Fish & Shellfish Immunology 26 (2009) 898–907

Contents lists available at ScienceDirect

Fish & Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

Identification of centrarchid hepcidins and evidence that 17b-estradiol

disrupts constitutive expression of hepcidin-1 and inducible expression
of hepcidin-2 in largemouth bass (Micropterus salmoides)q
Laura S. Robertson*, Luke R. Iwanowicz, Jamie Marie Marranca
Leetown Science Center, U.S. Geological Survey, 11649 Leetown Road, Kearneysville, WV 25430, USA

a r t i c l e i n f o a b s t r a c t

Article history: Hepcidin is a highly conserved antimicrobial peptide and iron-regulatory hormone. Here, we identify
Received 21 October 2008 two hepcidin genes (hep-1 and hep-2) in largemouth bass (Micropterus salmoides) and smallmouth bass
Received in revised form (Micropterus dolomieu). Hepcidin-1 contains a putative ATCUN metal-binding site in the amino-terminus
25 March 2009
that is missing in hepcidin-2, suggesting that hepcidin-1 may function as an iron-regulatory hormone.
Accepted 30 March 2009
Both hepcidins are predominately expressed in the liver of largemouth bass, similar to other fish and
Available online 17 April 2009
mammals. Experimental exposure of pond-raised largemouth bass to 17b-estradiol and/or the bacteria
Edwardsiella ictaluri led to distinct changes in expression of hep-1 and hep-2. Estradiol reduced the
Keywords:
Innate immunity constitutive expression of hep-1 in the liver. Bacterial exposure induced expression of hep-2, suggesting
Antimicrobial peptide that hepcidin-2 may have an antimicrobial function, and this induction was abolished by estradiol. To our
Hepcidin knowledge, this is the first report of the regulation of hepcidin expression by estradiol in either fish or
Fish mammals.
Largemouth bass Published by Elsevier Ltd.
Smallmouth bass
Estrogen
Estradiol
Real-time PCR

1. Introduction presence of EEDCs or other chemicals, has been suggested [10,11].

During the last decade there has been increasing awareness and
concern regarding endocrine disrupting chemicals (EDCs) [1].
These chemicals are virtually ubiquitous and have been identified
in aquatic ecosystems around the world [2–5]. Of particular interest
are estrogenic endocrine disrupting chemicals (EEDCs), which have
been shown to modulate immune responses in addition to repro-
ductive physiology [6–9]. In recent years, fish kills and fish lesions
have occurred concurrent with a high prevalence of intersex in the
Potomac and Shenandoah Rivers [10,11]. These fish kills primarily
involve centrarchids and a number of opportunistic bacteria, fungi,
and parasites have been isolated or observed in affected fish. Given
that no single pathogen appears to be associated with these fish
kills, a general suppression in immune function, perhaps due to the
q GenBank accession numbers: Micropterus salmoides hep-1: EU502749,
EU502754; Micropterus salmoides hep-2: EU502750, EU502755; Micropterus dolo-
mieu hep-1: EU502751, EU502756; Micropterus dolomieu hep-2: EU502752,
EU502756; Micropterus dolomieu 18S: EU502753.
* Corresponding author. Tel.: þ1 304 724 4579; fax: þ1 304 724 4465.
E-mail address: lrobertson@usgs.gov (L.S. Robertson).
Impairment of the acute phase protein response due to putative
exposure to EEDCs has not been examined in these fish.
Hepcidin is a small, cationic, disulphide-bonded peptide and
a type II acute phase protein that has a critical functional role as an
iron-regulatory hormone [12,13]. It was first identified in human
urine and plasma [14,15] and has since been identified in other
mammals, including mice and pigs. While originally described as an
antimicrobial molecule that exhibits antibacterial and antifungal
activity in vitro (Liver-Expressed Antimicrobial Protein; LEAP-1)
[14,15], the in vivo antimicrobial function of hepcidin is not clear. It is
possible that hepcidin acts as an antimicrobial peptide in macro-
phages: hepcidin localizes to the phagosome of mouse macrophages
infected with mycobacteria and exhibits antimycobacterial activity
in vitro [16].
Hepcidin is instrumental in the normal homeostatic regulation
of iron levels in humans. This is clinically evident as hepcidin
mutations are often associated with juvenile hemochromatosis,
a condition in which there is a severe overload of iron in the liver
and heart [17]. In addition, hepcidin is involved in the anemia
of inflammation [12], in which iron sequestration purportedly
increases resistance to microbial infection [18]. In its role as an

1050-4648/$ – see front matter Published by Elsevier Ltd.

doi:10.1016/j.fsi.2009.03.023
 L.S. Robertson et al. / Fish & Shellfish Immunology 26 (2009) 898–907 899

