Proefschift Bron

Novel Regenerative Strategies For The Treatment Of Intervertebral Disc Herniation
JL Bron
JL Bron
Johannes Leendert Bron
The studies described in this thesis are carried out at the department of orthopaedic surgery of the VU University Medical Center (VUMC), the department of oral cell biology of the Academic Centre for Dentistry (ACTA) and the FOM Institute for Atomic and Molecular Physics (AMOLF). The study was financially supported by Arthro Kinetics Ltd, Germany.
The publication of this thesis was supported by: - Nederlandse Orthopaedische Vereniging - Stichting Anna Fonds - Skeletal Tissue Engineering Group Amsterdam - Dutch Spine Society - Bauerfeind - Implantcast - Inspine - DSM Biomedical
Novel regenerative strategies for the treatment of intervertebral disc herniation Copyright 2012 JL Bron, Amsterdam, The Netherlands Lay out: JL Bron Cover design: JL Bron & G van den Berg Print: Gildeprint Drukkerijen Enschede ISBN: 978-94-6108-351-7
VRIJE UNIVERSITEIT

ACADEMISCH PROEFSCHRIFT ter verkrijging van de graad Doctor aan de Vrije Universiteit Amsterdam, op gezag van de rector magnificus prof.dr. L.M. Bouter, in het openbaar te verdedigen ten overstaan van de promotiecommissie van de Faculteit der Geneeskunde op dinsdag 27 november 2012 om 15.45 uur in het auditorium van de universiteit, De Boelelaan 1105
door Johannes Leendert Bron geboren te Leerdam
promotoren: prof.dr. B.J. van Royen prof.dr.ir. Th.H. Smit copromotor: prof.dr. G.H. Koenderink
Table of Contents Chapter 1 Chapter 2 General Introduction Rheological characterization of the nucleus pulposus and dense collagen scaffolds intended for functional replacement. J Orthop Res. 2009; 27: 260-266 Engineering alginate for intervertebral disc repair J Mech Behav Biomed Mater. 2011; 4:1196-1205 Migration of intervertebral disc cells into dense collagen scaffolds intended for functional replacement Mater Sci Mater Med. 2012; 23:813-821 Repair, regenerative and supportive therapies of the annulus fibrosus: achievements and challenges Eur Spine J. 2009; 18:301-313 Biomechanical and in vivo evaluation of experimental closure devices of the annulus fibrosus designed for a goat nucleus replacement model Eur Spine J. 2010; 19:1347-1355 Addendum 1: Techniques and instruments Addendum 2: Nucleus implant evaluation Chapter 7 Appendices General discussion 1. Summary 2. Nederlandse Samenvatting 3. Publications 4. Dankwoord 5. Curriculum Vitae 7 15
Chapter 3
31
Chapter 4
57
Chapter 5
79
Chapter 6
109
131 137 149 167 171 177 181 185
1
General Introduction
Chapter 1
Symptomatic lumbar disc herniation occurs in up to 2% of the general population at some point in life [1]. Men are affected more often than woman, with a peak incidence in the fourth and fifth decade of life [1,2]. Since the disease is mainly distributed within the working and employed part of our society, the socioeconomic consequences are substantial [3]. In the vast majority of the patients symptoms subside spontaneously within six weeks after presentation and these patients are best off treated conservatively [2]. Another large part will experience a decrease of symptoms in the following months and selection of patients suitable for surgery is therefore still not without dispute [4]. Moreover, the results of surgery are not always favourable in terms of outcome and recurrences [5]. Depending on the exact type and extent of the herniated disc rates of recurrence (of pain), reherniation and reoperation can be as high as 38%, 27% and 21% respectively [5]. It is therefore not surprising that advancements in knowledge, imaging techniques and surgery are all continuously evaluated for their potential in the development of better treatment strategies. In addition, during the past decade a complete new area of research has evolved in medicine: Tissue engineering. The latter yields a great promise for patients suffering from symptomatic lumbar disc herniation and pioneering pre-clinical research is presented in the current thesis. Disc herniation The spinal column combines its complex mechanical function with the protection of the most delicate tissue our body harbours: the spinal cord. Failure to fulfil one of its tasks will have dramatic consequences. The spinal column consists of the bony vertebral bodies that articulate with each other by two facet joints posteriorly and the intervertebral disc (IVD) anteriorly. The 33 vertebral bodies are numbered according to their cranio-caudal position: cervical (7), thoracic (12), Lumbar (5), sacral (5) and coccygeal (4). The spinal cord, or below the first lumbar level the cauda equine, is located directly posterior of the IVD. Other borders are the pedicles laterally and the laminae and flavum ligament posteriorly. Exiting nerve roots leave the spinal canal via the intervertebral foramen, which is located between two pedicles behind the posterolateral border of the IVD and anterior of the facet joint.
General introduction
The IVD is designed to resist the compressive forces yet allowing motion in the otherwise rigid vertebral column. The IVD consists of the gelatinous nucleus pulposus (NP) surrounded by the fibrous annulus fibrosus (AF) and endplates (Figure 1). With aging, a number of changes in the IVD occur, most notably the water content and number of cells decrease, diminishing the capability to cope with its mechanical function [6]. Mechanical demands on the other hand may contribute to the degenerative cascade itself defining a potential vicious circle. The region where the highest stresses are encountered and structural degenerative changes develop most rapidly is the posterolateral part of the AF (Figure 2). Disruption of the layers of the AF at this location results in expulsion of NP material which is often referred to as disc herniation or herniated NP (HNP). When this happens, the nerve root may become trapped resulting in back pain in combination with radicular symptoms (sciatica). Rarely, but more dramatically, the herniation is located centrally resulting in compression of the cauda equine, the so-called cauda syndrome. Besides the direct neurological consequences, other changes are initiated by disc herniation due to the loss of NP material. Due to the resulting reduction in hydrostatic pressure and subsequent decrease in disc height, facet joints may become overloaded and start to degenerate. Furthermore, the disrupted homeostasis will result in a decreased cell number within the NP and the amount of water-binding proteoglycans they produce declines. This results in further loss of disc height and finally an irreversible cascade of disc degeneration. Patients suffering from an herniated lumbar IVD typically suffer from (sub)acute low back pain and radicular complaints, a condition called sciatica. The origin of the low back pain is still not fully understood, but may be generated in either the ruptured AF (which has become more innervated due to degeneration), the degenerated IVD or facet joints.
Chapter 1
Figure 1: Image of a formalin embedded healthy human IVD showing the central NP surrounded by the layers of the AF (details: see text)
10
Figure 2: Image of a human IVD a few weeks after disc herniation shows a large defect of the posterolateral AF at the left side of the picture.
Current treatment modalities The mainstay of the treatment of disc herniation has always been the removal of the herniated NP material, the so-called discectomy. These procedures are performed since the late 70-ies of the past century and are now the most performed spinal surgical procedures worldwide [7,8]. However, compared to the first described (open) discectomies, many things have been changed. Increased knowledge and the advent of the MRI in the 1990s have resulted in numerous less invasive procedures, abandoning the conventional discectomy. The gold standard nowadays is the microdiscectomy in which every type of disc herniation can be excised through a small incision and limited laminoarthrectomy [7]. An alternative procedure that shows comparable results in experienced hands is the endoscopic transforaminal discectomy [8]. Although the evolution of the conventional discectomies to less invasive procedures has resulted in a decrease of morbidity, still a significant number of patients suffer from recurrences or persisting low back pain. The outcome of patients that undergo a microdiscectomy is not better compared to patients receiving conservative treatment after 1 year follow-up [9]. Considering that the discectomy is directed towards the decompression of the nerve roots and therefore does not deal with the damaged IVD these findings may not be surprising.
11
Figure 3: schematic drawing of a lumbar discectomy
Chapter 1
Tissue Engineering In patients suffering from disc herniation, there is an (sub)acute change in mechanics and biology due to the rupture or bulging of AF and the subsequent expulsion of the NP. Although the acute episode is often preceded by some degenerative changes, most (mechanical) changes may still be reversible and the patients might therefore be favorable candidates for early disc repair. This should restore the biomechanical equilibrium within the disc, preserve local homeostasis, and prevent progressive degeneration [10]. Tissue engineering is generally described as the use of a combination of cells, engineering and materials methods, and suitable biochemical and physio-chemical factors to improve or replace biological functions [11]. As tissue engineering has quickly emerged as an area of pre-clinical research over the last decade, attractive new strategies that deal with this problem can be developed. The replacement of the lost NP tissue should not only restore local biomechanics but ideally allow disc regeneration in the long-term. To that end cells, being the factories of the extracellular matrix components, are essential. Much research has been performed by seeding scaffolds with either native or stem cells. Native IVD cells, however, are sparse and the use of stem cells requires additional harvesting procedures and time consuming techniques. Therefore the concept of in situ seeding has been proposed, meaning the use of a-cellular scaffolds that allow invasion of cells from the surrounding tissue [10]. This concept allows IVD regeneration in a single (one-step) surgical procedure. Ideally, such a scaffold further imitates the biomechanical properties of the NP, allows the invasion of surrounding native cells, and can be used in a single procedure in adjunct to microdiscectomy. Scope of the thesis In the current dissertation the concept of in situ seeding is further explored, from basic scaffold science till in vivo evaluation. In the first two chapters, scaffold stiffness, which has been shown to strongly influence the biosynthetic response of cells and thus is a crucial factor for successful IVD engineering, is studied. In chapter 2 dense collagen scaffolds are rheologically characterized to find a match in stiffness with native NP tissue. In addition, the effects of sterilization techniques, necessary for final production, are assessed. In chapter 3, another
12
frequently used scaffold material, alginate, is prepared via several techniques and densities to match to the NP. In this study we also investigate the actual effects of ranging densities on native IVD cells. For the concept of in situ seeding the migration of native cells into the scaffold material is a conditio sine qua none. Therefore the capability of IVD cells to migrate into dense collagen scaffolds is assessed in chapter 4. The remainder of the dissertation is directed to the development of an animal model to evaluate the scaffold materials in vivo. It has been discussed that the success of NP replacement therapies might be dependent on an appropriate solution to close the AF defect. In chapter 5 an extensive review is performed to find the literature in which this subject has been addressed. In chapter 6, self-developed AF closure devices are evaluated in a goat model in vitro and in vivo. The results of the collagen scaffolds that are used in addition to the closure devices in the in vivo study are presented in a separate addendum to chapter 6.
13
Chapter 1
14
References 1. Rihn JA, Hilibrand AS, Radcliff K, Kurd M, Lurie J, Blood E, Albert TJ, Weinstein JN (2011) Duration of symptoms resulting from lumbar disc herniation: Effect on treatment outcomes. J Bone Joint Surg Am 93:1906-1914 2. Schneider C, Krayenbuhl N, Landolt H (2007) Conservative treatment of lumbar disc disease: patients quality of life compared to an unexposed cohort. Acta Neuochir (Wien) 149: 785-791 3. Katz JN (2006) Lumbar disc disorders and low-back pain: socioeconomic factors and consequences. J Bone Joint Surg Am 88 (suppl 2): 21-24 4. Jacobs WC, Van Tulder M, Arts M, Rubinstein SM, Van Middelkoop M, Ostelo R, Verhagen A, Koes B, Peul WC (2011) Surgery versus conservative management of sciatica due to a lumbar herniated disc: a systematic review. Eur Spine J 20: 513-522 5. Carragee EJ, Han MY, Suen PW, Kim D (2003) Clinical outcomes after lumbar discectomy for sciatica: The effects of fragment type and anular competence. J Bone Joint Surg Am 85: 102-108 6. Chan WC, Sze KL, Samartzis D, Leung VY, Chan D (2011) Structure and biology of the intervertebral disk in health and disease. Orthop Clin North Am 42(4):447-64, vii. 7. Postacchini F, Postacchini R (2011) Operative management of lumbar disc herniation: the evolution of knowledge and surgical techniques in the last century. Acta Neurochir Suppl 108: 17-21 8. Nellesteijn J, Ostelo R, Bartels R, Peul W, Van Royen BJ, Tulder M (2010) Transforaminal endoscopic surgery for symptomatic lumbar disc herniations: a systematic review of the literature. Eur Spine J 19: 181-204 9. Peul WC, Van Houwelingen HC, Van den Hout WB, Brand R. Eekhof JA, Tans JT, Thomeer RT, Koes BW (2007) Surgery versus prolonged conservative treatment for sciatica. N Eng J Med 356: 2245-2256 10. Hegewald AA, Ringe J, Sittinger M, Rhome C (2008) Regenerative treatment strategies in spinal surgery. Front Biosci 13: 1507-1525 11. Wikipedia 2012: http://en.wikipedia.org/wiki/Tissue_engineering
2
Rheological characterization of the nucleus pulposus and dense collagen scaffolds intended for functional replacement
JL Bron GH Koenderink V Everts TH Smit
Chapter 2
16
Abstract Lumbar discectomy is an effective therapy for neurological decompression in patients suffering from sciatica due to a herniated nucleus pulposus (NP). However, high numbers of patients suffering from persisting postoperative low back pain have resulted in many strategies targeting the regeneration of the NP. For successful regeneration, the stiffness of scaffolds is increasingly recognized as a potent mechanical cue for the differentiation and biosynthetic response of (stem) cells. The aim of the current study is to characterize the viscoelastic properties of the NP and to develop dense collagen scaffolds with similar properties. The scaffolds consisted of highly dense (0.5% 12%) type I collagen matrices, prepared by plastic compression. The complex modulus of the NP was 22 kPa (at 10 rad s-1), which should agree with a scaffold with a collagen concentration of 23%. The loss tangent, indicative of energy dissipation, is higher for the NP (0.28) than for the scaffolds (0.12) and was not dependent on the collagen density. Gamma sterilization of the scaffolds increased the shear moduli but also resulted in more brittle behavior and a reduced swelling capacity. In conclusion, by tuning the collagen density, we can approach the stiffness of the NP. Therefore, dense collagen is a promising candidate for tissue engineering of the NP that deserves further study, such as the addition of other proteins.
Rheological characterization
Introduction Lumbar discectomy is a well-established surgical procedure to decompress neural structures in patients suffering from a symptomatic herniated lumbar intervertebral disc. There are, however, serious adverse effects of disc herniation and surgical evacuation on spinal biomechanics. Disc space narrowing may result in discogenic pain or cause overloading in other structures including facet joints, ligaments and muscles by altered motion [1]. The long-term sequelae after discectomy signicantly affects the quality of life of the relatively young and employed patient population and therefore has serious socio-economic consequences. This gave researchers the impetus to develop regenerative strategies that deal with the damaged intervertebral disc, especially the nucleus pulposus (NP) [2]. Scaffolds for NP replacement are enriched with stem cells, growth factors, and/or additional molecules in order to promote and utilize the regenerative potential of the human body [3]. Under physiological conditions, cells within a scaffold are able to synthesize and secrete their own extracellular matrix (ECM) [3]. Recently, it has been appreciated that their biosynthetic response is strongly affected by the stiffness of the ECM [4,5]. The stiffness of the ECM acts as a passive mechanical cue that can be more selective than soluble factors [6]. By adjusting the stiffness of the scaffold to the targeted ECM, stem cell differentiation and ECM synthesis can be directed [4,5]. The aim of this study is to mimic the elastic properties of the NP with dense collagen scaffolds. Plastic compression of collagen solutions leads to signicant densication and viscoelastic properties that closely approach those of skeletal tissue and has already been investigated for its potential in cartilage and bone engineering [7 10]. In the current study, we characterize the viscoelastic properties of the NP by rheology [11,12] and screen dense collagen type I scaffolds to determine which collagen density matches to these properties. Our overall scope is to develop a collagen scaffold that could be used in in situ therapy in patients with a herniated NP. Such a scaffold, combined with chemotactic agents, should allow the in situ recruitment of progenitor and disc cells [13]. In this concept, discomfort for patient and clinician is minimized, because the harvesting and culturing of cells prior to the surgical procedure are not necessary. Patients suffering from herniated discs could be treated in a one-step surgical procedure, in which a discectomy is combined with a functional replacement [13]
17
Chapter 2
A-cellular collagen constructs require additional sterilization steps prior to this stage. Because gamma sterilization has been described to have serious effects on collagen matrices [14], its effect on rheology and swelling capacity of the current dense collagen scaffolds is also assessed.
Materials and methods NP Specimen Preparation The lumbar spines of two mature female Dutch milk goats were harvested and stored at -20 C until the day of testing. After removal of the soft tissues and the posterior and lateral elements, the intervertebral discs at the levels T12 L1 until L5 L6 were separated from the upper and lower endplate by incision with a surgical knife. The intervertebral discs were refrozen and the annulus brosis (AF) was removed with a 9 mm circular trephine, sparing the NP. Rheological tests were performed immediately after the NP samples were thawed. After the rheological tests, the samples were weighed. The hydration status of the NP samples was determined by weighing the samples before and after freeze drying. Collagen Scaffold Preparation The collagen scaffolds were prepared by using a rat-tail type 1 collagen gel with a concentration of 6 mg/mL (0.6% w/w) collagen dissolved in 0.1% acetic acid (Arthro Kinetics AG, Esslingen, Germany). The collagen gel (8/10 volume parts) was mixed with (1/10 volume part) neutralization solution (Arthro Kinetics AG) and (1/10 volume part) Dulbeccos Modied Eagle Medium (Greiner Bio-one, Kremsmunster, Austria). Variable amounts of the mixture were poured into a cylinder (diameter 25 mm) with a polycarbonate cell culture insert (3 mm pores; Nunc GmbH, Wiesbaden, Germany) at the bottom. The cylinder was then placed in a CO2 incubator at 37.8 C for 60 min to allow polymerization of the collagen. When the collagen matrix was formed, a weight of 100 g was placed on top of the matrix in the cylinder. The cylinder was placed back into the incubator overnight for the ltration process to take place. The 3 mm pores allow uid to pass (ltrate), while retaining the collagen matrix itself (residue), thereby increasing the collagen density. The nal height of the collagen scaffolds was kept constant at 3.6 mm, and the diameter was xed by the cylinder diameter, 12.5 mm. The
18
nal collagen density was varied by changing the amount of collagen solution in the cylinders before compression. For example, 6% collagen samples were obtained by adding 10 times the volume of collagen solution (17.5 mL) to the cylinders compared to the nal sample volume (1.75 mL). For each density, ve samples were made (4 rheological examination, 1 electron microscopy). Samples were transferred directly from the cylinders to the rheometer for characterization. After the rheological measurements, all samples were weighed and the solid weight fraction was determined by freeze drying and weighing again. From each collagen density one sample was transferred immediately from the compression cylinders into 0.1 M Na-cacodylate buffer (pH 7.4) containing 4% paraformaldehyde and 1% glutaaraldehyde. After 5 days in the xative medium, the samples were cut in two equal parts for transmission electron microscopy (TEM). For electron microscopy the samples were dehydrated and embedded in epoxy resin. Ultrathin sections were made with a diamond knife, contrasted with uranyl and lead and examined in a Philips TEM. Gamma-Irradiated Samples Collagen samples, fabricated according to the protocol described above, with four densities (0.5, 3, 6, and 10%) of collagen were packaged in containers made of polyethylene lterplate and stored in sterile phosphate buffered saline at 48 C. The containers allow storage under wet conditions, yet prevent swelling of the samples. For every concentration 10 samples were made. From these samples, ve were sent to Isotron (Ede, The Netherlands) immediately after fabrication to undergo treatment with 15 kGg -irradiation according to the local medical implant sterilization protocol. All samples underwent rheological characterization 3 days after preparation. After the rheological measurements, the samples were weighed, put in 10 mL sterile water for 12 h at 48 C, and weighed again to determine the swelling capacity. The samples were nally freeze dried and weighed again.
19
Rheological Measurements The mechanical behavior of the collagen samples was assessed using a stresscontrolled rheometer (Paar Physica MCR501; Anton Paar, Graz, Austria) in parallel plate conguration (40 mm diameter, 3.5 mm gap). For the NP samples, a parallel
Chapter 2
20
plate conguration was also used (20 mm diameter, 2 3 mm gap). To prevent sample slippage, sandpaper (CP918C P180; VSM Abrasives, OFallon, MO) was attached to the plates. The discs were loaded between the plates, and the gap was closed until the sample was in good contact with both plates (normal force <1 N). The tests were performed at a temperature of 37.8 C in a humidied chamber. Three types of measurements were performed in the following order: time sweep, frequency sweep, and amplitude sweep. To exclude any timedependent relaxation during the tests, the samples were rst equilibrated for 20 min. During this time, the normal force decreased to values below 0.1 N in all samples. Subsequently, we probed the time-dependent shear moduli by performing frequency sweep measurements over an angular frequency range of 0.2 200 rad s-1 at a xed strain amplitude of 1%, well within the linear regime. Finally, the behavior of the samples at large deformations was tested by amplitude sweep tests. Strain oscillations at a xed frequency of 0.5 Hz and gradually increasing strain amplitude were applied, until a maximum of 1000% strain or until sample failure occurred. The shear modulus G*() = ()/() follows from the ratio between stress () and strain amplitude (). G*() = G+ iG is a complex quantity with an elastic storage modulus (G) and viscous loss modulus (G). The absolute magnitude of the shear modulus,G*, was calculated using G*= (G2 + G2)0,5. The ratio G/G is called the damping factor and equals the tangent of the phase angle difference between stress and strain (tan ). Data reported represent the mean from at least four replicates of each collagen sample or 11 NP samples. Because the sample diameters were smaller than the plates, the measured values had to be corrected before further evaluation. In a parallel plate conguration, values are based on measurements at the outer edge of the samples, where the strain is maximal. If the sample radius (Rsample) is smaller than the plate radius (R), the moduli are underestimated by a factor (R/Rsample)4, because the stress scales with R as 1/R3 while the strain is proportional to R. The correction factor that was applied to the data was 6.55 for the collagen samples and 24.4 for the NP samples. Statistical Analysis Differences between various sample groups were statistically analyzed using the paired t-test.
Results The mean weight of the NP samples was 210 ( 25.2) mg with a dry weight of 52.3 ( 10.9) mg, implying a water content of 75.2% ( 4.1). The mean weight of the collagen samples was 1,390 ( 81) mg, and dry weights varied from 7 to 150 mg (dependent on collagen concentration), implying a water content between 88% and 99.5%. As a control of the collagen densities after compression, real densities were calculated using test-weight and dry-weight. Real percentages of collagen ([dry-weight/test-weight] * 100%) of 3.2 ( 0.2), 6.0 ( 0.4), and 9.6 ( 0.4) were found for the 3%, 6%, and 10% collagen samples respectively. Real densities of collagen therefore did not signicantly differ from intended densities. Plastic compression resulted in collagen scaffolds with decreased water content and increased density of collagen bers. Individual bers of collagen bers were still present, but the mean spacing between bers greatly decreased upon compression, as shown by the transmission electron micrographs in Figure 1.
B 21
Figure 1: TEM images of sections of noncompressed (0.5%) (A) and a 20-fold compressed (10%) (B) collagen scaffold. The collagen fibers display characteristic periodic D-banding.
Otherwise there did not seem to be any structural changes in the length of the collagen bers or alignment. The complex modulus,G*, was slightly frequency dependent in both the NP and collagen samples, increasing at ascending frequencies, as shown in Figure 2. At a frequency of 10 rad s-1, both the elastic modulus, G , and viscous modulus, G , increased with increasing collagen concentration, as shown in Figure 3. This increase however, only occurred at collagen densities above 1.5%. Below this concentration, the shear moduli were
Chapter 2
independent of concentration. All samples showed a predominantly elastic behavior. Mean values for the loss tangent, tan (or G /G), of the NP and collagen scaffolds at an angular frequency of 10 rad s-1 are shown in Figure 4. The collagen samples were less viscous than the NP, independent of collagen concentration. During amplitude sweep experiments, the collagen samples showed a gradual decrease of G and G with increasing amplitudes, but did not fail up to strain amplitudes of 1,000%, as shown in Figure 5. Due to the sandpaper, no sample slippage was observed at high shear strains. However, minor slippage cannot be excluded at 1,000% shear strain level and the data in Figure 5 are therefore conned to 100% shear strain. Treatment with 15 kGg -irradiation resulted in a twofold increase of both G and G at small strains. Upon increasing the strain amplitude, the sterilized samples all failed between strain amplitudes of 10% and 100%, regardless of the collagen concentration. The gamma irradiated collagen samples showed a statistically signicant reduced (p < 0.05) swelling capacity when compared to the nonirradiated samples, as shown in Figure 6.
22
Figure 2: The complex shear modulus, G*, increases slightly with ascending frequency and increases with increasing collagen concentration. Each data set represents a replicate of four measurements (11 in case of the NP).
Figure 3: The elastic modulus, G, and viscous modulus, G, at an angular frequency of 10 rad s increase with collagen concentration (above 1.5% collagen) according to a power-law with exponents 1.4 (G) and 1.5 (G). Each data point represents a replicate of four measurements.
-1
23
Figure 4: The loss tangent, G/G or tan , of collagen scaffolds is independent of collagen concentration and significantly lower (*p<0.05) than that of the goat NP. Each data point represents a replicate of four measurements for collagen and 11 for the NP.
Chapter 2
Figure 5: Amplitude sweep experiments at a fixed frequency of 0.5 Hz reveal failure of the irradiated samples between strain amplitudes of 50% and 100% (black symbols), whereas no failure was observed in control (nonirradiated) samples (grey symbols). Each data set represents the mean of five measurements.
24
Figure 6: Swelling experiments reveal a statistically significant reduced (*p<0.05) swelling capacity of the -irradiated samples compared to controls. Each bar represents the mean of five measurements.
Discussion We focused on the NP from goat spines, because of the resemblance to the human situation and the suitability of this animal as a model for intervertebral disc regeneration therapies [15,16]. The viscoelastic properties of the goat NP are largely in line with earlier investigations of human [17,18], pig [19] and sheep [20] NP, as summarized in Table 1.
These ndings underscore the potential of the goat as an animal model for disc herniation studies. However, compared to the ndings of Iatridis et al. [17], in human NP, our samples showed a twofold higher elasticity and slightly lower loss tangent. This difference may be due to intrinsic rheological differences between human and goat NP tissue or to differences in the test protocol. Unfortunately, the authors do not describe testing temperature, or the plate diameter they used for the experiments and whether they had to correct for a sample-plate diameter discrepancy as we did. They did do similar processing of the NP samples before testing. The loss tangent reported for porcine lumbar NP by Causa et al. [19] agrees well with the ndings in our study, but the absolute values for G (450 Pa) and G (150 Pa) are over 30 times lower. These authors possibly did not correct for the discrepancy between plate (15 mm) and sample (7.7 mm) diameter, which would result in an under estimation of the absolute values by a factor of 15. Leahy and Hukins [20] found values for G, G, and tan for sheep NP that were comparable to those in this study. Interestingly, the authors additionally showed that freezing increases G, but does not affect G [20]. Because our samples were also frozen prior to the experiments, values for G may thus be overestimated.
25
Chapter 2
In the context of regeneration of the damaged NP, we should note that our NP samples were derived from healthy intervertebral discs. Earlier studies have shown that G increases in case of disc degeneration [18]. In this study, we used a plastic compression technique to develop collagen I-based scaffolds with varying concentrations and viscoelastic properties. This is a novel technique that was rst described by Brown et al. [21] as a form of cell-independent engineering. Central in this concept is the reduction of the liquid content of the scaffold, which is a result of the casting [21]. Plastic compression therefore yields scaffolds much denser than conventional, uncompressed collagen type I matrices. The moduli of these conventional scaffolds are typically below 1 kPa [22,23], and these scaffolds should rst grow stronger in culture [21]. Our technique of plastic compression differs from earlier studies, because we use cell culture inserts with 3 mm pores to reduce the liquid content instead of nylon and stainless steel meshes [7 10,21]. Furthermore, the dimensions of our scaffolds are much larger than reported earlier and the compression times therefore longer. The latter reduces the attractivity to enrich scaffolds with cells, which should not easily survive in such large constructs [10].
26
To our knowledge, a detailed rheological characterization of dense collagen I scaffolds, as in the current study, has not been reported previously in literature. With our dense collagen scaffolds, we are able to approach the viscoelastic properties of the NP, in particular its elasticity. The loss tangent, G/G, of the collagen matrices is lower than that of the NP, and perhaps this could be remedied by adding other components such as proteoglycans. We do not have an explanation why the moduli only reveal a density-dependence at collagen densities above 1.5%, as shown in Figure 3. Because the volume capacity of our cylinders was conned, we could not obtain higher collagen densities than 12%. The value for G* of the 12% collagen scaffold is still below the value of the NP. If we use the power law formula for the values of G* above 1.5%, we can extrapolate the collagen density that agrees with the G* value of the NP. The stiffness of the NP should than be matched by a scaffold containing 22.7% collagen. In the current study we also assessed the effects of a standard sterilization treatment, which is a regulatory requirement for the acellular dense collagen
scaffolds to be sold as a medicinal product. Gamma irradiation is the method of choice for sterilizing collagen biomaterials and is considered as the most reliable method available [14]. In this study we showed that a standard sterilization treatment with 15 kGy -irradiation results in an over twofold increase of G and also a signicant increase of G. More importantly we showed that the resistance to high amplitude strains decreases dramatically. Non-treated samples did not fail below 1,000% whereas treated samples already failed at strain amplitudes of only 50%. Plastic compression of collagen matrices results in compensatory swelling of the samples when put free oating in water, which is density dependent. This might be an advantage because it is comparable to the overnight rehydration of the NP itself that occurs when external loads on the spine cease. The rheologic properties are strongly related to the hydration state and variations due to the overnight swelling should ideally be comparable. The swelling capacity of the samples was signicantly reduced by -sterilization. The effects of -irradiation can be explained by the increase in the number of cross links and chain scission in the collagen matrix due to the g-irradiation [14,24]. Chain scission of the collagen peptide backbone results in a fraction of lower molecular weight material [24], whereas the formation of additional cross links compensates to a certain extent for this fragmentation [14]. The effects of -irradiation are dose-dependent and lowering the dosage could lower the damage, but also result in subcomplete sterilization [24]. Alternatives for -irradiation include ethylene oxide (Eto) and Ebeam sterilization [24]. However, these techniques have their own limitations and drawbacks. Eto results in decreased helix stability and slower degradation rates and potentially leaves toxic residues in the implants [25]. The effects of E-beam on collagen are less well documented, but it has shown to result in a dramatic increase of the inherent viscosity of other polymers [26]. It is therefore important to check for structural and mechanical effects of sterilization procedures during the development of implants and scaffolds. The importance of this subject is currently not always recognized, but will gain attention when tissue engineering makes the step from the developmental stage to clinical trials. Promising developments in the eld of collagen sterilization that are currently being evaluated include pulsed electric eld sterilization and the addition of free radical scavengers to the treatment with -irradiation [27,28].
27
Chapter 2
Wilke et al. [29] already showed that collagen scaffolds are capable of restoring disc height and stability after disc herniation. However, the authors also showed that the risk of dislocation of the implant across the annulus defect forms a serious problem. It seems important, therefore, to develop additional annulus closure techniques or other methods to anchor the collagen scaffold within the intervertebral disc space [29]. Our current plan is to develop a nucleus replacement composed of dense collagen that can be implanted via a small hole in the annulus, which can be closed afterwards (Fig. 7). Preclinical studies however, shall be needed to prove this concept.
Figure 7: The dense collagen scaffolds that will be used in further preclinical studies have a snakelike appearance, allowing implantation via a small annular defect. In the current picture, the implant is shown implanted in a real-sized Perspex model of the goat intervertebral disc.
28
In conclusion, we achieved close biomechanical imitation of the NP with dense collagen matrices. To better match the viscoelastic behavior, we will in the future investigate the effects of adding other components such as proteoglycans. Sterilization has important effects on the mechanical strength and rehydration capacity of the scaffold, which should be considered to prevent discrepancies between the in vitro scaffolds and nal clinical applications. Acknowledgements The authors thank R. Bank (VU University Medical Center), M. Dogterom (Amolf Institute), and K. Hoeben (Academic Medical Center) for their contributions. This study was funded by Arthro Kinetics AG, who also provided the collagen gel. G. H. K. was supported by the Stichting voor Fundamenteel Onderzoek der Materie (FOM), which is nancially supported by the Nederlandse Organisatie voor Wetenschappelijk Onderzoek (NWO).
References 1. Boyd LM, Carter AJ (2006) Injectable biomaterials and vertebral endplate treatment for repair and regeneration of the intervertebral disc. Eur Spine J 15(Suppl 3): S414-S421 2. Hegewald AA, Ringe J, Sittinger M, et al. (2008) Regenerative treatment strategies in spinal surgery. Front Biosci 13: 1507-1525 3. Richardson SM, Mobasheri A, Freemont AJ, et al. (2007) Intervertebral disc biology, degeneration and novel tissue engineering and regenerative medicine therapies. Histol Histopathol 22: 1033-1041 4. Ghosh K, Pan Z, Guan E, et al. (2007) Cell adaptation to a physiologically relevant ECM mimic with different viscoelastic properties. Biomaterials 28: 671-679 5. Zaman MH, Trapani LM, Sieminski AL, et al. (2006) Migration of tumor cells in 3D matrices is governed by matrix stiffness along with cell-matrix adhesion and proteolysis. Proc Natl Acad Sci USA 103: 10889-10894 6. Engler AJ, Sen S, Sweeney HL, et al. (2006) Matrix elasticity directs stem cell lineage specication. Cell 126: 677-689 7. Bitar M, Brown RA, Salih V, et al. (2008) Effect of cell density on osteoblastic differentiation and matrix degradation of biomimetic dense collagen scaffolds. Biomacromolecules 9: 129-135 8. Mudera V, Morgan M, Cheema U, et al. (2007) Ultra-rapid engineered collagen constructs tested in an in vivo nursery site. J Tissue Eng Regen Med 1: 192-198 9. Grad S, Gogolewski S, Alini M, et al. (2006) Effects of simple and complex motion patterns on gene expression of chondrocytes seeded in 3D scaffolds. Tissue Eng 12: 31713179 10. Nazhat SN, Neel EA, Kidane A, et al. (2007) Controlled microchannelling in dense collagen scaffolds by soluble phosphate glass bers. Biomacromolecules 8: 543-551 11. Kavanagh GM, Ross-Murphy SB. (1998) Rheological characterisation of polymer gels. Prog Polym Sci 23: 533-562 12. Smith CM, Christian JJ, Warren WL, et al. (2007) Characterizing environmental factors that impact the viability of tissue engineered constructs fabricated by a direct-write bioassembly tool. Tissue Eng 13: 373-383 13. Abbushi A, Endres M, Cabraja M, et al. (2008) Regeneration of intervertebral disc tissue by resorbable cell-free polyglycolic acid-based implants in a rabbit model of disc degeneration. Spine 33: 1527-1532 14. Friess W. (1998) Collagen-biomaterial for drug delivery. Eur J Pharm Biopharm 45: 113136 15. Smit TH (2002) The use of a quadruped as an in vivo model for the study of the spine biomechanical considerations. Eur Spine J 11: 137-144 16. Ethier DB, Cain JE, Yaszemski MJ, et al. (1994) The inuence of anulotomy selection on disc competence. A. radiographic, biomechanical, and histologic analysis. Spine 19: 2071-
29
Chapter 2
30
