You are on page 1of 12

exposition

Eduardo Kac
histoire naturelle de l’Énigme
8 octobre > 20 décembre 2009
Dossier pédagogique
Eduardo Kac, défricheur et visionnaire

Eduardo Kac ne peut pas être défini par un médium. (…) Sa création repose non pas sur
une technologie mais sur des concepts qui trouvent leur expression dans les technologies
actuelles.

Né à Rio de Janeiro en 1962, Eduardo Kac


effectue la première partie de sa carrière artis-
tique dans son pays natal avant de s'installer
à Chicago en 1989 où il enseigne à la School
of the Art Institute. (…) Donner une forme
artistique à la complexité est le fondement de
l'oeuvre d'Eduardo Kac. Ainsi, incorporer dans
une même création les différents espaces
(physiques et virtuels), rendre à la relation
corps/esprit toute sa dimension et sa richesse
de connections et d'interpénétrations, associer les différentes composantes du vivant
(humaines, animales, mais également les hybrides en émergence), s'inscrire dans – et
inscrire – cette nouvelle écologie où les systèmes organiques et technologiques se fécon-
dent mutuellement sont les paramètres sur lesquels s'organisent ses dernières créations.
Pour les qualifier, il a inventé le terme de biotelématique. Mentionnons Teleporting of an
Unknown State (1996) où une graine pousse grâce à la lumière envoyée par les internautes
par le biais de leur webcam et A-positive (1997), «échange de vie» entre un humain et un
robot.

Eduardo Kac est un artiste actuel, au sens fort du terme, non pas parce qu'il utilise les
technologies de son époque ou parce que toutes ses œuvres incluent un aspect politique et
social subtil mais, parce qu'il invente de nouvelles formes artistiques et établit une proposi-
tion esthétique sur le monde.

Annick Bureaud

(Extrait de l’article paru dans Artpress 246, mai 1999, p. 34-35)


Annick Bureaud est critique d'art, spécialiste des nouvelles technologies.
L'œuvre d'Eduardo Kac s'articule autour des questions liées à la biologie génétique, aux
technologies de la communication, au langage, à la poésie. Les œuvres présentées à Rurart
explorent les différentes facettes de la production de l'artiste.

GENESIS, 1999

Que l'homme domine les poissons, les oiseaux dans le ciel,


et tous les animaux qui rampent sur la terre
Cet extrait de l'Ancien Testament recouvre
le mur de droite d'une salle plongée dans
l'obscurité, à peine éclairée par des tubes de
lumière noire. Sur le mur du fond, le même
extrait, transcrit en Morse cette fois. Puis sur
le mur de gauche, l'artiste a traduit le code
Morse en quatre lettres (qui représentent les
points et les traits, les espaces courts et les
espaces longs), AGCT, initiales des quatre
acides qui composent un fragment d'ADN. La
séquence ADN ainsi obtenue est fabriquée synthétiquement par un laboratoire puis intégrée
à une bactérie, déjà transgénique : elle a reçu une protéine GFP, qui la rend vert fluores-
cente à la lumière ultra-violet. La bactérie se trouve au milieu de la pièce, dans une boîte de
Petri. Sur le quatrième mur, l'image de la boîte de Petri est projetée.

Pour faire apparaître la fluorescence, le visiteur doit activer des lumières ultra-violet. Il peut
agir sur l'œuvre via internet. Or, les lampes ultra-violet ont un effet mutagène sur la bactérie
transgénique. Ainsi, en activant l'œuvre, le visiteur altère la bactérie et la séquence ADN qui
s'y trouve. Le visiteur répond ainsi à l'injonction biblique qui lui est faite : il domine le vivant
et il domine le langage.

Eduardo Kac : «  Au XIXe siècle, la compa-


raison par Champollion des langages de la
pierre de Rosette (grec, écriture démotique,
hiéroglyphes) fut la clef pour comprendre
le passé. Aujourd'hui, le système triple de
Genesis (langage naturel, code ADN et
logique binaire) est la clef qui ouvre la com-
préhension du futur. » L'artiste cherche ainsi
une nouvelle grammaire, à l'articulation en-
tre science, croyance et communication.
Toute son œuvre tournera autour de ces trois
piliers.
HISTOIRE NATURELLE DE L'ENIGME
(NATURAL HISTORY OF ENIGMA), 2009

