
L
-glucans
EW dm EW light
0
20
40
60
80
100
120
m
g
/
L
phenolic compounds
EW dm EW light
0
1000
2000
3000
4000
m
g
/
L
-glucans
0
50
100
150
200
m
g
/
L
phenolic compounds
0,0
5,0
10,0
fruity
honey
sweet
yeast
malt
acid
bitterness
astringent
foam
sensory analys
double malt emmer wheat beer weiss beer
Fig. 3. Sensory profile of dm EW beer compared to
Weiss beer (trained panel)
15
th
289
15
th

The utilization of Solid Carbon Dioxide in the Production of
Extravirgin Olive Oil
Chiara Sanmartin (csanmartin@agr.unipi.it)
Dip.to Biologia delle Piante Agrarie,DBPA, University of PISA, Italy
Tutor: Prof. Gianpaolo Andrich

This PhD thesis aims to compare the extraction of olive oil carried out adding CO
2,(s)
to olives and/or olive paste
with the more traditional technology.
The product yield and the main indexes usually employed to evaluate oil quality, will be applied to characterize
oils extracted with or without CO
2,(s)
. The experimental results would be possible to individuate the best values
to be assigned to the working parameters (ratio between amount of cryogen added and weight of used olives;
temperatures used during the different working steps; possible use of modified atmospheres during the extraction
process; ecc).

Lutilizzo della neve carbonica nella produzione di olio extravergine di oliva

Valutare leffetto delladdizione di CO
2,(s)
direttamente alle olive e/o alla pasta da queste ottenuta, costituisce lo
scopo della presente tesi di dottorato. Resa estrattiva e principali caratteristiche chimico-composizionali ed
organolettiche degli oli ottenuti, permetteranno di confrontare questa tecnologia innovativa con la pi
tradizionale tecnica estrattiva.
I risultati sperimentali permetteranno di individuare i migliori valori da assegnare alle principali variabili
operative (rapporto quantit criogeno addizionato/peso olive lavorate, temperature cui condurre le fasi di
processo, eventuale impiego di atmosfere modificate in lavorazione, ecc.) per esaltare le potenzialit produttive
legate allimpiego del criogeno nella produzione di olio extravergine di oliva di elevata qualit.

Key words: extravirgin olive oil; carbonic snow; cryomaceration; product quality
1. Introduction
According to the working progress planned for this research project (14
th
Italian PhD Research on Food Science Technology and Biotechnology, University of Oristano, 16-18
September, 2009), the main preliminary results concerning the three first steps of the planned program:
A1) Structural and chemical characterization of the olive fruits experimentally used;
A2) Experimental extractions of olive oils carried out adding or not the cryogen to the used fruits. An
innovative equipment suitably modified to allow the utilisation of carbonic snow during oil extraction has been
utilised;
A3) Chemical and sensorial characterization of extracted oils;
will be presented and discussed.
These first extraction runs were carried out utilising a micro oil mill (Oliomio Baby , Toscana Enologica
Mori), which is able to mill 2030 kg of olives, and it was suitably modified to allow the addition of carbonic
snow directly to olive fruits and/or to their paste.
The main process steps followed by this micro oil mill, can be so schematically presented: olives properly
cleaned and washed, are poured into the receiving hopper, where a screw feeds the crusher equipped with a
hollow knife impeller. The produced paste falls into the lower mixer, where an helicoidally shaped stirrer
promotes its malaxation, the temperature reached by the paste is maintained in the wished range by a thermal
regulation system (temperature sensor put inside the olive paste, connected with an heat exchanger). The wished
flow of the olive paste is then sent to a biphasic decanter by a pump equipped with a speed change gear. The
decanter (4200 rpm) promotes the separation of oil from the solid parts of olive mixed with vegetable water plus
the fraction possibly added to allow an efficient separation of these two phases.
The separation efficiency of this decanter can be enhanced by a suitable regulation of its nozzles, which
determine the point of oil picking and then also the purity degree of the product.
The main characteristics (carpological properties, harvest index, moisture and oil contents) of used fruits were
determined, according to the analytical procedures reported by Mincione (2007) and Uceda/Frias (1975).
15
th
290
15
th

Different percentages of selected olive fruits (30 kg) belonging to several cultivars (Leccino, Frantoio and
Correggiolo), hand-picked and accurately washed, were initially charged inside the hopper.
To allow a credible comparison between the results obtained in the presence or in the absence of solid CO
2

during the oil extraction process, the olive fruits utilised in these two experimental runs (! 60 kg) were
preliminary and suitably mixed to ensure homogeneous feeds.
The analytical characterisation of extracted oils (acidity, peroxide number, spettrophotometer indexes, total
phenol content) were carried on according to the conventional analytical procedures (Capella et al., 1997; Tateo
and Bononi, 2004).
The preliminary activity related to make the necessary changes to the experimental apparatus used and to
optimise the milling parameters to be adopted, takes a considerable time. In fact, the management and the use
of cryogen, the control system of temperatures of the different extraction phases, the individuation of an
efficient monitoring system of the main working variables, were accurately examined to obtain an efficient and
reliable experimental apparatus. So it was possible to carry on only a reduced number of preliminary
experimental runs.

4. References
Capella P.. Fedeli E.. Bonaga G.. Lercker G. Il manuale degli oli e dei grassi. tecniche nuove. 1997
Tateo F.. Bononi M.. Guida allAnalisi Chimica degli Alimenti vol. 3. Oli e Grassi Vegetali. ARS Edizioni
Informatiche Milano. 2004.
Uceda. M.. Frias. L. (1975). 'Harvest dates. Evolution of the fruit oil content. oil composition and oil quality'.
En: Proceedings del Segundo Seminario Oleicola Internacional. COI. Cordoba. Pag: 125-128

added CO
2(s)

(kg/30kg of olives)
0 4.0
olives 12.4 14.5 ! -1.6
Temperature (C)
paste 26.8 25.5
malaxation 2400 2400
time (s)
extraction 3900 4200
water added
(m
3
s
-1
)
1.1310
-4
1.0310
-4

oil extracted
(kg of oil/kg of olives)
0.132 0.138
acidity of extracted oil
(% oleic acid)
0.180.01 0.190.01
peroxide number
[meq O
2
/kg of oil]
1.690.30 1.690.10
K
232
1.57 1.64
K
270
0.13 0.15
"K 110
-3
710
-4

moisture content (%) 0.27 0.32
total phenol content
(g of gallic acid/kg of oil)
0.4500.007 0.5020.006
Table 1.: Working parameters, oil yields and chemical
characteristics of extracted oils when solid CO
2
was
added or not to the milled olives
Table 1 reports the working parameters
adopted, the oil yields and some
analytical characteristics of extracted
oils of two experimental runs carried out
using the same olive fruits.
The utilised olive fruits belonged to
Correggiolo, Leccino and Frantoio
cultivars. The olives used (! 60 kg) in
these two preliminary runs were suitably
mixed to ensure in any case, an
homogenous extraction substrate. The oil
content was about 16% (weight/weight),
the moisture near 48% while the harvest
index according to Uceda/Frias (1975),
was equal to 3.81 (07 range).
The extraction yields obtained in the
two runs (with and without carbonic
snow addition), did not differ
significantly as the main characteristics
of obtained oils. Only the total content
of phenols appears to be higher in the
oil extracted in the presence of cryogen
which presented also a flavour more
intense and flagrant. These preliminary
results need obviously to be confirmed
while the effects induced by working
parameters on oil yield and quality, will
be investigate during the last year of this
PhD activity.
15
th
291
15
th
Why does P. fermentans switch? Insights into the molecular mechanisms
involved in the dimorphic transition.
Maria Lina Sanna (mlsanna@uniss.it)
Dip. Scienze Ambientali Agrarie e Biotecnologie Agroalimentari, Universit degli Studi di Sassari, Italia
Tutor: Prof. Ilaria Mannazzu, Prof. Marilena Budroni

The aim of the present PhD thesis is to study the molecular mechanisms involved in the transition from yeast-
like/antagonistic behaviour to pseudohyphal/pathogenic behaviour in the yeast Pichia fermentans. To achieve
this goal it was first necessary to individuate the nutritional factors able to induce and separate yeast-like and
pseudo-hyphal growth. It was thus observed that while on different carbon sources it is not possible to
differentiate pseudohyphal and yeast-like growth, on Yeast Carbon Base added with urea or methionine this
result was easily obtained (Sanna, 2009). Subsequently, the utilization of Rapid Subtraction Hybridization
(RASH) lead to the individuation of at least 10 genes differentially expressed during pseudohyphal growth.

Perch P. fermentans cambia morfologia?
Studio dei meccanismi molecolari coinvolti nella transizione dimorfica

Lo scopo della presente tesi di dottorato quello di studiare i meccanismi molecolari coinvolti nella transizione
di P. fermentans dallo stato lievitiforme/antagonista a quello pseudoifale/patogeno. Per realizzare questo
obbiettivo stato necessario individuare i fattori nutrizionali in grado di indurre e separare la crescita
lievitiforme da quella pseudoifale. Si cos osservato che mentre su differenti fonti di carbonio non possibile
differenziare la crescita pseudoifale da quella lievitiforme, in Yeast Carbon Base addizionato di urea o metionina
questo risultato facilmente ottenibile (Sanna, 2009). Successivamente, lutilizzo della tecnica Rapid
Subtraction Hybridization (RASH) ha consentito di individuare almeno 10 geni differenzialmente espressi
durante la crescita pseudoifale.

1. Introduction
The yeast Pichia fermentans controls brown rot caused by Monilia spp. on apple fruit but shows a pathogenic
behaviour on peach (Giobbe et al., 2007). Interestingly, in both cases P. fermentans forms biofilm on fruit
surfaces, but this is made of yeast-like cells on apple and of pseudo-hyphae on peach fruit. At present, it is still
not known whether there is a direct correlation between pseudohyphae formation and pathogenic behaviour and
also the forces acting on the thin diaphragm that separates antagonism from pathogenicity need to be elucidated.
In accordance with the project previously described (Sanna, 2009), here are reported the results concerning:
A1) Individuation of cultural and nutritional conditions able to induce P. fermentans dimorphic transition
from yeast-like to pseudohyphae.
A2) Construction of a cDNA library by means of Rapid Subtraction Hybridization for the individuation of the
genes differentially expressed during pseudohyphal growth.
A3) Individuation of genes differentially expressed by means of reverse Northern hybridization.

Materials and methods
Strain and culture conditions
Pichia fermentans DiSAABA726 (DBVPG3627) was maintained in YEPD (2% glucose, 2% peptone, 1% yeast
extract, 2% agar) at 4C for short term storage and YEPDGLY (YEPD+ 50% glycerol) at -80C for long term
storage. Other media were YCBU (1,17% Yeast Carbon Base; 2% Urea) and YCBM (1,17% Yeast Carbon Base
0.2% Methionine). Escherichia coli DH5! (Invitrogen) was grown at 37C on Luria-Bertani (LB) medium. E.
coli transformation was carried out as indicated by the manufacturer.
Construction of a cDNA library by means of Rapid Subtraction Hybridization
This procedure was carried out as described by Scherm et al., (2008). Briefly: total RNAs were extracted from
yeast-like cells grown on YCBU (driver) and pseudohyphae grown for YCBM (tester) cells, respectively and
retrotranscribed to cDNAs according to the manufactures instructions. cDNAs were digested into small
fragments with EcoRII, ligated to adapters (XE-14, XEA-13 XET-13). Following ligation of adapters digested
cDNA was PCR amplified with primers XEA-18 and XET-18. PCR products were purified and amplified tester
cDNA was digested by XhoI and hybridized to cDNA of the driver (1:30 ratio). The resulting tester fragments
were cloned in XhoI-digested and dephosphorylated pBlueScript SK vector and transformed into E. coli DH5!.
Individuation of genes differentially expressed by means of Reverse Northern hybridization
15
th
292
15
th

Bacterial colonies were utilised in PCR reaction with RaSH-F and RaSH-R, which align to pBluescript SK.
PCR products were analysed by gel electrophoresis and blotted onto Hybond-N
+
membrane. Hybridization was
performed using 3 g of cDNAs PCR amplifed from tester or driver, digested and labeled with digoxigenin-
dUTP. Densitometric analysis was carried out using the ChemiDoc Quantity One 4.6.7..

Results and discussion
In accordance with the PhD project previously described (Sanna, 2009) the activities of the second year were
focussed first on the individuation of the nutritional conditions that trigger the dimorphic transition.
Subsequently, with the aim of further understanding the molecular mechanisms involved in the switch from
yeast like to pseudohyphal morphology, RASH analyses was utilized to hunt for the genes differentially
expressed under yeast-like and pseudohyphal growth.
To individuate the nutritional factors able to induce and separate yeast-like and pseudo-hyphal growth under
laboratory conditions, about 5"10
6
cells of DiSAABA 726 and CBS 187 were inoculated in liquid media
differing for both nitrogen and carbon sources, and observed daily for biofilm formation and cell morphologies.
It resulted that while on different carbon sources it was not possible to differentiate pseudohyphal and yeast-like
growth, on Yeast Carbon Base added with urea or methionine this result could be easily obtained (Sanna, 2010).
Indeed, under both conditions DiSAABA726 formed a biofilm on the liquid/air interface but this was made of
yeast-like cells on YCBU and pseudohyphae on YCBM. Since 24 h were sufficient to observe the differentiation
of the two morphotypes total RNA extraction was carried out 24 h after the inoculum in the two media (Fig. 1)
and Rapid Subtraction Hybridisation (RASH) was utilized to individuate the genes differentially expressed in
YCB methionine as described by Scherm et al. (2009).
By using this protocol 346 bacterial colonies carrying recombinant plasmids were obtained and subject to
Reverse Northern hybridization against cDNAs of tester and driver (Fig. 2). Densitometric analyses of Reverse
Northern Blot highlighted at least 10 clones showing a differential expression on YCBM (pseudohyphae) (Fig.
2). At present sequence analyses of the clones of interest is in progress and further Northern Blots will be carried
out to confirm their differential expression at the dimorphic transition.
In summary, in spite of the numerous problems encountered in the application of RASH analysis, the research
activities were carried out according to the program presented (Sanna, 2009). The results obtained were those
expected for the second year thus indicating that the original PhD thesis project can proceed without any
substantial amendment.

Giobbe S., Marceddu S., Scherm B., Zara G., Mazzarello V., Budroni M., Migheli Q. (2007) FEMS Yeast
Research 7(8):1389-1398.
Sanna M.L (2009). 14
th
Technology, Oristano. 16-18 Settembre, 2009, pp 435-436.
Scherm B, Schmol M, Balmas V, Kubicek C. P & Migheli Q (2008). Curr Genet (2009) 55:8191.

B A
Fig. 1. Morphology of P. fermentans DISAABA 726
on liquid media. A) YCBU B) YCBM

A
Fig. 2. Reverse Northern hybridization of the cDna library against A) cDNA of driver (DiSAABA 726
grown on YCBU); B) cDNA of tester (DiSAABA 726 grown on YCBM).

B
15
th
293
15
th

Survey on community and dynamics of lactic acid bacteria in Italian PDO
hard cheeses
Marcela Santarelli (marcela.santarelli@nemo.unipr.it)
Dept. of Genetics, Biology of Microorganisms, Anthropology, Evolution, University of Parma, Parma, Italy
Tutor: Prof. Monica Gatti

During this PhD period investigations were focused on the study of microflora in the phases of cheese
production, which may influence the further success of the process. The contribution of season during the
preparation of natural whey starter and the utilization of non-traditional fermenters were evaluated. Moreover,
the evolution and dynamics of the microbial population of raw milk and natural whey starters up to 9 months in
ripened cheese were studied. The results showed that the season influences not only the viability but also species
composition of natural whey starters and highlights the contribution of SLAB and NSLAB as whole and lysed
cells to the definition of the microbial ecosystem that may influence the overall characteristics of the final
product.
Indagine sulla comunit e dinamiche di batteri lattici in formaggi duri DOP italiani
Durante questo periodo di dottorato lindagine si incentrata sullo studio della microflora nelle fasi di
produzione del formaggio che possono condizionarne la buona riuscita. Si considerato il fattore stagionale
della preparazione del siero innesto oltre allutilizzo di fermentatori non tradizionali. Inoltre, sono state valutate
levoluzione e le dinamiche della popolazione microbica a partire dal latte e dal siero innesto fino ad arrivare al
formaggio di 9 mesi di stagionatura. I risultati hanno mostrato come la stagionalit influenzi sia la vitalit che la
composizione in specie dei siero innesti e hanno evidenziato il contributo della popolazione SLAB e NSLAB sia
come cellule intere che lisate alla definizione dellecosistema microbico che pu condizionare le caratteristiche
del prodotto finale.

Key words: microbial ecosystem; LH-PCR; hard cheeses; whole and lysed cells
1. Introduction
With the aim to evaluate the community and the dynamics of lactic acid bacteria in Italian PDO hard cheeses two
different activities for two cheeses were considered:
Parmigiano Reggiano (PR)
a. Assessment of Starter Lactic Acid Bacteria (SLAB) composition of natural whey starters
during its preparation in two different seasons.
b. Study of LAB population dynamics in the first days of cheese production.
Grana Padano (GP)
c. Assessment of natural whey starter microflora in controlled fermenters.
d. Assessment of microbial population dynamics during cheese fermentation and ripening.

2. Materials and Methods:
a. Eighteen natural whey starters and 18 nonacidified wheys belonging to 9 dairies of PR cheese production were
sampled in two different seasons: summer and winter.
b. Eighteen cheese production cycles of different dairies were considered thus, 18 natural whey starters and the
corresponding 18 curds (24 h after extraction) were sampled.
c. Six natural whey starters were produced in an experimental fermenter and compared to the 4 natural whey
starters prepared in a traditional fermenter.
d. Six different dairies of 6 provinces of GP production were investigated. In each dairy, raw milk, natural whey
starter, curd at 48 h, and cheeses at 2, 6 and 9 months of ripening were sampled.
All samples were subjected to viability counts by using Bacterial Viability kit and fluorescence Microscopy,
Fluorescence in situ hybridization (FISH) and Length Heterogeneity-PCR (LH-PCR). FISH was performed using
probes targeting 16S rRNA molecules of L.helveticus and S.thermophilus species and microscopic analysis
(Bottari et al., 2006). By using LH-PCR, 16S rDNA Domain A was amplified and resolved by capillary
electrophoresis in an automated sequencer. The fragment sizes were attributed to bacterial species according to
the LH-PCR database. For cheeses of 2, 6 and 9 months, LH-PCR was performed discriminating both the whole
and autolysed cells (Gatti et al., 2008).
15
th
294
15
th

Parmigiano Reggiano cheese. Variability of SLAB in natural whey starters depending on the season.
The season does not seem to influence cultivable microbial counts in natural whey starters. Whereas in summer,
many samples showed a high percentage of non viable cells contrarily in winter it was observed that all samples
show high viability values. In summer, the majority of samples were characterized by L.helveticus, L.delbrueckii
subsp. lactis and viable cells of S.thermophilus. On the contrary, in winter, all samples showed the presence of
L.helveticus and L.delbrueckii subsp. lactis species; many samples did not show the presence of S.thermophilus
or, conversely, such microorganism was detected at high densitiy.
The preparation of natural whey starters from nonacidified whey fermentation showed a similar behavior in the
two seasons. Natural whey starters with L.helveticus as dominant species arose from nonacidified wheys in
which L.helveticus was the dominant. However, nonacidified wheys, with high percentages of L.helveticus
resulted in whey starters with L.helveticus as non-dominant species. This can be possibly attributed to the
different incubation conditions utilized in cheese factories for the production of whey starters and/or to the
different strains present in the matrix. Furthermore, nonacidified whey samples in which L.delbrueckii subsp.
lactis was dominant, or with a comparable percentage of L.helveticus, did not show the same trend in the natural
starter. In conclusion, the different technological criteria of natural whey starters preparation from nonacidified
whey fermentation seem to influence mainly the growth of L.helveticus instead of L.delbrueckii subsp. lactis
species. In winter, the natural whey starters seem to be less variable in terms of microbial composition than in
summer and L.helveticus is generally dominant. Only S.thermophilus contribution seems to remain invariable
within samples in summer.

Parmigiano Reggiano cheese. Dynamics of LAB population in the first days of cheese production.
Curds showed i) low, ii) intermediate and iii) high acidification. All curd samples showed viable cells of
L.delbrueckii subsp. lactis, L.helveticus and a variable presence of viable cells of S.thermophilus.
Heterofermentative L.fermentum species were also found in all curds; these species are well-known for their
contribution, if present as reduced numbers, to the micro hole formation in cheese (Mucchetti and Neviani,
2006). Mainly curds with high acidification were characterized by L.helveticus species with high viability. Both
natural whey starters with suitable and not suitable LAB composition and viability gave rise curds with correct
and low acidification. A possible explanation could be given by the influence of the raw milk to the selection of
the whey population or by the use of unsuitable technology. However, a quantitative evaluation of viable species
is required.

Grana Padano cheese. Assessment of natural whey starter microflora in controlled fermenter.
To evaluate natural whey starter quality upon production in a controlled fermenter (experimental starter), its
microbial composition needs to be evaluated and compared to natural whey starters produced in a traditional
fermenter. Results showed that the programmed fermenter seems to favour the growth of L.helveticus instead of
L.delbrueckii subsp. lactis mainly present in natural starters obtained in traditional fermenters. Moreover, a
reduction of total cell viability (whey starters in traditional fermenter were characterized by a high cellular
density of 10
9
cells/ml and viability over 80%) and, in particular, of the viable cell number of S.thermophilus
species was observed.

Grana Padano cheese. Dynamics of LAB population during cheese production and ripening.
Raw milk bacterial composition, evaluated using this high-sensitivity technique, was variable among samples,
L.delbrueckii subsp. lactis and S.thermophilus being mainly detected. The absence of L.helveticus highlights that
the whey starter provides this lactobacillus in suitable amounts for milk acidification (Mucchetti and Neviani,
2006). L.helveticus, L.delbrueckii subsp. lactis and S.thermophilus species were identified in all whey starters
according to Rossetti et al., (2008). Differently from this author, heterofermentative L.fermentum were
undetected in natural whey samples, despite present in some curd samples and in the lysed fraction of all 2
month cheese samples. A continuous evolution of microflora characteristics inside each matrix analysed was
observed. The dynamics of SLAB L.helveticus and L.delbrueckii subsp. lactis in the first hours of production and
their presence up to nine months of ripening not only as whole but also as lysed cells highlights the role of
natural culture in curd acidification and cheese ripening. From the second month of ripening the presence of non-
starter LAB whole cells of L.rhamnosus and P.acidilactici was observed, underlining the input of the raw milk
and production environment to the definition of the GP microbial ecosystem and to the overall characteristics of
the final product.
4. References
Bottari B, Ercolini D, Gatti M, Neviani E (2006) Application of FISH technology for microbiological analysis: current state and prospects, Appl Microbiol
Biotechnol 73:485-94.
Gatti M, De Dea Lindner J, De Lorentiis A, Bottari B, Santarelli M, Bernini V, Neviani E (2008) Dynamics of Whole and Lysed Bacterial Cells during
Parmigiano-Reggiano Cheese Production and Ripening, Appl Environ Microbiol 74:6161-6167
Mucchetti G, Neviani E (2006) Microbiologia e Tecnologia lattiero-casearia. Qualit e sicurezza. Ed. Tecniche nuove, Milano.
Rossetti L, Fornasari ME, Gatti M, Lazzi C, Neviani E, Giraffa G (2008) Grana Padano cheese whey starters: microbial composition and strain distribution, Int J
Food Microbiol 127(1-2):168-71.
15
th
295
15
th
Optimization of analytical methods for the characterization
of traditional raw milk cheeses of the Marche region
Sara Santarelli (sara.santarelli@univpm.it)
Dept. SAIFET, Polytechnic University of Marche, Ancona, Italy
Tutor: Prof. Natale G. Frega

The second year of the PhD thesis project concerning the optimization of analytical methods to study the
chemical and microbiological properties of traditional raw milk cheeses manufactured in the Marche region. In
particular the composition of the bacterial community was evaluated by PCR-DGGE analysis of the bacterial
DNA extracted directly from either the cheese samples or the bulk cells harvested from the MRS and M17
dilution plates. The volatile profiles were determined by solid phase micro-extraction coupled with gas-
chromatography (SPME-GC).
Ottimizzazione di metodi analitici per la caratterizzazione di formaggi tradizionali a
latte crudo della regione Marche
Nel corso del secondo anno di dottorato sono stati ottimizzati i protocolli per lo studio delle propriet chimiche e
microbiologiche di formaggi tradizionali a latte crudo prodotti nella regione Marche. In particolare la
composizione della popolazione batterica stata investigata attraverso analisi PCR-DGGE a partire da DNA
batterico estratto sia direttamente dal formaggio sia dal pool di colonie raccolte dalle diverse diluizioni sui
terreni MRS e M17. Il profilo volatile stato determinato utilizzando la tecnica SPME-GC (solid phase micro-
extraction-gas chromatography).

Key words: raw milk cheeses, lactic acid bacteria, PCR-DGGE, SPME-GC.
1. Introduction
The Marche region encompasses a large number of typical cheeses, as reported in the National list of the
traditional agro-alimentary products. In the present study the chemical and microbiological properties of
traditional raw milk cheeses manufactured in the Marche region were examined. Many of these cheeses were
manufactured through cheese-making techniques including one or more peculiar traits as the use of ovine or
vegetable rennet, the addition of unusual ingredients (herbs, olive oil, grated lemon peels), and ripening under
unconventional conditions (pit ageing).
The sampling campaign included 19 raw milk cheeses made from goat milk (Caprino), ewe milk (Pecorino), or
a mixture of cow and ewe milk (Caciotta) collected from local dairy farms.
All the samples were subjected to: (i) pH and a
w
measurements; (ii) determination of the main compositional
parameters (NaCl, lipids, proteins); (iii) viable counting of lactobacilli, mesophilic lactococci, Streptococcus
thermophilus, Salmonella spp., Listeria monocytogenes and staphylococcal enterotoxins; (iii) solid-phase
microextraction coupled with gas chromatography (GC-SPME) (Pinho et al., 2001); (iv) PCR-DGGE analysis of
the bacterial DNA extracted directly from the food matrices (Randazzo et al., 2008) and the bulk cells harvested
from the MRS and M17 dilution plates (Ercolini et al., 2001). Physico-chemical, compositional and
microbiological data were subjected to a one-way analysis of variance (ANOVA), by using JMP v 8 softwar
(Cary, NC, USA).
The absence of bacterial hazard was demonstrated in all raw milk cheeses thus revealing that they were produced
by fully complying with good hygienic practices (data not shown). The results of viable counts, physico-
chemical and compositional analysis are shown in Table 1. In particular significantly lower pH and lower loads
of the lactobacilli and lactococci were found for a particular Caprino cheese (a3cp) characterized for the
unconventional ripening condition (pit ageing). Furthermore, the Caprino cheeses were characterized for the
presence of distinctive bacterial species, namely, Lb. homoiochii and Macrococcus caseolyticus (Table 2) and for
higher amounts of volatile compounds (Figure 1), while Pecorino cheeses were distinguished for the presence of
the species namely Lb. coryniformis and Lb.. plantarum (Table 2). The Caciotta cheeses were distinguished for
the lower amounts of the proteins and lipids.
15
th
296
15
th

Table 1. Mean value and standard deviation of physico-chemical, compositional and microbiological analyses.Within each
data the values labelled with the same letter(s) are not significantly different (P < 0.05).

Table 2: LAB species identified by PCR-DGGE analysis Figure 1. Volatile compounds identified by SPME-GC analysis.

The polyphasic PCR-DGGE approach, combined with traditional plating methodology, revealed slight
differences in the microbial composition of raw and pasteurized milk cheeses, while a neat diversification was
highlighted by SPME-GC.
During the third year of the PhD thesis project will be compared, using statistical methods, these results with
those obtained by analyzing the three types of cheese (Caciotta, Caprino and Pecorino), but produced with
pasteurized milk and commercial starter cultures.

4. References

Ercolini D, Moschetti G, Blaiotta G, Coppola S. (2001): The Potential of a Polyphasic PCR-DGGE Approach in
Evaluating Microbial Diversit of Natural Whey Cultures for Water Buffalo Mozzarella Cheese
Production: Bias of Culture-Dipendent and Culture-Independent Analyses. Syst. Appl. Microbiol. 24, 610-
617.
Randazzo CL, Torriani S, Akkermans ADL, De Vos WM, Vaughan EE. (2002): Diversity, Dynamics, and
Activity of Bacterial Communities during Pruduction of an Artisanal Sicilian Cheese as Evaluated by 16S
rRNA Analysis. App. Envirom. Microb. 68, 1882-1892.
Pinho O, Ferreira IMPLVO, Casal S, Fernandes JO, Oliveira MBPP., Ferreira MA. (2001): Method optimization
for analysis of the volatile fraction of ewe cheese by solid-phase microextraction. Chromatographia
Supplement. 53, 390-393.
0,00
500000,00
1000000,00
1500000,00
2000000,00
2500000,00
3000000,00
3500000,00
4000000,00
4500000,00
5000000,00
raw raw raw
Caciotta cheeses Pecorino cheeses Caprino cheeses
A
r
e
a
ethylacetate
acetone/ethanol
acetic acid
butyric acid
caproic acid
enanthic acid
caprylic acid
pelargonic acid
capric acid
undecanoic acid
undecenoic acid
lauric acid

Caciotta Pecorino Caprino
St. thermophilus
Lc. lactis
Lc. raffinolactis
Lb. casei sensu latu
Lb. brevis
Lb. fermentum
Lb. plantarum
Lb. homoiochii
M. caseolyticus
St. macedonicus
Leu. mesenteroides
Lb. coryniformis

Viable counts (log cfu/g)
Cheese
pH aW
NaCl
(g/100g
cheese)
Proteins
(g/100g
cheese)
Lipids
(g/100g
cheese)
Lactobacilli Mesophilic
lactococci
Streptococcus
thermophilus
a1ca 5.57 0.07
fg
0.93 0.02
c
1.85 0.01
def
21.29 2.73
g
26.79 0.54
gh
8.45 0.05
abc
9.01 0.20
bc
7.79 0.34
bcd
a2ca 5.34 0.04
h
0.98 0.01
ab
1.93 0.34
de
20.23 0.45
gh
21.69 0.41
jkl
8.00 1.32
abcd
8.57 0.72
cd
6.29 0.61
ef
a3ca
5.26 0.01
hi
0.97 0.01
ab
1.56 0.01
fgh
19.32 0.02
gh
23.21 0.01
ijk
7.10 0.09
def
9.52 0.04
ab
9.19 0.04
a
a4ca
5.34 0.02
h
0.98 0.00
ab
1.81 0.01
ef
21.33 0.01
g
25.71 0.01
hi
7.21 0.09
de
8.97 0.04
bc
5.54 0.02
fg
C
a
c
i
o
t
t
a

a5ca
5.72 0.011
ef
0.97 0.00
ab
1.95 0.00
de
18.85 0.01
h
19.19 0.01
l
9.05 0.03
a
9.13 0.03
abc
7.87 0.13
bcd
a1pe 5.30 0.01
h
0.91 0.01
cde
2.04 0.04
cde
25.24 0.77
de
32.13 0.99
cd
8.14 0.30
abcd
7.53 0.40
ef
8.17 0.46
abc
a2pe 5.55 0.01
g
0.96 0.00
ab
2.15 0.01
bcd
23.76 0.01
ef
29.47 0.01
ef
6.00 0.04
f
8.17 0.09
de
8.51 0.01
ab
a3pe 5.38 0.02
h
0.97 0.01
abcd
1.76 0.01
efg
26.90 0.01
cd
26.80 0.01
gh
8.42 0.04
abc
9.19 0.01
abc
8.50 0.06
ab
a4pe 5.54 0.01
g
0.96 0.01
b
2.45 0.01
b
24.50 0.01
e
26.61 0.01
gh
8.37 0.01
abc
9.42 0.01
ab
8.05 0.05
bc
a5pe 5.28 0.02
h
0.90 0.01
de
1.43 0.10
ghi
29.98 0.03
ab
44.14 0.13
a
8.09 0.08
abcd
7.36 0.12
fg
7.12 0.13
cde
a6pe 5.87 0.03
cde
0.98 0.01
a
1.33 0.02
hi
21.49 0.06
fg
20.68 0.34
kl
8.38 0.21
abc
9.11 0.10
abc
5.12 0.13
gh
a7pe 5.89 0.04
bcd
0.89 0.01
e
3.51 0.23
a
24.98 0.05
de
35.30 0.33
b
7.17 0.15
de
8.12 0.13
de
6.88 0.20
de
P
e
c
o
r
i
n
o

a8pe 5.78 0.05
de
0.92 0.00
cd
1.41 0.10
hi
27.99 0.04
bc
33.78 0.01
bc
6.53 0.19
ef
3.15 0.13
i
3.48 0.21
i
a1cp 5.82 0.19
cde
0.90 0.00
de
1.43 0.11
ghi
30.55 1.47
a
28.56 3.45
efg
6.48 0.79
ef
6.76 0.40
g
4.38 1.26
hi
a2cp 6.52 0.01
a
0.98 0.00
ab
3.41 0.01
a
14.59 0.01
i
20.01 0.01
l
7.91 0.06
bcd
9.76 0.11
a
8.36 0.01
ab
a3cp 5.14 0.02
i
0.91 0.01
cde
2.31 0.01
bc
31.89 0.03
a
25.31 0.01
hi
1.99 0.02
g
3.01 0.01
i
3.26 0.26
i
a4cp 5.95 0.01
bc
0.91 0.01
cde
0.46 0.01
j
31.86 0.01
a
28.41 0.01
fg
7.48 0.05
cde
8.09 0.01
de
7.73 017
bcd
a5cp 5.89 0.04
bcd
0.92 0.00
cd
2.32 0.04
bc
27.85 0.01
bc
31.11 0.13
de
6.63 0.10
ef
4.47 0.20
h
7.87 0.09
bcd
C
a
p
r
i
n
o

a6cp 6.03 0.04
b
0.98 0.01
a
1.12 0.13
i
20.14 0.33
gh
23.44 0.19
ij
8.65 0.12
ab
9.34 0.10
ab
8.20 0.20
abc

15
th
297
15
th
Bioethanol production from agri-food lignocellulosic residues
Guglielmo Santi (santi@unitus.it)
Dept. Agrobiology and Agrochemistry, University of Tuscia, via S.C. de Lellis, Viterbo, Italy
Tutor: Dr. Silvia Crognale
In order to evaluate the suitability of various lignocellulosic wastes as possible substrates for hydrolysis and
ethanol fermentation, the chemical characterization of a first residue, olive pomace, was performed. Lignin,
cellulose and hemicellulose content was determined. Secondly, various ethanol-producing yeast strains were
tested in synthetic media under different culture conditions, thus assessing their fermentative potential on
hydrolyzates of agri-food residues.
Produzione di bioetanolo da scarti agroalimentari lignocellulosici
Allo scopo di valutare ladeguatezza di diversi scarti lignocellulosici come possibili substrati per lidrolisi e la
fermentazione alcolica, stata effettuata la caratterizzazione chimica di un primo residuo, le sanse di olive, di cui
stato determinato il contenuto in lignina, cellulosa ed emicellulosa. Inoltre, diversi ceppi etanologenici sono
stati studiati in diverse condizioni su terreni sintetici, verificandone il potenziale fermentativo su idrolizzati di
scarti agroalimentari.
Key words: Bioethanol, lignocellulosic agri-food residues, characterization, yeasts, screening,.
1. Introduction
In accordance with the PhD thesis project previously described (Santi, 2009), this poster reports the main results
of the first two activities concerning:
(A1) the chemical characterization of a lignocellulosic residue in order to quantify its lignin, cellulose,
hemicellulose, sugars, proteins, nitrogen, phenols and tannins content.
(A2) the screening of Pichia, Candida and Metschnikowia strains for their ethanologenic capabilities.
The lyophilized olive pomace underwent Soxhlet extraction according to a modification of the method
NREL/TP-510-42619: the second extraction was performed using a mixture of toluene and ethanol (2:1 v/v) for
an improved quantification of the lipophilic component. The final solid residue was used to define the cellulose,
hemicellulose and lignin content (Van Soest, 1963). Monosaccharides were determined from the acid
hydrolyzate, using a Varian 9010 HPLC system, with a refraction index detector IR10 Varian and an Aminex
87P (7,8 mm x 350 mm) column (Biorad) at 85C; isocratic elution (0.6 ml/min flow rate) was applied using
MilliQ water as the mobile phase. Ashes were determined gravimetrically after incubation at 500C for 4 hours;
phenols and tannins content was determined according to the method of Makkar et al. (1993) modified as follow:
the raw material was extracted (in the ratio 1:10 w/v) with a mixture of methanol and acetate buffer 10 mM pH 5
(50:50 v/v) for 4 h in orbital agitation; nitrogen was determined through Kjeldahl method (Mariani et al., 1995).
As for the yeast screening procedure, the following strains were employed: Pichia anomala AN 4/2, AN 4/3; P.
stipitis 6264; P. guillermondi 1079 and 1076; Candida shehatae 6850; Metschnikowia fructicola 1075. The
strains were precultured (250 rpm, 30C) on Yeast Nitrogen Base (YNB) 6,7 g/L and glucose 20 g/L.
Fermentations were performed under shaken conditions (30C and 120 rpm) in Synthetic Complete (SC)
medium, buffered with citric acid trisodium salt 0,1 M solution, and prepared by dissolving (per liter) YNB 6,7
g, glucose 100 g, Yeast Synthetic Drop Out 4 g, Tween 80 0,4 g and ergosterol 10 mg. In the second test the
same medium was supplemented with xylose 40 g/L. A qualitative xylose fermentation test was performed using
Durham tubes in 15 ml of yeast extract 5 g/L and xylose 30 g/L medium. An ethanol stress tolerance test was
performed in SC medium supplemented with glucose 20 g/L, adding the alcohol at different concentrations (10
and 20 g/L). Sugars were determined according to DNSA method (Miller 1959). Ethanol was determined using a
DANI Master fast gas chromatography system with a Teknokroma Meta WAX capillary column (30 m x 0,25
mm x 0,5 !m); oven temperature was programmed from 50 to 180C at 15C/min; split ratio was 50 ml/min,
injector temperature 180C and FID temperature 250C. Carrier gas was helium at a flow rate of 1 ml/min.
Results represent means of duplicate experiments standard deviation.
3.1 Olive pomace characterization
Due to the wide heterogeneity of olive pomace, the sample used in the present study was chemically
15
th
298
15
th
characterized before hydrolysis and fermentation and the results are summarized in Table 1. Dry matter was
mainly composed of lignin (approx. 36%), as already reported by other authors, while cellulose and
hemicellulose content, in our case, was higher than that reported by Felizn et al. (2000). Fiber composition was
then confirmed by the analyses of the carbohydrates in the acid hydrolyzate, showing that the main sugars,
glucose and xylose, overall represented more than the 50% of the dry matter. The amount of glucose in particular,
was much higher than that reported by Georgieva et al. (2007). Given the above-mentioned high sugar content,
the olive pomace can be considered a good feedstock for hydrolysis and fermentation.
Table 1 Olive pomace characterization: aqueous extract (AE), toluene ethanol extract (TE), acid soluble lignin (ASL), acid
insoluble lignin (AIL), cellulose, hemicellulose, nitrogen, phenols, tannins, condensed tannins (CT), glucose, xylose,
arabinose and galactose. Values are referred as percent of dry matter.
AE TE Ashes ASL AIL Cellulose Hemicellulose Nitrogen
7,20,36 7,60,4 0,470,05 1,80,03 34,53,01 35,052,6 17,70,5 0,70,04
Proteins Phenols Tannins CT Glucose Xylose Arabinose Galactose
6,90,04 1,040,09 0,120,02 0,0180,002 42,57,7 12,60,95 1,40,15 1,170,38

