Professional Documents
Culture Documents
http://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
Primer-BLAST Primer-Blast results NCBI/ Primer-BLAST : results: Job id=JSID_01_151677_130.14.22.10_9002_primertool more... Input PCR template Range 1 - 1782 Specificity of primers primer specificity was not determined as specificity checking option was not selected. Other reports Search Summary Search parameters and other details Search parameter name Search parameter value Number of Blast hits analyzed 0 Entrez query Min total mismatches 2 Min 3' end mismatches 2 Defined 3' end region length 5 Mismatch threshold to ignore targets 6 Misprimed product size deviation 4000 Max number of Blast target sequences 50000 Blast E value 30000 Blast word size 7 Max candidate primer pairs 500 Min PCR product size 70 Max PCR product size 400 Min Primer size 15 Opt Primer size 20 Max Primer size 25 Min Tm 57 Opt Tm 60 Max Tm 63 Max Tm difference 3 Repeat filter AUTO Low complexity filter Yes Graphical view of primer pairs
Primer pair 1
Sequence (5'->3') Template Length Start Stop Tm GC% Self Self 3'
1 of 4
1/13/2014 5:15 PM
Primer-Blast results
http://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
strand Forward CGTAAGCACAACCAGGGGAT Plus primer Reverse TAAGTGCGCCTTCGGTCTTT Minus primer Internal Plus oligo Product 218 length Product Tm Product Tm min(OLIGO Tm) Exon junction Total intron size Products on intended target Products on allowed transcript variants Products on potentially unintended templates Products on target templates 20 20
complementarity complementarity 967 986 60.04 55.00 3.00 1184 1165 59.97 50.00 6.00 2.00 0.00
Primer pair 2
Sequence (5'->3') Template Length Start Stop Tm strand 20 20 GC% Self Self 3' complementarity complementarity 0.00 2.00
Forward CTGCCAACATCCTCCGACTT Plus primer Reverse CTTCCCAACTGCCACTGCTA Minus primer Internal Plus oligo Product 101 length Product Tm Product Tm - min(OLIGO Tm) Exon junction Total intron size Products on intended target Products on allowed transcript variants Products on potentially unintended templates Products on target templates
489 508 60.04 55.00 3.00 589 570 59.96 55.00 3.00
Primer pair 3
Sequence (5'->3') Template Length Start Stop Tm strand GC% Self Self 3' complementarity complementarity
2 of 4
1/13/2014 5:15 PM
Primer-Blast results
http://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
Forward TTATTGGCGGTGTGGCTCTT Plus primer Reverse AAGTCGGAGGATGTTGGCAG Minus primer Internal Plus oligo Product 101 length Product Tm Product Tm min(OLIGO Tm) Exon junction Total intron size Products on intended target Products on allowed transcript variants Products on potentially unintended templates Products on target templates
20 20
408 427 59.96 50.00 2.00 508 489 60.04 55.00 3.00
0.00 1.00
Primer pair 4
Sequence (5'->3') Template Length Start Stop Tm strand 20 20 GC% Self Self 3' complementarity complementarity 2.00 1.00
Forward GCTTGAGCGGCAATACATCG Plus primer Reverse CGAATTCCCCACTGAGCCTT Minus primer Internal Plus oligo Product 237 length Product Tm Product Tm - min(OLIGO Tm) Exon junction Total intron size Products on intended target Products on allowed transcript variants Products on potentially unintended templates Products on target templates
1131 1150 60.04 55.00 4.00 1367 1348 60.04 55.00 6.00
Primer pair 5
Sequence (5'->3') Forward primer Template Length Start Stop Tm strand 20 GC% Self Self 3' complementarity complementarity 2.00
TCCATTGATGGCAGGCCTTT Plus
3 of 4
1/13/2014 5:15 PM
Primer-Blast results
http://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
Reverse AAGAGCCACACCGCCAATAA Minus primer Internal Plus oligo Product 291 length Product Tm Product Tm - min(OLIGO Tm) Exon junction Total intron size Products on intended target Products on allowed transcript variants Products on potentially unintended templates Products on target templates
20
1.00
4 of 4
1/13/2014 5:15 PM