Please cite this article in press as: Shi C, et al.

Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing

HspX protein. Vaccine (2010), doi:10.1016/j.vaccine.2010.05.063
ARTICLE IN PRESS
GModel
JVAC-10591; No. of Pages 8
Vaccine xxx (2010) xxxxxx
Contents lists available at ScienceDirect
Vaccine
j our nal homepage: www. el sevi er . com/ l ocat e/ vacci ne
Enhanced protection against tuberculosis by vaccination with recombinant
BCG over-expressing HspX protein
Chunwei Shi
a,1
, Lingxia Chen
a,1
, Zhenhua Chen
a
, Ying Zhang
b
, Zhiguang Zhou
a
, Jia Lu
a
,
Ruiling Fu
a
, Chun Wang
a
, Zhengming Fang
a
, Xionglin Fan
a,
a
Department of Pathogen Biology, Tongji Medical College, Huazhong University of Science & Technology, Wuhan 430030, PR China
b
Department of Molecular Microbiology and Immunology, Bloomberg School of Public Health, Johns Hopkins University, Baltimore, MD 21205, USA
a r t i c l e i n f o
Article history:
Received 5 November 2009
Received in revised form 6 May 2010
Accepted 26 May 2010
Available online xxx
Keywords:
Recombinant BCG
Tuberculosis
Latency antigen
Vaccine
HspX
a b s t r a c t
Immunization with Mycobacterium bovis Bacille CalmetteGuerin (BCG) did not induce adequate Th1
responses to the latency antigen, HspX of M. tuberculosis. To increase the immunogenicity and protec-
tive efcacy of BCG, a recombinant BCG strain over-expressing antigen HspX (rBCG::X) was constructed.
The recombinant strain rBCG::X expressed high levels of both HspX protein in the cytosol and Ag85B
protein in the cytosol and supernatant. Mice vaccinated with rBCG::X produced a more consistent and
enduring protective effect against infection with M. tuberculosis, showing lower bacterial load in lung
and less severe lung pathology, than the control mice vaccinated with BCG strain containing the vec-
tor pMV261. The long-term protection induced by rBCG::X was associated with signicant increases in
antigen-specic IFN- to both HspX and Ag85B proteins, while PPD-specic IFN- responses declined.
Our results suggest that latency antigens of M. tuberculosis may be promising targets for developing more
effective recombinant BCG strains to protect against TB.
2010 Elsevier Ltd. All rights reserved.
1. Introduction
Tuberculosis (TB) remains a major health problem world-
wide despite the availability of the chemotherapy and the Bacille
CalmetteGuerin (BCG) vaccine. The causative agent Mycobac-
terium tuberculosis has latently infected over 2 billion people,
causing 9 million new cases and nearly 2 million deaths each
year worldwide [1]. The disease burden has been worsened by
the emergence of multi-drug resistant M. tuberculosis strains
and the HIV infection [2]. BCG is a live and attenuated strain
derived from virulent M. bovis and is the only available prophy-
lactic TB vaccine. BCG vaccine can protect against severe forms of
childhood TB, while it provides inconsistent protective efcacy,
ranging from 0% to 80%, against adult pulmonary TB [3,4]. New
drugs and vaccines are urgently needed to better control the dis-
ease.
BCG is capable of inducing Th1 responses to some impor-
tant immunodominant antigens shared with M. tuberculosis, such
as Ag85 complex [5], Rv0125 and Mtb8.4 [6], which play vital
roles in the protection against mycobacterial infections in ani-
mals and humans [711]. It is noteworthy that BCG only expresses

Corresponding author. Tel.: +86 27 83650637; fax: +86 27 83650639.