La ville de Thèbes était gardée par un Sphinx qui ôtait


la vie à ses victimes en leur posant des questions
relatives à la nature humaine. Contre l'ordre des
choses, Œdipe a résolu l'énigme. Il a pu pénétrer dans
la ville et accomplir la funeste prophétie qui lui avait été
faite : il tuera son père et épousera sa mère.
Pour Levi-Strauss, Œdipe est celui qui a rassemblé des
paradigmes qui ne devaient pas l'être et, par là même,
a semé le chaos dans la cité.
Peut-être la métaphore œdipienne peut-elle s'appliquer
à cette œuvre d'Eduardo Kac, tant l'artiste rassemble
des éléments antinomiques. L'œuvre consiste en l'hy-
bridation entre une plante – en l'occurrence un pétu-
nia – et un être humain, l'artiste : par une manipulation
génétique très complexe – l'œuvre a demandé six
années de développement à un laboratoire américain – Kac est parvenu à inclure un de ses
gènes dans le patrimoine génétique du pétunia, pour créer un nouveau type d'organisme
vivant qu'il appelle un plantimal, au croisement de la plante et de l'animal.
Le gène sélectionné par Kac a une fonction immunitaire : il rejette les corps étrangers pour
préserver l'équilibre de l'organisme.

En réussissant à intégrer un gène dont la fonc-


tion est de lutter contre l'altérité, la portée sym-
bolique de l'œuvre apparaît clairement : Œdipe
transgresse l’interdit de l’inceste, qui vise à as-
surer la préservation de l’espèce, en imposant à
l’homme l’altérité. Kac poursuit ses recherches
de communication inter-espèces en repous-
sant les limites naturelles de catégorisation du
vivant, en forçant la nature du gène. Eduardo
Kac : « Dans cette œuvre c'est précisément ce
qui identifie et rejette l'autre que j'incorpore à
l'autre. Avec la combinaison de l'ADN humain
et végétal dans une nouvelle fleur, Histoire
Naturelle de l'Énigme est une réflexion poétique
sur la continuité de la vie entre les différentes espèces. L'œuvre emploie la rougeur des
nervures de la plante et celle des vaisseaux sanguins humains comme un marqueur de
notre patrimoine commun.»
ESSAI DE COMMUNICATION INTERESPÈCE
(ESSAY CONCERNING HUMAN UNDERSTANDING), 1994

Essay concerning human understanding consiste


en un dialogue téléphonique entre un canari et une
plante, situés à deux endroits distincts.
Des électrodes captent l'activité électrique
produite par une plante. Amplifiées, les ondes cap-
tées sont converties en sons, envoyées par internet et
diffusées par des haut-parleurs dans la cage d'un
canari. Le chant de l'oiseau suit le chemin inverse
et entraîne une nouvelle réaction électrique de la
plante.

Dans cette œuvre à l'absurde poésie, en faisant


communiquer un animal avec une plante l'artiste
met en évidence la fonction phatique du langage
: la communication est une fin en soi, présente ici
comme une prouesse technologique, quel que soit
le contenu du message. Parallèlement, la capacité
à faire dialoguer des espèces différentes, à rassembler les contraires, est une constante
dans l'œuvre de l'artiste, que l'on retrouvera développée de manière plus radicale avec
Histoire de naturelle de l'Énigme. Outre les enjeux de communication, c'est aussi la capacité
du monde contemporain à se penser au-delà
d'une taxinomie établie que semble ici proposer
Eduardo Kac.
KIT TRANSGÉNIQUE (CYPHER)

La commande de création Kit transgénique (Cypher),


réalisée à l’occasion de l’exposition à Rurart, est au
croisement des principales préoccupations artistiques
de l’œuvre d’Eduardo Kac ces dernières années : Kit
transgénique (Cypher) met en jeu des questions liées
à la poésie, à l’art transgénique, au langage.

Kit transgénique (Cypher) consiste en un poème,


écrit par l’artiste à parti des lettres G, A, T, C, qui
correspondent aux quatre acides de l’ADN (Cf.
encadré ci-dessous). A tagged cat will attack Gattaca.
Un chat tigré attaquera Gattaca.
À partir du poème, une séquence d’ADN synthétique est fabriquée et intégrée à une
bactérie modifiée génétiquement pour la rendre rouge. L’ensemble est lyophilisé afin de ne
pas s’altérer avec le temps et conservé sous vide d’air dans une capsule étanche. Ce poème
transgénique trouve sa place dans un coffret précieux d’acier et de velours, qui comprend
tout le matériel chimique nécessaire à l’extraction de la séquence ADN, autrement dit à la
lecture du poème transgénique.