3.2 Yeasts screening
In order to valorise the considerable amount of the pentose detected in this waste, several fermentative screening
tests were carried out to find a yeast strain with good fermentation ability also in presence of xylose. Table 2
summarizes the main results of these experiments. The best ethanol producing strains, using 100 g/L glucose as
sole carbon source, were P. anomala AN 4/2 and AN 4/3. On the other hand, only the strain 6264 gave positive
results in the qualitative xylose fermentation test (Tab. 2, column C) although the low substrate consumption
rate, highlighted during the previous tests (0,38 g L
-1
h
-1
), negatively affected the ethanol production (Tab. 2,
columns A and B). In order to assess whether the ethanol accumulation in the medium caused a decrease in
fermentation rate, an ethanol stress tolerance test was performed. The results show that the fermentative process
using the strain 6264 was strongly inhibited by the presence of 10 g/L and totally hindered by the presence of 20
g/L of ethanol, thus explaining the poor performance obtained in the previous tests. On the other hand the strain
1075 was slightly affected by the presence of ethanol, preserving high bioconversion levels even in the presence
of the highest ethanol concentration. However, the final choice of the strain that will be employed in the
fermentation of hydrolyzates will be accomplished according to the results of feedstock hydrolysis experiments
that are in progress.
Table 2 Main results of fermentations with glucose 100 g/L (A); glucose 100 g/L + xylose 40 g/L (B); xylose 30 g/L (C);
stress tolerance tests with glucose 20 g/L + ethanol 10 g/L (D) or 20 g/L (E): inhibition percentages are referred
to the control with only glucose 20 g/L (F). The most interesting results are reported in Bold.
A B C D E F
strain
ethanol
(g /L)

ethanol
(g /L)
ferment.
capacity
ethanol
(g /L)
inhib. %
ethanol
(g /L)
inhib. %
ethanol
(g /L)
AN4/2 39,16,3 43,92,9 4,22,3 35,4 3,70,9 43,08 6,50,7
AN4/3 40,17,3 41,11,5 6,72,1 15,2 53,9 36,71 7,91,4
6264 13,50,1 18,70,1 + 2,40,4 60 0 100 60,2
6850 33,51,2 36,50,1 5,60,1 34,12 0,80,1 90,6 8,50,7
1079 31,80,2 35,11,7 7,10,5 84,5 4,81,3 42,86 8,40,3
1075 29,42,2 32,80,2 8,70,4 0 6,91,1 15,9 8,20,6
1076 36,13,2 36,10,2 9,30,2 0 5,81,1 37 9,20,1
4. References
Felizn B, Fernndez-Bolaos J, Heredia A, Guilln R (2000) Steam-Explosion Pretreatment of Olive Cake.
JAOCS 77, 15-22.
Georgieva TI, Ahring BK (2007) Potential of agroindustrial waste from olive oil industry for fuel ethanol
production. Biotechnol. J. 2, 15471555.
Makkar, HPS, Singh B, Vats SK, Sood RP (1993) Total phenols, tannins and condensed tannins in different parts
of Rumex hastatus. Biores. Technol. 45, 69-71.
Mariani P, Zanzucchi G, Summer A, Vecchia P (1995) Variabilit dellindice di caseina e distribuzione degli
scarti tra caseina calcolata (proteina grezza x 0.77) e caseina Kjeldahl in 1065 campioni di latte individuale.
Scienza e Tecnica Lattiero Casearia, 46 (2), 69-81.
Miller, GL (1959) Use of DNSA reagent for determination of reducing sugar. Anal. Chem. 31, 426-428.
NREL (2008) Determination of Extractives in Biomass Technical Report NREL/TP-510-42619.
Van Soest P J (1963b) Use of detergents in the analysis of fibrous feeds. II. A rapid method for the determination
of fiber and lignin. J. Assoc. Off. Anal. Chem. 46, 829-835.
15
th
299
15
th
Development of Bioprocesses for the Production of Food Protein
Hydrolysates Containing Bioactive Peptides
Milda Stuknyte (milda.stuknyte@unimi.it)
Dipartimento di Scienze e Tecnologie Alimentari e Microbiologiche, Universit degli Studi di Milano, Milan, Italy
Tutor: Prof. Ivano De Noni Co-tutors: Dr. Simone Guglielmetti and Prof. Diego Mora

The first two activities of the PhD thesis project are described. Firstly, we performed the selection of lactic acid bacteria by
screening bacterial cell envelope-associated proteinases (CEPs) at the genetic level as well as by testing the proteolytic
activity on milk caseins. Moreover, fractionation of casein hydrolysates (CHs) by means of high-performance liquid
chromatography (HPLC) was performed. Secondly, we developed a protocol for the in vitro biological analysis of CHs,
addressed to determine their immunomodulatory activity by using a luciferase reporter gene system. This system is based on
a nuclear factor kappa B (NF-!B)-inducible reporter plasmid, pNiFty2-Luc, in human colonic adenocarcinoma cells Caco-2.
Sviluppo di bioprocessi per lottenimento di idrolizzati di proteine alimentari contenenti peptidi
ad attivit biologica
Sono descritte le prime due attivit previste nel progetto di tesi di dottorato. Inizialmente, stata effettuata la selezione di
alcuni ceppi di batteri lattici valutando la presenza e il tipo di proteinasi di parete delle cellule batteriche (CEPs) e testando
l'attivit proteolitica dei ceppi proteasi-positivi sulle caseine del latte. Il profilo peptidico degli idrolizzati di caseina (CHs)
stato studiato mediante cromatografia liquida ad alta prestazione (HPLC). In seguito, lattivit immunomodulante degli stessi
CHs stata valutata in vitro usando un sistema reporter basato sullattivit dellenzima luciferasi. Questo sistema costituito
dal plasmide pNiFty2-Luc, inducibile dal fattore nucleare kappa B (NF-!B), introdotto in cellule umane di adenocarcinoma
del colon Caco-2.

Key words: lactic acid bacteria, cell envelope-associated proteinases, casein hydrolysates, immunomodulatory activity.
1. Introduction
In accordance with the PhD thesis project previously described (Stuknyte, 2009), this poster reports the main results of the
first two activities concerning:
1. selection of bacteria of alimentary origin and screening of bacterial CEP activity in a model system containing milk
caseins;
2. in vitro biological testing of CHs addressed to determine their immunomodulatory activity using a luciferase reporter
gene system, based on the NF-!B-inducible reporter plasmid pNiFty2-Luc, in human colonic adenocarcinoma cells
Caco-2.
Preparation of CHs. Sodium caseinate was prepared from unprocessed bovine bulk skimmed milk by isoelectric
precipitation with hydrochloric acid. Bacterial strains were subjected to evaluation of casein hydrolysis by CEPs as described
by Arioli et al. (2007) and Hebert et al. (2008) with modifications.
Reverse-phase HPLC of CHs was performed as previously described (Neveu et al., 2002).
Evaluation of immunomodulatory activity of CHs was performed with recombinant Caco-2:pNiFty2-Luc cell layers as
described by Guglielmetti et al. (2010). All CHs were analysed in duplicate in at least two independent experiments.
Statistical analysis. The significance of the results was analyzed by unpaired heteroscedastic Students t test with two-tailed
distribution. Differences of P < 0.05 were considered to be significant.
It is well known the ability of cell envelope associated-proteinases (CEPs) of lactic acid bacteria to release peptides from
food proteins. They substantiate food fermentation process and ensure bacterial growth. Moreover, a large variety of
peptides with potential biological activities can be liberated during this process. On this basis the following lactic acid
bacterial strains were initially screened for the presence of CEP genes: 4 belonging to the species Streptococcus
thermophilus (3207, ST24, CNRZ 385, DSM 20617
T
), 3 to the species Lactobacillus helveticus (MIMLh5, Lh164, ATCC
15009
T
), 3 to the species L. acidophilus (La-5, LA03, ATCC 4356
T
), and 2 Lactococcus lactis subsp. lactis strains (GR1,
GR5). Five different primer pairs were designed. The presence of CEP genes was determined by PCR in nine bacterial
strains (Table 1). Subsequently, CEP-positive strains were subjected for milk casein hydrolysis. Sodium caseinate was
chosen as a model system for milk proteolytic activity determination. Hydrolysis profiles were evaluated by reverse-phase
HPLC analysis. All strains demonstrated sodium caseinate hydrolysis.
15
th
300
15
th
For evaluation of immunomodulatory activity of CHs, stable
NF-!B reporting Caco-2 cell line was constructed. Stable
transfectants of Caco-2 cell line were obtained after
transfection with the plasmid pNiFty2-Luc (Invivogen,
Labogen S.r.l., Italy). This plasmid contains a promoter
combining five NF-!B-binding sites and the firefly luciferase
reporter gene luc. The presence of NF-!B activating
molecules in the cell activates this transcription factor, which
binds to the promoter, resulting in the expression of the
luciferase gene. The level of luciferase gene expression is
directly related to NF-!B activation.
Sodium caseinate hydrolysates, produced after digestion with
CEPs of all nine CEP-positive strains, were tested for their
ability to modulate NF-!B activation in recombinant Caco-2
cells. Two of them, deriving from digestion with L. helveticus
MIMLh5 and L. acidophilus ATCC 4356
T
CEPs, were found to significantly decrease the basal NF-!B activity. Therefore,
they abolished NF-!B activation in Caco-2 reporter cell line demonstrating immunomodulatory activity.
Since it has been demonstrated that bacteria themselves can modulate the immune responses due to their surface components
(Sokol et al., 2008), it is paramount to assure that these components are not present in CHs. Moreover, these components are
reported to have molecular weight largely exceeding 3 kDa (Konstantinov et al., 2008). On these bases, CHs were
ultrafiltered (3 kDa) and the obtained fractions were tested for ability to modulate NF-!B activation in recombinant Caco-2
cells. No significant alteration of the basal NF-!B activity was recorded for 3 kDa-ultrafiltered CH produced by MIMLh5.
This result suggested that immunomodulatory activity of CH produced by MIMLh5 strain was likely not related to presence
of small peptides. However, the decrease of the basal NF-!B activity by 3 kDa ultrafiltered hydrolysate produced by ATCC
4356
T
was documented. This activity later was attributed to bacterial origin (data not shown). It can be presumed that non
fractionated CHs contain peptides that enhance as well as suppress NF-!B activation and, therefore, synergistic action of
these peptides does not give immunomodulatory response. For this reason, other seven CHs (that intact did not modulate
NF-!B activation in recombinant Caco-2 cells) were ultrafiltered (3 kDa) and tested for immunomodulation. Surprisingly, 3
kDa-fraction of CH produced by L. lactis subsp. lactis GR5 strain significantly decreased and that of S. thermophilus ST24
significantly increased the basal NF-!B activity (Fig. 1A).
Further, the anti-inflammatory activity of all 3 kDa-fractionated CHs was tested. For this reason recombinant Caco-2 cells
were co-stimulated with 3 kDa-fractionated CHs and IL-1", a prototypical pro-inflammatory cytokine that plays a central
role in the inflammation amplification cascade. The 3 kDa-fraction of CH produced by L. lactis subsp. lactis GR5 strain
significantly decreased the basal NF-!B activity in the presence of IL-1" thus showing anti-inflammatory activity (Fig. 1B).
Guglielmetti S, Taverniti V, Minuzzo M, Arioli S, Stuknyte M, Karp M, Mora D (2010) Oral Bacteria as Potential
Probiotics for the Pharyngeal Mucosa, Appl Environ Microbiol 76:3948-58.
Hebert EM, Mamone G, Picariello G, Raya RR, Savoy G, Ferranti P, Addeo F (2008) Characterization of the pattern of "
s1
-
and #-casein breakdown and release of a bioactive peptide by a cell envelope proteinase from Lactobacillus delbrueckii
subsp. lactis CRL 581, Appl Environ Microbiol 74:3682-9.
Phelan M, Aherne-Bruce SA, O'Sullivan D, FitzGerald RJ, O'Brien NM (2009) Potential bioactive effects of casein
hydrolysates on human cultured cells, Int Dairy J 19: 279-85.
Stuknyte M (2009) Development of Bioprocesses for the Production of Food Protein Hydrolysates Containing Bioactive
Peptides. In Proc.s of the 14
th
Workshop on the Developments in the Italian PhD Research on Food Science Technology
and Biotechnology, Oristano (Italy), 16-18 September, 2009, pp. 446-7.
Table 1 Presence of CEP genes in lactic acid bacterial strains.
Species Strain CEP gene
S. thermophilus 3207 prtS-l
ST24 prtS-s
CNRZ 385 prtS-l
DSM 20617
T

L. helveticus MIMLh5 prtH2
Lh164 prtH2
ATCC 15009
T
prtH2
L. acidophilus La-5
LA03 prtR
ATCC 4356
T
prtR
L. lactis subsp. lactis GR1
GR5 prtP
Figure 1 Effects of 3 kDa-ultrafiltered
CHs, produced after digestion with lactic acid
bacterial strains on recombinant Caco-2 cells, in
the absence (A) and in the presence (B) of IL-1!.
Luciferase activity is expressed as percentual
change in relative luminescence units, assuming
the control as 100%. Control, Caco-2 incubated
with undigested and 3 kDa-ultrafiltered sodium
caseinate. The values are the means ( standard
deviation) of at least two independent experiments
conducted in duplicate. Different asterisks (*)
indicate statistically significant differences
compared to control.
M
I
M
L
h
5
L
h
1
6
4
A
T
C
C

1
5
0
0
9
A
T
C
C

4
3
5
6
L
A
0
3
G
R
5
3
2
0
7
S
T
2
4
C
N
R
Z

3
8
5
C
o
n
t
r
o
l
M
I
M
L
h
5
L
h
1
6
4
A
T
C
C

1
5
0
0
9
A
T
C
C

4
3
5
6
L
A
0
3
G
R
5
3
2
0
7
S
T
2
4
C
N
R
Z

3
8
5
C
o
n
t
r
o
l
0
20
40
60
80
100
120
140
%

c
h
a
n
g
e

o
f

b
i
o
l
u
m
i
n
e
s
c
e
n
c
e
A B
* **
*
*, P < 0.05
**, P < 0.01
**
15
th
301
15
th
Study of a beta-Glucanase preparation in synthetic wine to enhance yeast
lysis
Sara Torresi (sara_torresi@virgilio.it)
Dept. Food Science and Technology, University of Tuscia, Viterbo, Italy
Tutor: Prof. Gabriele Anelli; Co-Tutor: Dott.ssa Maria Teresa Frangipane

In this paper, the first activity of the PhD Thesis project is reported. A kinetic study of a beta-Glucanase
preparation has been conducted in synthetic wine in order to assess its activity also in presence of
Saccharomyces cerevisiae EC1118 yeast strain. Moreover, ethanol and pH effects on enzyme activity have been
determined.
Studio di un preparato enzimatico a base di beta-Glucanasi in vino modello per
promuovere la lisi cellulare del lievito
In questo lavoro viene presentata la prima attivit del progetto di tesi di dottorato. E stato condotto uno studio
cinetico su un preparato enzimatico a base di beta-Glucanasi in vino modello. Lattivit enzimatica stata
valutata anche in presenza del ceppo di lievito Saccharomyces cerevisiae EC1118. Inoltre sono stati studiati gli
effetti della concentrazione di etanolo e del pH sullattivit dellenzima.

Keywords: Yeast cells lysis, beta-Glucanase, enzyme activity, Saccharomyces cerevisiae EC1118.
1. Introduction
The cell wall of Saccharomyces cerevisiae is made of mannoproteins crossed by fibres of glucan and chitin
(Pretorius, 2000). During autolysis, the cell wall is progressively degraded through the breakage of these glucan
and chitine fibres by glucanases and mannosidases. These activities lead to the release of intracellular low
molecular weight compounds with a great influence on organoleptic and foaming properties of sparkling wines
(Alexandre and Guilloux-Benatier, 2006). In accordance to the PhD thesis project previously described (Torresi,
2009), this paper reports the main results of the first activity concerning:
(A1) Optimization of sparkling wine production by using a selected Saccharomyces cerevisiae EC1118 yeast
strain and an enzymatic preparation having !-(1,3)-glucanase activity. A preliminary characterization of a beta-
Glucanase preparation (Lallzyme MMX
, a beta-Glucanase blend developed to improve the short maturing of

wines on lees) has been conducted. Kinetic parameters have also been determined in presence of the yeast strain
S. cerevisiae EC1118, frequently used for secondary fermentation in sparkling wines production and presenting a
good autolytic capacity (Martnez-Rodrguez et al., 2001a). Further studies will assess the effectiveness of beta-
Glucanase on yeast cells in sparkling wines and the effects on foam quality and organoleptic characteristics.
A kinetic study of a beta-Glucanase preparation (Lallzyme MMX
, Lallemand-Italy) has been conducted in

synthetic wine. The kinetic parameters of the enzymatic preparation have been determined also in presence of
the S. cerevisiae EC1118 yeast strain (Lallemand-Italy). The enzymatic activity has been expressed as the
amount of glucose (mg/l) released by the synthetic substrate Laminarine from Laminaria digitata (Sigma-Italy).
The assay consisted in incubating the reaction mixture (8 ml) containing Laminarine, with enzyme and yeast
cells firstly together and then separately. The same enzyme concentration generally used by winemakers (0,01
g/l) has been chosen. After 45 minutes of incubation and heat inactivation (100C, 2 minutes), (Humbert-Goffard
et al., 2004), glucose has been determined by the enzymatic test-combination D-glucose/D-fructose (R-
Biopharm-Germany). Kinetic parameters (V
max
, K
M
) were estimated with a nonlinear regression procedure using
GraphPad Prism 4. The effects of pH (from 2.5 to 7) in McIlvaine buffer have been evaluated. Moreover, the
influence of two ethanol concentrations, 11.30% v/v and 12.70% v/v on the enzymatic activity has also been
determined in a model wine solution (tartaric buffer, pH 3.2). These ethanol concentrations correspond to those
of a base wine and a sparkling wine respectively, which will be further tested in experimental applications. A
blank assay counting the residual glucose content of Laminarine, yeast and enzyme has been performed for each
test.
Yeast cells incubated with Laminarine did not show an enzymatic activity, for this reason, data concerning these
15
th
302
15
th
experiments are not shown.
The effect of pH on enzyme activity is reported in Figure 1. Data revealed the highest activity values at pH 5.00
for both samples (optimum pH), with a slightly higher rate for beta-Glucanase in presence of EC1118. In
McIlvaine buffer, the enzyme retains 75% of its activity at pH 3.2 than at pH 5.00 (Figure 1a) . This result is no
affected by the yeast, in fact, beta-Glucanase with EC1118, at wine pH, maintain the 79% of its activity than at
pH 5.00 (Figure 1b). The enzyme kinetic performed in acetate buffer (25C, pH 5.00) shows a higher activity for
the sample with beta-Glucanase and yeast EC1118 than those with the only enzyme (Figure 2). This may be due
to the release of endogenous yeast beta-Glucanases that could give rise to a synergic activity on Laminarine and
a higher glucose release. In Table 1 kinetic parameters are reported, V
max
values are higher for beta-Glucanase
with EC1118 than for the enzyme alone, the K
M
values, reflecting the enzyme-substrate complex formation are
quite similar. This evidence means that the yeast does not influences the enzyme-substrate complex formation.

In Table 2, the effects of two ethanol concentrations (11.30% v/v and 12.70 % v/v) at wine pH (3.20) on enzyme
activity are shown. Data are also reported as relative % activity. Ethanol has a reducing effect on the enzyme
activity, nevertheless it remains between 63-71% with respect to the same samples at pH 3.2 without ethanol.
beta-Glucanase maintain a relative activity between 63-65%, while the samples with EC1118 present again a the
highest activity, in fact relative values are about 70% compared to those without ethanol. No significant
differences were observed between the two considered ethanol concentrations. Further studies will be focused on
assessing kinetic parameters in base wine and sparkling wine.

4. References
Alexandre H, Guilloux-Benatier M (2006) Yeast autolysis in sparkling wine-a review. Aust. J. Grape Wine Res.
12: 119-127.
Humbert-Goffard A, Saucier C, Moine-Ledoux, V, Canal-Llaubres RM, Dubourdieu D, Glories Y (2004) An
assay for glucanase activity in wine. Enzyme Microb. Tech. 34: 537-543.
Martnez-Rodrguez AJ, Carrascosa AV, Polo MC (2001a) Release of nitrogen compounds to the extracellular
medium by three strains of Saccharomyces cerevisiae during induced autolysis in a model wine system. Int.
J. Food Micribiol. 68:155-160.
Pretorius IS (2000) Tailoring wine yeast for the new millennium: novel approaches to the ancient art of
winemaking. Yeast 16: 675-729.
Torresi S (2009) Biotechnological applications to optimize sparkling wine quality. In: Proc. s of the 14
th
Workshop on the
Developments in the Italian PhD Research on Food Science Technology and Biotechnology, Oristano (Italy), 16-18
September, 2009, pp. 448-449.

Figure 2 Enzymatic activity (mg/l
Glucose) of beta-Glucanase and
EC1118 yeast (!) and of beta-
Glucanase alone (") in acetate
buffer pH 5.00.
G
l
u
c
o
s
e

(
m
g
/
l
)

Enzymatic activity (mg/l
Laminarine (mg/ml)
Data 1
0.00 0.25 0.50 0.75 1.00 1.25
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
Attivit T
Attivit solo E
S, mg/ml
pH
Data 1
0 1 2 3 4 5 6 7 8
0.00
0.05
0.10
0.15
0.20
Attivit mg/l glucosio
pH
0 1 2 3 4 5 6 7 8
0.000
0.025
0.050
0.075
0.100
0.125
0.150
0.175
Attivit mg/l glucosio
pH
a b
pH
Table 1 Kinetic parameters of beta-Glucanase
alone and with EC1118 yeast in acetate
buffer at pH 5.00 using Laminarine

pH pH
Figure 1 Enzymatic activity (mg/l Glucose) vs. pH of beta- Glucanase (a)
and of beta-Glucanase and EC1118 yeast (b) in McIlvaine buffer.

Table 2 Effect of two ethanol concentrations and pH in
synthetic wine on the enzyme activity reported as mg/l
of glucose and as relative % activity

Beta Gluc. 0.2743 0.006 0.1345 0.009
Beta-Gluc.+EC1118 0.3806 0.019 0.1511 0.023
K
M
Samples Vmax
Ethanol Enzymatic activity Relative activity
(% v/v) (mg/l glucose) (%)
beta-Gluc. 3.20 0 0.160 0.009 100
beta-Gluc.+EC1118 3.20 0 0.172 0.005 100
beta-Gluc. 3.20 11.32 0.100 0.014 63
beta-Gluc.+EC1118 3.20 11.32 0.122 0.017 71
beta-Gluc. 3.20 12.70 0.104 0.005 65
beta-Gluc.+EC1118 3.20 12.70 0.118 0.005 69
Samples pH
0.
0.
G
l
u
c
o
s
e

(
m
g
/
l
)

0.
0.
0.
0.
0.
G
l
u
c
o
s
e

(
m
g
/
l
)

15
th
303
15
th
Genomic and transcriptomic characterization of natural yeast strains
of oenological relevance.

Laura Treu (laura.treu@unipd.it)
Dept. of Agricultural Biotechnology, University of Padua, Legnaro, Italy
Tutor: Prof.ssa Viviana Corich, co-tutor: Dott. Stefano Campanaro

The aim of this work is to provide the genome structure of some interesting strains isolated from Raboso and
Prosecco grape, and to correlate gene content with fermentative and sensory characteristics.Twenty
representative strains have been chosen on the basis of their phylogenetic and technological properties and at
least ten ascii for each strain have been dissected to evaluate spore viability. These strains are a perfect template
for genome sequencing and assembly due to lack of both heterozygosis and anaeuploidy. Finally, transcriptional
profiling will be performed using SOLID technology and will be aimed to identify variable regions involved in
determining phenotypic traits relevant for wine production and also the presence of specific regulation sites.

Caratterizzazione genomica e trascrittomica di ceppi naturali
di Saccharomyces cerevisiae di importanza enologica.

Lobiettivo di questo lavoro quello di ottenere, per alcuni ceppi provenienti da una selezione di lieviti naturali
isolati da mosto di Prosecco e Raboso, la loro struttura genomica e correlare la composizione genica con le
capacit fermentative e le caratteristiche organolettiche. Sono stati scelti venti ceppi rappresentativi sulla base
del loro profilo filogenetico e delle caratteristiche tecnologiche e, per ognuno, sono stati dissezionati almeno
dieci aschi al fine di verificare la vitalit delle spore. Grazie allassenza di eterozigosit e aneuploidia questi
ceppi sono unottima base per il sequenziamento e lassemblaggio del genoma. Infine le analisi del profilo di
trascrizione che verranno effettuate grazie alla tecnologia SOLID permetteranno di identificare le regioni
variabili responsabili dei tratti fenotipici rilevanti nel processo di vinificazione nonch la presenza di specifici
siti di regolazione.

Key words: Yeast, genomic sequence, fermentation, natural isolates, transcriptional profiling, wine production.
1. Introduction
In accordance with the PhD thesis project previously described (Treu L., 2009) this paper reports the main
results obtained in molecular and physiological characterization of twenty S. cerevisiae strains and the analysis
performed on all homozygous diploids derived from ascii dissection to choose those having the same oenological
characteristics and karyotype of the natural isolates from which they were obtained. To increase genome
coverage it has been tried to lower mitochondrial DNA copy number and now four selected strains are
undergoing genome sequencing with a 454-FLX using a mixed approach combining paired-end and shotgun
sequencing. Genomes will be compared to those of other S. cerevisiae strains available on public databases and
will be used to analyze transcriptional profiling data obtained for each strain grown in bioreactor under
winemaking conditions.
Cells were routinely grown in YPD medium (1% yeast extract, 2% peptone and 2% glucose) at 28 C, with
shaking, and sporulation was examined in cultures grown on acetate medium (1% potassium acetate, 0.1% yeast
extract, 0.05% glucose, 2% agar; w/v). Digestion of mithocondrial DNA using HinfI enzime have been
performed for genetic characterizations of oenological strains (Shuller D., 2005). Fermentation ability was
tested in MNS media (Delfini C.,1995).The number of mitochondrial genomes has been verified in different
glucose concentration YPD medium (5 g/l, 50 g/l, 200 g/l). PFGE has been carried out as described in Vaughan-
Martini et al. 1993. In genomic DNA extraction, 100 ml of an overnight culture was centrifuged and submitted to
nucleic acids protocol performed as described in Barnett J.A, 1990. Purification Mitochondrial DNA copy
number was verified using both semi-quantitative PCR reaction and Real Time PCR with two specific primers.
Separation of genomic from mitochondrial DNA was obtained by caesium chloride gradient with Hoechst dye
labelling.
3.1 Strains characterization and selection
S. cerevisiae strains are of great importance in industrial processes like alcoholic fermentations, but while the
physiological characterization of the yeasts involved in oenological applications is commonly performed, there is
less information about the genetic properties and the regulatory mechanisms of the enzymatic activities involved
in flavour production. Using statistical analysis, the genetic traits of the strains were related to the metabolic
properties thus obtaining a global overview on the fermentation performances of the different genetic groups.
15
th
304
15
th
Several genetic and physiological characterizations of oenological strains have been also performed in order to
achieve an overview of the karyotypes and to obtain strains with winemaking characteristics matching those of
the original diploid parent. To detect large genomic differences and facilitate genomic data comparison, a
preliminary analysis using pulsed field gel electrophoresis (PFGE) has been performed both on the natural
isolate diploids and on the four homozygous lines obtained from ascii dissection (fig. 1a).

Figure 1 a) PFGE comparison and b) fermentation ability of selected strains and homozygous lines derived.

Four homozygous diploids has been selected on the basis of their phylogenetic and technological properties
(fermentation ability, ethanol resistance) when they matched the same characteristics of the natural isolates from
which they were obtained. This strategy will facilitate genome sequencing and assembly, while all the
procedures would have been more difficult with parental diploids due to heterozygosis and anaeuploidy.

3.2 Genome sequencing and transcriptional profiling
Genomic sequencing and data analysis will be used to explore the genetic variability of the natural isolates. To
increase genome coverage we tried to lower mitochondrial DNA copy number testing several growth conditions
but we did not obtain a strong reduction. To overcome this problem we tried to associate it with growth
condition and to choose those one specific for low copy number. We looked for a correlation between glucose
concentration in media, O
2
presence or absence, early or late phase in cell growth curve but the estimated
mitochondrial number was always higher than 30. Hence we used caesium chloride gradient with Hoechst dye
on total DNA isolated to separate genomic from mitochondrial DNA.

Table 1 Genome coverage calculated for increasing mitochondrial copy number.

Sequences
lenght
Number of
sequences
Sequence
produced
Mit. genome
copies
Mit. DNA
Genomic
DNA
Frazione
Mit.
Frazione
Gen.
Coverage
Gen X
Coverage
Mit X
300 800000 480000000 1 344000 48000000 0,007 0,993 9,9 9,9
300 800000 480000000 50 17200000 48000000 0,264 0,736 7,4 368,1
300 800000 480000000 100 34400000 48000000 0,417 0,583 5,8 582,5

As a result of this selection strategy, four strains representative of the 600 natural isolates are undergoing
genome sequencing with a 454-FLX Roche sequencer. We chose a mixed strategy: half of the sequences are
being processed with paired-end library preparation providing scaffolds for the genome while the other half will
be a shotgun library preparation to obtain a better coverage. Genomic sequences will be analyzed with specific
software in order to identify highly polymorphic regions and will be compared to those of other
S. cerevisiae strains available on public databases. A transcriptional profiling of isolates grown in synthetic wine
media on bioreactors will provide the gene expression profile of our oenological yeasts. This part of the study
will be performed using SOLID technology and will be aimed to identify variable regions involved in
determining phenotypic traits relevant for wine production and also the presence of specific regulation sites. The
localization of differentially expressed genes will indicate the variable regions involved in determining
phenotypic traits and also specific regulation sites.
4. References
Treu L. (2009) In: Proc.s of the 14th Workshop on the Developments in the Italian PhD Research on Food
Science Technology and Biotechnology, Oristano, 16-18 September 2009, 582-583.
Delfini C. (1995) Scienza e Tecnica di Microbiologia Enologica, Edizioni Il lievito, 165-166.
Barnett J.A., Payner R.W., Yarrow D. (1990) Yeast Characteristics and identification. 2nd edn Cambridge
University press Cambridge, UK.
Vaughan-Martini et al. (1993) Antonie Van Leeuwenhoek, 63: 145-156.
Shuller D. and Casal M. (2005) The use of genetically modified Saccharomyces cerevisiae strains in the wine
industry. Appl. Microbiol. Biotechnol. 68: 292-304.
15
th
305
15
th

Exploitation of microbial capability to enhance the characteristics of
regional wines Prosecco and Tocai

Alessia Viel (alessia.viel@unipd.it)
Dept. of Agricultural Biotechnology, University of Padua, Italy
Tutor: Prof. Alessio Giacomini

In order to isolate new autochthonous yeast strains from Lison-Pramaggiore DOC region, fermentation of single
bunches of grapes was performed. Since only 19% of isolates belonged to Saccharomyces sensu stricto group, a
new sampling strategy was carried out: 22 bark portions were sampled and inoculated in synthetic must. The
54% of the collected yeasts was S. sensu stricto and an increase in strain number was found. Secondly, 17 yeast
strains, previously selected from Raboso and Prosecco grapes for their important oenological traits, were
fermented by means of bioreactors. The obtained kinetics showed two main behaviours due to strain adaptation
to the increasing ethanol concentration.

Sfruttamento delle potenzialit microbiologiche per migliorare le caratteristiche dei vini
regionali Tocai e Prosecco

Con lo scopo di isolare nuovi ceppi di lievito autoctoni provenienti dal territorio della DOC Lison-Pramaggiore,
stato condotto un campionamento, in vigneto, di grappoli che successivamente sono stati fermentati
singolarmente. Poich solo il 19% degli isolati apparteneva al gruppo Saccharomyces sensu stricto, stata
attuata una nuova strategia di campionamento raccogliendo 22 porzioni di tralcio. Il 54% dei lieviti risultato
appartenente al gruppo S. sensu stricto e comprendere un numero pi elevato di ceppi. Inoltre sono state
indagate, mediante lutilizzo di bioreattori, le performance di fermentazione di 17 ceppi, provenienti da uve di
Prosecco e Raboso, selezionati per le loro importanti caratteristiche tecnologiche. Le cinetiche di fermentazione
mostrano due andamenti principali dipendenti dalle capacit di adattamento alla quantit crescente di etanolo.

Key words: autochthonous yeast; yeast characterization; fermentative performance, bioreactor.
1. Introduction
In accordance with the PhD project, the main results on the first two activities are reported.
(A1) In order to isolate new autochthonous yeast strains, sampling of single bunches of grape was performed. As
the number of oenological yeasts collected in Lison-Pramaggiore DOC area was limited, grapevine bark portions
were analyzed, as well. Isolates characterization at species and strain level was performed by molecular methods.
Moreover fermentation performances were evaluated.
(A2) Secondly, the fermentation performances of 17 yeast strains previously selected from Raboso and Prosecco
grapes were investigated. The kinetics, obtained in synthetic musts, was easily achieved using bioreactors
equipped by flowmeters that allowed a real-time measurement of the CO
2
production.
Grapes were collected immediately before harvest and yeasts were isolated from fermentation of single bunches.
Bark portions were collected after harvest (October-November) and added to synthetic must for yeast isolation.
The colonies with Saccharomyces-like morphology were processed by multiplex PCR to identify yeasts
belonging to the Saccharomyces sensu stricto group (Nardi et al. 2006). Afterwards, mitochondrial DNA
restriction analysis (mtDNA-RFLP) was performed to cluster the isolates at strain level (Querol, Ramon 1996).
One representative for each group was finally identified at species level by restriction analysis of the ribosomal
internal transcribed spacer (ITS-RFLP) (Esteve-Zarzoso et al. 1999). To evaluate the main oenological traits,
each strain was inoculated in 100 ml of synthetic must and incubated at 25C (Delfini 1995). To study the
fermentation performance of 17 yeast strains isolated from Prosecco and Raboso grapes, one-litre capacity
bioreactors, equipped by a flowmeter to achieve the carbon dioxide efflux, were used. Yeasts were grown in
synthetic must at 25C.
3.1 Isolation of new autochthonous yeasts
During the sampling, 161 bunches of grapes were collected from the vineyards of Lison-Pramaggiore DOC area
and fermented separately. At the end of the fermentation (Tab. 1), 650 colonies with Saccharomyces-like
morphology were collected. After the genetic analysis (multiplex PCR), only 125 isolates were identified as
belonging to S. sensu stricto group. Unfortunately, mtDNA-RFLP analysis pointed out the presence of only 9
15
th
306
15
th

different strains (out of 125 isolates). Cluster analysis (GelComparII, Applied Maths) was performed adding
seventy commercial oenological strains and electrophoretic profiles comparison showed in one case 100% of
similarity with the profile of a selected yeast already on the market.

Table 1 Results of yeast isolation by means of grape bunches and bark portions sampling.
Total samples Total isolates
Samples containing
S. sensu stricto
S. sensu stricto
mtDNA
profiles
Bunches
of grapes
161 650
9
(5.6%)
125
(19%)
8
Bark
portions
22 73
4
(18.2%)
43
(54%)
7

As the number of oenological yeasts collected from the grape bunches was limited, a new sampling strategy was
carried out. With the aims to find out a higher level of biodiversity, 22 bark portions were sampled, as first trial,
and fermented in synthetic must. A total of 73 colonies were isolated. After genetic analysis, 43 colonies were
confirmed belonging to Saccharomyces sensu stricto group reaching the value of 54% of the total isolates
(instead of 19% obtained from fermented grape bunches). The mtDNA-RFLP analysis showed an increase in the
number of different profiles with a ratio (n of profiles/n of S. sensu stricto isolates) of 1:6 compared with 1:15
found when isolation was based on grape bunch fermentation. This preliminary results indicated that the bark
sampling seems to be more effective in isolating new oenological strains. All yeast strains were identified as
belonging to the species Saccharomyces cerevisiae. The fermentative performances of each strains were
compared with the kinetics of two commercial yeasts. Three isolates from grapes had a very slow fermentation
rate and did not consume all the sugar. All the other strains had a rapid fermentation rate similar to commercial
ones.

3.2 Comparison of fermentation kinetics of yeasts isolated from Prosecco and Raboso
fermented grape bunches.

The fermentation kinetics, measured as quantity of produced CO
2
(g/l) per hour, of 17 S. cerevisiae strains with
interesting oenological traits obtained from Prosecco and Raboso fermented grape bunches, were evaluated in
bioreactors. Examples of the main fermentation kinetics are shown in Fig. 1. During the exponential growth
phase, all the strains showed a similar behaviours, but the maximum value of produced CO
2
(g/l) per hour was
clearly strain dependent. After the peak, the fermentation rate decreased following two main trends. A slower
decrease was observed in 4 strains, presumably due to high adaptation ability to the in creasing ethanol
concentration. These strains consumed all the sugar very rapidly (Fig. 1A). The other strains showed a more
rapid decrease revealing poor adaptation ability to the increasing ethanol concentration. They determined a long
lasting fermentation that in some case is not sufficient to completely transform all the sugar.

(A) (B)
Fig. 1 The fermentation kinetics of autochthonous yeast strains.

4. References
Esteve-Zarzoso, B., Belloch, C., Uruburu, F. & Querol, A. 1999, "Identification of yeasts by RFLP analysis of
the 5.8 S rRNA gene and the two ribosomal internal transcribed spacers", International Journal of
Systematic and Evolutionary Microbiology, vol. 49, no. 1, pp. 329.
Nardi, T., Carlot, M., De Bortoli, E., Corich, V. & Giacomini, A. 2006, " A rapid method for differentiating
Saccharomyces sensu stricto strains from other yeast species in an enological environment", FEMS
microbiology letters, vol. 264, no. 2, pp. 168-173.
Querol, A. & Ramon, D. 1996, "The application of molecular techniques in wine microbiology", Trends in Food
Science & Technology, vol. 7, no. 3, pp. 73-78.
Delfini 1995, Scienza e tecnica di microbiologia enologica, .
15
th
307
15th Workshop on the Developments in the Italian PhD Research on Food Science Technology and

Pipette into cuvette Blank Sample
phosphate buffer 0.0 5 M pH 7 0. 927 ml 0. 927 ml
NADH 10mM 0.0 20 ml 0.0 20 ml
4- viny lguaiacol 0. 3 M 0.00 3 ml -
Cell extract - 0.0 50 ml
Mix and read absorbances of the solution for 5 minutes.
Then, start the specific reaction adding into the cuvette :
4- viny lguaiacol 0. 3 M - 0.00 3 ml
Mix and read absorbances of the solution for 5 minutes.
Molecular characterisation, stress responses and specific enzymatic
activities of Dekkera/Brettanomyces bruxellensis wine strains
Ileana Vigentini (ileana.vigentini@unimi.it)
Universit degli Studi di Milano, DiSTAM, Via Celoria 2, Milan, Italy
The aim of this PhD research project is to develop strategies in order to analyse and control the wine spoilage
linked to Dekkera/Brettanomyces bruxellensis species. The present work describes the main issues that have
been investigated during the second year of this PhD project: i) the development of a multiplex PCR protocol of
typing using intronic sequences; ii) the setting up of a spectrophotometric assay for the dosage of the
vinylphenol reductase activity, involved in volatile phenols production; iii) the yeast response to a low electric
current treatment (LEC).

