Mol Genet Genomics (2009) 281:391405

DOI 10.1007/s00438-008-0418-2
1 3
ORI GI NAL PAPER
The application of expression analysis in elucidating
the eukaryotic elongation factor one alpha gene family
in Arabidopsis thaliana
Wendy Danielle Ransom-Hodgkins
Received: 7 October 2008 / Accepted: 22 December 2008 / Published online: 9 January 2009
Springer-Verlag 2009
Abstract Eukaryotic elongation factor one alpha
(eEF1A) encoding genes are part of the large GTP binding
protein family. The eEF1A family is important for protein
synthesis and actin Wlament and bundle formation. In this
study, the expression of four eEF1A genes in Arabidopsis
thaliana is reported. Microarray analyses of the gene family
showed high expression levels in germinating seeds,
embryos, and shoot and root meristems. Quantitative real
time RT-PCR was used to determine individual eEF1A
gene expression. Unlike animals, in Arabidopsis tissues all
four eEF1A genes were expressed in all tissues sampled.
However, the abundance of each transcript varied spatially.
Knocking out expression of one eEF1A gene produced
seedlings with stunted roots and a subsequent change in
expression of the other three eEF1A genes. The varying
abundance of each gene in diVerent tissues may indicate
diVerent concentration requirements for each message
product. These results will be very useful for elucidating
the role of each gene in growth, development, and stress
responses of the plant.
Keywords eEF1A Quantitative real time RT-PCR
Arabidopsis thaliana Development Microarray Roots
Abbreviations
eEF1A Eukaryotic elongation factor one alpha
ACT,2,8 Actin2 and Actin8 genes
UBQ10 Polyubiquitin 10 gene
Q real time Quantitative real time reverse transcription
RT-PCR polymerase chain reaction
GUS -glucuronidase
A1 At1g07920
A2 At1g07930
A3 At1g07940
A4 At5g60390
ORF Open reading frame
GFP Green Xuorescent protein
CDS Coding sequence
UTR Untranslated region
NPA 1-N-naphthylphthalamic acid
ABA Abscisic acid
BL Brassinolide
GA
3
Gibberellin
AVG Aminoethoxyvinylglycine
MJ Methyl jasmonate
Introduction
Several protein synthesis factors perform additional unre-
lated activities to their primary function in translation. The
translation factor eukaryotic elongation factor one alpha
(eEF1A) is one of them. eEF1A is a multifunctional protein
essential in protein translation (Andersen et al. 2003).
eEF1A binds and bundles actin (Demma et al. 1990), binds
and severs microtubules (Ohta et al. 1990), and interacts
with ubiquitin during protein degradation (Gonen et al.
1994). In addition, eEF1A functions in several signaling
pathways, including activation of phosphatidylinositol
Communicated by A. Aguilera.
Electronic supplementary material The online version of this
article (doi:10.1007/s00438-008-0418-2) contains supplementary
material, which is available to authorized users.
W. D. Ransom-Hodgkins (&)
Department of Biological Sciences, Western Michigan University,
1903 West Michigan Avenue, Kalamazoo, MI 49008-5410, USA
e-mail: w.ransom-hodgkins@wmich.edu
392 Mol Genet Genomics (2009) 281:391405
1 3
4-kinase (Yang et al. 1993), binding calmodulin (Kaur and
Ruben 1994), and it serves as a substrate for Rho associated
(Izawa et al. 2000) and calcium dependent protein kinases
(Yang and Boss 1994). The protein also interacts with
Rho1p target Bni1p (Umikawa et al. 1998), phosphokinase
C (Chang and Traugh 1998) and the ZPR1 transcription
factor (Gangwani et al. 1998). Chaperone-like activity of
misfolded proteins (Negrutskii and Elskaya 1998; Rao
et al. 2004) and tRNA channeling (Negrutskii and Elskaya
1998), has also been reported. Recently, eEF1A has been
identiWed as a regulator in DNA replication/repair protein
networks (Toueille et al. 2007), and has a putative role in
apoptosis (Ejiri 2002). The ability of this protein to interact
with over 24 diVerent proteins is unique. The reason for
development of the multifunctional capabilities of this and
other translational proteins is unknown. The intention of
this study is to analyze the transcriptional regulation of the
eEF1A gene family in an eVort to discover the need for
multiple genes and the development of multiple functions
in addition to eEF1As role in protein translation.
In plants, a small gene family comprised of two to 15
copies encodes eEFIA. Soybean (Aguilar et al. 1991) and
carrot (Kawahara et al. 1992) contain two copies; tomato
has four to eight copies (Pokalsky et al. 1989); rice (Kidou
and Ejiri 1998) and Arabidopsis have four genes (Axelos
et al. 1989); and maize exhibits 1015 copies, which is the
highest number yet documented (Berberich et al. 1995;
Carneiro et al. 1999). The four genes in Arabidopsis are
designated A1, A2, A3, and A4 (Axelos et al. 1989). A1,
A2, and A3 are clustered within a 10 kb region and encode
identical proteins (Axelos et al. 1989), and A4 is unlinked
(Axelos et al. 1989). The four proteins are 99% identical
with A4 diVering by one amino acid (E68D).
eEF1A expression has been studied in a several plants
during development and in response to diVerent stimuli.
eEF1A northern blot analysis in tomato showed expression
in young and mature leaves and roots, and green and red
fruit (Pokalsky et al. 1989). Gene expression was also stud-
ied in meristematic regions of root tips and shoot apices.
DiVerential screening was used to identify a low tempera-
ture-responsive eEF1A in barley (Dunn et al. 1993), and
cold treatment in maize also induced eEF1A expression
(Berberich et al. 1995). Furthermore, wounding (Morelli
et al. 1994) and low oxygen (Vayda et al. 1995) stress
induced eEF1A transcript accumulation in potatoes. Visual-
ization of eEF1A expression in transgenic tobacco using
eEF1A-Gus reporter constructs showed activity in meriste-
matic regions of shoots and roots and all Xoral parts (Ursin
et al. 1991). More recently, the eEF1A A1 promoter was
shown to direct GFP expression in Medicago trunculata
roots and Wxation nodules (Auriac and Timmers 2007).
RT-PCR has been shown a useful tool to study individ-
ual eEF1A gene expression in rice (Kidou and Ejiri 1998)
and maize endosperm (Carneiro et al. 1999). In rice, (Kidou
and Ejiri 1998) used real time RT-PCR analysis and
showed that all four eEF1A genes were transcribed in all
rice tissues sampled (Kidou and Ejiri 1998). The rice
eEF1A genes refa1 and refa4 genes showed strong expres-
sion in all tissues, and refa2 and refa3 genes exhibited
decreased expression levels. The amount of RNA was con-
sistent across all tissues examined. In maize, endosperm
expression was identiWed for Wve genes (Carneiro et al.
1999). These genes were expressed in the ear, leaf, root,
silk and stem tissues, but at diVerent levels. However, no
evidence of tissue-speciWc or developmental-stage speciWc
gene expression has been reported for eEF1A in plants
(Kidou and Ejiri 1998; Carneiro et al. 1999), results
incongruent to those exhibited in animals (Dj et al. 1990;
Knudsen et al. 1993; Kahns et al. 1998).
The purpose of this study was to determine the transcrip-
tional regulation of the eEF1A gene family in Arabidopsis
thaliana. Expression of eEF1A genes was investigated
using publicly available microarray datasets. Q (quantita-
tive) real time RT-PCR was chosen to study the A1, A2, A3
and A4 genes independently, and to determine individual
eEF1A gene expression in four Arabidopsis tissues, includ-
ing germinating seeds, embryos, and shoot and root meris-
tems. We were particularly interested in the expression
patterns of each gene and the speciWc stimuli that regulate
gene expression. eEFIA exhibits a wide range of functions,
therefore we hypothesize that the functional regulation of
the eEFIA gene family is encoded at the transcriptional
level in diVerent plant tissues.