E-mail address: xionglinfan@yahoo.com.cn (X. Fan).
1
These authors contributed equally to this paper.
a small amount of HspX (a heat shock protein also called Acr,
Hsp16.3, Rv2031c) during oxygen depletion [1214] or upon infec-
tion with macrophage [15], it does not induce IFN- immune
responses to HspX, as conrmed after neonatal BCG immuniza-
tion [5,16] or in BCG vaccinated animal model [17]. HspX is
identied as a major protein expressed by M. tuberculosis in the
Wayne non-replicating persistence model [18], when compared
with other antigens Ag85 complex, Rv0125, or Mtb8.4 during
log-phase growth. acr, HspX encoding gene, is required by M.
tuberculosis for growth in macrophages [19]. Moreover, epitopes
of HspX were also recognized by Th1-type CD4 and CD8 T cells
in TB patients [20,21], and effective treatment of TB resulted in
a shift from Th0 to Th1 type of response to HspX protein [22].
Recently, strong Th1 immune responses were induced by HspX
DNA vaccinated mice [9,23] and HspX DNA vaccinated guinea
pigs conferred protection against M. tuberculosis challenge [9].
Therefore, we assume that immune responses to latency antigen
HspX may contribute to the control of M. tuberculosis infec-
tion.
In the present study, we have constructed a recombinant BCG
strain over-expressing HspX (rBCG::X) and evaluated the humoral
and cell-mediated immune responses, short and long-term pro-
tective efcacy in BALB/c and C57BL/6 mice. Our results indicate
that immunization of mice with rBCG::X results in a signicantly
enhanced protection, characterized by a marked reduction in bac-
terial load in lungs along with a signicantly less pathology, when
compared to BCG up to 18 weeks post-infection.
0264-410X/$ see front matter 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.vaccine.2010.05.063
Please cite this article in press as: Shi C, et al. Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing
HspX protein. Vaccine (2010), doi:10.1016/j.vaccine.2010.05.063
ARTICLE IN PRESS
GModel
JVAC-10591; No. of Pages 8
2 C. Shi et al. / Vaccine xxx (2010) xxxxxx
Fig. 1. Recombinant plasmid pMHspX and expression of rBCG::X strain. The full-length copies (0.8kb) of the M. tuberculosis acr gene and its anking regions including the
promoter region, were amplied fromM. tuberculosis H37Rv chromosomal DNA. The PCR product was digested by enzymes and cloned into the E. coliMycobacteriumshuttle
vector pMV261. HspX and Ag85B proteins in the cell lysates or supernatants of the primary (G0, cultures of log phase) and the fourth generation (G4, cultures of 1 month) of
rBCG::261 (lane 1), rBCG::85B (lane 2) and rBCG::X (lane 3) were detected by Western blotting with anti-Rv2031 or anti-Ag85B sera, respectively.
2. Materials and methods
2.1. Bacterial strains and culture conditions
Escherichia coli strains DH5 and BL21 (DE3) were grown in
LuriaBertani mediumandusedfor cloningandexpressioninE. coli,
respectively. M. bovis BCG Danish, rBCG and M. tuberculosis H37Rv
strains were grown in either Middlebrook 7H9 medium(Difco Lab-
oratories, USA) or on Middlebrook 7H11 agar (Difco Laboratories,
USA), supplemented with 10% ADC, 0.5% glycerol and 0.05% Tween
80. When required, a nal concentration of 100g/ml ampicillin or
25g/ml kanamycin was added.
2.2. Over-expression and purication of HspX and Ag85B proteins
in E. coli
The ORFs corresponding to Rv2031c and fbpB were PCR-
ampliedusingM. tuberculosis H37Rvgenomic DNAas thetemplate
and the primers HspXF (AAGGATCCATGGCCACCACCCTTC), HspXR
(AGAAGCTTTCAGTTGGTGGACCGG), Ag85BF (GGGATCCTTCTCC-
CGGCCGGGGCTGCGGT) and Ag85BR (GGAATTCTCAGCCGGCGCC-
TAACG), respectively. The PCR amplicons were then cloned into
pProExHTb vector (Life Technologies, USA). The presence of
cloned insert in the resultant recombinant plasmids pProHspX or
pProAg85B was veried by restriction digestion and DNA sequenc-
ing. The recombinant HspX or Ag85B protein, containing a six
Histidine tag at the N-terminus, was over-expressed in E. coli BL21
(DE3) transformed with the plasmid pProHspX or pProAg85B upon
induction of 0.4mM IPTG. The recombinant proteins were puri-
ed by afnity chromatography on a Ni-NTA column according to
the manufacturers protocol (Life Technologies, USA). The recom-
binant HspX or Ag85B protein was analyzed by SDS-PAGE and
conrmed by Western blotting with an anti-Rv2031 mouse mono-
clonal antibody (1:2000, ab64786, Abcam, UK) or anti-Ag85Brabbit
polyclonal antibody (1:2000, ab43019, Abcam, UK), respectively.
Proteins were diluted in phosphate-buffered saline (PBS) using
pyrogen-free reagents and stored at 20

C. Endotoxin contami-
nation and protein concentration were determined as described
previously [24].
2.3. Construction of recombinant BCG strains
The recombinant E. coli-mycobacteria shuttle plasmid pMHspX
was prepared as follows. First, the 0.8-kb fragment correspond-
ing to the full-length Rv2031c gene (including the promoter)
of M. tuberculosis H37Rv strain was isolated from pcDNA3.1-
HspX by digesting the plasmid with BamHI and XbaI. This
fragment was ligated into XbaI/BamHI-digested pMV261 vector
(kindly supplied by W.R. Jacobs Jr., USA), yielding the shut-
tle plasmid pMHspX. The plasmid pMHspX was engineered to
express the recombinant HspX protein from its own promoter
(Fig. 1). pMHspX was then introduced into BCG strain by elec-
troporation. Kanamycin-resistant colonies on Middlebrook 7H11
plate were selected and grown in Middlebrook 7H9 broth. The
recombinant plasmid construct rBCG::X was sequenced and the
anticipated sequence of the insert was conrmed. rBCG::85B
strain (over-expressing antigen Ag85B of M. tuberculosis) was
prepared as described previously [8]. Both pMV261 trans-
formed BCG (rBCG::261) and rBCG::85B strains were used as
controls.
2.4. Analysis of HspX and Ag85B expression in recombinant BCG
Culture supernatants from 7H9 broth that had reached an opti-
cal density at 600nm of 1.0 were harvested after centrifugation
and passage through a 0.22-m-pore-size lter. Samples from
supernatants were concentrated approximately 50-fold by freeze-
drying. Cell pellets were washed, re-suspended in PBS with the
equivalent values of cell density, and disrupted on ice with an
Ultrasonic Processor. The bacterial cell debris from the sonicated
samples was removed by centrifugation. About 40g proteins of
bacterial pellets or supernatants were separated by SDS-PAGE on
a 12% gel and then analyzed by Western blotting. Total proteins
were electrotransferred onto a nitrocellulose membrane, and the
membrane was blocked with 1% bovine serum albumin (BSA)-PBS.
The presence of HspX and Ag85B were detected using anti-Rv2031
mouse antibody and anti-Ag85B rabbit antibody, respectively. The
immunoblots were developed with a Pierce ECL kit according to
the manufactures protocol (Pierce, USA). Monthly subcultures of
rBCGstrains in7H9brothwithout kanamycinwerealsoanalyzedby
Please cite this article in press as: Shi C, et al. Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing
HspX protein. Vaccine (2010), doi:10.1016/j.vaccine.2010.05.063
ARTICLE IN PRESS
GModel
JVAC-10591; No. of Pages 8
C. Shi et al. / Vaccine xxx (2010) xxxxxx 3
Western blotting, in order to evaluate the stability of recombinant
HspX or Ag85B expression in rBCG::X.
2.5. Mice and immunization protocol
Specic pathogen-free, female BALB/c (H-2
d
) and C57BL/6 (H-
2
b
) mice at 6 weeks of age (Beijing Vital River com., China) were
used in this study. Mice were fed commercial mouse chow and
water ad libitum. Mice were immunized s.c. once at the base of the
tail with 110
6
CFU of either rBCG::261, rBCG::85B or rBCG::X in
a nal volume of 100l of PBS. A control group received 100l of
PBS. C57BL/6 mice were sacriced for immunological assays after 6
and 24 weeks. Animal experiments were performed in accordance
withthe guidelines of Chinese Council onAnimal Care. The research
protocol was approved by Tongji Medical School Committees on
Biosafety.
2.6. Antigen-specic IgG antibody detection by ELISA
ELISA plates were coated overnight at 4