iron-regulatory hormone, hepcidin binds to the iron transporter collected from the South Branch of the Potomac River via electro-
ferroportin and induces internalization and degradation of ferro- shocking by West Virginia Division of Natural Resources biologists
portin [19]. Ferroportin is expressed in the small intestine, in and transported to the Leetown Science Center, Leetown, WV. Fish
hepatocytes, and in macrophages. Hepcidin-mediated degradation were maintained in 150 L black, circular tanks supplied with two
of ferroportin blocks uptake of iron from the intestine and release complete changes of aerated, 20  C spring water daily. Fish were fed
of stored iron from macrophages [19,20], thus decreasing the live fathead minnows every four days. Animal research protocol
abundance of available iron. was approved by the Leetown Science Center Institutional Animal
Hepcidin is primarily expressed in the liver [14,15] and its Care and Use Committee (IACUC).
expression is induced by infection [12], inflammation [21], and
excess iron [22]. Expression of hepcidin is stimulated by inter-
2.2. Gene identification
leukin-6 [23] and interleukin-1 [24]. Regulation of hepcidin
expression by estrogen has not yet been reported, but expression of
Primers used for sequencing are listed in Table 1 and described
interleukin-6, which stimulates hepcidin expression, is inhibited by
below. Genomic DNA was extracted from largemouth bass and
estrogen [25]. Macrophages and neutrophils, but not hepatocytes,
smallmouth bass liver tissue using a DNeasy Blood & Tissue Kit
produce hepcidin in response to bacterial exposure in a TLR4-
(Qiagen). RNA was extracted from the liver tissue of largemouth bass
dependent fashion [26]. TLR4 is a toll-like receptor that is known to
and smallmouth bass exposed to estradiol using RNeasy Mini Kits
recognize lipopolysaccharides (LPS) in association with MD-2 in
humans and mice. (Qiagen) and transcribed into cDNA using Taqman Reverse Tran-
scription Reagents (Applied Biosystems). 50 and 30 end sequences
Hepcidins have been identified in several species of fish,
were determined using the First Choice RLM RACE kit (Ambion),
including hybrid striped bass [27], winter flounder and Atlantic
according to kit instructions for 50 and 30 RACE (Rapid Amplification
salmon [28], zebrafish [29], Japanese flounder [30,31], red sea bream
of cDNA Ends) and using the gene-specific primers described below
[32], channel catfish [33], and sea bass [34]. The structure and
and in Table 1. For sequencing, PCR products were cloned using
sequence of hepcidin genes are conserved between mammals
a TOPO TA cloning kit (Invitrogen); bacterial colonies were lysed,
and fish. Genes that encode this peptide consist of three exons and
cellular debris pelleted, and plasmid inserts amplified using
two introns, and are predicted to encode preproproteins with
M13forward and M13reverse primers according to Estoup & Turgeon
a signal peptide and acidic propiece that are cleaved to form the
[43]; PCR products were labeled using the BigDye Terminator Cycle
mature peptide. Fish hepcidins are predominantly expressed in the
Sequencing Kit v. 3.1 (Applied Biosystems); cycle sequencing prod-
liver, similar to mammalian hepcidins, but are also detected in other
ucts were cleaned using CleanSeq (Agencourt); cleaned products
tissues [27–29,31–34]. Several fish species encode multiple distinct
were sequenced on an ABI3130 (Applied Biosystems).
hepcidin genes that display differential tissue expression [28–30]. In
Hepcidin gene sequences available in GenBank were aligned to
fish, expression of hepcidin is induced by bacterial infection; struc-
identify conserved sequence regions. Forward primers LRO-001
tural components of bacteria, e.g. lipopolysaccharides; and polyI:C
and LRO-002 and reverse primer LRO-003 were used to amplify
(a double-stranded RNA molecule) [27,28,30,34–39]. Synthetic fish
conserved hepcidin regions from smallmouth bass cDNA; two
hepcidin peptides have been shown to be bactericidal and fungicidal
distinct hepcidin genes (hep-1 and hep-2) were identified.
in vitro [36,38]. Expression of hepcidin is also regulated by iron. In
sea bass, expression is stimulated by iron overloading [34], while
in Japanese flounder, expression of one hepcidin appears to be
Table 1
inhibited in the liver and expression of another hepcidin appears to Primers used for sequencing hep-1 and hep-2 from largemouth bass and smallmouth
be stimulated in kidney in response to iron overloading [30]. In bass and 18S from smallmouth bass and primers used for real-time PCR expression
zebrafish, hepcidin expression is reduced by anemia and induced by analysis in largemouth bass.
high levels of iron [40]. Hepcidin expression is also reduced by Gene Primer Sequence (50 – 30 )
anemia in catfish [41] and by hypoxia in goby fish [42].
hep-1, sequencing LRO-001 ATTCAGTGTTGCAGTTGCAGTGGC
Here, we identify two distinct hepcidin genes (hep-1 and hep-2) LRO-003 TCAGAACCTGCAGCAGATACCACA
in both largemouth bass (Micropterus salmoides) and the closely LRO-009 ATTCTGGAGAGCTCTGCCGTCCCATT
related smallmouth bass (Micropterus dolomieu). We show that both LRO-010 TCAGAACCTGCAGCAGATACCACA
LRO-011 AAGGAGAGGTGGCTTTGACGCTT
hep-1 and hep-2 are primarily expressed in the liver of largemouth
LRO-046 GTGGTGCTCTTTTGGTGGCCTG
bass. Constitutive expression of hep-1 is downregulated by the sex LRO-073 TCACATCAGGCAGAAGCGTCA
steroid 17b-estradiol (E2). Hep-2 expression is induced by bacterial LRO-074 TGTGCCGCTGGTGCTGCAACT
exposure and this induction is blocked by estradiol. In the spleen of hep-1, real-time PCR forward CATTCACCGGGGTGCAA
largemouth bass, expression of hep-1 and hep-2 are not affected by reverse CCTGATGTGATTTGGCATCATC
hep-2, sequencing LRO-002 TGGCCGTCGTGCTCACCTTTATTT
estradiol; however, bacterial exposure induced hep-1 expression
LRO-003 TCAGAACCTGCAGCAGATACCACA
and reduced hep-2 expression in largemouth bass spleens. This work LRO-010 TCAGAACCTGCAGCAGATACCACA
is the first demonstration of the regulation of hepcidin expression LRO-012 AGAGCTCCGCTGTCCCAGTCA
by physiological concentrations of estradiol and suggests that envi- LRO-013 ACATTTAATGCCGCGCTCCTGTCT
ronmental estrogenic endocrine disrupting chemicals (EEDCs) may LRO-043 CTGGAAGATGCCATATAACAAC
LRO-048 AGACAGGAGAACTCAGAGGAGC
also modulate hepcidin. LRO-073 TCACATCAGGCAGAAGCGTCA
LRO-076 CTTTTGCTGTGGCTGCTGCAC
2. Materials and methods LRO-082 ATCCTGGAAGATGCCATATA
LRO-129 CATGTGGATGACGTGGTCAC
LRO-130 GACAGTAGGTGGTAAAACTGC
2.1. Laboratory fish care
hep-2, real-time PCR forward TCAGTGGAATCCTGGAAGATGC
reverse ACAGCAAAAGCGACATTTAATGC
Six-month-old largemouth bass (n ¼ 30) raised in facility ponds 18S, sequencing LRO-018 CAAGACGGACGAAAGCGAAAGCAT
at the Leetown Science Center were acclimatized to experimental LRO-019 TCCCTTTAAGAAGTTGGACGCCGA
research tanks for three weeks before experimental exposures. 18S, real-time PCR forward GCAAAGCTGAAACTTAAAGGAATTG
reverse TCCCGTGTTGAGTCAAATTAAGC
Smallmouth bass, approximately one-to-two years old, were
900 L.S. Robertson et al. / Fish & Shellfish Immunology 26 (2009) 898–907
A partial fragment of smallmouth bass hep-1 was amplified
with primers LRO-001 and LRO-003. LRO-011 was used as the
gene-specific primer for 50 RACE and LRO-074 as the gene-specific
primer for 30 RACE. Genomic DNA was amplified with the primers
LRO-009 and LRO-011 and cDNA was amplified with the primers
LRO-046 and LRO-010 for sequencing.
A partial fragment of smallmouth bass hep-2 was amplified with
primers LRO-002 and LRO-003. LRO-013 was used as the gene-
specific primer for 50 RACE. Genomic DNA was amplified with
primers LRO-012 and LRO-013 and cDNA was amplified with primers
LRO-048 and LRO-010 for sequencing. Attempts to sequence the 30
end of smallmouth bass hep-2 using 30 RACE were unsuccessful.
Instead, the 30 end was amplified from smallmouth bass liver cDNA
using the primers LRO-043 and LRO-129, then amplified from this
first PCR product using the primers LRO-076 and LRO-130 and
sequenced; LRO-129 and LRO-130 were designed from the 30 end of
the largemouth bass hep-2 sequence.
Largemouth bass hep-1 was amplified from genomic DNA using
primers LRO-009 and LRO-011 and amplified from both genomic
DNA and cDNA using primers LRO-046 and LRO-010. LRO-073 was
used as the gene-specific primer for 30 RACE.
Largemouth bass hep-2 was amplified from genomic DNA using
primers LRO-012 and LRO-013 and amplified from both genomic
DNA and cDNA using LRO-048 as the forward primer and using
LRO-010 and LRO-013 as reverse primers. LRO-073 and LRO-082
were used as gene-specific primers for 30 RACE.
A partial 18S gene fragment was amplified from smallmouth
bass using LRO-018 and LRO-019 and sequenced.
2.3. Sequence analysis
Hepcidin protein sequences from GenBank were aligned with
ClustalX v1.83 [44] as unprocessed preproproteins or post-
translationally processed mature peptides. Mature peptides were
predicted in silico assuming cleavage following (R/K)X(R/K)R or
RXXR sequences [45] unless existing literature suggested other-
wise. Phylogenetic analyses included hepcidin sequences from
Homo sapiens (NP_066998), M. dolomieu (this paper: ACD13025,
ACD13026) and M. salmoides (this paper: ACD13023, ACD13024),
and published or RefSeq teleost hepcidin sequences from Gen-
bank (n ¼ 35): Acanthopagrus schlegelii (AAU00801, AAU00795,
AAU00796, AAU00797, AAU00798, AAU00799, AAU00800) [46],
Danio rerio (NP_991146, AAR18592, AAR18593, Q7T273) [29],
Dicentrarchus labrax (AAZ85124) [34], Gadus morhua (ACA42769,
ACA42770) [47], Ictalurus furcatus (AAX39714) [33], Ictalurus
punctatus (AAX39713, AAY59889) [33,35], Lateolabrax japonicus
(AAT09138) [48], Morone chrysops (AAM28439) [27], M.
chrysops  Morone saxatilis (P82951) [27], Oncorhynchus mykiss
(AAG30029) [49], Oplegnathus fasciatus (ACF49394, ACF49395,
ACF49396, ACF49397) [50], Pagrus major (AAR28076) [32], Para-
lichthys olivaceus (AAT01563, AAT01564) [31], Salmo salar (NP_00
1134321, AAO85553) [28], Scophthalmus maximus (AAX92670)
[51], and Sparus aurata (CAO78619, ABV01929, ABV01931, ABV
01932) [52–54]. Bayesian inference of phylogeny was determined
using Mr. Bayes 3.1.2 software [55,56]. Parameters for the
Bayesian analysis included 1,000,000 generations of Markov
Chain Monte Carlo sampling sampled once every 100 generations
with H. sapiens hepcidin set as an outgroup. Model jumping
between fixed-rate amino acid substitution models was imple-
mented for the analysis. A consensus phylogram was constructed
based on the trees sampled in the asymptotic phase of the
Bayesian analysis (burnin ¼ 2500, credible trees sampled ¼
12,794); branch nodes were supported by posterior probability
(PP) values.
Biochemical properties of largemouth and smallmouth bass
mature hepcidin peptides were evaluated using the ProtParam tool
(http://ca.expasy.org/tools/protparam.html).
2.4. Largemouth bass estradiol injection and bacterial exposure
After acclimation to laboratory conditions, largemouth bass (30
fish) were divided into three estradiol exposure groups: estradiol
injection (12 fish), vehicle-injection control (12 fish), and no-injec-
tion (6 fish). Fish were anesthetized in 100 ppm of tricaine meth-
anesulfonate (MS-222; Argent Chemical Laboratories, Inc.), then
injected with 5 mg 17-beta estradiol in corn oil per kg fish (estradiol
group), corn oil (vehicle control), or not injected. Fish were main-
tained in the laboratory for forty-eight hours after injection before
bacterial exposure. Fish from each estradiol exposure group were
transferred to 5 gallon buckets containing either 15 L tank water
with no bacteria or 15 L tank water with 5  106 CFU of Edwardsiella
ictaluri (NFHRL; E02-2004; [57]) per liter for 30 min, then returned
to their tanks. Half of the fish from each of the two injection groups
were exposed to bacteria, half were not. The no-injection control fish
were not exposed to bacteria. Forty-eight hours post-bacterial
exposure, all fish were euthanized with a lethal dose of MS-222, and
then dissected. Liver, gill, spleen, anterior kidney, and posterior
kidney tissue samples were preserved in RNAlater (Ambion),
then frozen. All fish survived throughout the experiment. The
no-injection control groups were used for the measurement of hep-1
and hep-2 expression in different tissues. The vehicle-injected
control groups were used as controls for the estradiol and/or
bacterial exposure experiment.
2.5. Measurement of plasma estradiol
Approximately 500 ml of blood was collected from each fish
via the caudal vessel using a 1 cc syringe preloaded with 200 U
of sodium heparin. Whole blood from each fish was transferred
to a heparinized vacutainer containing 68 U of sodium heparin
and centrifuged at 500  g for 15 min at 4  C. The plasma was
removed and stored at 80  C prior to hormone extraction.
Plasma samples were extracted twice in a ten-fold excess of
diethyl ether prior to radio immune assay (RIA). Plasma estradiol
concentrations were determined using the RIA method of Sower
and Schreck [58] with slight modifications. Samples and estra-
diol standards were solubilized in 200 ml of room temperature
PG buffer (0.1% knox gelatin in Dulbecco’s phosphate buffered
saline). 100 ml of anti-estradiol antiserum (17B-estradiol Ab
(#244 anti-estradiol-6-BSA) purchased from Gordon Niswender,
Colorado State University, Fort Collins, CO; diluted 1:65 000 in
PG buffer) was added to the samples, samples were mixed
vigorously, and then samples were incubated at room temper-
ature for 30 min. 100 ml PG buffer was added to control tubes to
determine non-specific background and total counts per minute
(CPM). Following incubation, 100 ml of tritiated 17b-estradiol
(5000 CPM in PG buffer) was added to all tubes, samples were
mixed vigorously, and then samples were incubated at room
temperature for 60 min. Samples were cooled in an ice bath for
30 min and 500 ml of ice-cold charcoal-dextran solution (0.63%
alkaline charcoal and 0.4% dextran in PG buffer) was added.
Samples were mixed vigorously, incubated on ice for 15 min, and
centrifuged at 2200  g for 20 min at 4  C. Supernatant was then
decanted into scintillation vials containing 4 ml of OptiPhase
HiSafe 2 scintillation fluid (Perkin Elmer) and mixed well.
Sample CPM were measured using a Tri Carb Liquid Scintillation
Counter (Perkin Elmer) and mean sample CPM was determined
over an 8 min integration time. All samples were run in dupli-
cate and plasma estradiol values were extrapolated from
 L.S. Robertson et al. / Fish & Shellfish Immunology 26 (2009) 898–907 901