Materials and methods
Genomic and microarray expression analysis
eEF1A sequences were obtained from GenBank. Sequence
comparisons were performed using the SDSC Biology
Workbench tools (http://workbench.sdsc.edu/) BlastX,
Clustal W, and Phylip programs. Gene expression compari-
sons among the four eEFIA genes was performed using
publicly available chip datasets in Genevestigator v3
Bioinformatics Tool (https://www.genevestigator.ethz.ch/;
Zimmermann et al. 2004), with datasets submitted based on
the ATH1 22 k array (AVymetrix http://www.affymetrix.
com). The array sources included: NASC, FGCZ, GEO,
Array Express, AtGen Express, and TAIR totaling 3 110
arrays. The experimental ID numbers are provided in
Tables 1 and 2, Supplementary Tables 1 and 2, which iden-
tify the experimenter and the location and details of each
experiment. Raw CEL Wles were normalized using the MAS5
algorithm. It is important to note that the probe designed by
AVymetrix for eEF1A (247644_s_at) recognized all four
Mol Genet Genomics (2009) 281:391405 393
1 3
genes. Changes in eEF1A gene expression were analyzed
using the Meta-proWle tool within Genevestigator v3. In the
anatomy proWle the mean signal value and standard error
were computed and are reported for all Arabidopsis tissue
types in Fig. 1. In the development proWle the mean signal
value and standard error were computed and are reported
for diVerent developmental stages in Fig. 2a. Changes in
the expression of eEF1A in response to stimuli were mea-
sured and the log
2
ratio values were computed using
treated/non-treated control signal values and are reported in
Table 1. Changes in the expression of eEF1A in mutant
plants was measured and the log
2
ratio values were com-
puted using mutant/wild type control signal values and are
reported in Table 2. The four-eEF1A genes were separated
using the Microarray Elements Search and Expression
Viewer. Consequently, tools from TAIR (http://www.
arabidopsis.org) were used to analyze data derived from
cDNA microarrays obtained from AFGC. The values for
tissue expression were given as slide fold change using the
tissue signal values. Whole 2-week-old plants were used as
control material and signal value reported is the change in
expression in each tissue compared to the signal measured
in whole 2-week-old plants. The slide fold change was
reported by the Microarray Expression Viewer and is pre-
sented in Fig. 2b and Table 3. The array element numbers
are provided in Fig. 2b and Table 3 and identify the experi-
menter, location, and details of each experiment. The
abiotic and biotic expression data were given as slide fold
Table 1 Altered expression of the eEF1A gene family in response to stimuli
Information was extracted from public gene expression databases on the Genevestigator v3 web site. All data were generated using the 22K
AVymetrix ATH1 Arabidopsis Genome array. Probe sets included: 247644_s_at (eEF1A); 255220_at (UBQ10); 257749_at (ACT2); 260765_at
(ACT8). The log
2
ratio value of experimental treated/non-treated controls are reported. 0 = no change. Positive and negative values represent the
fold increase or decrease in expression, respectively. Only stimuli that induced a change 0.3-fold were included
a
Experimental ID, detailed information about each treatment can be obtained from the Genevestigatorv3 web site
b
Compound concentration and sampling hours after treatment
c
Positive numbers in bold show fold increase in expression levels above 0.3
Treatments eEF1A UBQ10 ACT2 ACT8
Biotic
[23]
a
Mycorrhiza 0.41
c
0.35 0.32 0.32
[24] Nematode 0.37 0 1.04 0.5
[103] Zearalenone(50 M, 2, 24 h)
b
0.44 0.3 0.47 0
[113] Cycloheximide (10 M, 3 h) 0.36 0 0.83 1.67
[10] Isoxaben (0.1 mM) 0.53 0 0.39 0.898
Hormone and growth inhibitors
[110] ABA (10 M, 1 and 3 h) 0.65 0.3 0.3 0
[241] ABA (0.5 M, wt. 4 h leaves) 0.5 0.3 0.37 0.32
[241] ABA (0.5 M, abh 4 h leaves) 0.59 0 0 0
[113] Paclobutrazole (10 M, 3 h) 0.32 0 0 0
[113] AVG (10 M, 3 h) 0.45 0 0 0
[156] 6-Benzyl adenine 0.8 0.85 0.83 1.13
[113] Daminozide (10 M, 3 h) 0.55 0.3 0.3 0
[100] GA
3
(10 M, 1 and 3 h) 0.4 0.8 0 0
[113] Prohexadione (10 M, 3 h) 0.62 0 0 0
[110] BL (10 M, 1 and 3 h) 0.61 0.41 0 0
[113] NPA (10 M, 3 h) 0.5 0 0 0
[218] MJ (10 M, 1 and 3 h) 0.4 0.3 0 0
[113] Ibuprofen (10 M, 3 h) 0.57 0.3 0 0.43
Nutrient
[209] Nitrate(0) and sucrose (30 mM suc, roots, 8 h) 0.39 0 0 0.3
[209] Nitrate(45 mM) and sucrose(90) (roots, 8 h) 0.33 0 0.9 0.85
[15] Sucrose 0.31 0 0.4 0.52
Stress
[221] Cold (4C) 0.42 0 0 0
[120] Osmotic green (300 mM mannitol, 6, 12, 24 h) 0.37 0 0 0
394 Mol Genet Genomics (2009) 281:391405
1 3
change using stress/non-stress signal values. Identical non-
treated plant tissues were used as control material and the
signal value reported is the change in expression with each
treatment compared to the signal measured in non-treated
tissue. The slide fold change was reported by the Micro-
array Expression Viewer and is presented in Table 3. The
array element numbers are provided in Table 3 and identify
the experimenter, location, and details of each experiment.
Plant material
Arabidopsis thaliana Columbia (Col-0) seeds were steril-
ized and placed on germination media comprised of 1/2
Murashige and Skoog (MS) basal salts (PhytoTechnology
Laboratories, Shawnee Mission, KS) containing 1%
sucrose and 0.5 mL/L Plant Preservative Mixture (Phyto-
Technology Laboratories). Seeds were germinated on
media in plates for collection of 3, 5, 7, and 14 day tissues.
Seeds were germinated on media in magenta boxes for col-
lection of leaf, root, Xower, inXorescence stem, and siliques
tissues. The plates and magenta boxes containing sterilized
seed were incubated at 4C for 3 days, and then moved to a
growth chamber (12 h light/dark 200 Em
2
s
1
; 21C/
18C, 70% RH). Germinating seedlings and whole plants
(0.1 g) were collected at 3, 5, 7, and 14 days. Root, leaf,
Xower, inXorescence stem and silique tissues (0.1 g) were
collected at four to 6 weeks and frozen in liquid nitrogen.
The frozen tissues were stored at 80C.
Table 2 Altered expression of the eEF1A gene family in mutant back-
ground genotype
Data gathered as described in Table 1
Mutants eEF1A UBQ10 ACT2 ACT8
Hormones
[156] 35S::CKX1 0.88 1.25 0.41 0.3
[961] abi1-1.2 0.34 0.39 0.34 0
[180] ctr1 0.3 0.97 0 0.3
[131] ga1 0.38 0 0.38 0.81
[204] gh3.5-1D 0.34 0 0.38 0.32
miRNAs
[187] dcl1-7 0.33 0 0 0
[124] se-1 0.38 0.3 0.3 0
Stress
[179] hsf1:hsf3.1 0.34 0.59 0 0
[185] ZAT12.1 0.36 0 0 0
[58] sfr2.1 0.38 0 0 0
[242] oxt6:ATCPSF30 0.95 1.66 1.8 2.41
[183] 35S::MBF1c 0.43 0.47 0.36 0.73
[180] mpk4 0.41 0.36 0.63 0
[242] oxt6 1.32 0.61 0 0
[213] mpk4:ctr1 0.65 0.42 0.7 1.41
Fig. 1 Expression of the eEF1A gene family in Arabidopsis thaliana
plant tissues. Gene expression proWles based on microarray data were
correlated using the Meta-Analyzer of Genenvestigator v3 (Zimmer-
mann et al. 2004). Probe sets included: 247644_s_at (eEF1A);
255220_at (UBQ 10); 257749_at (ACT 2); 260765_at (ACT 8). Re-
sults are given as heat maps in blue/white coding that reXect mean sig-
nal values where darker represent stronger expression. The 100%
expression level of each gene as mean signal value: eEF1A: 108872;
UBQ10: 108963; ACT2: 35057; ACT8: 23424. The experimental ID
numbers are provided in Supplemental Table 1
Mol Genet Genomics (2009) 281:391405 395
1 3
Arabidopsis thaliana Columbia (Col-0) T-DNA line
SALK_067772 (T-DNA Express: Arabidopsis Gene
Mapping Tool (http://signal.salk.edu) Alonso et al. 2003)
was obtained from ABRC stock center (Columbus, OH).