C with 100l
HspX, Ag85B protein or antigen control (5g/ml) in carbon-
ate/bicarbonate buffer (pH 9.6). Nonspecic binding sites were
blocked by 1% BSAPBS for 30min at 37

C and washed with

PBS containing 0.05% Tween 20 ve times. Individual serum sam-
ples were added at serial two-fold dilutions (beginning at a 1:50
dilution) and incubated for 2h at 37

C and washed, followed by

the addition of HRP-conjugated rabbit anti-mouse IgG antibodies
(diluted at 1:5000). Plates were incubated for 1h at 37

C, washed
and developed with 3, 3

5, 5

-tetramethylbenzidine (TMB) sub-

strate. After determination of OD at 450nm, the OD value from
antigen control was subtracted as background to exclude antibody
against nonspecic E. coli protein. Sera frommice groupimmunized
withPBS insteadof rBCGwere usedas the negative control (N). Sera
with P/Nvalue 2.1 were considered positive. Antibody titers were
expressedas reciprocal endpoint titers. Results were showedas the
mean of log
2
antibody titer of each vaccinated group.
2.7. IFN- enzyme-linked immunospot (ELISPOT) assay
Six and 24 weeks after C57BL/6 mice were vaccinated, mouse
IFN- ELISPOT kit (U-CyTech biosciences, Netherlands) was used
to determine the number of IFN--expressing cells in the single-
cell spleen suspensions following the manufacturers instructions.
Lymphocytes from spleen of each mouse were prepared using
EZ-Sep
TM
Mouse 1Lymphocyte Separation Medium (Dakewe
Biotech. Com., China) according to the manufacturers recommen-
dations. The cells were diluted to a concentration of 2.510
6
/ml
withLympho-Spot serumfree mediumfor rodent (Dakewe Biotech.
Com., China) containing an appropriate antigen (2g/well of PPD,
Ag85B or HspX). About 2.510
5
cells were added to the wells of
the ELISPOT plate. IFN-spot-forming cells were enumeratedusing
an ELISPOT Reader (Biosys Bioreader 4000 PRO, Germany). For each
animal, the number of spots in wells with medium alone was sub-
tracted from the number of spots in test wells. The mean number
of antigen-specic IFN- spot-forming cells (per million cells) for
each group was determined.
2.8. Challenge of mice with M. tuberculosis
Six weeks after immunization, C57BL/6 and BALB/c mice were
challenged with 10
6
CFU of virulent M. tuberculosis H37Rv through
a lateral tail vein. Four weeks post-challenge, ve mice per
group were sacriced for efcacy comparison and the remain-
ders of infected C57BL/6 mice were kept up to 18 weeks for the
observation of long-term protection. The spleens and lungs were
removed aseptically, homogenized, and cultured for CFU of M.
tuberculosis on Middlebrook 7H11 agar containing 2g/ml of 2-
thiophenecarboxylic acid hydrazide (TCH, Beijing Luqiao Corp.,
China) to selectively inhibit the growth of the residual BCG.
2.9. Histopathological analysis
Four and 18 weeks after the challenge infection, left lung lobes
fromdifferent vaccinated C57BL/6 mice were xed in 10% formalin
inPBSandembeddedinparafn. Tissuesections werepreparedand
stained with hematoxylin and eosin (H&E) stain. Apathologist with
no prior knowledge of the experimental groups recorded the result
under a light microscope and scored as described previously [25].
Briey, sections were evaluated according to four histopathologi-
cal parameters, includingperibronchiolitis, perivasculitis, alveolitis
and granuloma formation and noted as absent, minimal, slight,
moderate, marked or strong, which was scored as 0, 1, 2, 3, 4 and 5
respectively, thus the maximal sum was 20.
2.10. Data analysis
Students t test was used to compare the difference between
groups and the difference was considered statistically signicant
when P<0.05.
3. Results
3.1. Stable and high expression of HspX and Ag85B from rBCG::X
The M. tuberculosis Rv2031c and its anking regions including
the promoter sequence, were amplied fromM. tuberculosis H37Rv
chromosomal DNA. The PCR product was digested by different
enzymes and cloned into the E. coliMycobacterium shuttle vector
pMV261, resulting in the recombinant plasmid pMHspX (Fig. 1).
rBCG::X strain was obtained by transformation of BCG with the
recombinant plasmid pMHspX. The over-expression of proteins in
both culture supernatants and cell lysates of the primary (G0, cul-
tures of log phase) and the fourth generation (G4, cultures of the
fourth passage) were analyzed by Western blotting (Fig. 1). HspX
was not able to be detected in supernatant samples of all recom-
binant BCG strains (data not shown). rBCG::X expressed a much
higher amount of HspX protein than rBCG::85B and rBCG::261 in
the cell lysates of bothG0andG4cultures. Ag85Bproteinwas found