a standard curve. Sample values were rejected and re-evaluated
if the coefficient of variation between duplicate tubes exceeded
10%. Statistical analyses were done using GraphPad Prism 5
(GraphPad Software).
2.6. RNA isolation and measurement of gene expression by
real-time PCR
Total RNA was extracted from tissue samples preserved in RNA-
later (Ambion) using RNeasy kits (Qiagen) according to manufac-
turer instructions; all samples were treated with RNase-free DNase
(Qiagen). The quality of a subset of samples was determined using
a 2100 Bioanalyzer (Agilent Technologies). RNA was reverse tran-
scribed using Taqman Reverse Transcription Reagents (Applied
Biosystems). Primers for real-time PCR were designed using Primer
Express (Applied Biosystems). Real-time PCR was performed on an
ABI7900HT using the Power SYBR green kit (Applied Biosystems). All
real-time PCR reactions (target gene and control gene) were done in
triplicate. When possible, primers for real-time PCR were designed
across exon–intron borders to avoid amplification of genomic DNA.
Primers used in real-time PCR are listed in Table 1. Mean expression
of target gene normalized to mean expression of a validated
reference gene (18S) is reported. Results were analyzed by ANOVA
followed by Tukey post hoc pairwise comparisons. Statistical anal-
yses were done using GraphPad Prism 5 (GraphPad Software).
3. Results
3.1. Largemouth bass and smallmouth bass hepcidin-1 and
hepcidin-2 sequences
Forward primers (LRO-001 and LRO-002) designed to the signal
peptide and a reverse primer (LRO-003) designed to the mature
peptide were used to amplify hepcidin from smallmouth bass liver
cDNA. Partial sequences from two distinct hepcidin genes (hep-1
and hep-2) were identified. cDNA and genomic DNA for hep-1 and
hep-2 were sequenced from both smallmouth bass and the closely
related species, largemouth bass (GenBank accession numbers:
M. salmoides hep-1: EU502749, EU502754; M. salmoides hep-2:
EU502750, EU502755; M. dolomieu hep-1: EU502751, EU502756;
M. dolomieu hep-2: EU502752, EU502756).
The largemouth bass hep-1 cDNA contained a partial 50 -UTR of
18 bp, a 273 bp open reading frame, and a 66 bp 30 -UTR. The
smallmouth bass hep-1 cDNA contained a 214 bp 50 -untranslated
region (UTR), a 273 bp open reading frame that encodes a putative
91 amino acid protein, and a 348 bp 30 -UTR. A typical poly-
adenylation signal (AATAAA) is located 17 bp upstream of the poly
(A)þ tail. Both hep-1 genes consisted of three exons and two introns;
the location of the introns was conserved between largemouth and
smallmouth bass.
The largemouth bass hep-2 cDNA contained a 61 bp 50 -UTR,
a 261 bp open reading frame predicted to encode an 87 amino acid
protein, and a 225 bp 30 -UTR with a polyadenylation signal
(AATAAA) 13 bp upstream of the poly(A)þ tail. The smallmouth bass
hep-2 cDNA contained an 87 bp 50 -UTR, a 261 bp open reading
frame predicted to encode an 87 amino acid protein, and an
incomplete 30 -UTR of 54 bp. Both hep-2 genes had three exons and
two introns; the location of the introns was conserved between
largemouth and smallmouth bass.
The predicted hepcidin-1 prepropeptides from both largemouth
bass and smallmouth bass are 91 residues long; the predicted
hepcidin-2 prepropeptides are both 87 residues long. A signal
peptidase cleavage site was predicted by PSORT between residues
24 and 25 for both hepcidin-1 and hepcidin-2 from both largemouth
and smallmouth bass. An Arg-X-Lys/Arg-Arg motif for propeptide
cleavage [59] is located at residues 61–64 in both hepcidin-1 and
hepcidin-2 from both largemouth and smallmouth bass (Fig. 1).
The largemouth and smallmouth bass hep-1 cDNAs differ at two
nucleotides, resulting in two amino acid differences: an alanine-to-
valine change in the putative signal sequence and a conservative
arginine-to-lysine change at position fifteen of the predicted mature
peptide (Fig. 1A). The alanine-to-valine change in the putative signal
sequence is predicted to be a tolerated functional change by the
sequence alignment-based tool SIFT [60]. Lysine and arginine are
both found at position fifteen of the predicted mature peptides in
fish hepcidins, e.g., zebrafish hepcidin-1 (GenBank accession number
NP_991146) has an arginine at this position and turbot hepcidin-1
(GenBank accession number CAJ34592) has a lysine.
The largemouth and smallmouth bass hep-2 cDNAs differ at
three nucleotides, resulting in three amino acid differences:
a threonine-to-alanine change in the signal peptide sequence, an
aspartic acid-to-asparagine change in the acidic propiece, and
a glutamic acid-to-lysine change at position three of the predicted
mature peptide (Fig. 1B). All three of these amino acid changes are
predicted to be tolerated functional changes by the sequence
alignment-based tool SIFT [60]. When predicting tolerated func-
tional changes, the SIFT tool considers not only the chemical
characteristics of the substituted amino acids, but also the char-
acteristics of all amino acids found at the substituted position in an
alignment of similar proteins.
Phylogenetic analysis of published teleost hepcidin prepropep-
tide sequences clustered all but four hepcidin sequences by fish
order (Fig. 2A). Hepcidins from the more evolutionarily recent
Perciformes fish form one major clade distinct from a second major
clade that contains smaller clusters of hepcidins from fish of the
orders Cypriniformes, Siluriformes, Gadiformes, or Salmoniformes.
The four exceptional hepcidins are largemouth and smallmouth