The SALK_067772 line contains a T-DNA inserted into the
promoter region of At1g07930. Seeds were planted in soil
and placed in a growth chamber (12 h light/dark
200 Em
2
s
1
; 21C/18C, 70% RH). DNA was extracted
from leaf punches (0.5 cm disk) using the REDExtract-N-
AMPTM Plant PCR kit (Sigma, St Louis, MO). and used in
PCR ampliWcation with At1g07930 forward primer
AACACCCATGCGTACTTGAAG and At1g07930 reverse
primer GTGCTCTCTACCAGCGTTTTC to amplify the
At1g07930 gene or LBb1 SALK T-DNA forward primer
GCGTGGACCGCTTGCTGCAACT and At1g07930 reverse
primer to amplify the T-DNA insert. Primers were designed
using the iSect Tools SIGnAL T-DNA VeriWcation Primer
Design program (http://signal.salk.edu/isects.html). The
PCR was carried out using the manufacturers directions.
PCR products were separated on a 2% agarose gel. The
presence of a PCR product for the LBb1 and At1g07930
reverse primers reaction using SALK_067772 genomic
DNA veriWed the insertion of a T-DNA. The absence of a
PCR product for the At1g07930 forward and reverse
Fig. 2 Expression of eEF1A gene family during development. a Gene
expression proWles based on microarray data were correlated using
Meta-Analyzer of Genenvestigator v3 (Zimmermann et al. 2004).
Probe sets included: 247644_s_at (eEF1A; solid square); 255220_at
(UBQ 10; open square); 257749_at (ACT 2; closed triangle);
260765_at (ACT 8; open triangle). The mean signal value is reported
with error bars showing the standard error. The experimental ID num-
bers are provided in Supplemental Table 2. b Gene expression proWles
based on cDNA microarray data using TAIR Microarray Expression
Viewer. The values for tissue expression are given as slide fold change
using the individual tissue/2-week plant signal values. The cDNA
arrays numbers used include 201F18T7, 185L22T7, F7F4T7, 43B9T7
Table 3 Altered expression of eEF1A A1, A2, A3, and A4 genes
Information was extracted from the cDNA microarrays available at
TAIR Microarray Element Search and Expression tools (http://
www.arabidopsis.org). Tissue expression values are given as slide fold
change using the treatment/non-treatment signal values. Only treat-
ments that induced a changed one-fold in expression were included.
0 = no change. Positive and negative values represent the fold increase
or decrease in expression, respectively
ND indicates information not determined for those genes
a
Array element ID, detailed information about each treatment in each
experiment can be obtained from the Microarray Element Search and
Expression tools at the TAIR web site
b
Compound concentration or sampling hours after treatment
c
Positive numbers in bold show fold of increase in expression levels
above 1
Treatments eEF1A genes
A1 A2 A3 A4
Hormone (185L22T7, 161F17T7)
a
Ethylene (2 h)
b
NA 2.8 NA 2.8
Ethylene (24 h) NA 2 NA 2
Cytokinin (2 h) NA 0 NA 2
Cytokinin (24 h) NA 2 NA 2.8
Gibberellin (100 M) NA 2 NA 2
1-NAA (1 M, 24 h) NA 2 NA 2
IAA (10 M, 30 m) NA 2.8 NA 2.8
Light (201F18T7, 185L22T7, F7F4T7, 161G1971)
Light (6 h) 0 2 0 1
Light (12 h) 1 2 1 2
Light (24 h) 1 2 2 2
Light (48 h) 2.8 2.8 2.8 2.8
Dark (24 h) 2 2 2 0
Blue 0 2 0 0
Abiotic (201F18T7, 185L22T7, F7FT7, 161G1971)
Salt (24 h) NA 2.8 NA 2.8
Gentle mechano stimulation 1 1 0 0
Vernalization (10 day) 1 2 1 1
Elevated CO
2
(700 ppm) 2.8 2 2.8 2.8
Biotic (201F18T7, 185L22T7, 161G1971)
Tobacco mosaic virus 1 1 NA 0
Pseudomonas syringae (24 36 h) 0 0 NA 0
Phytophthora infestans (16 h) 1 1 NA 0
Powdery mildew (48 h) 2 0 NA 1
Nutrient ((201F18T7, 185L22T7, F7FT7, 161G1971)
Fe deWciency 2 2.8 2.8 2.8
KNO
3
deWciency 2 0 0 0
No zinc transport 1 2 2 0
396 Mol Genet Genomics (2009) 281:391405
1 3
primers reaction using SALK_067772 genomic DNA veri-
Wed the plant was homozygous for the T-DNA insertion.
An At1g07930 forward and reverse primers reaction using
wild type genomic DNA was also performed to show the
primers ampliWed the At1g07930 gene. Seed from homozy-
gous plants were chosen for the growth study. The seed (40
seeds) were sterilized and placed on germination media
comprised of 1/2 MS basal salts (PhytoTechnology Labo-
ratories) and plates containing 1% sucrose and 0.5 mL/L
Plant Preservative Mixture (PhytoTechnology Laborato-
ries). Seeds were germinated on media in plates for collec-
tion of 7 and 14 days tissues. Seeds were germinated
on media in magenta boxes for collection of root, and
inXorescence stem tissues. The plates and magenta boxes
containing sterilized seed were incubated at 4C for 3 days,
and then moved to a growth chamber (12 h light/dark
200 Em
2
s
1
; 21C/18C, 70% RH). Tissues (0.1 g) were
collected and frozen in liquid nitrogen. The frozen tissues
were stored at 80C. The square media plates containing
sterile seeds were placed vertically in the growth chamber
to observe root growth. The root growth of SALK_067772
and wild type plants was measured at 6, 12, and 18 day post
germination. Measurements were taken by placing a ruler
next to the plants and measuring the length of the root. Pho-
tographs were taken immediately following the measure-
ments with a digital camera. The root growth experiment
was repeated three times with 20 plants each of wild type
and SALK_067772 each time.
RNA isolation
Total RNA was extracted from all frozen tissue samples
using the Plant RNeasy kit (Qiagen, Valencia, CA). The
RNA was treated with DNAse I (Qiagen,) during isolation
as directed by the manufacturers instructions to remove
any genomic DNA. The quality of the RNA was assessed
using the RNA 6000 Nano Assay and a Bioanalyzer 2100
(Agilent Technologies, Santa Clara, CA). RNA concentra-
tion was determined using a spectrophotometer.
Quantitative real-time RT-PCR
The Taqman Gold RT-PCR Kit (Applied Biosystems,
Foster City, CA) was used following the two-step format.
RNA was reverse transcribed using an Oligo dT reverse
primer for cDNA synthesis. Primers and probes were designed
using Primer Express software (Applied Biosystems;
Fig. 3, Tables 4, 5). The sizes of the PCR products were as
follows: A1 200 bp; A2 186 bp; A3 194 bp; A4 178 bp;
UBQ10 74 bp; ACT2,8 73 bp; eEF1A Family 75 bp
(Supplemental Fig. 1). If genomic DNA contaminated RNA,
a 168 bp product was produced using the eEF1A gene family
primers. PCR products were cloned into the pCR4-TOPO
plasmid vector (Invitrogen, Carlsbad, CA) and sequenced
to verify correct ampliWcation of each eEF1A gene. The
RT-PCR portion of the assay was performed on an ABI
7700 Sequence Detection System (Applied Biosystems,
Foster City, CA). Relative expression levels were calcu-
lated using the Standard Curve Method as described in User
Bulletin #2 (Applied Biosystems), with 8, 4, 2, 1 and 0.5 ng
RNA. The relative mRNA abundance of ACT2,8 and
UBQ10 were compared for use as endogenous reference
expression genes. The expression of UBQ10 was stable,
whereas the expression of ACT2,8 was highly variable
(Supplemental Fig. 2). Consequently, UBQ10 expression
was used for normalization of eEF1A gene expression.
Results
Analysis of the eEF1A gene family
Four loci were identiWed in the A. thaliana genome using
the following databases: GenBank A. thaliana genome,
GenBank A. thaliana CDS and protein databases (SDSC
Biology Workbench: http://workbench.sdsc.edu), and TAIR
(http://www.arabidopsis.org). The four loci are At1g07920
(A1), At1g07930 (A2), At1g07940 (A3), and At5g60390
(A4) (Axelos et al. 1989). Three genes (A1, A2, and A3) are
located on chromosome one in tandem with the A3 gene
lying opposite in orientation to A1 and A2 (Pennisi 2000).