in the culture supernatant of both rBCG::X and rBCG::85B strains
as a secreted protein and had a much higher concentration than
that of rBCG:261 strain. Notably, rBCG::X also expressed a much
higher amount of Ag85B protein than rBCG::85B and rBCG::261 in
the cell lysates of both G0 and G4 cultures. rBCG::X stably retained
the plasmid pMHspX and maintained high level expression of the
HspX or Ag85B proteins when subcultured in broth monthly in the
absence of selective antibiotic pressure for at least 4 months, as
evidenced by the data of G4 with Western blot analysis (Fig. 1).
3.2. Antibody responses induced by rBCG
Antibody responses against HspX or Ag85B proteins were eval-
uated by ELISA at 6 and 24 weeks (Fig. 2). The antibody titres in
PBS control group were negative during 6 to 24 weeks. rBCG::X
produced higher antibody titres against HspX than both rBCG::85B
and rBCG::261 strains at 6 and 24 weeks (P<0.05). Six weeks after
immunization, antibodytitres against Ag85BinrBCG::Xgroupwere
induced much higher than that of rBCG::261 group (P<0.05), and
were increased to the same level of rBCG::85B group at 24 week.
Please cite this article in press as: Shi C, et al. Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing
HspX protein. Vaccine (2010), doi:10.1016/j.vaccine.2010.05.063
ARTICLE IN PRESS
GModel
JVAC-10591; No. of Pages 8
4 C. Shi et al. / Vaccine xxx (2010) xxxxxx
Fig. 2. IgG antibodies against HspX or Ag85B in mice immunized with rBCG strains (n=6). Serum was collected from each mice immunized with different rBCG strains at
6 and 24 weeks after immunization. Shown are the mean (SD) log
2
antibody titre per group. *P<0.05 vs. rBCG::261;**P<0.05 vs. 6 weeks. This experiment was repeated
twice with similar results.
3.3. IFN- ELISPOT assay
Splenocytes were isolated from C57BL/6 mice immunized with
rBCG following stimulation with HspX, Ag85B or PPD, respec-
tively. Splenocytes from PBS control group only produced very
low number of IFN- secreted cells during 6 to 24 weeks (Fig. 3).
UponstimulationwithPPD, splenocytes frommice vaccinatedwith
rBCG::85B or rBCG::261 produced higher levels of IFN- than that
of rBCG::X group at 6 and 24 weeks (P<0.05) (Fig. 3). The number
of IFN-secreting cells stimulated with HspXin rBCG::Xgroup was
much more than that of rBCG::85B or rBCG::261 groups at 6 and
24 weeks (P<0.05). Moreover, there was a signicant increase in
rBCG::X group at 24 week (Fig. 3). In addition, rBCG::X group also
induced higher levels of IFN- responses to Ag85B than rBCG::261
at 6 and 24 weeks (P<0.05).
3.4. Protective efcacy of rBCG::X vaccine
Six weeks after immunization, both BALB/c and C57BL/6 mice
were challenged with virulent M. tuberculosis strain, in order to
determine the effect of mouse species on the protective efcacy
induced by rBCG::X. Four weeks later, mice were killed and bac-
terial load in the lung and spleen of each mouse were analyzed.
The clear hierarchy of protective efcacy was seen in the differ-
ent groups of vaccinated mice (Fig. 4). Highest bacterial load was
seen in the lung and spleen in PBS control animals. Vaccination
with rBCG::261, rBCG::85B or rBCG::X strongly reduced bacterial
load in the lung and spleen in both BALB/c and C57BL/6 mice.
Both rBCG::85B and rBCG::Xinhibited the growth of M. tuberculosis
moresignicantlyinthelungandspleenthanrBCG::261vaccinated
BALB/c and C57BL/6 mice. rBCG::X resulted in a more signicant
decrease of the bacterial load in the lung (P<0.05), when com-
pared with rBCG::85B vaccinated BALB/c and C57BL/6, respectively
(Fig. 4). Eighteenweeks after the challenge infection, rBCG::Xstrain
inhibitedthegrowthof M. tuberculosis inthelungmoresignicantly
and consistently than rBCG::261 and rBCG::85B (P<0.05) (Fig. 5).
3.5. Pathological examinations
Lung tissue from different groups of C57BL/6 mice was xed,
sectioned and stained with HE stain for assessment of pathologi-
cal changes (Fig. 6). Four weeks after the challenge infection, there
were extensive serious pathological changes in the lung frommice
of each group. PBS control mice had the highest score (15) of
lung pathology, with strong peribronchiolitis, perivasculitis and
alveolitis. Comparatively, pathological changes were much less
Fig. 3. IFN- secretion was measured in an ELISPOT assay with splenocytes isolated fromrBCG strains immunized C57BL/6 mice (n=3) after 6 and 24 weeks. Freshly isolated
spleen cells were plated in duplicate at 2.510
5
cell and incubated with 2g per well of PPD, Ag85B, HspX, or culture mediumcontrol for 72h at 37