2076 17. Iatridis JC, Weidenbaum M, Setton LA, et al. (1996) Is the nucleus pulposus a solid or a uid? Mechanical behaviors of the nucleus pulposus of the human intervertebral disc. Spine 21: 1174-1184 18. Umehara S, Tadano S, Abumi K, et al. (1996) Effects of degeneration on the elastic modulus distribution in the lumbar intervertebral disc. Spine 21: 811-819 19. Causa F, Manto L, Borzacchiello A, et al. (2002) Spatial and structural dependence of mechanical properties of porcine intervertebral disc. J Mater Sci Mater Med 13: 12771280 20. Leahy JC, Hukins DW (2001) Viscoelastic properties of the nucleus pulposus of the intervertebral disk in compression. J. Mater Sci Mater Med 12: 689-692 21. Brown R, Wiseman M, Chuo C, et al. (2005) Ultrarapid engineering of biomemetic materials and tissues: fabrication of nano- and microstructures by plastic compression. Advanced Functional Materials 15: 1762-1770 22. Forgacs G, Newman SA, Hinner B, et al. (2003) Assembly of collagen matrices as a phase transition revealed by structural and rheologic studies. Biophys J 84: 1272-1280 23. Wu CC, Ding SJ, Wang YH, et al. (2005) Mechanical properties of collagen gels derived from rats of different ages. J. Biomater Sci Polym Ed 16: 1261-1275 24. Cheung DT, Perelman N, Tong D, et al. (1990) The effect of gamma-irradiation on collagen molecules, isolated alpha-chains, and crosslinked native bers. J Biomed Mater Res 24: 581-589 25. Olde Damink LH, Dijkstra PJ, Van Luyn MJ, et al. (1995) Inuence of ethylene oxide gas treatment on the in vitro degradation behavior of dermal sheep collagen. J Biomed Mater Res 29: 149-155 26. McManus AJ, Moser RC, Dabkowski RB, et al. (2007) Enhanced retention of polymer physical characteristics and mechanical strength of 70:30 poly(L-lactide-co-D,L-lactide) after ethylene oxide sterilization. J. Biomed Mater Res B Appl Biomater 82: 325-333 27. Seto A, Gatt CJ Jr, Dunn MG (2008) Radioprotection of tendon tissue via crosslinking and free radical scavenging. Clin Orthop Relat Res 466: 1788-1795 28. Smith S, Grifths S, Macgregor S, et al. (2009) Pulsed electric eld as a potential new method for microbial inactivation in scaffold materials for tissue engineering: The effect on collagen as a scaffold. J. Biomed Mater Res A 90: 844-841 29. Wilke HJ, Heuer F, Neidlinger-Wilke C, et al. (2006) Is a collagen scaffold for a tissue engineered nucleus replacement capable of restoring disc height and stability in an animal model? Eur Spine J 15(Suppl 3): S433-S438 30. Cloyd JM, Malhotra NR, Weng L, et al. (2007) Material properties in unconned compression of human nucleus pulposus, injectable hyaluronic acid-based hydrogels and tissue engineering scaffolds. Eur Spine J 16: 1892-1898
3
Engineering alginate for intervertebral disc repair
JL Bron LA Vonk TH Smit GH Koenderink
Chapter 3
32
Abstract Alginate is frequently studied as a scaffold for intervertebral disc (IVD) repair, since it closely mimics mechanical and cell-adhesive properties of the nucleus pulposus (NP) of the IVD. The aim of this study was to assess the relation between alginate concentration and scaffold stiffness and find preparation conditions where the viscoelastic behaviour mimics that of the NP. In addition, we measured the effect of variations in scaffold stiffness on the expression of extracellular matrix molecules specific to the NP (proteoglycans and collagen) by native NP cells. We prepared sample discs of different concentrations of alginate (1%6%) by two different methods, diffusion and in situ gelation. The stiffness increased with increasing alginate concentration, while the loss tangent (dissipative behaviour) remained constant. The diffusion samples were ten-fold stiffer than samples prepared by in situ gelation. Sample discs prepared from 2% alginate by diffusion closely matched the stiffness and loss tangent of the NP. The stiffness of all samples declined upon prolonged incubation in medium, especially for samples prepared by diffusion. The biosynthetic phenotype of native cells isolated from NPs was preserved in alginate matrices up to 4 weeks of culturing. Gene expression levels of extracellular matrix components were insensitive to alginate concentration and corresponding matrix stiffness, likely due to the poor adhesiveness of the cells to alginate. In conclusion, alginate can mimic the viscoelastic properties of the NP and preserve the biosynthetic phenotype of NP cells but certain limitations like long-term stability still have to be addressed.
Engineering alginate
Introduction Transplantation systems based on scaffolds seeded with stem cells or native cells offer a promising means to repair aged, damaged, or diseased tissues [18]. Accordingly, there has been much recent effort to design scaffolds that mimic the bioadhesive and physical characteristics of natural extracellular matrices found in tissues and can thus promote tissue-specific cell phenotype [20, 30]. A variety of tissues can already be engineered by this approach, including artery, skin, cartilage, bone, ligament, and tendon. Scaffold stiffness has been recognized as an especially important cue to guide cell differentiation and extracellular matrix (ECM) production [4,12,14] and this knowledge is now increasingly being implemented in tissue engineering strategies [13]. The mechanical characteristics of many tissues have been documented over the recent years, facilitating the development of new generations of 3D scaffolds mimicking these features [4,21]. Our own research over the past years has focused on tissue engineering strategies to repair damaged intervertebral discs (IVDs) [5-7]. The IVD is a cartilaginous structure that lies between adjacent vertebrae, where it acts as a shock absorber and allows motion of the otherwise rigid vertebral column [33]. The IVD consists of a collagenous outer annulus fibrosus (AF) which surrounds the gelatinous inner nucleus pulposus (NP). Ageing is accompanied by loss of water and proteoglycans from the gelatinous NP, which becomes more fibrous, resulting in a more rigid IVD. Although these changes are to some extent physiological, they may result in symptomatic degenerative disc disease [33]. In some patients, early degeneration of the AF may result in a posterior tear through which the NP can extrude (disc herniation), compromising the neurological structures (spine and nerve roots) that the vertebral column usually protects. The current clinical solution is to evacuate the herniated NP material (discectomy), thereby relieving the compressed nerves [17]. There are, however, serious adverse effects of disc herniation and subsequent discectomy on spinal biomechanics resulting in discogenic back pain that seriously affects the quality of life in many patients. Much research is therefore directed towards the restoration of the herniated disc either by replacement or regenerative approaches. Ideally, current discectomy procedures should be combined with the replacement of the lost NP material by a scaffold with (native or stem-) cells initiating disc regeneration instead of degeneration [17].
33
Chapter 3
In chapter 2, we showed that the mechanical properties of the NP can be mimicked using dense scaffolds of collagen I, which is a natural extracellular matrix protein [6]. The scaffold stiffness approached that of the NP, but the viscous modulus was lower. Aside from the difference in viscous behaviour, type I collagen is not an optimal replacement of the NP, which is predominantly composed of type II collagen and proteoglycans. Other 3D scaffold materials, such as alginate, agarose and chitosan, have also been studied for NP regeneration, and these might allow a closer match both from a mechanical and a biochemical point of view [15,27,35]. Alginate is most often studied since it is inexpensive and does not evoke adverse tissue reactions [27,28,32]. Alginate is a naturally occurring, water soluble polysaccharide block copolymer composed of -Lmannuronic acid (M) and -L-guluronic acid (G) that can be ionically crosslinked by divalent ions, such as calcium [25]. The resulting matrix has a stiffness which is determined by the alginate concentration and by the ratio between G and M blocks [32]. Other conditions such as gelation temperature and type of crosslinker also influence the final network structure and ensuing mechanical properties [3].
34
The aim of this study was to design alginate scaffolds with viscoelastic properties that mimic those of the NP and to assess the biosynthetic response of native NP cells. We therefore investigated the effects of variations in alginate concentration on the viscoelastic (rheological) characteristics of scaffolds. In addition, we compared two different methods of inducing alginate gelation, by diffusion and by in situ gelation. In diffusion-induced gelation, calcium ions are allowed to diffuse into the alginate gel via a porous membrane, leading to crosslinking [32]. In situ gelation is performed by mixing insoluble calcium with the alginate solution and then releasing calcium ions within the solution by enzymatically decreasing the pH level [23]. Since it has been documented that alginate scaffolds rapidly loose their stiffness in vivo [32], we monitored the time-dependent stiffness during prolonged incubation in cell culture medium. Finally, to determine whether variations in alginate concentration affect cell behaviour, we cultured native cells isolated from goat NP and annulus fibrosus (AF) in alginate beads of different alginate concentrations (2%, 4% and 6%). We monitored the gene expression levels of the main natural components of the ECM of the NP (types I and II collagen and aggrecan) up to 4 weeks. The gene expression levels were compared
to gene expression levels found in chondrocytes from articular cartilage (AC), for which extensive studies have been performed of the preservation of phenotype in alginate [10,16,29,31].
Materials and Methods Preparation of alginate sample discs by calcium diffusion Freeze dried alginate (LVCR sodium alginate, Monsanto, San Diego, CA) was dissolved in water containing 0.9 wt% sodium chloride. Alginate solutions at four different concentrations (1, 2, 4, and 6 wt%) were sterilized by autoclaving (121 C, 15 min). Sample discs were prepared by pouring 2 ml of alginate solution into tissue culture inserts (25 mm, pore size 0.4 m; Nunc, Roskilde, Denmark). The inserts were placed in Petri dishes containing an aqueous solution of 500 mM calcium chloride, and a polycarbonate filter membrane (thickness 8 mm) was placed on top, which was irrigated with 2 ml of the calcium solution. After two hours at room temperature, alginate gelation was finished and the sample discs were removed from the culture inserts. The samples intended for analysis after prolonged storage in medium were transferred to 6-well plates containing 5 ml Dulbeccos Modified Eagles Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% streptomycin, penicillin and amphotericin B (all from Gibco). The medium was refreshed every three days. Samples were assayed at three time points (0, 1 and 10 days), using five separate samples for each time point and each alginate concentration. Preparation of alginate sample discs by in situ gelation Insoluble calcium carbonate powder was mixed at a concentration of 100 mM with alginate solutions in 0.9% NaCl (2%, 4% or 6% alginate) and stirred. The mixture was acidified by adding the enzyme Glucono Delta-Lactone (GDL, Sigma Chemical Co. (St. Louis, MO)) to a final concentration of 80 mM. A volume of 2 ml of the acidified mixture was injected into the wells of 12-well (well diameter 22 mm) plates using a syringe. After 2 h at room temperature, the gelled sample discs were removed from the wells and transferred to the rheometer for analysis. The samples intended for analysis after prolonged storage in medium were transferred to 6-well plates containing 5 ml DMEM supplemented with 1%
35
Chapter 3
antibiotics. The medium was refreshed every three days. Samples were assayed at two time points (0 and 10 days), using five separate samples for each time point and each alginate concentration. The samples after 10 days of incubation showed irregular edges and were therefore reduced to a size of 20.0 mm with a cork borer. Rheometry The viscoelastic properties of the alginate discs were measured using a stresscontrolled rheometer (Paar Physica MCR501, Anton Paar, Graz, Austria) equipped with a temperature-controlled steel bottom plate and 20 or 40 mm diameter steel top plates. The alginate discs showed some variability in diameter after incubation in culture medium, due to variable degrees of shrinkage. Since variations in sample size complicate the interpretation of rheological data, we equalized the sample diameters using cork borers. Samples prepared by diffusion were reduced to a diameter of 20 mm at t = 0 and 15.4 mm for t = 1 and 10 days. In situ gelled samples were perfectly circular directly after gelation, with a diameter of 22 mm; they were measured using a 40mm top plate. After 10 days incubation, the samples showed some edge irregularities. To exclude any edge effects, the incubated samples were reduced to a diameter of 20 mm, matching the diameter of the 20 mm top plate. For samples with a diameter smaller than the diameter of the rheometer top plate, the absolute values of the shear moduli were corrected as described earlier [6]. To prevent sample slippage, self-adhesive sandpaper (CP918C P180, VSM Abrasives, OFallon, Missouri, USA) was attached to both plates. The discs were loaded between the plates, and the top plate was lowered until the sample was in good contact with both plates. The tests were performed at a temperature of 37 C in a humidified chamber. To exclude any timedependent relaxation during the tests, the samples were first equilibrated for 10 min. During this time, the normal force decreased to values below 0.25 N in all samples. Subsequently, we probed the frequency-dependent shear moduli by performing frequency sweep measurements over an angular frequency range of 0.2200 rad s1 at a strain amplitude of 1%, well within the linear regime. Finally, to test the strength of the alginate discs, we subjected them to sinusoidally oscillating shear at a fixed frequency of 0.5 Hz and gradually increasing strain amplitude, until a maximum of 1000% strain or until sample failure occurred. The shear modulus G() follows from the ratio between stress () and strain
36
amplitude (). G* is a complex quantity with an elastic (or storage) modulus (G) and viscous (or loss) modulus (G). The absolute magnitude of the shear modulus, |G*|, was calculated using |G*| = ((G)2 + (G)2)0.5. The ratio G/G is referred to as the loss tangent, since it equals the tangent of the phase angle difference between stress and strain (tan ). Data reported represent the mean +/- S.E. from 5 samples per condition. Isolation of native cells and cell culture in alginate Cartilaginous tissues were obtained from skeletally mature female Dutch milk goats (n = 8) that were sacrificed for other studies. All thoracic and lumbar intervertebral discs (IVDs, T1-L2/L6-S1) and articular cartilage (AC) from the glenohumeral joint were collected. The IVDs were dissected to separate the nucleus pulposus (NP) from the annulus fibrosus (AF). To assure an adequate cell number, tissues from two goats were mixed for every measurement. Experiments were performed in quadruplicate. The tissues were dissected and minced, and the cells were released by subjected the tissues to sequential treatments first with DMEM supplemented with 1% foetal bovine serum (FBS, HyClone, Logan, UT, USA), 100 U/ml penicillin, 100 g/ml streptomycin, 2.5 g/ml amphotericin B and 2.5% (w/v) Pronase E (Sigma, St. Louis, MO) for 1 h, then with DMEM supplemented with 25% FBS, 100 U/ml penicillin, 100 g/ml streptomycin, 2.5 g/ml amphotericin B and 0.125% (w/v) collagenase (CLS-2, Worthington, Lakewood, NJ) for 16 h at 37 C. After filtering the cell suspension through a 70 m pore size cell strainer (BD Biosciences, San Diego, CA), isolated cells were resuspended in an alginate solution (2, 4 and 6 (w/v) in 0.9% NaCl (0.2 m sterile filtered), creating a suspension of 4 106 cells/ml. The suspension was homogenized by slow pipetting and transferred to a sterile syringe. Alginate beads were formed by the diffusion method, dripping ~10 L drops of the solution from the syringe needle (26 gauge) into a calcium chloride solution (102 mM). The beads were allowed to gel by inward diffusion of Ca2+ for 10 min at ambient temperature. After washing twice in 0.9% NaCl and twice in DMEM, the alginate beads were transferred to 24-well tissue culture dishes with 10 beads per well (Greiner Bio-one, Kremsmuenster, Austria). The cells were cultured in 500 l of DMEM per well, supplemented with 10% FBS, 100 U/ml penicillin, 100 g/ml streptomycin, 2.5 g/ml amphotericin B, and 50 g/ml ascorbate-2-phosphate (Sigma). We note that our purpose is to develop a clinical procedure where freshly
37
Chapter 3
harvested cells are immediately transplanted back into the patient in an alginate scaffold. For this reason, we did not first do expansion in 2D culture, but characterized gene expression for freshly isolated cells cultured in 3D. Real-time PCR Alginate beads were dissolved in alginate dissolving buffer (55 mM Na-citrate, 0.15 M NaCl, 30 mM Na2 EDTA, pH 6.8), total RNA was isolated from the cells with the RNeasy mini kit (Qiagen, Gaithersburg, MD), and DNase I treatment was performed as described by the manufacturer to remove any contaminating genomic DNA. Total RNA (750 ng) was reverse transcribed using 250 U/ml Transcriptor Reverse Transcriptase (Roche Diagnostics, Mannheim, Germany), 0.08 U random primers (Roche diagnostics), and 1 mM of each dNTP (Invitrogen, Carlsbad, CA) in Transcriptor RT reaction buffer at 42 C for 45 min followed by inactivation of the enzyme at 80 C for 5 min. Real-time PCR reactions were performed using the SYBRGreen reaction kit according to the manufacturers instructions (Roche Diagnostics) in a LightCycler 480 (Roche Diagnostics). The Light-Cycler reactions were prepared in 20 l total volume with 7 l PCR-H2O, 0.5 l forward primer (0.2 M), 0.5 l reverse primer (0.2 M), 10 l LightCycler Mastermix (LightCycler 480 SYBR Green I Master; Roche Diagnostics), to which 2 l of 5 times diluted cDNA was added as PCR template. Primers (Invitrogen) used for real-time PCR are listed in Table 1. Specific primers were designed from sequences available in data banks, based on homology in conserved domains between human, mouse, rat, dog and cow. The amplified PCR fragment extended over at least one exon-border (except for 18S). Tyrosine 3monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (Ywhaz) and hypoxanthine 18S (ribosomal RNA) were used as housekeeping genes and the gene expression levels were normalized using a normalization factor calculated with the equation (Ywhaz x 18S). With the LightCycler software (version 4), the crossing points were assessed and plotted versus the serial dilution of known concentrations of the standards derived from each gene using the Fit Points method. PCR efficiency was calculated by LightCycler software and the data were used only if the calculated PCR efficiency was between 1.85 and 2.0.
38
Target gene Ywhaz 18S Agc Col1a1 Col2a1
Oligonucleotide sequence Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse 5' GATGAAGCCATTGCTGAACTTG 3' 5' CTATTTGTGGGACAGCATGGA 3' 5' GTAACCCGTTGAACCCCATT 3' 5' CCATCCAATCGGTAGTAGCG 3' 5' CAACTACCCGGCCATCC 3' 5' GATGGCTCTGTAATGGAACAC 3' 5' TCCAACGAGATCGAGATCC 3' 5' AAGCCGAATTCCTGGTCT 3' 5' AGGGCCAGGATGTCCGGCA 3' 5' GGGTCCCAGGTTCTCCATCT 3'
Annealing temperature (C) 56 56 57 57 56
Product size (bp) 229 151 160 191 195
Ywhaz, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide; 18S, 18S ribosomal RNA; Agc, aggrecan; Col1a1, 1(I)procollagen; Col2a1, 1(II)procollagen Table I: Primer sequences used for real time PCR
Statistical analysis For the rheological measurements, unpaired Students T-test was used for statistical analysis. P < 0.05 was considered as significant. For the real-time PCR experiments, Friedmans non-parametric rank test was used to determine statistically significant differences within an experiment. When statistically significant differences were detected, assessment of differences between individual groups was performed using Wilcoxons signed-rank test.
39
Chapter 3
Results Alginate sample discs prepared by different methods We prepared alginate discs of concentrations between 1 and 6 wt% by two different methods, namely by diffusion of Ca2+ ions from outside or by in situ release of Ca2+ from calcium carbonate inside the alginate. To characterize the viscoelastic properties, we performed small amplitude oscillatory shear tests on the alginate discs. Both series of samples became significantly stiffer with increasing alginate concentration (square symbols, upper panel Fig. 1). However, the samples prepared by diffusion (black squares) were at least ten-fold stiffer than the in situ gelated samples (grey squares) at all alginate concentrations (significant with P < 0.05). The sample-to-sample variability was higher for the diffusion series than for the in situ series, as shown by the larger error bars. This indicates that the diffusion samples were less homogeneous than the in situ gelled samples, consistent with prior observations [32]. The viscous modulus of the samples prepared by diffusion (black triangles) was also significantly larger than that of the in situ polymerized samples (grey triangles). The loss tangent (G/G) was independent of alginate concentration for the diffusion gelated samples (P > 0.05), as shown in the bottom panel of Fig. 1 (black circles). For the in situ gelled samples (grey circles), the 4% and 6% alginate samples had a significantly lower loss tangent than the 2% alginate samples (P < 0.05). The loss tangent of the samples prepared by diffusion (black circles) was significantly higher than that of samples that were gelled in situ (grey circles). These findings implicate that the diffusion samples are stiffer but also have a higher viscosity. To characterize the nonlinear viscoelastic behaviour, we subjected the alginate discs to large amplitude oscillatory shear. The alginate samples prepared by diffusion showed no appreciable linear elastic regime: their shear modulus immediately started to decrease as the strain amplitude was raised, and they failed already at strains of about 100% (black symbols in Fig. 2). In contrast, the samples prepared by in situ gelation were linearly elastic up to strains of about 10%, and thereafter gradually strain-weakened (grey symbols in Fig. 2).
40
41
Figure 1: Linear viscoelastic behaviour of alginate matrices. Upper panel: dependence of scaffold stiffness (G, squares), and viscous modulus (G, triangles), on alginate concentration (%), for samples prepared by diffusion (black symbols) and in situ gelation (grey symbols), measured at 10 rad/s. Bottom panel: dependence of the loss tangent of alginate scaffolds on alginate concentration, for samples prepared by diffusion (black circles) and in situ gelation (grey circles).
Chapter 3
42
Figure 2: Nonlinear viscoelastic response of alginate matrices to large amplitude oscillatory shear. The complex shear modulus of the alginate scaffolds is plotted as a function of strain amplitude. Samples prepared by diffusion gelation (black symbols) gradually strain-weaken and fail at approximately 100% strain, whereas in situ gelled samples (grey symbols) are linearly elastic up to 10% strain, and then gradually weaken. Symbols correspond to alginate concentrations of 2% (squares), 4% (circles), and 6% (triangles).
Stability of samples discs in cell culture medium After prolonged incubation, all samples were visibly weaker than freshly prepared samples. The samples of the lowest concentrations (1% for diffusion and 2% for in situ gelation) had even become too fragile for testing by rheology. After 1 day of incubation in cell culture medium, the diffusion samples already showed a 10% reduction in elastic and viscous modulus (black symbols, upper panel Fig. 3). The decreases of G and G were statistically significant at alginate concentrations of 2% (black squares) and 6% samples (black triangles), but not at 4% (black circles; G : P = 0.3, G : P = 0.08). After 10 days, the moduli were ten-fold lower than the original value at t = 0(P < 0.05). The samples gelled in situ also showed a significant decline in stiffness, but less (~40% compared to the initial value), than samples prepared by diffusion (~90% compared to the initial value), both at an alginate concentration of 4% (grey circles) and 6% (grey triangles), as shown in the upper panel of Fig. 3. After 10 days, there was no longer a significant difference in stiffness between alginate samples of different concentrations or prepared by different methods. As shown in the bottom panel of Fig. 3, the loss tangent of samples prepared by diffusion (black symbols) and in situ gelling (grey symbols) significantly decreased with increasing incubation time in medium, while being independent of alginate concentration (compare 2%, squares, and 4%, circles). The decrease of loss tangent of the 2% diffusion gelled samples only showed a non-significant decline in the loss tangent after 10 days compared to day 0 and 1 (P = 0.07 and P = 0.16). After 10 days, the loss tangents of all samples were statistically indistinguishable.
43
Chapter 3
44
Figure 3: Time-dependence of the linear viscoelastic behaviour of alginate matrices stored in cell culture medium. Upper panel: the complex shear modulus of alginate discs prepared by diffusion gelation (black symbols) or in situ gelling (grey symbols) upon incubation in cell culture medium for 1 and 10 days (at 10 rad/s). Symbols correspond to alginate concentrations of 2% (squares), 4% (circles), and 6% (triangles). After 10 days, no significant differences in stiffness remain. Bottom panel: loss tangent of alginate discs upon incubation in cell culture medium for 1 and 10 days (measured at a frequency of 10 rad/s).
ECM gene expression To assess the influence of the alginate matrices on the biosynthetic phenotype of native tissue cells, we cultured NP, AC, and AF cells isolated from goat IVDs and cartilage inside alginate beads with concentrations of 2%6% alginate. We measured the expression levels of NP-specific extracellular matrix components (collagen types I and II and aggrecan) by real-time PCR. Cells freshly isolated from the AF showed the highest level of type I collagen gene expression and chondrocytes from AC showed the lowest expression level (Fig. 4, T = 0; differences statistically significant with p < 0.05). Upon culturing in alginate beads, there was an increase in type I collagen gene expression by all the cells after 1 week (p < 0.001) which was sustained after 2 and 4 weeks (Fig. 4). However, this increase was not significantly influenced by the alginate concentration over a range of 2%6% (p > 0.05). The increase in gene expression of type I collagen was strongest for the NP cells. After 4 weeks of culture, the expression level of type I collagen for NP cells was similar to the levels found in AF cells (p = 0.08). The levels found in AC cells consistently remained the lowest (p < 0.05). The highest type II collagen gene expression levels directly after cell isolation were found in AC cells and the lowest in AF cells (Fig. 5 T = 0; differences statistically significant with p < 0.05). The gene expression level of type II collagen for all cell types was decreased significantly after 1 week of culture in alginate (p < 0.001), but thereafter remained constant (Fig. 5, p > 0.3). Levels of type II collagen expression remained the lowest in AF cells (p < 0.05), while NP and AC cells had similar levels of expression after 1 or more weeks culturing in alginate (p = 0.067). Levels of aggrecan gene expression were highest for NP cells after isolation (Fig. 6 T = 0, p < 0.05). Culture in alginate led to a steady decrease of the aggrecan gene expression levels of all three cell types, which was already noticeable after 1 week (p < 0.001). NP cells had higher aggrecan gene expression levels than AF and AC cells (p < 0.05). No significant differences in the gene expression levels for type I and II collagen and aggrecan could be found in any of the cell populations when cultured in beads with alginate concentrations of 2% (white bars), 4% (grey bars), or 6% (black bars) (Figs. 46; p > 0.05).
45
Chapter 3
46
Figure 4: Gene expression levels for type I collagen of native cells cultured in alginate matrices. Realtime PCR was performed on reverse-transcribed RNA isolated from cells derived from the NP, AF and AC of goat intervertebral discs after 0, 7, 14, and 28 days of culture in alginate beads with a concentration of 2% (white bars), 4% (grey bars) and 6% (black bars). The gene expression level of type I collagen (Col1a1) is normalized by the expression levels of two housekeeping genes (2hk). Data are shown as mean SD. Differences between NP, AF, and AC cells are statistically significant with p < 0.05 at all time points and alginate concentrations (except for NPAF in Fig. 4(D), p = 0.08). The dependence on alginate concentration for each cell type is not statistically significant (p > 0.05). Changes with time are significant for all cells on going from T = 0 to later time points (p < 0.001), and for NP cells there is a significant increase between T = 1 week to 4 weeks (p = 0.03). Otherwise, there are no statistically significant time changes.
47
Figure 5: Gene expression levels for type II collagen of native cells cultured in alginate matrices. Realtime PCR was performed on reverse-transcribed RNA isolated from cells derived from the NP, AF and AC of goat intervertebral discs after 0, 7, 14, and 28 days of culture in alginate beads with a concentration of 2% (white bars), 4% (grey bars) and 6% (black bars). The gene expression level of type II collagen (Col2a1) is normalized by the expression levels of two housekeeping genes (2hk). Data are shown as mean SD. Differences between NP, AF, and AC cells are statistically significant with p < 0.05 at all time points and alginate concentrations (except for NP-AC in Fig. 4(B), p = 0.067). The dependence on alginate concentration for each cell type is not statistically significant (p > 0.05). There is only a significant change with time for all cells on going from T = 0 to T = 1 or more weeks (p < 0.001).
Chapter 3
48
Figure 6: Gene expression levels for aggrecan of native cells cultured in alginate matrices. Real-time PCR was performed on reverse-transcribed RNA isolated from cells derived from the NP, AF and AC of goat intervertebral discs after 0, 7, 14, and 28 days of culture in alginate beads with a concentration of 2% (white bars), 4% (grey bars) and 6% (black bars). The gene expression level of aggrecan (Acan) is normalized by the expression levels of two housekeeping genes (2hk). Data are shown as mean SD. Differences between NP, AF, and AC cells are statistically significant with p < 0.05 at all time points and alginate concentrations. The dependence on alginate concentration for each cell type is not statistically significant (p > 0.05). There is only a significant change with time for all cells on going from T = 0 to T = 1 or more weeks (p < 0.001) and for the AC cells between week 2 and 4 (p = 0.002).
Discussion The principal aim of the current study was to design alginate scaffolds with viscoelastic properties that mimic those of the NP. We showed that the stiffness of alginate scaffolds, crosslinked by diffusion of calcium into the alginate solution, can be varied over two orders of magnitude (between 1 kPa and almost 100 kPa) by varying the alginate concentration. The loss tangent was not affected by variations in polymer concentration. The closest matching of the stiffness as well as loss tangent of a healthy NP, which has a stiffness of 11 kPa and loss tangent of about 0.24 [21], was found for 2% alginate scaffolds. Other cartilaginous tissues are stiffer than even the most concentrated alginate discs (6%) (Table 2). It is difficult to prepare more concentrated alginate discs because the high viscosity of the pre-gelled solution renders it difficult to process and mould the gel and to mix in cells [3]. However, this difficulty may be counteracted by stirring the alginate solutions, which are shear-thinning [3]. Moreover, the stiffness of alginate scaffolds may be tuned by other factors, such as the alginate source, G/M ratio, cross linker type, and temperature [3,23,27,32]. However, these factors are not always accessible for manipulation in the context of tissue engineering. The G/M ratio depends on alginate source and processing and is therefore usually fixed upon delivery [23,25]. Changes in Ca2+ concentration and temperature influence gelation time and thereby matrix organization and stiffness [3], but these variations are not always well tolerated by seeded cells. We also compared samples derived by diffusion gelation to samples prepared by in situ release of Ca2+ [32].
49
Chapter 3
The in situ method has several practical advantages over the diffusion method for clinical applications in tissue engineering. The liquid solution can be injected via a syringe and gelation occurs inside the tissue of interest. Moreover, in situ gelation results in more homogeneous scaffolds with less spatial and sample tosample variation in biomechanical properties. Scaffolds prepared by diffusion are notoriously inhomogeneous due to the diffusion kinetics of calcium ions. Although we prepared the diffusion scaffolds under standardized circumstances, the structural inhomogeneity appeared to affect the rheology and may have affected cell phenotype. The stiffness of alginate samples prepared by in situ gelation was much lower than that of the diffusion samples, consistent with prior findings [28]. To assess the applicability of alginate discs for IVD repair, it is also crucial to characterize the biological response of native tissue cells to prolonged culture in an alginate matrix. We therefore screened the effects of alginate scaffolds (prepared by diffusion) on native cells by measuring gene expression of extracellular matrix components that are naturally present in the NP. The relative gene expression levels for types I and II collagen found in native IVD cells after isolation is in line with the well-known collagenous composition of these tissues [1]. The AF contains a mixture of type I and II collagen, the NP contains more type II collagen than the AF, and the AC contains predominantly type II collagen [1,22]. Aside from collagens, proteoglycans (mainly aggrecan) are the main components of cartilage. The NP contains the highest amount of proteoglycans and the AF the lowest amount [1,22]. This is reflected by the high gene expression levels of aggrecan seen in native NP cells and the low levels found in native AF cells. The differences found between the cell populations after isolation were mostly maintained during culture in alginate beads, suggesting that alginate preserves the phenotypical characteristics of the cells. Although we observed a decrease in the gene expression levels of type II collagen and aggrecan during culture in alginate beads, it has been reported that AC and IVD cells do produce considerable amounts of both proteins under these culture conditions [8,16,31,37]. In contrast, cells cultured on polystyrene dishes lose the ability to synthesize aggrecan and type II collagen and start to produce more type I collagen [9]. We did not observe any effect of variations in the alginate concentration on gene expression levels of type I and type II collagen or aggrecan by NP, AF or AC cells cultured within alginate gels (Figs. 46). This observation is in contrast with
50
observations on other cell types cultured on top of flat elastic hydrogels, where a pronounced influence of matrix stiffness on ECM synthesis has been documented [4]. However, a requirement for a stiffness-responsive cell phenotype is that the cell adheres to the scaffold material via integrin adhesions so that the cell can exert traction forces to the matrix by actomyosin contractility [13]. Cells have no integrin receptors for alginate and therefore adhere very weakly to alginate matrices [3]. They can therefore not actively respond to matrix stiffness via focal adhesion sites. Several methods to promote cell attachment to alginate matrices are currently being studied; for instance, by coupling of extracellular matrix proteins such as laminin, collagen, fibronectin, or RGD peptides [2,3,11,19]. We note that another reason for the lack of sensitivity to matrix stiffness observed in our study may be the rapid reduction of matrix stiffness upon prolonged exposure to cell culture medium. Similarly, it has been documented that alginate scaffolds rapidly soften after implantation in vivo [32]. This softening has been attributed to the loss of divalent crosslinking cations at neutral pH [3]. In our study, we observed a 10% decline in stiffness after 1 day and a ten-fold decline after 10 days in medium in samples prepared by diffusion (Fig. 3). The in situ gelled samples softened less in medium, but were much softer than samples prepared by diffusion to begin with, so that their stiffness after 10 days was similar to that of the diffusion samples. The consequence of the loss of stiffness is that the 2% alginate scaffold no longer matched the stiffness of the NP after 10 days. Moreover, even the stiffness of the 6% alginate scaffolds was lower than that of the NP after 10 days. Several methods to prevent the loss of stiffness during storage in medium have been reported. Arguably the most straightforward method is to supplement Ca2+ to the medium. However, this strategy is not attractive in the context of NP regeneration, where chondrogenic differentiation is required, since calcium has osteogenic effects. Moreover, the Ca2+ concentration of the environment is difficult to control after in vivo implantation. An alternative strategy is the addition of cationic polyethyleneimine to alginate to increase the resistance to de-crosslinking [23,24]. Finally, the addition of cells is known to have stabilizing effects on the alginate matrix [3]. We could not test this stabilizing effect with native IVD cells, because there were not enough cells available for the large sample sizes required for rheology. In fact, limited availability of cells is also a limiting factor for IVD
51
Chapter 3
engineering with native cells [5]. In patients, the availability of IVD tissue for digestion is even less than in our study, in which we used pooled IVDs derived from goat thoracic spines. An attractive alternative is the use of mesenchymal stem cells [30], but differentiation towards NP or AF phenotypes is still not fully directional [5]. Furthermore, specific phenotypic markers to distinguish both cell types are currently being elucidated [26,34,36,37]. In conclusion, we showed that the stiffness of alginate scaffolds can be varied by tuning the alginate polymer concentration and can be matched to the stiffness of the NP. Moreover, the biosynthetic phenotype of native IVD cells is maintained upon prolonged culture in alginate matrices. There are still some practical limitations that need to be solved, specifically the long-term mechanical stability in vivo, the bioadhesive properties, and the availability of tissue cells from the patient. Current study underscores the potential of alginate as a scaffold material for IVD engineering, but more importantly reveals some important limitations, which in spite of many promising research over the past decade, still have to be overcome.
52
References 1. Almarza AJ, Athanasiou KA (2004) Design characteristics for the tissue engineering of cartilaginous tissues. Ann Biomed Eng 32: 2-17 2. Alsberg E, Anderson KW, Albeiruti A, Franceschi RT, Mooney DJ (2001) Cell-interactive alginate hydrogels for bone tissue engineering. J Dent Res 80: 2025-2029 3. Augst AD, Kong HJ, Mooney DJ (2006) Alginate hydrogels as biomaterials. Macromol Biosci 6: 623-633 4. Breuls RG, Jiya TU, Smit TH (2008) Scaffold stiffness influences cell behavior: opportunities for skeletal tissue engineering. Open Orthop J 2: 103:109 5. Bron JL, Helder MN, Meisel HJ, Van Royen BJ, Smit TH (2009) Repair, regenerative and supportive therapies of the annulus fibrosus: achievements and challenges. Eur Spine J 18: 301-313 6. Bron JL, Koenderink GH, Everts V, Smit TH (2009) Rheological characterization of the nucleus pulposus and dense collagen scaffolds intended for functional replacement. J Orthop Res 27: 620-626 7. Bron JL, Van der Veen AJ, Helder MN, Van Royen BJ, Smit TH (2010) Biomechanical and in vivo evaluation of experimental closure devices of the annulus fibrosus designed for a goat nucleus replacement model. Eur Spine J 19: 1347-1355 8. Chubinskaya S, Huch K, Schulze M, Otten L, Aydelotte MB, Cole AA (2001) Gene expression by human articular chondrocytes cultured in alginate beads. J Histochem Cytochem 49: 1211-1220 9. Darling EM, Athanasiou KA (2005) Rapid phenotypic changes in passaged articular chondrocyte subpopulations. J Orthop Res 23: 425-432 10. De CF, Lesur C, Pastoureau P, Caliez A, Sabatini M (2004) Culture of chondrocytes in alginate beads. Methods Mol Biol 100: 15-22 11. Degala S, Zipfel WR, Bonassar LJ (2011) Chondrocyte calcium signaling in response to fluid flow is regulated by matrix adhesion in 3-D alginate scaffolds. Arch Biochem Biophys 505: 112-117 12. Discher DE, Janmey P, Wang YL (2005) Tissue cells feel and respond to the stiffness of their substrate. Science 310: 1139-1143 13. Discher DE, Mooney DJ, Zandstra PW (2009) Growth factors, matrices, and forces combine and control stem cells. Science 324: 1673-1677 14. Engler AJ, Sweeney HL, Discher DE, Schwarzbauer JE (2007) Extracellular matrix elasticity directs stem cell differentiation. J Musculoskelet Neuronal Interact 7: 335 15. Gruber HE, Fisher Jr EC, Desai B, Stasky AA, Hoelscher G, Hanley Jr EN (1997) Human intervertebral disc cells from the annulus: three-dimensional culture in agarose or alginate and responsiveness to TGF-beta1. Exp Cell Res 235: 13-21 16. Hauselmann HJ, Fernandes RJ, Mok SS, Schmid TM, Block JA, Aydelotte MB, Kuettner KE, Thonar EJ (1994) Phenotypic stability of bovine articular chondrocytes after
53
Chapter 3
54