A
Largemouth bass hep-1 MKAFSIAVAV TLVLAFICIL ESSAVPFTGV QELEEAGSND TPVAAHQEMS
Smallmouth bass hep-1 MKVFSIAVAV TLVLAFICIL ESSAVPFTGV QELEEAGSND TPVAAHQEMS

Largemouth bass hep-1 MESWMMPNHI RQKRQSHLSL CRWCCNCCRG NKGCGFCCRF

Smallmouth bass hep-1 MESWMMPNHI RQKRQSHLSL CRWCCNCCKG NKGCGFCCRF

B
Largemouth bass hep-2 MKTLSVAVAV AVVLTFICLP ESSAVPVTEV QELEEPMSDD NLAAAHEDMS
Smallmouth bass hep-2 MKTLSVAVAV AVVLAFICLP ESSAVPVTEV QELEEPMSND NLAAAHEDMS

Largemouth bass hep-2 VESWKMPYNN RQKRGIECRF CCGCCTPGVC GVCCRF

Smallmouth bass hep-2 VESWKMPYNN RQKRGIKCRF CCGCCTPGVC GVCCRF

Fig. 1. Deduced amino acid sequences of hep-1 (A) and hep-2 (B) from largemouth bass and smallmouth bass. Differences between the predicted amino acid sequences from
largemouth bass and smallmouth bass are boxed. The Arg-X-Lys/Arg-Arg motif for propeptide cleavage is underlined.
902 L.S. Robertson et al. / Fish & Shellfish Immunology 26 (2009) 898–907

Fig. 2. Comparison of teleost fish and human hepcidins; complete prepropeptide sequences are used, species and Genbank accession number are shown for each sequence.
Largemouth bass and smallmouth bass hepcidin-1 (ACD13023 and ACD13025) and hepcidin-2 (ACD13024 and ACD13026) are in bold. A) Consensus phylogram. See Methods for
a list of protein sequences used for the Bayesian analysis. Posterior probabilities at each branch node indicate statistical branch support. B) Alignment of the same prepropeptide
hepcidin sequences used in the phylogenetic analysis. Eight cysteine residues and a glycine residue that are highly conserved across all mature hepcidin peptides are marked with
asterisks. Confirmed cleavage site for mature hepcidin peptide indicated for human hep-25 (;). Metal-binding site in human hep-25 is underlined. The Q-S/I-H-L/I-S/A-L motif at
the N-terminus of the predicted mature peptide of largemouth bass hepcidin-1 and related hepcidins is shaded.
 L.S. Robertson et al. / Fish & Shellfish Immunology 26 (2009) 898–907
bass hep-1 (M. salmoides ACD13023 and M. dolomieu ACD13025), an
olive flounder hepcidin (P. olivaceus AAT01563, Pleuronectiformes),
and a turbot hepcidin (Scophthalmus maximus AAX92670, Pleuro-
nectiformes), which group together in the second major clade that
includes hepcidins from fish of the Cypriniformes, Siluriformes,
Gadiformes, or Salmoniformes, rather than other Perciformes
hepcidins. All the hepcidins in this second major clade contain
a histidine in the third position of the mature peptide as part of
a conserved sequence Q-S/I-H-L/I-S/A-L that is missing in all the
hepcidins of the first Perciformes clade (see Fig. 2B).
An alignment of the hepcidin prepropeptide sequences used in
the phylogenetic analysis is shown in Fig. 2B. The largemouth and
smallmouth bass hepcidin-1 and the hepcidin-2 mature peptides
contain eight cysteine residues and a glycine residue that are highly
conserved in all hepcidins. The largemouth and smallmouth
bass hepcidin-1 mature peptide has an N-terminal Q-S/I-H-L/I-S-L
sequence that is found in zebrafish, Atlantic salmon, rainbow trout,
and turbot hepcidin-1. This sequence is lacking in the mature
hepcidin-2 peptides, which instead have an N-terminal G-I-E
(largemouth bass) or G-I-K (smallmouth bass) sequence similar to
the N-terminal A/G-I-K sequence found in black porgy hepcidin-5
and Japanese sea bass hepcidin.
The hepcidin-1 and hepcidin-2 mature peptides were analyzed
using the ProtParam tool (http://ca.expasy.org/tools/protparam.
html; [61]). The predicted half-life of hepcidin-1 (0.8 h in mamma-
lian reticulocytes, 10 min in yeast or E. coli) is much shorter than the
predicted half-life of hepcidin-2 (30 h in mammalian reticulocytes,
more than 20 h in yeast or E. coli). The longer predicted half-life for
hepcidin-2 is due to the N-terminal glycine residue. Smallmouth
bass hepcidin-2 had a lower theoretical isoelectric point (pI ¼ 7.7)
than largemouth bass hepcidin-2 (pI ¼ 8.54) or hepcidin-1 (pI ¼ 8.78
for both largemouth bass and smallmouth bass).
No 18S sequences for largemouth bass or smallmouth bass were
available in GenBank. A partial 18S gene fragment was amplified
from smallmouth bass using primers (LRO-018 and LRO-019, see
Table 1) designed from the Seriola quinqueradiata 18S sequence
(GenBank accession number AY850370) and sequenced (data not
shown; GenBank accession number EU502753).
3.2. Tissue-specific expression of hepcidin-1 and hepcidin-2
in largemouth bass
Hepcidin expression was measured by real-time RT-PCR in liver,
spleen, anterior (head) kidney, posterior (trunk) kidney, and gill
hep-1
2.5
2.0
Mean normalized hep-1
*
1.5
1.0
0.5
0.0
ak gill liver
Fig. 3. Constitutive expression of hep-1 and hep-2 in largemouth bass in anterior kidney (ak), gill, liver, posterior kidney (pk), and spleen tissues. One sample was taken for each
tissue from each fish (n ¼ 6) and the abundance of hep-1, hep-2, and 18S was measured by qPCR with three technical replications. Mean expression of target gene (hep-1 or hep-2)
normalized to mean expression of 18S is evaluated for each tissue sample from each fish. Boxplots show the lower quartile, median, and upper quartile for hepcidin expression for
each tissue. Statistical significance was assessed by ANOVA with Tukey post hoc pairwise comparisons (*, Tukey post hoc pairwise comparisons p < 0.05).
903
tissues from pond-raised largemouth bass. Expression of hep-1 was
higher in the liver than in the spleen, anterior kidney, posterior
kidney, or gill (Fig. 3). Results were analyzed by ANOVA followed by
Tukey post hoc comparisons; p < 0.0001 for ANOVA and p < 0.05
for all Tukey post hoc pairwise comparisons with liver. Expression
of hep-2 was higher in liver than in spleen, anterior kidney,
posterior kidney or gill, but the results were not statistically
significant (Fig. 3).
3.3. Expression of hep-1 and hep-2 in largemouth bass
exposed to estradiol and bacteria
To ascertain the effects of estradiol and bacterial exposure on
hepcidin expression, pond-raised largemouth bass were injected
with 5 mg of 17-beta estradiol per kg fish (estradiol group) or with
corn oil (vehicle control), then exposed to the gram-negative
bacterium E. ictaluri. Expression of hep-1 and hep-2 was measured
by real-time PCR in liver, gill, and spleen tissue. The mean plasma
estradiol concentration was 2471 pg ml-1 in estradiol-injected fish
and 345.9 pg ml-1 in control-injected fish (Table 2). The plasma
estradiol concentration was higher in female fish than in male fish
for both estradiol-injected fish and control-injected fish. However,
estradiol injection significantly increased plasma estradiol
concentrations for both male and female fish. Plasma estradiol
concentrations in the estradiol-treated fish are similar to physio-
logical concentrations observed in female largemouth bass during
spawning season and the plasma estradiol concentrations in the
vehicle-injected fish are similar to the concentrations seen in male
largemouth bass outside of spawning season [62].
In the liver, expression of hep-1 was significantly reduced by
estradiol treatment (Fig. 4; ANOVA, p ¼ 0.001; p < 0.05 for Tukey
post hoc pairwise comparisons between control-injected fish and
estradiol-injected fish and between control-injected fish and
estradiol-injected plus bacterial-exposed fish). Bacterial exposure
did not affect hep-1 expression in the liver. Expression of hep-2 was
upregulated in the liver tissue of largemouth bass exposed to
bacteria and this increase in expression was blocked by estradiol
(Fig. 4; ANOVA, p ¼ 0.0122; p < 0.05 for Tukey post hoc pairwise
comparisons between bacterial-exposed fish and control-injected
fish, bacterial-exposed fish and estradiol-injected fish, and bacte-
rial-exposed fish and estradiol-injected plus bacterial-exposed
fish).
hep-2
5
4
Mean normalized hep-2
3
2
1
0
pk spleen ak gill liver pk spleen
904 L.S. Robertson et al. / Fish & Shellfish Immunology 26 (2009) 898–907