Caratterizzazione molecolare, risposte a stress e attivit enzimatiche specifiche di ceppi
vinari di Dekkera/Brettanomyces bruxellensis
Lo scopo di questo progetto di tesi di dottorato sviluppare strategie per lanalisi ed il controllo dellalterazione
del vino legato alla presenza di lieviti della specie Dekkera/Brettanomyces bruxellensis. Il presente lavoro
descrive le principali attivit che sono state condotte nel corso dei primi due anni di questo progetto di dottorato:
i) sviluppo di un protocollo di PCR multiplex per la tipizzazione che sfrutta le sequenze introniche; ii) messa a
punto di un saggio spettrofotometrico per il dosaggio dellattivit della vinilfenolo reduttasi, coinvolta nella
produzione di fenoli volatili; iii) risposta del lievito allo stress da campo elettrico a bassa intensit.

Key words: Dekkera/Brettanomyces bruxellensis, ISS-PCR, volatile phenols, low electric current treatment.

1. Introduction
Dekkera/Brettanomyces bruxellensis is a major cause of red wine spoilage since it develops off-flavours (4-
ethylguaiacol and 4-ethylphenol) in wine through a specific reductive metabolism where vinylphenol reductase
(VPR) is the crucial enzyme. Recent observations suggest that brett spoilage is strictly strain-dependent and
therefore, a rapid and reliable identification at strain level becomes strategic (Vigentini, 2008; Agnolucci, 2009).
This poster communication reports the main results achieved during the first two years of PhD research project:
A1) the development of a new method for molecular typing; A2) the setting up of a protocol for the
measurement of the VPR activity A3) the yeast response to an electric current treatment.

A1) Molecular characterisation of D. bruxellensis wine strains
A total of 17 D. bruxellensis strains belonging to the international CBS collection were analysed in this study
(Fig. 1, 2). Genomic DNAs was extracted as described by Querol et al. (1992). The primers employed in the
amplification reactions were EI1, EI2, LA1, LA2 (De Barros et al. 1996) and DbEI1 (5-
CTGGCTTGGTGTAAGT-3). Amplifications were carried out following the protocol described for S.
cerevisiae (de Barros, 1996), setting the annealing temperatures at 46C and 47C when EI1/LA2 or DbEI1/LA
and EI2/LA1 or DbEI2/LA1 pairs of primers were used, respectively. Multiplex amplifications were performed
as described above using EI1, DbEI1 and LA2 oligonucleotides. The digitalized gel images were analysed using
Quantity One version 4.6.2 (Bio-Rad). Indexes of discrimination among ISS genetic profiles were calculated as
described by Hunter and Gaston (1988) according to the repeatability percentage.
A2) VPR activity of D. bruxellensis wine strains
The same D. bruxellensis CBS collection was tested for VPR activity.
Cells in exponential phase were harvested, washed in phosphate buffer
0.05 M pH 7 and subsequently centrifuged. Pellets were resuspended
in the same buffer, added with dithiothreitol 0.1 mM and PMSF 2
mM. Cells were then disrupted by subsequently steps of icing and
vortexing. Total proteins content was measured by Bradford assay.
The determination of the specific activity of VPR was calculated by
means of a spectrophotometer at 340 nm. Enzyme trials were performed as described in Table 1.
A3) Stress response of D. bruxellensis to LEC treatment
The experiments were performed applying to wine a 200 mA current intensity (Lustrato, 2010) using D.
bruxellensis CBS4481. Cellular viability was evaluated by plate counts and ATP determination (Ranalli, 2002).
Sample treatment was performed as follows: i) control (wine + cells), ii) wine + cells, added with SO
2
(80 mg l
-
1
), iii) wine + cells, subjected to 200 mA. Measurements of pH, titrable acidity, ethanol and sugar concentrations
Table 1
15
th
308
15th Workshop on the Developments in the Italian PhD Research on Food Science Technology and
0
0,02
0,04
0,06
0,08
0,1
0,12
0,14
Strain
were carried out. Cell morphology was observed using a scanning electron microscopy (SEM) (Ranalli, 2002).
Detection of volatile phenols (vinyl- and ethyl-phenols) was evaluated as described by Vigentini et al. (2008).

A1) Primers that anneal to specific conserved motifs, such as those
designed for ISS-PCR, have been already described for the inter- and
intraspecific characterisation of S. cerevisiae (de Barros Lopes,
1996). On the other hand, no reliable results have been shown for the
discrimination of D./B. bruxellensis species at strain level when
yeasts are analysed with the primer EI1 alone (Oelofse, 2009).
Primers EI1/LA2 and EI2/LA1 were preliminary employed in pair on
D. bruxellensis collection and results showed that different indexes
of discrimination were generated (98.5% and 93.0%, respectively).
Considering that D. bruxellensis has an intron content similar to the
one of S. cerevisiae and that the most represented 5 motif seems to
be GTAAGT instead of GTATGT as reported for S. cerevisiae
(Woolfit, 2007), a new primers pair DbEI1/LA2 was tested (Fig.1).
Since different patterns were generated from the same strain, a
multiplex PCR was applied on the whole collection using primers
DbEI1, EI1 and LA2 (Fig. 2), with an increasing of the
discriminatory power up to 99.3%. This work suggests a simple and
reliable method for strain typing of D. bruxellensis species.
A2) The specific activity of the VPR enzyme was preliminary
measured in presence of NADPH as coenzyme. The low decreasing in
the kinetics of reaction obtained for all the strains (A
340
/min< 0.1),
confirmed the low affinity of VPR to NADPH. On the contrary, the
use of NADH led to quantifiable values of VPR activity, especially
for CBS4601 strain (Fig. 3). These data indicated that VPR is a
NADH-dependent enzyme and that a reliable UV method, here
described for the first time, can discriminate the strains for their
physiological aptitude to produce off-flavours. Tests, performed in
triplicate, showed a good repeatability (standard error of 3%).
A3) No significant variations in the viable cell count and in the ATP content were observed between the LEC
and SO
2
treatments, showing an inhibition effect due to electric current. Kinetics of off-flavours production,
under various conditions, are shown in Fig. 4 and 5. In the control (i/!) higher amounts of volatile phenols were
produced compared to tests (ii/") and (iii/#). The LEC treatment (200 mA at 72nd h) caused alterations in the
morphology and integrity of the cells. Our findings show that the
inactivation of D. bruxellensis CBS 4481 using LEC treatment
was obtained. The use of this technological process could improve
the quality of wine without recourse to chemical additives,
offering an alternative for the production of organic wines.

References
Agnolucci M, Vigentini I, Capurso G et al (2009) Genetic diversity and physiological traits of
Dekkera/Brettanomyces bruxellensis strains isolated during fermentation of Sangiovese grapes. Int J Food
Microbiol 130: 238-244.
de Barros M, Soden A, Henschke PA, Langridge P (1996) PCR differentiation of commercial yeast strains using
intron splice site primers. Appl Environ Microbiol 62: 4514-4520.
Hunter PR, Gaston MA (1988) Numerical index of the discriminatory ability of typing systems: an application of
Simpsons index of diversity. J Clin Microbiol 26: 2465-2456.
Lustrato G, Vigentini I, De Leonardis A, Alfano G, Tirelli A, Foschino R, Ranalli G (2010) Inactivation of wine
spoilage yeasts Dekkera bruxellensis using low electric current treatment (LEC). J Appl Microbiol doi:
10.1111/j.1365-2672.2010.04686.x
Querol A, Barrio E, Huerta T, Ramn D (1992) Molecular monitoring of wine fermentation conducted by active
dry yeast system. Appl Environ Microbiol 58: 2948-2953.
Ranalli G, Iorizzo M, Lustrato G, Grazia L (2002) Effects of low electric treatment on yeast microflora. J Appl
Microbiol 93: 877-883.
Vigentini I, Romano A, Compagno C et al (2008) Physiological and oenological traits of different
Dekkera/Brettanomyces bruxellensis strains under wine-model conditions. FEMS Yeast Res 8: 1087-1096.
Woolfit M, Rozp$dowska E, Pi%kur J, Wolfe KH (2007) Genome survey sequencing of the wine spoilage yeast
Dekkera (Brettanomyces) bruxellensis. Euk Cell 6: 721-733.
Figure 3
Figure 4 Figure 5
15
th
1
st
Year PhD Student
Dissertation Project
15
th
311
15
th
The Effects of Natural Compounds on the Growth and Biofilm Formations
of Food borne Pathogens
Debbie Andyanto (debbieandyanto@yahoo.com)
Dept. Food Science and Technology, University of Udine, Udine, Italy
Tutor: Prof. Giuseppe Comi
This PhD thesis research project is aimed to evaluate the effectiveness of natural compounds as food
antimicrobial, to inhibit the growth of food-borne pathogens and the biofilm formations. The goal of this project
will be to evaluate the optimum concentration of the natural compounds to be employed as food preservatives
and to study the synergistic or antagonistic action with each other and with food ingredients.
Effetti di Composti Naturali sulla Crescita e Formazione di Biofilm di Microrganismi
Patogeni degli Alimenti

Questo progetto di tesi di dottorato si propone di verificare lefficacia di particolari sostanze naturali nellinibire
la crescita e la formazione di biofilm prodotti da batteri patogeni di origine alimentare. Lo scopo sara quello di
trovare delle sostanze naturali, come oli essenziali o batteriocine, che sole o lavorando in sinergia possano essere
utilizzati per migliorare la qualita totale del prodotto.

1. State-of-the-Art
The basic purpose of preservative application into food products is to eliminate and inhibit the growth of
microorganism, especially pathogen microbial. Another reason is also to minimize the risk of foodborne disease.
It has been estimated that as many as 30 % of people in industrialised countries suffer from a food borne disease
each year and in 2000 at least two million people died from diarrhoeal disease worldwide (Burt, S. 2004). In
contrast, consumers demand on natural preservatives for their food. Roller (1995) has reported that consumer
concern over the possible adverse health effects of certain food preservatives, increasing demand for
convenience foods with long shelf-lives has resulted in increasing pressure on manufacturers to remove
chemically-synthesized additives and to provide more natural alternatives. Western society desire fewer
synthetic food additives and products with a smaller impact on the environment (Burt, S. 2004).
From two different reports within range time 9 years, showed that there are interest on the search of natural
preservatives. Seems that there are trends that consumer demands for replacing or completely remove chemical
preservatives from food. This is a challenge for food industries to be able to compete in the markets.
This project is interested in the exploration of essential oils and bacteria-antimicrobial producers for the
application on the food matrix as natural preservatives and also to inhibit the growth of biofilm, which in some
occasion gave problem to the food industry, since biofilm grew on the surface of the process equipments in food
industry, and this lead to the cross contamination of food products. Study by Hood & Zottola (1997) indicated
that S. typhimurium, E.coli O157, L. monocytogenes do adhere to stainless steel. Peng et al., (2001) demonstrated
the adhesion capability of the spores and vegetative cells of B. cereus to stainless steel, which is a material
commonly used in food processing industry.
The applications of plant essential oils (EOs) for control of food-borne pathogens have been studying in recent
years (Roller, 1995; Hammer et al., 1999; Marino et al., 2001; Singh et al., 2003; Burt, 2004; Gutierrez 2008;
Tajkarimi et al., 2010) and reported the effectiveness of EOs against pathogenic bacteria. Application and
combination of food processing technologies with addition of EOs resulted in a potential synergetic effect. In the
other side, the possibility to use EOs in foods could have disadvantageous effects, such as influencing the
organoleptic properties (flavour) and influencing the stress tolerance of pathogens (Burt, 2004). It is well known
that the physical structure and food components like fat and protein, may protect bacteria from the action of EOs
or limit and/or reduce the efficacy of the oils (Burt, 2004; Gutierrez et al., 2008; Tajkarimi et al, 2010).
This PhD thesis project will focus chiefly on the selection of minimum EOs concentrations required to achieve
optimum antibacterial effect and evaluate the synergistic or antagonistic action with each EOs and with food
ingredients. The capability of some bacteria to have an inhibitory activity against other bacteria, but do not kill it,
is an interesting antagonism mechanism. The main antagonism-mechanisms are belongs to the lactic acid
bacteria (LAB) groups. LAB are able to produce a uncommon substance to suppress their competitors:
bacteriocins (Lucke, 2000). Bacteriocin showed inhibitory activity confines to gram-positive bacteria and act
against bacteria closely related to the producers organisms (Abbe, et al., 1995; Gautam et al., 2009; Parente,
1995).
15
th
312
15
th
2. PhD Thesis Objectives and Milestones
Within the overall objective mentioned above this PhD thesis project can be subdivided into the following
activities according to the Gantt diagram given in Table 1:
A1) Food pathogens strain selection (Listeria monocytogenes, Staphylococcus aureus, Bacillus cereus,
Salmonella typhimurium, Eschericia coli O157:H7, Pseudomonas aeruginosa).
A2) Essential Oils inhibition actions in vitro and selection of minimum concentration of optimum inhibition
action (A2. 1). Synergism-antagonism action of EOs with food ingredients: fat and protein (A2. 2).
A3) Identification of strain-producer antimicrobial to select the productive strains, which are exhibit the
inhibition activity.
A4) Evaluation on the inhibition action of antimicrobial compounds with food-borne pathogens using
cell-free supernatans and containing-cells supernatans.
A5) Survival of food-borne pathogens on abiotic surface to assess the influence of natural antimicrobial on
the bacterial attachment on stainless-steel surface.
A6) Writing and Editing of the PhD thesis, scientific papers and oral and/or poster communications.
Table 1 Gantt diagram for this PhD thesis project.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
A1) Food pathogens strain selection
A2) Essential oils
1) in vitro
2) synergism-antagonism
A3) Identification of strain-producers
antimicrobial
A4) Evaluation on the inhibition action
of antimicrobial compounds with
food-borne pathogens
A5) Survival of food-borne pathogens
on abiotic surface
A6) Thesis and Paper Preparation
Abee T, Krockel L, Hill C (1995) Bacteriocins: modes of action and potentials in food preservations and control
of food poisoning, Int J Food Microbiol. 28: 169-185.
Burt S (2004) Essential oils: their antibacterial properties and potential applications in foods a review, Int J
Food Microbiol. 94. 223-253.
Gautam N, Sharma N (2009) Bacteriocin: safest approach to preserve food products, Indian J Microbiol 49: 204-
211.
Gutierrez J, Barry-Ryan C, Bourke P (2008) The antimicrobial efficacy of plant essential oils combinations and
interactions with food ingredients. Int J Food Microbiol. 124: 91-97.
Hammer KA, Carson, CF, Riley TV (1999) Antimicrobial activity of essential oils and other plants extracts. J
Appl Microbiol. 86: 985-990.
Hood SK, Zottola EA (1997) Adherence to stainless steel by food borne microorganisms during growth in model
food systems, Int J Food Microbiol. 37: 145-153.
Lucke FK (2000) Utilization of microbes to process and preserve meat, Meat Science. 56: 105-115.
Marino M, Bersani C, Comi G (2001) Impedance measurements to study the antimicrobial activity of essential
oils from Lamiaceae and Compositae, Int J Food Microbiol. 67: 187-195.
Parente E, Brienza C, Moles C, Ricciardi A (1995) A comparison of methods for the measurement of bacteriocin
activity, J Microbiological Methods. 22: 95-108.
Roller S (1995) The quest for natural antimicrobials as novel means of food preservation : status report on a
European research project, Int. Biodeterioration & Biodegradation. 333-345.
Peng JS, Tsai WC, Chou CC (2001) Surface characteristic of Bacillus cereus and its adhesion to stainless steel,
Int J Food Microbiol. 65: 105-111.
Singh A, Singh RK, Bhunia AK, Singh N (2003) Efficacy of plant essential oils as antimicrobial agents against
Listeria monocytogenes in hotdogs. Lebensm.-Wiss. U.-Technol. 36: 787-794.
Tajkarimi MM, Ibrahim SA, Cliver DO (2010) Antimicrobial herb and spice compounds in food. Food Control
21: 1199-1218.

15
th
313
15
th

Innovative encapsulating materials and techniques for flavour
encapsulation
Claudia Belingheri (claudia.belingheri@gmail.com)
Dept. Food Science and Technology, University of Parma, Parma, Italy
Tutor: Prof. Elena Vittadini
This PhD thesis research project is aimed at the development of new technologies, the improvement of existing
technologies and the implementation of new wall materials for the encapsulation of flavours in a specific
industrial context.
Materiali e tecniche innovative per lincapsulazione di aromi
Questo progetto di tesi di dottorato ha lo scopo di sviluppare nuove tecnologie, migliorare tecnologie esistenti e
sperimentare nuovi materiali per lincapsulazione di aromi in un contesto industriale specifico.

1. State-of-the-Art
Encapsulation of active ingredients has been in use for over 50 years in the pharmaceutical, chemical, fragrance
and flavour industries and it produces various advantages: a liquid product can be converted to powder form and
be thus easier to handle, the core material is isolated from its environment to protect it from evaporation,
oxidation and other reactions that can cause its degradation and/or production of off notes, a concentrated
product is diluted for ease of use and last but not least, a controlled release of the core material can be obtained
(Uhlemann et al., 2002).
The first technique to be developed, which is still today the most widely used due to its low costs and available
equipment, is spray drying (Gharsallaoui et al., 2007). This process involves the atomization of a liquid slurry,
composed of wall materials, water and the active ingredient, into a drying chamber where it meets hot air which
causes the evaporation of water and a dry powder is collected. Different wall materials can be used in this
process, the most widespread being gum arabic, maltodextrins, modified starches and certain proteins (Drusch
and Schwarz, 2006). The properties which define a good wall material are their emulsifying properties for the
production of a small sized and stable slurry, their viscosity in solution for slurry pumpability, the ability to
retain the active ingredient during atomization and at the same time allow the evaporation of water, moreover
good wall materials are inert towards the active ingredient and protect the core from heat, oxygen and light once
in powder form (Buffo and Reineccius, 2000).
New wall materials, especially new modified starches and proteins, are constantly being developed with the aim
of obtaining higher oil loads, better controlled release, and possibly avoiding the negative aspects of gum arabic
related to its unstable price and availability. Besides the search for new wall materials for spray drying, the
industry has, over the years, also worked on the development of different techniques for encapsulation, briefly
mentioned below (Madene et al., 2006) and summarised in table 1.
Coacervation this technique involves two oppositely charged polymers in a near stoichiometric ratio that at a
correct pH and temperature associate ionically to form microcapsules. The wall is often hardened by chemical or
enzymatic crosslinking. The production process is long and costly, and the few existing commercialised products
are in a liquid suspension form.
Liposomes these particles simulate the structure of cells by encapsulating a hydrophilic phase into a lipid
double-layer, forming a lypophilic product.
Encapsulation in yeasts yeast cell walls (!-glucans) may be used in the intact form for the adsorption of
flavours or in the hydrolysed form as spray drying wall materials.
Fluid bed agglomeration this technique is used to achieve larger and instantly soluble powder particles by
wetting fine powders in a fluid bed system and allowing their agglomeration.
Molecular inclusion this occurs when a small molecule is hosted within the lattice structure of a larger
molecule, such as !-cyclodextrins.
Spray chilling this technique is analogous to spray drying but uses low temperatures and fats or oils as wall
materials. Products are lypophilic and will release the flavour upon heating and melting.
It must be noted, however, that with few exceptions made for niche products, spray dried powders remain the
bulk of commercialised encapsulated flavours.
15
th
314
15
th
Table 1 Overview of existing encapsulation techniques (Madene et al., 2006).
Technology Most common wall materials
Spray Drying Maltodextrins, Gum Acacia, Modified Starches
Spray Chilling Fats and oils
Coacervation Gelatin and Gum Arabic
Fluid bed agglomeration Dextrose, Maltodextrins, Gum Acacia, Modified Starches
Molecular inclusion !-cyclodextrins
Liposomes Phospholipids
Encapsulation in yeasts Yeast cell walls (!-glucans)

Within the overall objective mentioned above, this PhD thesis project can be divided into the following activities
according to the Gantt diagram given in Table 2:
A1) Porous starch as a new wall material is the initial focus of the project. Starch can be modified in many
ways, one of which is hydrolysis which can cause the formation of a porous structure, able to include
molecules. This starch will be studied to investigate its ability to perform as an encapsulant, first of all by
investigating its affinity with different solvents (A1.1) and by exploring different flavour loading methods
(A1.2). Positive results in these areas will lead to further studies regarding the flavour stability (A1.3), the
starchs performance in food products (A1.4) and its ability to release the loaded flavour (A1.5).
A2) The Coacervation technique is the second main focus of this project, the first aim being the successful
drying of a coacervate suspension (A2.1). Research will be done into the use of enzymes for the
crosslinking of the coacervate wall (A2.2) and new wall materials will be explored for coacervate formation
(A2.3). Successful products will be tested into food products (A2.4).
A3-5) Liposomes and the use of yeasts for encapsulation are two techniques on which focus will be directed
once progress has been made on the first two activities. During the next years, furthermore, any new or
emerging technique or wall material deemed interesting can be explored.
A6) Writing and editing of the PhD thesis, scientific papers and oral and/or poster communications.

Buffo R. and Reineccius G. (2000) Optimization of Gum Acacia/Modified Starch/Maltodextrin Blends for the
Spray Drying of Flavors, Perfumer & Flavorist, 25: 45-54.
Drusch S. and Schwarz K. (2006) Microencapsulation Properties of Two Different Types of n-Octenylsuccinate
Derivatised Starch, Eur. Food. Res. Technol., 222: 155164.
Gharsallaoui A., Roudaut G., Chambin O., Voilley A. and Saurel R. (2007) Applications of Spray-Drying in
Microencapsulation of Food Ingredients: An Overview, Food Res. Int., 40:1107-1121.
Madene A., Jacquot M., Scher J. and Desobry S. (2006) Flavor Encapsulation and Controlled Release a
Review, Int. J. of Food Science and Technology, 41: 1-21.
Uhlemann J., Schleifenbaum B. and Bertram H-J. (2002) Flavor Encapsulation Technologies: An Overview
Including Recent Developments, Perfumer & Flavorist, 27: 52-61.
15
th
315
15
th
Competitiveness in the wine sector
Victoria Bruno Bossio (victoria.brunobossio@uniud.it)
Dept. Food Science, University of Udine, Udine, Italy
Tutor: Prof. Sandro Sillani
The aim of this PhD thesis is to analyse the main aspects regarding competitiveness in the wine industry. Trough
a study of the different aspects that create competitive advantage in a business, understand the situation of the
wine sector, differences occurring within it, and enhancing strength/weakness points of its different parts. The
objective is to achieve a deeper lecture of the situation in order to be able to suggest solutions and actions for
possible local/national concrete developments.
La competitivit nel settore vitivinicolo
Questo progetto di tesi di dottorato intende analizzare i maggiori aspetti legati alla competitivit del settore
vitivinicolo. Attraverso uno studio delle diverse componenti coinvolte nella creazione del vantaggio competitivo,
descrivere la situazione del settore, evidenziando le differenze che intercorrono al suo interno, e i punti di
forza/debolezza delle diverse parti che lo compongono. Lobiettivo finale sar di quello di proporre azioni e
soluzioni concrete a diversi livelli, locale e nazionale.
1. State-of-the-Art
Through the past years, European countries with the greatest wine potential (France, Italy and Spain) are losing
progressively competitiveness. This fact is related to many reasons, as a general decrease of wine consumption
and a change in import trends towards low end wines from new wine producing countries to the detriment of
traditionally producing countries.
According to Michael Porters theory of competitive advantage (1987), the most important factors that are
connected to competition in a specific sector are: the intensity of competitiveness between existing competitors,
the bargaining power of suppliers, the bargaining power of buyers, the threat of potential new or substitutive
products. In time, different types of firm organization were developed according to the different coordination
needs that the competitive environment required. The model was based on the main internal and external factors
that determine competitive advantage. Between the internal factors, of great importance is the capability of
controlling production and management costs, trough technological and managerial know-how. Within the
external aspects, we find the products quality characteristics as perceived by customers, that are developed
trough marketing know-how in order to understand and answer customers needs.
Recently, the growing economic system along with its instability has brought the problem of coordination
outside the borders of the single firm. The stress now is on the coordination between different firms that
participate together in the so called value chain. This way of organizing the production system should bring to
the achievement of a major efficiency and effectiveness compared to the standard model of the stand-alone
firm (firm that acts according to its own autonomous decisions). The production system organized as a network,
or what Porter defines cluster, offers new development chances to firms, as much as new business models.
The evolution of competitiveness is showing how the key-sources for business success relies often on non-
material resources, and especially on knowledge. The emerging model of business is a flexible one, that works at
a global level, developing the borders of his action area thanks to a coordination activity based on knowledge
and on the capability of interacting with a net of other companies/business activities more than on the property of
production processes. Some new dimensions connected to competition are becoming relationships and
knowledge within a society, territory, people, institutions. The neighborhood of different bodies that are involved
in the same chain are able to constitute a critical mass and divert resources, enhancing competitiveness and
innovation (Porter, 1990) not only at a national but also at an international level.
The example of Australias wine sector growth comes together with a change of approach in the industry: it has
ceased to be composed solely of rivalrous, competitive firms, replaced by a combination of industry
collaboration around matters of shared concern and competition. The industry has raised its level of integration
and is developing into a knowledge driven cluster, where humanly created advantages predominate. This
combination has been decisive in sustained success.
Regarding the Italian small and medium size food sector enterprises, such as the ones involved in the wine
sector, which are tightly connected and related to the territory, these new models offer opportunities for the
development of a new management approach, but of course bring up new problems that need a careful strategic
analysis on the possible future scenarios.

15
th
316
15
th

Within the overall objectives mentioned above, this PhD thesis project can be divided into the following
activities according to the Gantt diagram given in table 1:
A1) Study of the wine sector: local, national and international situation; bibliographic research; collection of
existing and new data (trough surveys, questionaires); analysis of data.
A2) Study of different competitive forces: collected data will be analyzed with statistic techniques regarding
production costs, R&D, innovation, marketing and communication, training and learning.
A3) Development of projects/proposals for new strategies/actions: seting of new strategies/actions to
overcome weak points. Description of possible future scenarios.
A4) Writing and editing of the PhD thesis, scientific papers and oral and/or poster communications, on a
National and International level.
Table 1 Gantt diagram for this PhD project
Act
Months
Activity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1
Study of wine sector

Bibliographic research

Data collection and
analysis
A2
Study of competitive
forces
Bibliographic research

Data collection and
analysis
A3

Proposals for new
strategies/actions
A4
Thesis development

Castillo S., Hidalgo C. (2007), Wine sector in the European Union: determining and determinant aspects of the
competitive and productive position, Universidad de Castilla-La Mancha, dagli Atti del I Mediterranean
Conference of Agro-Food Social Scientists, Barcelona.
Cesaretti G.P., Green R., Mariani A., Pomarici E. (2009), Il mercato del vino: tendenze strutturali e strategie
dei concorrenti, Franco Angeli Editore, Milano.
Marsh I., Shaw B. (2000), Australias wine industry: collaboration and learning as causes of competitive
success, Australian Business Foundation
Porter M.E.(1998), Clusters and the new economics of competition, Harvard Business Review, November
December Edition: 7790.
Porter M.E. (1998), On Competition, Harvard Business School Press, Boston.
Rossi M. (2008), Competitivit e localizzazione. Analisi del distretto del vino in Campania, dagli Atti del V
Convegno Annuale SIM, Milano.
Volpato G. (2006), Economia e gestione delle imprese, Carocci Editore, Roma.

15
th
317
15
th
Sustainability assessment of Durum wheat-based production systems under
Blue Agriculture, Italian way of Conservation Agriculture
Sandra Corsi (scorsi@unite.it)
Agronomy and Crop Sciences Research and Education Center
Department of food science, University of Teramo, Teramo, Italy
Tutor: Prof. Michele Pisante
The purpose of the present work includes the objective assessment of the environmental sustainability (in terms
of water use efficiency, soil quality, biodiversity) and economical profitability (as yield and grain quality) of
Durum wheat-based cropping systems under the production method known as Conservation Agriculture.
Valutazione di sostenibilit della filiera produttiva del grano duro in Agricoltura Blu, la
via italiana dellAgricoltura Conservativa
Il presente lavoro ha come principale obiettivo quello di valutare la sostenibilit ambientale (in termini di
efficienza di uso dellacqua, qualit del suolo, biodiversit) ed economica (espressa in termini di rese e qualit
della granella) del sistema produttivo noto come Agricoltura Blu nella filiera grano duro-paste alimentari.
1. State-of-the-Art
Farming faces a multiple challenge: maximize profits, guaranteeing high yields and quality standards, while
simultaneously preserving natural resources. Growing demand for food, fertility loss, climate change and
increasing stress on water resources are putting existing farmland under further pressure. In order to provide
sufficient and diversified food for the growing world population in sustainable ways, agriculture in the 21
st

century needs meeting the demand for a 70% higher crop production relative to 2005 by 2050 (FAO, 2006). This
will require expanding the land area, increasing the frequency with which this is cropped, and boosting yields.
As moving into uncultivated territory threatens biodiversity and adds to climate change through deforestation,
priorities for research efforts should include identifying and adapting production systems that enable farmers to
achieve a sustainable balance between improved productivity, high quality standards and environmental
protection. Since low standards of implementation management, inadequate input availability and poor extension
support are the main causes of poor yield and quality performance in many areas, there is scope to reduce the
yield gap (maximum agro-ecologically attainable yield vs. actual yield) on the basis of better use of knowledge
and technology (with improvements based on plant varieties and farming technologies).
Environmentally sound intensive production will need to feed the world, yet a relatively limited role for small
scale and, traditional methods will remain. Traditional tillage (TT) is based on mechanical tillage. This kind of
agriculture is blamed to increase erosion rates, deplete the soil organic matter (SOM), reduce soil fertility and
accentuate costs of soil restoration. Furthermore tractor fuel emissions should be added up with those that
originate from the oxidative breakdown of soil organic matter through mechanical tillage. As in a vicious circle,
the reduction of soil organic matter endangers the biological soil structuring processes carried out by the soil
edaphon, which in turn reinforces the need for more mechanical tillage leading to further soil degradation. As
opposed to tillage-based systems, Conservation Agriculture (CA) is a concept for resource-saving agricultural
crop production that aims to achieve high agricultural yields while helping to reduce land degradation and
increase water use efficiency. This agricultural system includes: i) minimum mechanical soil disturbance, which
can be achieved by the implementation of no-tillage (i.e. sod seeding); ii) permanent organic soil cover (either
cover crops or crop residues); iii) diversified crop rotations or plant associations.
The main reason for the present experimental work is the lack of knowledge on CA systems, on the best
management practices during the transition phase, and on CA influence on the quality of end-products. Data
from field trials implemented at different latitudes and longitudes, under different soils, climatic conditions (i.e.
Italy, Brazil and Ethiopia) will be analyzed with the aim to get to a clear position on the impact of CA on wheat-
based cropping systems. It has been decided to investigate the sustainability of the durum wheat (Triticum durum
Desf.) sector, as this is one of the most important crops used for human consumption: it is cultivated on about 20
million ha worldwide, and its production ranges at about 30 million t annually. In Italy, with 1.6 million ha and
an average productions of 4 million t, durum wheat has a direct and effective role in the national economy.
Trials in Rome and Teramo will help to: i) account for the agricultural panorama of hills and plains in areas
where this cropping system is traditionally associated with monoculture and burning of stovers, which would
highly benefit from conservation effective production systems, and ii) to build on existing knowledge on CA
systems and their impact on grain quality (Shewry et al., 2002). The lack of knowledge makes it particularly
difficult and socio-economically risky for European farmers to farm without ploughing (Imaz et al., 2010),
15
th
318
15
th
which is deeply rooted in their cultural backgrounds. In Brazil, durum wheat is not one of the most important
crops grown (under rainfed circumstances wheat yields are about 2 t ha
-1
). Nevertheless, Brazil is one of the few
places where long period time series of agricultural production under CA are available, and this is why
experiences there would be very useful for this research. In Africa, CA is not practiced on the same scale as in
Brazil and, on a country basis, wheat yields in Ethiopia are comparable to the yields in Brazil. However, there
are efforts to promote CA for its potential to help control erosion and provide more stable yields.
Within the overall objective of building on existing knowledge on the sustainability CA systems, this PhD
research will include the experiments as reported in Table 1 and described below:
A1 Bibliographic research and literature review.
A2 Field and laboratory work: for all locations, CA systems will be compared to TT systems on a split-plot
design arranged as randomized block with 3 replicates. The main plots will have a surface of 5000 m
2
and
the sub plots of 1000 m
2
. The main thesis will include the 2 agricultural systems, while the secondary thesis
will be represented by different rotations, crop residue managements and wheat genotypes. 4 wheat
cultivars will be selected among those tested for grain yields and quality in ongoing Rome based trials
(2009-2010) and those reported in literature (Pisante, 2007) to have achieved positive results in the Centre
and South of Italy. Compared cultivars include Casanova, Isildur, Achille, Avispa, Canyon, Claudio,
Simeto. Physiology, quality and environmental analysis as described in A2 and Table 2 will be carried out.
A3 Data elaboration: wheat response to management systems and performance in the rotation will be
assessed by measuring the parameters described in Table 2. More specifically, productivity will be
measured in terms of yield (Y) and grain quality (GQ), the environmental sustainability will be measured
in terms of biodiversity (B), water use efficiency (WUE) and soil quality (SQ). The ability to sequester
carbon by CA and TT-based systems will be also quantified and compared.
A4 Writing and editing of the PhD thesis, scientific papers, and oral and/or poster communications.
Table 1 Activities to be carried out from 2009 to 2012

ACTIVITIES
MONTHS
1
N
2
D
3
J
4
F
5
M
6
A
7
M
8
J
9
J
10
A
11
S
12
O
13
N
14
D
15
J
16
F
17
M
18
A
19
M
20
J
21
J
22
A
23
S
24
O
25
N
26
D
27
J
28
F
29
M
30
A
31
M
32
J
33
J
34
A
35
S
36
O
A1 Literature review
Trials management,
crop and soil
analysis

A2
Field
and
lab
work
Harvesting and
quality analysis

A3 Data elaboration
A4 Report / Thesis writing
Table 2 Parameters to be monitored
PARAMETERS AIM
Soil cover (% and type) and erosion (crusting, spacing, gullies); stratification ratio of soil organic C and N
pools; soil color and structure;
SQ
Soil organic matter content; presence of soil organisms (earthworms, dung beetles, ants), biological activity
(holes, burrows), or microbial activity (DGGE, respiration and ratio of microbial C on the total soil C);
SQ, B
Direct measurement of water uptake in field; root length and density; WUE, SQ
Yield and yield components (number and length of the spike, number of tillers, Harvest Index); WUE, Y
Crop emergence (as number of seedling m
-2
); incidence of weeds; Y
Nutrient Use Efficiency, Leaf Area Index, and SPAD in different phases of the crop cycle; Y, GQ
Kernel size; thousand grain weight; hectolitre weight; content of: macronutrients, starch, crude proteins,
amino acids, pigment, oxidizing and antioxidant enzymes; gluten content, strength, and elasticity.
GQ
FAO (2006). World agriculture: towards 2030/2050, an FAO study. Rome.
Pisante M (2007). Agricoltura Blu. La via italiana dellagricoltura conservativa. Principi, tecnologie e metodi
per una produzione sostenibile. IlSole24Ore-Edagricole, Bologna, XII+317 pp. ISBN-978-88-506-5253-2.
Imaz MJ, Virto I, Bescansa P, Enrique A, Fernandez-Ugalde O,Karlen DL (2010). Soil quality indicator
response to tillage and residue management on semi-arid Mediterranean cropland. Soil and Tillage
Research 107 (2010) 1725.
Shewry P, Halford N (2002). Cereal seed proteins: structure, properties and role in grain utilization. J. Exp.
Bot., 53:947-958.
15
th
319
15
th
Characterization of donkeys milk proteins by proteomic approach
Angela Costanzo (angela.cost@libero.it)
Dept. Food Science, University of Naples, Federico II, Italy
Tutor: Prof. Lina Chianese
This PhD thesis is aimed to characterization of donkeys milk proteins (caseins and whey proteins) by coupling
immunoelectrophoretic and chromatography technique to mass-spectrometric analysis. The golden goal of
research project is to find scientific data on which it can justify the positive intake of donkey milk by CMPA
(cows milk protein allergy) patients.
Caratterizzazione delle proteine del latte di asina mediante approccio proteomico
Lo scopo della presente tesi di dottorato la caratterizzazione molecolare della frazione proteica del latte di asina
(caseine e sieroproteine) quale base scientifica della digeribilit di questo latte da parte di bambini con
conclamata allergia alle proteine del latte di vacca (CMPA). La metodologia analitica messa a punto si basa sulla
sinergia di tecniche immunoelettroforetiche mono e bidimensionali e di quelle cromatografiche ad alta
risoluzione (RP-HPLC) accoppiate allanalisi di spettrometria di massa.