long-term culture in alginate beads. J Cell Sci 107 (Pt. 1): 17-27 17. Hegewald AA, Ringe J, Sittinger M, Thome C (2008) Regenerative treatment strategies in spinal surgery. Front Biosci 13: 1507-1525 18. Hubbell JA (2003) Materials as morphogenetic guides in tissue engineering. Curr Opin Biotechnol 14: 551-558 19. Huebsch N, Arany PR, Mao AS, Shvartsman D, Ali OA, Bencherif SA, Rivera-Feliciano J, Mooney DJ (2010) Harnessing traction-mediated manipulation of the cell/matrix interface to control stem-cell fate. Nat Mater 9: 518-526 20. Huebsch N, Mooney DJ (2009) Inspiration and application in the evolution of biomaterials. Nature 462: 426-432 21. Iatridis JC, Weidenbaum M, Setton LA, Mow VC (1996) Is the nucleus pulposus a solid or a fluid? Mechanical behaviors of the nucleus pulposus of the human intervertebral disc. Spine 21: 11741184 (Phila Pa 1976) 22. Kuettner KE, Cole AA (2005) Cartilage degeneration in different human joints. Osteoarthr Cartilage 13: 93-103 23. Kuo CK, Ma PX (2001) Ionically crosslinked alginate hydrogels as scaffolds for tissue engineering: part 1. Structure, gelation rate and mechanical properties. Biomaterials 22: 511-521 24. Kuo CK, Ma PX (2008) Maintaining dimensions and mechanical properties of ionically crosslinked alginate hydrogel scaffolds in vitro. J Biomed Mater Res Part A 84: 899907 25. Larsen B, Haug A (1971) Biosynthesis of alginate. 1. Composition and structure of alginate produced by Azotobacter vinelandii (Lipman). Carbohydr Res 17: 287-296 26. Lee CR, Sakai D, Nakai T, Toyama K, Mochida J, Alini M, Grad S (2007) A phenotypic comparison of intervertebral disc and articular cartilage cells in the rat. Eur Spine J 16: 2174-2185 27. Leone G, Torricelli P, Chiumiento A, Facchini A, Barbucci R (2008) Amidic alginate hydrogel for nucleus pulposus replacement. J Biomed Mater Res Part A 84: 391-401 28. Li Z, Gunn J, Chen MH, Cooper A, Zhang M (2008) On-site alginate gelation for enhanced cell proliferation and uniform distribution in porous scaffolds. J Biomed Mater Res Part A 86: 552-559 29. Lin YJ, Yen CN, Hu YC, Wu YC, Liao CJ, Chu IM (2009) Chondrocytes culture in threedimensional porous alginate scaffolds enhanced cell proliferation, matrix synthesis and gene expression. J Biomed Mater Res Part A 88: 23-33 30. Lutolf MP, Gilbert PM, Blau HM (2009) Designing materials to direct stem-cell fate. Nature 462: 433-441 31. Masuda K, Sah RL, Hejna MJ, Thonar EJ (2003) A novel twostep method for the formation of tissue-engineered cartilage by mature bovine chondrocytes: the alginaterecoveredchondrocyte (ARC) method. J Orthop Res 21: 139-148
32. Nunamaker EA, Purcell EK, Kipke DR (2007) In vivo stability and biocompatibility of implanted calcium alginate disks. J Biomed Mater Res Part A 83: 1128-1137 33. Roberts S, Evans H, Trivedi J, Menage J (2006) Histology and pathology of the human intervertebral disc. J Bone Joint Surg Am 88 (Suppl. 2): 10-14 34. Rutges J, Creemers LB, Dhert W, Milz S, Sakai D, Mochida J, Alini M, Grad S (2010) Variations in gene and protein expression in human nucleus pulposus in comparison with annulus fibrosus and cartilage cells: potential associations with aging and degeneration. Osteoarthr Cartilage 18: 416-423 35. Saad L, Spector M (2004) Effects of collagen type on the behavior of adult canine annulus fibrosus cells in collagenglycosaminoglycan scaffolds. J Biomed Mater Res Part A 71: 233-241 36. Sakai D, Nakai T, Mochida J, Alini M, Grad S (2009) Differential phenotype of intervertebral disc cells: microarray and immunohistochemical analysis of canine nucleus pulposus and anulus fibrosus. Spine 34: 1448-1456 (Phila Pa 1976) 37. Vonk LA, Kroeze RJ, Doulabi BZ, Hoogendoorn RJ, Huang C, Helder MN, Everts V, Bank RA (2010) Caprine articular, meniscus and intervertebral disc cartilage: an integral analysis of collagen network and chondrocytes. Matrix Biol 29: 209-218
55
Chapter 3
56
4
Migration of intervertebral disc cells into dense collagen scaffolds intended for functional replacement.
J L Bron HW Mulder LA Vonk BZ Doulabi MJ Oudhoff TH Smit
Chapter 4
Abstract Invasion of cells from surrounding tissues is a crucial step for regeneration when using a-cellular scaffolds as a replacement of the nucleus pulposus (NP). Aim of the current study was to assess whether NP and surrounding annulus fibrosus (AF) cells are capable of migrating into dense collagen scaffolds. We seeded freshly harvested caprine NP and AF cells onto scaffolds consisting of 1.5 and 3.0% type I collagen matrices, prepared by plastic compression, to assess cell invasion. The migration distance was dependent both on time and on collagen density and was higher for NP (25% of scaffold thickness) compared to AF (10%) cells after 4 weeks. Migration distance was not enhanced by Hst-2, a peptide derived from saliva known to enhance fibroblast migration, and this was confirmed in a scratch assay. In conclusion, we revealed invasion of cells into dense collagen scaffolds and therewith encouraging first steps towards the use of a-cellular scaffolds for NP replacement.
58
Migration of intervertebral disc cells
Introduction Lumbar discectomy is an effective therapy for neurological decompression in patients suffering from a herniated nucleus pulposus (NP). Discectomies however, do not deal with the damaged intervertebral disc (IVD) and may even further aggravate existing damage [17]. In the majority of the patients, radiological signs of disc degeneration are present after 2 years [18]. It is therefore not surprising, that after a successful decompression, many patients suffer from persisting or progressive low back pain. After 10 years follow-up, almost one third of the patients are dissatisfied and a quarter underwent re-surgery in the meantime [5, 9, 16, 29]. During the last decade, increasing knowledge and technical advancements in the field of tissue engineering have resulted in numerous promising strategies to replace or regenerate the NP [17, 20]. Materials that have been used include collagen, chitosan, alginate and fibrin [13, 6, 7, 19, 32]. All of them have their own advantages, disadvantages, and clinical potential. In chapter 2, we showed that with very dense collagen scaffolds (23% or ~230 mg/mL), prepared by plastic compression, the viscoelastic properties of native NP tissue can be approached [6]. Scaffold stiffness is increasingly recognized as a potent mechanical cue for the differentiation and biosynthetic response of (stem) cells [4, 6, 1012, 14]. Our overall goal is to develop a-cellular collagen scaffolds that can be used to replace the NP in one surgical procedure combined with a discectomy. The scaffolds should prevent the degenerative cascade of the intervertebral disc and surrounding structures, which is initiated directly after disc herniation. Furthermore, restoration of the biomechanical properties should facilitate regeneration of the herniated disc. The advantage of using an a-cellular scaffold is the absence of time-consuming and expensive cell harvesting and culturing techniques during surgery. Instead, cells from the surrounding tissue are hypothesized to migrate into the scaffold thereby digesting the scaffold and secreting their own native extra cellular matrix (ECM) [6, 17]. The invasion of cells, also called in situ seeding, should occur from tissues that are in direct contact with the scaffold and thus only include the remnants of the NP and the surrounding annulus fibrosus (AF) [5]. The aim of the current study is to investigate if AF and NP cells are actually capable of migrating into dense collagen scaffolds. We investigate the migration of cells into scaffolds with densities of 1.5% (~15 mg/mL) and 3.0% (~30 mg/mL)
59
Chapter 4
collagen. Since the spaces between collagen fibers in dense collagen matrices are too small for cells to pass (Fig. 1), migration is expected to occur only in the presence of some matrix breakdown. We therefore studied the presence of Endo180, a receptor involved in the uptake for intra-cellular degradation of collagen and migration of the cells [31]. We also studied if migration can be enhanced by the use of a chemotactic agent. For this purpose we used Histatin-2, a peptide derived from saliva, which was recently discovered to have chemo attractive properties on fibroblasts [23, 24]. The migratory effects of Histatin-2 are finally confirmed in a scratch assay, which is a more sensitive and reproducible model to detect migration [8].
60 A B
Figure 1: Transmission electron microscopic pictures of the collagen scaffolds; a. Uncompressed 0.5% (~5 mg/mL), b. Compressed 1.5% (~15 mg/mL) and c. Compressed 3% (~30 mg/mL). The spaces between individual collagen fibers can be estimated from the bars in the lower right hand corners (500 nm)
Materials and methods Cell isolation and culturing Cells of the AF and the NP were isolated from the thoracic spines of mature female Dutch milk goats. The IVDs were carefully excised from the endplates and separated into the AF and NP by knife. The tissues were minced and digested under gentle shaking at 37 C in medium composed of Dulbeccos Modified Eagles Medium (DMEM, Invitrogen, Carlsbad, Ca, USA) supplemented with 500 g/ml streptomycin (Sigma-Aldrich, St. Louis, MO, USA), 600 g/ml penicillin (SigmaAldrich, St. Louis, MO, USA) and 2.5 g/ml amphotericin B (Fungizone, SigmaAldrich, St. Louis, MO, USA) in the presence of 2.5 % (w/v) pronase E (SigmaAldrich, St. Louis, MO, USA) (digestion of the NP) or 5% (w/v) pronase E (digestion of the AF). After 1 hour a solution of medium, fetal calf serum (FCS, HyClone, South Logan UT, USA) and liberase (Roche, Mannheim Germany) was added. The final concentration of liberase was 0.125% (w/v) for digestion of the NP and 0.25 % (w/v) for digestion of the AF. The final concentration FCS was 5% for both types of tissue. Tissue was digested overnight (stirring, 37 C). All digests were filtered through a cell strainer (100 m pores, BD Falcon, San Jose, CA, USA). After centrifuging for 10 minutes at 600 RCF, the cells were rinsed in medium containing 10% FCS. Additionally, the cells that were used in the threedimensional migration experiments were stained with 5 M DiI (absorption = 553 nm, emission= 570 nm, Molecular Probes, Carlsbad, Ca, USA) for 20 minutes (37 C, 5% CO2) and washed twice in phosphate buffered saline (PBS Invitrogen, Carlsbad, Ca, USA). The cells were then resuspended in medium containing 10% FCS and 50 g/ml ascorbic acid (Merck Biosciences, Sandiago, CA, USA), which will be referred to as IVD cell medium. Preparation of the collagen scaffolds Dense collagen scaffolds were prepared by plastic compression, as described in chapter 2. Briefly, a collagen solution (6 mg/ml, Arthro Kinetics, Esslingen, Germany) was neutralized, moulded in a cylinder with a cell culture insert on the bottom, and then polymerized in an incubator (37 C, 5% CO2) for 90 minutes. Then a stamp was put on top of the matrix and the cylinder was put in the incubator overnight. The pores of the cell culture inserts allow the fluid to pass and retain the collagen matrix thereby increasing its density. The scaffold had a
61
Chapter 4
final height of 3.6 mm and a circular shape (diameter 25 mm, similar to the cylinders). Scaffolds were prepared in two densities, 1.5 and 3% collagen (Fig 2). Histatin-2 synthesis Peptides were synthesized by solid-phase peptide synthesis by Fmoc chemistry with a MilliGen 9050 peptide synthesizer (Milligen-Bioresearch, Bredford, MA, USA). Purification by reversed phase high performance liquid chromatography (RP_HPLC) and confirmation of authenticity by mass spectrometry (MS) were conducted as described previously [23,28]. The amino-acid sequence of Histatin 2 (Hst2) is RKFHEKHHSHREFPFYGDYGSNYLYDN. In addition, a dextro nantiomer, DHst2 was synthesized, which was shown to lack migratory effect (23). The sequence is the same, but made with D-amino acids. Scaffold migration experiments After the removal of the cell culture inserts together with the scaffolds from the cylinders, they were transferred to the wells of a six-well plate filled with 1.5 ml IVD cell medium. This arrangement is shown in Figure 2. A plexiglass ring was placed inside the filter to prevent the leakage of medium from the upper side of the scaffold into the well. To obtain a sufficient number of cells, the cells acquired from two different donors were mixed and 300k of these mixed cells were seeded on top of each scaffold. These cells were suspended in 0.5 ml IVD cell medium. Every day 0.5 ml IVD cell medium was added on top of the scaffold, compensating for the evaporation of the medium and also maintaining the chemotactic gradient. The medium inside the well was replaced twice a week. Cells were incubated for two or four weeks at 37 C and 5% CO2. For the chemotactic experiments, the medium inside the well contained 50 g/ml Hst2 or D-Hst2. During the incubation period, samples were visualized weekly using a Bio-Rad MRC-1000 UV confocal system attached to an inverted microscope (Leica Microsystems)
62
Figure 2: Schematic presentation of the set up used for the migration experiments. First collagen scaffold are made by plastic compression in a cylinder with a cell culture insert used as a filter on the bottom (A). The filter is then transferred to a culture well and cells are seeded on top of the scaffolds (B).
63
Histology After the incubation period, the scaffolds were fixed with 4% formaldehyde and stored at 4 C overnight. The scaffolds were cut in half and one half was dehydrated in a graded series of ethanol solutions, followed by xylene, and at last the scaffold was embedded in paraffin. Sections of 7 m thickness were prepared orthogonal to the seeding plane. After deparaffinization of the sections with xylene substitute and hydration in a declining series of ethanol solutions, sections were stained with haematoxylin for 20 minutes, followed by eosin for 1 minute. Sections were dehydrated in a series of ethanol solutions, transferred into xylene and coverslipped. A bright-field microscope (Leica Microsystems, Bannockburn, IL, USA) was used to visualize the sections. When the scaffold was too broad to be visualized in a single view, two pictures with sufficient overlap were taken. An overlay of these pictures was made using Photoshop (Adobe, San Jose, CA, USA).
Chapter 4
The pictures were read into Matlab (The MathWorks Inc., Eindhoven, The Netherlands). The level of migration M is defined by: M= d/w x100%, where d is the distance travelled by the cells and w is the width of the scaffold (Fig 3). Relative migration was used as a measure of migration because of deformations that where introduced in the scaffolds during the incubation period and fixation process. The migration in a scaffold is calculated as the mean of four measuruments at different positions in the scaffold. In turn, the migration for each different condition is the mean of the triple experiments. The standard deviation per condition is calculated as the root of the sum of the squared standard deviations of each individual scaffold. Only samples in which at least at two different positions migration could be determined are included in the analysis.
64
Figure 3: Examples of 1.5 % collagen scaffolds seeded with AF (A) and NP (B) cells after 28 days of migration (Stain: Haematoxylin eosin. Magnification x20)
Immunohistology A custom made rabbit polyclonal antibody (B.Z.D.) directed against KLH-coupled linear synthetic peptide C-GTDVREPDDSPQGRRE corresponding to the hinge domain between two adjacent Ctype lectin-like domains (CTLDs) of ENDO 180 protein was used to verify the presence of Endo180 in the cells. Preliminary sections were deparaffinized with xylene substitute and hydrated in a declining series of ethanol solutions. The sections were then treated with proteinase K to retrieve the antigen (10 g/ml, Merck, Darmstadt, Germany) for 30 minutes and washed three times with PBS. Subsequently, sections were incubated for 10
minutes with 3% hydrogen peroxide in methanol to block endogenous peroxidase activity and washed again with PBS. Sections were incubated with blocking solution (Zymed Laboratories, San Francisco, CA, USA) for 30 minutes and incubated with affinity purified primary antibody (1,3 g/ml) for 30 minutes at room temperature followed by incubation overnight at 4 oC. Universal negative control (rabbit antibodies, Dako) was used as negative control. Next day sections were washed with a solution of TBS, 0.25% BSA and 0.5% Triton X-100 and incubated for 30 minutes with 1:500 diluted HRP-labelled sheep anti-rabbit secondary antibody (Dako). After washing with PBS, sections were incubated for 15 minutes with 3,3-diaminobenzidine (DAB) and hydrogen peroxide (peroxidase substrate kit DAB, Vector Laboratories, Burlingame, CA, USA) and washed in distilled water. Sections were counterstained with Mayers haematoxylin or 2 minutes. Scratch assay The effects of Hst2 on the migration of AF and NP cells were also examined in a 2D scratch assay. In 48-well plates, 25,000 cells were seeded and cultured until confluence in IVD cell medium. After five hours of serum deprivation a scratch was made using a sterile blue pipette tip. The following conditions were tested: IVD cell medium without serum, IVD cell medium without serum containing 10, 50 or 100 g/ml Hst2 or 50 g/ml D-Hst2, and IVD cell medium. The scratch was photographed at the day of creation (day 0) and after two days. For each sample the surface area of the scratch was determined in the open source software ImageJ. Per donor the mean of the experiments performed in triplicate was calculated. From these mean values relative closure (RC) was calculated as described by Oudhoff et al. [23] and given by: RC
65
X0 X2 . X0 is the mean SF0 SF2
surface area of the scratch in a specified condition at day 0 and X2 is the mean surface area at the second day. SF0 is the mean surface area of the scratch in serum free medium at day 0 and SF2 is the mean surface area after two days of exposure to serum free medium. Cells were fixed for 20 minutes in 4% paraformaldehyde and stained with ALEXA-conjugated phalloidin (5 U/ml, Molecular Probes) for 1 hour in a dark environment. In addition to the actin staining, the nuclei of the cells were stained by the addition of vectashield with DAPI (Vector
Chapter 4
Laboratories, Burlingame, CA, USA). Cells were viewed under a fluorescence microscope. Statistical analysis Statistical significance of the data was determined with a N-way ANOVA procedure. Additionally a t-test with Bonferroni correction was performed to determine significance between individual samples. A p-value less than 0.05 was considered significant.
Results Migration without chemoattractant After 14 days, there were no significant differences in the migration distance between NP (white bars) or AF (black bars) cells (Fig. 4). In both series, the 1.5% and the 3% scaffolds, the mean migration distance was limited to approximately 5% (~180 m) of the full scaffolds thickness. After 28 days, the migration distance of the NP cells had significantly increased compared to 14 days, while no differences were observed for the AF cells (Fig. 4). The mean migration distance of the NP cells after 28 days was significantly higher compared to the AF cells in both scaffolds densities. For the 1.5% collagen scaffolds the mean distance was 25% (~0.9 mm) for the NP cells compared to 9.5% (~0.35 mm) for the AF cells (P<0.05). For both cell types, a significant higher migration distance was observed in the 1.5% collagen scaffolds compared to the 3% scaffolds (Fig. 4). The collagen scaffolds were too dense to visualise cells in the deeper layers of the scaffold. An example of the surface area of a scaffold is shown in Fig. 5.
66
Figure 4: Graphic showing the results of the migration experiments of NP (white bars) and AF (black bars) cells after 14 (at the left) and 28 days (at the right) in 1.5 and 3% collagen matrices. After 14 days, no significant differences are observed. After 28 days, NP cells show a significantly higher migration compared to the AF cells. For both cell types the migration is higher in the 1.5 compared to the 3% collagen scaffolds
67
Figure 5: Surface area of 1, 5% collagen type I scaffolds after 1 week of incubation. (a AF cells, b NP cells. Membrane Stain DiI)
Chapter 4
Migration with Hst-2 The addition of Hst-2 did not result in increased migration distance. Instead, in a large fraction of the AF cell samples, no cells could be detected after 14 or 28 days, or too few to perform analysis. Although some cell death was also observed in a few of the NP cell experiments, these data was sufficient for analysis. After 14 days, no differences were observed for NP cells with or without chemo attractant. After 28 days however, NP cells in the samples supplemented with Hst-2 (Fig. 6, grey bars) showed significantly less migration when compared to samples without chemo attractant (Fig. 6, black bars) The migration without chemoattractant was significantly higher compared to the migration with Hst2 or D-Hst2 (Fig. 6, white bars). Between both peptides, no significant differences were found.
68
Figure 6: Graphic showing the results of the migration experiments of NP in a 1.5% collagen matrix with and without the addition of Hst-2 as a chemo attractant. The results with the negative enantiomer DHst-2 are also shown. The samples with Hst2 and Dhst-2 reveal a significantly decreased migration after 28 days
Expression of endo180 The expression of endo180 by both NP and AF was assessed using an antibody directed to a hinge domain in the protein. Figure 7 shows that endo180 was expressed on both cell types after 14 days of migration in 1.5% collagen scaffolds. Similar results were obtained after 28 days of incubation and in 3% scaffolds.
69
Figure 7: Images showing the results of Endo180 staining (brown colour) (HE counterstain) of 1.5% collagen scaffolds after 14 days of migration. a AF cells stained for Endo180 (brown colour), b AF cells, negative control, c NP cells stained for Endo180 (brown colour), d NP cells negative control
Scratch assay The scratches had a mean width of 666 m (+/- 77). No statistically significant differences between AF and NP cells were observed in any of the assays (Fig. 8). The addition of Hst-2 to the medium had no significant effect on scratch closure compared to the negative control (D-Hst-2) or serum free medium. The addition of 10% serum to the medium resulted in complete closure of the scratch in both
Chapter 4
assays with NP and AF cells (7). Staining of the F-actin filaments, to visualize the morphology of the cells, revealed different cell shapes for AF and NP cells (Fig. 9). In addition, differences were found between cells inside and outside the scratch. Non-migrated NP cells outside the scratch had a round, chondrocytic, morphology (Fig. 9a), while NP cells that had migrated into the scratch were characterized by long dendritic processes (Fig. 9b). Cells of the AF outside the scratch had a more flattened, fibroblast like, appearance (Fig. 9c), whereas cells inside the scratch were more elongated and aligned with each other (Fig. 9d). To confirm Hst-2 activity, a scratch assay was performed with human oral mucosa derived cells (HO-1-N-1 cell line), known to be sensitive for Hst-2 stimulation [24]. This assay showed a significant increased scratch closure after addition of Hst-2 (Fig. 10).
70
Figure 8: Graphic showing the results of the scratch assay. No significant differences are observed between the samples supplemented with Hst-2 compared to the negative control (D-Hst2) or serum free medium. The addition of 10% serum to the medium resulted in a significant increase in closure of the scratches
Figure 9: Images of cells during the scratch assay stained for F-actin (green) and the nuclei are stained with DAPI (blue). a NP cells outside the scratch, b NP cells inside the scratch, c AF cells outside the scratch, d AF cells inside the scratch
71
Figure 10: A confirmation scratch assay with human squamous carcinoma HO-1-N-1 cells reveals a significant enhanced cell migration after the addition of Hst-2
Chapter 4
72
Discussion The aim of the current study was to assess the migration of native cells into collagen scaffolds intended for functional replacement of the NP. Migration distance proved to be both time and density dependent. After 14 days, the observed migration was very limited for all cell types and collagen densities. Although current conditions are not fully comparable to other studies, since migration is usually studied from high towards low density matrices, a certain lag phase before migration occurs has been recognised [25]. A few explanations have been suggested for this phenomenon [25]. Firstly, cells require some time to overcome the differences in matrix stiffness [15, 25]. This could also explain the relatively long lag period (14 days) in the current study compared to previously reported periods (16 h), since in the current study cells had to migrate into a high stiffness matrix from the outside [15, 25]. Secondly, cells need some time to upregulate biosynthetic features such as actinmyosin activity necessary for migration [22, 25]. This again seems to apply for the current condition, since we used freshly harvested cells for the experiments. Prior to harvesting, these cells are surrounded by their own pericellular matrix, interacting with neighbouring cells and subjected to tensile forces (AF cells) or hydrostatic pressure (NP cell) [5, 13]. Migration was not enhanced by the addition of Hst-2, a peptide present in human saliva, which was described to be an important wound closure-stimulating factor [23]. The peptide was shown to enhance the activity of oral and non oral fibroblasts in vitro [24]. The exact receptor, however, to which the protein binds, remains unknown [23, 24], making it difficult hypothesize why IVD cells were insensitive to the pro-migratory effects of Hst-2 and cell death was even increased. A scratch assay, which is a more sensitive model to detect chemotaxis [23], confirmed that NP and AF cells are insensitive to Hst-2. Migration of both AF and NP cells was not enhanced by Hst2 or D-hst2 compared to the negative control (serum free medium). All samples showed significantly less migration than the positive control (medium with 10% serum), in which full closure of the scratches was observed. The absence of any chemo attractive effects of Hst2 on current IVD cell populations might be related to differences between human and caprine cells. We used cells derived from goats, while human cells were used in earlier studies [23, 24]. Interestingly, the scratch assay allowed visualising the phenotypical differences between NP and AF cells, both before and during migration (Fig. 9). These findings are of importance since specific phenotypical
markers for both cell types are still being studied and not generally accepted [26, 27, 30]. We studied collagen densities of 1.5% (~15 mg/mL) and 3% (~30 mg/mL), which are both higher compared to the free floating collagen matrices most often studied (up to 0.5% or 5 mg/mL) [6]. In the latter, cells adhere to the matrix and transmit forces to the collagen fibers resulting in increased stiffness and contraction [25]. For stiffer matrices, as currently studied, cells have to undergo major cytoskeletal reorganisation in order to induce the formation of stress fibers and focal adhesions. Furthermore, microtubules play an important role in the remodelling of 3D matrices. In stiff matrices, the microtubules determine cell polarity, while they mainly participate in spreading in soft matrices [22, 25]. Miron et al. [22] hypothesized that if the collagen matrix can resist the cellular traction force, cells can move. Reversely, if the matrix cannot resist the traction forces, remodelling occurs first. However, the matrices studied by Miron et al. had a much lower collagen density (1.5 mg/mL) compared to our study (15 and 30 mg/mL). Figure 1 shows that the spaces between individual collagen fibers (approximately ~100 nanometer) are too small for cells (~1020 m) to pass. For this reason, some collagen degradation will be necessary to allow cell migration. We therefore stained one specimen of every series with an antibody directed to the hinge domain of the collagen internalisation receptor Endo180 (Fig. 7). Endo180 binds and internalises collagen for lysosomal degradation and was shown to be important for ECM remodelling and cell migration [21]. Interestingly, expression of the receptor was found on both NP and AF cells. The presence of the antibody indicates that cell invasion in stiff collagen matrices may occur via collagen breakdown. This may be an important explanation why stimulation of migration by a chemokine alone does not have any effect. However, the differences in invasion and migration between AF and NP cells cannot be explained, since endo180 was present on both (Fig. 7). Other mechanisms, either via intra-cellular uptake or via extra-cellular collagen degradation (by matrix metalloproteinases) might be responsible [21]. An important limitation of our study is that the stiffness of the tested scaffolds (1.5 and 3%) is lower than the stiffness of the NP itself, which was found to agree with 23% collagen [6]. We did not study such high concentrations because preliminary studies in our laboratory showed that this might require culturing times in the order of years. However, as
73
Chapter 4
scaffolds within the repaired intervertebral disc will continuously be loaded and deformed, the migration speed of native cells into the scaffolds might actually be higher in vivo. Furthermore, long culturing times, which limited our choice for higher collagen densities, are of course no problem in vivo. In vivo studies in a large animal models are required to address these issues. Another potential limitation of current study is the use of scaffolds consisting of Collagen type I, since the major collagen component of the NP is type II collagen. However, the fabrication of dense collagen scaffold requires large amounts of collagen, making collagen type II unattractive. Furthermore, the technique of plastic compression has not yet been applied to type II collagen. In conclusion, in the current study we showed that IVD cells are capable of migrating into dense collagen scaffolds and that intra-cellular uptake and digestion of collagen are involved. The migration speed was both time and density dependent and was higher for NP compared to AF cells. Migration speed could not be enhanced by the use of Hst-2, a peptide derived from human saliva that was recently described to have chemo attractive properties. Although the densities currently studied have a lower stiffness compared to the NP, current results underscore the potential of in situ seeding concept of scaffolds for intervertebral disc engineering. However, the thickness of the final implant should be kept small to facilitate invasion and remodelling. Acknowledgments The authors like to thank Prof. Dr. E. C. I. Veerman for his kind donation of the histatins and attributions to the design of the experiments
74
References 1. Abbushi A, Endres M, Cabraja M, Kroppenstedt SN, Thomale UW, Sittinger M, Hegewald AA, Morawietz L, Lemke AJ, Bansemer VG, Kaps C, Woiciechowsky C: Regeneration of intervertebral disc tissue by resorbable cell-free polyglycolic acidbased implants in a rabbit model of disc degeneration. Spine 33:1527-1532, 2008 2. Alini M, Li W, Markovic P, Aebi M, Spiro RC, Roughley PJ: The potential and limitations of a cell-seeded collagen/hyaluronan scaffold to engineer an intervertebral disc-like matrix. Spine 28:446-454, 2003 3. Boyd LM, Carter AJ: Injectable biomaterials and vertebral endplate treatment for repair and regeneration of the intervertebral disc. Eur Spine J 15 Suppl 3:S414-S421, 2006 4. Breuls RG, Jiya TU, Smit TH: Scaffold stiffness influences cell behavior: opportunities for skeletal tissue engineering. Open Orthop J 2:103-109, 2008 5. Bron JL, Helder MN, Meisel HJ, van Royen BJ, Smit TH: Repair, regenerative and supportive therapies of the annulus fibrosus: achievements and challenges. Eur Spine J 18:301-313, 2009 6. Bron JL, Koenderink GH, Everts V, Smit TH: Rheological characterization of the nucleus pulposus and dense collagen scaffolds intended for functional replacement. J Orthop Res 27:620-626, 2009 7. Cloyd JM, Malhotra NR, Weng L, Chen W, Mauck RL, Elliott DM: Material properties in unconfined compression of human nucleus pulposus, injectable hyaluronic acid-based hydrogels and tissue engineering scaffolds. Eur Spine J 16:1892-1898, 2007 8. Cory G: Scratch-wound assay. Methods Mol Biol 769:25-30, 2011 9. Dai LY, Zhou Q, Yao WF, Shen L: Recurrent lumbar disc herniation after discectomy: outcome of repeat discectomy. Surg Neurol 64:226-231, 2005 10. Damianova R, Stefanova N, Cukierman E, Momchilova A, Pankov R: Threedimensional matrix induces sustained activation of ERK1/2 via Src/Ras/Raf signaling pathway. Cell Biol Int 32:229-234, 2008 11. Dikovsky D, Bianco-Peled H, Seliktar D: Defining the role of matrix compliance and proteolysis in three-dimensional cell spreading and remodeling. Biophys J 94:29142925, 2008 12. Discher DE, Janmey P, Wang YL: Tissue cells feel and respond to the stiffness of their substrate. Science 310:1139-1143, 2005 13. Duncan NA: Cell deformation and micromechanical environment in the intervertebral disc. J Bone Joint Surg Am 88 Suppl 2:47-51, 2006 14. Engler AJ, Sweeney HL, Discher DE, Schwarzbauer JE: Extracellular matrix elasticity directs stem cell differentiation. J Musculoskelet Neuronal Interact 7:335, 2007 15. Grinnell F, Ho CH, Tamariz E, Lee DJ, Skuta G: Dendritic fibroblasts in threedimensional
75
Chapter 4
76
collagen matrices. Mol Biol Cell 14:384-395, 2003 16. Hakkinen A, Kiviranta I, Neva MH, Kautiainen H, Ylinen J: Reoperations after first lumbar disc herniation surgery; a special interest on residives during a 5-year followup. BMC Musculoskelet Disord 8:2, 2007 17. Hegewald AA, Ringe J, Sittinger M, Thome C: Regenerative treatment strategies in spinal surgery. Front Biosci 13:1507-1525, 2008 18. Jonsson B, Stromqvist B: Repeat decompression of lumbar nerve roots. A prospective two-year evaluation. J Bone Joint Surg Br 75:894-897, 1993 19. Leone G, Torricelli P, Chiumiento A, Facchini A, Barbucci R: Amidic alginate hydrogel for nucleus pulposus replacement. J Biomed Mater Res A 84:391-401, 2008 20. Leung VY, Chan D, Cheung KM: Regeneration of intervertebral disc by mesenchymal stem cells: potentials, limitations, and future direction. Eur Spine J 15 Suppl 3:S406S413, 2006 21. Messaritou G, East L, Roghi C, Isacke CM, Yarwood H: Membrane type-1 matrix metalloproteinase activity is regulated by the endocytic collagen receptor Endo180. J Cell Sci 122:4042-4048, 2009 22. Miron-Mendoza M, Seemann J, Grinnell F: Collagen fibril flow and tissue translocation coupled to fibroblast migration in 3D collagen matrices. Mol Biol Cell 19:2051-2058, 2008 23. Oudhoff MJ, Bolscher JG, Nazmi K, Kalay H, van 't HW, Amerongen AV, Veerman EC: Histatins are the major wound-closure stimulating factors in human saliva as identified in a cell culture assay. FASEB J 22:3805-3812, 2008 24. Oudhoff MJ, van den Keijbus PA, Kroeze KL, Nazmi K, Gibbs S, Bolscher JG, Veerman EC: Histatins enhance wound closure with oral and non-oral cells. J Dent Res 88:846-850, 2009 25. Rhee S: Fibroblasts in Three Dimensional Matrices: Cell Migration and Matrix Remodeling. Exp Mol Med 2009 26. Rutges J, Creemers LB, Dhert W, Milz S, Sakai D, Mochida J, Alini M, Grad S: Variations in gene and protein expression in human nucleus pulposus in comparison with annulus fibrosus and cartilage cells: potential associations with aging and degeneration. Osteoarthritis Cartilage 18:416-423, 2010 27. Sakai D, Nakai T, Mochida J, Alini M, Grad S: Differential phenotype of intervertebral disc cells: microarray and immunohistochemical analysis of canine nucleus pulposus and anulus fibrosus. Spine (Phila Pa 1976 ) 34:1448-1456, 2009 28. Veerman EC, Valentijn-Benz M, Nazmi K, Ruissen AL, Walgreen-Weterings E, van MJ, Doust AB, van't HW, Bolscher JG, Amerongen AV: Energy depletion protects Candida albicans against antimicrobial peptides by rigidifying its cell membrane. J Biol Chem 282:18831-18841, 2007 29. Videman T, Nurminen M: The occurrence of anular tears and their relation to lifetime
back pain history: a cadaveric study using barium sulfate discography. Spine 29:26682676, 2004 30. Vonk LA, Kroeze RJ, Doulabi BZ, Hoogendoorn RJ, Huang C, Helder MN, Everts V, Bank RA: Caprine articular, meniscus and intervertebral disc cartilage: an integral analysis of collagen network and chondrocytes. Matrix Biol 29:209-218, 2010 31. Wienke D, MacFadyen JR, Isacke CM: Identification and characterization of the endocytic transmembrane glycoprotein Endo180 as a novel collagen receptor. Mol Biol Cell 14:3592-3604, 2003 32. Wilke HJ, Heuer F, Neidlinger-Wilke C, Claes L: Is a collagen scaffold for a tissue engineered nucleus replacement capable of restoring disc height and stability in an animal model? Eur Spine J 15 Suppl 3:S433-S438, 2006
77
Chapter 4
78
5
Repair, regenerative and supportive therapies of the annulus fibrosus: achievements and challenges.
JL Bron MN Helder HJ Meisel BJ van Royen TH Smit
Chapter 5
Abstract Lumbar discectomy is a very effective therapy for neurological decompression in patients suffering from sciatica due to a hernia nuclei pulposus. However, high recurrence rates and persisting post-operative low back pain in these patients require serious attention. In the past decade, tissue engineering strategies have been developed mainly targeted to the regeneration of the nucleus pulposus (NP) of the intervertebral disc. Accompanying techniques that deal with the damaged annulus fibrous are now increasingly recognised as mandatory in order to prevent re-herniation to increase the potential of NP repair and to confine NP replacement therapies. In this chapter, the requirements, achievements and challenges in this quickly emerging field of research are discussed.
80
Annulus fibrosus repair
Introduction Lumbar discectomy is an effective therapy for neurological decompression in patients suffering from an herniated nucleus pulposus (HNP), which can be safely performed via minimal invasive procedures [44, 128]. Current discectomy procedures, however, are not directed to treat the damaged intervertebral disc (IVD) and may even further aggravate existing damage [16, 22, 45]. It is therefore not surprising that successful neurological decompression is often followed by periods of persisting low back pain, severely affecting the quality of life [7, 8, 45]. Another serious problem in these patients is the high recurrence rates after discectomy, affecting up to 15% of the patients [7, 8, 16, 23, 42, 59, 63, 66, 98, 113, 115]. Since discectomy is still the most performed spinal surgical procedure worldwide and mainly affects the employed population, the resulting socioeconomical consequences are dramatic [61]. This gives investigators the impetus to search for new strategies that also deal with the damaged IVD in patients treated for HNP [68, 74, 105]. During the last 5 years, increasing knowledge and technical advancements in the field of tissue engineering has resulted in numerous promising strategies to repair, replace or regenerate the herniated nucleus pulposus (NP) [45, 105]. None of these advancements, however, has yet resulted in a clinically proven effective therapy. One of the major limitations is the lack of effective strategies that deal with the damaged annulus fibrosus (AF) [125]. Since optimal regeneration of the NP should lead to restoration of the physiological intradiscal pressure, the surrounding AF is generally of too inferior quality to withstand these forces. Without sufficient attention to the damaged AF, these treatments might be condemned to fail [5, 125]. Therefore, intervertebral disc engineering strategies are increasingly focusing on the regeneration or repair of the AF in order to reduce the number of re-herniations, increase the potential of NP engineering strategies and to mechanically assist NP replacement therapies [6, 125]. In this chapter, we will discuss the requirements, achievements and challenges in this rapidly emerging field of research.
81
Chapter 5
Anatomy Structure of the annulus fibrosus The IVD is confined by the two cartilage endplates and is composed of two distinct structures, the nucleus pulposus (NP), and the surrounding annulus fibrosus (AF) [53, 130]. The two cartilage endplates offer anatomical limitation to the vertebral bodies and morphology along the plate is distinguished by a central articular-like cartilage under the NP and a peripheral fibrocartilage appropriately associated with the AF. During embryogenesis, the AF develops from the mesenchyme, whereas the NP is derived from the notochord [120]. The AF consists of water (65 90%), collagen (5070% dry weight), proteoglycans (10 20% dry weight) and noncollagenous proteins (e.g. elastin) [14, 114]. The AF has a laminate structure consisting of a minimum of 15 (posterior) to a maximum of 25 (lateral) concentric layers [71]. The layers are composed of type 1 collagen fibres that alternate in angles from 28 (peripheral AF) to 44 (central AF) with respect to the transverse plane of the disc [17, 71, 84]. The spaces between the separate layers of the AF are called interlamellar septae, and they contain proteoglycan aggregates and a complex structure of linking elements creating interlamellar cohesion [14, 89,111]. At the periphery, some of the annulus fibres pass the endplates to penetrate into the bone of the vertebral body as Sharpeys fibres [57]. Central fibres either insert into the cartilage of both endplates or bend with the NP (Fig. 1). The highly organised structure of the AF results in a complex anisotropic behaviour, with the tensile, compressive, and shear properties differing in the axial, circumferential, and radial directions [11, 106, 114]. Based on structural and cellular differences, the AF can be further distincted into an inner and an outer part (Fig. 2) [14, 15, 71, 114]. The inner AF is a broad transition zone between the highly organised collagenous structure of the outer AF and the highly hydrated NP and consists of a mixture of extra cellular matrix (ECM) components of both [20, 130]. The inner AF is less hydrated than the NP and the layers are more widely spaced compared to the outer AF [52]. Mechanically, the inner AF is more subjected to the high hydrostatic pressures of the NP than to the tensile forces in the outer AF [73, 112]. These differences have major consequences on ECM synthesis and turnover [52]. The proportion type 1 collagen increases from the inner part towards the outer annulus, whereas type II
82