C, 5% CO
2
, respectively.
Results are expressed as the mean (SD). *P<0.05 vs. rBCG::261. This experiment was repeated twice with similar results.
Please cite this article in press as: Shi C, et al. Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing
HspX protein. Vaccine (2010), doi:10.1016/j.vaccine.2010.05.063
ARTICLE IN PRESS
GModel
JVAC-10591; No. of Pages 8
C. Shi et al. / Vaccine xxx (2010) xxxxxx 5
Fig. 4. Bacterial load of per spleen and lung 4 weeks after BALB/c and C57BL/6 mice challenged with M. tuberculosis (n=5). Six weeks after immunization, BALB/c (n=5) and
C57BL/6 mice (n=5) were challenged i.v. with 10
6
CFU virulent M. tuberculosis H37Rv strain. Four weeks post-challenge, spleens and lungs were harvested and numbers
of bacterial CFU per organ were enumerated. Results are shown as the mean (SEM) log
10
CFU/organ. *P<0.05 vs. rBCG::261; **P<0.05 vs. rBCG::X. This experiment was
repeated twice with similar results.
in the lung from mice vaccinated with rBCG::X (score 2). Eigh-
teen weeks later, the lung section from PBS control mice still
showed severe interstitial pneumonia and intense inammation
throughout the lung (score 11). Some inammatory foci had the
appearance of granuloma formation. Slight damage in alveolar tis-
sues with aggregated, relatively large number of lymphocytes was
also observed in the lung from rBCG::261 (score 3) or rBCG::85B
(score2) vaccinated group. Alveolar tissue from mice vaccination
with rBCG::Xappeared to be intact with limited lung inammation
(score2).
4. Discussion
In this study, we constructed the recombinant BCG strain over-
expressing the immunodominant antigen HspX of M. tuberculosis
(rBCG::X) and assessed the immunogenicity and protective ef-
cacy of rBCG::X in mice. Our results demonstrated that rBCG::X
strain could provide a better and more enduring protection against
virulent M. tuberculosis infection than the parental BCG vaccine,
as evidenced by higher levels of HspX-specic IFN- production,
lower bacterial load in tissues and less lung pathology. To our
Fig. 5. Bacterial load per spleen and lung in C57BL/6 mice at 18 weeks post-
challenge(n=5). Vaccinated C57BL/6 mice (n=5) were challenged i.v. with 10
6
CFU
virulent M. tuberculosis H37Rv strain. Eighteen weeks post-challenge, spleens and
lungs were harvested and numbers of bacterial CFU per organ were enumerated.
Results are shown as the mean (SEM) log
10
CFU/organ. *P<0.05 vs. rBCG::261;
**P<0.05 vs. rBCG::X. This experiment was repeated twice with similar results.
knowledge, this is the rst demonstration that latency antigens of
M. tuberculosis could be used to improve the protective efcacy of
BCG.
The M. tuberculosis HspX protein, also called 16kDa a-crystallin
homologue, encodedby the acr gene, is a member of the small heat-
shock protein family of chaperones. HspX expression increases
during the transition from log-phase growth to stationary phase
and HspX becomes one of the most abundant proteins in the sta-
tionary phase [26]. HspX protein is involved in cell wall thickening
under microaerophilic or anaerobic cultures of M. tuberculosis, and
stabilizes cell structures during long-term survival of M. tubercu-
losis [13]. Over-expression of HspX antigen under hsp60 promoter
or from its own promoter, makes recombinant M. tuberculosis or
M. smegmatis less susceptible to autolysis and both recombinant
bacteria have a slowinitial growth rate [26]. Therefore, HspX plays
a role in the maintenance of long-term viability of M. tuberculo-
sis in vivo and during early stages of adaptation to intracellular
environments. HspX is a highly immunogenic protein with anti-
HspX antibody detected in 77% chronic TB patients [27]. Recent
latent TB contacts [28] or active TB patients [27,29] had little IgG
antibody against HspX, but the higher level of IFN- responses
to HspX protein could be used as a predictor of latent TB infec-
tion [28]. Higher anti-HspX antibody and IFN- response were
detected during 6 to 24 weeks after rBCG::X immunization in
this study, which indicated that rBCG over-expressing HspX strain
could persist for a longer time in vivo than BCG control. In addi-
tion, higher Th1 immune response and IgG antibody to Ag85B
also were induced after rBCG::X immunization. Ag85B is a mycolyl
transferase involved in cell wall biosynthesis [30]. BCG cultured
under lowoxygentensionresultedinthe highly expressionof HspX
proteinand a strikingly thickened cell wall outer layer [14]. As indi-
cated inthis study, the introductionof HspXinto BCGmight imitate
this biological effect andresultedinmoreabundanceexpressions of