The fourth gene (A4) is found on chromosome four. All four
genes share an identical gene model Wrst described by
Axelos et al. (1989). The sequence of the A1, A2 and A3 cod-
ing regions is 99% identical, and the A4 gene-coding region
is 93% identical. (Table 6). The eEF1A A1, A2 and A3 genes
produce identical proteins, and the A4 protein diVered by
one amino acid. The A2, A3 and A4 genes are 88, 83, and
57% identical to the A1 gene. These results showed that
even though the coding region sequences are highly con-
served between the four genes, the 5 non-coding, intron,
and 3 UTR regions lack similarity. Alignments of the 5
non-coding Xanking regions for A1, A2, and A3, located
from the translation initiation codon to a position 330 bp
upstream are very similar (Axelos et al. 1989). However, the
5 non-coding region for A4 was highly divergent from the
other three genes. The 3 UTR Xanking region lacks similar-
ity in all four genes (Fig. 3), and the sequence divergence
begins immediately at the end of the coding region.
Variation in the eEF1A gene models
Eight gene models are suggested for the four-eEF1A genes
(TAIR: http://www.arabidopsis.org). All four genes share
one common model comprised of a 5 non-coding region,
two introns, two exons, and a 3 non-coding region (Fig. 4).
Mol Genet Genomics (2009) 281:391405 397
1 3
In addition, a second gene model exists for A2, A3, and A4
(TAIR; Arabidopsis MPSS Plus Gene Analysis (http://
mpss.udel.edu/)) denoted A2.2, A3.2, and A4.2, and a third
gene model is identiWed for the A4 gene (TAIR) denoted
A4.3. The A3.2 gene is predicted to contain an additional
exon before the ORF that does not become part of the pro-
tein. The A4.2 gene produces a truncated protein with 16
amino acids removed from the C-terminal (Fig. 4). The
additional intron in the C-terminal shifts the reading frame
and results in premature termination at the 3end, shorten-
ing the coding sequence by 32 amino acids. All models for
each gene contain the GTP and tRNA binding domains nec-
essary for elongation translation activity (TAIR) and a cal-
modulin binding domain (Reddy et al. 2002). The A3.2 and
A4.3 gene models lack the calmodulin-binding domain.
Proteomic studies using mass spectrometry analysis of
digested peptides identiWed diVerent locations for the four
eEF1A proteins at the tissue and subcellular levels (SUBA:
Subcellular Proteomic Database http://www.plantenergy.
uwa.edu.au/applications/suba/ (Heazlewood et al. 2005;
Heazlewood et al. 2007). Information from SUBA placed
A1, A2.1, A2.2, A4.1, and A4.2 in the male gametophyte
Fig. 3 Nucleotide sequences in
the 3UTR region of the four
eEF1A genes. The translation
stop codon is shown in bold.
Nucleotides that are identical to
those of A3 are indicated with
asterisks. The position and ori-
entation of the primers used in
quantitative real time RT-PCR
are indicated by underlining.
The nucleotide sequence data of
A1, A2, A3, and A4 are in
GenBank under the accession
numbers At1g07910,
At1g07920, At1g07930, and
At5g60390, respectively
398 Mol Genet Genomics (2009) 281:391405
1 3
(Holmes-Davis et al. 2005; Noir et al. 2005). A1 was also
localized in vascular bundles (Martina Schad et al.
2005). At the subcellular level, all proteins examined
(A1, A2.1, A3.1, A4.1) were situated in the cytoplasm,
mitochondria (Heazlewood et al. 2004), and nucleus
(Calikowski et al. 2003). A1 was the only protein
detected in plastids (KleVmann et al. 2004), A1 and A2.1
were identiWed in vacuoles (Jaquinod et al. 2007), and
A3.1 and A4.1 were found in plasma membrane fractions
(Marmagne et al. 2004).
Expression of eEF1A encoding genes in diVerent
Arabidopsis tissues
Expression of the eEF1A gene family in Arabidopsis was
assessed by searching the Genevestigator v3 database
(Zimmermann et al. 2004) based on AVymetrix ATH
microarrays and Microarray Expression Viewer (TAIR)
using cDNA microarrays. The Genevestigator database
provided information regarding total eEF1A expression.
cDNA microarrays employing the Microarray Expression
Viewer allowed for separation of the eEF1A genes, which
facilitated a greater understanding of individual expression
of A1, A2, A3 and A4. The cDNA microarray data
represent fold induction or repression in speciWc tissues
measured from the control deWned in the Material and
methods for each variable analyzed. The highest level of
eEF1A expression was found in speciWc tissue types
including seeds, embryos and roots (Figs. 1, 2a, 5a). Mod-
erate signal was observed in embryos and endosperm.
Hypocotyl tissue showed low levels of expression, and no
expression was detected in pollen (Fig. 1). In the A1 and
A3 genes, a one- and two-fold decrease in expression
levels was detected in individual tissues relative to the
Table 4 PCR primers used in quantitative real time RT-PCR primers
a
These primers anneal to a region spanning the Wrst intron following the translation start codon of the eEF1A genes. The sequence in this region
is identical for all four genes
b
The primers anneal to a region that is identical in both Act 2 and Act 8 genes
AGI Gene Primers
Forward Reverse
At1g07920 eEF1A Family
a
5-TGT CAA GCA GAT CTG CTG TT-3 5-TCA TCG TAC CTG GCC TTG G-3
At1g07930
At1g07940
At5g60390
At3g18780 ACT 2, 8
b
5-GTG CTG AGA GAT TCA GGT GCC-3 5-GGA TCC CTG CAG CTT CCA T-3
At1g49240
At4g05320 Ubq10 5-GTC GAC CCT TCA CTT GGT GTT-3 5-TGG TCT TTC CGG TCA AAG TC-3
Table 6 Eukaryotic elongation factor one alpha gene family in Arabidopsis thaliana
Nucleotide and deduced amino acid sequences were obtained from Genbank
a
Axelos et al. (1989) cloned and sequenced the four eEF1A genes and deposited the information in Genbank. Gene, CDS, and amino acid
identities were determined in this study based on nucleotide or amino acid alignments of the four genes using Clustal W and Blast, available
in the SDSC Biology Workbench
Gene Gene accession no. Gene identity (%) CDS identity Amino acid identity (%) Reference
A1 At1g07920 100 100 100 Axelos et al. (1989)
a
A2 At1g07930 85 98 100 Axelos et al. (1989)
a
A3 At1g07940 83 99 100 Axelos et al. (1989)
a
A4 At5g060390 57 93 99 Axelos et al. (1989)
a
Table 5 Taqman probes used in quantitative realtime RT-PCR
a
This probe anneals to a region spanning the Wrst intron following the
translation start codon of the eEF1A genes. The sequence in this region
is identical for all four genes
b
The probe anneals to a region that is identical in both Act 2 and Act
8 genes
Gene Probe sequence (53)
eEF1A
Family
a
ACA AGA TGG ATG CCA CTA CCC CCA AGT AC
ACT2,8
b
AGA AGT CCT TTT CCA GCC ATC ATT TGT TGG
Ubq10 CGT CTG CGT GGA GGT ATG CAG
Mol Genet Genomics (2009) 281:391405 399
1 3
2-week-plant control (Fig. 2b). A1 and A2 genes had one
and two-fold decreased RNA levels in the roots compared
to the control, respectively. A2 increased one-fold in inXo-
rescence stems, and both A3 and A4 increased one-fold in
Xowers.
Q real time RT-PCR results measured total eEF1A mes-
sage abundance and the results were consistent with Gene-
vestigator data. The highest expression levels were detected
in germinating seedlings (Fig. 5a). Roots showed highest
expression of separate plant tissues (Figs. 1, 5a). However,
comparison of Q real time RT-PCR to cDNA microarray
data was inconsistent. The cDNA microarray data show a
decrease in expression for A1 and A3 in leaves and A1 and
A2 in roots compared to the 2-week-plant control (Fig. 2b)
that was not observed for any of the eEF1A genes using
quantitative real time RT-PCR (Fig. 5b). Increased expres-
sion levels measured in the inXorescence stem and Xowers
were congruent with cDNA microarray data (Fig. 5b). In
addition, Q real time RT-PCR results showed that A2 had
the highest message abundance of any eEF1A gene in
roots, and A4 the highest message abundance of any
eEF1A gene in leaves and all other tissues examined
(Fig. 5b).