1. State-of-the-Art
Cows milk protein allergy (CMPA) occurs in predisposed infant patients during the first 3 years of their life.
The very effective treatment against CMPA consists in replacing the based cows milk infant formulas with
either soy milk or hydrolyzed bovine casein and whey protein formulas (Muraro et al., 2002). Moreover these
formulas, in addition to an expensive price and the presence of peptides having a size which can stimulate the
immunological response, also have an unpleasant taste. For these reasons, other non bovine milk (mainly goat
milk) have been studied (Bevilacqua et al., 2002) to find a substitute having a composition more similar to
human milk. Several clinical studies (Monti et al., 2007) showed that donkeys milk could represent a valid
alternative to both IgE and non-IgE mediated CMPA.
Till now, as scientific results, only the similar quantitative composition between donkey and human milk, was
available. On the other hand the composition of donkeys milk is more similar to human milk than cow, because
of the higher lactose content (7 vs 5 g/100ml), the lower protein content (1,7 vs 3,2 g/100ml), the lower casein/
whey protein ratio (about 1 vs 4). Therefore the relevant percentage of essential amino acids, vitamins and
polyunsaturated fatty acids make this milk a potential new dietetic food and a promising breast milk substitute
(Guo et al., 2007).
From a qualitatively point of view, the presence of the four caseins fractions, by means of
immunoelectrophoretic analysis (Mauriello et al., 2009a) and that of their compositional heterogeneity due to
postraductional phenomena (phosphorylation for !s1,!s2 and "-CN and glycosylation for k-CN ) were achieved
(Mauriello et al., 2009b). Very recently the primary structure of !s1-CN (Cunsolo et al., 2009a), "-CN (Cunsolo
et al., 2009b) and !s2-CN (Chianese et al., in press) have been achieved. More structural data were available on
whey proteins, as !-lactoalbumins (!-La) (Conti et al., 1989), "-lactoglobulins ("-Lg) and lysozyme (Lys).
The !-La involved in lactose biosynthesis, was found always monomorphic; the "-Lg, not expressed in human
milk but being the main whey protein in cow milk (for this is the main allergen for the CMPA patients) is
expressed by the two genes "-Lg I and "-Lg II at this locus (Cunsolo et al., 2007b).
To date the main "-Lg I was found monomorphic differently by "-Lg II whose four genetic variants (A,B,C,D)
was found (Cunsolo et al., 2007a). Lysozyme is known to be a natural antimicrobial agent and together with
immunoglobulins, lactoferrin and lactoperoxidase reduce the incidence of gastrointestinal infections. In donkey
milk the high lysozyme content (1,5 g/L) may be responsible for its low bacterial count and in the same time for
its longer shelf life (Herrouin et al., 2000).
This scenario is lacking data about the primary structure of donkey k-CN and the occurrence of genetic
polymorphism either at casein fraction or whey protein locus as well as that concerning their individually
quantitative expression. These data may be useful in breeding selection aimed to production of donkeys milk
for human consumption and in the same time they are the scope of the present PhD thesis.
The set up analytical strategy was consisting of one-dimensional immunoelectrophoretic techniques (PAGE,
PAGE-SDS, UTLIEF) their orthogonal combination (2-DE), coupled either to chromatography (RP-HPLC), or
mass-spectrometric methods (MALDI-TOF MS, LC-ESI MS, ESI-Q-TOF MS).

15
th
320
15
th
A1) Immunoelettrophoretic screening of individual donkey whole casein fractions (!s1-, !s2-, "- and K-
CN), extracted by individual donkeys milk from different Italian breeds, to find the most common
phenotypes (A1.1) and their genetic variants (A1.2).
A2) Up setting of the analytical procedure to isolate donkey K-CN (A2.1) for determine its primary structure
(A2.2).
A3) Determination of quantitative level of single casein fractions (A3.1) as well as of the single whey protein
(A3.2) to select the animals producing the more similar human milk.
A4) Pasteurisation of donkey milk with use of microwaves (A4.1).
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) Immunoelettrophoretic screening
1) Casein phenotypes
2) Genetic variants
A2) Caseins Analysis
1) Isolation K-CN
2) Primary structure
A3) Quantitative determination
1) Single casein fractions
2) Single whey protein
A4) Pasteurisation
1) Milk stability
Bevilacqua C, Ferranti P, Garro G, Veltri C, Lagonegro R, Leuroux C, Pietrol E, Addeo F, Pilla F, Chianese L
Martin P (2002) Interallelic recombination is probably responsabile for the occurence of a new !s1-CN
variant found in goat species. European J of Biochemistry 269: 1293-1303.
Chianese L, Calabrese MG, Ferranti P, Mauriello R, Garro G, De Simone C, Addeo F, Cosenza G, Ramunno L
(in press) Proteomic characterization of donkey milk caseome. J of Cromatography A
Conti A, Napoletano L, Lai P, Pinna W, Godovac-Zimmermann J (1989) Isolation of donkey whey proteins and
N-terminal amino acid sequence of !-lactoalbumins A and B, "-lactoglobulins I and II and lysozyme.
Milchwissenschaft 44:138-141.
Cunsolo V, Cairone E, Fontanini D, Criscione A, Muccilli V, Saletti R, Foti S (2009a) Sequenze determination
of !s1-casein isoforms from donkey by mass spectrometric methods. J Mass Spectrometry 44: 1742-1753.
Cunsolo V, Cairone E, Saletti R, Muccilli V, Foti S (2009b) Sequence and phosporylation level determination of
two donkey "-caseins by mass spectrometry. R Communications in Mass Spectrometry 23: 1907-1916.
Cunsolo V, Costa A, Saletti R, Muccilli V, Foti S (2007a) Detection and sequence determination of a new
variant "-Lg II from donkey. R Communications in Mass Spectrometry 21: 1438-1446
Cunsolo V, Saletti R, Muccilli V, Foti S (2007b) Characterization of the protein profile of donkeys milk whey
fraction. J of Mass Spectrometry 42: 1162-1174.
Guo HI, Pang K, Zhang XY, Zhao L, Chen SW, Dong ML, Ren FZ (2007) Composition, physiochemical
properties, nitrogen fraction distribution and amino acid profile of donkey milk. J of Dairy Science 90:
1635-1643.
Herrouin M, Moll D, Fauquant J, Ballestra F, Maubois JL, Leonil J (2000) New genetic variants identified in
donkeys milk whey protein. Journal of Protein Chemistry 19:105-115.
Mauriello R, Calabrese MG, Ferranti P, Garro G, Quarto M, Chianese L (2009a) Caratterizzazione molecolare
della caseina di asina. Nota 1. 9 CISETA, fiera Milano, 11-12 Giugno.
Mauriello R, Calabrese MG, Ferranti P, Garro G, Quarto M, Cosenza G, Ramunno L, Chianese L (2009b)
Approccio proteomico per la caratterizzazione del latte di asina. Alimenti funzionali 1: 1-4.
Monti G, Bertino E, Muratore MC, Coscia A, Cresi F, Silvestro L, Fabris C, Fortunato D, Giuffrida MG, Conti
A (2007) Efficacy of donkeys milk in treating highly problematic cows milk allergenic children: an in
vivo and in vitro study. Pedriatr Allergy Immunol 18: 258-264.
Muraro MA, Gianpietro PG, Galli E (2002) Soy formulas and non bovine milk. Ann allergy Asthma immunol
89: 97-101.
15
th
321
15
th

Development of an active packaging for the controlled release of natural
antimicrobials, obtained from biomacromolecules

Carlo Alessio Cozzolino (trichocar@libero.it)
Dept. Scienze Ambientali Agrarie e Biotecnologie Agro-Alimentari, University of Sassari, Italy
Tutor: Prof. Antonio Piga

The goal of this PhD thesis is firstly to study the incorporation and the release of active compounds from bio-
coatings (among which gelatin, pectin, chitosan) for food packaging applications (e.g. controlled release
packaging). Secondly, an in-depth investigation on the effect of such antimicrobials on the spoilage inhibition for
shelf life extension purposes is aimed.

Sviluppo di un imballaggio per il rilascio modulato di antimicrobici naturali, ottenuto da
biomacromolecole

Scopo di questo progetto di tesi di dottorato lo studio dei meccanismi di incorporazione e di rilascio di
antimicrobici naturali in coatings ottenuti da biomacromolecole (gelatina, pectina, chitosano), per lo sviluppo di
un packaging a rilascio controllato. Successivamente si analizzer leffetto degli antimicrobici sullinibizione
microbica, per valutare lestensione della shelf life dellalimento.
1. State-of-the-Art
Consumer demands and industrial production trends towards minimally processed, fresh, tasty and convenient
food products with extended shelflife and controlled quality have recently increased. For this reason new food
packaging technologies are being developed. The today research is looking for an alternative method for
controlling microbial contamination of foods, in order to limit, inhibit or delay the growth of microorganisms. In
this perspective, one way is the incorporation of antimicrobial substances in either the packaging materials or
coating onto them [Dainelli et al., 2008]. The results achieved so far are different, as they strongly rely on the
type of antimicrobial used, the microbial kinetics as well as the target food (Table 1) [Tiwari et al., 2009].

Table 1 Effect of natural antimicrobial agents on food preservation and quality [modified]
Food product Antimicrobial agent
(concentrations)
Microbial dynamics Quality attributes
Fruit yoghurt Vanillin (2000 ppm) Yeast, bacterial (delays growth) Shelf life (!)
Minimal
processed
vegetables
Thyme oil (1%) Aeromonas spp (2LR) Sensory properties (")
Ready-to-eat
fruit salad
Citral (25-125 ppm)
Citron (600 ppm)
Yeast and Lactic acid bacteria
(delays growth)
Salmonella enteritidis (2 LR)
E. coli (<4.5 LR)
L. monocytogenes (4 LR)
Shelf life (!)
Sensory properties (~)
Milk Reuterin (8 AU/ml)
Nisin (100 IU/ml)
L. monocytogenes (4.59 LR)
S. aureus counts (5.45 LR)

Chicken meat Nisin (100 IU/ml) E. coli (<1 LR) Proximate composition (~)
Shelf life (!)
Fish Eos (0.5% carvacrol +
0.5% thymol)
Total viable count (2.5 LR) Shel life (!)
Lipid oxidation (")
Red meat Tea catechins (300
mg/kg)
Shel life (!)
Lipid oxidation (")
AU: arbitrary units were defined as the reciprocal of the highest two-fold dilution that did not allow the growth of the indicator
strain; AC: anthocyanin content ; ~: no significant difference; LR: microbial log reduction
15
th
322
15
th
There exist several types of antimicrobial packaging systems, as shown in table 2. [Appendini and Hotchkiss,
2002]
Table 2 Antimicrobial packaging
Form Example
Addition of sachets/pads containing volatile
antimicrobial agents into packages
Oxygen absorbers, moisture, ethanol vapor generators
Incorporation of volatile and non-volatile
antimicrobial agents directly into polymers
Silver ions, lactoperoxidase, lactoferrin, lysozyme
Coatings or adsorbing antimicrobials onto
polymer surfaces
Nisin on PE, PP, PET
Immobilization of antimicrobials to polymers by
ion or covalent linkages
Acrylates
Use of polymers that are inherently antimicrobial Chitosan-based antimicrobial films have been used to carry
organic acids and spices

Among the antimicrobial active packaging, it is widely accepted to talk about controlled release packaging
(CRP) when the release of active compounds takes place in a deliberately controlled manner, i.e. at different
rates. The ultimate benefit is an increase in quality and safety of a wide range of foods during storage.
Nevertheless, to make such systems really effective, some key-aspects need to be carefully checked, such as the
distribution of the active compound across the coating, the active compound-biocoating interactions, and the
effect of external triggers. Research is dealing with this topic because CRP allows extending the shelf-life of
packaged foods without adding any additive directly in the food matrix [LaCoste et al., 2005].
Within the aforementioned overall objective, this PhD project can be subdivided into the following activities
A1) Antimicrobials screening: thymol/carvacrol (essential oils), nisin (bacteriocin), a soluble compound (i.e.
Na-Lauroyl-L-arginine ethyl ester monohydrochloride, LAE).
A2) Selection of the more suitable biomacromolecules and antimicrobials incorporation feasibility in bio-
coatings (gelatin, pectin, chitosan).
A3) Selection of the food substrate (vegetables, meat, fish) and microorganisms target (L. monocytogenes,
E. coli).
A4) Antimicrobials release: effects (spoilage inhibition), measurement of controlled release kinetics and
modeling.
Table 3 Gantt diagram for this PhD thesis project
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) Antimicrobials screening
A2)
Selection of the biomacromolecules
and antimicrobials incorporation

A3
Selection of the food
substrate/microorganisms target

A4) Antimicrobials release
Dainelli D et al. (2008) Active and intelligent food packaging: legal aspects and safety concerns. Trends in Food
Science & Technology 19 (2008) S103-S112.
Tiwari B et al. (2009) Application of natural antimicrobials for food preservation. J. Agric. Food Chem. 57,
5987-6000.
Appendini P, Hotchkiss J H (2002) Review of antimicrobial food packaging. Innovative Food Science &
Emerging Technologies 3, 113-126.
LaCoste A et al. (2005) Advancing controller release packaging through smart blending. Packag. Technol. Sci
2005; 18: 77-87.

15
th
323
15
th
Influence of microclimatic characteristics on microbial communities in
Montepulciano vineyards
Umberto della Vella (udellavella@unite.it)
Dept. Food Science, University of TERAMO, Mosciano SantAngelo, Italy
Tutor: Prof.ssa Giovanna Suzzi
The PhD thesis research project is aimed to select indigenous strains, isolated from soils with different
microclimate characteristics and agronomic managements, and to determine their role on wine quality. For this
microbial communities and their functions, through a phenotypic (Biolog) and molecular (PCR-ARDRA)
approach, will be studied.
Influenza delle caratteristiche microclimatiche sulle comunit microbiche in vigneti
Montepulciano
Il progetto di ricerca di questa tesi di dottorato prevede la selezione di ceppi autoctoni, isolati da terreni con
caratteristiche microclimatiche e pratiche agronomiche adottate diverse, per determinare il loro ruolo nella
qualit del vino. Per questo saranno studiate le comunit microbiche e le loro funzioni mediante un approccio
fenotipico (Biolog) e molecolare (PCR-ARDRA).

1. State-of-the-Art
Soil is one of the main factors that determine grape and wine quality, because it affects the distribution of roots
and the assimilation of nutrients and water by plants. Moreover, chemical and physical characteristics such as
moisture, texture, pH, agronomic managements and the microclimate of a given area are crucial in selecting the
quantity and quality of the microbiota. Its well known that the fluctuations in the availability of nutrients,
chemical characteristics and abiotic conditions determine changes in microbial composition of crops and
uncultivated soils, as well is established that soil microorganisms are responsible for the cycling of organic
compounds and contribute to soil structure and fertility (Yao et al., 2000; ODonnell et al., 2001) and plant
health and nutrition (Smith and Goodman, 1999). For decades, plant growth-promoting rhizobacteria (PGPR)
have been added to soil to improve plant health and/or growth (Bashan et al., 2004). Azospirrilum lipoferum was
inoculated to study its effects on indigenous microbial community (Baudoin et al., 2009). Other species, such as
Azotobacter chroococcum, Bacillus megaterium and Bacillus circulans, were used as fertilizer for vines to
improve the wine quality (Siv!ev et al., 2005).
The immense phenotypic and genetic diversity found in soil bacterial and fungal communities makes it one of
the most difficult communities to study, also due to non cultivability of most soil microorganisms. It is believed
that less than 1% of microbial species present in soil can be cultivated in vitro and yet its not known whether
this 1% may represent a microbial population (Torsvik et al., 1998). Therefore, at present, the study of microbial
communities is made through a culture-independent approach, which avoids the use of methods that require the
isolation and cultivation of microorganisms and allows the assessment of biodiversity in a natural ecosystem.
Molecular biology techniques, such as nucleic acids extraction, amplification of a specific and preserved region
(usually, 16S rDNA and 26S rDNA, for prokaryotes and eukaryotes respectively) and denaturing or temperature
gradient gel electrophoresis (DGGE or TGGE), have been used to overcome the limitations of culture-based
methods (Heuer et al., 1997), although there are limitations related to the nucleic acids extraction.
Garland and Mills (1991) developed a technique to assess the potential functional diversity of the bacterial
population through sole source carbon utilization (SSCU) patterns. Gram-negative (GN) and gram-positive (GP)
plates are available from Biolog (Hayward, CA, USA, www.biolog.com) and each contains 95 different carbon
sources and one control well without a substrate. Subsequently, Biolog introduced an Ecoplate (Choi and Dobbs,
1999) containing 3 replicates of 31 different environmentally relevant carbon sources and one control well per
replicate. This method has been used successfully to assess potential metabolic diversity of microbial
communities in plant rhizospheres, soil treated with herbicides (el Fantroussi et al., 1999) or inoculation of
microorganisms (Bej et al., 1991). The Biolog approach is a powerful tool for profiling of soil microbial
communities, but when are sought indications about diversity or ecosystem functioning should be used 16S
ARDRA of the Ecoplate wells communities (Viti et al., 2008).
This PhD thesis project can be subdivided into the following activities according to the Gantt diagram given in
15
th
324
15
th
Table 1:
A1) Literature search.
A2) Soil microbial community analysis. The study of microbial communities will be conducted by Biolog
approach and for their diversity and function will analyze the restriction profiles (ARDRA).
A3) Isolation and identification of indigenous strains. This activity involves the use of classical
microbiological techniques (preparation of culture media, growth of microorganisms in Petri plates,
etc.) and molecular biology techniques (nucleic acid extraction, construction of appropriate primers,
PCR, etc.).
A4) Phenotypic and metabolic characterization of selected strains.
A5) Assessment of the characteristics of musts and wines. Some musts and wines quality indices will be
determined to evaluate the relationship between soil microbiota and wine.
Attivit Mesi 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36
A1) Literature search
A2) Soil microbial community analysis
A3)
Isolation and identification of indigenous
strains

A4)
Phenotypic and metabolic
characterization of selected strains

A5)
Assessment of the characteristics of musts
and wines

A6) Writing and Editing
Bashan Y, Holguin G, de-Bashan LE (2004) Azospirillumplant relationships: physiological, molecular,
agricultural and environmental advances (19972003). Can J Microbiol 50: 521-577.
Baudoin E, Nazaret S, Mougel C, Ranjard L, Monne-Loccoz, Y (2009) Impact of inoculation with the
phytostimulatory PGPR Azospirillum lipoferum CRT1 on the genetic structure of the rhizobacterial
community of field-grown maize. Soil Biol Biochem 41: 409-413.
Bej AK, Perlin M, Atlas RM (1991) Effect of introducing genetically engineered microorganisms on soil
microbial community diversity. FEMS Microbiol Ecol 86: 169-176.
Choi K-H, Dobbs FC (1999) Comparison of two kinds of Biolog microplates (GN and ECO) in their ability to
distinguish among aquatic microbial communities. J Microbiol Methods 36: 203-213.
el Fantroussi S, Verschuere L, Verstraete W, Top EM (1999) Effect of phenylurea herbicides on soil microbial
communities estimated by analysis of 16S rRNA gene fingerprints and community-level physiological
profiles. Appl Environ Microbiol 65: 982-988.
Garland JL, Mills AL (1991) Classification and characterization of heterotrophic microbial communities on the
basis of patterns of community-level-sole-carbon-source utilization. Appl Environ Microbiol 57: 2351-
2359.
Heuer H, Krsek M, Baker P, Smalla K, Wellington, EMH (1997) Analysis of actinomycete communities by
specific amplification of genes encoding 16S rRNA and gel electrophoretic separation in denaturing
gradients. Appl Environ Microbiol 63: 3233-3241.
ODonnell AG, Seasman M, Macrae A, Waite I, Davies JT (2001) Plants and fertilisers as drivers of change in
microbial community structure and function in soils. Plant Soil 232: 135-145.
Siv!ev B, Jovi" S, Rai!evi" V, Petrovi" A, Lalevi" B (2005) Application of microbiological fertilizers in
viticulture: grape yield and quality of wine cv. Riesling. Journal of Agricultural Sciences 50(1): 19-26.
Smith KP, Goodman RM (1999) Host variation for interactions with beneficial plant-associated microbes. Annu
Rev Phytopathol 37: 473-491.
Torsvik V, Daae FL, Sandaa R-A, Ovreas L (1998) Review article: novel techniques for analysing microbial
diversity in natural and perturbed environments. J Biotechnol 64: 53-62.
Viti C, Quaranta D, De Philippis R, Corti G, Agnelli A, Cuniglio R, Giovannetti L (2008) Characterizing
cultivable soil microbial communities from copper fungicide-amended olive orchard and vineyard soils.
World J Microbiol Biotechnol 24: 309-318.
Yao H, He Z, Wilson MJ, Campbell CD (2000) Microbial biomass and community structure in a sequence of
soils with increasing fertility and changing land use. Microb Ecol 40: 223-237.
15
th
325
15
th
The role of information in the consumer markets of alimentary products,
the case of the extra virgin olive oil
Alessandro Esposito (alex_es@libero.it)
Dept. Food Science, University of Udine (UD), Italy
Tutor: Prof. Sandro Sillani - Prof. Lanfranco Conte
This PhD thesis research project aims to assess, through statistical techniques belonging to multi-attribute
compositional models (conjoint analysis, etc. ...) and analysis/statistical text (content analysis, etc. ...), the impact
of information on consumer preferences in the case of extra virgin olive oil. In particular, we will study the
compulsory and optional indications provided for the labeling of extra virgin olive oil according to very recent
Community and national legislation. We will also provide new information for legislative updates (especially
regarding the link between the EU and national legislation).
Il ruolo delle informazioni nei mercati al consumo dei prodotti alimentari, il caso
dell'olio extra vergine d'oliva
Questo progetto di tesi di dottorato ha lo scopo di valutare, attraverso tecniche statistiche che appartengono a
modelli composizionali multi attributi (Conjoint analysis, ecc. ...) ed analisi/statistica testuale (Content analysis,
ecc. ...), l'impatto delle informazioni sulle preferenze dei consumatori di olio extra vergine di oliva. In particolare
saranno studiate le indicazioni obbligatorie e facoltative previste per l'etichettatura degli oli extra vergini di oliva
alla luce delle recentissime normative comunitarie e nazionali. Inoltre saranno fornite nuove indicazioni per
eventuali aggiornamenti legislativi (raccordo tra la legislazione comunitaria e quella nazionale).
1. State-of-the-Art
Currently the legislation defined as "horizontal", that is the one applied to all food, defines: 1) labeling as the set
of terms, indications, trademarks or trade, of images or symbols that relate to the product and are listed directly
on the package or on a label affixed or the device closing or on boards, rings and clips link to the product itself
(Lgs. Decree of 27 January 1992, n. 109); 2) indication as any message or representation not compulsory
respecting Community or national legislation, including pictorial, graphic or symbolic in any form, which states,
suggests or implies that the product has particular characteristics (EC REG. N. 1924/2006); 3) product
presentation as the form or appearance of the product, packaging materials, mode of provision of food on
shelves, the environment in which the product is exposed to (Lgs. Decree of 27 January 1992, n. 109).
The sectoral legislation, called "vertical", has instead identified tools and techniques to ensure the consumer in
relation to the quality and chemical characteristics of olive oil on the market, at the same time it is strongly
directed to ensure the origin and the quality of raw material (Reg. (EC) N. 182/2009 of 6 March 2009 - REG.
(EC) N. 640/2008 of July 4, 2008 - DM (Mipaaf) of 10 Nov. 2009). So basically the food producer establishes
with the consumer a "sales contract" through labeling/presentation, which has the following purposes: 1)
providing accurate information on product characteristics, namely providing clear and explanatory information,
especially regarding nature, identity, properties, composition, storage, source or origin and method of
manufacture or production of the food (Lgs. Decree of 27 January 1992, n. 109); 2) not misleading consumers
about the features/properties that the product does not possess; 3) helping to accurately assess the relationship
between the quality of the product and the selling price; 4) ensuring the fairness of commercial transactions and
the free movement of foodstuffs on the Community and international markets; 5) promoting the product
commercially. This last point introduces the concept of marketing communication that is the type of
communication that aims to make the potential customer turns into actual customer. It is a kind of
communication that acts directly on the behavior of potential customers (prospects) but can also have important
effects on positioning of the company and can be used to convey relevant messages in institutional terms.
Information on consumer behavior is essential to take marketing decisions and is produced through a number of
tools and technical processes, each of which can be classified in one specific methodological approach. The
Conjoint Analysis is a statistical technique that allows us to simultaneously analyze a set of attributes for the
product studied, including the information on the label, and determine their relative importance and what levels
of each attribute are preferred by consumers. Among the quantitative content analysis techniques used to
measure the effect of advertising on the perceptual system of customers we will use quantitative analysis of the
content (Content analysis), that is a textual analysis or statistical (Molteni - Troilo (2007) - Marketing Research).

15
th
326
15
th
A1) Analysis the compulsory and optional label provided in accordance with the regulations applicable to
the field of extra virgin oil: label information study Communitary and Italian laws.
A2) Determination of the preferred combination of attributes through Conjoint Analysis - Analysis of the
effect of advertising on the perceptual system of customers through Content Analysis: interview data
collecting data analysis assessment of utility estimation.
A3) Correlation analysis between Italian law and EU regulations N. 1924/2006 (so called nutrition &
health claims new discipline): Analysis of marketing communications; Analysis of synergies and
"conflicts" between corporate communication and marketing communication.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1)
Analysis of label of extra virgin oil

1) EC Regulation

2) Italian law

A2) Conjoint Analysis and Content
Analysis

1) Interview data collecting
2) Assessment of utility estimation
A3) Correlation analysis between
Italian law and EU regulations N.
1924/2006

1) Marketing communications

2) Synergies and "conflicts"

Molteni L, Troilo G (2007) - Marketing Research, McGraw-Hill.
Paola Colaneri (2009), New rules on labeling of extra virgin olive oil, Agribusiness Economics & Law -
Regulatory Observatory XIV 1 2009: 175-185.
Regulation (EC) N. 1019/2002 of 13 June 2002 on marketing standards for olive oil, Official Journal of the
European Communities of 14.6.2002 L 155: 27-31; as amended by REG. (EC) Commission N. 182/2009
dated 6 March 2009, Official Journal of the European Communities of 07.03.2009 L 63: 6-8.
Regulation (EC) N. 2568/91 of 11 July 1991 on the characteristics of olive oil and olive-residue oil and methods
of analysis, Official Journal of the European Communities of 5.9.1991L 248: 1-83, as amended by REG.
(EC) N. 640/2008 of 4 July 2008, Official Journal of the European Communities of 07.05.2008 L 178: 11-
16.
Regulation (EC) N. 1924/2006 of the European Parliament and of the Council of 20 Dec. 2006 on nutrition and
health claims made on foods, Official Journal of the European Communities of 30.12.2006 L 404: 9-25.
Directive 2000/13/EC of the European Parliament and of the Council of March 20, 2000 Official Journal of the
European Communities of 6.5.2000 L 109: 29-42.
Legislative Decree N. 109 of January 27, 1992, Ordinary Gazz. N. 39, 17 February 1992 Suppl Ordinary Gazz.
N. 31 - Implementation of directives (EC) N. 395/89 and (EEC) N. 396/89, labeling, presentation and
advertising of foodstuffs.
Ministerial Decree of 10 November 2009 (Mipaaf) - National provisions on marketing standards for olive oil
Official Gazette of January 16, 2010 General Series N. 12.
15
th
327
15
th
Safety and quality of fish products: a methodological polyphasic approach
to study contaminating emerging pathogens
Chiara Ferrario (chiara.ferrario@unimi.it)
Dept. DISTAM, University of Milan, Italy
Tutor: Prof. Maria Grazia Fortina

This PhD thesis research project aims to improve the current systems of management and control of food safety,
focusing the attention on the study of two bacterial species, Lactococcus garvieae and Morganella morganii that
represent valid models of contaminating emerging pathogens in fish products.
Qualit e salubrit dei prodotti ittici: un approccio metodologico polifasico per lo studio
di contaminanti patogeni emergenti
Con questo progetto di tesi di dottorato si intende contribuire ad implementare gli attuali sistemi di gestione e controllo
della salubrit dei prodotti alimentari, focalizzando lattenzione sullo studio di due specie batteriche, Lactococcus
garvieae e Morganella morganii che nell'ambito del settore ittico rappresentano due validi modelli di ecotipi
contaminanti, potenziali patogeni emergenti.

1. State-of-the-Art
Today, fish products have a big importance in the human supply and so the international fish product and
aquaculture trades are in expansion. This implies a strong regulatory action combined with a depth control along the
entire food chain to ensure the respect of quality and safety parameters of the final product, at local level in the free
trade (Ababouch, 2006). Fish it is a very high perishable product with a shelf life limited by microbial growth, due
to the presence of native and external bacteria. The producers demand, but overall the consumers need, to have a
foodstuff with good quality and safe, is very strong, in relation with the diffusion of new food models that provide
the consume of raw fish, typical of Nippon tradition.
Despite many efforts done till today to develop suitable methods to evaluate freshness, quality and safety of fish
products, there be a lot of microbiological limitations, linked to different parameters, like the used method,
sometimes little discriminating, sometimes too long and complicated to be compatible with the processing time and
the product marketing, the detection of new microbial potential pathogen species, for which studies related to their
dissemination, impact and role are insufficient.
The most important problem in the aquaculture sector is the contamination by Lactococcus garvieae, a typical
pathogen of fish products, that cause septicemia in fish and a severe economic damage (Vendrell et al., 2006).
Despite a lot of study to limit this contamination, little has been discovered about his origin, his pathogen factors
and about containing action against it. As Lactococcus garvieae has been associated to human infections and
founded in other food sectors, overall in dairy products (Fortina et al., 2003)., it could represent a potential emerging
pathogen for human. L. garvieae could represent a model of gram positive potential dangerous bacteria, whose
knowledge deserve to be thoroughly investigated.
In the fishing sector problems are related to find quality and freshness indicators and are more complex because due
to type of fish, fishing areas, water contamination and type of fishing. Tuna trades is strongly increased in the last
few years (primarily related to its raw consumption) and about its microbiological problems, its healthiness is linked
to the limitation of bacterial spoilage, and by the absence of particular pathogen bacteria that can decarboxylate
histidine to histamine, a biogenic amine that can cause the scombroid syndrome (Economou et al., 2007). Among
enterobacteria implicated in the tuna contamination Morganella morganii could be a model for this study: its one of
the most detected species and its one of the principal histamine producer bacteria (Kim et al, 2003).. Until today,
there arent methods that can significantly evaluate a food freshness and healthiness with short time required for
processing and subsequent distribution. There are few study in literature, about the develop dynamic of these
pathogen along the food chain and during the product shelf-life, in different conditions. In this context, we want to
study and monitoring the dynamic development of the microbial population of tuna, evaluate the diffusion of
Morganella morganii and make a methodological polyphasic approach to develop a suitable quality and safety
indicator, by the development of chemical, molecular methods and the creation of sensor/biosensor specific to the
microbial strain used like model or for a specific metabolite.
15
th
328
15
th

This PhD thesis will be divided in two principal part, the firs Lactococcus garvieae (steps A) and the second about
Morganella morganii (steps B), like showed in Tabella 1.

Lactoccus garvieae
A1) Creation of a strains collection, through the research and specific selection of L. garvieae from different food
habitat
A2) Molecular Typing, by using method that can assemble isolates in function of their origin habitat, to
underline a specific molecular fingerprint for every ecotype and gave a detailed framework about the degree of
biodiversity in the specie..
A3) Research of mobil genetic elements, in particular to the presence and distribution of simple or complex
insertion sequence along the genoma and the presence of extracromosomial DNA.
A4) Research of specific genes or genetic cluster that encoded virulence and pathogenity factors
A5) Phylogenetic study through the research and the sequencing of particular conserved genes, called molecular
clocks, and the use of bioinformatics software to building detailed phylogenetic tree

Morganella morganii
B1) Monitoring and development dynamics of the microbial population of tuna samples from fish market and
GDO in different storage conditions, to evaluate the microbiological quality of the product and problems due
to its consume like raw fish
B2) Development of molecular method and creation of model systems to isolate Morganella morganii and its
direct quantification in the food matrix, by using Real-time PCR
B3) Development of molecular method to detect the presence of potential producers of biogenic amines trough
the research of specific genes that encoder for enzymes that transform aminoacids in biogenic amines.
B4) Creation of DNA sensor and bionsensor to detect ad enumerate Morganella morganii and/or histamine to
develop a new control system to evaluate the product healthiness
5) Thesis and paper preparation
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
A1) Strain collection
A2) Molecular typing
A3) Search of MobileGenetic Elements
A4) Search of Virulence Factors
A5) Phylogenetic studies
B1) Monitoring and dynamics studies
B2) Isolations and creation of models
B3) Molecular methods
B4) Sensor and biosensor
5) Thesis and paper preparation

Ababouch L (2006) Assuring fish safety and quality in International fish trade. Mar Pollut Bull 53:561-568
Economu V, Brett MM, Papadopoulou C, Frillingos S, Nichols T (2007) Changes in histamine and microbiological
analyses in fresh and frozen tuna muscle during temperature abuse. Food Addit Contam 24:820-832.
Fortina MG, Ricci G, Acquati A, Zeppa G, Gandini L, Manachini PL (2003) Genetic characterization of some lactic
acid bacteria occurring in an artisanal protected de nomination origin (PDO) Italian cheese, the Toma piemontese.
Food Microbiol 20: 397-404
Kim SH, An H, Wei CI, Visessanguan W, Benjakul S, Morrisey MT, Su YC, Pitta TP (2003) Detection of
Morganella morganii, a prolific histamine former, by the polymerase chain reaction assay with 16S rDNA-targeted
primers. J Food Prot 66:1385-92
Vendrell D, Balcalzar JL, Ruiz-Zarzuela I, de Blas I, Girones O, Muzquiz JL (2006) Lactococcus garvieae in fish: a
review. Comp Immun Microbiol & Inf Dis 29: 177-198
15
th
329
Development of nanostructured sensing system for food analysis
Giuseppe Christian Fusella (gcfusella@unite.it)
Dept. Food Science, University of Teramo, Italy
Tutor: Prof. Dario Compagnone
The aim of this PhD thesis project is to develop screening assays that will exploit the features of sensors
modified with nanostructured material , such as gold nanoparticles (AuNPs) and carbon nanotubes (CNT),
chemically functionalized.

Sviluppo di sistemi di rilevamento nanostrutturati per l'analisi degli alimenti

Lobiettivo di questo progetto di tesi di dottorato quello di mettere a punto tecniche elettroanalitiche che
sfruttino sensori modificati con materiale nanostrutturato, come nanoparticelle doro e nanotubi di carbonio,
funzionalizzati chimicamente, al fine di effettuare analisi di screening in alimenti.
1. State of the Art
Nanoscience and nanotechnology deal with the study and application of structures of matter with at least one
dimension of the order of less than 100 nm. This is the standard way of classifying what belongs to the nano
world.
However, properties related to low dimensions are more important than size. Nanotechnology is based on the
fact that some structures usually smaller than 100 nm have new properties and behaviour that are not exhibited
by the bulk matter of the same composition. This is because particles that are smaller than the characteristic
lengths associated with the specific phenomena often display new chemistry and new physics that lead to new
properties that depend on size. Perhaps one of the most intuitive effects is due to the change in the
surface/volume ratio. When the size of the structure is decreased, this ratio increases considerably and the
surface phenomena predominate over the chemistry and physics in the bulk (Riu et al., 2006).
Therefore, although the reduction in the size of the sensing part and/or the transducer in a sensor is important in
order to better miniaturise the devices, nanoscience deals with new phenomena, and new sensor devices are
being built that take advantage of these phenomena. New effects appear and play an important role that is often
related to quantum mechanics and quantum mechanisms. Consequently, important characteristics and quality
parameters of the nanosensors can be improved over the case of classically modelled systems merely reduced in
size. For example, sensitivity can increase due to better conduction properties, the limits of detection can be
lower, very small quantities of samples can be analysed, direct detection is possible without using labels, and
some reagents can be eliminated.
Nanomaterials, such as AuNPs and CNTs, are be used to develop analytical system to evaluate pesticides in food
and environmental systems (Del Carlo & Compagnone, 2010). A colloidal goldmultiwalled carbon nanotubes
composite electrode (Au/MWCNT/Teflon) using Teflon as binding material was reported by Manso et al.
(2008). The composite electrode exhibited significantly improved electrooxidation of NADH when compared
with other carbon composite electrodes.
The aim of the work will be to develop sensing systems based on nanomaterial tailored on purpose based on
the specific application required. This will be achieved via the chemical functionalisation of the material with
mediators, peptides of other compounds that will give further analytical advantages in terms of sensitivity and
selectivity.
The first target of this PhD project is to produce AuNPs functionalized with organic and bioorganic molecules,
such as thiolate, amino acids and peptides. They will be studied to improve characteristics of functionalized
AuNPs stability. This approach will be carried out by electrochemical and spectroscopic analysis. The modified
AuNPs will be used to increase the surface of piezoelectric sensors that are normally used in electronic nose(EN)
techniques. By choosing the best pattern of sensors, it could be possible to enhance analytical signal and
selectivity of EN. The new sensors pattern of EN will be used to study flavour model system profiles.
Nevertheless they will be applied to real food systems, such as sweets, candies and creams. These patterns could
be used to evaluate the aromatic profile evolution in industrial process control. Extra virgin olive oil production
will be one of the food process tested.
The second purpose of this project is the application of CNTs to develop pre-treatment methods and
nanostructured sensors. The porous and hydrophobic characteristics of CNTs permit to obtain the extraction of
hydrophobic compounds. Consequentially it is suggested to study extraction efficiency using standard
15
th
330
hydrophobic compounds. After the standardization of the extraction parameters, the system could be applied on
foods to recover toxic contaminants, such as dioxins and PCBs. This extraction method could be coupled with
other analytical systems for the analytes determination.
Considering the nanostructured sensors development, CNTs will be used in order to increase the electroactive
electrodes surface and to entrap electrochemical mediators or biomolecules thus improving the system
selectivity. The first of the system tested will be molidbate modified CNTs for the detection of o-diphenols in
olive oil.
Table 1 shows guntt diagram.

MILESTONES - MONTHS 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36
I - PRODUCTION, CHARACTERIZATION AND DEVELOPMENT
OFELECTROCHEMICAL SYSTEMS BASED ON METAL
NANOPARTICLES
Ia - Bibliographic Search
Ib - Production and characterization of metalnanocomposites
Ic - Functionalization of nanocomposites
Id - Development of piezoelectric sensors modified with nanoparticles
Ie - Modification of the pattern of the electronic nose sensors
If - Data analysis
II - DEVELOPMENT OFNANOSENSINGSYSTEMS
IIa - Bibliographic Search
IIb - Study and characterization of CNT
IIc -Study, production and development of extraction methods based
with carbon nanotubes
IId - Development of screening methods for the study of food
contaminants such as dioxins and PCBs based on MIP and carbon
nanotubes
IIe - Data analysis
III - THESIS PREPARATION AND WRITINGPAPER

Del Carlo M, Compagnone D, (2010). Recent strategies for the biological sensing of pesticides: from the design to
the application in real sample. Bioanal Rev DOI 10.1007/s12566-010-0012-z;
Manso J, Mena ML, Yanez-Sedano P, Pingarron JM, (2008). Alcohol dehydrogenase aperometric biosensors based
on colloidal gold-carbono nanotubes composite electrode. Electrochim Acta 53: 4007-4012;
Riu J, Maroto A, Xavier Rius F, (2006). Nanosensors in enviromental analysis. Talanta 69: 288-301;
Rodriguez-Mozaz S, Marco MP, Lpez de Leda MJ, Barcelo D, (2004). Biosensors for environmental applications:
Future development trends. Pure Appl Chem Res 76: 723-752.