collagen follows a counterwise distribution [14, 20, 122, 130]. Other proteins that have a specific distribution include decorin and biglycan (mainly outer AF) and collagen type X [inner AF and (aged) NP] [55]. Elastin constitutes 2% of the dry weight of the AF, but plays an important role in the recoil properties of the AF [97, 129]. In the outer AF, long elastic fibres are present within the lamellae, running parallel to each other and into the same direction as the collagen bundles. In the inner AF, the fibres are present between adjacent lamellae as well as more regularly organised within the lamellae [129]. These fibre networks couple adjacent lamellae together allowing them to work cooperatively during dynamic loading and prevent separation of lamellae during torsional compressive loading [76]. Annulus fibrosus cells In mature subjects the cell density in the AF is about 9 x106 cells/cm3, which is over two times higher as compared to the NP [98]. Although all cells in the AF are derived from the mesenchyme, cells within the layers of the AF, the interlamellar spaces and the inner AF have their own morphology and synthesize a distinct ECM [14, 28, 52, 71, 90, 98, 130]. The cells experience not only differences in mechanical environment as described above, but also a rise in pO2 and pH and a decrease in hydration from the central NP to the outer layers of the AF [50, 52, 94, 98, 118]. In the layers of the outer annulus, fusiform shaped cells, aligning with the collagen fibres and alternating with each lamella are found [71, 90, 106]. In the periphery of the outer annulus, these cells are interconnected by very long processes which results in a continuous communicating network [14, 77]. The processes are gradually reduced in length and increased in thickness towards the inner AF. In the most central part of the outer AF, the cells are completely isolated without any apparent physical, intercellular connections [14]. These outer annulus cells mainly produce type I collagen [130]. The cells in the interlamellar septae have a more flattened, disc-shaped morphology that show many similarities to the cells of the NP [14]. The predominant cell morphology in the inner annulus consists of spherical shaped cells with one or two short processes, having the highest frequency at the border with the NP [14]. These chondrocyte-like cells in the inner annulus mainly produce type II collagen. A recent study showed that cells derived from the human AF were able to differentiate into the chondrogenic and adipogenic lineages [95]. This suggests that cells in the AF could be skeletal
83
Chapter 5
progenitor cells that could be recruited under pathologic conditions such as herniation. Otherwise, progenitor cells from surrounding tissue might perhaps be capable to migrate into the intervertebral disc in the circumstances. Pathophysiology tissue retrieved from a herniated disc is more often vascularised and is more highly innervated than healthy tissue [97]. Not surprisingly, this variant morphology also demonstrates a proclivity to MMP and cytokine expression, each of which would be expected to contribute to further remodelling [97]. Besides these clearly pathologic conditions, other structural changes do occur during ageing that are to a certain extent physiological but might have consequences for its strength (Fig. 1). In the ageing AF of rats, the number of distinct layers was found to decrease gradually and this loss of volume is compensated by increasing thickness of individual layers and thickening of the inner annulus [90]. In addition, the fibre bundles within the layers become more irregularly distributed with increased interbundle spaces [90]. The loss of distinct layers carries with it the inability for a sustained response to loading and support [1, 41].
84
Figure 1 (Page 85): Histological image (toluidine blue) of the canine intervertebral disc revealing the relation between the nucleus pulposus (NP), annulus fibrosus (AF) and endplates (EP). Some of the most central AF fibres bend with the NP (arrow) Figure 2 (Page 85): Sagittal section specimen of the L3L4 intervertebral disc of a middle aged asymptomatic male subject. NP nucleus pulposus, IA inner annulus fibrosus, OA outer annulus fibrosus. Defects in the outer annulus (asterisk) and tears (hat symbol) are visible in the outer annulus, without a sign of herniation. The NP has a severely dehydrated appearance due to conservation techniques>>
85
Chapter 5
Due to dehydration of the inner annulus, the compressive load is insufficiently converted in the integral of progressive recruitment of tensile support. The lack of annular tone in the degenerated disc results in a lag of mechanical conversion and the annulus comes under the force of axial compression, further reducing the anisotropic capacity for deformation in the normal, healthy disc [2, 49]. These changes have most significant impact on the posterolateral location of the AF, that has the highest frequency of layer interruption [71, 110]. This is also the region where the highest stresses are observed during loading [26] and where annular tears, fissures, protrusions, extrusion and/or sequestrations may develop [86]. Annular tears are seen in more than half of the patients in early adulthood and are invariably present in the elderly (Fig. 1) [119]. The degree of degeneration varies between subjects, for which genetic and environmental (e.g. physical loading, smoking) factors are held responsible [10, 13, 81, 88]. Patients with a genetic predisposition are more prone to disc degeneration under repeated mechanical loading [10]. The relation between loading and degeneration of the AF has been studied by several authors, but our knowledge is still only fragmented. Elverfig et al. [27] showed that shear stress increased the intracellular calcium concentration in AF cells. The sensitivity for shear stress was increased in the presence of the inflammatory cytokine II1 [27]. Rannou et al. [92] showed that static compression resulted in a significant increase of apoptotic cells in the inner AF in a mouse model. The authors also found an increased caspase-9 activity and decreased mitochondrial membrane potential following overload, suggesting that degeneration might be mediated through the mitochondrial apoptotic pathway [91]. Furthermore, vibratory loading has been associated with the activation of signalling pathways that regulate ECM destruction in the IVD [127]. Yamazaki showed that gene expression in AF cells for key ECM components such as aggrecan and type II collagen was suppressed following vibratory loading [126]. Lastly, cyclic tensile stretch was found to regulate the ECM by decreasing proteoglycan production through a post-translational regulation involving nitrite oxide [92]. Gruber et al. hypothesized that the well-recognised reduction in cell number in the AF during ageing is an important factor for degeneration. This should result in a loss of cellcell communication and hence a disruption of coordinated cell function [40]. Finally, many adult IVDs show signs of dehydration
86
and brown degeneration, which is the result of post-translational collagen modification resulting in the formation of chromophores [83, 104]. In these discs, accumulated or enhanced oxidative stress of matrix proteins has resulted in glycoxidation of proteins [83]. Advanced glycosylation end products are further processed to carboxymethyl-lysine by free oxygen radicals, which can be detected by antibodies and used as a biomarker for oxidative stress [82]. Intrinsic healing potential The intrinsic capacity of the AF to cope with damage or degenerative changes has been studied in several animal studies [3, 29, 34, 43, 62, 75, 79, 85, 99, 109]. Key and Ford [62] studied the healing capacity of three different types of posterior AF lesions in a dog model. The lesions included a square annular window, a transverse incision and puncture with a 20-gauge needle. At follow up, they found that the lesions were initially filled with extravasated blood, fibrin, bone and cartilage debris that was gradually replaced by a thin layer of fibrous tissue at later time points (up to 22 weeks). Some of the levels within the window and incision lesion group developed slowly progressive disc protrusion, which was most common in the transversely incised discs. The levels that underwent needle puncture revealed nothing abnormal and the site of puncture could not be identified after 22 weeks. A recent study, however, with rabbit discs in an organ culture model showed that needle puncture has immediate and progressive mechanical and biologic consequences that may lead to degenerative remodelling [65]. The findings of Key and Ford have been underscored and complemented in many studies afterwards [29, 43, 85, 97]. Smith et al. [109] further specified the healing process in three different phases. During the first phase, the outer AF heals, caused by a proliferative reaction in the fibrous tissue spreading from the lateral parts of the wound to the median parts. In the second phase, starting after a few weeks and lasting up to one year postoperative, changes occur in inner annular fibres. Similarly to the outer AF, the lateral parts of the inner AF layers gradually heal by a slow appositional spread in the median direction. During the last phase, there is an increase in the number of collagenous fibres in the NP tissue that has remained in the AF wound tract, which becomes increasingly dense [109]. Similar findings were more recently obtained in sheep and dog studies [43, 85].
87
Chapter 5
From the studies performed thus far it can be concluded that he AF has only a very limited regenerative capacity after annulotomy. Depending on the technique that is used, healing results in a thin layer of biomechanical inferior fibrous tissue [31]. One of the reasons for the limited healing capacity may be the fact that exterior repairs are not matched, or insulated to the demands of progressive recruitment of fibres to tensile force [41, 54]. The mechanical basis for shifting axial loading to circumferential tension requires that the nucleus volume remain elastic, deformable and contained. When the lateral aspects of the annulus are violated or scarred, the ability of the fibres to adequately contain the nucleus changes. In the case of static patient posture and prolonged loading, the disc will experience creep that is proportional to the stage of disc degeneration. In practice, disc degeneration results in a stiffer matrix that does not accommodate the modelling of a disc with normal morphology. If it is not possible to reduce the axial load, then the inevitability of sustaining increasing force in a stiffened matrix will lead to accelerated herniation and more rapid propagation of anular fissures [80].
88
Surgical strategies The limited intrinsic healing capacity of the AF negatively affects the success rates of discectomies and NP replacement therapies. It also decreases the potential of intervertebral disc regenerative strategies. To dissolve this problem, attempts to preserve, repair, reinforce or regenerate the AF in addition to these surgical techniques are desired. Annulus closure techniques The most straightforward solution is per operative suturing of the annular defect and this has been studied by Ahlgren et al. [3] in a sheep model. Although they found that sutured discs showed a tendency towards stronger healing, this was not significant [3]. Unfortunately, no further studies on this subject have been reported. The Xclose and INclose implants are now commercially available for annuloplasty and can be seen as modified sutures with anchors [12, 18]. Sutures, however, are fully directed to containment of the NP (replacement) and do not compensate the loss of annulus material nor reverse the biomechanical changes that have occurred in the damaged AF. The Barricaid is a commercially available
implant used in adjunction to discectomies that fully bridges the defect in the AF [36]. This implant even reinforces the complete posterior annulus and would therefore even prevent contralateral herniation. Several other novel suture, seal and barrier techniques are currently being developed, resulting in increasing attention at scientific workshops and conferences [9, 12, 16, 18, 36, 60, 108, 117]. More detailed analyses are therefore expected in peer reviewed journals in the near future. The momentum of acceptance, however, needs to be balanced in the proof of principle. Risks imposed by criticism need to be weighed in both shortand long-term successes. Clinical durability is the eventual arbiter of technology value, and open trials with clear data will be required. Regenerative strategies Regeneration of the damaged AF is an attractive concept, since it allows restoration of all functions of the AF, but is exceptionally complex to achieve. Regenerative strategies can be divided into cell therapy, gene therapy and tissue engineering with scaffolds [45]. In case of the AF, however, direct mechanical strength and a certain volume to patch the defect seem required in order to contain the NP [125]. Ideally, it should combine direct closure of the defect, as discussed in the preceding section, with the potential for regeneration. Cell and gene therapies are therefore not suitable as standalone therapies, but should be combined with scaffolds. Below, these strategies are first discussed separately, followed by an overview of the studies performed with the necessary scaffolds. Annulus cells Annulus fibrosus cells that are used for AF tissue engineering are derived from humans or various other species (Table 1). The use of human disc cells as a cell source for tissue engineering is difficult because normal healthy disc tissue is not available for such a treatment strategy. In previous studies with tissue derived from herniated discs, an increased degree of cell senescence was found that accumulates over time [38, 96], thus hampering the applicability of this cell source for regenerative strategies [38]. Furthermore, isolation of the cells retrieved from human discectomy material does usually not allow division between inner and outer AF cells. Therefore, cells used for studying annulus regeneration are often harvested from IVDs from healthy small animals. To increase cell number, the AF cells are cultured in vitro first. These cells are isolated from native tissue and it is
89
Chapter 5
therefore important to realise that the environment differs greatly from that in situ. Cells no longer have processes, a pericellular matrix and are isolated from each other, and are cultured in gels that do not always allow cellular sliding [25]. Annulus cells have shown to lose their phenotype during two-dimensional (2D) culturing. Chou et al. [20] showed that up to passage two, both inner and outer annulus cells are not different from freshly isolated cells. At later passages, however, both cell types became indistinguishable fibroblast-like with similar type I collagen expression and protein elaboration. The negative effects of monolayer culturing are currently further investigated with specialised 2D environments like collagen coatings, well inserts, or micro-grooved polycaprolactone membranes [21, 37, 58]. To prevent the loss of their phenotype, AF cells are usually cultured in threedimensional (3D) environments, such as alginate, agarose or collagen hydrogels [4, 37, 39, 64, 100, 130]. Chou et al. [21] found NP and inner and outer AF cells to adopt similar phenotypes after two weeks of culturing in alginate. NP cells and AF cells displayed a rounded chondrocyte-like morphology, expressing high levels of type II collagen versus type I collagen and accumulation of sulphated GAGs. Indeed, the adopted phenotypes are typically NP-like and it was not investigated by these authors whether the changes are reversible [21]. Gruber et al. assessed the ECM expression of AF cells in different 3D culture environments including collagen sponge, collagen gel, agarose, alginate and fibrin [39]. Collagen sponges supported the most abundant ECM formation, whereas the ECM production was nearly absent in fibrin gel. The ECM production, however, included types I and II collagen, aggrecan and chondroitin-6-sulfotransferase for all carriers and this is not specific for AF cells. Moreover, although alginate might be appropriate for inner AF cells, outer AF cells do not survive well in alginate and show a different morphology and matrix expression than observed in vivo [52]. It can be concluded that the appropriate culture environment for AF cells has yet to be elucidated. AF cells are very sensitive to pressure effects during culturing and this might be useful for tissue engineering strategies. Reza et al. [93] cultured inner and outer AF cells in PGA scaffolds to evaluate the effect of dynamic hydrostatic pressures (HP). Type II collagen production was enhanced in both cell types by the application of HP. This effect, but also the effects on ECM elaboration and
90
organization, was more pronounced in the scaffold seeded with outer AF cells [93]. The value of these results for AF engineering however, may be questioned, since AF cells in vivo are more subject to tensile and shearing forces and mainly produce type I collagen. An attractive alternative, that would prevent the problems regarding senescence, limited supply and culturing of autologous AF cells, would be the use of mesenchymal stem cells [30, 51]. There are currently, however, no studies available demonstrating stem cells to differentiate into AF cells. The lack of conclusive phenotypic markers for both, AF cells and stem cells, makes it difficult to study this differentiation [30]. Gene and bio-active factors Extra cellular matrix production of AF cells can be influenced by various gene and bio-active factors [72, 93, 116, 126]. A few studies have addressed the effect of osteogenic protein-1 (OP-1) on AF cells cultured in alginate beads [72, 116]. Masuda et al. showed that continuous stimulation of rabbit AF cells cultured in alginate beads with recombinant OP-1 led to an increase in the total DNA, collagen content and a pronounced effect on proteoglycan synthesis. However, the authors also showed that this stimulation is more effective in NP cells, compared to AF cells [72]. Takegami et al. [116] showed that AF cells that were stimulated with OP-1 were able to repair the ECM that was depleted of sulphated glycosaminoglycans by chondroitinase ABC exposure. Since these studies show that OP-1 has greater effects on PG synthesis and on NP cells, it may be questioned if OP-1 really offers advantages for AF engineering. Zhang et al. studied the effects of several bone morphogenetic proteins (BMPs) and Sox-9 transfection on AF cells. They found that collagen synthesis could be enhanced by over-expression of BMP-13 and of the transcription factor Sox9 [131]. Although these in vitro results are promising, the effects of these growth factors upon application in animals or humans in vivo remain unknown. Scaffolds The ultimate goal of AF engineering is to achieve both direct mechanical stability and to allow the formation of native tissue in the long term. In order to develop suitable scaffolds for tissue engineering, general principles should be taken into account including the immunogenicity, biocompatibility and biodegradability and
91
Chapter 5
method of graft delivery [67]. Specific requirements may be recognised for AF scaffolds. They should: Fill and/or repair the AF gap to contain the NP (replacement) Allow fixation to the surrounding structures, i.e. endplates and/or surrounding AF tissue Allow AF cells (or stem cells) to survive (differentiate), synthesize and secrete the native ECM Have the characteristic anisotropic behaviour, to maintain/restore the mechanical properties of a spinal motion segment Not irritate or adhere to the perineurium Several scaffolds that could be used for AF tissue engineering have been proposed and evaluated in in vitro or in small in vivo studies. In Table 1 these studies are summarised, as well as to which extent they meet the aforementioned requirements. Without exception, strategies for delivery and fixation in vivo are lacking. Accurate mechanical characterizations are sparse. Only one study reported of a scaffold material showing anisotropic behaviour, comparable to the AF [84]. Anisotropy however, deserves further study, since a lack of tension was found to influence collagenase and cytokine activity [24, 35]. The biphasic appearance of the native AF has also been targeted by a single study. In this study, the inner and outer AF were simulated by bone matrix gelatine (BMG) and polycaprolactone triol malate, respectively [122]. In general, these studies have been designed to investigate cell attachment, morphology, proliferation and ECM production on the scaffolds. Native outer AF cells have a typical elongated shape and this is observed in most scaffolds [47, 84, 107, 121]. Shao and Hunter, however, found spherical shaped cells in their scaffolds that agree with an inner AF cell morphology. Interestingly, most studies report of the production of type II collagen and aggrecan [19, 78, 84, 102, 107, 121, 122], instead of collagen type I [47, 48, 107, 124], while the latter is by far the most common ECM component of the AF. Ideally the cells are seeded in a homogenous fashion through the scaffolds. The disadvantage of the silk and BMG scaffold is that the cells only can be seeded on top and invasion occurs only slowly [19, 122]. Chang et al. tried to improve cell attachment onto the silk scaffold by
92
chemically coating the scaffold with the integrin binding motif RGD. RGD, however, did not result in enhanced cell attachment, but did result in higher levels of type II collagen and aggrecan [19]. Higher levels of type II collagen is an insufficient bridge to repair. Given the fact that type II collagen does not bundle or form fibrillated structures, expression obtained by using RGD peptides may be questioned. Using decorin, or small proteoglycans, which have known function in appropriately binding TGFb might be a separate consideration [70]. A critical structural entity of the annulus structure is the network of type I collagen forming fibrils oriented in sheets around the nucleus. A number of molecules present in the matrix regulate and direct the collagen fibril assembly by interacting with the collagen molecule and also the formed fibril. Several of these molecules bind by one domain to the collagen fibre and present another functional domain to interact either with other fibres or with other collagen matrix constituents such as type VI collagen. In this manner the collagen fibres are cross-linked into a network that provides tensile strength and distributes load over large parts of the AF. Assembly occurs both by end-to-end and side-to-side associations. This process is catalyzed by both biglycan and decorin, where the combined effect of direct binding of the core protein to the collagen-6 N-terminal globular domain and the presence of the glycosaminoglycan side chain is essential. Diminished function in these cross-bridging molecules will lead to loss of mechanical properties of the collagen network and result in an impaired ability of the AF to resist forces delivered by compression of the disc and particularly the nucleus. Decorin has been shown in other systems to retard the TGFbeta affected fibrotic pathway and as such might limit fibrous scarring and impose tissue specific remodeling [32, 56]. Translation from in vitro results to the in vivo situation is difficult and the few studies that have assessed the scaffolds in vivo do provide important additional information. Mizuno et al. [78] implanted complete tissue engineered IVD constructs consisting of calcium alginate discs surrounded by a polyglycolic acid (PGA) ring seeded with AF cells in the dorsum of athymic mice. The tissue that was formed after 12 weeks follow-up tissue did not resemble native AF tissue with alignment of cells and tissue. Cell proliferation and viability was not quantified in this study. Sato et al. performed laser vaporization in rabbits and the lacunas in
93
Chapter 5
the NP and hole in the annulus were filled with an AF cell seeded atelocollagen honeycomb shaped scaffold with a membrane seal (ACHMS-scaffold) [101103]. They found a marked accumulation of cartilage like matrix inside and around the scaffold, which was histologically comparable to native AF tissue [102]. Although this combined NP/AF concept seems promising, it might be questionable if this technique is also feasible to be used to fill larger annulus defects. Novel strategies for delivery and fixation may be required. Alternative therapies Wang et al. simulated a herniation in a swine model and delivered gelfoam, platinum coil, bone cement and tissue glue into the discs. Analysis was performed after two months by quantitative discomanometry. The gelfoam proved best in maintaining disc integrity with resistance to significantly higher intradiscal pressures compared to the other groups. The gelfoam group was the only group that was not significantly weaker compared to the intact disc group. The authors conclude that gelfoam may be a potentially clinically applicable method to prevent re-herniation [123]. However, although the foam is safe to use according to the authors, it may be questioned how effective this method is in preventing re-herniation in larger annulus defect than the 18 gauge lateral needle hole in the presented animal model.
94
95
Chapter 5
96
Discussion Research on the AF as a target for novel therapies has only just started to evolve. There are several limitations and pitfalls in the research thus far that should be noted. Experimental AF lesions are generally made at the (antero) lateral region of healthy AFs (Fig. 2) and extrapolation of these studies to humans is difficult [87]. Repair mechanisms in animal studies may differ compared to patients with HNP due to the pathophysiological changes within the IVD that have occurred in the period prior to HNP (Fig. 1) [16]. Furthermore, it is important to realise that annulus fissures commonly develop bilaterally [2]. When successful patching of an AF defect allows restoration of the physiological high intradiscal pressures, the contralateral fissure may progress and become symptomatic. Complete annulus and nucleus tissue engineered constructs as for example of Mizuno et al. [78] would offer a solution for this, but are even more difficult in terms of implantation. There are striking discrepancies between AF closure techniques and regenerative strategies. Closure techniques are primarily focussing on restoration of the mechanical integrity of the AF and do offer clear solutions for delivery and fixation. These developments are mainly practised in vivo and scientific data is only sparse. Regenerative therapies, on the other hand, target the engineering of healthy and functional AF tissue, but lack strategies for implantation and fixation and thus for clinical application. Of course, a combination of strategies that offer direct mechanical stability and potential for remodelling AF tissue would be preferred. Future research Now that the need for AF repair is increasingly recognised, many studies on this subject are expected to be reported in the scientific literature in the upcoming years. Both AF and NP engineering research are still in very early stages and combined repair strategies should be attempted. Patients undergoing discectomy should ideally benefit from a complete concept in which in one surgical procedure the neurological structures are decompressed and the damaged NP and AF are treated. The increasing knowledge on degradable (bio) polymers offers very encouraging future perspectives [69]. Regenerative matrix scaffolds, biopath materials, memory polymers, disc foams and synthetic gels to translate axial loads, and bioactive hybrid polymers with differential sacrifice to generate cyclic
97
Chapter 5
loading during integration efforts might open new paths to successful treatment of patients suffering from disc herniation. These therapies might be further potentiated when combined with cell supplementation, bioactive factors and cytokine modulation. The important role of mechanical loading in addition to IVD engineering is yet underexposed. The use of an interspinous implant for example, to favourably alter the motion, in addition to novel IVD engineering therapies in patients undergoing lumbar discectomy deserves attention [33]. AF cells are a phenotypically heterogeneous cell population. In many studies these differences are disregarded and a mixture of AF cells is used. If we could reveal the exact circumstances under which these cells elaborate, we might substitute these different cell types by stem cells and stimulate them to differentiate into all native cell types [46]. This should further prevent the inconveniences in the harvesting and culturing procedures needed for AF cells. Conclusion Intervertebral disc regeneration offers promising perspectives for patients suffering from low back pain due to disc herniation treated with lumbar discectomy. Thus far, efforts for novel therapies have mainly been directed towards replacement or regeneration of the NP. The real challenge, however, is the development of strategies that deal with the damaged AF, preferably in a combined approach with the NP. Regenerative therapies of the AF should always be accompanied by a clear vision for future clinical application. Acknowledgments The authors are grateful to Timothy Ganey (Atlanta Medical Center, GA, USA) for his contributions to the manuscript.
98
References 1. Acaroglu ER, Iatridis JC, Setton LA et al (1995) Degeneration and aging affect the tensile behavior of human lumbar annulus fibrosus. Spine 20: 26902701. 2. Adams MA, Hutton WC (1985) Gradual disc prolapse. Spine 10 :524531. 3. Ahlgren BD, Lui W, Herkowitz HN, Panjabi MM, Guiboux JP (2000) Effect of anular repair on the healing strength of the intervertebral disc: a sheep model. Spine 25(17):2165 2170. 4. Alini M, Li W, Markovic P et al (2003) The potential and limitations of a cell-seeded collagen/hyaluronan scaffold to engineer an intervertebral disc-like matrix. Spine 28(5):446454 5. Alini M, Roughley PJ, Antoniou J, Stoll T, Aebi M (2002) A biological approach to treating disc degeneration: not for today, but maybe for tomorrow. Eur Spine J 11(Suppl 2):S215 S220 6. Andersson GB, An HS, Oegema TR Jr, Setton LA (2006) Directions for future research. J Bone Joint Surg Am 88(Suppl 2):110114. 7. Atlas SJ, Keller RB, Wu YA, Deyo RA, Singer DE (2005) Long-term outcomes of surgical and nonsurgical management of sciatica secondary to a lumbar disc herniation: 10 year results from the maine lumbar spine study. Spine 30(8):927935. 8. Atlas SJ, Keller RB, Wu YA, Deyo RA, Singer DE (2005) Long-term outcomes of surgical and nonsurgical management of lumbar spinal stenosis: 8 to 10 year results from the maine lumbar spine study. Spine 30(8):936943. 9. Bajanes G, Perez A, Diaz M (2007) One year follow up of discectomy patients who received a mesh to repair the annulus fibrosus, vol 7. Spine Arthroplasty Society, Berlin 10. Battie MC, Videman T (2006) Lumbar disc degeneration: epidemiology and genetics. J Bone Joint Surg Am 88(Suppl 2):39. 11. Best BA, Guilak F, Setton LA et al (1994) Compressive mechanical properties of the human anulus fibrosus and their relationship to biochemical composition. Spine 19(2):212221 12. Bourgeault C, Beaubien B, Griffith S (2007) Biomechanical assessment of annulus fibrosus repair with suture tethered anchors. Spine Arthroplasty Society, Berlin 13. Bron JL, van Royen BJ, Wuisman PI (2007) The clinical significance of lumbosacral transitional anomalies. Acta Orthop Belg 73(6):687695 14. Bruehlmann SB, Rattner JB, Matyas JR, Duncan NA (2002) Regional variations in the cellular matrix of the annulus fibrosus of the intervertebral disc. J Anat 201(2):159 171. 15. Cao L, Guilak F, Setton LA (2007) Three-dimensional morphology of the pericellular matrix of intervertebral disc cells in the rat. J Anat 211(4):444452 16. Carragee EJ, Han MY, Suen PW, Kim D (2003) Clinical outcomes after lumbar discectomy for sciatica: the effects of fragment type and anular competence. J Bone Joint Surg Am 85-A(1):102108
99
Chapter 5
100
17. Cassidy JJ, Hiltner A, Baer E (1989) Hierarchical structure of the intervertebral disc. Connect Tissue Res 23(1):7588. 18. Cauthen J (1999) Microsurgical reconstruction (annuloplasty) following lumbar discectomy: preliminary report of a new technique. Proceedings of the AANS/CNS joint section on spine and peripheral nerves, Orlando 19. Chang G, Kim HJ, Kaplan D, Vunjak-Novakovic G, Kandel RA (2007) Porous silk scaffolds can be used for tissue engineering annulus fibrosus. Eur Spine J 16(11):18481857. 20. Chou AI, Bansal A, Miller GJ, Nicoll SB (2006) The effect of serial monolayer passaging on the collagen expression profile of outer and inner anulus fibrosus cells. Spine 31(17):18751881. 21. Chou AI, Reza AT, Nicoll SB (2008) Distinct intervertebral disc cell populations adopt similar phenotypes in three-dimensional culture. Tissue Eng Part A 14:20792087 22. Choy DS (2000) Familial incidence of intervertebral disc herniation: an hypothesis suggesting that laminectomy and discectomy may be counterproductive. J Clin Laser Med Surg 18(1):2932 23. Dai LY, Zhou Q, Yao WF, Shen L (2005) Recurrent lumbar disc herniation after discectomy: outcome of repeat discectomy. Surg Neurol 64(3):226231. 24. Derderian CA, Bastidas N, Lerman OZ et al (2005) Mechanical strain alters gene expression in an in vitro model of hypertrophic scarring. Ann Plast Surg 55(1):6975. 25. Duncan NA (2006) Cell deformation and micromechanical environment in the intervertebral disc. J Bone Joint Surg Am 88(Suppl 2):4751. 26. Edwards WT, Ordway NR, Zheng Y et al (2001) Peak stresses observed in the posterior lateral anulus. Spine 26(16):17531759. 27. Elfervig MK, Minchew JT, Francke E, Tsuzaki M, Banes AJ (2001) IL-1beta sensitizes intervertebral disc annulus cells to fluid-induced shear stress. J Cell Biochem 82(2):290 298. 28. Errington RJ, Puustjarvi K, White IR, Roberts S, Urban JP (1998) Characterisation of cytoplasm-filled processes in cells of the intervertebral disc. J Anat 192(Pt 3):369378. 29. Ethier DB, Cain JE, Yaszemski MJ et al (1994) The influence of anulotomy selection on disc competence. A radiographic, biomechanical, and histologic analysis. Spine 19(18):20712076. 30. Evans C (2006) Potential biologic therapies for the intervertebral disc. J Bone Joint Surg Am 88(Suppl 2):9598. 31. Fazzalari NL, Costi JJ, Hearn TC et al (2001) Mechanical and pathologic consequences of induced concentric anular tears in an ovine model. Spine 26(23):25752581. 32. Feng H, Danfelter M, Stromqvist B, Heinegard D (2006) Extracellular matrix in disc degeneration. J Bone Joint Surg Am 88(Suppl 2):2529.
33. Floman Y, Millgram MA, Smorgick Y, Rand N, Ashkenazi E (2007) Failure of the Wallis interspinous implant to lower the incidence of recurrent lumbar disc herniations in patients undergoing primary disc excision. J Spinal Disord Tech 20(5):337341. 34. Ganey T, Libera J, Moos V et al (2003) Disc chondrocyte transplantation in a canine model: a treatment for degenerated or damaged intervertebral disc. Spine 28(23):2609 2620. 35. Garlet TP, Coelho U, Silva JS, Garlet GP (2007) Cytokine expression pattern in compression and tension sides of the periodontal ligament during orthodontic tooth movement in humans. Eur J Oral Sci 115(5):355362. 36. Gorensek M, Vilandecic M, Woburn (2007) Clinical investigation of intrinsic therapeutics Barricaid, a novel device for closing defects in the annulus. NASS 2006 37. Gruber HE, Fisher EC Jr, Desai B et al (1997) Human intervertebral disc cells from the annulus: three-dimensional culture in agarose or alginate and responsiveness to TGFbeta1. Exp Cell Res 235(1):1321. 38. Gruber HE, Ingram JA, Norton HJ, Hanley EN Jr (2007) Senescence in cells of the aging and degenerating intervertebral disc: immunolocalization of senescence-associated betagalactosidase in human and sand rat discs. Spine 32(3):321327. 39. Gruber HE, Leslie K, Ingram J, Norton HJ, Hanley EN (2004) Cell-based tissue engineering for the intervertebral disc: in vitro studies of human disc cell gene expression and matrix production within selected cell carriers. Spine J 4(1):4455. 40. Gruber HE, Ma D, Hanley EN Jr, Ingram J, Yamaguchi DT (2001) Morphologic and molecular evidence for gap junctions and connexin 43 and 45 expression in annulus fibrosus cells from the human intervertebral disc. J Orthop Res 19(5):985 989. 41. Guerin HL, Elliott DM (2007) Quantifying the contributions of structure to annulus fibrosus mechanical function using a nonlinear, anisotropic, hyperelastic model. J Orthop Res 25(4):508516. 42. Hakkinen A, Kiviranta I, Neva MH, Kautiainen H, Ylinen J (2007) Reoperations after first lumbar disc herniation surgery; a special interest on residives during a 5-year follow-up. BMC Musculoskelet Disord 8:2. 43. Hampton D, Laros G, McCarron R, Franks D (1989) Healing potential of the anulus fibrosus. Spine 14(4):398401. 44. Hansson E, Hansson T (2007) The cost-utility of lumbar disc herniation surgery. Eur Spine J 16(3):329337. 45. Hegewald AA, Ringe J, Sittinger M, Thome C (2008) Regenerative treatment strategies in spinal surgery. Front Biosci 13:15071525. 46. Helder MN, Knippenberg M, Klein-Nulend J, Wuisman PI (2007) Stem cells from adipose tissue allow challenging new concepts for regenerative medicine. Tissue Eng 13(8):17991808.
101
Chapter 5
102
47. Helen W, Gough JE (2007) Cell viability, proliferation and extracellular matrix production of human annulus fibrosus cells cultured within PDLLA/Bioglass(R) composite foam scaffolds in vitro. Acta Biomater 3:715721 48. Helen W, Merry CL, Blaker JJ, Gough JE (2007) Threedimensional culture of annulus fibrosus cells within PDLLA/Bioglass composite foam scaffolds: assessment of cell attachment, proliferation and extracellular matrix production. Biomaterials 28(11):2010 2020. 49. Heuer F, Schmidt H, Wilke HJ (2008) The relation between intervertebral disc bulging and annular fiber associated strains for simple and complex loading. J Biomech 41:1086 1094 50. Holm S, Maroudas A, Urban JP, Selstam G, Nachemson A (1981) Nutrition of the intervertebral disc: solute transport and metabolism. Connect Tissue Res 8(2):101119. 51. Hoogendoorn RJ, Lu ZF, Kroeze RJ et al (2008) Adipose stem cells for intervertebral disc regeneration: current status and concepts for the future. J Cell Mol Med (in press) 52. Horner HA, Roberts S, Bielby RC et al (2002) Cells from different regions of the intervertebral disc: effect of culture system on matrix expression and cell phenotype. Spine 27(10):10181028. 53. Humzah MD, Soames RW (1988) Human intervertebral disc: structure and function. Anat Rec 220(4):337356. 54. Iatridis JC, ap Gwynn I (2004) Mechanisms for mechanical damage in the intervertebral disc annulus fibrosus. J Biomech 37(8):11651175. 55. Inkinen RI, Lammi MJ, Lehmonen S et al (1998) Relative increase of biglycan and decorin and altered chondroitin sulphate epitopes in the degenerating human intervertebral disc. J Rheumatol 25(3):506514 56. Jahanyar J, Joyce DL, Southard RE et al (2007) Decorin-mediated transforming growth factor-beta inhibition ameliorates adverse cardiac remodeling. J Heart Lung Transplant 26(1):3440. 57. Johnson EF, Chetty K, Moore IM, Stewart A, Jones W (1982) The distribution and arrangement of elastic fibres in the intervertebral disc of the adult human. J Anat 135(Pt 2):301309 58. Johnson WE, Wootton A, El HA et al (2006) Topographical guidance of intervertebral disc cell growth in vitro: towards the development of tissue repair strategies for the anulus fibrosus. Eur Spine J 15(Suppl 3):S389S396. 59. Jonsson B, Stromqvist B (1993) Repeat decompression of lumbar nerve roots. A prospective two-year evaluation. J Bone Joint Surg Br 75(6):894897 60. Kamaric E, Gorensek S, Trummer M et al (2007) Surgical factors affecting after lumbar discectomy: the need for an anular closure device. In Thera 61. Katz JN (2006) Lumbar disc disorders and low-back pain: socioeconomic factors and consequences. J Bone Joint Surg Am 88(Suppl 2):2124.
62. Key JA, Ford LT (1948) Experimental intervertebral-disc lesions. J Bone Joint Surg Am 30A(3):621630 63. Kim JM, Lee SH, Ahn Y et al (2007) Recurrence after successful percutaneous endoscopic lumbar discectomy. Minim Invasive Neurosurg 50(2):8285. 64. Kluba T, Niemeyer T, Gaissmaier C, Grunder T (2005) Human anulus fibrosis and nucleus pulposus cells of the intervertebral disc: effect of degeneration and culture system on cell phenotype. Spine 30(24):27432748. 65. Korecki CL, Costi JJ, Iatridis JC (2008) Needle puncture injury affects intervertebral disc mechanics and biology in an organ culture model. Spine 33(3):235241. 66. Laus M, Bertoni F, Bacchini P, Alfonso C, Giunti A (1993) Recurrent lumbar disc herniation: what recurs? (A morphological study of recurrent disc herniation). Chir Organi Mov 78(3):147154 67. Leung VY, Chan D, Cheung KM (2006) Regeneration of intervertebral disc by mesenchymal stem cells: potentials, limitations, and future direction. Eur Spine J 15(Suppl 3):S406S413. 68. Lotz JC, Kim AJ (2005) Disc regeneration: why, when, and how. Neurosurg Clin N Am 16(4):657663, vii. 69. Lutolf MP, Hubbell JA (2005) Synthetic biomaterials as instructive extracellular microenvironments for morphogenesis in tissue engineering. Nat Biotechnol 23(1):47 55. 70. Macri L, Silverstein D, Clark RA (2007) Growth factor binding to the pericellular matrix and its importance in tissue engineering. Adv Drug Deliv Rev 59(13):13661381. 71. Marchand F, Ahmed AM (1990) Investigation of the laminate structure of lumbar disc anulus fibrosus. Spine 15(5):402410. 72. Masuda K, Takegami K, An H et al (2003) Recombinant osteogenic protein-1 upregulates extracellular matrix metabolism by rabbit annulus fibrosus and nucleus pulposus cells cultured in alginate beads. J Orthop Res 21(5):922930. 73. McNally DS, Adams MA (1992) Internal intervertebral disc mechanics as revealed by stress profilometry. Spine 17(1):6673. 74. Meisel HJ, Siodla V, Ganey T et al (2007) Clinical experience in cell-based therapeutics: disc chondrocyte transplantation A treatment for degenerated or damaged intervertebral disc. Biomol Eng 24(1):521. 75. Melrose J, Ghosh P, Taylor TK et al (1997) Elevated synthesis of biglycan and decorin in an ovine annular lesion model of experimental disc degeneration. Eur Spine J 6(6):376 384. 76. Melrose J, Smith SM, Appleyard RC, Little CB (2008) Aggrecan, versican and type VI collagen are components of annular translamellar crossbridges in the intervertebral disc. Eur Spine J 17(2):314324. 77. Melrose J, Smith SM, Little CB et al (2008) Recent advances in annular pathobiology provide insights into rim-lesion mediated intervertebral disc degeneration and potential new approaches to annular repair strategies. Eur Spine J 17(9):11311148.