Expression of eEF1A genes during development
The Genevestigator dataset shows the highest signal for
total eEF1A in germinated seeds (Fig. 2a), and imbibed
seeds exhibits the highest expression levels of all tissues
(Figs. 1, 2a). Within the seed, the embryo shows the highest
expression. Endosperm expression is less than that
measured in the embryo, but greater than that detected in
cotyledons, hypocotyls and radicles (Fig. 1). Total eEF1A
Fig. 5 Quantitative real time RT-PCR measurement of eEF1A.
a Total eEF1A expression in tissues throughout development. RNA
was extracted from 3, 5, 7, and 14 days seedlings; 4 week leaves, roots,
Xowers, and siliques. The RNA was used as template for cDNA syn-
thesis; the eEF1A family PCR primers, probe, and reaction conditions
are described in Materials and methods. The experiment was repeat-
ed twice with triplicate samples for each treatment. The relative mRNA
normalized to UBQ10 and standard deviation is reported b, eEF1A A1,
A2, A3 and A4 expression in tissues throughout development. The
methods are described above except that eEF1A A1, A2, A3 and A4
primers were used for PCR. A1 solid bar; A2 white bar; A3 grey bar;
and A4 diagonal hatched
Fig. 4 Models of eEF1A A1, A2, A3, and A4 genes as predicted by
gene structure and cDNA data by TAIR and MPSS Plus gene analysis
software. Exons are indicated by solid dark squares. Open reading
frames are indicated by light squares. Introns that are removed during
mRNA processing are indicated with lines. Function was determined
by gene analysis and annotation of the gene by TAIR. Tissue and
subcellular localization data were obtained by SUBA (http://www.
plantenergy.uwa.au/applications/suba/). T translation, C calmodulin,
MG male gametophyte, VB vascular bundle, N nucleus, C cytoplasm,
M mitochondria, P plastid, V vacuole, PM plasma membrane
400 Mol Genet Genomics (2009) 281:391405
1 3
expression decreases following germination to the lowest
levels recorded in seedlings (Figs. 2a, 5). However, even
the lowest signal recorded for eEF1A at 38,895 was still
well above the expression of UBQ10 at 25,007 (Fig. 2a).
The results of Q real time RT-PCR were consistent with
data from the Genevestigator database. Q real time RT-
PCR also showed expression diVerences between A1, A2,
A3, and A4 seedlings at 3, 5, 7 and 14 days after germina-
tion (Fig. 5b). The highest expression was measured in
3 day seedlings. A1, A2 and A4 showed a six- to ten-fold
increased expression relative to UBQ10 in seedlings
(Fig. 5b). Expression of A3 was the lowest in 3 day seed-
lings, but four-fold higher than UBQ 10. From 3 to 14 day,
the expression of A1 and A2 decreased from six to eight-
fold to one to two-fold higher than UBQ10, respectively.
A3 showed peak expression in 5 day seedlings.
Expression of eEF1A in response to biotic and abiotic
interactions
eEF1A expression was also analyzed with respect to sev-
eral types of stimuli including hormonal, nutrient, light,
and abiotic and biotic stress using the Genenvestigator
and Microarray Expression Viewer programs. Overall,
the expression of eEF1A remained unchanged for most
stimuli except cold, osmotic, nutrient, biotic, and hor-
mone treatment. However, expression results were incon-
sistent between the Genenvestigator and Microarray
Expression Viewer for hormone treatments. Total eEF1A
expression decreased in response to ABA, ethylene,
gibberellin, brassinosteroids and methyl jasmonate
(Table 1). Hormone biosynthesis inhibitors caused an
expression increase in eEF1A. For individual eEF1A
genes, the A2 and A4 genes show a two-fold expression
decrease in response to IAA, but a two-fold expression
increase in response to ethylene, cytokinin, gibberellin,
and 1-NAA (Table 3).
Plant interactions with mycorrhiza and nematodes
increased total eEF1A expression. Phytophthora infestans
stimulated A1, and A2 gene expression, whereas powdery
mildew led to decreased expression for A1 and A4. Nitrate
and sucrose treatments exhibited opposite eVects on gene
expression (Table 3). Sucrose stimulates and nitrate
decreases total eEF1A expression. The nitrate response was
consistent with a two-fold decrease in expression observed
for A1 under potassium nitrate deWciency, while A2, A3
and A4 gene expression remains unchanged. Iron deW-
ciency also results in decreased expression of all four
eEF1A genes.
An increase in eEF1A expression was measured in
response to cold and a decrease in expression was measured
in response to osmotic stress (Table 1). A2 was the only
eEF1A gene to increase expression in response to vernali-
zation (Table 3). Other abiotic stresses, including salt,
touch and elevated CO
2
also decreases eEF1A expression
(Table 3). All four genes were up regulated in response to
light (Table 3), and A2 exhibited a decrease in expression
with 24-h dark treatment or blue light stimulus. The protein
synthesis inhibitor cycloheximide stimulates total eEF1A
expression.
Changes in gene expression of eEF1A in Arabidopsis
mutants
eEF1A expression in several diVerent Arabidopsis mutants
was determined using datasets in the Genenvestigator v3
program. Hormone deWcient mutants show an increase in
eEF1A expression indicated by the positive log
2
signal
value reported in Table 2. These results were consistent
with the increase in eEF1A expression observed in plants
treated with hormone inhibitors (Table 1). In addition, abi-
otic stress pathway mutants showed a decrease in eEF1A
expression (Table 2). The greatest decrease in eEF1A
expression was measured in the oxt6 mutant deWcient in a
polyadenylation factor subunit. The complemented mutant
oxt6: AtCPSF30 mutant shows a one-fold increase in
eEF1A expression. In addition, dcl1-7 and se-1 mutants
in micro RNA function exhibit an increase in eEF1A
expression.
The T-DNA line SALK_067772 containing an insert in
the eEF1A A2 gene promoter region was investigated to
determine the eVects of knocking out expression in one
Arabidopsis eEF1A gene (Alonso et al. 2003). The
SALK_067772 mutant grew normally and was indistin-
guishable from wild type plants grown in soil. However,
when SALK_067772 seedlings were grown on vertical
plates, they showed stunted roots compared to the wild
type (Fig. 6a, b). At 6 days post germination, the
SALK_067772 roots were 2 mm shorter than the wild
type roots (Figs. 6a, c, e). At 12 and 18 days post germi-
nation, the SALK_067772 roots were similar in length to
the wild type roots (Fig. 6b, d, f). To determine the extent
of eEF1A-altered expression due to the T-DNA insertion,
Q real time RT-PCR was performed on 57 day old ger-
minating seedlings, 14 day old seedlings, inXorescence
stems, and roots (Fig. 7). The amount of A2 and A3 gene
message detected was very small in all four tissue types,
and also very low compared to the wild type message
(Fig. 7b). The A1 message levels were similar to the wild
type in germinating and fourteen day old seedlings
(Fig. 7a). However, higher message levels were detected
in inXorescence stems and less in roots compared to the
wild type. A4 message levels were identical to the wild
type (Fig. 7d).
Mol Genet Genomics (2009) 281:391405 401
1 3
Discussion
Expression proWles of eEF1A protein encoding genes
during development in diVerent tissues
In this study, the transcriptional regulation of the eEF1A
gene family in A. thaliana was examined. Expression of
four eEF1A genes from publicly available microarray data-
sets and Q real time RT-PCR were used to evaluate the A1,
A2, A3 and A4 genes independently. Our results revealed
that the eEF1A A1, A2, A3 and A4 genes were transcribed
in all Arabidopsis tissues sampled. However, the abundance
of the total eEF1A RNA and RNA for each individual
gene varied for each tissue type. For most tissues exam-
ined, the level of eEF1A gene expression detected in the
microarray studies was consistent with Q real time RT-PCR
results. For example, total eEF1A message was highest
in germinating seeds and root meristems, and lowest in
14-day-old seedlings. High expression in the rapidly
dividing tissues of germinating seeds and meristems provides
Fig. 6 eEF1A A2 knockout
mutant and WT seedlings.
a Photograph of wild type 6-day
seedlings; b SALK_067772
6-day seedlings; c, wild type
12-day plants; d SALK_067772
12-day plants. e Length of
SALK_67772 and wild type
roots at six, 12, and 18 days.
Measurements were made on 24
seedlings for wild type and
SALK_067772, grown verti-
cally on plates as described in
Material and methods. The
standard deviation is reported.
The experiment included three
replicates
Fig. 7 Quantitative real time
RT-PCR measurements of the
eEF1A A2 knockout mutant.