15
th
331
15
th

Aerobic metabolism of Lactobacillus plantarum: physiological and
technological aspects.
Angela Guidone (angela.guidone@unibas.it)
Department of Biology, Defence and Biotechnology of Agroforestry, University of Basilicata, Italy
This PhD thesis research project is aimed at studying the aerobic metabolism of Lactobacillus plantarum and the
assessment of the impact of the aerobic growth on the response to different abiotic stresses its survival and
performance as a starter. A series of experiments will be carried out to investigate with an integrated approach
(including proteomic and genomic studies) the biological basis for the aerobic metabolism and response to
oxidative stress in controlled growth conditions and the impact on survival and viability of the microorganism
during preservation.
Metabolismo aerobio di Lactobacillus plantarum: aspetti fisiologici e tecnologici
Lobiettivo di questo progetto di tesi lo studio del metabolismo aerobio di Lactobacillus plantarum e la
valutazione delle conseguenze della crescita aerobia sulla risposta a diversi stress abiotici che possono
influenzare la sua sopravvivenza e attivit come starter. In particolare saranno studiate con un approccio
integrato (comprendente approcci genomici e proteomici) le basi biologiche del metabolismo aerobio e la
risposta allo stress ossidativo in condizioni di crescita controllate e le conseguenze sulla sopravvivenza e la
vitalit del microrganismo.
1. State of the Art
Lactobacillus plantarum is a mesophilic facultatively heterofermentative lactic acid bacterium (LAB) which is
widely employed in food fermentations. It has a relatively large genome (L. plantarum WCFS1 genome is 3.30
Mbp, coding for 3009 proteins; L. plantarum JDM1 genome is 3.20 Mbp and codes for 2948 proteins) and
unusually diverse metabolic abilities for a LAB. The large size of its genome is related to the diversity of
environmental niches in which L. plantarum strains are encountered: it can be isolated from fermented foods as
sourdoughs, olive, vegetables, wine, cheese, sausages but also from gastro-intestinal tract of human and animals,
human oral cavity and female genitourinary tract. Like other LAB it is able to use oxygen because it synthesizes,
a partial electron transport chain (coded by the operon cydABCD), in the presence of hemin and menaquinone
(Brooijmans et al., 2009). Quatravaux et al. (2006) have defined the role of some enzymes in the aerobic
metabolism of L. plantarum and they have showed that with the exhaustion of the glucose in the substrate, the
pyruvate is catabolised into acetyl phosphate by the enzyme pyruvate oxidase (POX) or by the patway pyruvate
formate lyase and phosphotransacetylase and then it is converted to acetate by the enzyme acetate kinase. The
genome of L. plantarum codifies for four different POX enzymes and the expression of these key enzymes is
regulated positively by the presence of O
2
and H
2
O
2
but repressed by the catabolite control protein CcpA (Goffin
et al., 2006). POX activity, however, results in the production of toxic products such as H
2
O
2
and in order to
detoxify it, some strains of L. plantarum characterized by the presence of the gene katA synthesize an heme-
dependent catalase while other strains express, in the presence of Mn
2+
, an atypical catalase which allows an
increase of the vitality in stationary growth phase but a decrease in growth rate. About the presence of the
enzyme superoxide dismutase in strains of L. plantarum the data in the literature are conflicting.
The enzyme thioredoxin disulfide reductase (TRX) is also involved in response to oxidative stress. TRX is
synthesized in presence of H
2
O
2
and allows the reduction of disulfide bonds in the protein target and probably it
activates the expression of genes involved in the DNA repair mechanisms, in the purine metabolism, in the
energy metabolism and in the transport of Mn
2+
(Serrano et al. 2007).
During food fermentations, transformations, preservations and its propagation as starter cultures, L. plantarum is
subjected to other abiotic stress (acid, alkaline, heat, cold, osmotic, starvation, toxic compounds) and, in order to
adapt its metabolism to the changing environmental conditions, it has developed a series of strategies, such as a
specific induction of protection mechanisms, the synthesis of response regulators and correlated proteins.
Usually, in LAB, the expression of genes involved in the stress response is controlled by the repressors CtsR and
HrcA which regulate the expression of the operons of class III (clpP, clpE, clpC, etc..) and class I (groESL and
dnaK ), respectively, but in L. plantarum genes are also known that have a dual regulation by both repressors.
Some authors have also identified an additional regulatory system based on the positive control exerted by
CcpA, that interact with a sequence located in the regulatory region of the groESL operon and the dnaK operon.
15
th
332
15
th

A1) Optimization of methods: development of low cost substrates (A1.1) and choise of the fluorochromes
(A1.2) able to determine the cells viability and the metabolic activity of L. plantarum strains.
A2) Study of the aerobic metabolism with the screening on 13 different strains of L. plantarum to evaluate the
production of a respiratory chain, H
2
O
2
and the synthesis of enzymes required to remove the reactive
oxygen species, ROS (A2.1) during the growth without pH control (A2.2).
A3) Study in batch fermentation (A3.1) and in continuous fermentations (A3.2) at controlled pH and
aeration conditions on 2 different strains of L. plantarum to control the growth parameters as the flux of
nutrients and the oxygen consumption.
A4) Analysis of specific DNA sequences (A4.1), with the help of a pyrosequencing, in order to search operons
encoding of the electron transport chain and of the enzyme for the removal of the ROS and to search
possible polymorphisms of genes involved in aerobic metabolism and in the response of the oxidative
stress. Proteomic analysis (A4.2) on the cell extracts obtained from the different strains during the
fermentations. Impact of H
2
O
2
on mutations. Study of the transcription of genes involved in general
response to the stress and in aerobic metabolism and study of the metabolome by mass spectrometry.
A5) Identifying of protocols to preserve strains with the spray-drying tehnique and understanding of the impact
of pre-adaptation or mutations on the survival and the activity of starter cultures in bakery products.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) Development of methods
1) Optimization of substrates and of
fluorescence microscopy.

A2) Study of the aerobic metabolism
1) Screening for the production of
enzymes

2) Growth in uncontrolled conditions
A3) Study of the kinetics of growth
1) Batch fermentation
2) Continuous fermentations
A4) Genomic, transcriptomics and
proteomics analysis

1) Analysis of polymorphism of genes
involved in stress resistance

2) Proteomic analysis 1D, 2D
3) Transcriptomic and metabolomic
analysis

A5) Technological implications
1) Conservation and survival
A6) Thesis and publication Preparation
Brooijmans R, de Vos WM, Hugenholtz J (2009) Lactobacillus plantarum WCFS1 electron transport chains,
Appl Env Mic. 75: 35803585.
Goffin P, Muscariello L, Lorquet F, Stukkens A, Prozzi D, Sacco M, Kleerebezem M, Hols P (2006)
Involvement of pyruvate oxidase activity and acetate production in the survival of Lactobacillus plantarum
during the stationary phase of aerobic growth, Appl Env Mic. 72: 7933-7940.
Quatravaux S, Remize F, Bryckaert E, Colavizza D, Guzzo J (2006) Examination of Lactobacillus plantarum
lactate metabolism side effects in relation to the modulation of aeration parameters, J Appl Mic. 101: 903
912.
Serrano LM, Molenaar D, Wels M, Teusink B, Bron PA, de Vos WM, Smid E J (2007) Thioredoxin reductase is
a key factor in the oxidative stress response of Lactobacillus plantarum WCFS1, Microb Cell Fact, 6:29.
15
th
333
15
th
Development of high performance bio-based hybrid coatings for food
packaging applications

Laura Introzzi (laura.introzzi@unimi.it)
Department of Food Science, Technology and Microbiology, DiSTAM, University of Milan, Milan, Italy
Tutor: Prof. Alberto Schiraldi
This PhD project research aims to the optimization of the food packaging materials currently available on the
market. To this purpose, our goal is develop high performance coating able to improve the original
characteristics of the plastic substrate after their deposition. In particular, to fulfill the increasing request for
replacing synthetic polymers already used in the nowadays industrial coating processes as well as to reduce the
thickness of the plastic films, biomacromolecules, possibly combined with inorganic or synthetic compounds,
will be used to generate a new class of bio-hybrid-coatings. This will lead to a greener packaging structure
with the same overall performances of the conventional ones.
Sviluppo di bio-coatings ibridi altamente performanti per applicazioni nel settore
dellimballaggio alimentare
Il presente progetto di dottorato mira ad ottimizzare le forme di packaging esistenti attraverso lo sviluppo di
nuovi coatings da applicare sui tradizionali films flessibili per limballaggio. Per sostituire i materiali sintetici gi
utilizzati negli impianti di laccatura industriale e per ridurre lo spessore dei pi comuni film plastici, verranno
utilizzate bio-macromolecole, combinate con composti inorganici e/o sintetici, per creare una nuova classe di
bio-coating ibridi. Ci consentir lottenimento di un packaging pi verde, in grado di offrire le stesse
performances di quelli convenzionali.

1. State-of-the-Art
For more than 50 years plastics have been used as the most practical, cheaper and useful solutions for food
packaging applications. However, over the last decade the interest in using natural resources in order to replace,
totally or partially, synthetic packaging has increased, as shown by the number of research papers, reviews and
book chapters reported in the scientific literature. In fact, biomacromolecules directly extracted from biomass
(proteins, polysaccharides, lipids), or from microorganisms (polyhydroxyalkanoates), or obtained from chemical
synthesis (polylactic acid) have shown properties similar to those of plastic films and they can be used to
generate new structures with the additional properties to be biodegradable (Tharanathan 2003). Moreover, they
can act as releasing system of active compounds under the effect of specific triggers like temperature, relative
humidity, or pH. A wide range of biomacromolecules has already been used in the biomedical field to create
capsules, contact lenses, membranes, while in the food packaging area it is only starting to come. It is currently
acknowledged that replacing food packaging using a stand-alone edible film represents a difficult task to
achieve, because of some drawbacks, like the poor mechanical properties and the great sensibility to humidity. A
promising way to see biopolymers promptly used as packaging materials is represented by their deposition as
thin layers on plastics or bio-derived materials. To date, common plastic films are coated or laminated with
synthetic polymers in the form of thin layers in order to increase specific properties of the substrate, such as
barriers (to gases, vapours, UV radiations), mechanical (friction of coefficient), optical (transparency) and
thermal properties (sealability). Till now these results have been obtained through different approaches:
coupling different materials through a lamination process, in which different polymers are joint
together with a tie, in order to exploit the performances of each individual layer. The main disadvantage
of this approach, especially from an environmental impact perspective, is the obtainment of a heavy
packaging (often made by more than 5 layers);
coating of synthetic polymers of different origin (vinylic, acrylic, inorganic) that bring to an expensive
final packaging due to the price of the materials;
plasma deposition or metallization, other surface treatments that involve negative aspects like technical
efforts and environmental impact (Farris et al. 2009b).
It is clear that the replacement of multi-layered structures with lighter solutions appears a compelling and an
attainable opportunity, and bio-coating deposition on plastic webs is probably one of the most convenient and
efficient techniques to accomplish this goal, with the advantage to be a promising way to face the packaging
waste disposal issue (Farris et al. 2009c). Lot of examples can be found in literature, for instance coatings made
of whey protein isolate have been credited of excellent both transparency (Hong et al. 2003) and barrier
properties against oxygen (Hong et al. 2006), chitosan has been proved to be effective as coating material on
15
th
334
15
th

paper and paperboard (Gllstedt at al. 2005), gelatin has been applied as a component of thin sealing layers
(Farris et al. 2009a). Thus, this PhD project will be specifically address to the development of bio-coatings able
to provide a high barrier against oxygen and water vapour, which are the most appealing properties for a water-
base coating. In order to do that, biomacromolecules will be used in conjunction with other materials, like other
biodegradable components, enzymes and inorganic fillers.

Keeping in mind the overall aim mentioned above this PhD project can be subdivided into the following
activities, according to the Gantt diagram shown in Table 1:
A1) Identification of biopolymers for coating application: different biopolymers will be tested on the basis of
their attitude to form coatings. Physical and chemical characteristics will be specifically considered.
A2) Analysis of film coated with single component solutions: the effect of deposition of individual
biomacromolecules will be considered through the typical analysis of packaging films: barrier properties
(A2.1), optical properties (A2.2), surface properties (A2.3) and others (A2.4).
A3) Improvement of the coating system through a blending process: the properties of the bio-coating will
be improved through the addition of others ingredients. This will be done by a screening step (A3.1), a
second step of blending feasibility (A3.2), a third step of optimization of the coating solution (A3.3), a
fourth step of analysis of the final biocoating/film structure (A3.4) as in the previous point A2.
A4) Scaling up: the process will be scaled-up to a pilot-plant to validate the feasibility of an industrial
application. The obtained films will be compared to those obtained in the lab.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) Identification of biopolymers
A2)
Analysis of film coated with single
component solutions

1) barrier properties
2) optical properties
3) surface properties
4) others
A3) Improvement of the system
1) screening of fillers
2) blending feasibility
3) optimization of the coating solution
4) analysis of the final structure
A4) Scaling-up
1) comparison with laboratory films

Farris S, Cozzolino CA, Introzzi L, Piergiovanni L. (2009a) Effects of different sealing conditions on the seal
strength of polypropylene films coated with a bio-based thin layer. Packag. Technol. Sci. 22: 359-369.
Farris S, Introzzi L, Piergiovanni L (2009b) Evaluation of a bio-coating as a solution to improve barrier, fiction
and optical properties of plastic films. Packag. Technol. Sci. 22: 69-83
Farris S, Schaich KM, Liu LS, Piergiovanni L, Yam K (2009c) Development of polyion-complex hydrogels as
an alternative approach for the production of bio-based polymers for food packaging applications: a review.
Trends Food Sci. Tech. 20: 316-332
Gllstedt M, Brottman A, Hedenqvist MS (2005) Packaging-related properties of protein- and chitosan-coated
paper. Packag. Technol. Sci. 18: 161-170
Hong S, Krochta CM, (2003) Oxygen Barrier Properties of Whey Protein Isolate Coatings on Polypropylene
Films J. Food Sci. 68: 224-228.
Hong S, Krochta CM, (2006) Oxygen barrier performance of whey-protein-coated plastic films as affected by
temperature, relative humidity, base film and protein type J. Food Eng. 77: 739-745.
Tharanathan RN (2003) Biodegradable films and composite coatings: past, present and future. Trends Food Sci.
Tech. 14: 71-78.
15
th
335
15
th
Development of nano-material for food packaging
Fei LI (fei.li@unimi.it)
Department of Food Science, Technology and Microbiology, DiSTAM, University of Milan, Milan, Italy
Tutor: Prof. Luciano Piergivanni
The aim of this PhD project is to improve the properties of conventional food packaging materials and develop
new food packaging concepts. To this purpose, nano-materials as coatings of traditional polymers will be used
and composites with nano-materials as functional constituents will be produced, together with the setting up the
best technologies to improve the ultimate performance of the package. Particularly, improvement and innovation
will be achieved using bio-polymers, especially cellulose, of both bacterial and plant origin. An additional
fundamental aim of the research is the understanding of the structure!morphology!properties hierarchical
relationship of the obtained nano-materials, in order to control deliberately the ultimate performance.
Studio e sviluppo di nano materiali per migliorare le prestazioni degli imballaggi
alimentari
Scopo del presente progetto di dottorato sviluppare nuovi concetti nel settore dellimballaggio alimentare, al
fine di migliorare le propriet dei materiali utilizzati nel settore. A questo scopo verranno utilizzati nano-
materiali sotto forma di coatings da depositare sui tradizionali polimeri e verranno prodotte strutture composite a
base di nano-materiali come costituenti funzionali, contemporaneamente allo sviluppo delle migliori tecnologie
per il miglioramento delle performance finali dellimballaggio. In particolare, miglioramento ed innovazione
saranno raggiunti utilizzando bio-polimeri, in particolare cellulosa di origine sia batterica che vegetale. Un
ulteriore obiettivo della ricerca la comprensione della relazione gerarchica struttura!morfologia!propriet
dei nano-materiali ottenuti, allo scopo di poter intervenire deliberatamente nel controllo delle performance finali.
1. State-of-the-Art
Over the past decades, polymers have replaced conventional materials in packaging applications due to their
functionality, lightweight, ease of processing, and low cost. Synthetic polymers are world-wide used in food
packaging where they provide mechanical, chemical, and microbial protection from the environment and allow
product display. Polymers most frequently used in food packaging are polyethylene, polypropylene, polystyrene,
polyvinyl chloride, and polyethylene terephthalate (Bureau et al., 1996; Marsh et al., 2007). However, despite
their huge versatility, a limiting property of these polymers is their inherent permeability to gases and vapors
(e.g. oxygen, carbon dioxide, and organic vapors). This has boosted interest in developing new strategies to
enhance the general performance and to carry out research aimed to understand the structure-properties
relationship.
The most frequently used strategies to enhance the properties of synthetic polymers are the use of polymer
blends, high barrier coatings, and the use of multilayered films. Polymers can also be added with suitable fillers
to form composites with enhanced barrier properties (Matthews et al., 1994). Fibers, platelets, and particles have
been used for decades to form polymer composites with enhanced mechanical and thermal properties. A recent
breakthrough in composite materials is the advancement of nanotechnology. Nanocomposites are materials in
which the filler has at least one dimension smaller than 100 nm. Mechanical, thermal, and properties of
nanocomposites often differ markedly from those of their component materials. Polymer nanocomposites
promise a new crop of stronger, more heat resistant, and high barrier materials (Arora et al., 2010). Moreover,
biopolymer nanocomposites from fruit and vegetable purees and cellulose nanofibers (CNF) have been recently
studied as film-forming edible materials. Cellulose nanofibers were added to improve tensile properties, water
vapor permeability, and glass transition temperature of mango puree films (Azeredo et al., 2009). Environmental
concerns and the need for a sustainable development led to a growing attention towards bio-based materials also
in the packaging sector. However, biopolymers are exhibit high water vapor permeability and low mechanical
properties in comparison with traditional materials. Hence, the general goal of the project: to achieve better
performance of food packaging materials using bio-based nanomaterials, mainly obtained from cellulose.
A1) Determination of the physical and chemical properties of selected biopolymers:
in the form of nanobers, including bacterial and wood cellulose nanobers, obtained by acid hydrolysis
or electrospinning under optimized condition (A1.1) and morphology (A1.2).
A2) Characterization of plastic films coated with selected nanofibers: the effects on barrier, optical, surface
properties (A2.1), and others (A2.2) of different nanofibers used will be determined.
15
th
336
15
th
A3) Characterization of nanocomposites: using the different length of the nanofibers produced from wood or
bacterial cellulose or by electrospinning, blending and casting or extruding with other biopolymer in order
to improve the properties that will be measured as in (A2.1) and (A2.2).
A4) Improvement of the coating and nanocomposites production: the improvement will be based on fillers
selection (4.1), coating/composite process optimization (4.2) and checked by chemical and physical
analyses (4.3) in order to understand the relationships between structure, morphology and performance.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) Biopolymer Properties
1) Obtaining nanofibers
2) Morphology
A2) Analysis of coated films
1) Barrier, optical, surface properties
2) Others
A3) Analysis of nanocomposites
A4) Improvement
1) Fillers selection
2) Coating solution optimization
3) Typical analysis
Bureau G, Multon JL (1996) Food packaging technology. Weinheim 1-2: VCH.
Marsh KS, Bugusu B (2007) Food packaging - roles, materials and environmental issues. J Food Sci 72: 3955.
Michaels F (1995) Modern plastic encyclopedia. New York: McGraw-Hill.
Matthews FL, Rawlings RD (1994) Composite materials: engineering and science. London: Chapman and Hall. 137.
Arora A, Padua GW (2010) Review: Nanocomposites in Food Packaging. J Food Sci 75: 43-49.
Azeredo HMC, Mattoso LHC, Wood D, Williams TG, Avena-Bustillos RJ, McHugh TH (2009) Nanocomposite
edible films from mango puree reinforced with cellulose nanofibers. J Food Sci 74: 31-35.
15
th
337
15
th
[Digitare il testo]

Bifidogenic activity of protein hydrolizate from poultry by-products

Federica Meli (federica.meli@meno.unipr.it)
Dept. Genetics, Biology of microorganisms, Anthropology, Evolution, University of Parma, Parma, Italy
Tutor: Prof. Erasmo Neviani
This PhD thesis research project is aimed at investigate about microbiological properties of protein hydrolizates (FAP
Functional Animal Protein - and FFP-Functional Feathers Protein) obtained from poultry bones&meat trimmings and
from feathers. Actually the main goal is to set FAP activities as growth stimulator for Bifidobacterium genus. This
project belongs to the European research project PROSPARE -PROgress in Saving Proteins and Recovery of Energy-,
whose aim is the recovery of poultry industry leftovers into valuable end-products.

Attivit bifidogenica di idrolizzati proteici ottenuti dagli scarti della macellazione avicola

Questo progetto di tesi di dottorato si pone lobbiettivo di riconoscere un valore aggiunto agli scarti dellindustria
avicola. In particolare mira a caratterizzare le funzionalit microbiologiche e lattivit stimolanti la crescita di differenti
specie di Bifidobatteri di idrolizzati proteici ottenuti dagli scarti della macellazione avicola e dalle piume (FAP-
Functional Animal Protein- and FFP-Functional Feathers Protein-). Gli idrolizzati sono prodotti nellambito di
PROSPARE -PROgress in Saving Proteins and Recovery of Energy-: un progetto Europeo di ricerca il cui scopo il
recupero degli scarti dellindustria avicola creando nuovi prodotti con un alto valore aggiunto (www.prospare.eu).

1. State-of-the-Art
The microbiota of the human gastrointestinal tract plays a key role in nutrition and health. Bifidobacteria are considered to be
examples of health-promoting constituents of the microflora. In particular, the use of some Bifidobacterium spp. as probiotics
is widespread in food industries, mainly in the dairy product area (Heller 2001).
Although they are much employed in the production of functional food, their growth is often slow or limited even on
synthetic media because of the absence of a growth promoting factor (Etoh et al. 1999).
Bifidobacterial growth is stimulated by the presence of two types of promoting factors: growth factors which are metabolized
by the body, or by the microflora, in the upper gastrointestinal tract (such as threonine, yeast extract, cystein, peptone, ect);
and bifidogenic factors, which are substances that survive the direct metabolism of the host and reach the large intestine for
preferential metabolism by bifidobacteria (lacteal secretions, transgalactosylated-oligosaccharides (Modler et al. 1994,
Ventura et al. 2004). Promoting factors can also be considered non-glycosilated peptides derived from protein after
hydrolysis using proteases (Tamime et al. 1995). Some studies have shown that compounds found in human milk (Liepke et
al. 2002) and in cow milk (Petschow and Talbott 1991) have the ability to promote growth of bifidobacteria. Also molecules
present in dairy industry effluents such as whey (Mahalakshmi and Murthy 2000) or the by-product of latex rubber
production have been demonstrated to have this effect (Etoh et al. 2000).
The aim of this PhD project is evaluate and comprehend the potential, as probiotic bacteria growth stimulators, of the peptide
hydrolysates (FAP-functional animal protein; FFP-Functional Feathers Protein) obtained from poultry bone and meat
trimmings and from feathers. FAP samples were provided by the European project PROSPARE (Progress in Saving Proteins
and Recovering Energy, www.prospare.eu). The aim of PROSPARE is to convert unmarketable poultry secondary resources
into value-added peptide hydrolyzates that can be exploited in the food, feed and green chemical (cosmetic and
microbiological sector) chains.
In this first year the growth promoting activity of different FAPs and FFP was studied through the comparison of two
different techniques: turbidimetric measurements and a direct count by fluorescence microscope. The use of microscopic
count makes it possible to evaluate both the growth and the level of viability in the presence of peptide hydrolizate. This
element is considered of great importance because the essential condition for a probiotic to carry out its activity in the
intestinal tract is strictly connected to the physiological cellular state and therefore to its viability.

A1) Evaluation of growth promoting activity of FAPs/FFPs on Bifidobacterium and Lactobacillus probiotic
spp. with different techniques:
traditional turbidimetric measurements
15
th
338
15
th
[Digitare il testo]

direct count by fluorescence microscope;

Setting up and application real-time PCR based method to evaluate viability of cells exposed to
FAPs/FFPs. The viable/dead stain Propidium monoazide (PMA) is used in combination with realtime PCR
to inhibit amplification of DNA from dead cells that have taken up PMA.
A2) Testing growth promoting activity of FAP/FFP fractions on Bifidobacterium and Lactobacillus probiotic
spp
A3) Setting up and application of cDNA-AFLP method to identify and analyze genes involved in possibly
adaptive characteristics with/without FAPs/FFPs. When AFLP tecnique(amplified fragment length
polymorphism) is applied to cDNA, it should be capable of finding different gene expression that happens
during different growth conditions.
A4) Testing the growth promoting activity of protein hydrolizate from different kind of food industry left-
products:
comparison with FAP/FFP

Months Activity

1 2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

EvaluationCompletion of evaluation
of growth promoting activity of
FAPs/FFPs on Bifidobacterium and
Lactobacillus probiotic spp.

A1)
Setting up and application real-time
PCR based method to evaluate
viability of cells exposed to FAPs/FFPs

A2)
Testing growth promoting activity of
FAP/FFP fractions on Bifidobacterium
and Lactobacillus probiotic spp.

A3)
Setting up and application of cDNA-
AFLP method to identify and analyze
genes involved in possibly adaptive
characteristics with/without
FAPs/FFPs

A4)
Testing the growth promoting activity
of protein hydrolizate from different
kind of foodindustry leftproducts

Etoh, S., Asamura, K., Obu, A., Sonomoto, K. and Ishizaki, A. (2000) Purification and identification of a growth-
stimulating peptide for Bifidobacterium bifidum from natural rubber serum powder. Biosci Biotechnol Biochem 64,
2083-2088.
Etoh, S., Sonomoto, K. and Ishizaki, A. (1999) Complementary effects of bifidogenic fgrowth stimulators and
ammonium sulphate in natural rubber serum powder on Bifidobacterium bifidum. Biosci Biotechnol Biochem 63, 627-
631.
Heller, K.J. (2001) Probiotic bacteria in fermented foods: product characteristics and starter organisms. Am J Clin
Nutr 73, 374-379.
Liepke, C., Adermann, K., Raida, M., Magert, H. J., Forssmann, W.G.and Zucht, H.D. (2002) Human milk provides
peptides highly stimulating the growth of Bifidobacteria. Eur J Biochem 269, 712-718.
Mahalakshmi, R. and Murthy, V.V.P.S. (2000) Growth of Bifidobacteria bifidum in whey-based media. J Ind Microbiol
Biotechnol 25, 177-179.
Modler, H. W. (1994) Bifidogenic factors- Sources, metabolism and applications. Int Dairy J 4, 383-407.
Petschow, B.W. and Talbott, R.D.(1991) Response of Bifidobacterium species to growth promoters in human and cow
milk. Pediatr Res 29,208-213.
Tamime, A.Y., Marshall, V.M.E. and Robinson, R.K. (1995) Microbiological and technological aspects of milks
fermented by bifidobacteria. J Dairy Res 62, 151-187.
Ventura, M., van Sinderen, D., Fitzgerald, G.F. and Zink, R.(2004) Insights into the taxonomy, genetics and physiology
of bifidobacteria. Antonie Van Leeuwenhoek 86, 205-223.
15
th
339
15
th
Bio-based Food Packaging: Influence of Formulation and Processing on
Functional Properties
Stefano Molinaro (stefano.molinaro@uniud.it)
Dept. Food Science and Technology, University of Udine, Udine, Italy
This PhD thesis research project aims to study and to set up a food bio-packaging PLA-based. In particular, the
influence of formulation and process conditions on mechanical and physico-chemical properties of the film will
be investigated. These properties will be compared with those of selected reference films for food products. In the
second part of the project, the influence of the material on a food model system will be evaluated in comparison
to the food packaging materials traditionally used.
Influenza della formulazione e delle condizioni di processo sulle propriet funzionali di
un imballaggio alimentare ottenuto da fonti rinnovabili
Il progetto di tesi di dottorato ha come obiettivo lo studio e la messa a punto di un biopackaging alimentare a
base di PLA. In particolare, verr approfondita linfluenza della formulazione e delle condizioni di processo sulle
propriet meccaniche e chimico-fisiche del film in oggetto, propriet che saranno poste a confronto con film
alimentari di riferimento. Nella seconda parte del progetto verr valutata linfluenza del materiale su un sistema
alimentare modello, rispetto ai materiali di imballaggio tradizionalmente usati.
1. State-of-the-Art
Over the last decades, plastics have been the most used material in the world, playing a central role in modern
industrial economies (Carol et al., 2004). Nevertheless, the growing reliance on oil-based polymers had raised
several environmental and human health issues because of their persistence in the environment. Moreover, food
packaging has recently been affected by significant changes in food distribution, due to the globalization of food
supply and the growing consumer demand for better, more fresh and safer quality foods (Lopez-Rubio et al.,
2004). This new approach has been a key factor in the development of alternative sustainable packagings,
targeted to be beneficial, safe and healthy for individuals and communities throughout its life cycle, at the
same time meeting market criteria for both performances and cost and being sourced, manufactured,
transported and recycled using renewable energy (www.sustainablepackaging.org). Examples of these
packaging materials include bio-based polymers, bioplastic or biopolymer packaging products made from raw
materials originating from agricultural or marine sources (Cha and Chinnan, 2004). Generally, bio-based
polymers or biopolymers are considered to be produced from renewable resources (Comstock et al., 2004;
Weber et al., 2002; Petersen et al., 1999). Bio-based polymers are divided into three main categories depending
on their origin and production: polymers directly extracted/removed from biomass, polymers produced by
classical chemical synthesis using renewable bio-based monomers and polymers produced by microorganisms or
genetically modified bacteria (Weber, 2000). Recently, polymers like polyethylene, polypropylene, PVC or PET,
but also high-performance polymers like polyamide or polyester have been totally or partially replaced by their
renewable equivalents. Nevertheless, probably bio-based plastics will not be able to replace oil-based polymers
in the coming years, because of low oil price, high production cost and restricted production capacity of
biomass-based polymers that contain their the technically possible growth in the near future. According to Van
Bailen and Poirier (2007), a recovery in the spread on the use of biopolymers in industrial and consumer product
depends on economics, public acceptance and regulation. For instance, the recent strong increase in oil price has
already allowed some biopolymers to be competitive with petrochemical plastics. However, public acceptance of
the use of transgenic plants for non-food purposes is not assured, especially in the European Union (Gaskell et
al., 2006). The most important biogenic sources of raw materials for industrial chemicals are oil plants (oil, fat,
glycerol, celluloses), starch plants (starch, inulin, carbohydeates, celluloses), sugar beets and sugar cane
(sucrose), wood (ligno-cellulose, cellulose), and waste and residues from agriculture and industry (biomass, fats,
oils, whey, glycerol) (Wilke and Vorlop, 2004). Polylactic acid (PLA) is a compostable polymer derived from
renewable sources, in particular from starch and sugar. During the last ten years, it has been used primarily for
medical applications such as implant devices, tissue scaffolds and internal sutures, due to its high cost, low
availability and limited molecular weight (Datta and Henry, 2006). Recently, since production cost has been
lowered by new technologies and large-scale production, the use of PLA has been extended to other commodity
areas such as packaging, textiles and composite materials (Drumright et al., 2000; Garlotta, 2001). Because of its
properties to be both derived from renewable resources and compostable, PLA has also been viewed as one of
the solutions to reduce solid waste disposal problems (Lim et al., 2008). The building block of PLA, lactic acid
15
th
340
15
th
(2-hydroxy propionic acid), can exist in optically active d- or l- enantiomers. Its good optical, physical,
mechanical and barrier properties make it suitable to compete with the existing petroleum-based thermoplastics
(Lim et al., 2008). Thus, this PhD thesis project will be directed to study and to set up a food packaging material
PLA-based, evaluating its performance on a selected food model system.
A1) Bio-based packaging development and properties: influence of packaging formulation and process
conditions on mechanical, barrier and interfacial film properties.
A2) Evaluation of film performance: evaluation of film performance on a selected food model system.
A3) Film process optimisation and scaling-up: set up of optimal running conditions and validation of the
process in the pilot scale.
Activity Months
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
17
18 19 20 21 22 23 24
A1) Bio-based packaging development
and properties

1) Packaging development based on
the study on formulation

2) Effect of process conditions
A2) Evaluation of film performance
1) Selection of a food model system
2) Evaluation of film performance
using the packaged food model

A3) Film process optimisation and
scaling-up

1) Optimal running conditions set up
2) Scaling-up of the process
Carole TM, Pellegrino J, Paster MD (2004) Opportunities in the industrial biobased products, Appl Biochem
Biotechnol 113: 871-85.
Cha DS, Chinnan MS (2004). Biopolymer-based antimicrobial packaging: a review, Crit Rev Food Sci Nutr 44:
2237.
Comstock K, Farrell D, Godwin C, Xi Y (2004) From hydrocarbons to carbohydrates: food packaging of the
future. Website:http://sea-cr.com.
Datta R, Henry M (2006) Lactic acid: recent advances in products, processes and technologiesa review, J
Chem Technol Biotechnol 81: 111929.
Drumright RE, Gruber PR, Henton DE (2000) Polylactic acid technology, Adv Mater 12: 184146.
Garlotta D (2001) A literature review of poly(lactic acid), J Polym Environ 9: 6384.
Gaskell G, Allansdottir A, Allum N, Corchero C, Fischler C, Hampel J, Jackson J, Kronberger N, Mejlgaard N,
Revuelta G, Schreiner C, Torgesen H, Wagner W (2006) Europeans and biotechnology in 2005: patterns
and trends, Eurobarometer 64.3, report to the European Commissions Directorate-General for Research,
London.
Lim LT, Auras R, Rubino M (2008) Processing technologies for poly(lactic acid), Prog Polym Sci 33: 82052.
Lopez-Rubio A, Almenar E, Hernandez-Munoz P, Lagaron JM,Catala R, Gavara R (2004). Overview of active
polymer-based packaging technologies for food applications, Food Rev Inter 20: 35787.
Petersen K, Nielsen PV, Bertelsen G, Lawther M, Olsen MB, Nilsson NH, Mortensen G (1999) Potential of
biobased materials for food packaging, Trends Food Sci Tech 10: 52-68.
Van Beilen JB, Poirier Y (2007) Prospects for Biopolymer Production in Plants. Adv Biochem Eng Biotechnol
107: 13351.
Weber CJ (2000). Biobased packaging materials for the food industry. Status and perspectives. A European
Concerted Action (http://crl-fcm.jrc.it/files/biopack_report.pdf).
Weber CJ, Haugaard V, Festersen R, Bertelsen G (2002) Production and applications of biobased packaging
materials for the food industry, Food Addit Contam 19: 1727.
Willke T, Vorlop KD (2004) Industrial bioconversion of renewable resources as an alternative to conventional
chemistry, Appl Microbiol Biotechnol 66: 13142.
15
th
341
15
th
Development of Guidelines for Microbiological Control in Microbreweries
Elio Moretti (elio.moretti@hotmail.it; elio.moretti@studio.unibo.it)

This thesis project aims to identify a set of standardized procedures and optimized for microbiological control in
microbreweries. Today in Italy there are around 300 craft breweries, in most cases they do not perform routine
microbiological controls of process and product. The research will aim to monitoring and identification of the most
involved microorganisms in the contamination of the finished product.
Sviluppo di linee guida per il controllo microbiologico nelle microbirrerie
Questo progetto di tesi ha lo scopo di individuare una serie di procedure standardizzate ed ottimizzate per il controllo
microbiologico nelle microbirrerie. Oggi in Italia vi sono circa 300 birrifici artigianali, questi nella maggior parte dei
casi non svolgono controlli microbiologici routinari di processo e prodotto. Lattivit di ricerca sar volta al
monitoraggio e allidentificazione dei microrganismi maggiormente coinvolti nelle contaminazioni del prodotto
finito.
1. State of the Art
In the brewing industry, beer spoilage bacteria and yeast have been problematic for centuries. In large breweries,
routine microbiological controls are performed within the process and on the final product, but this does not happen
in microbreweries. The most important spoilage bacteria are represented by some lactic acid bacteria such as
Lactobacillus brevis, Lactobacillus linderi and Pediococcus damnosus, and some Gram negative bacteria such as
Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae (Sakamoto and Konings, 2003).
They can spoil beer by turbidity and the production of unfavourable smell such as diacetyl or hydrogen sulfide
(Sakamoto and Konings, 2003).
The yeast that is not deliberately used in the brewery and not under full control is designated as wild yeast (Back,
2005). Growth of wild yeast during processing and in the packaged product may lead to defects, including the
formation of phenolic, acidic, fatty acid and estery off-flavours, as well as hazes and turbidity (Khle and Jespersen,
1998).
The hygiene of vessels, machinery and other process surfaces crucially affects the quality of the final product. To
ensure high quality, reliable detection of microorganisms that could have a detrimental effect on the product is
essential as earlier as possible (Storgrds, 2000).
This project of research has a first objective the definition of the state of art and of methodologies currently applied
through a bibliographic research that will continue during the whole PhD period. Further work steps will include the
quantification and identification of microorganisms involved in the most common contamination of brewery
industry. The identification of spoilage microorganism is one of the objectives of this study in order to help the craft
breweries in the elimination of the main products defects. During the PhD the detected microorganisms will be
stored and used for morphological tests, characterization and identification. Finally, the work will develop guidelines
for microbiological control in microbrewery.
The research program includes:

A1) Bibliographic Research and Implementation of the main analytical methods used for official identification
and recognition of micro-contaminants associated with the production of beer.
A2) Review of microbiological methods currently used in microbreweries.
A3) Sample collection and analytical determinations.
A4) Discussion of results and set-up of guidelines for microbiological quality control in micro breweries.
A5) Writing and editing the PhD thesis, scientific papers and oral and/or poster communications.