Table 2
Mean plasma estradiol concentration in pg ml-1 þ/ S.E.M. (standard error of the
mean) and number of samples (n) in each group.
Estradiol-injected fish
Estradiol-injected males
Estradiol-injected females
Control-injected fish
Control-injected males
Control-injected females
In spleens, exposure to E. ictaluri increased expression of hep-1
(Fig. 4; ANOVA, p ¼ 0.0459; no pairwise Tukey post hoc comparisons
with p < 0.05) and decreased expression of hep-2 (Fig. 4; ANOVA,
p ¼ 0.0205; p < 0.05 for Tukey post hoc pairwise comparisons
between control-injected fish and bacterial-exposed fish and between
control-injected fish and estradiol-injected plus bacterial-exposed
fish). These effects of bacterial exposure on hepcidin expression in the
spleen were not affected by estradiol injection.
In the gill, expression of both hep-1 and hep-2 was not signifi-
cantly affected by estradiol or bacterial exposure (data not shown).
4. Discussion
We identified two hepcidin genes, hep-1 and hep-2, in both
largemouth bass and smallmouth bass. All four genes contained
Plasma estradiol (pg/ml)
2471 þ/ 140.7, n ¼ 12
2219 þ/ 137.0, n ¼ 8
2974 þ/ 56.11, n ¼ 4
345.9 þ/ 77.14, n ¼ 12
175.7 þ/ 33.29, n ¼ 7
584.3 þ/ 112.2, n ¼ 5
three exons and two introns and are predicted to encode a protein
with an N-terminal 24 residue signal peptide, a 40 residue acidic
propiece, and a mature peptide with eight conserved cysteines,
similar to the hepcidin genes identified in mammals and other fish.
In general, fish hepcidin sequences have a highly conserved signal
peptide sequence 24 amino acids in length, an acidic propiece
approximately 38–40 residues long, then a mature peptide that is
19–27 amino acids long [28]. Hepcidin peptides have both antimi-
crobial activity and iron regulatory activity, and these two functions
are conserved between humans and fish. In humans, both functions
are mediated by a single peptide, whose primary role is as an
iron-regulatory hormone and whose in vivo antimicrobial activity is
unclear. Mice differentially express two distinct hepcidins, hepc1
and hepc2. Hepc1 is required for normal iron regulation, but hepc2
is not [63]. The sequence of mouse hepc2 is more similar to fish
hepcidins than mouse hepc1 and it has been hypothesized that
mouse hepc2 is involved in innate immunity [63].
Fish genomes have undergone genome duplication events since
the divergence from tetrapods, resulting in numerous duplicated
genes. Some of these duplicated genes have been lost during
subsequent rediploidization and some of the duplicated genes have
lost function (pseudogene formation); in some cases, multiple
functions of a parent gene are partitioned between duplicated
genes (subfunctionalization), while other duplicated genes acquire
new function(s) altogether (see [64] and references therein). While
multiple hepcidin sequences have been identified in many fish, for