Ag85B protein in cell supernatants and lysates, as compared with
BCG control. Therefore, the more thickened cell wall of rBCG::X
might be formed than that of BCG. The over-expression of HspX
in BCG may allow this strain to survive better in mice and could
underlie its higher protective effect than BCG alone seen in this
study.
After rBCG::X immunization, HspX antigen-specic IFN-
secreting cells were signicantly increased and more cells were
produced than those of rBCG::261 during the entire period, which
may contribute to the enhanced and enduring protection. It is
noteworthy that the protection against virulent M. tuberculosis
challenge mediated by rBCG::X is most obvious during the early
time point at 4 weeks for both spleens and lungs but is also seen at
Please cite this article in press as: Shi C, et al. Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing
HspX protein. Vaccine (2010), doi:10.1016/j.vaccine.2010.05.063
ARTICLE IN PRESS
GModel
JVAC-10591; No. of Pages 8
6 C. Shi et al. / Vaccine xxx (2010) xxxxxx
Fig. 6. Representativelungpathologyandscoreof C57BL/6miceafter challenge. VaccinatedC57BL/6micewerechallengedi.vwith10
6
CFUvirulent Mycobacteriumtuberculosis
H37Rv strain. Four (left) and 18 (right) weeks after infection, lung tissue sections from different vaccine groups were prepared for HE staining (40). PBS group (A and B);
rBCG::261 group (C and D); rBCG::85B(E, F); rBCG::X (G and H). The summation of scores of histological parameters in the lungs of mice after infection was shown in (I).
Please cite this article in press as: Shi C, et al. Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing
HspX protein. Vaccine (2010), doi:10.1016/j.vaccine.2010.05.063
ARTICLE IN PRESS
GModel
JVAC-10591; No. of Pages 8
C. Shi et al. / Vaccine xxx (2010) xxxxxx 7
18 weeks inthe lungs (Fig. 5). The better lung protectionby rBCG::X
at 4 and 18 weeks correlates with the higher IFN- production
induced by rBCG::X than that by BCG vector control (Fig. 3) and
could be another reason for this observation besides the possible
better survival of rBCG over-expressing HspX than BCG control.
Previously, protective antigens Ag85 complex [8,3133], 38kDa
[34] and ESAT-6 [35] of M. tuberculosis have been used for develop-
ing recombinant BCG strains, which showed stronger protective
efcacy than native BCG in experimental animal models of TB.
Among these, rBCG-30 (rBCG over-expressing Ag85B) has been
nished phase I clinical research [8]. These antigens are mainly
secreted by M. tuberculosis during log-phase growth. Compared
with these rBCG strains and native BCG, rBCG::X based on antigen
HspX also demonstrated stronger short and long-term protective
efcacy against M. tuberculosis infection. Comparing the protective
efcacy of rBCG::X with rBCG::85B (rBCG over-expressing Ag85B),
we demonstrated that rBCG::X had a slight signicant decrease of
the bacterial growth in the lungs of vaccinated mice after challenge
with M. tuberculosis.
Although about 510% of infected individuals are estimated
to develop active disease during their lifetime, the remaining
90% contain the infection [36]. The immune response generated
by exposure to M. tuberculosis may be more effective than BCG
in providing protection against adult TB. Our research supports
the hypothesis that mycobacterial antigens that induced differen-
tial immune responses between BCG-vaccinated individuals and
healthy contacts of M. tuberculosis are the key targets to develop
recombinant BCGvaccines for inducing M. tuberculosis-like protec-
tive response. This also may be the cause for failing in inhibiting
the endogenous reactivation of latent TB in adults by BCG vac-
cination. However, the limitation of the present work is that
mice were challenged by intravenous injection route, which does
not represent the latent TB infection model. By microarray gene
expression proling and proteomic analysis, 48 so-called latency
antigens, including HspX, have been identied and all are encoded
by genes of the dormancy regulon (DosR, Rv3133) [3740]. Among
these latency antigens, many could induce strong IFN- response
in latently infected individuals and have elevated expression in
infected macrophages, such as Rv2623, Rv2626, etc [41,42]. Future
studies are needed to test whether other latency antigens besides
HspX evaluated in this study could be used for improving the pro-
tective efcacy of BCG and for protecting against latent TB.
Acknowledgments
We thank Prof. WilliamR. Jacobs Jr. for providing pMV261 plas-
mid. This work was supported by grants of the National High
Technology Research and Development of China (863 program