15
th
342
15
th
Activity Activities Months 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36
A1)
Bibliographic Research and Implementation of the
main analytical methods used for official
identification and recognition of micro-contaminants
associated with the production of beer

A2)
Review of microbiological methods currently used
in microbreweries

A3)
Sample collection and analytical determinations

A4)
Discussion of results and set-up of guidelines for
microbiological quality control in micro breweries

A5)
Writing and editing the PhD thesis, scientific papers
and oral and/or poster communications

Back W (2005) Colour Atlas and Handbook of Beverage Biology. Fachverlag Hans Carl. Nrnberg, 2005.
Khle A, Jespersen L (1998) Detection and identification of wild yeasts in lager breweries. Int J Food Microbiol 43: 205-213.
Sakamoto K, Konings WN (2003) Beer spoilage bacteria and hop resistance. Int J Food Microbiol 89: 105-124.
Storgrds E. (2000) Process hygiene control in beer production and dispensing. VTT Technical Research Centre of Finland,
ESPOO 2000.
15
th
343
15
th
Microbiological approaches to reduce the SO
2
addition in oenology
Chiara Nadai (chiara.nadai@studenti.unipd.it)
Dept. of Agricultural Biotechnology, University of Padova, Conegliano, Italy
Tutor: Prof.ssa Viviana Corich

This PhD thesis aims to study the mechanisms of action of sulphur dioxide during the vinification process, with
the purpose of developing technically effective and economically convenient protocols for reduction or
elimination of sulphite addition in alcoholic beverages. The aim of the project will be to study the genetic bases
of sulphite metabolism in ecotypical yeasts of the species Saccharomyces cerevisiae and to verify how this
function can be influenced by other factors.
Approcci microbiologici per la riduzione dei solfiti in enologia
Questa tesi di dottorato mira ad approfondire i meccanismi di azione dell'anidride solforosa durante il processo
di vinificazione, con lobiettivo di sviluppare trattamenti mirati, tecnicamente efficaci e commercialmente
convenienti, che permettano la riduzione o l'eliminazione dei solfiti nelle bevande alcoliche. Lo scopo del
progetto sar chiarire le basi genetiche del metabolismo dei solfiti in lieviti ecotipici della specie Saccharomyces
cerevisiae e verificare in che modo questo venga influenzato da altri fattori.
1. State-of-the-Art
Sulphites are the most diffuse preservatives used in the food and beverage industry for their antioxidant and
antimicrobial properties, relevant for quality and stability of products. In winemaking SO
2
addition is extensively
diffused, although its toxic effect on human health is largely proven, especially when linked to alcoholic drink
consumption, since ethanol itself contributes to intensify allergic and allergic-like reactions due to other
molecules (Vally et al., 2009). Thus, despite its useful effects on food and wine, SO
2
is added in low amounts
and, nowadays, reduction of sulphite use in wine processing is considered a primary objective in oenology, but
there are no specific tools that actually could completely substitute this toxic additive because of its
multifunctional effects due to the antimicrobial, antioxidant and antioxidasic activities (Ribreau-Gayon et al.,
2007). Excessive doses of SO
2
should be avoided because of their impact on aroma, as well. At high
concentrations sulphite produces effects ranging from aroma neutralization to characteristic flavour defects. On
the other hand, binding ethanol, pyruvic acid, acetaldehyde and other similar compounds, SO
2
at low doses
protects wine aromas and erases the flat character.
Most of the yeasts belonging to the genus Saccharomyces, which includes microorganisms important for
fermentative processes of many foods and drinks, are naturally resistant to sulphites at the doses legally
permitted. Thus, SO
2
addition at the beginning of alcoholic fermentation is usually set to promote their growth.
Notwithstanding, wine yeasts are widely variable in terms of level of resistance to sulphites and the mechanisms
that regulate such characteristic are not completely known yet. Moreover, most of wine yeasts currently used
was obtained many years ago, when SO
2
was used at relatively high dosages. Hence, strains highly tolerant to
SO
2
were sought, whose behaviour at low-to-medium SO
2
doses was not studied, especially in terms of H
2
S
production. Indeed, lowering SO
2
amounts would allow use of alternative strains more adapted to such
conditions. Nowadays, high sulphite resistance is far less important, whereas interest is focusing on the use of
yeasts able to seize sulphur dioxide and low amounts of added sulphites, taking advantage of the SO
2
produced
by yeasts themselves. These characteristics are strain-dependent in yeasts and change depending on the initial
sulphite content of the medium; moreover both characters are complex and poorly studied in literature.
Sulphites inhibit microbiological contaminants of grape musts, such as moulds, yeast and bacteria naturally
present on grape skin. Thus, SO
2
addition at the beginning of alcoholic fermentation is usually set to promote
Saccharomyces yeasts which are generally resistant to sulphites at legal doses and are able to produce
themselves small amounts of SO
2
. It is well accepted that microorganisms are mainly affected by SO
2
-free forms
after entering the cell. Membrane transport of sulphite in wine yeasts is by simple diffusion of liberated sulphur
dioxide rather than being carrier mediated. Yeast can cope with sulphite stress by several mechanisms, such as
acetaldehyde production, up regulation of sulphite uptake and reduction and sulphite efflux from the cell by the
membrane pump Ssu1 (Casalone et al., 1992). Proteins involved in these functions have been studied and
identified although their regulation remains still unclear. These mechanisms are cross-linked: this explains why a
high production of acetaldehyde by yeast strains leads to increased sulphite resistance; the opposite is also true,
since acetaldehyde increases transcription of sulphur metabolism coding genes. The main protein involved in
sulphite resistance is the sulphite pump Ssu1p that mediates sulphite efflux and has been studied for many years
since it is a marker of genetic rearrangements involved in the adaptive evolution of yeast strains.
15
th
344
15
th
Sulphite detoxification is also achieved by yeast through up regulation of uptake and reduction to sulphate and
sulphide, with consequent incorporation in other metabolites (i.e. sulphurated amino acids) and removal of
sulphite from the medium by transformation in other compounds (Pretorius, 2000). Thus, studying sulphite
impact on whole yeast metabolism would be useful for better understanding the complex metabolic adaptation to
oenological environment.
A1) Evaluation of sulphite resistance, SO
2
and H
2
S production of ecotypical yeasts. It will consist of a first
screening phase by means of plate assays to determine the level of SO
2
resistance and production, and the ability
to produce H
2
S, compound that is linked to sulphite metabolism (Pretorius, 2000), related to the pool of
ecotypical yeast. A pool of a hundred commercial strains will be submitted to the analysis with the aim to
compare the performances of the ecotypical strains, collected from the vineyard, with those of yeast starters
traditionally isolated in cellar where high level of SO
2
were usually added to the musts. Afterwards, on the basis
of their ability to produce SO
2
and to resist to the antiseptic toxicity, the most interesting strains will be chosen
and further analyzed. These strains will be submitted to pilot-scale fermentations with different concentration of
antiseptic added into the synthetic must. The quantity of SO
2
and H
2
S produced by the different tested strains
will be determined. Moreover the concentration of acetaldehyde, involved into the mechanisms of SO
2
stress
response in yeasts, will be measured. Finally, during the fermentation process, gene expression quantification, by
means of Real-Time PCR, will be performed to determine the expression level of the most relevant genes
involved in the metabolism (SSU1, FZF1, MET3, MET10, MET17, Aranda et al., 2006).
A2) Molecular studies on sulphite metabolism in Saccharomyces cerevisiae. On the basis of the previous
results, few yeast strains will be chosen and the pleiotropic effect of sulphites on yeast metabolism will be
evaluated analyzing transcriptome of oenological strains at different SO
2
doses.
A3) Gene mapping of sulphite resistance traits by means of hybrids production and genomic analysis of
segregants. The four ecotypical strains characterized by high level of SO
2
toxicity and whose genome sequences
are available, will be considered to carry out a selection scheme using EC1118 as high performance parental.
The haploid strains obtained from ecotypical and commercial yeasts will be genetically and physiologically
characterized in order to find out the segregants that will be closest to the parental ones. Afterwards, the obtained
zygotes will be allowed to sporulate and generate segregants that will be physiologically characterized to
evaluate the fermentation performances and the level of SO
2
resistance and production. The genome sequencing
of the selected segregants and the gene mapping will be performed by means of ultra high troughput
technology systems ( SOLiD-TM).
A4) Writing and Editing of the PhD thesis, scientific papers and oral and poster communications.
Activity \ Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
A1 Evaluation of yeasts
1) Screening phase
2) Pilot-scale fermentation
3) Real-time PCR
A2 Molecular studies
1) Fermentations in bioreactors
2) Transcriptome analysis
A3 Gene mapping
1) Segregant characterization
2) Sequencing and data analysis
A4 Thesis and Paper Preparation
3. Selected Reference
Aranda A, Jimenez-Marti E, Orozco H, Matallana E, Del Olmo M (2006) Sulphur and adenine metabolisms are
linked, and both modulate sulphite resistance in wine yeast, J.Agric.Food Chem. 54: 5839-5846.
Casalone E, Colella CM, Daly S, Gallori E, Moriani L, Polsinelli M (1992) Mechanism of resistance to sulphite
in Saccharomyces cerevisiae, Curr.Genet. 22: 435-440.
Pretorius IS (2000) Tailoring wine yeast for the new millennium: novel approaches to the ancient art of
winemaking, Yeast. 16: 675-729.
Ribereau-Gayon P, Dubourdieu D, Doneche B, Lonvaud A (2007) Traite d'oenologie I, 3rd ed. Dunod, Paris.
Vally H, Misso NL, Madan V (2009) Clinical effects of sulphite additives, Clin.Exp.Allergy. 39: 1643-1651.
15
th
345
15
th
Proteomic, metabolomic, and biological activities of dietary seed protein
Chiara Nitride (chiara.nitride@virgilio.it)
The amount of protein present in seeds varies from 10% in cereals to 40% in certain legumes of the dry weight,
forming the major source of dietary protein. The protein pattern of dietary seeds has important impacts on their
nutritional quality for humans and livestock and on their functional properties in food processing. This thesis is
aimed to the characterization of seed proteins, from different dietary species, through an integrated proteomic
and metabolomic approach, in order to improve the quality of their nutritional and technological property.
Proteomica, metabolomica e attivit biologica di proteine da semi dinteresse alimentare
Il contenuto proteico dei semi varia dal 10% (p.s.), nei cereali, al 40% (p.s.), in alcune leguminose,
rappresentando la maggiore risorsa di proteine nella dieta. La componente proteica influenza notevolmente la
qualit nutrizionale dei semi, sia se diretti allalimentazione umana che a quella del bestiame, e le propriet
funzionali che essi svolgo negli alimenti processati. Questo progetto di tesi volto alla caratterizzazione della
componente proteica dei semi, di diverse specie alimentari, attraverso un approccio integrato di tipo proteomico
e metabolomico, al fine di migliorarne la qualit nutrizionale e tecnologica.
1. State-of-the-Art
A major part of the human diet, all over the world, consists of dietary seeds (legumes, cereals, nuts). According
to FAO estimate, 70% of human food comprises seeds and the remaining 30% derives from animals, which are
mostly fed with those seeds. Seed proteins have a moderate biological value and a low bioavailability because
they contain complex indigestible polysaccharides (fiber) or for the presence of antinutritional factors. Most of
the seed proteins has high molecular weights and their water solubility is poor. The seed proteins of legumes and
cereals are classified into storage and biologically active proteins. The main seed biologically active proteins
include lectins, enzymes and enzyme inhibitors. These are minor proteins and may have nutritionally more
balanced amino acid composition than storage proteins. Seed storage proteins are an important group of proteins,
which, together with the reserves of carbohydrates and oils, are synthesized during seed development. They are
not enzymes and have the only function of providing proteins (nitrogen and sulphur source) required during the
germination and the growth of a new plant. Albumins and globulins comprise the storage dicots proteins (e.g.
pulses), whereas prolamins and glutelins are the major proteins in monocots (e.g. cereals). These are synthesized
only in the seeds (in cotyledon or in endosperm) and not in other tissues. They lack any other functional activity.
The legume proteins (mostly 711S globulins) tend to be deficient in the sulphur containing cysteine, methionine
and tryptophan while cereals generally lack lysine, threonine and tryptophan. The globulins are generally present
as oligomers. The cereal prolamins are present as monomers or small aggregates, while glutelins form large
disulphide-bonded aggregates (Shewry et al., 1995).
It is well known that incorrectly processed seed proteins are able to cause gastrointestinal poisoning, allergy and
sometimes systemic anaphylactic reaction. On the other hand the mechanism of these actions is not known. The
accidental ingestion of uncooked seed can cause gastroenteritis for the presence of vegetal toxins, such as
legume lectins. On the other hand the ingestion of food, which contains allergens, such as Cor a1of hazelnut and
Ara h1of peanut, even if it is a minor ingredient, can cause an allergic reaction in an allergic subject. Only a
small fraction of the seed peptides is toxic or allergic, and represents an antinutritional factor in food. Many of
these proteins exist as isoform with a 67% identical amino acid sequence and with some differences in degree of
glycosylation or protein amidation. Glycosylation is one of the most frequently occurring post-translational
proteins modifications and is related to physiochemical (conformational stability, folding, solubility) as well as
functional properties (biological activity, enterotoxicity immune response). Most of these antinutritional factors
are glycoproteins with an acidic isoelectric point. These properties allow protein to persist in the stomach acidic
pH. Many of these are often storage proteins, and display a high degree molecular stability enough resistant to
processing, cooking and enzymatic digestion (Bayard et al., 2001).
In this thesis the protein fraction of the seed of legumes (beans, soy), nuts (hazelnut) and some cereals species
will be examined.
The proteomic and metabolomic approach will be applied to obtain the complete identification and
characterization of protein individual components of seeds or seed products, obtaining qualitative and
quantitative information. Several studies have demonstrated that high resolution two-dimensional (2-D)
15
th
346
15
th
electrophoresis (IEF-SDSPAGE), can be resolutive to obtain maps of proteins extracted from seeds, followed by
mass spectrometry (MS) of selected trypsin-digested polypeptides. For complete characterization of protein
extracts, we will study post-translation modifications, with focus on glycosylation (Magni et al., 2007). This
analytical approach allows us to examine the possible correlation between (glyco)protein structure and biological
activities in order to remove efficiently toxic or allergic factors from the food source. At the same time the
studies of the structural changes, induced by heat treatment, which reduce the biological activities of the
antinutritional factors, through different timetemperature cycles, will allow us to find optimal process
conditions. The protein itself becomes a marker of the technological process of transformation able to guarantee
food safety, allowing the monitoring of the complete transformation process, in order to predict the final
performance and give fast and timely information to make any adjustments in the production process.
Furthermore, the resistance to proteases throughout the gastrointestinal tract is a prerequisite for the protein to
exert antinutritional activities. In order to identify the portion of the toxic protein that is able to do a toxic effect,
and to identify the site of antigens that are recognized and bound by particular antibodies, so called epitopes, a
model system of digestion in vitro can be realized. The protein is hydrolyzed by the enzymes of gastric,
duodenal and jejunal environments, such as pepsin and pancreatin. Enzymatic concentrations and reaction times
are selected in order to closely reproduce the in vivo conditions. The aim is to identify the peptide able to
exhibit significant toxic and allergic effects. The product, obtained from different reactions, will be isolated and
sequenced by the combined application of HPLC and MS techniques. The set of separated peptides can be
subsequently scanned for sequential epitopes in a specific ELISA system using sera from allergic subjects, or
analyzed by specific cellular tests.
On the other hand seeds are rich in protein with a high nutritional value, but little is known about their bioactive
compounds that could benefit health. The presence of biopeptides is largely demonstrated for a lot of dietary
seeds, in particular it is known the ACE inhibitor activity of a lot of leguminoses, such as kidney beans, peas and
soy, in the treatment of hypertension. The same approach to study antinutritional factors will be used in order to
identify the peptide(s) able to exhibit significant bioactive effects, evaluated by different biological tests.
A1) Optimisation of techniques for extraction and purification of protein from seed.
A2) Qualitative and quantitative characterization of the protein pattern: qualitative characterization by
separation of proteins extract by 2D electrophoresis, and analysis by MS and peptide mass fingerprinting;
quantitative characterization by HPLC analysis.
A3) Study of proteins structural modification induced by heat treatments (different time temperature cycle).
A4) Study of biological activity by Immunochemical test, and biological test on cell lines.
Bayard C, Lottspeich F (2001) Bioanalytical characterization of proteins, J. Chromatogr. B, 756:113122.
Magni C, Duranti M (2007) Combined 2D electrophoretic approaches for the study of white lupin mature seed
storage proteome, Phytochemistry 68:9971007.
Shewry P, Tatham A (1995) Seed Storage Proteins: Structures 'and Biosynthesis, Plant. Cell 7:945-956.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) Protein extraction and purification
1) solubilisation and extraction
2) purification by chromatography
A2)
Qualitative-quantitative
characterization

1) separation gel electrophoresis
2) mass-spectrometry analysis
3) HPLC analysis
A3) Simulation of heat treatment
A4) Biological activity
1) immunochemical test
2) biological test on cell lines
15
th
347
15
th
Study of Traditional and Innovative Technologies for Minimally Processed
Fruit and Vegetable Products
Valentina Panarese (valentina.panarese2@unibo.it)
Tutor: Dr. Pietro Rocculi

The principal aim of this research project is to study the phenomena and the changes occurring during
preparation and storage operations of fresh cut fruit and vegetable products, such as traditional technologies (e.g.
washing, peeling) and innovative ones (e.g. vacuum impregnation and osmotic dehydration pre-treatments,
modified atmosphere and active packaging).
Studio di processi di trasformazione tradizionali ed innovativi per la realizzazione di
prodotti vegetali lavorati al minimo
Il presente progetto di ricerca ha come obiettivo principale lo studio dei fenomeni e dei cambiamenti a carico di
prodotti vegetali di I gamma evoluta e di IV gamma, che avvengono a seguito di interventi di preparazione e
conservazione tradizionali (lavaggio, mondatura e taglio) ed innovativi (pre-trattamenti di impregnazione a
pressione atmosferica e sotto-vuoto, confezionamento in atmosfera protettiva, utilizzo di imballaggi attivi).
1. State of the art
Fresh-cut fruit and vegetable products are fresh commodities, packed and ready to use, without any customer
preliminary operations (washing, cutting, slicing).
In the last decades, the needs of the ready to eat market are increasing together with the consumer
expectancies, that is asking for safe fast-food products with high nutritional value. Fresh cut fruit and vegetable
product quality is connected to attributes combination, such as appearance, color, texture, flavor and nutritional
value, determining the consumer choice. In this specific context the main aim of the research and development is
to extend the quality maintenance of fresh-cut fruit and vegetables, always guarantying the product safety.
Nowadays one of the main fresh-cut product limits is the relatively short shelf-life of few days. The raw material
preliminary operations, provoking tissues injuries, are responsible of the induction and/or acceleration of the
chemical and enzymatic reactions causing product quality depletion (King & Bolin, 1989). Following the hurdles
theory (Leistner, 2000), the quality spoiling phenomena can be controlled by the modulation of some partial
stabilizing operations. These last can guaranty the same safety grade reachable by a single and intense process
treatment, but limiting the negative effects. Among the techniques able to prolong the shelf-life of fresh-cut fruit
and vegetables, the most useful are the short time dipping treatment in aqueous solution with molecules that can
inactivate the enzymatic and microbiological activities, the modified atmosphere packaging and the cold storage
(Rocculi et al., 2003).
Many researches were aimed to study the phenomena occurring during product processing and storage, with
particular regard to mass, water and solutes transfer during the dipping process. Together with the studies of the
macro-phenomena occurring in tissues, it seems more and more important to understand the cellular mechanisms
at the base of the physiological feedback, which can be modulated by the applied technology. In this direction
there is an increasing interest concerning the tissue microstructure by the evaluation of water state by magnetic
resonance techniques (Hills & Remigereau, 1997) joined to morphological evaluation by different microscope
techniques (Hallet et al., 1992). The physiological feedback is strictly connected to the environment;
consequently an important focus is the understanding of the atmospheric changes in the packages as a function
of the packaging material permeability.
Industrial supervision and automation permit a better control of the processes, obtaining products with
standardized quality and safety characteristics. This approach can be integrated at the research level to study
reproducible process conditions and easily transferable to the industrial scale.
To reach the PhD thesis objectives, the work is divided in the following activities, summarized in the Gantt
diagram reported in Table 1:
A1) Bibliographic research, to obtain the specific skills for the PhD activities;
A2) Tweaking the technological process on a laboratory scale by using an approach of automation and
supervision of the system to obtain productive standards with a reproducible quality;
A3) Studying the phenomena and changes occurring during the processing and storage of fruit and
vegetable products. To reach an overall understanding about the process effects on vegetable tissues, it will be
15
th
348
15
th
followed a methodic approach from a macroscopic to a microscopic evaluation. The calorimetry, associated to
chromatography and fluorescence microscopy, will permit to investigate the tissue metabolism. Parallel
magnetic resonance analysis will supply a complementary knowledge on chemical-physical tissue characteristics
(e.g. water state) and on metabolic aspects.
A4) Writing and editing PhD thesis, scientific papers and oral and/or poster communications.

Table 1 Gantt diagram for the PhD thesis project
Activity Months 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36
A1) Bibliographic research
A2)
Tweaking the technological process on a
laboratory scale

A3)
Studying the phenomena and changes occurring
during the process and storage of fruit and
vegetable products

A4) Writing and editing PhD thesis, scientific papers
and oral and/or poster communications

Fito P, LeMaguer M, Betoret N, Fito PJ (2007) Advanced food process engineering to model real foods and process: The
SAFES methodology. J Food Eng 83: 173-185.
Hallett I, Macrae E, Wegrzyn TF (1992) Changes in kiwi fruit cell wall ultrastructure and cell packing during postharvest
ripening. Int J Plant Sci 153: 49-60.
Hills BP, Remigereau B (1997) NMR studies of changes in subcellular water compartmentation in parenchyma apple tissue
during drying and freezing. Int J Food Sci Tech 32: 51-61.
King AD Jr, Bolin HR (1989) Physiological and microbiological storage stability of minimally processed fruit and
vegetables. Food Tech 43: 132.
Leistner L (2000) Hurdle technology in the design of minimally processed foods. In: Alzamora, S.M., Tapia,M.S., Lpez-
Malo, A. (Eds.), Design of Minimal Processing Technologies for Fruits and Vegetables, Aspen Publishers,
Gaithersburg, Maryland.
Rocculi P, Romani S, Venir E, Dalla Rosa M, Mastrocola D (2003) Aspetti tecnologici dei prodotti a base di frutta
trasformati al minimo (IV gamma). Frutticoltura 3.

15
th
349
15
th
Study of Food-related Microorganisms by Use of Genomic and Proteomic
Applications
Gianfranco Pannella (gianfranco.pannella@unimol.it)
Dipartimento di Scienze e Tecnologie Agro-alimentari, Ambientali e Microbiologiche
Tutor: Prof.ssa Elena Sorrentino
This PhD thesis aims to study characters of technological interest of food-related microorganisms and to assess
the action of these microorganisms in food preservation and/or transformation. For these purposes, genomic
techniques (RAPD-PCR, DGGE, specific-PCR) and proteomic approaches (SDS-PAGE, Micro-fluidics
separation technology and 2D-Electrophoresis) will be employed.
Studio di microrganismi di interesse alimentare attraverso luso di tecniche genomiche e
proteomiche
Questo progetto di tesi di dottorato di ricerca si propone di studiare i caratteri di interesse tecnologico di
microrganismi di interesse alimentare e di valutare lazione di tali microrganismi nella conservazione e/o
trasformazione degli alimenti. A tal fine, saranno impiegate tecniche genomiche quali RAPD-PCR, DGGE,
PCR-specifica e tecniche proteomiche quali SDS-PAGE, elettroforesi a micro-fluidi ed elettroforesi 2-D.
1. State-of-the-Art
Several methods are applied in food preservation, such as physical (high pressure, ionizing rays, pasteurization,
sterilization, freezing, refrigeration, etc.) and chemical treatments (nitrites, sulphites, etc.). These applications
often compromise the food quality, modifying sensorial and structural characteristics. Further problems are
related to the use of chemical preservatives, due to their potential negative effect on human health. These data
encourage the research for applicable alternatives, in particular those based on the use of biological agents
known for their safety. Accordingly, the use of bacterial strains as protective cultures (PCs) seems to be a
promising way to promote new categories of foods such as the bio-products, including natural compounds that
may play preservative role. Lactic acid bacteria (LAB) represent a microbial group widely investigated and used
as microbial starter in fermented foods because of their high production of organic acids able to improve
sensorial characteristics. LAB can also be used in food preparations for their antimicrobial activity against
pathogenic and undesired microbial species. Different LAB strains produce several natural antimicrobial
compounds, including organic acids (lactic acid, acetic acid, formic acid, caproic acid) carbon dioxide, hydrogen
peroxide, diacetyl, ethanol, bacteriocins and bacteriocin-like inhibitory substances (BLIS). Bacteriocins from
LAB represent an heterogeneous group of peptides produced or modified through the ribosomal synthesis,
released into extracellular environment and active against several pathogen and spoilage microorganisms. They
were classified into three classes (Nes et al. 1996) on the basis of common characteristics: i) lantibiotics (class I,
e.g. Nisin), ii) small heat-stable peptides (class II, e.g. pediocin) and iii) large heat-labile proteins (class III, e.g.
helveticin). Bacteriocins have generally a very specific bacteriocidal action through the dissipation of internal
proton motive force (Chung et al. 2000) causing an arrest of !pH and !" (transmembrane electrical potential)
and are effective at very low concentration. In the last years different Authors studied the application of purified
bacteriocins and/or bacteriocinogenic strains in unfermented food preservation. Lactobacillus curvatus CRL705
showed a positive influence in the final safety and quality of meat during its storage under chill and vacuum
conditions (Fadda et al. 2008). Lactococcus lactis DPC 3147, a lacticin 3147 producer, showed good results in
fresh pork sausages (Scannell et al. 2000). Rodgers (2003) demonstrated the ability of 10 #g/g purified nisin to
inhibit pathogen species. Also 4 mg/g of cell dry mass of reuterin, produced by Lactobacillus reuteri (Luthi-
Peng et al. 2002) resulted adequate to inhibit pathogens.
Challenge studies for PCs application in food systems include numerous tests, first of all the selection of strains
based on their ability to inhibit in vitro undesired (pathogen and spoilage ) microorganisms. Subsequently, the
antimicrobial activity have to be confirmed in vivo for industrial applications.
Stress conditions, such as heat shock, cold shock, acid shock, salt stress and starvation, can induce a microbial
stress-response that involves, in numerous cases, the microbial synthesis of new proteins and/or the repression of
other ones. Microorganisms, through these mechanisms, are able to adapt themselves in difficult environments,
and then to survive harsh conditions. The knowledge of stress response in lactic acid bacteria could open new
possibility of practical application for stress-resistant strains, for instance of new strains which could become
useful in medicine and industry. Both genomic and proteomic techniques represent powerful tools in order to
investigate this interesting topic. In conclusion, the use of protective cultures in foodstuff products may play an
15
th
350
15
th
important role in food preservation in order to decrease or eliminate the practice of chemical additives.
Moreover, considering the potential probiotic activity of several LAB, the use of cultures with both probiotic and
protective proprieties could represent an important goal for the food industry, involved in the definition of
healthy and minimally processed foods.
Within the overall objective mentioned above, this PhD thesis project can be divided into the following activities
A1) Bibliographic research and State-of-the-Art.
A2) Selection of strains for food application to be used as PCs. This step concerns a selection of strains
among those belonging to the DiSTAAM collection and previously isolated by different foods. The
selection will be based on phenotypic studies such as grow capacity at different temperatures, pH, salt
concentration, atmosphere conditions, maintenance of stability and functionality after freeze- and spray-
drying and inhibitory effect using the spot-on-the-lawn assay in the agar. At the same time, strains will be
subjected to proteomic studies with different technologies (e.g. Micro-fluidics separation technology, 2D-
Electrophoresis) in order to investigate protein expression of strains adapted in different grow condition.
A3) Characterization of strains by genetic (DGGE, specific-PCR) and proteomic techniques.
A4) Antimicrobial activity tests for the detection of inhibitory activities against indicator species (e.g. Listeria
spp.). For this purpose, conventional techniques such as the well diffusion assay will be adopted.
Furthermore, in this step several tests will be carried out for the determination of the Minimum inhibitory
concentration (MIC). An hypothetical bacteriogenitic activity will be detected with proteolytic enzymes in
a liquid medium and characterized by electrophoretic techniques.
A5) PCs antimicrobial test in vivo against pathogenic bacteria in food preparations.
A6) Writing and Editing of PhD thesis, scientific papers and oral and/or poster communications.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) State-of-the-Art
A2) Strains selection
1) Phenotypical studies
2) Spot-on-the-lawn assay
3) 2D-Electrophoresis
A3) Strains characterization
1) DGGE and specific-PCR
2) SDS-PGE
A4) Antimicrobial activity tests
1) Well diffusion assay
2) MIC determination
A5) Food antimicrobial tests
A6) Thesis preparation
Chung HJ, Montville TJ, Chikindas ML (2000) Nisin depleted ATP and proton motive force in mycobacteria.
Lett Appl Microbiol 31(6):416-421.
Fadda A, Chambon C, Champomier-Vergs MC, Talon R, Vignolo G (2008) Lactobacillus role during
conditioning of refrigerated and vacuum-packaged Argentinean meat. Meat Sci 79:603-610.
Lthi-Peng Q, Schrer S, Puhan (2002) Production and stability of 3-hydroxypropionaldehyde in Lactobacillus
reuteri. Appl Microbiol Biot 60:73-80.
Nes IF, Diep DB, Hvarstein LS, Brurberg MB, Eijsink V, Holo H (1996) Biosynthesis of bacteriocins in lactic
acid bacteria. Antonie van Leeuwenhoek 70:113-128.
Rodgers S, Peiris P, Casadei G (2003) inhibition of nonproteolytic Clostridium botulinum with lactic acid
bacteria and their bacteriocins at refrigeration temperatures. J Food Prot 66:674-678.
Scannell AGM, Ross RP, Hill C, Arendt EK (2000) An effective lacticin biopreservative in fresh pork sausage. J
Food Prot 63:370-375.
15
th
351
15
th
Selection of lactic acid bacteria and yeasts to be used as mixed starter
cultures for table olive fermentation.
Giorgia Perpetuini (gperpetuini@unite.it)
Dept. Food Science, University of Teramo, via C.R. Lerici,1 Mosciano SantAngelo (TE), Italy
Tutor: Prof. Aldo Corsetti
This PhD thesis research project is aimed at setting up a mixed starter culture based on lactic acid bacteria and
yeasts for table olive fermentation. Biotechnological characteristics of strains isolated from fermented olives and
brines as well as co-culture performances will be studied at laboratory and pilot-plant scale. The final aim of the
project is to obtain one or more starter cultures to apply in standardized protocols in order to drive the
fermentation process toward high quality products with repeatable characteristics.
Selezione di batteri lattici e lieviti per la realizzazione di colture starter per la
fermentazione di olive da tavola.
Questo progetto di dottorato ha come obiettivo la messa a punto di uno starter misto, costituito da batteri lattici e
lieviti, per la fermentazione delle olive da tavola. Verranno valutate le caratteristiche biotecnologiche di ceppi
isolati dalle olive fermentate e dalle rispettive salamoie sia in coltura singola che in co-coltura, in fermentatori a
scala di laboratorio e in impianto pilota. Il progetto ha come obiettivo finale la realizzazione di una o pi colture
starter per la fermentazione di olive da tavola al fine di ottenere un prodotto di qualit con caratteristiche
ripetibili.
1. State-of-the-Art
Table olives are traditional fermented vegetables of the Mediterranean countries, but their production and
consumption are now spread all around the world. The olive fruit is a drupe with a complex chemical
composition. Among polyphenols it contains bitter compounds (e.g. oleuropein and other secoiridoids) which
prevent olives from being consumed directly from the tree and have promoted a series of processes to make
olives eatable (Tassou et al., 2002). Most fermentation processes of table olives start spontaneously and are
strongly influenced by the olive cultivar itself, the state of fruit ripening and its chemical composition,
indigenous microbiota as well as process parameters such as fermentation temperature and salt concentration of
the brine (Tassou et al., 2002). Nevertheless, spontaneous fermentation can lead to unpredictable and scarcely
repeatable results. To better control the process, the inoculation of brine with selected strains could open
interesting perspectives as already demonstrated for many fermented foods (e.g. cheese, meat, wine, sourdough
bread). Different lactic acid bacteria (LAB) and yeasts strains are commonly used as starter culture. Among
LAB, Lactobacillus plantarum and Lb. pentosus strains commonly dominate the table olive fermentation
process. Many strains show !-glucosidase and esterase activity involved in the hydrolysis of oleuropein (Servili
et al., 2008). Regarding yeasts, they can play a double role: during the fermentation it lies in the production of
desirable volatile compounds and metabolites that improve the flavor properties of the final product, the
enhancement of LAB growth by the release on nutritive compounds, killer activity against spoilage yeasts. On
the other hand, yeasts may cause gas pocket formation because of excessive CO
2
production at the early stage of
fermentation, softening of the olive tissue or, at the stage of packaging, package bulging, clouding of the brines,
softening, production of off flavors and odors (Hurtado et al., 2008).
Thus, the establishment and assessment of LAB and yeast strains giving defined biotechnological performances
is expected to have a fundamental impact on the overall quality of table olives but harnessing and exploiting
microbiota useful traits require fundamental knowledge on their ecology, physiology, biochemistry and
molecular biology.
Within the overall objective mentioned above this PhD thesis project will include the following activities as
reported in the Gantt diagram given in Table 1:
A1) Bibliographic research.
A2) Isolation and identification of LAB and yeasts: microorganisms isolated from different olives/brines will
be identified by phenotypic and genotypic methods.
A3) Molecular and biotechnological characterization of strains: strains will be typed by using molecular
methods based on PCR (e.g. PCR-RAPD), tested for !-glucosidase, esterase and lypolitic activity,
characterized for their technological properties (e.g. tolerance to NaCl and acidity, capability to growth and
dominate in brines, organic acids and other metabolite release, bacteriocin production) as well as metabolic
15
th
352
15
th

activities with potential impact on human health (e.g. biogenic amine production, impact on polyphenols
profile).
A4) Determination of gene expression: interesting genes involved in table olive fermentation will be studied
by Real-Time PCR.
A5) Development of culture independent methods: in order to evaluate the microbial population dynamics
during table olive fermentation Real-Time PCR and PCR DGGE will be applied.
A6) Stress response analysis of LAB involved in table olive fermentation: this analysis will be performed
using 2D-PAGE.
A7) Starter culture selection and establishment of experimental conditions: selected strains (individually or
in co-culture) will be tested in synthetic- and semi-synthetic media (e.g. brine-based) in order to establish
exogenous and endogenous parameters for fermentation (e.g. pH, NaCl concentration, addition of
carbon/nitrogen sources, temperature, time).
A8) Chemical and microbiological monitoring of experimental fermentations: carbohydrate consumption,
organic acid release, phenolic compounds profile will be evaluated by HPLC; microbial dynamics will be
evaluated by culture dependent as well as culture independent techniques.
A9) Pilot-scale fermentation: selected starter with promising characteristics as evaluated during experimental
laboratory fermentations will be evaluated at pilot-plant scale and monitored by using the chemical-
microbiological procedures as defined above..
A10)Writing and Editing of the PhD thesis, scientific papers and oral and/or poster communications.

Activities Months

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36
A1) Bibliographic research

A2)
Isolation and identification of
LAB and yeasts

A3)
Biotechnological and
molecular characterization of
strains

A4)
Determination of gene
expression

A5)
Development of culture
independent methods

A6)
Stress response analysis of
LAB

A7)
Starter culture selection and
establishment experimental
conditions

A8)
Chemical and microbiological
monitoring of experimental
fermentations

A9) Pilot-scale Fermentation


Hurtado A, Reguant C, Esteve-Zarzoso B, Bordons A, Rozs N (2008) Microbial population dynamics during
the processing of Aberquina table olives. Food Res. Int. 41: 738-744.
Servili M, Minnocci A, Veneziani G, Taticchi A, Urbani S, Esposto S, Sebastiani L, Valmorri S, Corsetti A
(2008) Compositional and tissue modifications induced by the natural fermentation process in table olives. J.
Agric. Food Chem. 56: 6389-6396.
Tassou CC, Panagou EZ, Katsaboxakis KZ (2002) Microbiological and physicochemical changes of naturally
black olives fermented at different temperatures and NaCl levels in the brines. Food Microbiol. 19: 605-615.
15
th
353
15
th
Biotechnology, University of Napoli I Federico II, Potici, 15-17 September, 2010

Evolution of thiol related odours in wine during ripening and storage in
relation to glutathione content
Federico Piano (federico.piano@unimi.it)
Dept of Food Science, Technology and Microbiology, University of Milan, Milan, Italy
Co-tutor: Dr. Daniela Borsa (CRA-ENO Centro di Ricerca per lEnologia, Asti, Italy)

The aim of this PhD thesis is the characterization of some thiol components belonging to grapes and wines. The
aromatic compounds will be considered both as free molecules and precursors: as for molecular components,
they will be studied during grape ripening, winemaking process and aging of wine. Moreover, the evaluation of
various enological and viticultural practices on such components in grapes and wines will be objectives of this
research.
Valutazione dell'evoluzione aromatica di uve ad aroma tiolico in relazione al tenore in
glutatione
Lo scopo di questo progetto di dottorato la caratterizzazione di componenti tioliche di uve e vini. Le
componenti aromatiche saranno valutate sia come precursori che come molecole libere; i composti aromatici
saranno considerati nel corso della maturazione delle uve, la vinificazione e laffinamento dei vini. Inoltre la
valutazione delle pratiche enologiche sul contenuto in composti solforati di uve e vini sar un obiettivo di questo
lavoro di ricerca.
1. State-of-the-art
Although many volatile compounds are known to be involved in wine aroma, only few of them seem to be
responsible for the specific aroma of different varieties. In spite of their trace concentration some thiol molecules
play a key role in aromatic expression of wines. Such compounds arise from non-volatile precursors contained in
grape and they are characterized by both intense smelling properties and odour thresholds at nanograms per liter
level. A few of these volatile and semivolatile thiols, specifically 4-mercapto-4-methylpentan-2-one (4MMP), 3-
mercaptohexyl acetate (A3MH) and 3-mercaptohexan-1-ol (3MH), occur at trace concentrations and are
responsible for box tree, exotic fruit and grapefruit aroma. They have been identified in numerous wines
produced from different varieties such as the Sauvignon Blanc, Colombard, Merlot and Cabernet Sauvignon
(Tominaga T. et al., 2000).
Many other thiols, especially benzenemethanethiol, 3-sulfanylhexan-1-ol and 2-furanmethanethiol are involved
in the aromatic profile of various wines.
Aroma related thiols (4MMP, A3MH and 3MH) are released during alcoholic fermentation by the degradation of
the S-Cysteine (S-Cys) conjugates precursors performed by yeasts carbon-sulphur lyases (Peyrot des Gachons
C. et al., 2002).
The identification of S-Glutathione (S-Glu) conjugates (Fedrizzi B. et al.,2009) in must suggests that the S-Cys
conjugate could derive from S-Glu precursor after the elimination of glutamic acid and glycine. Moreover the
measurement of glutathione in grapes shows an increase in this tripeptide at the onset of ripening in berries
(Adams D.O & Liyange C., 1993).
Important thiol properties such as their accumulation in grapes, their release in wine, their precursor
characteristics, their accumulation in grapes and their biosynthetic pathways have to be elucidated.
The analysis of volatile or semivolatile thiols in wine is difficult because of their low concentration, their
sensitivity to oxidation and their high reactivity with grape and wine concompents (e.g. quinones, copper ions).
A few gaschromatography methods have been reported in the scientific literature for the analytical determination
of the thiol related odours in wine described . The most commonly used methods are based on the extraction of
mercaptans from wine (liquid-liquid extraction or solid phase extraction) followed by the formation of a
reversible complex of thiols with p-hydroxymercurybenzoate (Schneider R. et al., 2003). Derivatization of such
thiols using pentafluorobenzyl molecules as derivative agent is the main topic of some other methods developed
(Rodriguez-Bencomo J.J. et al., 2009).
The features described above will be explored in this thesis work with the aim of studying thiol compounds both
as precursors during grapes ripening in order to elucidate their biogenetic pathways and their release and
behaviour in winemaking. Knowledges about the mechanism implicated in the reactivity, genesis and loss of
such compounds should be elucidated.
15
th
354
15
th
Biotechnology, University of Napoli I Federico II, Potici, 15-17 September, 2010

Within the overall objective mentioned above, this PhD thesis project can be subdivided into the following
A1) Development of analytical methods in wine-like and must-like model-systems in order to obtain more
sensible and reproducible methods for specific components.
A2) Studies on thiol components in grapes and wines to assess thiol concentration in various steps of grape
ripening, winemaking and aging of wines..
A3) Evaluation of possible biogenetic pathways concerning studies on putative precursors storage and studies
on aroma release and formation.
A4) Studies on aromatic compounds-wine components (or fining agents) interaction in order to assess the
diversity of the mechanisms implicated in the reactivity leading to genesis or loss of thiol compounds.
Table 1. Gantt diagram for this PhD thesis project.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1)
Development of analytical methods in
wine-like and must-like model systems

Setting up of methodologies for
aromatic thiol compounds identification

Setting up of methodologies for
glutathione and sulphur containing
amino acid identification

A2)
Studies on thiol components in grapes
and wines

Identification and quantification of
aromatic thiol compounds

Quantification of glutathione and
sulphur containing amino acid

A3)
Evaluation of possible biogenetic
pathways

Studies on precursors storage in berries

Studies on aroma release and formation
in wines

A4)
Studies on aromatic compounds-wine
components (or fining agents)
interactions

Setting up of assays in wine-like model
system

Investigation on thiol reactivity in wines
Adams D.O. and Liyanage C. (1993). Glutathione increases in grapes berries at the onset of ripening. Am. J.
Enol. Vitic., 44, 3, 333-338.
Fedrizzi B., Pardon K. H., Sefton M. A., Elsey G. M., Jeffery D. W. (2009). First Identification of 4-S-
Glutathionyl-4-mehylpentan-2-one, a potential Precursor of 4-Mercapto-4-mehylpentan-2-one, in Sauvignon
Blanc Juice. J. Agric. Food Chem., 57, 991-995.
Peyrot des Gachons C., Tominaga T. and Dubourdieu D. (2002a). Sulfur aroma precursor present in S-
glutathione coniugate form : Identification of S-3-(Hexan-1-ol)-glutathione in must from Vitis vinifera L. cv
Sauvignon blanc. J. Agric. Food Chem., 50, 4076-4079.
Rodrguez-Bencomo J.J., Schneider R., Lepoutre J.P., Rigou P. (2009). Improved method to quantitatively
determine powerful odorant volatile thiols in wine by headspace solid-phase microextraction after derivatization.
J. of Chrom. A, 1216, 5640-5646.
Schneider R., Kotseridis Y., Ray J.-L., Augier C., Baumes R. (2003). Quantitative Determination of Sulfur
Containing Wine Odorants at sub Parts per bilion Levels. 2. Developement and Application of a Stable Isotope
Diluition Assay. J. Agric. Food Chem., 51, 3243-3248.
Tominaga T., Baltenweck-Guyot R., Peyrot des Gachons C. and Dubourdieu D. (2000). Contribution of volatile
thiols to the aromas of white wines made from several Vitis vinifera Grape varieties. Am. J. Enol. Vitic., 51, 178-
181.
15
th
355
15
th
Study of the aggregation of casein micelles in raw milk by combined
analytical techniques
Gianluca Picariello (picariello@isa.cnr.it)
Dipartimento di Scienza degli Alimenti, Universit di Napoli Federico II
Tutor: Prof. Francesco Addeo

Main aim of the PhD thesis project is the structural characterization of casein micelles from milk of
different species to provide information related to the technological and nutritional functions of milk. To this
purpose, an innovative approach based on native mono- and two- dimensional electrophoresis/mass spectrometry
will be developed. In addition casein micelles will be targeted by specifically designed antipeptide antibodies in
immunochemical tests to detect predetermined whey-exposed casein sequence stretches. The structure of
micelles will be defined in terms of prevalent aggregation amongst the four casein families taking into account as
a reference sample the !
s1
-casein null (0) allele goat milk.