hep-1 in liver hep-2 in liver

2.5 1000
a

2.0 800
Mean normalized hep-1

Mean normalized hep-2

1.5 600
d

1.0 400

0.5 b 200
b c
c
c
0.0 0

1 2 3 4 1 2 3 4

hep-1 in spleen hep-2 in spleen

1.2 0.06

1.0 0.05
Mean normalized hep-1

Mean normalized hep-2

0.8 0.04
e
0.6 0.03

0.4 0.02

f
0.2 0.01
f
0.0 0.00

1 2 3 4 1 2 3 4

Fig. 4. Regulation of hep-1 and hep-2 expression in largemouth bass livers and spleens following estradiol and bacterial exposure: 1) control injection, 2) estradiol injection,
3) estradiol injection þ exposure to E. ictaluri, and 4) control injection þ exposure to E. ictaluri. One liver sample and one spleen sample was taken from each fish per treatment
group (n ¼ 6) and the abundance of hep-1, hep-2, and 18S was measured by qPCR with three technical replications. Mean expression of target gene (hep-1 or hep-2) normalized to
mean expression of 18S is evaluated for each fish. Boxplots show the lower quartile, median, and upper quartile for hepcidin expression for each treatment group. Statistical
significance was assessed by ANOVA with Tukey post hoc pairwise comparisons; p < 0.05 for Tukey pairwise comparisons a–b, c–d, and ef.
 L.S. Robertson et al. / Fish & Shellfish Immunology 26 (2009) 898–907
most fish species, the different hepcidins cluster together by fish
order in phylogenetic analyses (see Fig. 2A), with hepcidins from
fish of the orders Cypriniformes, Siluriformes, Gadiformes, or Sal-
moniformes containing the Q-S/I-H-L/I-S/A-L sequence at the
amino terminus of the predicted mature peptide and hepcidins
from Perciformes fish generally lacking this sequence. However,
largemouth bass (ACD13025, ACD13026), smallmouth bass
(ACD13023, ACD13024), and turbot (S. maximus AAX92670 and the
unpublished CAI65387) have both a hepcidin containing the Q-S/I-
H-L/I-S/A-L sequence and a hepcidin lacking this sequence. Olive
flounder hepcidin-1 has a similar N-terminal sequence for the
predicted mature peptide N-terminal sequence, H-I-S-H-I-S-M
(P. olivaceus AAT01563), while olive flounder hepcidin-2 lacks this
sequence (AAT01564). It is possible that the antimicrobial and iron
regulatory activities are performed by different hepcidin proteins in
these fish. Olive flounder hep-2 expression, but not hep-1 expres-
sion, is induced by LPS-stimulation [31]; similarly, expression of
largemouth bass hep-2, but not hep-1, is induced in the liver by
bacterial exposure (see Fig. 4). The Q-S/I-H-L/I-S/A-L sequence
largemouth bass hepcidin-1 and related proteins may be involved
in iron regulatory activities.
Small amino-terminal Cu(II)- and Ni(II)-binding motifs
(ATCUN motifs) coordinate the binding of a metal ion between
the N-terminus of the protein, a histidine in the third position,
and the backbone nitrogens of the two intermediate residues.
The N-terminus of human Hep25 contains an ATCUN motif that
is required for Hep25 aggregation [65], Hep25 binding to fer-
roportin [66], and Hep25 binding to metal ions [67]. The pre-
dicted hepcidin-1 mature peptide from largemouth bass and
smallmouth bass has a histidine in the third position (Q-S-H-L-
S-L), similar to the ATCUN motif. However, binding studies are
required to verify the iron-binding function of this putative
motif in fish.
These N-terminal sequence differences also affect the predicted
half-lives of hepcidin-1 and hepcidin-2: hepcidin-2, which has an
N-terminal glycine residue, has a much longer predicted half-life
than hepcidin-1. The lower theoretical isoelectric point of small-
mouth bass hepcidin-2 (pI ¼ 7.7 compared to 8.54 for largemouth
bass hepcidin-2 and 8.78 for hepcidin-1) may affect the antimi-
crobial activity. In general, microbial membranes have a negatively
charged outer membrane, unlike the uncharged outer membrane of
most plants and animals; positively charged antimicrobial peptides
are believed to interact with negatively charged components of
microbial membranes [68].
We measured the tissue-specific constitutive expression of hep-
1 and hep-2 in largemouth bass and the effects of estradiol and
bacterial exposure on these expression patterns. Both hep-1 and
hep-2 are expressed primarily in the liver. We show that in the liver,
expression of hep-1 is reduced by estradiol and the induction of
hep-2 expression by bacterial exposure is blocked by estradiol.
Expression of hep-1 is much lower in the spleen than in the liver,
but expression is increased approximately three-fold in the spleens
of fish exposed to bacteria compared to unexposed fish; this
increased expression is not affected by estradiol. The expression of
hep-2 is reduced in the spleens of largemouth bass exposed
to bacteria. Largemouth bass are not susceptible to E. ictaluri,
suggesting the changes in hepcidin expression observed are not due
to a stress or a general immune decline in dying fish [69]. Fish
spleens are macrophage-rich tissues involved in innate immunity
[70,71]. Hepcidin expression is upregulated in both liver and spleen
of Atlantic salmon infected with Aeromonas salmonicida [72]; in
catfish, expression is upregulated in head kidney and spleen, but not
in liver, following exposure to E. ictaluri [33]. In mice, both macro-
phages and neutrophils produce hepcidin in response to bacterial
exposure [26]. Hepcidin production is dependent upon the toll-like
905
receptor TLR4 in macrophages and neutrophils exposed to bacteria,
but is not dependent upon TLR4 in liver hepatocytes [26].
In recent years, fish kills and fish lesions have been observed in
the Potomac River watershed where a high prevalence of intersex
has been noted in smallmouth bass [10]. A general decline in
immune function due to the presence of EEDCs and other
contaminants has been postulated to explain this observation
[10,11]. Estrogen and EEDCs have been shown to modulate the
immune response in fish [7,73–76]. It is likely that they interfere
with the expression of genes involved in innate immunity, thus
potentially increasing susceptibility of fish to bacterial infection.
Because of difficulties obtaining sufficient smallmouth bass for
experimental laboratory exposures and difficulties maintaining
wild-caught smallmouth bass in the laboratory, expression patterns
of hep-1 and hep-2 were determined in largemouth bass, a species
closely related to smallmouth bass. The expression of hep-1 was
downregulated by estradiol in the liver of largemouth bass. The
expression of hep-2 was upregulated in the liver of largemouth
bass by exposure to bacteria and this upregulation was blocked
by estradiol. Disruption of hepcidin expression, and possibly the
expression of other immune-related genes, by environmental
estrogenic endocrine-disrupting chemicals may leave fish more
susceptible to microbial attack.
To our knowledge, this is the first report of the regulation of
hepcidin expression by estradiol in either fish or mammals. It is
possible that the regulation of hepcidin by estradiol is mediated by
interleukin-6 (IL-6). In mammals, expression of hepcidin is stimu-
lated by interleukin-6 [23] and interleukin-1 [24]; interleukin-6
expression is inhibited by estrogen and the estrogen-mimic,
bisphenol A [7,25]. The first putative fish homolog of interleukin-6
was recently identified in Japanese pufferfish [77], but this
homolog was identified by synteny and sequence similarity and has
not yet been shown to have functional similarity to interleukin-6.
Regulation of hepcidin expression by cytokines has not yet been
studied in fish and is of future interest.
Acknowledgments
We thank Jim Hedrick for providing the smallmouth bass,
Roseanna Long and Caird Rexroad for help with DNA sequencing,
and Greg Wiens, Vicki Blazer, and Ed Pendleton for critical reading
of the manuscript. Use of trade or product names does not imply
endorsement by U.S. government.
References
[1] Sumpter JP. Xenoendocrine disrupters – environmental impacts. Toxicology