No. 2006AA02Z445), the Fok Ying Tung Education Foundation
(No.114032) and the National Mega-Projects of Science Research
for the 11th Five-Year Plan (2008ZX-10003-013).
Conict of interest statement: None declared.
References
[1] Dye C. Global epidemiology of tuberculosis. Lancet 2006;367:93840.
[2] Corbett EL, Watt CJ, Walker N, Maher D, Williams BG, Raviglione MC, et al. The
growing burden of tuberculosis: global trends and interactions with the HIV
epidemic. Arch Intern Med 2003;163:100921.
[3] Colditz GA, Brewer TF, Berkey CS, Wilson ME, Burdick E, Fineberg HV, et al.
Efcacy of BCG vaccine in the prevention of tuberculosis: meta-analysis of the
published literature. JAMA 1994;271:698702.
[4] Fine PE. Variation in protection by BCG: implications of and for heterologous
immunity. Lancet 1995;346:133945.
[5] Finan C, Ota MOC, Marchant A, Newport MJ. Natural variation in immune
responses to neonatal Mycobacterium bovis Bacillus CalmetteGuerin (BCG)
vaccination in a cohort of Gambian infants. PLoS ONE 2008;3:e3485.
[6] Vekemans J, Ota MO, Sillah J, Fielding K, Alderson MR, Skeiky YA, et al. Immune
responses to mycobacterial antigens in the Gambian population: implications
for vaccines and immunodiagnostic test design. Infect Immun 2004;72:3818.
[7] Coler RN, Campos-Neto A, Ovendale P, Day FH, Fling SP, Zhu L, et al. Vaccination
with the T cell antigen Mtb 8.4 protects against challenge with Mycobacterium
tuberculosis. J Immunol 2001;166:622735.
[8] Hoft DF, Blazevic A, Abate G, Hanekom WA, Kaplan G, Soler JH, et al. A
newrecombinant Bacille CalmetteGurin vaccine safely induces signicantly
enhanced tuberculosis-specic immunity in human volunteers. J Infect Dis
2008;198:1491501.
[9] Khera A, Singh R, Shakila H, Raoa V, Dhar N, Narayanan PR, et al. Elicitation of
efcient protective immune responses by using DNA vaccines against tubercu-
losis. Vaccine 2005;23:565565.
[10] McShane H, Pathan AA, Sander CR, Keating SM, Gilbert SC, Huygen K, et al.
Recombinant modied vaccinia virus Ankara expressing antigen 85A boosts
BCG-primed and naturally acquired antimycobacterial immunity in humans.
Nat Med 2004;10:12404.
[11] ReedSG, Coler RN, Dalemans W, TanEV, DeLa Cruz EC, Basaraba RJ, et al. Dened
tuberculosis vaccine, Mtb72F/AS02A, evidence of protection in cynomolgus
monkeys. Proc Natl Acad Sci USA 2009;106:23016.
[12] Boon C, Li R, Qi R, Dick T. Proteins of Mycobacterium bovis BCG induced in the
Wayne dormancy model. J Bacteriol 2001;183:26726.
[13] Cunningham AF, Spreadbury CL. Mycobacterial stationary phase induced by
low oxygen tension: cell wall thickening and localization of the 16-kilodalton
alpha-crystallin homolog. J Bacteriol 1998;180:8018.
[14] Lim A, Eleuterio M, Hutter B, Murugasu-Oei B, Dick T. Oxygen depletion-
induced dormancy in Mycobacterium bovis BCG. J Bacteriol 1999;181:
22526.
[15] Monahan IM, Betts J, Banerjee DK, Butcher PD. Differential expression of
mycobacterial proteins following phagocytosis by macrophages. Microbiology
2001;147:45971.
[16] Geluk A, Lin MY, van Meijgaarden KE, Leyten EMS, Franken KLMC, Ottenhoff
THM, et al. T-Cell Recognition of the HspX protein of Mycobacterium tubercu-
losis correlates with latent M. tuberculosis infection but not with M. bovis BCG
vaccination. Infect Immun 2007;75:291421.
[17] Lin MY, Geluk A, Smith SG, Stewart AL, Friggen AH, Franken KLMC, et al.
Lack of immune responses to Mycobacterium tuberculosis dosR regulon pro-
teins following Mycobacterium bovis BCG vaccination. Infect Immun 2007;75:
352330.
[18] Wayne LG, Hayes LG. An in vitro model for sequential study of shiftdown of
Mycobacterium tuberculosis through two stages of nonreplicating persistence.
Infect Immun 1996;64:20629.
[19] Yuan Y, Crane DD, Simpson RM, Zhu YQ, Hickey MJ, Sherman DR, et al. The
16-kDa alpha-crystallin (Acr) protein of Mycobacteriumtuberculosis is required
for growth in macrophages. Proc Natl Acad Sci USA 1998;95:957883.
[20] Caccamoa N, Milano S, Di Sano C, Cigna D, Ivanyi J, Krensky AM, et al.
Identication of epitopes of Mycobacterium tuberculosis 16-kDa protein rec-
ognized by human leukocyte antigenA*0201 CD8+ T lymphocytes. J Infect Dis
2002;186:9918.
[21] Wilkinson RJ, Wilkinson KA, De Smet KA, Haslov K, Pasvol G, Singh M, et
al. Human T- and B-cell reactivity to the 16kDa alpha-crystallin protein of
Mycobacterium tuberculosis. Scand J Immunol 1998;48:4039.
[22] Caccamoa N, Meravigliaa S, Dielia F, Romanob A, Titoneb L, Salernoa A. Th0 to
Th1 switch of CD4 T cell clones specic from the 16-kDa antigen of Mycobac-
terium tuberculosis after successful therapy: lack of involvement of epitope