Studio dellaggregazione delle micelle caseiniche nel latte fresco mediante tecniche
analitiche integrate
Il presente progetto di tesi di dottorato ha come principale obiettivo la caratterizzazione della struttura di
micelle di caseine da latte di diverse specie per ottenere informazioni sugli aspetti nutrizionali e tecnologici del
latte Saranno sviluppate ed applicate tecniche di elettroforesi mono- e bi-dimensionali in condizioni native
combinate con la spettrometria di massa. Le micelle saranno marcate con anticorpi anti-peptide opportunamente
prodotti, per individuare i domini caseinici esposti al solvente. La struttura delle micelle verr definita in termini
di interazioni prevalenti fra le quattro famiglie caseiniche, prendendo come riferimento micelle da latte di capra
con allele nullo per l !
s1
-caseina.
1. State-of-the-Art
The colloidal supramolecular assemblies known as casein micelles constitute the bulk mass of milk. The amino
acid sequence of the constitutive !
s1
-, !
s2
-, "- and #-casein fractions is well known for several species, while the
intimate arrangement of the casein families and their networks with colloidal calcium phosphate (CPP) remain to
some extent controversial. A large number of models have been devised for casein micelles, among which the
most important are depicted in Table 1 (Walstra, 1990; Home, 2006). The high-resolution physico-chemical
imaging techniques have provided direct images of the casein micelles (Dalgleish et al., 2004), demonstrating
that they are structurally non-homogeneous and polydisperse aggregates with diameter in 150-300 nm range.
Therefore, each milk micelle could be of different structure and described by its own peculiar composition.
Casein micelle have also been proved to be more complex than a sphere covered by a hairy layer; rather micelles
appear organized as an entangled network of protein tubules protruding to the exterior, spaced by large gaps,
creating an extremely diffuse boundary with the surrounding medium. Although a number of experimental
observations substantiate the mechanisms of #-casein segregation, the kinetics aggregation of the submicelles by
the CPP, which in turn have nutritional significance, the stability acquired by the casein micelle is a still
unsettled question especially for that concerns the technological implications. By a technological point of view,
the casein micelle arrangement plays a major role in the milk coagulation, conditioning the consistency of dairy
products.
In the last decade, techniques based on mono- and two-dimensional electrophoresis in native conditions have
been developed to characterize protein complexes assembled through non-covalent interactions (Wittig and
Shagger, 2009). One of the initial activities of this PhD thesis project will be the direct characterization of the
casein micelles by a native electrophoresis approach combined with the mass spectrometry identification of the
individual caseins engaged into the formation of micelle aggregates. An attractive alternative to mark the
externally exposed casein families is the of use immunochemical techniques (Johansson et al., 2009). Goat milk,
!
s1
-casein null (0) allele will be considered as a reference sample. One of the objectives of the current study is to
raise an already available panel of antipeptide antibodies against the single casein stretches in order to label
putative epitopes of the parent caseins on the micelle surfaces. A further action will consist in determining the
aggregation of caseins by using bifunctional reagent as cross-linkers to fasten casein units in their site of
emplacement. Interacting casein units will be identified by fingerprinting tryptic maps using mass spectrometry.
The ultimate objective of the present PhD Dissertation Project is the direct characterization of the casein micelles
using a series of analytical techniques to discover the intimate aggregation of the casein fractions.

15
th
356
15
th

Table 1. Scheme of the casein micelle structure models.
Models Essential traits Note
Subunit models
15-20 casein subunits assemble into submicelles, which
super-aggregate through hydrophobic interactions and CPP
linkages. Micelles are coated by !
s1
- and k-casein.
The submicelles are not all the
same. Essentially they are of two
major types, with or without k-
casein
Coat-core models
Micelle core is a framework of !
s1
-caseins which are
encircled by complex particles of "- , !
s1
-caseins and
comparatively high proportion of #-casein
No specific role for CCP in the early
models
Internal structure models
Hydrophobic interaction is the driving force for the formation
of casein micelles. Aggregates of "-casein act as the
nucleation point for !
s1
-casein attachment. Electrostatic
repulsion is the factor limiting growth of aggregates.
CPP act as a neutralizer of the
negative charge of phosphoserine.
Caseins inhibit CPP precipitation.

To accomplish the objectives of the present PhD Disseration Project above exposed the activities will be
subdivided according to the Gantt diagram given in Table 2:
A1) Sampling and micelle pre-fractionation. After milk sampling, micelles will be fractionated by
ultracentrifugation to reduce the range of polydispersity
A2) Assessment of micelle stability. The micelle stability will be assayed in several buffers optimized for
carrying out the native electrophoresis separation.
A3) Native electrophoresis of casein micelles. Conditions for the 1D-native electrophoresis of micelles will be
optimized. Then, micelles will be separated also in 2D-electrophoresis under denaturing conditions.
A4) Mass Spectrometry (MS) identification of casein components. Casein bands from 2D electrophoresis will
be identified by MS after excision and tryptic digestion.
A5) Alternative analytical approaches to determine the intimate assembly of caseins in micelles. A panel of
antipeptide antibodies will be raised against micelles in immunochemical and ELISA tests. Furthermore,
interacting caseins will be cross-limked bifunctional reagents and identified by MS.
A6) Extension of the analytical approach. The optimized analytical approach will be extended to the
characterization of micelles from different milk species (buffalo, goat, sheep and possibly human milk).
A7) Writing and Editing of the PhD thesis, scientific papers and oral and/or poster communication.

Table 2. Gantt diagram for the present PhD thesis project.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) Sampling and pre-fractionation
1) Sampling
2) micelle pre-fractionation
A2) Assessment of micelle stability
1) Stability assessment in buffers
A3) Native electrophoresis
1) 1D native electrophoresis
2) 2D native/SDS electrophoresis
A4) Mass spectrometry (MS)
MS identification of caseins
A5) Alternative analytical approaches
1) immunochemical tests (antibodies)
2) cross-link by bifunctional reagents
A6) Extension of the analytical approach
Micelles in milk from other species

Dalgleish DG, Spagnuolo AP, Goff HD. (2004) A possible structure of the casein micelle based on high-
resolution field-emission scanningelectron microscopy. Int. Dairy J. 14: 1025-1031.
Horne DS (2006) Casein micelle structure: Models and muddles. Curr. Opin. Colloid Interface Sci. 11: 148-153
Johansson A, Lugand D, Rolet-Rpcaud O, Moll D, Delage MM, Peltre G, Marchesseau S, Lonil J, Dupont D
(2009) Epitope characterization of a supramolecular protein assembly with a collection of monoclonal
antibodies: The case of casein micelle. Mol. Immunol. 46: 10581066
Walstra P (1990) On the Stability of Casein Micelles. J. Dairy Sci. 73:1965-1979
Wittig I, Schagger H (2009) Native electrophoretic techniques to identify proteinprotein interactions.
Proteomics 9: 1-10
15
th
357
15
th
Biotechnology, University of Napoles Federico II, Portici, 15-17 September, 2010
Identification of inflammatory proteins in milk and derived products as
direct molecular markers of generic diseases in ruminants
Gabriella Pinto (gabriella.pinto@unina.it)
Dept. Food Science, University of Naples Federico II, Italy
Tutor: Professor Francesco Addeo
The present PhD thesis research project aims to set up a immunochemical procedure capable to relate generic
inflammatory diseases of ruminants to milk protein marker(s) and proteolytic profile of casein, whey and derived
products. Identification of signatures peptides by HPLC and mass spectrometry will provide a means to obtain
synthetic peptides mimicking the natural peptides for raising anti-peptide antibodies and internal standards to
quantify the inflammatory proteins of interest.
Identificazione di marcatori proteici indicatori di flogosi nel latte dei ruminanti e nei
prodotti derivati
Il presente progetto di tesi di dottorato mira a mettere a punto un metodo immunochimico per rilevare nel latte
malattie infiammatorie dei ruminanti attraverso marcatori proteici (peptidici) e deducendo la loro presenza anche
sulla base del profilo proteico delle caseine, delle proteine del siero e dei prodotti derivati. Lidentificazione di
marcatori peptidici mediante HPLC e spettrometria di massa permetter di ottenere peptidi triptici sintetici simil-
naturali per la produzione di anticorpi anti-peptide e di standard interni per la quantificazione delle proteine di
interesse.
1. State-of-the-Art
The increased attention for food safety has prompted public authorities to pay greater interest to milk quality.
Mastitis is one of the most frequent diseases characterized by an inflammatory state of the mammary gland. As a
consequence, an increased somatic cell counts (SCC) (neutrophils, macrophages, lymphocytes and a smaller
number of epithelial cells) and proteolytic enzyme activity in milk have been observed (Sorbillo et al., 1997). In
the last years, the attention has been increasingly turned on mastitis determining the proteolytic degradation of
casein (Verdi et al., 1987). High SCC greatly decreased milk production and cheese yield due to higher casein
peptides losses in the whey. Moreover, the global phosphorylation level declined as effect of the increased
activity of alkaline phosphatase (ALP) in udders affected by subclinical (or clinical) mastitis. A higher ALP
proportion was transferred from blood to milk owing to the damage of blood-milk barrier by infection (Babei et
al., 2007). However, a few data are available for serum amyloid A (SAA) and milk mastitis. The recent
recognition that acute phase proteins (APPs) are produced in the mammary gland in response to bacterial
infections that cause bovine mastitis has stimulated their detection (Eckersall, 2004). In cattle, concentration of
APPs such as SAA and haptoglobin (Hp) increased particularly in response to the generic acute inflammatory
conditions as well as to subclinical inflammation (Gabay et al., 1999). SAA is primarily produced in the liver but
is also produced extrahepatically by macrophages, smooth-muscle cells and endothelial cells. Hepatically
derived bovine amyloid A (SAA) and mammary-derived bovine amyloid A (MAA) consist of two proteins that
share 83% amino acid sequence identity (McDonald et al., 2001). APPs become marker proteins in mammary
inflammation. Concentrations of SAA and Hp are higher in milk from infected quarters. The higher
concentrations of milk APPs from infected quarters could be due either to their production within the gland or to
their leakage across the blood-milk barrier as a result of its disruption by the inflammation, or to a combination
of these mechanisms. It has been shown that the permeability of the blood-milk barrier increases during episodes
of mastitis allowing serum proteins to gain access to the milk (Shuster et al., 1997). Extra-mammary
inflammatory processes that induced an increased concentration of SAA and Hp in the serum were not
accompanied by a parallel increase of concentration in milk (Nielsen et al., 2004). Another study did not
demonstrate significant differences in serum SAA and Hp concentrations in cows grouped according to SCC
thresholds (Kov et al., 2007).
The main aim of this PhD thesis is to obtain identification and quantification of some molecular markers of
major APPs including SAA and Hp in dairy products as drinking milk, whey, Ricotta cheese and pasta filata
cheese, and set up a simple immunochemical procedure. In this manner, the different stages of mastitis will be
defined through a molecularly-based characterization of bulk milk proteins (peptides).
Within the proposed objectives, this PhD thesis project can be subdivided into the following activities according
15
th
358
15
th
Biotechnology, University of Napoles Federico II, Portici, 15-17 September, 2010
to the Gantt diagram given in Table 1:
A1) Evaluation of the proteolytic profile and the phosphorylation level of milk proteins in relation to
SCC; mastitis staging using different casein peptides and some posttranslational modifications.
A2) Identification of peptide markers for inflammation in milk and derived products; identification in
Data Bank archives of the parent protein using LC-ESI-MS/MS peptide sequence.
A3) Setting up ELISA tests to evaluate the inflammatory proteins in dairy products using polyclonal anti-
peptide antibodies.
A4) Analysis of the variations of inflammatory proteins in milk at different mastitis stages and their
repartition within derived products.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1)
Milk protein at different mastitis
stages

1) Protein hydrolysis profiling
2) Protein phosphorylation profiling
A2) Identification of peptide markers
1) Peptide identification
2) Parent protein identification
A3) ELISA tests
1) Preparation of synthetic peptides
for polyclonal anti-peptide antibodies

2) ELISA tests
A4)
Analysis of the variations of
inflammatory proteins

1) Concentration in milk
2) Concentration in derived products
Babaei H, Mansouri-Najand L, Molaei MM, Kheradmand A, Sharifan M (2007) Assessment of lactate
dehydrogenase, alkaline phosphatase and aspartate aminotransferase activities in cows milk as an indicator
of subclinical mastitis. Veterinary Research Communications 31: 419-425.
Eckersall PD (2004) The time is right for acute phase protein assays. Veterinary Journal 168: 3-5.
Gabay C, Kushner I (1999) Acute-phase proteins and other systemic responses to inflammation. New England
Journal of Medicine 340: 448-454.
Kov G, Popelkov M, Tkikov , Burdov O, Ihnt O (2007) Interrelationship between somatic cell count
and acute phase proteins in serum and milk of dairy cows. Acta Vet. Brno 76: 51-57.
McDonald TL, Larson MA, Mack DR, Weber A (2001) Elevated extrahepatic expression and secretion of
mammary-associated serum amyloid A 3 (M-SAA3) into colostrum. Veterinary Immunology and
Immunopathology 83: 203-211.
Nielsen BH, Jacobsen S, Andersen RH, Niewold TA, Heegaard PMH (2004) Acute phase protein concentrations
in serum and milk from healthy cows, cows with clinical mastitis and cows with extramammary
inflammatory conditions. Veterinary Record 154: 361-365.
Shuster DE, Kehrli ME Jr, Rainard P, Paape M. (1997) Complement fragment C5a and inflammatory cytokines
in neutrophil recruitment during intramammary infection with Escherichia coli. Infection and Immunity 65:
3286-3292.
Sordillo LM, Shafer-Weaver K, DeRosa D (1997) Immunobiology of the mammary gland. Journal of Dairy
Science 80: 1851-1865.
Verdi RJ, Barbano DM, Dellavalle ME, Senyk GF (1987) Variability in true protein, casein, nonprotein nitrogen,
and proteolysis in high and low somatic cell milks. J. Dairy Sci 70: 230-242.
15
th
359
15
th
Application of Spectroscopic Techniques for Monitoring Biotransformation
Processes using Lactobacillus plantarum in Optimising Milk Whey
Destination
Maria Chiara Remagni (maria.remagni@unimi.it)
Dept. Food Science and Technology, University of Milan, Milan and CRA-FLC, Lodi, Italy
Tutor: Prof. Diego Mora
Co-Tutor: Dott.ssa Tiziana M.P. Cattaneo, Dott. Domenico Carminati
Whey disposal is one of the main problems for dairy industry due to its content of lactose. An interesting way to
upgrade this waste could be its use as a substrate for fermentation using lactic acid bacteria, particularly
Lactobacillus plantarum, recognized as a potential probiotic. These characteristics suggest the optimisation of a
biotransformation process able to convert lactose to lactic acid for the development of new products with added
value. This study aims to develop a control system for monitoring fermentation using NIR techniques,
recognised as rapid and accurate methods to also correct as quickly as possible anomalies during the process.
Impiego di Lactobacillus plantarum per la Valorizzazione del Siero di Latte e
Monitoraggio del Processo di Trasformazione mediante Tecniche Spettroscopiche
Lo smaltimento del siero rappresenta un problema a causa del suo elevato contenuto in materia organica. Per
ridurre il problema, il reimpiego del siero come substrato di fermentazione ad opera di batteri lattici, per la
produzione di acido lattico una delle modalit studiate ed applicate in particolare di Lactobacillus plantarum.
Per questo motivo, il presente progetto di dottorato ha come scopo quello di valutare la capacit fermentativa di
questa specie e di sviluppare un sistema di controllo per il monitoraggio del processo fermentativo utilizzando
tecniche NIR, in grado di fornire risposte rapide che consentono la possibilit di intervenire tempestivamente
durante il processo.
1. State-of-the-Art
The dairy industry generates significant liquid waste, whose disposal requires a large amount of capital
investment. The majority of total milk used for manufacturing cheese is discarded as whey, which retains a lot of
nutrients. The most abundant nutrients are lactose, soluble proteins, lipids and salts. The disposal of whey as
waste can have a high environmental impact. To overcome this problem, a better alternative can be to process
whey in obtaining new added value products (Parnesar et al., 2007).
Whey contains approximately 4.5% lactose, 0.8% proteins, 1% salts and 0.1-0.8% lactic acid. Availability of
high amount of lactose in whey and the presence of other essential nutrients for LAB growth become whey a
potent raw material for the production of different bio-products through biotechnological means, such as
fermentation processes.
Lactic acid bacteria (LAB) are Gram positive, non-spore forming, catalase negative, non-motile,
microaerophilic, rod or cocci that ferment sugars to mainly produce lactic acid.
Among LAB, selected species of the Lactobacillus genus are widely used as probiotic primary in dairy products.
Probiotics are defined as active microorganisms that show health benefits for the host by improving the
properties of indigenous microbial community when consumed in adequate amounts. They should have
technological characteristics to allow their production on large scale and their incorporation into food products
without losing viability and functionality but, at the same time, without creating unpleasant flavours.
One of this species, Lactobacillus plantarum, is industrially important and is involved in many vegetable
fermentations as well as being a frequent inhabitant of the human intestinal tract (Brinques et al., 2010).
Some Lactobacillus plantarum strains are presently on market as probiotics. High acid tolerance is an important
feature that prevents contamination during fermentation processes. L. plantarum is a fair lactic acid producer. In
recent years, there has been growing interest in the use of L. plantarum for many applications: its biomass and its
secondary metabolites, produced during fermentation processes, could be used as probiotic carriers in many
foodstuffs (Fu et al., 1999).
For accurate control of fermentation processes, it is very important to fast monitor both substrate and product
concentrations during incubation.
Use of Near InfraRed Spectroscopy (NIRS) offers the possibility of rapid sample monitoring with results
available in short time compared with official methods of analysis It is a non-disruptive technique that in general
requires no sample preparation and can simultaneously measure several constituents. The main advantage in
using NIRS is its ability to monitor in real time the progress of fermentation allowing the optimization of culture
during processes. Thus, this study aims to develop a control system for monitoring fermentation using NIR
15
th
360
15
th
techniques recognised as rapid and accurate methods to also correct as quickly as possible anomalies during the
milk fermentation processes originating new added value products starting from milk whey recovery (Macedo et
al., 2002).
According to the objectives mentioned above, this PhD thesis project can be subdivided into the following
activities as written in Gantt diagram given in Table 1:
A1) Strains selection: isolation from different dairy products, potential probiotic characterization, molecular
typing and final selection of strains with different genotype;
A2) In vitro phenotype tests to monitor lactose degradation and acid lactic production using potentiometric and
spectrometric techniques in order to select strains with good acid capability;
A3) In vivo phenotype tests using bioreactor after assessing its optimal operating conditions (pH,
temperature...); on line monitoring of fermentation processes with NIR optic probes;
A4) Writing and Ending of PhD thesis, scientific papers and oral/or poster communications.
Table 1 Gantt diagram for the PhD project.
Months
Activity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) Strains selection
1) Genotype characterisations
A2) In vitro phenotpe tests
A3) In vivo phenotpe tests
1) Setting up of operating conditions

2) Monitoring fermentation processes
with NIR probe

3)Evaluation of the results
Brinques GB, do Carmo Peralba M, Zachia Ayub MA (2010) Optimisation of probiotic and lactic acid
production by Lactobacillus plantarum in submerged bioreactor system. Journal of Industrial Microbiology and
Biotechnology 37: 205-212.
Fu W, Mathews AP (1999) Lactic acid production from lactose by Lactobacillus plantarum: kinetic model and
effects of pH, substrate and oxygen. Biochemical Engineering Journal 3: 163-170.
Macedo MG, Laporte MF, Lacroix C (2002) Quantification of exopolysaccharide, lactic acid and lactose
concentration in culture broth by Near-Infrared Spectroscopy. Journal of Agriultural and Food Chemistry 50:
1774-1779
Parnesar PS, Kennedy JF, Gandhi D, Bunko K (2007) Bioutilisation of whey for lactic acid production. Food
Chemistry 105: 1-14.
15
th
361
15
th
Effects of SAR (Systemic Acquired Resistance) Inducers on Quality and
Safety of the Grape Products
Antonietta Ruggiero (antonietta.ruggiero@unimi.it)
Dept. Biomolecular Sciences and Biotechnology, Universit degli Studi di Milano, Milano, Italy
Tutor: Prof. Stefania Iametti, Dott. Marcello Iriti
The aim of this PhD project is to verify the effects of some plant activators (benzothiadiazole and chitosan) on
poliphenol, volatile isoprenoid (mono- and sesquiterpene) and phytosterol (!-sitosterol, stigmasterol and
campesterol) content in two grapevine cultivars (Groppello and Merlot cultivated in different geographical areas)
and in their respective experimental wines. In the second part of the work, the efficacy of treatments will be
assayed on the control of the potentially toxigenic grape mycoflora, by measuring the mycotoxin levels
(especially ochratoxins) in wines.
Effetti degli induttori di SAR (Systemic Acquired Resistance) sulla qualit e sulla
sicurezza alimentare della filiera viti-vinicola
Lo scopo di questo progetto di dottorato quello di verificare gli effetti di alcuni induttori di resistenza
(benzotiodiazolo e chitosano) sul contenuto di polifenoli, isoprenoidi volatili (mono- e sesquiterpeni) e fitosteroli
(!-sitosterolo, stigmasterolo and campesterolo) in due cultivar di vite (Groppello e Merlot coltivate in due
differenti aree geografiche) e nei vini sperimentali da esse derivati. Inoltre, sar studiata lefficacia dei
trattamenti nel controllo della micoflora, potenzialmente micotossinogena, delluva, e saranno misurati i livelli di
uneventuale contaminazione da micotossine (soprattutto ocratossine) nei vini.

1. State-of-the-Art
As recently emphasized during the IX International Congress of Plant Pathology (Turin, August 2008) entitled
Healthy and Safe Food for Everybody, the improvement of the qualitative aspects of crops should be
considered an integral and remarkable part of any control program of plant diseases (www.ICPP2008.org). In
this view, some typologies of phytoiatric treatments, besides protecting from pathogens, can increase at the same
time the content of plant bioactive secondary metabolites. Resistance inducers are a class of natural and synthetic
compounds registered in agriculture able to boost the plant immune system, unlike the most common pesticides,
such as fungicides, directly toxic to the pathogens. Moreover, they have generally a lower toxicological and eco-
toxicological profile than agrochemicals, while offering in some cases the opportunity to protect the plant also by
abiotic stress (Iriti and Faoro, 2007). The induced resistance to diseases is durable and unspecific, is directed
towards a broad spectrum of pathogens of different nature (fungi, bacteria, viruses, nematodes, insects, parasitic
plants), and is effective also in distal organs from where the treatment occurred. This phenomenon, defined as
systemic acquired resistance (SAR), stimulates a series of plant defense reactions, including the synthesis of
pathogenesis related proteins and phytoalexins (Gozzo, 2003). These latter, also known as nutraceuticals, are
synthesized by the plant secondary metabolic pathways of phenylpropanoids, isoprenoids and alkaloids in
response to infections, because of their antibiotic activity. The efficacy of SAR inducers in increasing the
synthesis of bioactive metabolites in different food plants is well documented. In particular, benzothiadiazole
(BTH, Bion , Syngenta) has proven to increase the content of different phytochemicals (flavonoids,
anthocyanins, stilbenes, proanthocyanidins, lycopene and melatonin) in different crops (grape, tomato,
strawberry) (Iriti et al., 2004, 2007; Hukkanen et al., 2007).
Recent epidemiological studies have attributed to some plant secondary metabolites antioxidant, cardio- and
neuroprotective properties, possibly responsible, at least in part, of the health benefits associated with adequate
and regular consumption of fruit and vegetables (Heber, 2004). At this regard, certain phytoiatric practices could
increase the content of some bioactive compounds in numerous plant foods, avoiding much more laborious and
expensive techniques of genetic engineering, not yet accepted in Italy, in order to obtain similar results. In
addition to these qualitative aspects, the use of plant activators may also be beneficial in terms of food security.
In this context, the mycotoxin contamination is an increasingly important issue in the management of grape
products. Mycotoxins are fungal metabolites present, mostly, in certain products of plant origin (flours, pasta,
wine, coffee, but also milk, yoghurt and dairy products) and produced by some toxigenic strains of specific fungi
(Aspergillus, Penicillum, Fusarium), following both field and/or post-harvest infection. Example of mycotoxins
of great interest for public health includes aflatoxins, ochratoxins, fumonisins and trichothecenes. The main
15
th
362
15
th
mycotoxin in grape products is ochratoxin A (OTA), produced mostly by Aspergillus carbonarius and A. niger,
which colonize the grapes very early, often before veraison (Hocking et al., 2007). The OTA molecule is a
phenylalanine-dihydroisocoumarin derivative, very stable to both temperature and hydrolysis. It is known to
have nephrotoxic, immunotoxic, teratogenic and carcinogenic effects, and, for these reasons, the European
Commission has fixed maximum limits in wines and other foods. The maximum permitted level for wines is
2.00 g L
-1
(CE n. 123/2005).
The objective of this research project is to evaluate the effects of treatments with some resistance inducers
(benzothiadiazole and chitosan) on the content of secondary metabolites, mainly polyphenols and isoprenoids in
grapes and wines. The effects of these treatments will be also assayed on the development of field mycoflora,
possibly mycotoxinogenic, and on the levels of mycotoxins (especially ochratoxin) in wines.
The study of secondary metabolites will be performed by specific extraction, in combination with gas
chromatography and mass spectrometry for the identification of particular chromatography peaks.
The complexity of wine samples requires a clean-up step which enable the OTA to be isolated from the matrix.
Currently, immunoaffinity columns (IAC) are recommended as sample pre-treatment. This method, followed by
high performance liquid chromatography with fluorescence detection (HPLC-FD) or enzyme-linked
immunosorbent assays (ELISA), allows the detection and quantification of OTA in wine.
The results obtained at the end of this project would contribute to the knowledge on the effects of some plant
activators in the improvement of certain aspects related to both quality and food safety of the wine products.

The overall objectives above mentioned for this PhD thesis project can be subdivided into the following
activities, according to the Gantt diagram (Table 1):
A1) Phytoiatric campaign 2010 and 2011: open field treatments, disease evaluation, sampling of grape and
experimental wine preparation.
A2) Development of a method for the polyphenol and isoprenoid extraction from experimental wines;
development of a CG/MS method for the determination of the organic volatile compounds and of the main
phytosterols.
A3) Development of a method for OTA extraction from wines; setting up of HPLC/ELISA methods for OTA
analysis.
A4) Statistical elaboration of the data obtained.
A5) Writing and editing of the PhD thesis, scientific papers and oral and/or poster communications.
Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) Phytoiatric campaign 2010 and 2011
1)Open field treatments
2)Disease evaluation
3)Sampling of grape

4)Experimental wine preparation
A2) Polyphenols and isoprenoids
1) Bibliographic research
2) Setting up extraction method
3) Setting up analytical method
A3) Ochratoxins
1) Bibliographic research
2) Setting up extraction method

3) Setting up analytical method
A4) Statistical elaboration
A5) Thesis and paper preparation
Iriti M, Faoro F (2007). Review of innate and specific immunity in plants and animals. Mycopathologia 164: 57-64.
Gozzo F (2003). Systemic acquired resistance in crop protection: from nature to a chemical approach. JAFC 51:4487-4503.
Hukkanen AT et al (2007). Benzothiadiazole induces the accumulation of phenolics and improves resistance to powdery mildew in strawberries.
JAFC 55:1862-1870.
Iriti M et al (2004). Benzothiadiazole enhances resveratrol and anthocyanin biosynthesis in grapevine, meanwhile improving resistance to
Botrytis cinerea. JAFC 52:4406-4413.
Iriti M et al (2007). Chemical-induced resistance against post-harvest infection enhances tomato nutritional traits. Food Chem 105:1040-1046.
Heber D (2004). Phytochemicals beyond antioxidation. J Nutr 134:3175S-3176S.
Hocking AD et al (2007). Fungi and mycotoxins in vineyards and grape products. Int J Food Microb 119:84-88.
15
th
363
15
th
The Role of Probiotic Microorganisms and Dietary Compounds in the
Modulation of Immune Response: a Mechanistic Approach
Valentina Taverniti (valentina.taverniti@unimi.it)
Dept. Food Science and Microbiology, University of Milan, Italy
Tutor: Dr. Simone Guglielmetti
The research project of this PhD thesis deals with probiotic bacteria and dietary components and their role in
immune responses, especially at intestinal level. The main goal of the project is the identification of bacterial and
dietary molecules determining the immunomodulating activity. To this aim, we will employ in vitro
experimental approaches such as luciferase reporter gene systems, real time quantitative PCR and ELISA tests,
to evaluate the expression of immunologic key mediators on different cell lines.
Il ruolo di microrganismi probiotici e di componenti alimentari nella modulazione della
risposta immunitaria: un approccio meccanicistico
Il progetto di questo dottorato di ricerca rivolto allo studio del ruolo di microrganismi probiotici e di
componenti alimentari nelle risposte infiammatorie, in particolar modo a livello intestinale. Lo scopo principale
del progetto consiste nellidentificazione delle molecole batteriche o alimentari che determinano lattivit
immunomodulatoria. A questo scopo, saranno impiegati approcci sperimentali in vitro quali sistemi reporter di
bioluminescenza, PCR quantitativa real time e test ELISA per analizzare lespressione di mediatori chiave della
risposta immunitaria su differenti linee cellulari.

1. State-of-the-Art
Research in the eld of bioactive dietary components has greatly increased during the past decade, similarly to
the interest on probiotic microorganisms, in particular for the potential in reducing the risk of chronic
degenerative diseases, such as autoimmune diseases, cardiovascular disease, obesity, hypertension, diabetes and
even cancer. Particularly, immune system activation and other mechanisms associated with the interaction
between the human (host) and colonic content, have been recently demonstrated in degenerative diseases at
intestinal levels. Probiotics, defined as live or attenuated microorganisms or microbial products that confer a
significant health benefit to the host (Gorbach, 2002), might, in theory, exert beneficial effects in the prevention
of chronic degenerative disorders. Similarly, such properties have been also attributed to some food components.
Probiotics and compounds such as polyphenols, in fact, have been suggested to have anti-inflammatory and
immunomodulatory effects at mucosal surfaces and systemically (O'Mahony et al., 2005; Karlsen et al., 2007).
Many injurious agents initiate intracellular cascades that coverage on transcription factors, such as NF-!B and
Nrf2, allowing their translocation to the nucleus where they enhance, respectively, the transcription of pro-
inflammatory and cytoprotective genes. There are preliminary data supporting that both, intestinal/probiotic
microoganisms and some dietary compounds, mainly present in vegetable foods, may affect the immune system
and decrease the risk of individuals to develop pathologies related to chronic exposures to pro-inflammatory
cytokines (Clarke & Mullin, 2008). The potential for bioactive food components and probiotics to contribute to
health has been widely discussed in the scientic community. However, only some of the postulated health
effects have been understood at a mechanistic level. Particularly, the study of specific foods and microorganisms
in addressing the immune responses towards tolerance or atopy, is now only in its infancy. Therefore,
mechanistic studies are now required to unveil the molecular components operating on the scene of the
interactions between human host and his diet.
Within the overall objective mentioned above, this PhD thesis project can be subdivided into the following
activities, according to the Gantt diagram given in Table 1:
A1) Interleukins and Toll-like Receptors determination on CaCo-2 cells and HT-29. Bacterial or dietary
samples that led to significantly lower NF-!B activation in Caco-2 cells will be tested for their ability to
reduce the production of IL-6 and IL-8 by human intestinal epithelial cell lines by means of ELISA assay.
Both IL-6 and IL-8 are pro-inflammatory cytokines and signal the start of a mucosal inflammatory response
to an antigen (Isolauri, 1999). Moreover selected samples will be further examined by reverse transcription
quantitative PCR (RT-qPCR) arrays targeting toll like receptor (TLR) signalling pathway. TLRs are one of
the most important receptor families of the innate immune system, which are known to recognize specific
15
th
364
15
th
conserved microbial patterns (Medzhitov, 2001). The study of qualitative expression of TLRs on human
cell surface is important to individuate which pathway is triggered by the the contact between the bacterial
or dietary molecule under study and the hosts cells.
A2) Cytokines quantification on PBMCs We will consider the ability of selected samples to modulate the
production of other cytokines, such as IL-10, IL-12, IL-17, and TNF-", which have been suggested to be
key regulators in the pathogenesis of autoimmune inflammatory disorders, especially in the intestine. This
part of the study will be carried out on Peripheral Blood Mononuclear Cells (PBMCs). The cytokine
quantification will be carried out by ELISA tests and/or real time quantitative PCR
A3) Experiments on dendritic cells The samples that have given the most promising results in terms of
immunemodulation, will be included in experiments involving dendritic cells (DCs). DCs have a crucial
role in those intestinal disorders associated to altered immune tolerance. In vitro cultured DCs will be
treated with the immunostimulating agents previously selected and the concentration of several different
cytokines will be determined as described above. Particular attention will be given to IL-2, that can be
produced by DCs and activate natural killer (NK) cells. Activated NK cells are a type of cytotoxic
lymphocytes that constitute a major component of the adaptive immune system and play a major role in the
rejection of tumors and cells infected by viruses (Granucci et al., 2001).
A4) Search of molecular components For the purpose to individuate molecular components determining the
observed immunemodulating activity, selected bacterial cells will be fractionated and the single molecular
components (peptidoglycan, surface proteins, teichoic acids, S-layer or capsules) will be tested for their
ability to modulate the immune response through the previously described methods. Similarly, the raw
polyphenolic extracts will be fractionated to the single phenolic molecules, and tested as above.
A5) Study of interaction between selected probiotic bacteria and polyphenolic extracts In a following part
of the study, we will consider the interaction between selected probiotic bacteria and polyphenolic extracts.
We will test possible synergic effects by means of the experimental procedures described in the previous
points. Moreover, we will study the action of polyphenols on bacterial viability and physiology, by means
of traditional microbiological techniques.

Activity Months 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
A1) ILs and TLRs determination
ELISA quantification of IL-6 and 8
RT-qPCR arrays targeting TLRs

A2) Cytokines quantification on PBMCs
A3) Experiments on dendritic cells
A4) Search of molecular components
A5) Study of interaction
A6) Thesis and paper preparation
Clarke JO & Mullin GE (2008) A review of complementary and alternative approaches to immunomodulation,
Nutrition in Clinical Practice. 49-62, Feb., 23
Gorbach SL (2002) Probiotics in the third millennium, Dig Liver Dis. Suppl 2:S2-7, Sep. 34.
Granucci F, Vizzardelli C, Pavelka N, Feau S, Persico M, Virzi E, Rescigno M, Moro G, Ricciardi-Castagnoli P
(2001) Inducible IL-2 production by dendritic cells revealed by global gene expression analysis, Nat
Immunol. 882-8, Sep., 2(9).
Isolauri E (1999) Probiotics and gut inflammation, Curr Opin Gastroenterol. 1999 534-7, Nov., 15(6).
Karlsen A, Retterstl L, Laake P, Paur I, Kjlsrud-Bhn S, Sandvik L, Blomhoff R (2007) Anthocyanins inhibit
nuclear factor-kappaB activation in monocytes and reduce plasma concentrations of pro-inflammatory
mediators in healthy adults, J Nutr. 1951-4, Aug., 137(8).
Medzhitov R (2001) Toll-like receptors and innate immunity, Nat Rev Immunol. 1: 135145.
O'Mahony L, McCarthy J, Kelly P, Hurley G, Luo F, Chen K, O'Sullivan GC, Kiely B, Collins JK, Shanahan F,
Quigley EM (2005) Lactobacillus and Bifidobacterium in irritable bowel syndrome: symptom responses
and relationship to cytokine profiles, Gastroenterology. 541-51, Mar., 128(3).