103
Chapter 5
104
78. Mizuno H, Roy AK, Vacanti CA et al (2004) Tissue-engineered composites of anulus fibrosus and nucleus pulposus for intervertebral disc replacement. Spine 29(12):1290 1297. 79. Moore RJ, Osti OL, Vernon-Roberts B, Fraser RD (1992) Changes in endplate vascularity after an outer anulus tear in the sheep. Spine 17(8):874878. 80. Natarajan RN, Williams JR, Andersson GB (2004) Recent advances in analytical modeling of lumbar disc degeneration. Spine 29(23):27332741. 81. Nemoto Y, Matsuzaki H, Tokuhasi Y et al (2006) Histological changes in intervertebral discs after smoking and cessation: experimental study using a rat passive smoking model. J Orthop Sci 11(2):191197. 82. Nerlich AG, Bachmeier BE, Schleicher E et al (2007) Immunomorphological analysis of RAGE receptor expression and NFkappaB activation in tissue samples from normal and degenerated intervertebral discs of various ages. Ann N Y Acad Sci 1096:239248. 83. Nerlich AG, Schleicher ED, Boos N (1997) Volvo Award winner in basic science studies. Immunohistologic markers for age-related changes of human lumbar intervertebral discs. Spine 22(24):27812795. 84. Nerurkar NL, Elliott DM, Mauck RL (2007) Mechanics of oriented electrospun nanofibrous scaffolds for annulus fibrosus tissue engineering. J Orthop Res 25(8):1018 1028. 85. Osti OL, Vernon-Roberts B, Fraser RD (1990) 1990 Volvo Award in experimental studies. Anulus tears and intervertebral disc degeneration. An experimental study using an animal model. Spine 15(8):762767. 86. Osti OL, Vernon-Roberts B, Moore R, Fraser RD (1992) Annular tears and disc degeneration in the lumbar spine. A post-mortem study of 135 discs. J Bone Joint Surg Br 74(5):678682 87. Paajanen H, Haapasalo H, Kotilainen E, Aunapuu M, Kettunen J (1999) Proliferation potential of human lumbar disc after herniation. J Spinal Disord 12(1):5760. 88. Perie D, Korda D, Iatridis JC (2005) Confined compression experiments on bovine nucleus pulposus and annulus fibrosus: sensitivity of the experiment in the determination of compressive modulus and hydraulic permeability. J Biomech 38(11):21642171. 89. Pezowicz CA, Robertson PA, Broom ND (2006) The structural basis of interlamellar cohesion in the intervertebral disc wall. J Anat 208(3):317330. 90. Postacchini F, Bellocci M, Massobrio M (1984) Morphologic changes in annulus fibrosus during aging. An ultrastructural study in rats. Spine 9(6):596603. 91. Rannou F, Lee TS, Zhou RH et al (2004) Intervertebral disc degeneration: the role of the mitochondrial pathway in annulus fibrosus cell apoptosis induced by overload. Am J Pathol 164(3):915924
92. Rannou F, Richette P, Benallaoua M et al (2003) Cyclic tensile stretch modulates proteoglycan production by intervertebral disc annulus fibrosus cells through production of nitrite oxide. J Cell Biochem 90(1):148157. 93. Reza AT, Nicoll SB (2008) Hydrostatic pressure differentially regulates outer and inner annulus fibrosus cell matrix production in 3D scaffolds. Ann Biomed Eng 36(2):204213. 94. Richardson SM, Knowles R, Marples D, Hoyland JA, Mobasheri A (2008) Aquaporin expression in the human intervertebral disc. J Mol Histol (in press) 95. Risbud MV, Guttapalli A, Tsai TT et al (2007) Evidence for skeletal progenitor cells in the degenerate human intervertebral disc. Spine 32(23):25372544 96. Roberts S, Evans EH, Kletsas D, Jaffray DC, Eisenstein SM (2006) Senescence in human intervertebral discs. Eur Spine J 15(Suppl 3):S312S316. 97. Roberts S, Evans H, Trivedi J, Menage J (2006) Histology and pathology of the human intervertebral disc. J Bone Joint Surg Am 88(Suppl 2):1014. 98. Roughley PJ (2004) Biology of intervertebral disc aging and degeneration: involvement of the extracellular matrix. Spine 29(23):26912699. 99. Rousseau MA, Ulrich JA, Bass EC et al (2007) Stab incision for inducing intervertebral disc degeneration in the rat. Spine 32(1):1724. 100. Saad L, Spector M (2004) Effects of collagen type on the behavior of adult canine annulus fibrosus cells in collagen-glycosaminoglycan scaffolds. J Biomed Mater Res A 71(2):233 241. 101. Sato M, Asazuma T, Ishihara M et al (2003) An experimental study of the regeneration of the intervertebral disc with an allograft of cultured annulus fibrosus cells using a tissue-engineering method. Spine 28(6):548553. 102. Sato M, Asazuma T, Ishihara M et al (2003) An atelocollagen honeycomb-shaped scaffold with a membrane seal (ACHMSscaffold) for the culture of annulus fibrosus cells from an intervertebral disc. J Biomed Mater Res A 64(2):248256. 103. Sato M, Kikuchi M, Ishihara M et al (2003) Tissue engineering of the intervertebral disc with cultured annulus fibrosus cells using atelocollagen honeycomb-shaped scaffold with a membrane seal (ACHMS scaffold). Med Biol Eng Comput 41(3):365371. 104. Schroeder Y, Sivan S, Wilson W et al (2007) Are disc pressure, stress, and osmolarity affected by intra- and extrafibrillar fluid exchange? J Orthop Res 25(10):13171324. 105. Sebastine IM, Williams DJ (2007) Current developments in tissue engineering of nucleus pulposus for the treatment of intervertebral disc degeneration. Conf Proc IEEE Eng Med Biol Soc 1:64006405. 106. Setton LA, Chen J (2006) Mechanobiology of the intervertebral disc and relevance to disc degeneration. J Bone Joint Surg Am 88(Suppl 2):5257. 107. Shao X, Hunter CJ (2007) Developing an alginate/chitosan hybrid fiber scaffold for annulus fibrosus cells. J Biomed Mater Res A 82(3):701710.
105
Chapter 5
106
108. Sherman J, Cauthen J, Griffith S (2007) Pre-clinical evaluation of a mesh device for repairing the annulus fibrosus. Spine Arthroplasty Society, Berlin 109. Smith JW, Walmsley R (1951) Experimental incision of the intervertebral disc. J Bone Joint Surg Br 33-B(4):612625 110. Smith LJ, Byers S, Costi JJ, Fazzalari NL (2008) Elastic fibers enhance the mechanical integrity of the human lumbar annulus fibrosus in the radial direction. Ann Biomed Eng 36(2):214223. 111. Smith LJ, Fazzalari NL (2006) Regional variations in the density and arrangement of elastic fibres in the anulus fibrosus of the human lumbar disc. J Anat 209(3):359367. 112. Stokes IA (1987) Surface strain on human intervertebral discs. J Orthop Res 5(3):348 355. 113. Suk KS, Lee HM, Moon SH, Kim NH (2001) Recurrent lumbar disc herniation: results of operative management. Spine 26(6):672676. 114. Sun DD, Leong KW (2004) A nonlinear hyperelastic mixture theory model for anisotropy, transport, and swelling of annulus fibrosus. Ann Biomed Eng 32(1):92102. 115. Swartz KR, Trost GR (2003) Recurrent lumbar disc herniation. Neurosurg Focus 15(3):E10. 116. Takegami K, An HS, Kumano F et al (2005) Osteogenic protein- 1 is most effective in stimulating nucleus pulposus and annulus fibrosus cells to repair their matrix after chondroitinase ABCinduced in vitro chemonucleolysis. Spine J 5(3):231238. 117. Taylor W (2006) Biologic collagen PMMA injection (artifill) repairs mid-annular concentric defects in the ovine model. Spine J 6(5S1):48S49S 118. Urban JP, Holm S, Maroudas A, Nachemson A (1982) Nutrition of the intervertebral disc: effect of fluid flow on solute transport. Clin Orthop Relat Res (170):296302 119. Videman T, Nurminen M (2004) The occurrence of anular tears and their relation to lifetime back pain history: a cadaveric study using barium sulfate discography. Spine 29(23):26682676. 120. Walmsley R (1953) The development and growth of the intervertebral disc. Edinburgh Med J 60(8):341364 121. Wan Y, Feng G, Shen FH et al (2007) Novel biodegradable poly(1, 8-octanediol malate) for annulus fibrosus regeneration. Macromol Biosci 7(11):12171224. 122. Wan Y, Feng G, Shen FH, Laurencin CT, Li X (2008) Biphasic scaffold for annulus fibrosus tissue regeneration. Biomaterials 29(6):643652. 123. Wang YH, Kuo TF, Wang JL (2007) The implantation of noncell-based materials to prevent the recurrent disc herniation: an in vivo porcine model using quantitative discomanometry examination. Eur Spine J 16(7):10211027. 124. Wilda H, Gough JE (2006) In vitro studies of annulus fibrosus disc cell attachment, differentiation and matrix production on PDLLA/45S5 Bioglass composite films. Biomaterials 27(30):52205229.
125. Wilke HJ, Heuer F, Neidlinger-Wilke C, Claes L (2006) Is a collagen scaffold for a tissue engineered nucleus replacement capable of restoring disc height and stability in an animal model? Eur Spine J 15(Suppl 3):S433S438. 126. Yamazaki S, Banes AJ, Weinhold PS et al (2002) Vibratory loading decreases extracellular matrix and matrix metalloproteinase gene expression in rabbit annulus cells. Spine J 2(6):415420. 127. Yamazaki S, Weinhold PS, Graff RD et al (2003) Annulus cells release ATP in response to vibratory loading in vitro. J Cell Biochem 90(4):812818. 128. Yeung AT, Yeung CA (2007) Minimally invasive techniques for the management of lumbar disc herniation. Orthop Clin North Am 38(3):363372. 129. Yu J, Fairbank JC, Roberts S, Urban JP (2005) The elastic fiber network of the anulus fibrosus of the normal and scoliotic human intervertebral disc. Spine 30(16):18151820. 130. Yu J, Tirlapur U, Fairbank J et al (2007) Microfibrils, elastin fibres and collagen fibres in the human intervertebral disc and bovine tail disc. J Anat 210(4):460471. 131. Zhang Y, Anderson DG, Phillips FM et al (2007) Comparative effects of bone morphogenetic proteins and Sox9 overexpression on matrix accumulation by bovine anulus fibrosus cells: implications for anular repair. Spine 32(23):25152520
107
108
6
Biomechanical and in vivo evaluation of experimental closure devices of the annulus fibrosus designed for a goat nucleus replacement model.
JL Bron AJ van der Veen MN Helder BJ van Royen TH Smit
Chapter 6
110
Abstract Promising strategies are being developed to replace or regenerate the herniated nucleus pulposus. However, clinical efficacy of these methods has still to be addressed, and the lack of appropriate annulus closure techniques is increasingly being recognised as a major limiting factor. In the current study, in vitro and in vivo evaluation of novel annulus closure devices (ACDs) was performed. These devices are intended to be used in adjunct to nucleus replacement therapies in an experimental goat study. After a standardised discectomy had been performed, different ACDs were implanted solely or in addition to a collagen nucleus replacement implant. Biomechanical effects and axial failure load were assessed in vitro and followed by in vivo evaluation in a goat model. On axial compression, the average axial failure load for ACDs with four barb rings was significantly higher compared to the implants with five barb rings. The increased range of flexion extension and latero-flexion observed after discectomy were restored to the normal range after implantation of the implants. Positive findings with the fourring ACD were confirmed in goats after a follow-up of 2 weeks in vivo. However, after 6 weeks most implants (n = 16) showed signs of destruction and displacement. Although there seemed to be a tendency towards better results when ACDs were placed in addition to the nucleus replacements, these differences were not statistically significant. Moreover, two endplate reactions extending into the subchondral bone were observed, most likely due to continuous friction between the ACD and the vertebrae. Although current results are encouraging first steps towards the development of an efficient ACD for animal models, further optimisation is necessary. Current results also show that one cannot rely on in vitro biomechanical studies with annulus closure techniques, and these should always be confirmed in vivo in a large animal model.
Biomechanical and in vivo evaluation
Introduction The lack of effective strategies to deal with the damaged annulus fibrosus (AF) may currently be recognised as one of the major limiting factors for successful intervertebral disc engineering after herniation [7, 8, 10, 11, 26]. During the last decade, increasing knowledge and technical advancements in the field of tissue engineering have resulted in numerous promising strategies to replace or regenerate the nucleus pulposus (NP) [11, 19]. None of these advancements, however, has yet resulted in a clinically proven effective therapy [12, 24]. Since optimal regeneration of the NP should result in a restoration of the physiological high intradiscal pressure, the surrounding AF is generally of too inferior quality to withstand these forces [15]. In patients treated for disc herniation, there is often a loss of annulus tissue, restricting the potential of sutures and glues [1, 12]. These materials have limited strength, and the annulus usually has to be closed under tension. Tissue engineering strategies of the AF that deal with the gap due to loss of AF tissue are currently being developed. However, the attempts are mainly directed towards the engineering of native AF tissue, especially in the long term, instead of providing instant mechanical strength after surgery [5]. These AF tissue engineering attempts are therefore not ready to be used in adjunct nucleus replacement strategies. In this chapter, we investigate experimental ACDs, designed to be used in adjunct to nucleus replacement therapies in a goat model. These devices are primarily intended to enable the study of nucleus replacement therapies in animal models. However, the findings may also reveal valuable information for the development of human annulus closure devices. The purpose of the implants is to provide immediate mechanical support without affecting the nucleus replacement therapy or spinal biomechanics. Biomechanical and in vivo evaluation of the ACDs were performed in a goat model, both solely and in addition to a collagen nucleus replacement matrix that has been described earlier [12, 24].
111
Chapter 6
Materials and methods Nucleus replacement model A standardised discectomy procedure was developed, intended to allow the evaluation of novel nucleus replacement therapies in vivo. The procedure was designed for, and performed on mature Dutch female goat intervertebral discs. Initially, the NP is evacuated with custom-made instruments (Fig. 1a). These instruments consist of tubes with increasing diameter, which are used to make an entry site laterally into the AF. Via the largest tube, with an outer diameter of 3 mm, instruments are inserted to evacuate the NP. The discectomy was always performed as complete as possible without damaging the AF or the endplates, and the result was judged by the surgeon before continuation. After evacuation, the disc space is filled with a dense collagen implant (NuRes, Arthro Kinetics AG, Esslingen, Germany) that has been described previously [6]. Shortly, collagen gel is polymerised after which the density is increased by plastic compression. The chosen density was 25% w/w of collagen, which has a stiffness comparable to the native NP. For this study, the collagen matrix was prepared in a snake-like shape (diameter 2.5 mm, length 30 mm, volume ~0.6 cm3), allowing implantation via the tubes (Fig. 1b). After insertion of the collagen implant, the annulus defect was closed with one of the four different versions of a polyethylene closure device described below. (A more detailed description of the model is presented in: addendum 1) Annulus closure devices (ACDs) We first performed extensive preliminary testing, using the same set up for axial compression as described below (see Biomechanical evaluation). These pilot experiments (data not shown) were intended to determine the optimal shape and dimensions of the annulus closure devices (Fig. 2a). All devices were intended to close a standardised 3-mm circular defect in the AF of the goat intervertebral disc, as described above. Four devices were further evaluated in the current study (Fig. 2b) since they were found to withstand axial compression forces over 1,000 N. These four ACDs were composed of polyethylene and consisted of a core (diameter 1.3 or 1.5 mm) with four or five barb rings that have a maximum diameter of 3.5 mm (Fig. 2b). The ACDs were introduced into the AF till all barb
112
rings were inside the defect. The back end of ACDs was used to hold the implants during implantation, and this was cut after implantation (Fig. 2c). Intradiscal pressure calibration measurements In order to determine the relation between the applied load and the pressure inside the goat intervertebral disc, we first performed pressure measurements. This information is essential to be sure whether the resulting pressures of the applied loads in the current study are comparable to the intradiscal pressures known from studies in vivo. For these calibration experiments, the lumbar spine (L1L6) of a goat, derived from a local abattoir, was meticulously cleaned of soft tissues. The posterior elements were left intact. The spine was separated into three separate motion segments by incision of the discs between L2L3 and L4 L5. The ends of the vertebrae were embedded in a low melting point bismuth alloy, and the motion segments were placed in upright position in the biomechanical testing apparatus (Instron, Norwood, MA, USA). First, a pressure needle was inserted anteriorly into the core of each disc. Next, a load was applied increasing with 50 N/s to a maximum of 1,000 N or a maximum of 3 MPa as measured by the needle, whatever came first (higher pressures would result in irreversible needle damage). Both the values for load and pressure were documented. The measurements were repeated two times with the needle inserted via both lateral sides of the discs.
113
Chapter 6
114
B
Figure 1: Image of the instruments (a) used for evacuation of the nucleus pulposus containing rongeurs, tubes, a guide wire (for penetration of the annulus fibrosus) and a spoon -like instrument. The largest tube has an outer diameter of 3 mm and an inner diameter of 2.5 mm, through which the other instruments and collagen implant can be introduced. b The collagen implant and the end of the insertion tube
Biomechanical evaluation Biomechanical experiments were performed prior to the in vivo study on spinal segments, derived from the local abattoir. Using the same set up as described with the pressure experiments, the axial failure loads of different ACDs were tested using the standardised nucleus replacement model. After the implants were inserted, an axial compression load was applied to a maximum of 5,000 N. The experiments were ended when failure, considered as the leakage of the collagen implant or extrusion of closure devices, was observed. Each ACD was tested on three different motion segments (L1L2, L3L4 and L5L6). For every experiment a freshly dissected spinal segment was used. In addition to the failure experiments, the effects of the implants on the biomechanical behaviour of the motion segments were investigated. These experiments were mainly performed to exclude undesired effects on the range of latero-flexion or flexionextension due to the ACDs and to assess the possibility of the implants to restore the effects after discectomy. After fixation in bismuth, 12 motions segments (four of each different level) were multidirectionally tested using a four-point flexionextension set up and the instron 8872 testing machine (Instron Corp., Norwood, MA, USA). The motion segments were submitted to four cycles of flexionextension and latero-flexion under a maximum moment of 2 Nm at a speed of 1/s. Specimens were tested before discectomy (native), after discectomy and with both implants (nucleus implant and the four rings 1.5 mm ACD) inside. During all experiments, the segments were kept moisturised by wrapping with surgical gauze drowned in 0.9% saline. Forcedeformation data acquisition was performed for each direction through materials testing software (Fast Track 2, Instron Corp., Norwood, MA, USA). The range of motion-data of the third cycle of the tests was used for further calculation. The mean changes in the range of motion after discectomy and implantation of both implants were calculated as ratios compared to native values (treatment over control). In vivo evaluation Surgical procedure and animal care were performed in compliance with the regulations of the Dutch legislation for animal research, and the Animal Ethics Committee of the VU University Medical Center approved the protocol. Ten goats were sedated with 10 mg/kg ketamine and 1.5 mg atropine intramuscularly, followed by 0.4 mg/kg etomidate intravenously. General anaesthesia was
115
Chapter 6
116
maintained with 4 g/kg fentanyl per hour, 0.3 mg/kg midazolam per hour and 1.52.5% isoflurane. Before surgery, standardised lateral thoracolumbar roentgenograms were obtained. A dorsal paravertebral incision was made. The IVDs were identified using a left retroperitoneal approach and exposed after mobilisation of the psoas muscle. Level determination was performed by identification of the lowest rib. Two discectomies, as described above, were randomly performed over the levels T13L1, L2L3 or L4L5. At one of these levels, the collagen nucleus implant was inserted after evacuation of the NP, followed by closure of the annulus defect with the ACD (sterilised by irradiation). At the other level the plug was inserted solely. Two variants of the ACDs were used in the 6-week follow-up group: four goats received implants with a core diameter of 1.3 mm, the remainder with a core diameter of 1.5 mm. The number (four) and diameter (3.5 mm) of the barb rings was the same for all implants. Two of the goats were terminated by an overdose pentobarbital after 2 weeks and the remaining eight goats after 6 weeks. The latter group returned to their habitual environment from 1 week postoperative until 1 week prior to the autopsy. Evaluation was similar for all goats. After termination, the lumbar spines of the goats were harvested, and magnetic resonance imaging (MRI) of the explants was performed within 2 h. Hereafter, all soft tissue was removed, and careful macroscopic inspection was performed. Finally, a band saw was used to obtain transversal slices of the discs for macroscopic inspection. Both, macroscopic examination and MR Imaging were used to determine the position of the ACDs. The position was classified as in situ, partially displaced (maximum of two barb rings outside the AF), or fully displaced (at least two barb rings outside the AF). Statistics To calculate differences between different implant groups, the Student T test was used.
B
Figure 2: Overview image of different closure systems used in the pilot experiments (a) and in current study (b). The implants vary in the number of barb rings (4 or 5) and in the diameter of the core (1.3 or 1.5 mm). The instrument that was used to implant the devices is shown in c
117
Results Pressure calibration measurements The relation between the applied load and the pressure inside the three discs is shown in Fig. 3. A load of 600 N corresponds with an intradiscal pressure of 3 MPa. No effect was observed by changing the place of needle insertion from anterior to lateral, indicating that hydrostatic pressure was present within the entire NP.
Chapter 6
118
Figure 3: Relation between the applied axial load and pressure measured inside the discs. Each bar represents the mean of three measurements: insertion of the needle via anterior or from both lateral sides
Biomechanical evaluation All four annulus closure devices showed a mean axial failure load of at least 1,000 N (Fig. 4), which equals a pressure of approximately 5 MPa (as deduced from the results of the pressure experiments). The ACDs with four barb rings performed much better than the devices with five barb rings (Fig. 4). There was no difference in failure loads between devices with a 1.3 or 1.5 core diameter (data not shown). However, application of the devices with a 1.3-mm core was sometimes difficult since the implants easily buckled during implantation. The results from the flexionextension and latero-flexion experiments are shown in Fig. 5. The bars represent the mean changes with respect to the native values (ratio). The range of both latero-flexion and flexionextension significantly increased after the discectomy. The increase was much higher for flexionextension (59%) compared to latero-flexion (17%). After implantation of the ACDs and nucleus implants, the range of motion was restored to normal values both for flexionextension and
lateroflexion. Based on these results, revealing a sufficiently high axial failure load and a lack of undesired effects of the ACD on the range of motion, continuation towards animal experiments was judged feasible, and they were thus performed.
Figure 4: Failure loads of annulus closure system with four or five barb rings. The implants with four barb rings have a significantly higher (p<0.05) failure load compared to the implants with five barb rings. Each bar represents the mean of three measurements in three different segments (L1L2, L3L4 and L5L6)
119
Figure 5: Graphic showing the results of flexionextension and lateroflexion experiments. The motion segments were tested native, after discectomy and after implantation of the implants. The values after discectomy and with the implants are shown as fractions change compared to the native values. After discectomy, a significant increase (p<0.05) in both values was observed. After implantation of the nucleus and annulus implants, no significant changes compared to native values were observed. Importantly, the ACD does not significantly reduce latero-flexion
Chapter 6
120
In vivo experiments All goats recovered well from surgery and no per- or postoperative complications were observed. Two weeks after implantation of the ACDs (all have four barb rings, 1.5-mm core diameter), no displacement of the annulus closure devices in either animal with or without the nucleus replacement was observed. This was deduced from MR images and confirmed by macroscopic examination (Fig. 6). Based on these results, a study with longer follow up was initiated. The results after 6-week follow-up were not as successful as shown in Table 1. Only two of the closure devices remained in situ, both in the NP replacement group (Fig. 7). Seven of the closure devices were partially displaced (less than two barb rings) and seven were fully displaced. There are no statistical differences between the groups although there is a tendency towards better results when the closure devices are combined with the collagen implants. All ACDs revealed signs of severe plastic deformation, especially of the barb rings. This is also the case for both closure devices that remained in situ (Fig. 7). Two endplate reactions were observed, irrespective whether NP replacement was performed (Fig. 8). MRI proved to be especially valuable to determine the position of fully displaced ACDs and to observe the extent of the endplate reactions. Careful examination of the MR images confirmed that the ACDs are located in the centre of the reaction in both cases (Fig 9).
Figure 6: Macroscopic images of two intervertebral discs treated with the annulus closure system after 2-week follow-up. A: A disc treated with the addition of a collagen nucleus replacement, B a disc treated with the ACD solely. The arrows show the ends of the implants. The remnants of NP tissue are very much swollen by the water used to cool the sawing blade. Due to the sawing, the collagen implant has also been washed out, and is therefore not visible in A.
Figure 7: Image of one of the implants that was still in situ after 6-week follow-up. There are clear signs of destruction visible at the barb rings of the implant (arrows).
121
Discussion
Chapter 6
122
The need for annulus closure methods in addition to nucleus replacement strategies is increasingly being recognised [35, 13, 20]. Wilke et al. [24] showed that a collagen scaffold allows restoration of disc height and stability after herniation in vitro. However, the absence of an appropriate annulus closure technique limits the potential and applicability in vivo. These authors also showed that glues, sutures or a combination of both are insufficient to provide sufficient containment of a collagen scaffold [12]. This agrees with the findings in scientific literature, in which an appropriate closure method has never been documented thus far [1, 4]. In the current study, we found excellent results with experimental ACDs in vitro and after 2-week follow-up in vivo. However, after 6 weeks, the majority of the implants showed signs of migration and deformation. Since the barb rings should gain adhesion into the layers of the annulus, it is not surprising that their destruction results in implant extrusion. The ACDs in the goats after 2week follow-up showed only mild signs of damage. During these 2 weeks the goats stayed in the shed of the university animal facilities and were recovering from the surgeries. In this period, the animals might behave more quiescent than they usually do. Between the second and sixth week after the surgeries, the goats are fully recovered. The animals return to the farm and regain their usual activities. This may result in increasing forces on the implants, and when the damage to the barb rings accumulates to a certain level, the implants start to displace. The former agrees with the finding that those implants that were fully extruded were also the most damaged ones. The damage should have occurred prior to the moment of extrusion since the implants are located in the soft tissue directly adjacent to the disc, where no direct mechanical stresses are encountered.
123
Figure 8: MRI and macroscopic images of the two levels in which endplate reaction were encountered. Images a and b are of a level that was treated with an annulus closure system solely, and the reaction is mainly located at a single endplate. Images c and d are of a level treated with the closure system combined with the collage nucleus replacement implant. The reaction in this goat is located at both endplates and extends into the subchondral space.
Two of the implants even provoked a severe osteolytic reaction extending through the endplates into the subchondral bone. This reaction was observed in both groups, with and without a collagen implant, and it seems therefore not likely that the reaction was caused by the latter. Most probably the reactions are the result of the friction described above, which has resulted in pressure necrosis of the endplates. Another option, however less likely, may be that the endplates were damaged during surgery, and that leakage of nucleus material into the
Chapter 6
subchondral bone provoked the reaction. The potential for nucleus material, which normally does not encounter immune reactive cells due to the absent vascularisation in the disc space, to initiate such a reaction has been hypothesised earlier [2]. To prevent failure and endplate reactions, the design, dimensions and stiffness of the closing devices can be altered. Current devices were fabricated from polyethylene, which was used for its known biocompatibility. Polyethylene, however, is a rather stiff material, and friction between the barb rings and endplates might therefore have resulted in the observed reaction [18]. Taking a less stiff material would have decreased the risk, but might probably result in lower mechanical expulsion strength. The shape of the implants, especially of the barb rings, deserves attention in further optimisation of the closure devices. We performed several pilot experiments with different designed devices, but the current shape showed the highest resistance to forces. We do not know, however, why implants with four barb rings performed so much better than implants with five barb rings.
124
The dimensions of the closure devices can also be adjusted. Intradiscal pressure results in forces on the implants that are dependent of diameter and length. We always made a standardised circular defect of 3 mm in the annulus, and the diameter of the barb rings of the implants was 3.5 mm. The ring diameter was chosen to promote adherence between the annulus layers. A larger diameter would have increased this adherence, but would also have resulted in larger expulsion forces from the pressurised NP and subsequent failure at lower axial compression forces. The expulsion forces on the ACD depend on its crosssectional diameter, whereas the friction forces only depend on the circumference. In addition, regarding the disc height of the goat (45 mm), a larger diameter could also result in continuous contact between the implant and both endplates, increasing the risk of adverse reactions and ring damage. Although current biomechanical study results did not show a significant effect on latero-flexion, a tendency towards some small restriction could already be observed. Decreasing the diameter of both the defect and barb rings might therefore have been preferred from a mechanical viewpoint and from the aim to
reduce contact with the endplate. Unfortunately, this was currently not possible regarding the diameter of the nucleus implants. The length of the ACDs was maximally 15 mm (between front of the first and the back of the last barb ring), and this length was chosen since it always covers the whole lateral annulus. For some goats, however, a smaller length would have been sufficient, but this can only be judged afterwards at macroscopic evaluation. If current closure systems would have passed the animal experiments, a decrease of the lengths to allow more space for the nucleus replacements could have been evaluated. The main goal of the biomechanical experiments was to predict failures of the ACDs. We did not study torsion since the forces would be mainly distributed through the facet joints with only a marginal increase of the intradiscal pressure [21]. We found an axial load of 600 N to correspond to an intradiscal pressure of approximately 3 MPa. The applied load will be partially distributed through the annulus parts of the discs and/or posterior elements. We performed these experiments to allow comparison of the forces known from pressure measurements in vivo. A few studies have been performed measuring the pressure inside the human intervertebral disc in vivo [16, 17]. Wilke et al. [25] found a maximum intradiscal pressure of 2.3 MPa during the lifting of 20 kg combined with flexionextension forward. From our own in vivo measurements in goats we know that the axial load can rise up to 900 N [9]. According to current pressure measurements, this would correspond to a pressure over 4 MPa. Thus, the peak pressure inside the goat intervertebral disc seems to be higher than the peak pressure inside the human disc. This finding agrees with the fact that the bone density of the vertebra of goats is higher compared to humans, indicating higher stresses in vivo [23]. The differences might be explained by the fact that the forces on the goat spine are generated by muscles and ligaments surrounding the continuously bended spine. In the bipedal situation of humans, these compressive forces are lower and more dependent on activity and posture [14]. Furthermore, we used motion segments derived from young goats (age 4 years), and the osmotic pressure might therefore be higher compared to the adult human disc [22]. The goat model was used, since prior studies have shown that the absolute spinal forces in this animal are still comparable to that of humans [12, 23]. The mean value of axial load of 4,000 N, which we found that the current annulus closure system could withstand, provides a sufficient safety range. A
125
Chapter 6
limitation of the current study is that we only performed maximum axial failure load testing prior to implantation and no duration testing. Given the short-term in vivo results, however, this would not have forecasted the failures. The number and multi-directionality of biomechanical test loadings that should be applied to match to the goat spines during 6 weeks in vivo will not easily be obtained in vitro. Our ACDs were intended to allow evaluation of novel nucleus replacement therapies in animal models, and the results cannot easily be extrapolated to closure techniques of the AF in patients with disc herniation undergoing a discectomy. Current discectomy procedure was performed in a very standardised manner in healthy discs with fixed location and size in the lateral AF. This is in contrast to the human situation after a discectomy, where a very variable amount of the AF is damaged at the thin posterolateral part of the AF. For human AF closure, which should ultimately accompany a potential successful NP replacement, other closure techniques should be developed [5].
126
In conclusion, the current study found encouraging results with a novel annulus closure system in vitro and after 2 weeks in vivo. After 6-week follow-up, however, most implants revealed signs of severe plastic deformation and subsequent displacement. Although there was a tendency towards better results when combined with a nucleus replacement, these differences were not statistically significant. Further research on annulus closure devices, in order to allow the in vivo evaluation of nucleus replacement therapies, is therefore indicated. Current results also illustrate the importance of in vivo confirmation of results obtained by biomechanical experiments, especially in the field of annulus closure techniques.
Figure 9: MRI image that shows that the annulus closure system is located in the centre of the endplate reaction (arrow), suggesting a causative role.
Acknowledgments This study was supported by Arthro Kinetics AG (Esslingen am Neckar, Germany). The authors like to thank Klaas Walter Meyer, Paul Sinnige (both from the Department of Animal Experiment), Wouter Jurgens, MD (Department of Plastic and Reconstructive Surgery) and Robert Jan Kroeze, MD (Department of Oral Cell Biology) for their assistance in the surgeries and/or autopsies. Ger Vink and Jan Blom are acknowledged for taking care of the goats.
127
Chapter 6
128
References 1. Ahlgren BD, Lui W, Herkowitz HN, Panjabi MM, Guiboux JP (2000) Effect of anular repair on the healing strength of the intervertebral disc: a sheep model. Spine 25(17):21652170 2. Albert HB, Kjaer P, Jensen TS et al (2008) Modic changes, possible causes and relation to low back pain. Med Hypotheses 70(2):361368 3. Bajanes G, Perez A, Diaz M (2007) One year follow up of discectomy patients who received a mesh to repair the annulus fibrosus, vol 7. Spine Arthroplasty Society, Berlin 4. Bourgeault C, Beaubien B, Griffith S (2007) Biomechanical assessment of annulus fibrosus repair with suture tethered anchors, vol 7. Spine Arthroplasty Society, Berlin 5. Bron JL, Helder MN, Meisel HJ, van Royen BJ, Smit TH (2009) Repair, regenerative and supportive therapies of the annulus fibrosus: achievements and challenges. Eur Spine J 18(3):301313 6. Bron JL, Koenderink GH, Everts V, Smit TH (2009) Rheological characterization of the nucleus pulposus and dense collagen scaffolds intended for functional replacement. J Orthop Res 27(5):620626 7. Carragee EJ, Han MY, Suen PW, Kim D (2003) Clinical outcomes after lumbar discectomy for sciatica: the effects of fragment type and anular competence. J Bone Joint Surg Am 85A(1):102108 8. Choy DS (2000) Familial incidence of intervertebral disc herniation: an hypothesis suggesting that laminectomy and discectomy may be counterproductive. J Clin Laser Med Surg 18(1):2932 9. Dormans KW, Krijnen MR, Geertsen S, van Essen GJ, Wuisman PI, Smit TH (2004) Telemetric strain measurements in an interbody fusion cage: a pilot goat study. In: Proceedings of the 14th European Society of Biomechanics (ESB) conference. sHertogenbosch, Netherlands, p 224 10. Hansson E, Hansson T (2007) The cost-utility of lumbar disc herniation surgery. Eur Spine J 16(3):329337 11. Hegewald AA, Ringe J, Sittinger M, Thome C (2008) Regenerative treatment strategies in spinal surgery. Front Biosci 13:1507 1525 12. Heuer F, Ulrich S, Claes L, Wilke HJ (2008) Biomechanical evaluation of conventional anulus fibrosus closure methods required for nucleus replacement. Laboratory investigation. J Neurosurg Spine 9(3):307313 13. Kamaric E, Gorensek M, Vilendecic M, Eustacchio S, Trummer M, Eskinja N, Ledic D, Yeh O, Einhorn J, Lambrecht G (2006) Surgical factors affecting reherniation rate after lumbar microdiscectomy: effect of defect size and amount of disc removed. Spine J 6(5 Suppl 1):38S 14. Ledet EH, Tymeson MP, DiRisio DJ, Cohen B, Uhl RL (2005) Direct real-time measurement of in vivo forces in the lumbar spine. Spine J 5(1):8594