Eduardo Kac expérimente ainsi une forme de poésie transgénique, qui s’appuie sur ses
recherches en matière de communication et de génie génétique opérant dans Genesis (on
retrouve le principe de transposition du langage dans différents codes ainsi que l’inscription
d’un texte par l’ajout d’une séquence ADN dans une bactérie transgénique), ainsi que sur
la littérature poétique qu’il produit depuis plusieurs années. En activant la séquence ADN,
le lecteur donne littéralement vie à l’œuvre d’art. Sous-titrée Cypher (Chiffrement), l’œuvre
invite le lecteur à percer le code de chiffrement qui sous-tend l’organisation du texte et la
substitution des caractères romains par la séquence ADN.

A tagged cat will attack Gattaca. Un chat tigré attaquera Gattaca. Ce chat tigré, un matou
de gouttière, qui se propose de remettre en question les fondements d’un monde où règne
l’ordre et la perfection, quel est-il ? Le lecteur attentif prendra soin de rassembler les lettres
du poème qui ne correspondent pas aux nucléotides AGTC de l’ADN.
Il pourra lire « Ed K will ».
ATAGGEDCATWILLATTACKGATTACA
E = TTTt
D = AA
K = CC
W = GG
I = AAA
L = TT
L = TT
ATAGGTTTAACATGGAAATTTTATTACCCGATTACA
Œuvres non présentées à Rurart

Time Capsule, 1997


«En 1997, Eduardo Kac présente Time Capsule en direct à la télévision brésilienne.
En présence d’un médecin et d’un auditoire, Kac implante un microcircuit dans sa jambe gauche afin
d’inscrire son corps et son identité dans une base de données d’identification d’animaux qui sert à
retracer les animaux perdus. Après l’implantation, le microcircuit a été lu optiquement dans Inter-
net à partir de Chicago. Quelques minutes plus tard, Kac était officiellement inscrit à la fois comme
propriétaire et comme animal. La nature très publique et performative de son travail reflète les premiè-
res performances de Kac à Rio de Janeiro. Cette fusion satirique de la peau et de la technologie est
l’une des premières explorations de l’artiste en art biotechnologique. Ses œuvres génétiques ultérieures
traduisent son désir d’associer viscéralement le corps à la technologie». A.P

GFP Bunny (Alba), 2000


En 2000, a essayé de créer un lapin transgénique, Alba, en ajoutant à son patrimoine génétique une
protéine le rendant vert fluorescent. Alba n’a jamais été présenté au public.
«Le projet GFP Bunny est un événement social complexe qui commence par la création d’un animal qui
n’existe pas dans la nature et comporte également : 1) les discussions en cours entre spécialistes de
différentes disciplines (art, sciences, philosophie, droit, communication, littérature, sciences sociales);
2) la remise en cause de la prétendue suprématie de l’ADN dans la création du vivant, en faveur d’une
conception plus complexe du lien étroit qui unit la génétique, l’organisme et le milieu; 3) l’élargissement
des notions de biodiversité et d’évolution en vue d’incorporer un travail précis au niveau du génome;
4) la communication inter-espèces entre les humains et un mammifère génétiquement modifié;
5) l’intégration et la présentation d’Alba dans un contexte social et interactif; 6) l’examen des notions de
normalité, d’hétérogénéité, de pureté, d’hybridation et d’altérité; 7) la prise en compte d’une notion non
sémiologique de la communication telle que le partage du matériel génétique au-delà des traditionnel-
les barrières d’espèces; 8) Le respect et la reconnaissance de tous à l’égard de la vie émotionnelle et
cognitive des animaux génétiquement modifiés; 9) le dépassement des barrières matérielles et concep-
tuelles de l’art actuel pour pouvoir y inclure la création d’un être vivant». E.K