15
th
365
15
th
Sanitation Processes in Food Industry. Use of Hydrogen Peroxide
Simone Tibollo (simonetibollo@alice.it)
Dept. of Public Health Sec. Hygiene, University of Parma, Italy
Tutor: Prof. G.E. Sansebastiano

The aim of this research project is to verify the effectiveness of hydrogen peroxide as disinfectant against some
enteric viruses, microorganisms very resistant to the oxidants. These viruses are often concerned with food-borne
disease and food contamination could happen during the food chain. The results obtained through the kinetics of
inactivation will allow to set up contact time-concentration models for the use of hydrogen peroxide on food
plants.
I processi di sanificazione nellindustria alimentare. Impiego del Perossido di Idrogeno
Lo scopo di questo progetto di ricerca di verificare lefficacia dellacqua ossigenata impiegata come
disinfettante nei confronti di alcuni virus enterici, microrganismi molto resistenti agli ossidanti. Questi virus
sono spesso implicati nellinsorgenza di patologie veicolate dagli alimenti e la contaminazione pu avvenire
lungo tutta la filiera alimentare. I risultati ottenuti attraverso le cinetiche di inattivazione permetteranno di
mettere a punto dei modelli tempo di contatto-concentrazione per limpiego del perossido di idrogeno sugli
impianti alimentari.
1. State of the Art
Sanitation procedures have a main role in food industry to guarantee food safety from the microbiological point
of view, starting with primary production and ending at the consumers table. Actually hygiene and food safety
are increasingly important because most of the consumed foods are the product of industrial processes. Food
processing is a phase at high risk of microbial contamination during which food comes into contact with air and
surfaces without any protection. The USFDA and the CDC underline the importance of a correct sanitation and
food-handling in their codes and regulations and outline the procedures to avoid food contamination
(http://www.fda.gov; http://www.cdc.gov). Another thing to keep in mind is that sanitation means to protect food
products from contaminants and this is to be done from receiving through distribution. Its important also to
design and construct food-processing and handling facilities so that they should be cleanable and to prevent
entrance or harbourage of pests or other sources of contamination (Schmidt, 1997a). For these reasons the
hygiene of foodstuffs and food processing characteristics contribute significantly to the final quality of the
product reducing the risk of infections related to consumption of food. Its important also to remind that among
the different industries, the food industry ranks third in water consumption and wastewater discharge rates
(lmez and Kretzschmar, 2009) and that the use (in food preparation) or drinking of contaminated water is one
of the most problem we have to face when we deal with human health (Wong et al., 2010; Dotson et al., 2010).
In this, the choice of disinfectant becomes extremely important as it will need to take into account the various
factors which can affect its efficacy and the microorganisms to be inactivated.
A disinfectant should generally have a wide range of action versus the microorganisms and be able to inactivate
them quickly; it should remain stable for a long time; it should not be sensitive to the various environmental
factors affecting its efficacy, such as temperature, pH and the hardness of the water it comes into contact with in
cleaning procedures. Furthermore, the ideal disinfectant should present low toxicity, which facilitates its use;
absence of risk or the lowest possible risk of corroding the equipment it comes into contact with; a
reasonable price, which allows it to be widely used. There are various parameters which can increase the efficacy
of a disinfectant and at the same time affect the survival of the microorganisms. These parameters include
temperature, exposure time and the concentration of the disinfectant, which are all positively correlated to the
efficacy of the disinfectant; on the other hand, the formation of biofilm on the surfaces, the characteristics of the
water used indirectly to dilute the disinfectant or directly on the surfaces to eliminate dirt, as well as factors
intrinsic to the microorganisms and connected to their resistance as regards microbicidal agents, determine a
reduced efficacy of the disinfectant.
The official definition (Association of Official Analytical Chemists) of sanitizing procedures for surfaces in
contact with food requires a 99.999% (5 log) reduction of the level of contamination in 30 seconds, and 99.9% (3
log) for surfaces not in contact with foodstuffs (Schmidt, 1997b). Several studies were conducted using various
chemical disinfectants against pathogen microorganisms in the past years (Zoni et al., 2007; Gopal et al., 2010;
lmez and Kretzschmar, 2009).
Peroxides such as hydrogen peroxide or peracetic acid, are chemical compounds containing the characteristic
group formed by two oxygen atoms joined by a simple covalent bond, linked to metals or hydrogen. In solution
are unstable and decompose releasing oxygen, therefore acting as oxidants. Peroxides are common disinfectants
used in food industry that facilitate cleaning and sanitizing of surfaces and environments (Rudnick et al., 2009).
Disinfection with this type of oxidizing compounds is already effective at low concentrations in the presence of
processing residues and proteins (Christensen et al., 1990); they also present a wide action spectrum. Hydrogen
15
th
366
15
th
peroxide is used in various fields such as food, medical and environmental because it has a strong antimicrobial
activity in addition to a low corrosiveness and toxicity. Unlike other chemical compounds it doesnt produce by-
products or toxic gases (Gopal et al., 2010), therefore its use concern a lower environmental impact than
peracetic acid. The antimicrobial efficacy of H
2
O
2
is comparable to that of 100200 ppm chlorine treatment at
room temperatures (lmez and Kretzschmar, 2009). In the last years hydrogen peroxide has been used in
addiction of certain metals, UV light (Bayliss and Waites, 1980; Dotson et al., 2010), and ozone to form
.
OH,
which are very efficient oxidizers with a reactivity second only to fluorine. Its under study a new H
2
O
2
-based
compound called Hydrogen Peroxide Plus (HPP) that seems safe to use and more stable and more active than
H
2
O
2
alone, suggesting that lower quantities and contact times might be required for efficient disinfection.
However, as this formulation is in the process of being patented, no further details are available at this time
(Ronen et al., 2010).

2. PhD Thesis Objective and Milestones
In recent years there was an increased interest for hydrogen peroxide and its disinfectant properties, for this
reason we decided to test its activity against some pathogens that have proven particularly resistant to oxidizing
agents (Gulati et al., 2001). In particular for this study we decided to test the hydrogen peroxide varying factors
such as temperature, exposure time and concentration of disinfectant that are directly related to the effectiveness
of disinfection. For our trials were selected the Coxsackie B5 virus and the Feline Calicivirus strain F9, as
surrogate of the Norwalk virus which is unable to replicate in vitro. Assessment of the efficacy of the
disinfectant was performed by analyzing the trend of the inactivation kinetics and calculating the mean
inactivation times at 99%, 99.9%, 99.99%. The objective is to determine suitable contact time-concentration
combinations which could be applied on the field in various sectors of the food processing industry.
The future goals involve conducting tests directly to industrial plants to obtain an effective way enabling
sanitation of all the surfaces that may come into contact with food and of the environment itself. Thus it will be
possible to collect more realistic data about the elimination of pathogens and biofilms we can found on the
surfaces. Besides, to make a faster and safer detection and determination of the microorganisms we're going to
find on the plants, we consider the use of biomolecular techniques such as classical PCR and Real Time PCR. It
will be crucial to develop protocols for the treatment with hydrogen peroxide and the following efficacy control
of the sanitation of the industrial plants.

Bayliss C.E., Waites W.M. (1980): The effect of hydrogen peroxide and ultraviolet irradiation on non-sporing
bacteria, Journal of Applied Bacteriology; 48(3): 417-422.
Christensen B.E., Tr nnes H.N., Vollan K., Smidsr d O., Bakke R. (1990): Biofilm removal by low
concentrations of hydrogen peroxide, Biofouling; 2(2): 165175.
Dotson A.D., Keen V.O., Metz D., Linden K.G. (2010): UV/H
2
O
2
treatment of drinking water increases post-
chlorination DBP formation, Water Research; 44(12): 3703-3713.
Gopal A., Coventry J., Wan J., Roginsky H., Ajlouni S. (2010): Alternative disinfection techniques to extend
the shelf life of minimally processed iceberg lettuce, Food Microbiol.; 27(2): 210-219.
Gulati B.R., Allwood P.B., Hedberg C.W., Goyal S.M. (2001): Efficacy of commonly used disinfectants for the
inactivation of calicivirus on strawberry, lettuce and a food-contact surface, J. Food Prot.; 64(9): 1430-1434.
http://www.fda.gov
http://www.cdc.gov
lmez H., Kretzschmar U. (2009): Potential alternative disinfection methods for organic fresh-cut industry for
minimizing water consumption and environmental impact, LWT-Food Science and Technology; 42(3): 686
693.
Ronen Z., Guerrero A., Gross A. (2010): Greywater disinfection with the environmentally friendly Hydrogen
Peroxide Plus (HPP), Chemosphere; 78(1): 61-65.
Rudnick S.N., McDevitt J.J., First M.W., Spengler J.D. (2009): Inactivating influenza viruses on surfaces using
hydrogen peroxide or triethylene glycol at low vapour concentrations, Am. J. Infect Control.; 37(10): 813-819.
Schmidt R.H. (1997a): Basic Elements of a Sanitation Program for Food Processing and Food Handling,
Institute of Food and Agricultural Sciences, University of Florida; Fact sheet FS15.
Schmidt R.H. (1997b): Basic Elements of Equipment Cleaning and Sanitizing in Food processing and Holding
Operations. Istitute of Food and Agricultural Sciences, University of Florida; Fact sheet FS14.
Wong W.C., Dudinsky L.A., Garcia V.M., Ott C.M., Castro V.A. (2010): Efficacy of various chemical
disinfectants on biofilms formed in spacecraft potable water system components, Biofouling; 26(5): 583-586.
Zoni R., Zanelli R., Riboldi E., Bigliardi L., Sansebastiano G.E. (2007): Investigation on virucidal activity of
chlorine dioxide. Experimental data on Feline calicivirus, HAV and Coxsackie B5, J. Prev. Med. Hyg.; 48: 91-
95.
15
th
367
k
mb 200

M Vm (m.mgm.m)
D.
Tu: . Gu Cm
T D j u u bw b uu
wmkg . T R Tm qu CR qu (RTCR) w b u u g
x m m g m g um.

qu g e u z b uzz m
g u ' g g uz
mz m z um z b mb.

M m (ML) zm m bx Lm L
u b b (LAB) bgg m . uu u
m (A) kw m w qu ug u
b m m mb b (m . 200). Hw
m m wmkg u u bu
m xg w u w H (V . 99) w mu
(Bz T 990). uu w LAB g
w g w m
bw u u A b m b (MLB)
gw u ML (Ax . 2004). u w MLB b
b umb m g m b u mu.
m mb u mum (Cu Rm 994) O
2
(Ce . 2002) b ML w m
b w mu b gw w (GuuxB . 99). T
u u ML b mb
m u bw m.
A u g qu uu uu w b
m m muu u. T qu b uu u u ML
u mm (Kg 2002) bu m m bu ML mm
uu qu. u
ug m bu g x m zm g muu uu
w wk mum b.
um mz ML w m b ug g u
qum . Am ux MLB b w b (Rmz . 2006;
A z . 2004) bu kw bu g m uu
w ML b.
! "# $ % &
bj m b D j b ub
wg g G gm g Tb :
A) '( w w b u ug u.
A2) ) * w w b u.
A3) b muu A ML.
A4) + ,'( b mg L
15
th
368
k
mb 200
u Lm b m g um.
A) -. / m mx wk mx.
A6) 0 &') u qu m m
u/g.
A) -$"1- b ug w .
A8) + / m zm g m b ug RT
CR.
A9) u mm b.
A0) 2 "# / mmu.
3 -
/ 45 1 "65 - )5 7 65 7/( & 8!99:;
w: u kwg . J. Mb. 93 44.
) "5 )&5 & . &1 8!99:; E D gw
Mum D Am A Cu mbg 49 3636.
( $65 $ -" 8<<9; T mb H O
2
mu gw
J. A. B. 68 233.
1 05 - &= 8<<:;5 E m
A. Mb. B. 42 3939.
1> -5 $ = &5 ( 5 1 & 8!99!; b uu x
mu w AT EM Mb. L. 2 9.
7/( &5 7 65 ) & 8<<?; u
mmu u mbm w mgm Am J. g
uu 46 486492.
@ 8!99!; uu m mm u. : Vg T.. (E.)
g 3
Og mum; 92 Ju 2002. M . A.
Og Mgm Mkg 9.
. .5 & )5 $ " 8!99; m uu
m m z b
mbg 2 0.
- )5 7 5 @ A5 7 65 / 45 @ 5 7/( & 8!99B;
: qu qu g m A.
Mb 8 49469.
= 45 ) "5 7/ = 8<<?; M m w: u u m
m b xm g J. A. B. 9 64060.

mu wk mum
LAB
mm
Omz mg
Eu mg b
/LAB u
Omz RA x
ML
g
Omz RTCR
Eu g x
A b u
g mu
g g D
$ ! " #
15
th
369
15
th
New technologies for recovery and exploitation of olive mills wastewater
(OMWV) and production of functional olive oils
Vitagliano Massimo (mail: massimo.vitagliano@phenofarm.it; massimo.vitagliano@enea.it)
Department of Food Science, University of Naples Federico II, Naples, Italy
The aim of this PhD Thesis concern with definition of an experimental process based on separating technologies (as
membrane filtration systems), employement of nanoemulsion, to develop systems and functional food products
deriving from the recovery of biophenolic compounds from olive mill wastewaters (OMW).
Nuove tecnologie per il recupero e la valorizzazione dei reflui oleari e la produzione di oli
funzionali
Questa tesi di dottorato mira a definire un processo sperimentale, con Tecnologie (filtrazione tangenziale, nano-
emulsioni), sistemi di produzione e prodotti derivanti dal recupero dei polifenoli dalle acque di vegetazione olearie (ora
considerate un rifiuto) e producendo nuovi prodotti funzionali.
1. State-of-the-Art
The increasing competition of Mediterranean countries and of other countries as Australia, Chile, Argentina, the world
new olive-oil producers, induces the Italian companies to a top quality olive oil production improving at same time
whole production cycle economy and the recoverying end exploiting all biomasses produced by the olive fruit. The
nutritional value of Olives and Virgin Olive Oil (VOO), the basic lipid ingredient of the mediterranean diet, is due to
its lipidic composition (oleic acid 60-80%), but also to its biophenols content. Biophenols are antioxydant molecules
naturally contained in olive fruit and in less amount (2%) in olive oil. Biophenols are hydrosoluble molecules and
during the milling of olives only a small fraction is partioned toward the oily phase, the major amount of biophenols is
contained in OMW and in olive husk. Despite the poor amount of biophenols in VOO, it was demonstrated that olive
biophenols are associated to the healty value attributed to it . In fact biophenols are involved in prevention of olive oil
oxydation during the storage and are also implicated in protection from intracellular oxydation (1-2). Some of these
compounds are responsibles of some organolectic properties of VOO determining the characteristic bitter and spicy
taste. The VOO phenolic content is constituted by two different fractions: a fraction containing less than 20% of total
polyphenols, where phenolic-acids and phenolic alcohols were identified: tyrosol (p-Hydroxyphenilethanol) and
hydroxytyrosol (3,4 dihydroxyphenilethanol) are the most important compounds. The orto-diphenols, as
Hydroxytyrosol, contributes to the stability of olive oil, their antioxydant effect is due , to their ability to release proton
with formation of a radicalic hydroxyl species stabilized by resonance. The transfer of an electron from hydroxytyrosol
to a radicalic specie stops the propagation of radicalic reaction of lipid auto-oxydation. The second fraction
(hydrolysable) is constituted by secoiridoid molecules charachterized by structures containing tyrosol and
hydroxytyrosol and lignans. During the milling processes VOO is enriched of biophenol molecules deriving from
hydrolysis of oleuropein performed by b!Glucosidase. The biophenols deriving from hydrolysis of oleuropein,
responsibles of bitter taste, constitute one of the most important quality-trait of olive oil improving its nutritional value.
The opportunity of increasing biophenolic content in VOO by a solubilization approach seem to be very attractive in
order to amplify the natural resistance of olive oil to oxydation phenomena, characterizing its organolectic properties of
and finally improving its nutritional value . Recoverying poliphenols from OMW is an opportunity of exploitation of
their biomedical properties (3). OMW are liquid wastes characterized by low pH, high conductivity and quick
fermentation. This project will be developped in collaboration by the Department of Food Science of the University of
Naples Federico II (DSA-UNINA) and the private company Phenofarm s.r.l.. Experimental tests will be performed on
the industrial plant of Phenofarm s.r.l. in order to produce plant-extracts and concentrated biophenolic fractions, the
analitical characterization of fractions will be performed at DSA-UNINA laboratories.
Within the overall objective mentioned above this PhD thesis project can be subdivided into the following activities
A1) Definition of experimental campaign, bibliographic study, state of the art description (DSA-UNINA, Phenofarm
S.r.l..)

15
th
370
15
th
A2) Laboratory scale study of OMW pre-treatment (enzymatic hydrolysis, floatation, centrifugation, thermal
treatment), charachterization of poliphenols of pre-treated matrices (NMR/LC/MS). (DSA-UNINA).
A3) Optimization of process parameters in order to recovery polyphenols from AV using membrane technologies.
(PhenoFarm S.r.l.)
A4) Analytical characterization of phenolic content in fractions of interest (retentate of RO and NF). (DSA-UNINA).
A5) Purification of polyphenols contained in nanofiltration (NF) and reverse osmosis (RO) retentates with
chromatographic techniques (DSA-UNINA).
A6) Characterization of fractions obtained from membrane process and evaluation of anti-oxydant power. (DSA-
UNINA).
A7) Study of polyphenol solubilization process in oil matrices. (DSA-UNINA - PhenoFarm S.r.l.)
A8) Characterization of chemical composition, organolectic properties and stability of functional olive oils . (DSA-
UNINA).
A9) In vitro and in vivo evaluation of bioavailability of functional products obtained. (DSA-UNINA).
A10) Data evaluation, drafting PhD thesis and scientific papers (DSA-UNINA).
A11) Preparation of presentations, partecipation to PhD Workshops and data discussion.
Gantt diagram for this PhD thesis project.
Table 1

1) Antioxidant and Other Biological Activities of Olive Mill Waste Waters (F. Visioli, A. Romani, N. Mulinacci, S.
Zarini, D. Conti, F. Vincieri, and C. Galli
2) Tsimidou, M.; Papadopoulos, G.; Boskou, D. Phenolic compounds and stability of virgin olive oil-part 1. Food chem.
1992, 45, 141-144.
3) Benavante-Garca o., Castillo j., Lorente J., Ortuno A., Del Rio J. A. Antioxidant activity of phenolics entracte from
Olea europaea L. leale. Food chemisrty 68. Settembre 1999

15
th
15
th

INDEX
15
th
373
3
rd
year PhD Student Oral Communications
Giuseppina Adiletta 3
Hot Air-Drying and Rehydration of Fruits and Vegetables: Optimization and Modelling
Tutor: Prof. Marisa Di Matteo
Ilaria Benucci 8
Removal of unstable proteins from white wine by immobilized acid protease
Tutor: Prof. Marco Esti
Gaia Bonacina 13
Protective role of dietary bioactive compounds: mechanisms and hypothesis
Tutor: Prof. Marisa Porrini; Co-tutor: Dr. Patrizia Riso
Claudio Giorgio Bove 18
Evolution of Lactobacillus rhamnosus in Parmigiano Reggiano:
isolation and characterization of different strains during ripening
Tutor: Prof.ssa Monica Gatti
Giuseppina Bruno 23
Evolution of the Oxidative Level of Virgin Olive Oil as a Function of the Amounts
of Added Monoacylglycerols
Simona Campolongo 28
Brettanomyces bruxellensis in wine: presence, off-odours production and strategies for inhibition
Tutor: Prof. Luca Cocolin
Felicia Ciocia 33
Use of non-dairy Lactobacillus plantarum, Lactobacillus paraplantarum
and Lactobacillus pentosus strains as adjuncts in cheese making
Sara Da Pieve 39
Study and development of multiphase systems for new food design strategies
Tutor: Prof. ssa Maria Cristina Nicoli; Co-tutor: Dott.ssa Sonia Calligaris
Carmela De Simone 44
Production and evolution of peptides naturally derived from milk protein hydrolysis or generated by
technological processes: proteomic and bio-functional characterization
Federica Di Pasquale 49
Biopreservation against Listeria monocytogenes: activity of natural antimicrobial compounds
Tutor: Prof. Antonello Paparella - Co-tutor: Dott.ssa Annalisa Serio
Paola Di Matteo 54
Biotechnological Production of Vanillin from Natural Feedstocks and Development
of New Procedures for the Recovery of the Product
Tutor: Prof. Maurizio Ruzzi
Roberta Dordoni 59
Optimization of White Wine Clarifcation Process by means of Bentonites
Tutor: Prof. Dante Marco De Faveri
15
th
374
Viviana Durante 64
The Oxidative Level of Refned Olive Oil as a Function of Crude Oil Quality and Refning Process
Daniela Fracassetti 69
Investigation of thiol compounds from yeast affecting wine properties
Tiziana Mariarita Granato 74
Interaction between proteins of plant origin and wine components:
molecular-based choice of protein fning agents for organoleptic improvement
Tutors: Prof. Francesco Bonomi, Prof.ssa Stefania Iametti
Esteban Herrera 79
Evaluation of the use of milk as bioindicator of the environmental
contamination of dl-PCB and PCDD/F
Tutor: Prof. Michele Amorena
Romina Iezzi 84
Modelling of transient heat exchange during natural convective air cooling
of cheese by FEM analysis
Tutor: Prof. Germano Mucchetti
Francesca Lambertini 89
Emerging Properties of Oligopeptides in Higly Proteolized Novel and Traditional Foods
Tutors: Prof. Stefano Sforza, Prof. Arnaldo Dossena
Marco Lucchetta 93
Functionality of grape proteins in relation to turbidity of white wine:
Botrytis cinerea as remover of grape proteins
Alessandra Marti 98
Physical Approaches to Improve the Quality of Gluten-Free Pasta
Tutor: Prof.ssa Maria Ambrogina Pagani
Rossella Mignogna 103
Evaluation of Antioxidants in Fruits and Vegetables
Tutor: Prof. Gianfranco Panfli
Chiara Montanari 108
Oxidative Stress in Lactobacillus helveticus and Release
of Molecules Associated with Cell Fatty Acids Oxidation
Tutor: Prof. Maria Elisabetta Guerzoni
Lucia Monti 113
Characterisation of PDO Cheese Samples Through the Identifcation
of Biochemical Markers
Tutor: Prof. Stefania Iametti - co-tutor: Dott.ssa Tiziana M.P. Cattaneo
Serena Niro 118
Physical-Chemical Assessment of Innovative Pasta Filata Cheeses
Tutor: Prof. Gianfranco Panfli
Elisabetta Occhino 123
Vacuum impregnation: a process to improve the quality of vegetables
Tutor: Prof.ssa Paola Pittia Co-Tutor: Dott. Giancarlo Addario
15
th
375
Federico Pallottino 128
Assessment of Tarocco Orange Fruit Firmness by Standard and Non-Destructive Tests
Tutor: Mauro Moresi; Co-tutor: Paolo Menesatti
Vito Michele Paradiso 133
Lipid Oxidation Volatile Compounds in Corn Flakes and Their Impact on Flavour.
How to Prevent Sensory Deterioration?
Valeria Pelizzola 138
Traceability of mountain cheeses: identifcation and characterization of biochemical markers
Tutor: Prof. Ivano De Noni Co-tutor: Dott.ssa Giovanna Contarini
Maurizio Petrozziello 143
Characterization of volatile substances in wines obtained from Piedmont grape varieties.
The effect of different winemaking techniques on norisoprenoids content
Tutor: Antonella Bosso, Vincenzo Gerbi
Barbara Quarta 148
Mitigation strategies of heat-induced toxic molecules in foods:
the case of furfurals removal from roasted coffee by vacuum treatment
Tutor: Prof. Monica Anese
Annamaria Recchia 153
Factors affecting astringency induced by phenolic compounds
Tutor: Prof. Erminio Monteleone
Gian Franco Regnicoli 158
Innovative Systems for the Improvement of Food Quality and Safety
Tutor: Prof. Paolo Fantozzi - Co-Tutor: Dr. Giuseppe Perretti
Rossana Romaniello 163
Natural patrimony of old Cinque Terre vineyards as yeasts source
able to improve the features of originary cultivar
Tutor: Prof. Patrizia Romano - Co-Tutor: Dott. Angela Capece
Michele Sensidoni 168
Research on Filterability Characteristics of Beer and Optimisation of Filtration Process
Valeria Sileoni 173
Study of Innovative Methods of Control in the Cereal Productive Chain
for the Production of Beer and Spirits
Tutor: Dr. Giuseppe Perretti
Gianluca Ciro Telera 178
Infuence of organic viticulture on non-Saccharomyces wine yeast populations
Tutor: Prof.ssa G. Suzzi
Luca Tipaldi 183
Natural Compounds: Effects on Food-related Microorganisms and Potential Use in Fermented Meats
Tutor: Prof. Raffaele Coppola
Fabrizio Torchio 188
Technical Innovation in Winemaking and Winegrape Analysis to Enhance Varietal
Characteristics and Increase the Shelf Life of Wines
Tutor: Prof. Vincenzo Gerbi
15
th
376
Gianluca Tripodi 193
Effect of climatic changes on the quality of Sicilian wines: chemical and sensory characterization
of Nero dAvola in relation to the soil salinity
Tutor: Prof.ssa Antonella Verzera
Urszula Tylewicz 198
Innovative Technologies for Intact and Fresh-cut Fruit and Vegetables Processing
Tutor: Dr. Pietro Rocculi - Co-tutor: Drs. Santina Romani
2
nd
year PhD Student poster communications
Lavinia Alexandru 205
Phenolic profle of some selected spontaneous herbs from the Alps
Tutor: Prof. Lanfranco Conte
Michele Balzano 207
Distribution of Furan Fatty Acids in the Lipid Classes of Adriatic Crayfsh
Tutor: Prof. Francesca Clementi - Co-Tutor: Prof. Natale Giuseppe Frega
Federico Emanuele Barnaba 209
Application of NIR-AOTF to study grape ripening and dehydration
Tutor: Prof. Fabio Mencarelli
Shirley Mireya Barrera Crdenas 211
Biodiversity analysis of Saccharomyces cerevisiae strains isolated from Franciacorta
and Oltrepo Pavese to improve sparkling wine production made by champenois method
Tutor: Prof. Roberto Foschino - Co-tutor: Dr. Claudia Picozzi
Mariangela Bencivenni 213
Allergenicity of Different Tomato Ecotypes
Tutor: Prof. Stefano Sforza, Prof. Rosangela Marchelli
Tiziana Bongiorno 215
Shelf-life of vacuum packaged fresh mussel (Mytilus galloprovincialis):
microbiological and quality attributes
Tutor: Dr.ssa Francesca Tulli - Cotutor: Prof. Alessandro Sensidoni
Silvio Boveri 217
Using of minisatellites to confrm intraspecifc yeast hybrids
Tutor: Prof. Andrea Pulvirenti
Luca Calani 219
New data on bioavailability and catabolism of green tea favan-3-ols in humans
Tutor: Prof. Daniele Del Rio
Carola Cappa 221
Infuence of the presence of different fbers on gluten-free dough and bread properties
Tutor: Prof. Mara Lucisano - Co-tutor: Dr. Manuela Mariotti
Rosita Caramanico 223
Bread making aptitude of Italian waxy wheat
Tutor: Prof.ssa M. Ambrogina Pagani - Co-Tutor: Patrizia Vaccino
15
th
377
Patrizia Comandini 225
Impregnation Techniques for Aroma Enrichment of Apple Sticks: a Preliminary Study
Tutor: Dr. Tullia Gallina Toschi
Cristina Costa 227
Nanoparticles to extend the shelf life of ready to use fruit and vegetables
Tutor: Dott.ssa Amalia Conte - Co-tutor: Prof. Matteo Alessandro Del Nobile
Antonella Costantini 229
Selection of reference genes for quantitative RT-PCR normalization in Oenococcus oeni
Tutor: Emilia Garcia-Moruno, Luca Cocolin
Dorotea Anna Della Medaglia 231
Volatile markers of Extra Virgin Olive Oil quality and typicality
Giovanna Dima 233
Infuence of rootstock on aroma profle and sensory characters of honeydew melon
(Cucumis melo L. var. inodorus)
Tutor: Prof. Antonella Verzera
Ilona Di Maio 235
Individualization and Characterization of Oxidative Degradation Products of Secoiridoids
in Virgin Olive Oil by Innovative Analytical Techniques
Tutor: Prof. Maurizio Servili
Giuseppina Dorato 237
Shelf-life optimization of the orange fruit and juice (cv. Belladonna)
Tutor: Prof. Vincenzo Sicari - Co-tutor: Prof. Angelo Maria Giuffr
Claudia Falavigna 239
Free and hidden fumonisins in corn: occurrence and masking mechanism
Tutor: Dott.ssa Chiara DallAsta, Prof. Gianni Galaverna
Evelina Fasano 241
Evaluation of the Phthalate contamination in packaged meals
Tutor: Prof. Renata Cocchieri Amodio
Ilaria Ferrari 243
Modelling cake performances as a function of fat quantity and quality
Tutor: Prof. Margherita Rossi - Co-tutor: Prof. Mara Lucisano
Mariangela Gallo 245
Survival of Saccharomyces cerevisiae var. boulardii cells microencapsulated
Tutor: Dott.ssa Maria Rosaria Corbo
Diana Gazzola 247
Purifcation and Characterization of Chitinase Isoforms from Manzoni Bianco Grape Juice
Mariagrazia Giarnetti 249
An Effort to Improve the Lipid Fraction Quality of Taralli Using Extra Virgin Olive Oil
Tutor: Prof. Francesco Caponio
Anella Giordano 251
Changes induced by prolonged and discontinuous heat treatment on fatty acids of frying oils
Tutor: Prof. Raffaele Romano
15
th
378
Liberata Gualtieri 253
Proteomic and metabolomic approaches for the characterization
of meat typical products
Matteo Gumiero 255
Innovative Active Packaging for Food Products: Research and Developments
Pietro Lamiani 257
Innovative approaches and instruments in modelling and monitoring the shelf life
of packaged perishable foods
Tutor: Prof. Luciano Piergiovanni
Loredana Liguori 259
Partial and total dealcoholization of wines
Tutor: Prof.ssa Marisa Di Matteo
Sabrina Lucchetti 261
Identifcation of molecular markers for the characterization of hazelnut oil
Annalisa Lucera 263
Packaging optimization to prolong the shelf-life of minimally processed vegetables
Tutor: Prof. Matteo Alessandro Del Nobile
Dhouha Mamlouk 265
Setting up of culture independent methods to study acetic acid bacteria of vinegars
Tutor: Dr Maria Gullo
Laura Marinoni 267
Study of Chemical and Molecular Information Related to NIR and IR Spectroscopic
Data for Processes and Products Control
Tutor: Prof. Stefania Iametti; Co-tutor: Dott.ssa Tiziana M.P.Cattaneo
Giovanni Mastronardi 269
Study of the compounds responsibles some quality in the coffee drink
Tutor: Prof. Roberto Zironi
Nicoletta Antonella Miele 271
Effect of main ingredient on physical properties of fat-based flling
Tutor: Prof.ssa Silvana Cavella
Daniela Natale 273
Quality Parameters of Crude Frying Oils Blends Available in the Italian Market
Tutor: Dr. Maria Teresa Rodriguez-Estrada
Pierpaolo Piccone 275
Release of aroma compounds in aqueous model systems containing saccharides
of different molecular complexity
Tutor: Prof.ssa Paola Pittia - Co-Tutor: Prof. Dario Compagnone
Rocchina Pietrafesa 277
Wine yeast immobilization on food-like matrix for inoculated fermentation
Tutor: Prof. Patrizia Romano - Co-Tutor: Dr. Francesco Cellini
Giuseppe Polizzotto 279
Yeast populations in new vineyard in Linosa Island
Tutor Universitario: Dott. Onofrio Corona - Tutor IRVV: Dott. Daniele Oliva
15
th
379
Elisabetta Putignano 281
Applications of catalytic transfer hydrogenation and dehydrogenation
for the synthesis of products of biological relevance
Tutor: Prof. P. Rigo, Prof.W. Baratta
Assunta Raiola 283
Monitoring of Deoxynivalenol (DON), Ochratoxin A (OTA), Afatoxin B1 (AFB1)
in Italian commercial dry pasta showing a marketing for children
Tutor: Prof. Alberto Ritieni
Silvia Ricci 285
Phytoestrogens: characterization and biological effects
Selene Salvi 287
Characterization and technology of beer obtained from emmer malt (Triticum dicoccum)
Tutor: Prof. N.G. Frega
Chiara Sanmartin 289
The utilization of Solid Carbon Dioxide in the Production of Extravirgin Olive Oil
Tutor: Prof. Gianpaolo Andrich
Maria Lina Sanna 291
Why does P. fermentans switch? Insights into the molecular mechanisms
involved in the dimorphic transition
Tutor: Prof. Ilaria Mannazzu, Prof. Marilena Budroni
Marcela Santarelli 293
Survey on community and dynamics of lactic acid bacteria in Italian PDO hard cheeses
Tutor: Prof. Monica Gatti
Sara Santarelli 295
Optimization of analytical methods for the characterization of traditional raw
milk cheeses of the Marche region
Tutor: Prof. Natale G. Frega
Guglielmo Santi 297
Bioethanol production from agri-food lignocellulosic residues
Tutor: Dr. Silvia Crognale
Milda Stuknyte 299
Development of Bioprocesses for the Production of Food Protein Hydrolysates
Containing Bioactive Peptides
Tutor: Prof. Ivano De Noni - Co-tutors: Dr. Simone Guglielmetti and Prof. Diego Mora
Sara Torresi 301
Study of a beta-Glucanase preparation in synthetic wine to enhance yeast lysis
Tutor: Prof. Gabriele Anelli; Co-Tutor: Dott.ssa Maria Teresa Frangipane
Laura Treu 303
Genomic and transcriptomic characterization of natural yeast strains
of oenological relevance
Tutor: Prof.ssa Viviana Corich, co-tutor: Dott. Stefano Campanaro
Alessia Viel 305
Exploitation of microbial capability to enhance the characteristics
of regional wines Prosecco and Tocai
Tutor: Prof. Alessio Giacomini
15
th
380
Ileana Vigentini 307
Molecular characterisation, stress responses and specifc enzymatic activities
of Dekkera/Brettanomyces bruxellensis wine strains
1
st
year PhD student dissertation project
Debbie Andyanto 311
The Effects of Natural Compounds on the Growth and Bioflm Formations
of Food borne Pathogens
Claudia Belingheri 313
Innovative encapsulating materials and techniques for favour encapsulation
Tutor: Prof. Elena Vittadini
Victoria Bruno Bossio 315
Competitiveness in the wine sector
Tutor: Prof. Sandro Sillani
Sandra Corsi 317
Sustainability assessment of Durum wheat-based production systems under Blue Agriculture,
Italian way of Conservation Agriculture
Tutor: Prof. Michele Pisante
Angela Costanzo 319
Characterization of donkeys milk proteins by proteomic approach
Tutor: Prof. Lina Chianese
Carlo Alessio Cozzolino 321
Development of an active packaging for the controlled release of natural antimicrobials,
obtained from biomacromolecules
Tutor: Prof. Antonio Piga
Umberto della Vella 323
Infuence of microclimatic characteristics on microbial communities
in Montepulciano vineyards
Tutor: Prof.ssa Giovanna Suzzi
Alessandro Esposito 325
The role of information in the consumer markets of alimentary products,
the case of the extra virgin olive oil
Tutor: Prof. Sandro Sillani - Prof. Lanfranco Conte
Chiara Ferrario 327
Safety and quality of fsh products: a methodological polyphasic approach
to study contaminating emerging pathogens
Tutor: Prof. Maria Grazia Fortina
Giuseppe Christian Fusella 329
Development of nanostructured sensing system for food analysis
Tutor: Prof. Dario Compagnone
15
th
381
Angela Guidone 331
Aerobic metabolism of Lactobacillus plantarum: physiological and technological aspects
Laura Introzzi 333
Development of high performance bio-based hybrid coatings for food packaging applications
Tutor: Prof. Alberto Schiraldi
Fei LI 335
Development of nano-material for food packaging
Tutor: Prof. Luciano Piergivanni
Federica Meli 337
Bifdogenic activity of protein hydrolizate from poultry by-products
Tutor: Prof. Erasmo Neviani
Stefano Molinaro 339
Bio-based Food Packaging: Infuence of Formulation and Processing
on Functional Properties
Elio Moretti 341
Development of Guidelines for Microbiological Control in Microbreweries
Chiara Nadai 343
Microbiological approaches to reduce the SO2 addition in oenology
Tutor: Prof.ssa Viviana Corich
Chiara Nitride 345
Proteomic, metabolomic, and biological activities of dietary seed protein
Valentina Panarese 347
Study of Traditional and Innovative Technologies for Minimally Processed Fruit
and Vegetable Products
Tutor: Dr. Pietro Rocculi
Gianfranco Pannella 349
Study of Food-related Microorganisms by Use of Genomic and Proteomic Applications
Tutor: Prof.ssa Elena Sorrentino
Giorgia Perpetuini 351
Selection of lactic acid bacteria and yeasts to be used as mixed starter cultures
for table olive fermentation
Tutor: Prof. Aldo Corsetti
Federico Piano 353
Evolution of thiol related odours in wine during ripening and storage
in relation to glutathione content
Tutor: Prof. Antonio Tirelli - Co-tutor: Dr. Daniela Borsa
Gianluca Picariello 355
Study of the aggregation of casein micelles in raw milk
by combined analytical techniques
Tutor: Prof. Francesco Addeo
15
th
382
Gabriella Pinto 357
Identifcation of infammatory proteins in milk and derived products
as direct molecular markers of generic diseases in ruminants
Tutor: Professor Francesco Addeo
Maria Chiara Remagni 359
Application of Spectroscopic Techniques for Monitoring Biotransformation
Processes using Lactobacillus plantarum in Optimising Milk Whey Destination
Tutor: Prof. Diego Mora - Co-Tutor: Dott.ssa Tiziana M.P. Cattaneo, Dott. Domenico Carminati
Antonietta Ruggiero 361
Effects of SAR (Systemic Acquired Resistance) Inducers on Quality
and Safety of the Grape Products
Tutor: Prof. Stefania Iametti, Dott. Marcello Iriti
Valentina Taverniti 363
The Role of Probiotic Microorganisms and Dietary Compounds
in the Modulation of Immune Response: a Mechanistic Approach
Tutor: Dr. Simone Guglielmetti
Simone Tibollo 365
Sanitation Processes in Food Industry. Use of Hydrogen Peroxide
Tutor: Prof. G.E. Sansebastiano
Marco Vendrame 367
Optimization of alcoholic and malolactic fermentation to obtain high quality wines
Vitagliano Massimo 369
New technologies for recovery and exploitation of olive mills wastewater (OMWV)
and production of functional olive oils
15
th
AKNOWLEDGEMENTS
Ordine dei Tecnologi Alimentari
di Campania e Lazio
Molise
di Sicilia e Sardegna

BookOfAbstracts 15thWORKSHOP PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

BookOfAbstracts 15thWORKSHOP PDF

Uploaded by

Copyright:

Available Formats

University of Naples - Federico II

of the dehydration model with confidence intervals were reported in Table 3.

of the dehydration model with confidence intervals are reported in Table 5.

values extrapolated at three

-250L has been identified as one of

-250L from Degussa Rohm GmbH&Co., Darmstadt, Germany)

-250L Chitopearl BCW-3010

-250L - - - 3.2 Boller et al.,

-250L (81%). Nevertheless, all

resin, adsorption experiments

resin was affected by pH. In moderate acidic condition

C in a chamber connected to a vacuum pump,

, a beta-Glucanase blend developed to improve the short maturing of

, Lallemand-Italy) has been conducted in

You might also like