15. Melrose J, Smith SM, Little CB et al (2008) Recent advances in annular pathobiology provide insights into rim-lesion mediated intervertebral disc degeneration and potential new approaches to annular repair strategies. Eur Spine J 17(9):11311148 16. Nachemson A (1965) The effect of forwards leaning on lumbar intradiscal pressure. Acta Orthop Scand 35:314328 17. Nachemson A, Morris JM (1964) In vivo measurements of intradiscal pressure. Discometry, a method for the determination of pressure in the lower lumbar discs. J Bone Joint Surg Am 46:10771092 18. Ries MD, Pruitt L (2005) Effect of cross-linking on the microstructure and mechanical properties of ultra-high molecular weight polyethylene. Clin Orthop Relat Res 440:149 156 19. Sebastine IM, Williams DJ (2007) Current developments in tissue engineering of nucleus pulposus for the treatment of intervertebral disc degeneration. Conf Proc IEEE Eng Med Biol Soc 1:64006405 20. Sherman J, Cauthen J, Griffith S (2007) Pre-clinical evaluation of a mesh device for repairing the annulus fibrosus. Spine Arthroplasty society, Berlin 21. Shirazi-Adl A, Ahmed AM, Shrivastava SC (1986) Mechanical response of a lumbar motion segment in axial torque alone and combined with compression. Spine 11(9):914 927 22. Sivan S, Merkher Y, Wachtel E, Ehrlich S, Maroudas A (2006) Correlation of swelling pressure and intrafibrillar water in young and aged human intervertebral discs. J Orthop Res 24(6):12921298 23. Smit TH (2002) The use of a quadruped as an in vivo model for the study of the spine biomechanical considerations. Eur Spine J 11(2):137144 24. Wilke HJ, Heuer F, Neidlinger-Wilke C, Claes L (2006) Is a collagen scaffold for a tissue engineered nucleus replacement capable of restoring disc height and stability in an animal model? Eur Spine J 15(Suppl 3):S433S438 25. Wilke HJ, Neef P, Caimi M, Hoogland T, Claes LE (1999) New in vivo measurements of pressures in the intervertebral disc in daily life. Spine 24(8):755762 26. Yeung AT, Yeung CA (2007) Minimally invasive techniques for the management of lumbar disc herniation. Orthop Clin North Am 38(3):363372
129
Chapter 6
130
Addendum 1 Techniques and instruments
Addendum 1
Development of the model and instruments All instruments were developed to be used via for minimal invasive surgery of the goat lumbar spine. According to known anatomical dimensions of the goat IVD, a real sized Perspex model of the goat IVD was made (Fig 1A). Since a lateral surgical approach of the spine was intended, the IVD model has a hole at one side laterally (Fig 2B). The model was used as a guide for further development of the instruments. The first instrument is a guide wire designed to puncture the lateral side of the IVD (Fig 2A, left). Position of the tip of the guide wire can be monitored using the C-arm during surgery. Next, is a series of tubes with ascending diameter that can be introduced over the guide wire to gradually increase the size of the AF defect (Fig 2). The largest tube has an inner diameter of 2.6 mm en outer diameter of 3 mm. After this last tube is introduced into the IVD, the guide wire and other tubes are removed. All other instruments and implants are designed to fit through this largest tube. The next step is to evacuate to NP. The rongeurs and other instruments are shown in figure 3. After the NP is evacuated, the NP replacement material can be introduced through the tube. For the in vivo study, the NP space was filled with a highly dense collagen scaffold, which was also shaped to fit through the tube (length 50 mm, volume ~0.27 cm3) (Fig 4). The preparation and characteristics of this collagen matrix (NuRes, Arthro Kinetics AG, Esslingen, Germany) has been described in chapter 2 [5]. The chosen density was 25 % w/w of collagen, which has a stiffness comparable to the native NP [5]. Finally, the size of the AF defect, which was consistent with the outer size of the largest tube, was filled with a custom made annulus closure device that has been described in chapter 6 (Fig 5) [6]. Unfortunately, the ACD could not be introduced through the tube and was inserted immediately after removal of the tube. All implants had been sterilized before by -irradiation.
132
Techniques and instruments
Figure 1: Real size Perspex model of the goat IVD used for the development of the NP replacement model. The Perspex model has a hole at one size laterally (B), which is consistent with place of the AF defect using the posterolateral surgical approach.
133
Figure 2: shows the instruments intended to make a standardized defect in the AF. At the left (A) is a guide wire used to make the initial defect in the AF. Then, the tubes are inserted over the wire (B) to gradually increase the size of the defect. The largest tube has an outer diameter of 3 mm.
Figure 3: Instruments used for evacuation of native NP tissue (A). The instruments are designed to fit through the largest tube (B).
Addendum 1
134
Figure 4: Images showing how the collagen implant is inserted into the Perspex model via the largest tube. The collagen implant is delivered in a similar tube as the tube in the AF and is connected to the back of the latter (A). A stamp is used to push the collagen from the tube into the disc space (B,C). In image D shows the full implant (50 mm) inside the Perspex model.
Figure 5: The ACDs that used to close the defect in the AF after the collagen implant is inserted.
Techniques and instruments
In current addendum we described the development of a NP replacement model in order to evaluate scaffold materials via minimal invasive surgery in goats. The model and instruments were tested in a pilot study in vivo using high density collagen implants to replace the NP. Although the model was designed to be used for minimal invasive surgery, an open approach was used for the pilot study. The open approach allowed visualization of the AF defect, ascertained correct insertion of the collagen implant and excluded the learning curve necessary for minimal invasive spinal surgery. Furthermore, the ACDs could not be inserted via the same tube used for NP evacuation and the collagen implant, which is only one among several limitations of the devices (see chapter 6). Overall, the standardized NP replacement model turned out to be feasible in vivo. Clinically, the surgeries were well tolerated by the animals and no complications were observed.
135
Addendum 1
136
Addendum 2 Nucleus implant evaluation
Addendum 2
Introduction In chapter 6 an in vivo goat study was presented to evaluate annulus closure devices (ACDs). In this study a collagen nucleus implant was inserted in addition to an ACD at one level in every of the ten goats. Since chapter 6 was mainly directed to the development of a suitable ACD, no evaluation of the collagen implants was performed. Although the number of animals and the short term follow up in this study will not allow any firm conclusions on the collagen, it is the first large animal nucleus replacement in vivo study reported till date in literature. In this second addendum to chapter 6 we therefore perform an analysis of the results of the collagen scaffolds that were implanted in addition to the ACDs. The addendum includes histologic and radiological (disc height index and MRI) analysis of the levels treated with a collagen implant. As described in chapter 6, 2 of the goats were terminated after 2 weeks and 8 goats after 6 weeks of follow-up. Methods Histology Intervertebral discs were sectioned in 3 mm slices using a band saw (Exakt, Norderstedt, Germany). Digital photographs of all paramidsagittal slices were taken. Before further processing, slices were carefully inspected for the presence of dense collagen, any tissue reaction, and for the position of the ACD. One paramidsagittal slice was fixed in 10% neutral buffered formalin, decalcified, paraffin-embedded, sectioned to 7 m section and stained with haematoxylin and eosin (H&E). Alcian Blue- Periodic Acid Schiff (AB-PAS) staining was performed on adjacent sections. The pH of the AB used for the staining was 1.0. All sections were screened for the presence of dense collagen and tissue reactions. Also, the number of cells was counted and averaged in 5 randomly selected fields of view (magnification x 20) of the NP of each disc. IVD height measurements Before and after each surgery and before autopsy, standardized lateral lumbar radiographs were made. The X-rays were analysed digitally using image analysis software (Centricity Radiology Web, GE Medical Systems, Milwaukee, WI, U.S.A.). The Disc Height Index (DHI) was calculated by dividing the average IVD height by the average adjacent caudal vertebral body height, as described previously [11,
138
Nucleus implant evaluation
13, 17]. DHI measurements were performed by two scorers (JB & Remco Sonnega) on two separate occasions. Magnetic Resonance Imaging After harvesting the lumbar spines, MRI scans were made using a 1.5 Tesla clinical imager (Symphony Quantum, Siemens AG Medical Solutions, Erlangen, Germany). Sagittal sections were made using a T2-weighted spin echo sequence, a turbo factor 5 and a spine array coil (time to repetition (TR): 3000msec., time to echo (TE): 85 msec., field of view 200, matrix of 118x384, and a slice thickness of 3 mm with a 10% gap). Statistics To calculate differences between different implant groups, Students unpaired Ttest was used. Results Macroscopic and histological evaluation Macroscopy revealed that the dense collagen was still present in the IVD space, but not yet integrated in the NP tissue after 6 weeks (Figure 1). This resulted in the loss of the collagen material during sawing and processing for histology. Microscopic screening of the coupes for the presence of the collagen scaffold did not reveal any remnants. As in all experimental segments in this study the NP had been removed, the macroscopic and microscopic grading scores that have been developed for disc degeneration do not apply. All treated levels revealed unilateral damage to the AF (Fig 2a) and damage to the NP due to the discectomy (Fig 2b & d), compared to the control levels (Fig 2d). Two segments with adverse reactions were observed (Fig 3 & 4). The first reaction was at level treated with an ACD alone (Fig 3). The macroscopic picture of this IVD shows destruction of the upper endplate and the formation of an osteophyte at the side of the ACD (Fig 3a). The ACD itself is destructed and dislocated. HE staining of the endplate confirms the destruction and the invasion inflammatory cells reveals an extensive immunological reaction (Fig 3b). The other adverse reaction is observed in a level treated with a collagen implant and an ACD (Fig 4). Here the destruction involves the NP, both endplates and the AF at the ACD side (Fig 4a). AB-PAS staining of the
139
Addendum 2
NP reveals the absence of the typical low cellular- NP tissue but instead a remarkable increased cellularity and areas of necrotic debris (Fig 4b). HE-stained pictures of the tissue around the ACD clearly show that the reaction is centered round this implant. To analyse the regenerative effect of the different procedures, the density of cells per field view was analysed in all NPs. The two discs that demonstrated an inflammatory reaction with a dramatic increased cellularity were discarded from this analysis. The results of the cell count after 6 weeks follow-up are shown in figure 7. The average cell number is between 22-26 (per 20x field) and no statistical different numbers are observed between different groups. The control group has the lowest cell number, whereas the ACD reveals the highest. Disc height index: The results of the DHI measurements after 2 and 6 weeks follow-up were compared to the pre-operative DHI (Fig 5). As expected, the control levels did show not any significant change. After two weeks, the levels that were treated with discectomy alone had a significant lower DHI compared to the untreated control levels (P< 0.05). After 6 weeks, the levels treated with an ACD stand alone showed a significant decrease in DHI (P< 0.05) compared to untreated control levels. The levels treated with either a collagen implant (with ACD) or a discectomy alone also showed a decrease in DHI, but this was not significant (P=0.22 and P=0.055 respectively). The two levels that revealed endplate destruction (see below) were excluded from DHI analysis. On the radiographs taken directly postoperatively, the control levels showed a significant increased DHI compared to pre-operative, whereas the other levels did not show any significant change (Fig 6). The control levels had also a significant higher DHI compared to the discectomy (P= 0.006) and ACD (P= 0.04), but not to the NP implant level (P= 0.13).
140
Figure 1: Macroscopic image of a paramidsagittal slice of an IVD treated with a collagen implant (6 weeks follow-up) directly after sawing. The collagen implant (arrow) is still visible and clearly lacks adherence to the remainder NP tissue resulting in the loss of the material during preparation
141
Figure 2: A: Macroscopic image of an IVD treated with discectomy. The scar tissue is still evident after 6 weeks of follow up., B: IVD treated with a collagen implant and ACD (not visible). The collagen material is still visible (beige) as it loosely lies between the remnants of the NP (white), C: IVD treated with an ACD alone clearly showing scar tissue and a damaged AF at the operation side. The damaged ACD itself is partly visible at the left of the picture exterior of the scar tissue, D: image of a control level showing typical healthy NP tissue in the absence of AF damage. Figure 3 (next page): Macroscopic (A) and microscopic (B, stain: HE, magnification x10) image of an endplate reaction is a level treated with an ACD alone after 6 weeks of follow-up. An osteophyte has been formed at the side of the ACD, which itself is destructed and dislocated visible outside the AF. The microscopic image shows that the endplate structure is being destroyed by extensive cell infiltration >>
Addendum 2
Figure 3
142
Figure 4: A: macroscopic image of an IVD treated with a collagen implant and ACD after 6 weeks follow-up showing destruction of both endplates and the AF at the ACD side, B: Microscopy of the NP (AB-PAS, magnification x20) reveals that the normal tissue is replaced by a cellular reaction with areas of necrotic debris, C&D : Microscopic images (Stained HE, magnification x5 (C) and x20 (D)) of the border of the ACD implant (not present itself after fixation) reveals an extremely cell rich reaction located around the implant. Giant cells are present (D) indicating cellular reaction to breakdown the ACD by phagocytosis.
Figure 5: Results of the DHI measurements after 2 and 6 weeks, compared to pre-operative values. No significant differences are found after 2 weeks. After 6 weeks, the levels treated with a discectomy and an ACD alone show a significantly lower DHI compared to the control levels (P<0.05). The levels treated with the collagen implant show a non-significant decreased DHI compared to the control levels.
Figure 6: The differences of the DHI directly post-operative compared to preoperative values (included are all 10 goats). Interestingly, the control levels show a significant higher DHI postoperative compared to pre-operative. The DHI of the other levels show no significant changes per operative. The DHI of the DI en ACD levels, however, is postoperatively significantly lower than the control levels (P<0.05).
143
Figure 7: A graphic representing the average cell numbers of 5 random cell counts (magnification x20) of the NP after 6 weeks. The highest cell number is found for the levels treated with an ACD (25.7), whereas the lowest number is found in the control levels (22.9). However, these findings are not statistically significant. The two levels at which a tissue reaction was found, were excluded from the measurements
Addendum 2
MR Imaging: MRI images of all levels in all goats after 6 weeks are shown in Figure 8. The collagen implants are not visible on the MRI. Two segments showed an adverse reaction: level one segment treated with an ACD alone the lower endplate is involved and in a segment treated with an NP both endplates show extensive destruction. Besides the two reactions described above, MR images do not reveal any major differences between the treatments.
144
Figure 8: Sagittal MR images of all levels after 6 weeks follow-up. The first image of the ACD series and the sixth image of the NP implant series reveal a tissue reaction. The first case only one endplate is destructed, whereas both endplate are involved the latter.
Discussion Macroscopic evaluation of the IVDs revealed that the dense collagen was not yet integrated in the matrix of the NP (Fig 1). Collagen breakdown in the IVD is dependent on the remodeling and turnover capacity of the native cells. Since the number of natives cells in NP tissue is low and cell turnover only slow [21], this capacity is limited. [7]. The breakdown of collagen can be dramatically increased under certain circumstances including inflammation and malignancy [7]. Currently we did not observe an increase in the number of NP cells in the
IVDs treated with collagen (Fig 4), thus excluding major inflammation. The high density of the collagen (25% w/w), achieved by plastic compression, has a stiffness comparable to native NP tissue [5] but also results in a further decreased remodeling speed due to the restricted cell invasion and migration (chapter 4). The DHI of the discected IVDs could be preserved by implantation of a DCS compared to untreated control levels after 6 weeks (Fig 5). The levels treated with a discectomy or ACD alone showed a significant decrease in DHI. This suggests that the collagen implant is capable of restoring local resistance to hydrostatic and compressive forces. Of course, this greatly depends on containment capacity of the ACDs that is used. Current ACDs were already described to be suboptimal (only sufficient at in 2 out of 8 goats at 2 levels, partially sufficient[6] at 5 levels and insufficient[6] at 1 level). The (untreated) control levels showed a significant higher DHI directly post-operative compared to pre-operative. These differences may be due to the decreased hydrostatic pressure in the IVDs during surgery due to the administration of muscle relaxants and lying position. In contrast to the ACD and discectomy levels, the IVDs treated with the collagen implants did not show a significant difference in DHI directly post-operative compared to the control levels. In the first pilot study we showed that the ACDs do perform well in containing the collagen implants during the first two weeks (see also: [6]). The latter may be the reason that the levels with NP implant the pressure is (partly) restored directly post-operatively. Unsterilized dense collagen has the capacity to absorb water from the surrounding tissues resulting in swelling of the scaffolds. Current scaffolds, however, were sterilized by -irradiation and this results in an increase in the number of cross links and chain scission in the collagen matrix, both blocking the swelling potential [5]. From a practical point of view the latter is unfortunate, since the swelling capacity could have attributed to the hydrostatic pressure. Several radiological and histological grading systems for grading disc degeneration have been proposed [11, 13, 18, 24]. These grading systems however, have very limited value for a NP replacement model. For example, MRI grading systems rely on the signal intensity of the NP on T2-weighted images, reflecting water content. The healthy NP is a proteoglycan-rich matrix with a high capacity to retain water. Degeneration results in a reduction inproteoglycan content within the NP, with a
145
Addendum 2
subsequent reduction in water content. These changes facilitate a MRI based classification system [18]. In the current study however, the NP tissue was replaced by a dense collagen scaffold, which has a much lower water content compared to the proteoglycan-rich NP matrix. Perhaps MRI based grading could become useful for longer follow-up periods, when the collagen becomes replaced by native NP tissue. Currently, the DHI measured on plain lateral radiographs turned out to be more useful, but MRI did show its suitability in revealing the two tissue reactions. Also histological grading systems proved not useful in this study. These score systems use the NP, AF and endplates to grade degeneration [24]. In the current study the NP and AF were both damaged by the discectomy, always resulting in low scores. The endplates did not reveal abnormalities, except the two levels with adverse reactions on the ACD. Again these grading systems could gain some relevance during longer follow-up when treated levels will regenerate or otherwise progress to extensive degeneration with subsequent changes. We did measure the cell number in the NP tissue, which was not statistically different between the various groups. Degeneration is accompanied by decreased cellularity, whereas inflammatory responses on the implanted material would be associated with increased cellularity. Both however, were not observed. The cell numbers that were found (20-25 cells/field, Fig 7) are comparable to earlier observations (average 17.1) at our department (Hoogendoorn et al, data submitted). In conclusion, although the dense collagen scaffolds showed to preserve disc height till six weeks after discectomy, the results were negatively influenced by insufficient annulus closure and the lack of appropriate scoring systems. Before the model can be used for studies with longer follow up periods or other scaffolds, optimization of the ACD and the development of grading systems designed for NP replacement are crucial. Acknowledgment The authors like to than Remko Sonnega, MD for his attributions to the disch height measurements.
146
References to the addenda 1. Atlas SJ, Keller RB, Wu YA, Deyo RA, Singer DE (2005) Long-term outcomes of surgical and nonsurgical management of lumbar spinal stenosis: 8 to 10 year results from the maine lumbar spine study. Spine 30(8):936-943. 2. Atlas SJ, Keller RB, Wu YA, Deyo RA, Singer DE (2005) Long-term outcomes of surgical and nonsurgical management of sciatica secondary to a lumbar disc herniation: 10 year results from the maine lumbar spine study. Spine 30(8):927- 935. 3. Battie MC, Videman T (2006) Lumbar disc degeneration: epidemiology and genetics. J Bone Joint Surg Am 88 Suppl 2:3-9. 4. Bron JL, Helder MN, Meisel HJ, van Royen BJ, Smit TH (2009) Repair, regenerative and supportive therapies of the annulus fibrosus: achievements and challenges. Eur Spine J 18(3):301-313. 5. Bron JL, Koenderink GH, Everts V, Smit TH (2008) Rheological characterization of the nucleus pulposus and dense collagen scaffolds intended for functional replacement. J Orthop Res. 6. Bron JL, van der Veen AJ, Helder MN, van Royen BJ, Smit TH (2010) Biomechanical and in vivo evaluation of experimental closure devices of the annulus fibrosus designed for a goat nucleus replacement model. Eur Spine J 19(8):1347-1355. 7. Everts V, van der ZE, Creemers L, Beertsen W (1996) Phagocytosis and intracellular digestion of collagen, its role in turnover and remodelling. Histochem J 28(4):229-245. 8. Ganey T, Libera J, Moos V et al. (2003) Disc chondrocyte transplantation in a canine model: a treatment for degenerated or damaged intervertebral disc. Spine 28(23):26092620. 9. Haugen AJ, Grovle L, Brox JI et al. (2011) Estimates of success in patients with sciatica due to lumbar disc herniation depend upon outcome measure. Eur Spine J. 10. Hegewald AA, Ringe J, Sittinger M, Thome C (2008) Regenerative treatment strategies in spinal surgery. Front Biosci 13:1507-1525. 11. Hoogendoorn RJ, Helder MN, Kroeze RJ et al. (2008) Reproducible long-term disc degeneration in a large animal model. Spine (Phila Pa 1976 ) 33(9):949-954. 12. Hoogendoorn RJ, Lu ZF, Kroeze RJ et al. (2008) Adipose stem cells for intervertebral disc regeneration: current status and concepts for the future. J Cell Mol Med 12(6A):22052216. 13. Hoogendoorn RJ, Wuisman PI, Smit TH, Everts VE, Helder MN (2007) Experimental intervertebral disc degeneration induced by chondroitinase ABC in the goat. Spine (Phila Pa 1976 ) 32(17):1816-1825. 14. Humzah MD, Soames RW (1988) Human intervertebral disc: structure and function. Anat Rec 220(4):337-356. 15. Katz JN (2006) Lumbar disc disorders and low-back pain: socioeconomic factors and consequences. J Bone Joint Surg Am 88 Suppl 2:21-24.
147
Addendum 2
148
16. Kim JM, Lee SH, Ahn Y et al. (2007) Recurrence after successful percutaneous endoscopic lumbar discectomy. Minim Invasive Neurosurg 50(2):82-85. 17. Lu DS, Shono Y, Oda I, Abumi K, Kaneda K (1997) Effects of chondroitinase ABC and chymopapain on spinal motion segment biomechanics. An in vivo biomechanical, radiologic, and histologic canine study. Spine (Phila Pa 1976 ) 22(16):1828-1834. 18. Masuda K, Aota Y, Muehleman C et al. (2005) A novel rabbit model of mild, reproducible disc degeneration by an anulus needle puncture: correlation between the degree of disc injury and radiological and histological appearances of disc degeneration. Spine (Phila Pa 1976 ) 30(1):5-14. 19. Nellensteijn J, Ostelo R, Bartels R et al. (2010) Transforaminal endoscopic surgery for symptomatic lumbar disc herniations: a systematic review of the literature. Eur Spine J 19(2):181-204. 20. Postacchini F, Postacchini R (2011) Operative management of lumbar disc herniation : the evolution of knowledge and surgical techniques in the last century. Acta Neurochir Suppl 108:17-21. 21. Risbud MV, Schipani E, Shapiro IM (2010) Hypoxic regulation of nucleus pulposus cell survival: from niche to notch. Am J Pathol 176(4):1577-1583. 22. Suk KS, Lee HM, Moon SH, Kim NH (2001) Recurrent lumbar disc herniation: results of operative management. Spine 26(6):672-676. 23. Swartz KR, Trost GR (2003) Recurrent lumbar disc herniation. Neurosurg Focus 15(3):E10. 24. Thompson JP, Pearce RH, Schechter MT et al. (1990) Preliminary evaluation of a scheme for grading the gross morphology of the human intervertebral disc. Spine (Phila Pa 1976 ) 15(5):411-415. 25. Yeung AT, Yeung CA (2007) Minimally invasive techniques for the management of lumbar disc herniation. Orthop Clin North Am 38(3):363-372.
7
General Discussion
Chapter 7
150
Disc herniation Low back pain (LBP) is a leading cause of disability in our population, affecting most people at some point in life. Chronic LBP decreases quality of life and has significant socio-economic consequences due to absenteeism from work and increased medical consumption [37]. LBP is a multifactorial condition in which muscular, psychological and socioeconomic factors act in concert. Intervertebral disc (IVD) degeneration is also a strong etiological factor, but the exact contribution is still unclear since imaging modalities often do not correlate with symptomatology [6]. IVD degeneration is a complex disease, in which changes to certain extent develop physiologically due to aging, but can become pathologic in severe degeneration with no clear border inbetween. Due to degeneration, several structural changes occur in the IVD, most notably the dehydration of the nucleus pulposus (NP) in association with tears in the annulus fibrosus (AF) and endplates (Schmorls nodes) [6]. Damage to the AF may diminish its capability to cope with the local stresses and as a result the NP may herniate through the disrupted AF [6]. Initially, the herniated NP material results in direct mechanical compression of the nerve roots that are located posterior of the IVD. Furthermore, in the absence of vascularity the NP is normally an immune privileged tissue. Herniation of this material provokes an inflammatory response further adding to the irritation of the nerve roots [35]. Disc herniation occurs in up to 2% of the general population and these patients can often recall an episode of (sub)acute LBP in combination with radicular complaints. Whereas the radicular symptoms will resolve spontaneously in over two-thirds of the patients within 6 weeks, the LBP often persists or even progresses. In contrast to other forms of disc degeneration that develop in a slow progressive manner, in IVD herniation there is an acute change in local biomechanics and a disruption of homeostasis. The loss of intradiscal pressure results in decreased disc height and a diminished capability of the NP cells to maintain their ECM. The ECM, rich in waterbinding proteoglycans, is essential for the water maintaining capacity of the IVD. That IVD cells need a certain hydrostatic pressure to function properly was recently demonstrated in a clinical study among astronauts. The absence of gravity during the space flight and subsequent reduced IVD pressure resulted in an increased incidence of IVD herniation in the period after the flight [18]. If the biomechanical changes due to herniation are not reversed, progression to advanced stages of IVD degeneration will usually be inevitable, explaining the persisting LBP in
General discussion
patients after an episode of IVD herniation. Moreover, if the local effects of the IVD herniation are reversed quickly, homeostasis might be restored, however if treatment is delayed degenerative changes become irreversible. Recently it was shown that if treatment for IVD herniation is delayed over 6 months, outcomes are worse following both operative and non-operative treatment [33]. The aim of this thesis was to develop a tissue engineered strategy to reverse the state after IVD herniation and to restore local homeostasis. To minimize patient discomfort, the therapy should ideally be combined with the neurological decompression surgery. In this thesis, we have translated this strategy into practice, starting with material design and ending up with the in vivo evaluation in a large animal model. Tissue engineering Tissue engineering is generally described as the use of a combination of cells, engineering and materials methods, and suitable biochemical and physio-chemical factors to improve or replace biological functions [1]. It is also referred to as regenerative medicine, underscoring its relation to and among other medical disciplines. Tissue engineering has evolved very quickly as an area of research since the 90s of the past century. Where initial opportunistic research hypothesized that the injection of stem cells would be sufficient for the regeneration of virtually every organ or tissue, scientists now slowly learn all circumstances that are involved [23, 30]. For the herniated intervertebral disc, numerous regenerative strategies have been studied, however broad clinical success is still lacking. In the end, this will rely on clinical treatment outcomes and costs and these will require clinical trials to establish superiority over conventional treatment standards [24]. Figure 1 shows the development pathway for novel regenerative therapies. Even when all the steps in the figure have been passed successfully, commercial success is not guaranteed. Education of the clinicians with the intention to use tissue engineered products for their patients will be crucial. This will require scientific experts, parties involved in the fabrication/development and clinicians to work in concert.
151
Chapter 7
Figure 1: Development pathway for tissue engineering [24]
152
In this thesis, several steps of the development pathway (Figure 1) for IVD engineering have been challenged. The first step was to choose a suitable scaffolds material. Chapter 2 & 3 focused on the optimization of these scaffold materials and the interaction with cells (Point 2). The cell source selection (point 1) was studied in chapter 4. Since we preferred the development of an a-cellular scaffold these cells consisted of the cells from surrounding structures that were expected to invade these scaffolds. In these first chapters other important developmental issues were assessed including sterilization, formulation and method of delivery. The feasibility, safety and efficacy (point 3) were finally studied in goats in chapter 6. Every chapter revealed crucial answers and opportunities, but often also serious challenges and drawbacks, findings inherent to a relatively young area of medicine. Material development Like every tissue in the human body, the IVD is composed of extracellular matrix (ECM) in which native cells reside. The best material, or scaffold, used for replacement of the tissue should ideally mimic several, or ultimately all, functions of native IVD ECM [5]. Four important functions and features of scaffold with respect to native ECM were recently summarized by Chan et al. [5]:
General discussion
1. Architecture: Scaffolds should provide void volume for vascularization and remodeling and the rate of degradation should match to the new ECM formation. 2. Cyto-compatibility: The scaffolds should allow (native) cells to attach, grow, proliferate and differentiate 3. Bioactivity: scaffold may include biological cues to influence cell morphology, alignment, migration speed and differentiation. 4. Mechanical properties: scaffolds should provide mechanical and shape stability of a tissue defect. Interestingly the mechanical properties of a scaffold are also known to influence the biosynthetic cell response and thus act as a passive cue. At this moment, these material demands are principally qualitative and quantification is highly desirable with respect to material development. Numerous (bio)polymers and materials have been suggested as a suitable candidate for IVD engineering including collagen, alginate, gelatin, chitosan, poly-L-lactic acid and hyaluronan [5]. All of the materials have their advantages and disadvantages and the optimal material, fulfilling al the desired functions, will probably yet have to be invented. Beside the desired functions described above other concerns are involved in choosing the optimal scaffold, these involve availability, costs and handling [4]. The NP itself exists of Type II collagen, proteoglycans and small fractions of several other (glyco)proteins including elastin, fibronectin, laminins and tenasins [6]. It is not possible to remake the tissue in vitro, and attempts to overcome this problem have proposed. Mercuri et al. for example, harvested porcine NPs which were completely decellularized using a combination of chemical detergents, before the scaffolds were repopulated with human adiposederived stem cells [25]. Although their results seem promising the technique is very laborious and time consuming and not necessary since the aim of tissue engineering is to shape the optimal environment in which cells are able to synthesize and maintain the desired ECM [11]. In this thesis, we choose two very promising biomaterials to imitate the visco-elastic properties of the NP: collagen (chapter 2) and alginate (chapter 3). For this purpose, we first determined the visco-elastic properties of the goat NP and showed that this is comparable to the human NP known from literature.
153
Chapter 7
154
In Chapter 2, rat-tail derived type I collagen was used to match to the visco-elastic properties of the NP. The rat-tail derived collagen Type I scaffolds used for this study are already used in humans for the treatment of articulair cartilage defects of the knee (The cartilage regeneration system, Cares) [34]. Recently, the results of a large prospective multicenter clinical trial showed that the usage was safe and clinically effective after a mean of 30 months follow-up [34]. Unfortunately, it is not possible to retrieve scaffold material for histology in clinical trials. Instead, magnetic resonance imaging of the cartilage defects treated with Cares showed no signs of inflammatory reactions and comparable results to defects treated with Hyalograft C 2 years after implantation [40]. The absence of anti-immunity reactions in vivo was also confirmed in a rat model [21]. The rat, however, is arguably not the optimal species to evaluate inflammatory response of rat-tail derived collagen. In this thesis we showed the absence of anti inflammatory response in vivo in goats (Chapter 7). With respect to IVD regeneration, the collagen scaffolds were studied in vitro in bovine lumbar spinal motions units. In this study, the scaffolds were capable to restore the range of motion to native values after implantation in a discected IVD [41]. These findings show that a collagen type I scaffold is a very promising candidate to restore the biomechanical disturbances after IVD herniation and possibly prevent the degenerative cascade in the spinal motion unit. However, in order to prevent degeneration in the long term, the scaffolds should be remodelled into native ECM by cells. It has been appreciated that the local biomechanical environment acts as a passive cue for the gene expression and ECM production of native cells [8]. Cells mechanosense the stiffness of the ECM by actively exerting traction forces generated by their internal cytoskeleton. Moreover model studies on 2D substrates suggest that the cells adapt their biosynthetic response to changes in matrix stiffness [8]. Ideally therefore, a scaffold imitates the mechanical properties of NP tissue [5, 28]. An advantage of a collagen type I matrix is that the visco-elastic properties can be adjusted by a rapid filtration process called plastic compression [27]. In chapter 2 we used this process to increase the stiffness of the collagen matrix and found that a stiffness of 23 % w/w collagen agreed with the stiffness of NP tissue of the goat. However, the viscosity at this density of collagen was still lower compared to the NP and therefore a complete biomechanical match could not be found. An interesting finding was that the
General discussion
swelling capacity of dense collagen scaffolds increases with increasing density. This is a favorable finding with respect to the replacement of NP tissue that has also an impressive capacity to swell. In contrast, free floating collagen scaffolds, often studied as scaffolds as well, are known to shrink by the contraction of the seeded cells. In Chapter 2, we also showed that -sterilization has important effects on the visco-elastic properties of scaffolds. Sterilization techniques, such as -sterilization, are necessary steps before materials can be used in vivo and the effects are not always foreseen by scientist involved in the pre-clinical research. In the absence of an exact biomechanical match, type I collagen should still be considered as an attractive scaffold material for IVD engineering. The wide availability (e.g. rat-tail, bovine, transgenic) and known biocompatibility are noteworthy. The handling, however, is perhaps the most interesting feature of type I collagen. Plastic compression allows to produce scaffolds rapidly in virtually every collagen density [27]. Cells survive when added prior to compression resulting in completely seeded scaffolds [27], or the scaffolds can be used as acellular scaffolds as in the current studies. Besides the visco-elastic properties of the scaffold, the local hydrostatic pressure also influences cell response [32]. In the IVD space this is dependent on the forces on the motion segment and the capacity of the annulus closure technique to seal the defect. In chapter 3, we evaluated alginate as a scaffold material for NP replacement. Alginate is a natural polysaccharide used for numerous medical applications due to its non-toxic nature, wide availability, low costs and simple handling and gelling behaviour [10]. In addition, the biosynthetic activity of chondrocytes, like NP cells, cultured in alginate matrices is comparable to the activity in native NP ECM [22, 39]. Alginate beads are therefore widely used as a 3D culture environment for these cell types [38]. Moreover, initial in vitro and in vivo studies on alginate as a scaffold material for NP replacement showed encouraging results [22, 26]. However, inferior biomechanical properties, especially after some time in physiological solutions, have been recognized as important limitations for the usage of alginate as a scaffold material [10]. In our study, alginate was prepared via two different techniques [29] and in different densities to imitate the visco elastic behavior of the NP. The 2% alginate scaffolds prepared by diffusion gelation closely matched the visco-elastic properties of the NP, even more closely than the collagen scaffolds described in the preceding chapter. The moduli
155
Chapter 7
156
measured in our study (5kPa for 1% alginate at 10 rad/s) are somewhat lower than in a previous report (16 kPa) [22]. The difference may be due to a completely different gelation protocol in the previous study and is one of several important limitations of the use of alginate revealed in chapter 3: Firstly, there is a wide range in the characteristics of alginate gels due to variations in G/M ratio, gelation temperature and rate, molecular weight, calcium content and type of crosslinker [20]. All these variations strongly affect the final network structure and therefore the reproducibility of scaffold production will be questionable. This concern also underscores the importance of the accurate documentation of exact conditions of preparation in scientific studies. Secondly, incubation of the scaffolds in culture medium has major effects on scaffold stiffness and this was also found after implantation in vivo [29]. Thirdly, and perhaps most importantly, changes in alginate scaffold stiffness do not influence the biosynthetic response of native cells. We showed that the NP cell phenotype was preserved in the alginate matrix, but not changed by altering the scaffold stiffness as would be expected. Explanations include the rapid loss of stiffness during culturing and the absence of integrin receptors on the cells to sense stiffness of the alginate. Both problems are being studied by the substitution of molecules that either stabilize the alginate matrix or promote the mechano-sensitivity of the cells for alginate. Another limitation worth mentioning is the necessity to use a cross linker (currently calcium chloride) and its potential adverse effect on the cell population cultured. Due to these limitations we preferred dense collagen as a scaffold material for the remainder of the studies. In Situ seeding The classical approach in regenerative medicine is to seed scaffolds with either native or stem cells in order to regenerate the desired tissue. The cells are expected to secrete the appropriate ECM, which finally replace the scaffold material, a process called remodeling. Seeding of a scaffold with cells, however, requires several additional steps that are generally time consuming and expensive. The cells first have to be harvested, cultured and expanded until the desired number of cells is reached. Hereafter the cells have to be seeded into the scaffolds so the surgeon can implant it in the desired location. Many experiments showed favorable results of the former in vitro, but also in vivo in animal models. However, each of the steps mentioned carries risks and drawbacks that are often