Refer to Fig. 5b for measure-
ment details for eEF1A A1, A2,
A3, and A4 in wild type and
SALK_67772 plants. a A1
expression; b A2 expression;
c A3 expression; d A4 expres-
sion. The experiment was
repeated twice with triplicate
samples
402 Mol Genet Genomics (2009) 281:391405
1 3
the necessary eEF1A for protein synthesis in dividing cells.
eEF1A abundance may also reXect heavy use of the protein
to bind actin and microtubules in growing tissue. Both in
vivo (Clore et al. 1996) and in vitro (Sun et al. 1997) stud-
ies in maize endosperm cells have reported eEF1A serves
to bind actin Wlaments surrounding protein bodies. Accord-
ing to the microarray data, varying levels of eEF1A total
expression were observed in all tissues except pollen. The
absence of eEF1A expression in pollen is incongruent with
a study that used eEF1A promoter GUS constructs to dem-
onstrate gus activity in transgenic tobacco pollen (Ursin
et al. 1991). Perhaps diVerences in expression between the
two data sets are the result of diVerent experimental condi-
tions in the microarray data not optimal for eEF1A signal
detection. DiVerences in results were also observed
between cDNA microarray and Q real time RT-PCR data.
The microarray analysis detected decreases in gene expres-
sion for A1 and A3 in leaves, and A1 and A2 in root tissue,
not observed in Q real time RT-PCR data. The four individ-
ual eEF1A genes showed diVerent levels of expression in
diVerent tissues during development, suggesting the need
for varying concentrations of each gene message. Maintain-
ing proper eEF1A concentrations in the cell is vital for nor-
mal growth. Studies examining over expression of eEF1A
in yeast observed yeast with an abnormal phenotype,
including slow growth, fewer actin patches, disorganized
actin cables, and an increased yeast population size during
the G1 phase (Munshi et al. 2001; Gross and Kinzy 2005;
Gross and Kinzy 2007).
Expression proWles of eEF1A protein encoding genes
under various treatments
Examination of the microarray data showed that eEF1A
expression varied only one-fold across all treatments. This
may reXect tight regulation of the total amount of eEF1A
present in tissues. The levels of eEF1A are normally very
high in most tissues, and small changes in that amount may
be eVective in response to diVerent stimuli. Exposure to
exogenously applied hormones depressed total eEF1A
expression by 0.5-fold (Table 4). Conversely, hormone
inhibitors had the opposite eVect on eEF1A expression. The
decrease in expression of eEF1A to several hormones was
an unexpected result. Previous studies using transgenic
tobacco containing a GUS construct eEF1A promoter
showed a shift in gus activity from root meristems to the
roothypocotyl junction when treated with 2,4-D (Ursin
et al. 1991). The diVerences observed between microarray
expression and transgenic tobacco showed that diVerent
methods of detection produced diVering results. The
decrease in A2 and A4 expression in response to IAA was
similar to results from the Genenvestigator v3 datasets.
However, the increases in response to ethylene, cytokinin,
and gibberellin were diVerent. This could reXect a diVer-
ence in measuring abundance of individual genes verses the
entire gene family. The increase and/or decrease of eEF1A
in response to changes in hormone biosynthesis suggests a
link between hormone status and the amount of eEF1A
needed to maintain growth.
The protein synthesis inhibitor cycloheximide also
increased eEF1A expression. Inhibition of protein synthesis
leads to the production of more protein synthesis factors to
overcome limiting determinants and resume normal synthe-
sis rates. A2 was the only gene to increase expression in
response to vernalization and may be the one family mem-
ber responsive to cold temperatures. eEF1A induction has
been reported in response to cold in barley (Dunn et al.
1993) and corn (Berberich et al. 1995). A1, A2 and A4 all
increased expression in response to mold treatments. How-
ever, responses to viral and bacterial infection were mixed.
A1 decreased or increased expression dependent on the
species interaction. A2 increased expression from infection
with Tobacco mosaic virus and Phypthora infestions.
Expression of eEF1A encoding proteins in Arabidopsis
mutants
eEF1A expression showed the greatest induction and
repression in several mutant backgrounds. Both the
35s::CKX1 mutant deWcient in cytokinin (Wolfram et al.
2005) and an oxt6:ATCPSF30 mutant deWcient in a poly-
adenylation factor subunit and increased oxidative stress
tolerance, showed increased expression of nearly one-fold.
The increase in eEF1A expression was congruent with the
microarray data results showing increased eEF1A expres-
sion in response to hormone biosynthesis inhibitors. The
oxt6 mutant showed a 1.32-fold decrease in expression and
was the largest change in gene expression recorded for
eEF1A using the Genevestigatorv3 program. Interestingly,
oxt6:ATCPSF30 reversed the repression observed in the
oxt6 mutant and increased eEF1A expression to one-fold
that of normal wild type plants. An eEF1A A2 knockout
mutant exhibited a short root phenotype in Arabidopsis.
The short roots were noticed immediately after germina-
tion, but after 1218 days, the root length was equalivant to
wild type plants. Q real time RT-PCR used to conWrm dis-
ruption of the A2 gene showed that the A3 gene also exhib-
ited a dramatic decrease in expression. The change in
expression of A3 in response to changes in A2 suggested
that cross talk between expressions of the two genes occurs
in Arabidopsis, and we hypothesize this may also operate in
other plants. A short root phenotype is not unique to eEFIA
but has also been observed in Arabidopsis actin mutants
(Gilliland et al. 2002, 2003; Nishimura et al. 2003). ACT7
mutants were reported to have retarded root growth along
with increased root twisting and waving (Gilliland et al.
Mol Genet Genomics (2009) 281:391405 403
1 3
2003), and the short roots of the A2 mutant show similarity
to the ACT7 mutant. ACT2 mutants also have impaired
root hair elongation (Gilliland et al. 2002), not observed in
A2 mutants. It is possible that by decreasing the eEF1A
protein in the cell proper, formation of the actin cytoskele-
ton in the cell is disrupted. In yeast, actin mutants have a
variety of mutant phenotypes from lethal, to temperature
sensitive, to no observable phenotypic change dependent on
the particular mutation (Wertman et al. 1992). However,
over expression of eEF1A causes a phenotype of fewer
actin patches and disruption of actin cables (Munshi et al.
2001; Kandl et al. 2002; Gross and Kinzy 2007). Over
expression of eEF1A in some yeast actin mutants eliminated
the eEF1A over expression phenotype. These various
studies have demonstrated that increases and decreases
in eEF1A expression directly eVect actin structure in the
cell.
Expression of Arabidopsis eEF1A in comparison to other
organisms
The eEF1A amino acid sequence is highly conserved, and
shared by 95% of the plant kingdom. Alignment of the Ara-
bidopsis eEF1A CDS sequences with rice ref1a, ref2a,
ref3a, and ref4a (Kidou and Ejiri 1998) and Wve maize
eEF1A mRNAs (Lopez-Valenzuela et al. 2003) revealed
8386% identity in the coding region. In addition, all four
Arabidopsis genes were equally similar to all four rice and
all Wve maize genes. Studies from human, rabbit and Xeno-
pus have shown diVerential tissue expression of eEF1A
genes. Most animals contain two or more genes that are
diVerentially expressed by tissues or developmental stages.
In rabbit and humans, one gene is expressed in the skeletal
muscle, brain and heart; and the other in lung, liver, kidney
and spleen (Knudsen et al. 1993; Kahns et al. 1998). How-
ever, plants appear to be unique in this aspect. Maize con-
tains Wve genes all expressed in the ear, leaf, root, silk and
stem (Carneiro et al. 1999). Both rice and Arabidopsis have
four genes that are expressed in all tissues examined to date
(Ejiri 2002). Even though eEF1A gene expression in plants
lacks tissue speciWcity, the amount of each message varies
between tissues. In rice, maize and Arabidopsis, the amount
of message for each gene is diVerent in each tissue (Kidou
and Ejiri 1998; Carneiro et al. 1999). Comparisons of the
expression proWles for rice eEF1A gene refa and Arabidop-
sis A1 showed similarity in message levels in the same tis-
sues (Kidou and Ejiri 1998), and rice refd and Arabidopsis
A4 also showed similarity in message abundance in the
same tissues. In rice, refa and refd appear to have identical
expression proWles. Q real time RT-PCR performed in
Arabidopsis indicated that A1 and A4 were both highly
expressed, but showed diVerences in message abundance.
A4 was highly expressed in leaves, inconsistent with refd,
which showed increased expression in roots. A2, A3, refb
and refc exhibited similar expression proWles.
In plants the number of eEF1A genes identiWed and
characterized has increased compared to animals. The func-
tional role of all plant genes is unknown, and the increased
gene number remains elusive. Even though plants do not
show distinct diVerential tissue expression for eEF1A, stud-
ies in maize point to diVerential protein functions (Lopez-
Valenzuela et al. 2003). Maize eEF1A isoforms diVered in
their ability to bind F-actin, but all were capable of forming
a ternary complex with aminoacylated tRNA. Recent work
in proWling proteins using mass spectrometry has localized
the eEF1A proteins to diVerent positions in the cell
(Heazlewood et al. 2005). As expected, peptides for all
four eEF1A proteins were localized to the cytoplasm and
functioned in protein synthesis, and eEF1A proteins were
also identiWed in the nucleus and mitochondria. The nuclear
location may be associated with an interaction between
eEF1A and the transcription factor ZPR1 (Gangwani et al.