The 8th Day (Le huitième jour), 2001


«Le Huitième Jour est une œuvre d’art transgénique qui explore l’écologie des créatures
fluorescentes évoluant dans le monde. Ces créatures fluorescentes, développées indépendemment
dans divers laboratoires, apparaissent pour la première fois ensemble dans ce travail, et forment
ainsi le noyau d’un nouvel écosystème artificiel et bioluminescent. Cette pièce regroupe des formes
de vie transgénique et un robot biologique (biobot) dans un environnement clos, sous un dôme de
Plexiglas, montrant ainsi à quoi ressembleraient ces créatures si elles co-existaient en liberté dans
le monde. Le Huitième Jour présente une extension de la biodiversité au-delà des formes de vie
naturelles. En tant que système écologique artificiel et isolé, il renvoie à son titre qui ajoute un jour à la
création du monde narrée par les Écritures judéo-chrétiennes. Le Huitième Jour pose la question de
l’évolution transgénique, puisque chaque organisme de l’installation diffère par une mutation de son
type sauvage, et a été sélectionné et élevé en raison de cette mutation GFP.» EK
GLOSSAIRE

Acide aminé : élément de base constitutif des protéines. Il existe vingt acides aminés
différents.

ADN (Acide DésoxyriboNucléique) : l'ADN est une très grosse molécule, support de
l'hérédité, qui contient toute l'information génétique pour « fabriquer » un être vivant. Cette
molécule est organisée en double hélice formée de deux brins complémentaires correspon-
dant à la succession de nucléotides.

Bactérie : organisme vivant de très petite taille et constitué d'une seule cellule.
Les bactéries sont présentes un peu partout : l'air, les sols, l'eau, la peau... Certaines
bactéries peuvent provoquer des maladies (rhume, listériose... ) mais d'autres sont très
utiles à l'homme par exemple pour fabriquer certains aliments (fromages, yaourts…).

Cellule : unité de base de tous les êtres vivants. L’être humain est constitué d'environ
50 000 milliards de cellules. Il en existe quelques centaines de types différents (neurone,
cellule cardiaque, globule rouge, cellule musculaire …).

Chromosome : forme caractéristique que prend l’ADN pendant la division cellulaire (aspect
de fins bâtonnets). En fonction des espèces, le nombre et la forme des chromosomes seront
différents.

Gène : ce terme recouvre plusieurs définitions. Dans son sens premier, un gène correspond
à un fragment d'ADN qui est transmis des parents à leurs enfants et qui constitue une unité
d'information génétique. Dans son sens moderne, un gène contient l'information nécessaire
à la fabrication d'au moins une protéine.

Génome : ensemble des gènes d’un organisme.

GFP «  Green Fluorescent Protein  » : protéine, isolée à partir de la méduse Aequorea


victoria, présentant la propriété d'émettre une fluorescence de couleur verte. Elle est très
utilisée en biologie cellulaire, et notamment en microscopie où elle sert de marqueur.

Molécule : assemblage d'atomes dont la composition est liée à sa formule chimique.


Exemple : la molécule d’eau (H2O) correspond à l’assemblage de deux atomes d’hydrogène
(H) et d’un atome d’oxygène (O).

Mutation : modification de la séquence d'ADN d'un gène, dont la fonction peut-être, de ce


fait, perdue ou modifiée. La mutation peut être spontanée ou induite par des agents dits
«mutagènes» (radiations, produits toxiques,...).
Nucléotide : élément constituant l’ADN ou de l’ARN. Dans l’ADN, un nucléotide est
formé d'une base azotée (adénine (A), cytosine (C), guanine (G), thymine (T)), d'un sucre
(désoxyribose) et d'un groupement phosphate. Dans la structure en double brin de l’ADN,
les bases s’associent 2 à 2 de façon complémentaire : A avec T et C avec G.

OGM (Organisme Génétiquement Modifié)  : être vivant (animal, végétal ou


micro-organisme) dont le patrimoine génétique a subi des modifications, non naturelles,
par l’ajout, la suppression ou la modification d’un ou de plusieurs gènes lui conférant une
caractéristique nouvelle.

Plasmide : molécule d’ADN circulaire capable de se multiplier indépendamment de l’ADN


chromosomique de la bactérie et portant de nouveaux caractères génétiques.

Protéine : molécule essentielle dans la constitution et le fonctionnement de tous les êtres


vivants. Chaque protéine est formée d’un enchaînement différent d'acides aminés.

Transgénique : qualifie un être vivant dans lequel on a modifié l’information génétique de


façon stable. Équivalent à « génétiquement modifié ».
Les lois de bioéthique

La bioéthique est une discipline qui étudie les problèmes moraux soulevés par la recherche
biologique, médicale ou génétique. Elle se trouve au croisement de la morale, de la science
et du politique. La bioéthique se penche sur le développement des progrès scientifique
et les enjeux qui en résultent en matière de protection de l’individu : en raison des enjeux
économiques et éthiques dans le secteur des biotechnologies à l’échelle mondiale, et
compte tenu de la vitesse des progrès scientifiques dans ces domaines, la nécessité
d’encadrer la recherche apparaît comme une nécessité pour garantir le respect de la dignité
et de l’intégrité de l’homme.