General discussion
overseen. Harvesting of (stem) cells requires an additional procedure and thus time, costs and morbidity. Digesting native ECM to obtain the cells demands chemical agents such as collagenases, which if not properly washed out, may interfere with the final therapy. Culturing cells may result in de-differentiation of the cells and infection of the culture. Furthermore, native cells from tissue harvested during discectomy procedures were found to have only a very limited regenerative potential [13]. An alternative for the use of native cells is the use of (adipose) mesenchymal stem cells. This, however, still requires prior (subcutaneous) harvesting procedures and thus possesses a risk on donor side morbidity. Moreover, pre-seeding of the scaffolds may compromise sterilization techniques and may require additional demands of the final form and volume of the implant. The in vitro experiments are generally performed by basic scientists and it may be questioned if their enthusiasm will be shared by surgeons who will have to perform the procedures in their patients. Clinicians have become used to deal efficiently with time and costs. Therefore, alternatives are now being studied and including the use of a-cellular scaffolds outlined in this thesis. Since our scaffolds were intended to be used as a-cellular constructs, we did not study scaffolds pre-seeded with cells. When implanted, the scaffolds were expected to be invaded by cells from surrounding tissues, and thus derived from the AF and/or (remnants of the) NP. The term in situ seeding has been proposed for this concept [15]. In situ seeding does not require additional time consuming culturing and seeding techniques necessary for cell seeded scaffolds. In situ seeding therefore allows the implantation of a preformed and sterilized scaffold in a single -one step- surgical procedure in adjunct to a microdiscectomy. If viable, the in situ seeding concept is therefore advantageous over seeded scaffold techniques. A condition sine qua none for the viability of the in situ seeding concept is the invasion of native cells into the scaffolds in vivo. An advantage of using dense collagen is the very long half life (~95 year in the healthy IVD, ~215 in the aged IVD [36]) of collagen in the IVD space, which will thus occupy space till migrated cells arrive for remodeling. Interestingly, Cheema et al. recently showed that the oxygen diffusion coefficient of dense collagen scaffolds (11%) falls within the range of native tissue. This finding is crucial for early migrated cells to survive in the absence of any vascularization [7]. In the current thesis (chapter 4) we assessed the capability of native IVD cells to invade dense collagens scaffolds in vitro. Unfortunately, we could not study densities as high as 23 % (w/w) collagen,
157
Chapter 7
since the time frames (> years) this would require are not compatible with in vitro culturing [27]. We studied densities up to 3% collagen that are still much higher compared to the densities generally studied (0,05% collagen). We showed that both NP and AF cells are capable of invading the scaffolds. As was expected, the migration decreased with increasing collagen densities. Interestingly we found a significantly greater migration capacity of NP cells compared to AF cells. Intuitively we had expected the fibroblast-like AF cells to have a greater migration capacity in dense collagen than the chondrocyte-like NP cells. Unfortunately, no comparable studies that either confirm or reject these findings are published. The chemokine Hst-2, derived from saliva was not found to have any pro-migratory effects on goat IVD cells. Hegewald et al. showed that the chemokine CXCL10 did actively recruit human AF cells [14]. The migration of human NP cells on the other hand was found to be enhanced by human serum [12]. The latter was actually confirmed by our own findings in the scratch assay in chapter 4. The animals Having shown that the visco-elastic properties of the NP can be approached with an a-cellular scaffold that also allows the invasion of native cells, our next step was to develop a model to evaluate the scaffold in vivo. Although substantial research is performed on the development and characterization of scaffolds for NP engineering, the number of studies that actually performed in vivo evaluation is very limited. There is only one comparable study which was performed in a small animal model. Huanng and colleagues recently reported the in vivo evaluation of collagen/hyaluronan/chondroitin-6-sulfate scaffolds seeded with NP cells in a rabbit model [16]. Curiously, no annulus closure technique was described and might perhaps have been not necessary in the small animal model. The authors found maintenance of the disc height and a restoration of the T2 weighted MRI signal after 24 weeks follow-up. Other in vivo studies used scaffolds only as injectable carriers for (stem) cells in disc degeneration. These studies in rabbits [16] or pigs [31] do not deal with the annulus defect typically for disc herniation and are therefore not comparable. One last in vivo study worth mentioning reported the implantation of complete tissue engineered IVDs consisting of polyglycolic acid and calcium alginate matrices seeded with native cells in mice [26]. Although the ECM production was in line with native tissue up to 12 weeks, the method of delivery of these constructs is perhaps too
158
General discussion
complicated to be feasible in humans. The number of in vivo studies for NP scaffolds is remarkably small compared to the massive in vitro work that has been published. Possibly, more in vivo studies have been performed, but not been accepted for publication since the results were negative [24]. A potential explanation for this, and one of the main concerns of NP replacement models in general, is the necessity of a closure technique for the AF [41]. During the planning of the animal studies we soon experienced the problem ourselves and decided to start to summarize all available data from literature on this subject first. This resulted in an extensive review (Chapter 5) from which it can be concluded that, despite numerous attempts, an appropriate AF closing technique is not yet invented. Since our intention was to evaluate dense collagen implants in goats, we needed some AF closure technique and started to test several custom made AF closure devices. These devices were designed to the goat dimensions and should be compatible with our NP replacement model. After thorough in vitro and in vivo (2 weeks) evaluation (Chapter 6) of potential devices we found devices which closed the AF sufficiently. These devices were then used for a next pilot in vivo study (6 weeks) to evaluate the collagen scaffolds. However, after six weeks follow-up the ACDs showed important signs of dislodgement and destruction. We therefore could still not perform the full in vivo evaluation of the collagen implants that we aimed. However, we did show that the disc height could be preserved in the levels treated with the collagen scaffolds, results that are in line with the findings of Huanng et al. [16]. They also found restored hydration (based on MRI) of the IVD after 24 weeks follow up. We could not make a quantitative analysis of the MR images, since the surgical disturbances were still predominant after 6 weeks follow up. Moreover, the AF closure devices have their own effects on MRI signal, essentially disturbing appropriate quantification. Haunng et al however, used a small animal model, which has a very limited value for translation to humans [24]. Small animal have significantly different spinal biomechanics and the small volume of the disc affects transport [3, 24]. Remaining disc height and an acceptable MRI T2 signal is therefore not very informative. The use of these animals should be preserved for safety studies, but feasibility studies require a large animal model as was used in the current thesis [24]. Although the replacement model was feasible, the surgeries reproducible and the harm to the animals acceptable the results are strongly negatively influenced due to the lack of an appropriate AF closure technique. Therefore no
159
Chapter 7
firm conclusions can be drawn. The experiments deserve further study, accompanied by a proper AF closure technique. Future perspectives Substantial research in the field of tissue engineering has been based on trial and error rather than on firm scientific knowledge. Not surprisingly, since many factors and circumstances affecting the success of the regenerative medicine still have to be revealed. For example, we studied the visco-elastic properties of a scaffold because this has been recognized as a cue for differentiation and ECM production. However, first studies on this subject have been published only five years ago and involved cells seeded on a flat surfaces [9]. Meanwhile, similar findings were observed in 3D environments, but the exact value, and the relation to other local circumstances such as the hydrostatic pressure, the biochemical environment and scaffold degradation rates remains unclear [32]. During the past decade, in vitro research using scaffolds, native cells or stem cells, have detected several individual factors involved in the regeneration of tissues. Probably we still know only a small portion of all the factors and basic research will remain to have a crucial position, before fully scientifically based regenerative strategies can be designed. Even when we are aware of all the factors involved, we still have to study their interactions, counteractions and synergies. This can only be properly studied in vivo and studies in relevant animal models are therefore required. Small animal models are useful for screening purposes, but large animal models are required to mimic nutritional and surgical constraints to human application [24]. Early tissue engineering attempts should be accompanied by a vision how the final clinical application will look like and address demands like formulation, delivery and sterilization [4, 19]. To evaluate therapies that are intended to regenerate the herniated IVD, there is a need for standardized magnetic resonance imaging grading and/ or scoring systems [2]. The scoring systems should be developed in animal models with histologic confirmation and then translated to the human situation in which histology is not an option [24]. An alternative to the use of animal models, is the use of a bioculture system in which entire IVDs can be studied under physiological circumstances and with longer time frames [17]. These systems have the advantage to reduce the number of animals needed for research and are currently being developed and their exact value will become clear in the near future. We showed that the lack of AF closure
160
General discussion
techniques impedes the in vivo evaluation. Moreover, in our goat model only a standardized defect in the lateral region of the AF had to be closed. In the patients suffering from disc herniation the defects are irregular, located posteriorly close to the neurological structures and sometimes even bilaterally. Appropriate closure of the AF defect in these patients will be even more challenging and might further delay tissue engineering development that may have passed the pre clinical stage successfully. Several suggestions and requires for annulus closure techniques were extensively described in Chapter 5. An important possibility to prevent the unnecessary repeating of (animal) studies with not publishable negative outcomes is the dissemination of these results between internationally established spinal research sites [24]. In the end, the most important question will be if the patients actually will benefit from the new therapy. Improper patient selecting may place a potential beneficial procedure in disrepute [19]. Clinicians should be instructed how to implement the new types of therapy in their surgical practice. This will demand close cooperation between scientists, industry and medical personnel [24]. Tissue engineering sites should be close to the operating theaters within the same complex. It requires massive efforts to achieve all this but the improvement of health care may be likewise if the promise of tissue engineering is finally fulfilled.
161
Chapter 7
162
References 1. Wikipedia. 2011. 2. Andersson GB, An HS, Oegema TR, Jr., Setton LA (2006) Directions for future research. J Bone Joint Surg Am 88 Suppl 2:110-114. 3. Beckstein JC, Sen S, Schaer TP, Vresilovic EJ, Elliott DM (2008) Comparison of animal discs used in disc research to human lumbar disc: axial compression mechanics and glycosaminoglycan content. Spine (Phila Pa 1976 ) 33(6) :E166E173. 4. Bron JL, Helder MN, Meisel HJ, van Royen BJ, Smit TH (2009) Repair, regenerative and supportive therapies of the annulus fibrosus: achievements and challenges. Eur Spine J 18(3):301-313. 5. Chan BP, Leong KW (2008) Scaffolding in tissue engineering: general approaches and tissue-specific considerations. Eur Spine J 17 Suppl 4:467-479. 6. Chan WC, Sze KL, Samartzis D, Leung VY, Chan D (2011) Structure and biology of the intervertebral disk in health and disease. Orthop Clin North Am 42(4) :447-64, vii. 7. Cheema U, Rong Z, Kirresh O et al. (2011) Oxygen diffusion through collagen scaffolds at defined densities: implications for cell survival in tissue models. J Tissue Eng Regen Med. 8. De Santis G, Lennon AB, Boschetti F et al. (2011) How can cells sense the elasticity of a substrate? An analysis using a cell tensegrity model. Eur Cell Mater 22 :202213. 9. Engler AJ, Sen S, Sweeney HL, Discher DE (2006) Matrix elasticity directs stem cell lineage specification. Cell 126(4):677-689. 10. Ghahramanpoor MK, Hassani Najafabadi SA, Abdouss M, Bagheri F, Baghaban EM (2011) A hydrophobically-modified alginate gel system: utility in the repair of articular cartilage defects. J Mater Sci Mater Med 22(10):2365-2375. 11. Gilchrist CL, Darling EM, Chen J, Setton LA (2011) Extracellular matrix ligand and stiffness modulate immature nucleus pulposus cell-cell interactions. PLoS One 6(11):e27170. 12. Haberstroh K, Enz A, Zenclussen ML et al. (2009) Human intervertebral discderived cells are recruited by human serum and form nucleus pulposus-like tissue upon stimulation with TGF-beta3 or hyaluronan in vitro. Tissue Cell 41(6):414420. 13. Hegewald AA, Endres M, Abbushi A et al. (2011) Adequacy of herniated disc tissue as a cell source for nucleus pulposus regeneration. J Neurosurg Spine 14(2):273-280. 14. Hegewald AA, Neumann K, Kalwitz G et al. (2011) The Chemokines CXCL10 and XCL1 Recruit Human Annulus Fibrosus Cells. Spine (Phila Pa 1976 ).
General discussion
15. Hegewald AA, Ringe J, Sittinger M, Thome C (2008) Regenerative treatment strategies in spinal surgery. Front Biosci 13:1507-1525. 16. Huang B, Zhuang Y, Li CQ, Liu LT, Zhou Y (2011) Regeneration of the Intervertebral Disc with Nucleus Pulposus Cell-seeded Collagenalpha/Hyaluronan/Chondroitin-6-sulfate tri-copolymer Constructs in a Rabbit Disc Degeneration Model. Spine (Phila Pa 1976 ). 17. Jim B, Steffen T, Moir J, Roughley P, Haglund L (2011) Development of an intact intervertebral disc organ culture system in which degeneration can be induced as a prelude to studying repair potential. Eur Spine J 20(8):1244-1254. 18. Johnston SL, Campbell MR, Scheuring R, Feiveson AH (2010) Risk of herniated nucleus pulposus among U.S. astronauts. Aviat Space Environ Med 81(6) :566-574. 19. Kandel R, Roberts S, Urban JP (2008) Tissue engineering and the intervertebral disc: the challenges. Eur Spine J 17 Suppl 4:480-491. 20. Kuo CK, Ma PX (2001) Ionically crosslinked alginate hydrogels as scaffolds for tissue engineering: part 1. Structure, gelation rate and mechanical properties. Biomaterials 22(6):511-521. 21. Kuroda T, Matsumoto T, Mifune Y et al. (2011) Therapeutic strategy of thirdgeneration autologous chondrocyte implantation for osteoarthritis. Ups J Med Sci 116(2):107-114. 22. Leone G, Torricelli P, Chiumiento A, Facchini A, Barbucci R (2008) Amidic alginate hydrogel for nucleus pulposus replacement. J Biomed Mater Res A 84(2) :391-401. 23. Lim JM, Lee M, Lee EJ, Gong SP, Lee ST (2011) Stem cell engineering: limitation, alternatives, and insight. Ann N Y Acad Sci 1229:89-98. 24. Masuda K, Lotz JC (2010) New challenges for intervertebral disc treatment using regenerative medicine. Tissue Eng Part B Rev 16(1):147-158. 25. Mercuri JJ, Gill SS, Simionescu DT (2011) Novel tissue-derived biomimetic scaffold for regenerating the human nucleus pulposus. J Biomed Mater Res A 96(2):422435. 26. Mizuno H, Roy AK, Vacanti CA et al. (2004) Tissue-engineered composites of anulus fibrosus and nucleus pulposus for intervertebral disc replacement. Spine 29(12):1290-1297. 27. Mudera V, Morgan M, Cheema U, Nazhat S, Brown R (2007) Ultra-rapid engineered collagen constructs tested in an in vivo nursery site. J Tissue Eng Regen Med 1(3):192-198. 28. Nerurkar NL, Elliott DM, Mauck RL (2010) Mechanical design criteria for intervertebral disc tissue engineering. J Biomech 43(6):1017-1030. 29. Nunamaker EA, Purcell EK, Kipke DR (2007) In vivo stability and biocompatibility of implanted calcium alginate disks. J Biomed Mater Res A 83(4):1128-1137.
163
Chapter 7
164
30. Ott HC, Mathisen DJ (2011) Bioartificial tissues and organs: are we ready to translate? Lancet. 31. Revell PA, Damien E, Di Silvio L et al. (2007) Tissue engineered intervertebral disc repair in the pig using injectable polymers. J Mater Sci Mater Med 18(2) :303-308. 32. Reza AT, Nicoll SB (2008) Hydrostatic pressure differentially regulates outer and inner annulus fibrosus cell matrix production in 3D scaffolds. Ann Biomed Eng 36(2):204-213. 33. Rihn JA, Hilibrand AS, Radcliff K et al. (2011) Duration of symptoms resulting from lumbar disc herniation: effect on treatment outcomes: analysis of the Spine Patient Outcomes Research Trial (SPORT). J Bone Joint Surg Am 93(20):19061914. 34. Schneider U, Rackwitz L, Andereya S et al. (2011) A Prospective Multicenter Study on the Outcome of Type I Collagen Hydrogel-Based Autologous Chondrocyte Implantation (CaReS) for the Repair of Articular Cartilage Defects in the Knee. Am J Sports Med. 35. Shamji MF, Setton LA, Jarvis W et al. (2010) Proinflammatory cytokine expression profile in degenerated and herniated human intervertebral disc tissues. Arthritis Rheum 62(7):1974-1982. 36. Sivan SS, Wachtel E, Tsitron E et al. (2008) Collagen turnover in normal and degenerate human intervertebral discs as determined by the racemization of aspartic acid. J Biol Chem 283(14):8796-8801. 37. Steenstra IA, Anema JR, van Tulder MW et al. (2006) Economic evaluation of a multi-stage return to work program for workers on sick-leave due to low back pain. J Occup Rehabil 16(4):557-578. 38. Vonk LA, Doulabi BZ, Huang C et al. (2010) Preservation of the chondrocyte's pericellular matrix improves cell-induced cartilage formation. J Cell Biochem 110(1):260-271. 39. Wang CC, Yang KC, Lin KH et al. (2012) Cartilage regeneration in SCID mice using a highly organized three-dimensional alginate scaffold. Biomaterials 33(1):120-127. 40. Welsch GH, Mamisch TC, Zak L et al. (2010) Evaluation of cartilage repair tissue after matrix-associated autologous chondrocyte transplantation using a hyaluronic-based or a collagen-based scaffold with morphological MOCART scoring and biochemical T2 mapping: preliminary results. Am J Sports Med 38(5):934-942. 41. Wilke HJ, Heuer F, Neidlinger-Wilke C, Claes L (2006) Is a collagen scaffold for a tissue engineered nucleus replacement capable of restoring disc height and stability in an animal model? Eur Spine J 15 Suppl 3:S433-S438.
Appendices
166
Appendix 1 Summary
167
Summary
Lumbar discectomy is an effective therapy for neurological decompression in patients suffering from sciatica due to a herniated nucleus pulposus (NP). Discectomies however, do not deal with the damaged intervertebral disc (IVD) and high numbers of patients suffer from persisting postoperative low back pain. This has resulted in many strategies targeting the regeneration of the NP. In this thesis we developed a novel tissue engineering strategy to treat patients suffering from an herniated intervertebral disc (IVD). In chapter 2-4 the materials and cells were described and optimized. In chapter 5-6 a model was developed to evaluate the materials in goats in vivo. In chapter 2 we used rheology to assess the visco elastic properties of the nucleus pulposus (NP) of goats. We used plastic compression to increase the density of collagen type I scaffolds and aimed to imitate the visco elastic properties of the NP. We also assessed the effect of a standard treatment with -sterilization on the scaffolds. We found a complex modulus of 22 kPa for the NP which agreed with a collagen density of approximately 23 %. However, the loss tangent, indicative of energy dissipation, was independent of the collagen density and could not be matched to the value of the NP. Treatment by -sterilization resulted in an increase of the shear moduli, but also in a more brittle behaviour and a reduced swelling capacity. In chapter 3 we used alginate as a scaffold material and aimed to mimic the viscoelastic properties of the NP. We also assessed the effects of different alginate stifnessess on native cells. Alginate scaffolds were prepared by two different techniques (diffusion and in situ gelation) and in concentrations ranging from 1 to 6 %. The 2% alginate scaffolds prepared by diffusion gelation showed the best match to the visco-elastic properties of the NP. However, the visco elastic properties rapidly declined upon incubation in medium. The biosynthetic phenotype of the cells was preserved in alginate, but no differences were found between the various scaffold densities most likely due to the poor adhesiveness of the cells to alginate. In chapter 4 we assessed the capability of native cells to invade dense collagen scaffolds in vitro. The invasion of cells from the surrounding tissues, the (remnants of the) NP and the annulus fibrosus (AF), is crucial for the use of a-
168
Summary
cellular scaffolds. In this chapter we also assessed if migration could be enhanced by the addition of Histatin-2, a chemokine derived from human saliva that was shown to enhance the migration of fibroblast. We found that migration distance was density dependent and was higher for NP compared to AF cells after 4 weeks of culturing. We also observed a lag phase, before migration occurred. Histatin-2 did not enhance cell migration and this was confirmed in a separate scratch-assay. Although the densities used in this study were lower (1,5 and 3%) compared to the density shown to mimic the NP (23%), we proved that native cells are capable of invading dense collagen scaffolds and the in situ seeding concept might be viable. Numerous regenerative treatment strategies have being developed targeting the NP. However, accompanying techniques that deal with the damaged AF are increasingly being recognised as mandatory in order to prevent re-herniations and to increase the potential of the NP replacing strategies. In chapter 5 we summarized and discussed all available literature on AF closure techniques of the AF including the attempts performed by commercial parties. We showed that several attempts to repair, support or regenerate the AF have been studied, but a successful clinical application is still far away. In general, tissue engineering strategies lack a vision on the final clinical application and repair therapies lack scientific evidence. In chapter 6 we designed and tested annulus closure devices intended to be used in our goat nucleus replacement model. First a standardised defect (3 mm) in the lateral region of the AF was created through which a nucleotomy was performed. The AF defect was filled with one of the annulus closure devices (ACDs) with and without the addition of a collagen nucleus replacement. First studies were performed on goat cadaveric lumbar spines. We showed that ACDs with four barb rings could withstand the highest axial load. We further showed that the increased range of flexion-extension and lateroflexion due to the discectomy could be restored by implanting an ACD and collagen implant. The positive results were confirmed in a goat pilot study (n=2) after two weeks follow up. However, in a second pilot study (n=8) most ACDs revealed signs of destruction and/or displacement after 6 weeks follow-up. In addition we found two endplate reactions extending into the subchondral bone, most likely due to continuous
169
Summary
friction of the ACDs between the vertebrae. The ACDs showed a tendency to perform better when they were implanted together with a collagen implant. In the first addendum to chapter 6 we described the development the replacement model in detail. First, a Perspex model of the goat IVD was used to design the instruments and implants with appropriate dimensions. The instruments consisted of metal tubes with ascending diameter to punctuate the AF. Via the largest tube, with an outer diameter of 3 mm, all instruments and implants, except for the ACD can be inserted. In the second addendum to chapter 6, we present the results of the collagen scaffold that was used in adjunct to ACDs in the goat study. After 6 weeks the disc height index in goats treated with the collagen implants was not significantly decreased compared to untreated control levels. Levels that received a discectomy or ACD alone did show a significant decrease in disc height. Macroscopy revealed that the dense collagen was not yet integrated with the NP tissue and therefore lost during sawing and preparation for histology. Histologic and magnetic resonance imaging score were not useful to evaluate the results after 6 weeks follow up. There was no difference in cell number between the different treatments after 6 weeks. In conclusion, we showed that the visco elastic properties of the IVD can be imitated with scaffold materials that also allow the invasion of native cells. However, the promising results can not yet be translated to in vivo studies due to the lack of appropriate AF closure techniques.
170
Appendix 2 Nederlandse Samenvatting
171
Samenvatting
Een rughernia (voluit: hernia nuclei pulposi) is een veelvoorkomende en invaliderende ziekte. De huidige operatieve behandeling bestaat uit het verwijderen van het gehernieerde tussenwervelschijf weefsel (discectomie), waardoor de zenuwbeknelling wordt opgeheven. Hierbij wordt de beschadigde tussenwervelschijf zelf echter niet behandeld en veel patinten houden hierna dan ook rugklachten. Voor het herstel van de tussenwervelschijf bestaat op dit moment nog geen goede therapie. In dit proefschrift worden potentiele nieuwe behandelingsopties ontwikkeld die regeneratie van de tussenwervelschijf tot doel hebben. In het eerste deel (hoofdstukken 2-4) worden materialen en cellen voor tussenwervelschijf regeneratie onderzocht en geoptimaliseerd. In het tweede deel (hoofdstukken 5-6) wordt een model ontwikkeld om de materialen te kunnen testen in vivo in geiten. In hoofdstuk 2 wordt eerst door middel van reologie de visco-elasticiteit van de geiten nucleus pulposus (NP) bepaald. Vervolgens wordt geprobeerd om deze visco-elasticiteit na te bootsen met type I collageen scaffolds. Hiervoor wordt met behulp van plastische compressie de dichtheid van deze scaffolds verhoogd. Ook wordt onderzocht wat de effecten van een standaard sterilisatie proces middels irradiatie zijn op de visco-elastische eigenschappen van de scaffolds. De NP blijkt qua visco-elasticiteit ongeveer overeen te komen met collageen scaffolds die een dichtheid van 23% hebben. De verhouding tussen de viscositeit en elasticiteit blijkt echter wel lager in de scaffolds vergeleken met de NP. Door behandeling met -irradiatie stijgt de elasticiteit, maar wordt het materiaal ook breekbaarder en neemt de zwelcapaciteit sterk af. In hoofdstuk 3 wordt alginaat als een potentieel scaffold materiaal voor de NP onderzocht. De alginaat scaffolds worden op 2 verschillende manieren gemaakt (via diffusie en in situ gelling) in concentraties tussen de 1 en 6% om zo te kijken welke de visco-elastische eigenschappen van de NP het dichtst benadert. Ook wordt onderzocht wat het effect van de verschillende stijfheden alginaat op het gedrag van natieve tussenwervelschijf cellen is. De 2% alginaat scaffolds, bereid via de diffusie methode, blijken de visco-elasticiteit van de NP het sterkst te benaderen. Echter, wanneer de scaffolds in kweekmedium worden gelegd treedt er een zeer snelle sterke afname van de stijfheid op. Ook blijkt dat het fenotype van de cellen weliswaar blijft behouden in alginaat, maar er blijkt geen
172
Samenvatting
relatie met de stijfheid ervan. Dit laatste kan waarschijnlijk worden verklaard door de slechte binding van tussenwervelschijf cellen aan het alginaat. In hoofdstuk 4 wordt onderzocht of natieve tussenwervelschijf cellen in staat zijn om collageen scaffolds in te groeien in vitro. De ingroei van cellen uit de omgevende structuren, de (overblijfselen van de) NP of annulus fibrosus (AF), is een cruciale voorwaarde voor het gebruik van a-cellulaire scaffolds voor NP regeneratie. In dit hoofdstuk kijken we ook of de celmigratie kan worden bespoedigd met behulp van histatine-2, een chemokine uit menselijk speeksel waarvan is aangetoond dat het de migratie van fibroblasten versnelt. De celmigratie blijkt afhankelijk van de collageen concentratie en hoger voor NP vergeleken met AF cellen na 4 weken. De migratie blijkt pas op gang te komen na een bepaalde periode. Histatine-2 is geen migratie bevorderende factor bij onze celpopulatie en dit wordt ook bevestigd in een (2D) scratch assay. Ondanks dat de collageen dichtheden die in dit hoofdstuk worden onderzocht nog lager liggen dan de beoogde collageendichtheid (uit hoofdstuk 2), zijn de natieve cellen in staat zijn om de collageen scaffolds te in te groeien. Dit bevestigt dat a-cellulaire collageen scaffolds mogelijk kunnen worden gebruikt voor NP regeneratie. Er is in de afgelopen decade veel onderzoek gedaan naar de regeneratie van de NP. Hieruit blijkt steeds meer de noodzaak om een therapie te ontwikkelen die het defect in de omringende AF aanpakt, om zo het aantal re-herniaties te verlagen en het succes van potentiele NP regeneratie therapien te verhogen. In hoofdstuk 5 geven we een overzicht van alle beschikbare literatuur over het sluiten van de AF. Er blijken diverse pogingen gedaan te zijn om de AF te repareren of regenereren, maar een succesvolle klinische therapie lijkt nog ver weg. Bij de beschreven regeneratieve pogingen ontbreekt vaak een duidelijke visie betreffende de uiteindelijke toepassing, terwijl bij de directe repareerpogingen juist een wetenschappelijke onderbouwing ontbreekt. In Hoofdstuk 6 testen we enkele zelfontworpen implantaten om het AF defect ons geiten model te sluiten. Eerst wordt een gestandaardiseerd 3 mm groot defect gemaakt lateraal op de AF, waardoor de NP wordt uitgeruimd (discectomie). Het defect in de AF wordt vervolgens gesloten de afsluit implantaten. We testen tussenwervelschijven waar alleen een AF implantaat wordt ingebracht als ook die
173
Samenvatting
waar ook een collageen NP implantaat wordt ingebracht. In het eerste deel van de eerste experimenten worden de implantaten in tussenwervelschijven ex vivo getest. Hierbij blijkt een 3.5 mm groot AF afsluit implantaat met vier zijringen de hoogste axiale belasting aan te kunnen. Ook blijkt dat de toegenomen flexieextensie en lateroflexie die optreedt na een discectomie weer kan worden hersteld met behulp van een AF en collageen NP implantaat samen. De positieve resultaten worden bevestigd in 2 geiten in vivo na 2 weken follow up. Na 6 weken follow up (n=8) blijken echter de meeste AF afsluit implantaten gedestrueerd en verplaatst. Ook blijkt op 2 niveaus sprake van een forse eindplaatreaktie, waarschijnlijk door continu frictie van de AF implantaten. Er lijkt een trend dat de AF afsluit implantaten het iets beter doen wanneer ze gebruikt worden samen met een collageen implantaat dan wanneer standalone. In het eerste addendum bij hoofdstuk 6 wordt de ontwikkeling van het diermodel gedetailleerder beschreven. Er wordt begonnen om met behulp van een perspex model van de geiten tussenwervelschijf de benodigde instrumenten en implantaten te ontwikkelen met juiste dimensies. De instrumenten bestaan uit metalen holle buisjes, welke over een voordraad en over elkaar kunnen worden opgevoerd door de laterale AF. Door de grootste buis (buitenste diameter 3 mm) kunnen vervolgens alle andere instrumenten en implantaten, behoudens de AF afsluit implantaten, worden gentroduceerd. In het tweede addendum bij hoofdstuk 6 worden de collageen scaffolds, die in combinatie met de ACDs waren gebruikt in hoofdstuk 6, geanalyseerd. Deze analyse omvat de tussenwervelschijfhoogte, macro- en microscopie en MRI. Na 6 weken blijkt de hoogte van de tussenwervelschijf in de geiten die werden behandeld met een collageen implant niet significant afgenomen ten opzichte van onbehandelde controle niveaus. De tussenwervelschijven die worden behandeld met alleen een discectomie of een AF implantaat zonder collageen implantaat tonen wel een significante afname. Macroscopisch blijkt het collageen na 6 weken nog niet te zijn vastgegroeid met de omgeving waardoor het grotendeels verloren gaat tijdens het zagen en voorbereiden voor histologie. Voorts blijken bestaande histologische en MRI scores niet bruikbaar om de resultaten na 6 weken te evalueren. Er is geen significant verschil in aantallen cellen tussen de verschillende behandelingen.
174
Samenvatting
In dit proefschrift toonden we aan dat de visco elastische eigenschappen van de tussenwervelschijf kan worden nagebootst met scaffold materialen. Deze materialen laten ook de invasie van natieve cellen toe. De bemoedigende resultaten kunnen echter niet in vivo worden bevestigd door het gebrek aan een adequate annulus sluiting.
175
Samenvatting
176
Appendix 3 Publications
177
Publications
178
Publications contributing to this thesis - Bron JL, Koenderink GH, Everts V, Smit TH. Rheological characterization of the Nucleus pulposus and dense collagen scaffolds intended for functional replacement. J Orthop Res. 2009; 27:260-266 - Bron JL, Vonk LA, Smit TH, Koenderink GH. Engineering alginate for intervertebral disc repair. J Mech Behav Biomed Mater 2011;4:1196-205 - Bron JL, Mulder HW, Vonk LA, Boulabi BZ, Oudhoff MJ, Smit TH. Migration of intervertebral disc cells into collagen scaffolds intended for functional replacement. J Mater Sci Mater Med. 2012; 23:813-821 - Bron JL, Helder MN, Meisel HJ, Van Royen BJ, Smit TH. Repair, regenerative and supportive treatment strategies of the Annulus Fibrosus; Achievements and challenges. Eur Spine J. 2009; 801:301-313 - Bron JL, Van der Veen AJ, Helder MN, Smit TH. Biomechanical and in vivo evaluation of experimental closure devices of the annulus fibrosus designed for a goat nucleus replacement model. Eur Spine J. 2010;19:1347-1355 - Bron JL, Van royen BJ, Helder MN, Sonnega RJ, Smit TH. Development of a minimal-invasive lumbar disc repair model and evaluation in a goat pilot study in vivo. Eur Spine J. 2012; submitted
Other publications (international) - Bron JL, Brinkman JM, Visser M, Wuisman PI. A slow growing mass on the back in a 63-year old man. Clin Orthop Rel Res. 2006; 452: 274-283 - Van Royen BJ, Noske DP, Bron JL, Vandertop WP. Basilar impression in osteogenesis imperfecta: Can it be treated with halo traction followed by posterior fusion? Acta Neurochirurgica. 2006; 148: 1301-1305 - Bron JL, Saouti R, De Gast A. Treatment of posterior knee dislocation in a patient with multiple sclerosis after knee replacement. Acta Orthop Belg. 2007; 73: 118-121 - Brinkman JM, Bron JL, Wuisman PI, Van Diest PJ, Comans EF, Molthoff CF. The correlation between clinical, nuclear and histologic findings in a patient with Von Recklinghausens disease. World J Surg Oncol. 2007; 5: 130 - Bron JL, Van Kemenade FJ, Verhoof OJ, Wuisman PI. Long-term follow-up in a patient with disseminated spinal hydatidosis. Acta Orthop Belg. 2007; 73: 678682
Publications
Bron JL, Van Royen BJ, Wuisman PI. The clinical Significance of lumbosacral transitional vertebrae. Acta Orthop Belg. 2007; 73: 687-695 Verhoof OJ, Bron JL, Wapstra FH, Van Royen BJ. High failure rate of the interspinous distraction device (X-Stop) for the treatment of lumbar spinal stenosis caused by degenerative spondylolisthesis. Eur Spine J. 2008; 17: 188192 Langeveld AR, Bron JL, De Bruijn AJ. Lower back pain and bladder dysfunction. sBMJ. 2008; 16: 120 Bron JL, Mooi WJ, Saouti R, Wuisman PI. A 31-year-old female patient with a slow growing pre-patellar mass. Clin Orthop Rel Res. 2008; 466:1511-15 Bron JL, De Vries MK, Snieders MN, Van der Horst-Bruinsma IE, Van Royen BJ. The Andersson lesion of the spine in Ankylosing Spondylitis revisited. Clin Rheumatol. 2009; 28: 883-892
Other publications (national): - Nijveldt RJ, Teerlink T, Hoven B van der, Siroen MP, Bron JL, Rauwerda JA, Girbes AR, Van Leeuwen PA. Hoge plasma concentratie van ADMA als onafhankelijke sterftevoorspeller op bij intensivecarepatinten. Ned Tijdschr Geneeskd. 2004; 148; 782-7. - Bron JL, Jaspars EH, Molenkamp BG, Meijer S, Mooi WJ, Van Leeuwen PA. Drie patienten met op Spitz naevus gelijkende afwijkingen die later een melanoom bleken te zijn. Ned Tijdschr Geneeskd. 2005; 149:1852-8. - Bron JL, Van Solinge GB, Langeveld AR, Jiya TU, Wuisman PI. Drie tevoren gezonde personen met een vermoeidheidsbreuk. Ned Tijdschr Geneeskd. 2007; 151: 621-628 - Bron JL, Wuisman PI. Diagnose in beeld: Een patinte met een gezwollen knie. Ned Tijdschr Geneeskd. 2007; 151: 2564-2565 - Bron JL, Van Royen BJ, Wuisman PI. Het interspinale implantaat behandelingsoptie bij het syndroom van Verbiest? Ned Tijdschr Orthopaedie. 2007; 14: 5-11
179
Publications
180
Appendix 4 Dankwoord
181
Dankwoord
Wanneer je als arts aan een promotie onderzoek begint ben je aangewezen op de hulp en ondersteuning van velen. Mijn dank is groot voor alle betrokkenen bij o.a. de orthopedie, Arthro Kinetics, orale celbiologie, orale biochemie, UPC en AMOLF. Dit geldt ook voor alle mede auteurs, collegae, studenten, de paranimfen en uiteraard de leescommissie. Hier geen opsomming van namen, wel wil ik enkelen persoonlijk bedanken.
Prof. Dr. Paul Wuisman; Prof Wuisman stond aan de wieg van mijn onderzoek en daarom hier als eerste genoemd. Visie, enthousiasme en een onuitputtelijke bron van goede ideen. Gaf mij het vertrouwen om aan een promotie onderzoek te beginnen en regelde dat ik tot die tijd als ANIOS in de kliniek aan de slag kon. Zijn onverwachte overlijden in 2007 was dan ook een grote tegenslag. Tot het eind is prof. Wuisman de inspiratiebron gebleven voor mijn onderzoek en als mens zal ik hem blijven missen.
182
Prof. Dr. Ir. Theo Smit; Beste Theo, zonder jouw steun was dit boekje er niet gekomen. Na het verlies van prof Wuisman en het, tijdens de kredietcrisis, wegvallen van de financile steun voor mijn onderzoek nam jij het voortouw. Het waren soms angstige momenten, maar door jouw inzet en steun is het uiteindelijk goed gekomen. Als niet-clinicus temidden van met name klinische wetenschappers was jouw tegenwicht verhelderend en onmisbaar. Als wetenschapper scherp en kritisch, als mens eerlijk, bescheiden en betrokken. Het maakt jou de ideale begeleider en promotor. Prof. Dr. Barend van Royen; Beste Barend, geheel onverwacht moest jij alle onderzoeksprojecten op je nemen. Mijn onderzoek viel daar ook onder. Ik ben je erg dankbaar dat jij deze taak zo goed hebt opgepakt en me aan het einde de rust en steun hebt gegeven die ik nodig had. Naast promotor ben je inmiddels als opleider ook verantwoordelijk voor de volgende grote stap in mijn carrire.
Dankwoord
Prof. Dr. Gijsje Koenderink; Beste Gijsje, tijdens jouw eerste rondleiding door het AMOLF (FOM-instituut voor Atoom- en molecuulfysica) zag ik een wereld die ver af stond van het voor mij vertrouwde ziekenhuis. Maar jouw enthousiasme om een brug te slaan tussen deze 2 werelden werkte direct aanstekelijk. Terwijl ik in de weken hierna in een verlaten kelder van het AMOLF begon met mijn onderzoek aan de gloednieuwe reometers, zette jij in korte tijd een hele nieuwe onderzoeksgroep op. Toen ik dacht dat mijn boekje wel naar de drukker kon, kwam er alsnog een roodgekleurde correctie versie terug van alle spelfouten die je alsnog had ontdekt. Veel dank voor je gedreven, enthousiaste en altijd kritische houding!
183
184
Appendix 5 Curriculum Vitae
185
Curriculum vitae
Johannes Leendert (Harry) Bron was born on Januari 18th, 1980 in Leerdam, The Netherlands. After graduating from high school (Heerenlanden College, Leerdam) in 1999, he began studying Medicine at the Vrije Universiteit Amsterdam. During his medical internships he participated in orthopaedic research with Prof. Dr. P.I.J.M. Wuisman at the department of Orthopaedic Surgery of the VU University Medical Center Amsterdam. After receiving his medical degree (cum laude) in 2005, he started to work as an orthopaedic resident at the same department. In 2006 he started his PhD-project focusing on novel regenerative strategies of the intervertebral disc as described in this thesis (promotores: prof. dr. B.J. van Royen and prof. dr. ir. T.H. Smit). Directly after this he started his surgical residency (part of his orthopaedic training) in the Spaarne Ziekenhuis in Hoofddorp (Head: dr. G.J.M. Akkersdijk). Currently he works as an orthopaedic resident at the VU University Medical Center (Head: prof. dr. B.J. van Royen).
186