Letters 1998;103:337–42.
[2] Kime DE. Endocrine disruption in fish. Springer. 1998:1–396.
[3] Vos JG, Dybing E, Greim HA, Ladefoged O, Lambre C, Tarazona JV, et al. Health
effects of endocrine-disrupting chemicals on wildlife, with special reference to
the European situation. Critical Reviews in Toxicology 2000;30:71–133.
[4] Noaksson E, Tjarnlund U, Bosveld ATC, Balk L. Evidence for endocrine
disruption in perch (Perca fluviatilis) and roach (Rutilus rutilus) in a remote
Swedish lake in the vicinity of a public refuse dump. Toxicology and Applied
Pharmacology 2001;174:160–76.
[5] Gong YH, Chin HS, Lim LSE, Loy CJ, Obbard JP, Yong EL. Clustering of sex
hormone disruptors in Singapore’s marine environment. Environmental
Health Perspectives 2003;111:1448–53.
[6] Ahmed SR. The immune system as a potential target for environmental
estrogens (endocrine disrupters): a new emerging field. Toxicology 2000;150:
191–206.
[7] Sugita-Konishi Y, Shimura S, Nishikawa T, Sunaga F, Naito H, Suzuki Y. Effect of
Bisphenol A on non-specific immunodefenses against non-pathogenic
Escherichia coli. Toxicology Letters 2003;136:217–27.
[8] Iwata M, Eshima Y, Kagechika H, Miyaura H. The endocrine disruptors
nonylphenol and octylphenol exert direct effects on T cells to suppress Th1
development and enhance Th2 development. Immunology Letters 2004;94:
135–9.
906 L.S. Robertson et al. / Fish & Shellfish Immunology 26 (2009) 898–907
[9] Ndebele K, Tchounwou PB, McMurray RW. Coumestrol, bisphenol-A, DDT, and
TCDD modulation of interleukin-2 expression in activated CDþ4 Jurkat T cells.
International Journal of Environmental Research and Public Health 2004;1:
3–11.
[10] Blazer VS, Iwanowicz LR, Iwanowicz DD, Smith DR, Young JA, Hedrick JD, et al.
Intersex (testicular oocytes) in smallmouth bass from the Potomac River and
selected nearby drainages. Journal of Aquatic Animal Health 2007;19:242–53.
[11] Ripley J, Iwanowicz L, Blazer V, Foran C. Utilization of protein expression
profiles as indicators of environmental impairment of smallmouth bass
(Micropterus dolomieu) from the Shenandoah River, Virginia, USA. Environ-
mental Toxicology and Chemistry 2008;27:1756–67.
[12] Nemeth E, Valore EV, Territo M, Schiller G, Lichtenstein A, Ganz T. Hepcidin,
a putative mediator of anemia of inflammation, is a type II acute-phase
protein. Blood 2003;101:2461–3.
[13] Nicolas G, Bennoun M, Porteu A, Mativet S, Beaumont C, Grandchamp B, et al.
Severe iron deficiency anemia in transgenic mice expressing liver hepcidin.
Proceedings of the National Academy of Sciences of the United States of
America 2002;99:4596–601.
[14] Krause A, Neitz S, Maegert H-J, Schulz A, Forssmann W-G, Schulz-Knappe P,
et al. LEAP-1, a novel highly disulfide-bonded human peptide, exhibits
antimicrobial activity. FEBS Letters 2000;480:147–50.
[15] Park CH, Valore EV, Waring AJ, Ganz T. Hepcidin, a urinary antimicrobial
peptide synthesized in the liver. Journal of Biological Chemistry 2001;276:
7806–10.
[16] Sow FB, Florence WC, Satoskar AR, Schlesinger LS, Zwilling BS, Lafuse WP.
Expression and localization of hepcidin in macrophages: a role in host defense
against tuberculosis. Journal of Leukocyte Biology 2007;82:934–45.
[17] Roetto A, Papanikolaou G, Politou M, Alberti F, Girelli D, Christakis J, et al.
Mutant antimicrobial peptide hepcidin is associated with severe juvenile
hemochromatosis. Nature Genetics 2003;33:21–2.
[18] Jurado RL. Iron, infections, and anemia of inflammation. Clinical Infectious
Diseases 1997;25:888–95.
[19] Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Ward DM, et al.
Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing
its internalization. Science 2004;306:2090–3.
[20] Knutson MD, Oukka M, Koss LM, Aydemir F, Wessling-Resnick M. Iron release
from macrophages after erythrophagocytosis is up-regulated by ferroportin 1
overexpression and down-regulated by hepcidin. Proceedings of the National
Academy of Sciences of the United States of America 2005;102:1324–8.
[21] Nicolas G, Chauvet C, Viatte L, Danan JL, Bigard X, Devaux I, et al. The gene
encoding the iron regulatory peptide hepcidin is regulated by anemia, hypoxia,
and inflammation. Journal of Clinical Investigation 2002;110:1037–44.
[22] Pigeon C, Ilyin G, Courselaud B, Leroyer P, Turlin B, Brissot P, et al. A new
mouse liver-specific gene, encoding a protein homologous to human antimi-
crobial peptide hepcidin, is overexpressed during iron overload. Journal of
Biological Chemistry 2001;276:7811–9.
[23] Nemeth E, Rivera S, Gabayan V, Keller C, Taudorf S, Pedersen BK, et al. IL-6
mediates hypoferremia of inflammation by inducing the synthesis of the iron
regulatory hormone hepcidin. Journal of Clinical Investigation 2004;113:
1271–6.
[24] Lee P, Peng H, Gelbart T, Wang L, Beutler E. Regulation of hepcidin tran-
scription by interleukin-1 and interleukin-6. Proceedings of the National
Academy of Sciences of the United States of America 2005;102:1906–10.
[25] Pottratz ST, Bellido T, Mocharla H, Crabb D, Manolagas SC. 17 beta-Estradiol
inhibits expression of human interleukin-6 promoter-reporter constructs by
a receptor-dependent mechanism. Journal of Clinical Investigation 1994;93:
944–50.
[26] Peyssonnaux C, Zinkernagel AS, Datta V, Lauth X, Johnson RS, Nizet V. TLR4-
dependent hepcidin expression by myeloid cells in response to bacterial
pathogens. Blood 2006;107:3727–32.
[27] Shike H, Lauth X, Westerman ME, Ostland VE, Carlberg JM, Van Olst JC, et al.
Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge.
European Journal of Biochemistry 2002;269:2232–7.
[28] Douglas SE, Gallant JW, Liebscher RS, Dacanay A, Tsoi SC. Identification and
expression analysis of hepcidin-like antimicrobial peptides in bony fish.
Developmental and Comparative Immunology 2003;27:589–601.
[29] Shike H, Shimizu C, Lauth X, Burns JC. Organization and expression analysis of
the zebrafish hepcidin gene, an antimicrobial peptide gene conserved among
vertebrates. Developmental and Comparative Immunology 2004;28:747–54.
[30] Hirono I, Hwang JY, Ono Y, Kurobe T, Ohira T, Nozaki R, et al. Two different
types of hepcidins from the Japanese flounder Paralichthys olivaceus. FEBS
Journal 2005;272:5257–64.
[31] Kim YO, Hong S, Nam BH, Lee JH, Kim KK, Lee SJ. Molecular cloning and
expression analysis of two hepcidin genes from olive flounder Paralichthys
olivaceus. Bioscience Biotechnology and Biochemistry 2005;69:1411–4.
[32] Chen SL, Xu MY, Ji XS, Yu GC, Liu Y. Cloning, characterization, and expression
analysis of hepcidin gene from red sea bream (Chrysophrys major). Antimi-
crobial Agents and Chemotherapy 2005;49:1608–12.
[33] Bao B, Peatman E, Li P, He C, Liu Z. Catfish hepcidin gene is expressed in a wide
range of tissues and exhibits tissue-specific upregulation after bacterial
infection. Developmental and Comparative Immunology 2005;29:939–50.
[34] Rodrigues PNS, Vazquez-Dorado S, Neves JV, Wilson JM. Dual function of fish
hepcidin: response to experimental iron overload and bacterial infection in
sea bass (Dicentrarchus labrax). Developmental and Comparative Immunology
2006;30:1156–67.
[35] Shi J, Camus AC. Hepcidins in amphibians and fishes: antimicrobial peptides or
iron-regulatory hormones? Developmental and Comparative Immunology
2006;30:746–55.
[36] Lauth X, Babon JJ, Stannard JA, Singh S, Nizet V, Carlberg JM, et al. Bass
hepcidin synthesis, solution structure, antimicrobial activities and synergism,
and in vivo hepatic response to bacterial infections. Journal of Biological
Chemistry 2005;280:9272–82.
[37] Zheng W, Liu G, Ao J, Chen X. Expression analysis of immune-relevant genes in
the spleen of large yellow croaker (Pseudosciaena crocea) stimulated with poly
I:C. Fish and Shellfish Immunology 2006;21:414–30.
[38] Huang P-H, Chen J-Y, Kuo C-M. Three different hepcidins from tilapia, Oreo-