repertoire and LA-DR. Immunol Lett 2005;98:2538.
[23] Roupie V, Romano M, Zhang L, Korf H, Lin MY, Franken KLMC, et al.
Immunogenicity of eight dormancy regulon-encoded proteins of Mycobac-
terium tuberculosis in DNA-vaccinated and tuberculosis-infected mice. Infect
Immun 2007;75:9419.
[24] FuR, WangC, Shi C, LuM, FangZ, LuJ, et al. Animprovedwholebloodinterferon-
gamma assay based on the CFP21-MPT64 fusion protein. Clin Vaccine Immunol
2009;16:68691.
[25] Dormans J, Burger M, Aguilar D, Hernandez-Pando R, Kremer K, Roholl P, et
al. Correlation of virulence, lung pathology, bacterial load and delayed type
hypersensitivity responses after infection with different Mycobacterium tuber-
culosis genotypes in a BALB/c mouse model. Clin Exp Immunol 2004;137:
4608.
[26] Yuan Y, Crane DD, Barry III CE. Stationary phase associated protein expres-
sion in Mycobacterium tuberculosis: function of the mycobacterial a-crystallin
homolog. J Bacteriol 1996;178:448492.
[27] Silva VMC, Kanaujia G, Gennaro ML, Menzies D. Factors associated with
humoral response to ESAT-6, 38kDa and 14kDa in patients with a spectrumof
tuberculosis. Int J Tuberc Lung Dis 2003;7:47884.
[28] Demissie A, Leyten EM, Abebe M, Wassie L, Aseffa A, Abate G, et al. Recog-
nition of stage-specic mycobacterial antigens differentiates between acute
and latent infections with Mycobacterium tuberculosis. Clin Vaccine Immunol
2006;13:17986.
[29] Davidow A, Kanaujia GV, Shi L, Kaviar J, Guo X, Sung N, et al. Antibody pro-
les characteristic of Mycobacterium tuberculosis infection state. Infect Immun
2005;73:684651.
[30] Belisle JT, Vissa VD, Sievert T, Takayama K, Brennan PJ, Besra GS. Role of the
major antigen of Mycobacterium tuberculosis in cell wall biogenesis. Science
1997;276:14202.
[31] Horwitz MA, Harth G, Dillon BJ, Maslesa-Galic S. Recombinant Bacillus
CalmetteGuerin (BCG) vaccines expressing the Mycobacterium tuberculosis
30-kDa major secretory protein induce greater protective immunity against
tuberculosis than conventional BCG vaccines in a highly susceptible animal
model. Proc Natl Acad Sci USA 2000;97:138538.
Please cite this article in press as: Shi C, et al. Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing
HspX protein. Vaccine (2010), doi:10.1016/j.vaccine.2010.05.063
ARTICLE IN PRESS
GModel
JVAC-10591; No. of Pages 8
8 C. Shi et al. / Vaccine xxx (2010) xxxxxx
[32] Jain R, Dey B, Dhar N, Rao V, Singh R, Gupta UD, et al. Enhanced and enduring
protection against tuberculosis by recombinant BCG-Ag85C and its association
with modulation of cytokine prole in lung. PLoS ONE 2008;3:e3869.
[33] Sugawara I, Li Z, Sun L, Udagawa T, Taniyama T. Recombinant BCG Tokyo
(Ag85A) protects cynomolgus monkeys (Macaca fascicularis) infected with
H37Rv Mycobacterium tuberculosis. Tuberculosis (Edinb) 2007;87:51825.
[34] Castanon-Arreolaa M, Lopez-Vidala Y, Espitia-Pinzonb C, Hernandez-
Pandoc R. A new vaccine against tuberculosis shows greater protection
in a mouse model with progressive pulmonary tuberculosis. Tuberculosis
2005;85:11526.
[35] PymAS, Brodin P, Majlessi L, Brosch R, Demangel C, Williams A, et al. Recombi-
nant BCG exporting ESAT-6 confers enhanced protection against tuberculosis.
Nat Med 2003;9:5339.
[36] Styblo K. Recent advances in epidemiological research in tuberculosis. Adv
Tuberc Res 1980;20:163.
[37] Boon C, Dick T. Mycobacterium bovis BCG response regulator essential for
hypoxic dormancy. J Bacteriol 2002;184:67607.
[38] ParkHD, GuinnKM, Harrell MI, LiaoR, Voskuil MI, TompaM, et al. Rv3133c/dosR
is a transcription factor that mediates the hypoxic response of Mycobacterium
tuberculosis. Mol Microbiol 2003;48:83343.
[39] Rosenkrands I, Slayden RA, Crawford J, Aagaard C, Barry III CE, Andersen P.
Hypoxic response of Mycobacterium tuberculosis studied by metabolic label-
ing and proteome analysis of cellular and extracellular proteins. J Bacteriol
2002;184:348591.
[40] Sherman DR, Voskuil M, Schnappinger D, Liao R, Harrell MI, Schoolnik GK.
Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding
alpha-crystallin. Proc Natl Acad Sci USA 2001;98:75349.
[41] Florczyk MA, McCue LA, Stack RF, Hauer CR, McDonough KA. Identication
and characterization of mycobacterial proteins differentially expressed under
standing and shaking culture conditions, including Rv2623 from a novel class
of putative ATP-binding proteins. Infect Immun 2001;69:577785.
[42] Leyten EM, Lin MY, Franken KL, Friggen AH, Prins C, van Meijgaarden KE, et al.
HumanT-cell responses to25novel antigens encodedbygenes of thedormancy
regulon of Mycobacterium tuberculosis. Microbes Infect 2006;8:205260.