Proefschift Bron

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Proefschift Bron

Uploaded by

Copyright:

Available Formats

Novel Regenerative Strategies For The Treatment Of Intervertebral Disc Herniation

Novel Regenerative Strategies For The Treatment Of Intervertebral Disc Herniation

Novel Regenerative Strategies For The Treatment Of Intervertebral Disc Herniation

Johannes Leendert Bron

Novel Regenerative Strategies For The Treatment Of Intervertebral Disc Herniation

door Johannes Leendert Bron geboren te Leerdam

131 137 149 167 171 177 181 185

Figure 3: schematic drawing of a lumbar discectomy

Target gene Ywhaz 18S Agc Col1a1 Col2a1

Annealing temperature (C) 56 56 57 57 56

Product size (bp) 229 151 160 191 195

Migration of intervertebral disc cells

Migration of intervertebral disc cells

Migration of intervertebral disc cells

Migration of intervertebral disc cells

X0 X2 . X0 is the mean SF0 SF2

Migration of intervertebral disc cells

Migration of intervertebral disc cells

Migration of intervertebral disc cells

Migration of intervertebral disc cells

Migration of intervertebral disc cells

Migration of intervertebral disc cells

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Annulus fibrosus repair

Biomechanical and in vivo evaluation

Biomechanical and in vivo evaluation

Biomechanical and in vivo evaluation

Biomechanical and in vivo evaluation

Biomechanical and in vivo evaluation

Biomechanical and in vivo evaluation

Biomechanical and in vivo evaluation

Biomechanical and in vivo evaluation

Biomechanical and in vivo evaluation

Biomechanical and in vivo evaluation

Addendum 1 Techniques and instruments

Techniques and instruments

Techniques and instruments

Addendum 2 Nucleus implant evaluation

Nucleus implant evaluation

Nucleus implant evaluation

Nucleus implant evaluation

Nucleus implant evaluation

Nucleus implant evaluation

Figure 1: Development pathway for tissue engineering [24]

Appendix 2 Nederlandse Samenvatting

Appendix 5 Curriculum Vitae

You might also like