La recherche étant par définition amenée à évoluer, la bioéthique est un domaine très
mouvant. Aussi, les États et les organisations internationales (comme l’Unesco) ont convenu
de révisions régulières des lois de bioéthique.

En France, la loi de 1994 garantit le respect de tout être humain dès le commencement de
la vie. Elle interdit la recherche sur l’embryon et le clonage humain. Elle est modifiée en
2000 pour permettre la recherche sur des embryons congelés en vue de mettre au point
de nouveaux traitements à partir des cellules souches. La révision de la loi en 2004 prévoit
l’interdiction du clonage thérapeutique et reproductif.

Une nouvelle révision de la loi de bioéthique prévue en 2010 aura pour enjeu l’autorisation
ou non de la recherche fondamentale sur l’embryon – et non plus seulement de la recherche
thérapeutique. La loi devrait également se pencher sur la question de la légalisation des
mères porteuses, le débat portant sur le principe juridique d’indisponibilité du corps humain
et la distinction entre la chose et la personne, la gestation pour autrui pouvant entrainer de
possibles dérives mercantiles et amener à considérer l’enfant comme un objet de créance.

Au niveau international, l’assemblée générale des Nations Unies a adopté en 1998 la


déclaration universelle sur le génome humain et les droits de l’homme, qui interdit
notamment le clonage humain à des fins reproductives.
ATELIERS

ADN ? Élémentaire, mon cher Watson ! 1


L’atelier « ADN ? Elémentaire, mon cher Watson ! 1 » se présente comme une invitation
à découvrir le Vivant et son fonctionnement. Cet atelier accessible dès 7 ans permet de
comprendre l’organisation et le fonctionnement des êtres vivants.

Il amène tout d’abord les participants à travailler sur ce qui compose tout être vivant  : la
cellule. Mais la vie, quelle qu’elle soit, est un travail  qui ne peut exister que si la cellule
renferme en son sein une information génétique, le terme «  génétique  » étant pris ici au
sens éthymologique : « ce qui est transmis lors de la génération ». C’est donc vers cette
information génétique portée par la molécule d’ADN que nous travaillerons en deuxième
partie d’atelier.

De la «  cellule … vers l’ADN », ce premier atelier vise à apporter au public des notions
élémentaires de biologie pour mieux appréhender les dispositifs présentés à Rurart.
Gène, bactérie, GFP, ATCG … : autant de termes pour lesquels il est bienvenu de lever le
voile … avant de se lancer dans l’œuvre transgénique d’Eduardo Kac !

kit transgénique, 2009 : s’installer à la paillasse


L’atelier « Kit transgénique, 2009 : s’installer à la paillasse »… propose au lecteur curieux …
d’ouvrir la pièce centrale de l’exposition.

Après avoir vêtu la blouse blanche et chaussé les gants de laboratoire, le public est invité à
rassembler les éléments de l’œuvre… pour comprendre ce qu’est la transgénèse et échan-
ger sur l’homme et son rapport avec le Vivant.
Ce sera dans l’univers microbien que les participants seront amenés, un univers peu connu
de l’homme où la plupart des êtres vivants n’ont toujours pas dévoilé leur identité.

Dans de minuscules tubes mis à leur disposition, les participants auront pour objectif « d’en
faire voir de toutes les couleurs  » à leurs bactéries afin que ces dernières expriment le
poème transgénique imaginé par Eduardo Kac.

Un atelier à proposer dès la classe de troisième.


infos PratiQuEs

Exposition du 9 octobre > 20 décembre 2009


Vernissage le 8 octobre 2009 à 18h à Rurart

Visites gratuites, ateliers 80 € sur rendez-vous uniquement (prévoir 1h pour une visite et 1h30
pour un atelier.)
Ouverture aux groupes du lundi au jeudi, de 9h à 17h.
Visites publiques du lundi au vendredi de 9h à 12h et de 14h à 18h et le dimanche de 15h
à 18h.

Les ateliers sont animés par l’École de l’ADN en Poitou-Charentes et sont accessibles aux
enfants à partir de 7 ans.

Réservations : 05 49 43 62 59 / info@rurart.org