1998). A1, A3, and A4 have also been located at the plasma
membrane, and may function in activation of PI4-Kinase
(Yang et al. 1993) or interaction with microtubules (Dj
et al. 1990) closely associated in the region. The A1 and A2
proteins were also localized to the vacuole.
To date, Arabidopsis is the only plant with several puta-
tive gene models for each of the four-eEF1A loci. Little is
known regarding the functions of individual eEF1A pro-
teins or the proposed splice variants. A1, A2.1, A3.1, and
A4.1 produce an identical protein with 449 amino acids.
A2.2 and A4.2 gene models suggest a role for the formation
of truncated proteins. The A2.2 gene model has a deletion
in the second exon, but still maintains the C-terminal actin/
microtubule binding region. Two amino acids, 294N and
319D, considered necessary for actin binding but upstream
of the actin binding domain, are part of the deleted region
(Gross and Kinzy 2005). The absence of this region may
limit A2.2 function to protein synthesis but not actin bind-
ing. The A4.2 gene model predicts a protein missing part of
the second exon and a loss of the C-terminal removing the
actin and microtubule binding domains but leaving the GTP
and tRNA regions intact for protein synthesis. In yeast,
Gross and Kinzy (2005 and Gross and Kinzy (2007) dem-
onstrated that the last 31 amino acids are necessary for
proper actin formation. Point mutations N305S, N329S and
F422A are also important for binding actin (Gross and
Kinzy 2005; Gross and Kinzy 2007). Loss of the actin-
binding domain aVects the ability of the protein to bind
actin, but protein translation remains stable.
In conclusion, we demonstrated that the eEF1A Gene
Family was expressed in all A. thaliana tissues. Compari-
son of eEF1A expression in Arabidopsis, rice and maize
showed that expression in plants is diVerent from tissue
speciWc expression observed in animals. The relative
404 Mol Genet Genomics (2009) 281:391405
1 3
abundance of the total eEF1A message was diVerent in
each tissue examined. Further examination of A1, A2, A3,
and A4 expression using Q real time RT-PCR showed
each gene was expressed in all tissues but at diVerent
levels. Analysis of individual eEF1A gene expression
revealed that A4 had the highest expression in germinating
seeds and in leaves. A2 has the second highest expression
in germinating seeds and the highest expression in roots.
The A2 message abundance appeared to be sensitive to
abiotic stress and decreased in response to darkness and
increased in response to cold treatment. The results indi-
cated that all eEF1A genes had a unique expression pattern
regulated diVerently by a variety of stimuli. In addition,
one to three alternative gene models have been proposed
for each gene that would produce diVerent proteins with
varied functions. The combination of diVerential expres-
sion of the four genes and alternative splice variants for
each protein suggest each gene and the resulting protein
have a unique role in the cell in performing nontransla-
tional functions. Furthermore, knocking out expression of
the A2 gene product produced a short root phenotype sim-
ilar to actin mutants in Arabidopsis. Future work will
investigate changes in A2 message abundance in response
to various abiotic stresses and the short root phenotype and
its connection with actin in an eVort to understand the role
of protein synthesis and other eEF1A nontranslational
functions.
Acknowledgments I would like to thank Dr. Todd Barkman for
sequencing the PCR products; and Dr. Charles Ide and Dr. Anna Jelaso
for use of the Primer Express Software and assistance in the cDNA
microarray analysis. This work was supported by The College of Arts
and Sciences, Western Michigan University to W.R.H.
References
Aguilar F, Montandon PE, Stutz E (1991) Two genes encoding the soy-
bean translation elongation factor eef-1 alpha are transcribed in
seedling leaves. Plant Mol Biol 17(3):351360
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P,
Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrinab C,
Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L,
Ansari Y, Choy N, Deen H, Geralt M, Hazari N, Hom E, Karnes
M, Mulholland C, Ndubaku R, Schmidt I, Guzman P, Aguilar-
Henonin L, Schmid M, Weigel D, Carter DE, Marchand T,
Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, Ecker
JR (2003) Genome-wide insertional mutagenesis of Arabidopsis
thaliana. Science 301(5633):653657
Andersen GR, Nissen P, Nyborg J (2003) Elongation factors in protein
biosynthesis. Trends Biochem Sci 28(8):434441
Auriac MC, Timmers AC (2007) Nodulation studies in the model
legume Medicago truncatula: advantages of using the constitu-
tive ef1alpha promoter and limitations in detecting Xuorescent
reporter proteins in nodule tissues. Mol Plant Microbe Interact
20(9):10401047
Axelos M, Bardet C, Liboz T, Le Van Thai A, Curie C, Lescure B
(1989) The gene family encoding the Arabidopsis thaliana trans-
lation elongation factor ef-1 alpha: molecular cloning, character-
ization and expression. Mol Gen Genet 219(12):106112
Berberich T, Sugawara K, Harada M, Kusano T (1995) Molecular
cloning, characterization and expression of an elongation factor 1
alpha gene in maize. Plant Mol Biol 29(3):611615
Calikowski TT, Meulia T, Meier I (2003) A proteomic study of the
Arabidopsis nuclear matrix. J Cell Biochem 90(2):361378
Carneiro NP, Hughes PA, Larkins BA (1999) The eef1a gene family is
diVerentially expressed in maize endosperm. Plant Mol Biol
41(6):801813
Chang YW, Traugh JA (1998) Insulin stimulation of phosphorylation
of elongation factor 1 (eef-1) enhances elongation activity. Eur
J Biochem 251(12):201207
Clore AM, DannenhoVer JM, Larkins BA (1996) Ef-1[alpha] is asso-
ciated with a cytoskeletal network surrounding protein bodies in
maize endosperm cells. Plant Cell 8(11):20032014
Demma M, Warren V, Hock R, Dharmawardhane S, Condeelis J
(1990) Isolation of an abundant 50, 000-dalton actin Wlament
bundling protein from dictyostelium amoebae. J Biol Chem
264:2051820525
Dj MK, Mazabraud A, Viel A, le Maire M, Denis H, Crawford E,
Brown DD (1990) Three genes under diVerent developmental
control encode elongation factor 1-alpha in Xenopus laevis.
Nucleic Acids Res 18(12):34893493
Dunn MA, Morris A, Jack PL, Hughes MA (1993) A low-temperature-
responsive translation elongation factor 1 alpha from barley
(Hordeum vulgare l.). Plant Mol Biol 23(1):221225
Ejiri S (2002) Moonlighting functions of polypeptide elongation factor
1: from actin bundling to zinc Wnger protein r1-associated nuclear
localization. Biosci Biotechnol Biochem 66(1):121
Gangwani L, Mikrut M, Galcheva-Gargova Z, Davis RJ (1998).
Interaction of zpr1 with translation elongation factor-1alpha in
proliferating cells. doi:10.1083/jcb.143.6.1471. J Cell Biol
143(6):14711484
Gilliland LU, Kandasamy MK, Pawloski LC, Meagher RB (2002)
Both vegetative and reproductive actin isovariants complement
the stunted root hair phenotype of the Arabidopsis act2-1 muta-
tion. Plant Physiol 130(4):21992209
Gilliland LU, Pawloski LC, Kandasamy MK, Meagher RB (2003)
Arabidopsis actin gene act7 plays an essential role in germination
and root growth. Plant J 33(2):319328
Gonen H, Smith CE, Siegel NR, Kahana C, Merrick WC, Chakraburtty
K, Schwartz AL, Ciechanover A (1994) Protein synthesis
elongation factor ef-1 alpha is essential for ubiquitin-dependent
degradation of certain n alpha-acetylated proteins and may be
substituted for by the bacterial elongation factor ef-tu. Proc Natl
Acad Sci USA 91(16):76487652
Gross SR, Kinzy TG (2005) Translation elongation factor 1a is essen-
tial for regulation of the actin cytoskeleton and cell morphology.