chromis mossambicus: analysis of their expressions and biological functions.
Molecular Immunology 2007;44:1922–34.
[39] Chiou PP, Lin CM, Bols NC, Chen TT. Characterization of virus/double-stranded
RNA-dependent induction of antimicrobial peptide hepcidin in trout macro-
phages. Developmental and Comparative Immunology 2007;31:1297–309.
[40] Fraenkel PG, Traver D, Donovan A, Zahrieh D, Zon LI. Ferroportin1 is required
for normal iron cycling in zebrafish. Journal of Clinical Investigation 2005;115:
1532–41.
[41] Hu XY, Camus AC, Aono S, Morrison EE, Dennis J, Nusbaum KE, et al. Channel
catfish hepcidin expression in infection and anemia. Comparative Immu-
nology Microbiology and Infectious Diseases 2007;30:55–69.
[42] Gracey AY, Troll JV, Somero GN. Hypoxia-induced gene expression profiling in
the euryoxic fish Gillichthys mirabilis. Proceedings of the National Academy of
Sciences of the United States of America 2001;98:1993–8.
[43] Estoup A, Turgeon J. Microsatellite markers: isolation with non-radioactive
probes and amplification. Cited 2007; Available from: http://www.inapg.inra.
fr/dsa/microsat/microsat.htm; 1996.
[44] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUS-
TAL_X windows interface: flexible strategies for multiple sequence alignment
aided by quality analysis tools. Nucleic Acids Research 1997;25:4876–82.
[45] Smeekens SP. Processing of protein precursors by a novel family of subtilisin-
related mammalian endoproteases. Biotechnology (NY) 1993;11:182–6.
[46] Yang M, Wang K-J, Chen J-H, Qu H-D, Li S-J. Genomic organization and tissue-
specific expression analysis of hepcidin-like genes from black porgy (Acan-
thopagrus schlegelii B.). Fish and Shellfish Immunology 2007;23:1060–71.
[47] Solstad T, Larsen AN, Seppola M, Jorgensen TO. Identification, cloning and
expression analysis of a hepcidin cDNA of the Atlantic cod (Gadus morhua L.).
Fish and Shellfish Immunology 2008;25:298–310.
[48] Ren HL, Wang KJ, Zhou HL, Yang M. Cloning and organisation analysis of
a hepcidin-like gene and cDNA from Japan sea bass, Lateolabrax japonicus. Fish
and Shellfish Immunology 2006;21:221–7.
[49] Bayne CJ, Gerwick L, Fujiki K, Nakao M, Yano T. Immune-relevant (including
acute phase) genes identified in the livers of rainbow trout, Oncorhynchus
mykiss, by means of suppression subtractive hybridization. Developmental
and Comparative Immunology 2001;25:205–17.
[50] Cho YS, Lee SY, Kim KH, Kim SK, Kim DS, Nam YK. Gene structure and
differential modulation of multiple rockbream (Oplegnathus fasciatus) hepci-
din isoforms resulting from different biological stimulations. Developmental
and Comparative Immunology 2009;33:46–58.
[51] Chen SL, Li W, Meng L, Sha ZX, Wang ZJ, Ren GC. Molecular cloning and
expression analysis of a hepcidin antimicrobial peptide gene from turbot
(Scophthalmus maximus). Fish and Shellfish Immunology 2007;22:172–81.
[52] Chaves-Pozo E, Liarte S, Fernandez-Alacid L, Abellan E, Meseguer J, Mulero V, et al.
Pattern of expression of immune-relevant genes in the gonad of a teleost, the
gilthead seabream (Sparus aurata L.). Molecular Immunology 2008;45:2998–3011.
[53] Mulero I, Sepulcre MP, Fuentes I, Garcia-Alcazar A, Meseguer J, Garcia-Ayala A,
et al. Vaccination of larvae of the bony fish gilthead seabream reveals a lack of
correlation between lymphocyte development and adaptive immunocompe-
tence. Molecular Immunology 2008;45:2981–9.
[54] Cuesta A, Meseguer J, Esteban MA. The antimicrobial peptide hepcidin exerts
an important role in the innate immunity against bacteria in the bony fish
gilthead seabream. Molecular Immunology 2008;45:2333–42.
[55] Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic
trees. Bioinformatics 2001;17:754–5.
[56] Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under
mixed models. Bioinformatics 2003;19:1572–4.
[57] Iwanowicz LR, Griffin AR, Cartwright DD, Blazer VS. Mortality and pathology
in brown bullheads Amieurus nebulosus associated with a spontaneous
Edwardsiella ictaluri outbreak under tank culture conditions. Diseases of
Aquatic Organisms 2006;70:219–25.
[58] Sower SA, Schreck CB. Steroid and thyroid hormones during sexual maturation
of coho salmon (Oncorhynchus kisutch) in seawater of fresh water. General and
Comparative Endocrinology 1982;47:42–53.
[59] Hosaka M, Nagahama M, Kim WS, Watanabe T, Hatsuzawa K, Ikemizu J, et al.
Arg-X-Lys/Arg-Arg motif as a signal for precursor cleavage catalyzed by furin
within the constitutive secretory pathway. Journal of Biological Chemistry
1991;266:12127–30.
[60] Ng PC, Henikoff S. Predicting deleterious amino acid substitutions. Genome
Research 2001;11:863–74.
[61] Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, et al.
Protein identification and analysis tools on the ExPASy Server. In: Walker JM,
editor. The proteomics protocols handbook. Humana Press; 2005. p. 571–607.
[62] Gross TS, Wieser CM, Sepulveda MS, Wiebe JJ, Schoeb TR, Denslow ND.
Characterization of annual reproductive cycles for pond-reared Florida
 L.S. Robertson et al. / Fish & Shellfish Immunology 26 (2009) 898–907
largemouth bass Micropterus salmoides floridanus. Black bass. Ecology,
Conservation, and Management 2002:205–12.
[63] Lou D-Q, Nicolas G, Lesbordes J-C, Viatte L, Grimber G, Szajnert M-F, et al.
Functional differences between hepcidin 1 and 2 in transgenic mice. Blood
2004;103:2816–21.
[64] Volff JN. Genome evolution and biodiversity in teleost fish. Heredity 2005;
94:280–94.
[65] Hunter HN, Fulton DB, Ganz T, Vogel HJ. The solution structure of human
hepcidin, a peptide hormone with antimicrobial activity that is involved in
iron uptake and hereditary hemochromatosis. Journal of Biological Chemistry
2002;277:37597–603.
[66] Nemeth E, Preza GC, Jung CL, Kaplan J, Waring AJ, Ganz T. The N-terminus of
hepcidin is essential for its interaction with ferroportin: structure-function
study. Blood 2006;107:328–33.
[67] Melino S, Garlando L, Patamia M, Paci M, Petruzzelli R. A metal-binding site is
present in the amino terminal region of the bioactive iron regulator hepcidin-
25. Journal of Peptide Research 2005;66:65–71.
[68] Zasloff M. Antimicrobial peptides of multicellular organisms. Nature (London)
2002;415:389–95.
[69] Plumb JA, Sanchez DJ. Susceptibility of five species of fish to Edwardsiella
ictaluri. Journal of Fish Diseases 1983;6:261–6.
[70] Ellis AE, Roberts RJ. The immunology of teleosts. Fish Pathology 1989:135–52.
907
[71] Hadidi S, Glenney GW, Welch TJ, Silverstein JT, Wiens GD. Spleen size predicts
resistance of rainbow trout to Flavobacterium psychrophilum challenge. Journal
of Immunology 2008;180:4156–65.
[72] Tsoi SC, Ewart KV, Penny S, Melville K, Liebscher RS, Brown LL, et al. Identi-
fication of immune-relevant genes from Atlantic salmon using suppression
subtractive hybridization. Marine Biotechnology 2004;6:199–214.
[73] Wang R, Belosevic M. The in-vitro effects of estradiol and cortisol on the
function of a long-term goldfish macrophage cell-line. Developmental and
Comparative Immunology 1995;19:327–36.
[74] Gushiken Y, Watanuki H, Sakai M. In vitro effect of carp phagocytic cells by
bisphenol A and nonylphenol. Fisheries Science 2002;68:178–83.
[75] Watanuki H, Gushiken Y, Sakai MS. In vitro modulation of common carp
(Cyprinus carpio L.) phagocytic cells by di-n-butyl phthalate and di-2-ethyl-
hexyl phthalate. Aquatic Toxicology 2003;63:119–26.
[76] Iwanowicz LR, Patiño R, Stafford JL, Bengten E, Miller NW, Blazer VS. Channel
catfish (Ictalurus punctatus) leukocytes express estrogen receptor isoforms
ERa and ERb2 and are directly modulated by estrogens. Fish & Shellfish
Immunology, submitted for publicaton.
[77] Bird S, Zou J, Savan R, Kono T, Sakai M, Woo J, et al. Characterisation and
expression analysis of an interleukin 6 homologue in the Japanese puffer-
fish, Fugu rubripes. Developmental and Comparative Immunology 2005;
29:775–89.