Nat Struct Mol Biol 12(9):772778
Gross SR, Kinzy TG (2007) Improper organization of the actin cyto-
skeleton aVects protein synthesis at initiation. Mol Cell Biol
27(5):19741989
Heazlewood JL, Tonti-Filippini JS, Gout AM, Day DA, Whelan J,
Millar AH (2004) Experimental analysis of the Arabidopsis
mitochondrial proteome highlights signaling and regulatory com-
ponents, provides assessment of targeting prediction programs,
and indicates plant-speciWc mitochondrial proteins. Plant Cell
16(1):241256
Heazlewood JL, Tonti-Filippini J, Verboom RE, Millar AH (2005)
Combining experimental and predicted datasets for determination
of the subcellular location of proteins in Arabidopsis. Plant Physiol
139(2):598609
Heazlewood JL, Verboom RE, Tonti-Filippini J, Small I, Millar AH
(2007) Suba: the Arabidopsis subcellular database. Nucleic Acids
Res 35(Database issue): D2138
Mol Genet Genomics (2009) 281:391405 405
1 3
Holmes-Davis R, Tanaka CK, Vensel WH, Hurkman WJ, McCormick S
(2005) Proteome mapping of mature pollen of Arabidopsis
thaliana. Proteomics 5(18):48644884
Izawa T, Fukata Y, Kimura T, Iwamatsa A, Dohi K, Kaibuchi K (2000)
Elongation factor-1 is a novel substrate of rho associated kinase.
Biochim Biophys Res Comm 278:7278
Jaquinod M, Villiers F, KieVer-Jaquinod S, Hugouvieux V, Bruley C,
Garin J, Bourguignon J (2007) A proteomics dissection of
Arabidopsis thaliana vacuoles isolated from cell culture. Mol
Cell Proteomics 6(3):394412
Kahns S, Lund A, Kristensen P, Knudsen CR, Clark BF, Cavallius J,
Merrick WC (1998) The elongation factor 1 a-2 isoform from
rabbit: cloning of the cdna and characterization of the protein.
Nucleic Acids Res 26(8):18841890
Kandl KA, Munshi R, Ortiz PA, Andersen GR, Kinzy TG, Adams AE
(2002) IdentiWcation of a role for actin in translational Wdelity in
yeast. Mol Genet Genomics 268(1):1018
Kaur KJ, Ruben L (1994) Protein translation elongation factor-1 alpha
from Trypanosoma brucei binds calmodulin. J Biol Chem
269(37):2304523050
Kawahara R, Sunabori S, Fukuda H, Komamine A (1992) A gene
expressed preferentially in the globular stage of somatic embryo-
genesis encodes elongation-factor 1 in carrot. Eur J Biochem
209:157162
Kidou S, Ejiri S (1998) Isolation, characterization and mRNA expres-
sion of four cDNAs encoding translation elongation factor 1a
from rice (Oryza sativa l.). Plant Mol Biol 36(1):137148
KleVmann T, Russenberger D, von Zychlinski A, Christopher W,
Sjlander K, Gruissem W, Baginsky S (2004) The Arabidopsis
thaliana chloroplast proteome reveals pathway abundance and
novel protein functions. Curr Biol 14(5):354362
Knudsen SM, Frydenberg J, Clark BFC, LeVers H (1993) Tissue-depen-
dent variation in the expression of elongation facor-1 isoforms:
isolation and characterization of a cdna encoding a novel variant of
human elongation-factor 1. Eur J Biochem 215:549554
Lopez-Valenzuela JA, Gibbon BC, Hughes PA, Dreher TW, Larkins
BA (2003) Eef1a isoforms change in abundance and actin-bind-
ing activity during maize endosperm development. Plant Physiol
133(3):12851295
Marmagne A, Rouet MA, Ferro M, Rolland N, Alcon C, Joyard J,
Garin J, Barbier-Brygoo H, Ephritikhine G (2004) IdentiWcation
of new intrinsic proteins in Arabidopsis plasma membrane prote-
ome. Mol Cell Proteomics 3(7):675691
Martina Schad MSL, Giavalisco P, Smith RD, Kehr J (2005) Evalua-
tion of two-dimensional electrophoresis and liquid chromatogra-
phytandem mass spectrometry for tissue-speciWc protein
proWling of laser-microdissected plant samples. Electrophoresis
26(14):27292738
Morelli JK, Shewmaker CK, Vayda ME (1994) Biphasic stimulation
of translational activity correlates with induction of translation
elongation factor 1 subunit alpha upon wounding in potato tubers.
Plant Physiol 106(3):897903
Munshi R, Kandl KA, Carr-Schmid A, Whitacre JL, Adams AE, Kinzy
TG (2001) Overexpression of translation elongation factor 1a
aVects the organization and function of the actin cytoskeleton in
yeast. Genetics 157(4):14251436
Negrutskii BS, Elskaya AV (1998) Eukaryotic translation elongation
factor 1 alpha: structure, expression, functions, and possible role
in aminoacyl-tRNA channeling. Prog Nucleic Acid Res Mol Biol
60:4778
Nishimura T, Yokota E, Wada T, Shimmen T, Okada K (2003) An
Arabidopsis act2 dominant-negative mutation, which disturbs
f-actin polymerization, reveals its distinctive function in root
development. Plant Cell Physiol 44(11):11101131
Noir S, Brutigam A, Colby T, Schmidt J, Panstruga R (2005) A refer-
ence map of the Arabidopsis thaliana mature pollen proteome.
Biochem Biophys Res Comm 337(4):12571266
Ohta K, Toriyama M, Miyazaki M, Murofushi H, Hosoda S, Endo S,
Sakai H (1990) The mitotic apparatus-associated 51-kda protein
from sea urchin eggs is a gtp-binding protein and is immunologi-
cally related to yeast polypeptide elongation factor 1 alpha. J Biol
Chem 265(6):32403247
Pennisi E (2000) Sequence. Plants join the genome sequencing band-
wagon. Science 290(5499):20542055
Pokalsky AR, Hiatt WR, Ridge N, Rasmussen R, Houck CM,
Shewmaker CK (1989) Structure and expression of elongation
factor 1 alpha in tomato. Nucleic Acids Res 17(12):46614673
Rao D, Momcilovic I, Kobayashi S, Callegari E, Ristic Z (2004) Chap-
erone activity of recombinant maize chloroplast protein synthesis
elongation factor, ef-tu. Eur J Biochem 271(18):36843692
Reddy VS, Ali GS, Reddy AS (2002) Genes encoding calmodulin-
binding proteins in the Arabidopsis genome. J Biol Chem
277(12):98409852
Sun Y, Carneiro N, Clore AM, Moro GL, Habben JE, Larkins BA
(1997) Characterization of maize elongation factor 1a and its rela-
tionship to protein quality in the endosperm. Plant Physiol
115(3):11011107
Toueille M, Saint-Jean B, Castroviejo M, Benedetto JP (2007) The
elongation factor 1a: a novel regulator in the DNA replication/
repair protein network in wheat cells? Plant Physiol Biochem
45(2):113118
Umikawa M, Tanaka K, Kamei T, Shimizu K, Imamura H, Sasaki T,
Takai Y (1998) Interaction of rho1p target bni1p with f-actin-
binding elongation factor 1alpha: implication in rho1p-regulated
reorganization of the actin cytoskeleton in Saccharomyces cerevi-
siae. Oncogene 16(15):20112016
Ursin VM, Irvine JM, Hiatt WR, Shewmaker CK (1991) Developmen-
tal analysis of elongation factor-1 alpha expression in transgenic
tobacco. Plant Cell 3(6):583591
Vayda ME, Shewmaker CK, Morelli JK (1995) Translational arrest in
hypoxic potato tubers is correlated with the aberrant association
of elongation factor ef-1 alpha with polysomes. Plant Mol Biol
28(4):751757
Wertman KF, Drubin DG, Botstein D (1992) Systematic mutational
analysis of the yeast act1 gene. Genetics 132(2):337350
Wolfram G, Brenner GAR, Kllmer I, Lukas B, Thomas S (2005)
Immediate-early and delayed cytokinin response genes of Arabid-
opsis thaliana identiWed by genome-wide expression proWling
reveal novel cytokinin-sensitive processes and suggest cytokinin
action through transcriptional cascades. Plant J 44(2):314333
Yang W, Boss WF (1994) Regulation of phosphatidylinositol 4-kinase
by the protein activator pik-a49. Activation requires phosphoryla-
tion of pik-a49. J Biol Chem 269(5):38523857
Yang W, Burkhart W, Cavallius J, Merrick WC, Boss WF (1993) Puri-
Wcation and characterization of a phosphatidylinositol 4-kinase
activator in carrot cells. J Biol Chem 268(1):392398
Zimmermann P, Hirsch-HoVmann M, Hennig L, Gruissem W (2004)
Genevestigator. Arabidopsis microarray database and analysis
toolbox. doi:10.1104/pp.104.046367. Plant Physiol 136(1):2621
2632