Middle-East Journal of Scientific Research 10 (3): 332-341, 2011

ISSN 1990-9233
IDOSI Publications, 2011
Corresponding Author: N.A. Prayogo, Fisheries and Marine Science, Jenderal Soedirman University, Purwokerto, Indonesia.
332
Structure and Phylogenetic of Gnrh Genes of Hard-lipped Barb (Osteochilus hasselti C.V)
N.A. Prayogo, G.E. Wijayanti, Murwantoko, M. Kawaichi and P. Astuti
1,2 3 2,6 4 2,5
Fisheries and Marine Science, Jenderal Soedirman University, Purwokerto Indonesia
1
Post Graduate Programme of Biotechnology Gadjah Mada University, Yogyakarta, Indonesia
2
Postgraduate Programme, Magister Biologi, Jenderal Soedirman University, Purwokerto, Indonesia
3
Departemen of Biology, Nara Institute Science and Technology, Nara, Japan
4
Faculty of Veterinary Science, Gadjah Mada University, Yogyakarta, Indonesia
5
Faculty of Agriculture Science, Gadjah Mada University, Yogyakarta, Indonesia
6
Abstract: The gonadotropin-releasing hormone is known and named for its role as the final common signaling
molecule used by the brain to regulate reproduction in all vertebrates. Two Genomic DNA GnRH and cDNAs
of Hard-lipped barb carp, namely GnRH-II and GnRH-III, were firstly cloned from the brain reverse transcription-
polymerase chain reaction (RT-PCR). The length of genomic DNA GnRH-II was 632 bp and cDNA GnRH-II was
253 bp, the length of genomic DNA GnRH-III was 486 bp and cDNA GnRH-II was 285 bp, respectively.
The GnRH-II precursors encoded cDNA consisted of 84 amino acids and GnRH-III precursors encoded cDNA
consisted of 95 amino acids, including a signal peptide, GnRH-II decapeptide and a GnRH-associated peptide
(GAP) linked by a Gly-Lys-Arg proteolytic site. Recently, genes encoding two GnRH forms in hard-lipped barb
have been discovered.
Key words: GnRH-II GnRH-III PCR Amino Acid
INTRODUCTION fish [14-18] and this effect is believed to be its primary
Gonadotropin-releasing hormone (GnRH) is a GnRH (sGnRH) [13,19] and is found in the forebrain either
conservative neurodecapeptide family, which plays a alone or together with GnRH-I depending on the species
crucial role in regulating the gonad development and in [8,19]. GnRH peptides also reported in ovary and testis of
controlling the final sexual maturation in vertebrate [1-3]. fish and in ovary, testis, mammary gland and placenta of
The GnRH decapeptide is synthesized by neurosecretory mammals [13].
cells in the hypothalamus and secreted into portal GnRH genes share the same basic structure. the
vessels, to be transported to the pituitary gland where it GnRH preprohormone mRNA encodes GnRH and the
stimulates secretion of luteinizing hormone (LH) and GnRH-associated peptide (GAP), separated by a canonical
follicle-stimulating hormone (FSH) from pituitary cleavage site. The preprohormone mRNAs are encoded
gonadotrophs [4,5]. by four exons. Exon 1 encodes the 5??-UTR, Exon 2
The presence of either two or three forms of GnRH in encodes the signal peptide, GnRH decapeptide, the
teleost fishes has been well documented [6]. The so-called proteolytic cleavage site and the N-terminus of GAP, Exon
GnRH-I system is regarded as a species-specific form and 3 encodes the central portion of GAP and exon 4 encodes
includes mammalian GnRH (mGnRH), seabream GnRH the C terminus of GAP along with the 3??-UTR [16].
(sbGnRH), chicken GnRH-I (cGnRH-I) and pejerrey GnRH In this study, Hard-lipped Barb (Osteochilus
(pjGnRH), among others [2,6-9]. The GnRH-I system is hasselti C.V an indigenous tropical fish [20] is a
generally localized in the forebrain and is considered to synchronous batch spawner fish [5] capable of spawning
exert the neuroendocrine control over LH secretion. several time during the peak of the spawning period.
On the other hand, [His5 Trp7 Tyr8] GnRH (GnRH-II) also GnRH-II and GnRH-III genes have been cloned from hard
designated as GnRH-II [10-12] has been reported in all lipped barb brain tissue for the first time. In this study, the
major vertebrate groups, including mammals and is mainly isolation and identification of two differing GnRH-II and
expressed in the midbrain [13]. GnRH-II appears to have GnRH-III cDNAs and genomic in the hard lipped barb are
direct effects on sexual behavior in mammals, birds and reported.
function. Finally, GnRH-III is represented by salmon
Middle-East J. Sci. Res., 10 (3): 332-341, 2011
333
MATERIALS AND METHODS The primers pairs, Cyprinadae GnRH-III F contain
Brain Collection: Total RNA and genomic DNA were designed from carrasius Auratus (AB017271.1), cyprinus
isolated from brain. Total 15 sexually mature female Hard- carpio, (AF521130.2), rutilus rutilus, (U60667.1),
lipped Barb weighing of 100 g in average were purchased ctenopharyngodon idella, (EU981295.1) and Danio Rerio,
from local market in Indonesia. Fish brain were removed, (AY557019.1). All sequence were aligment with multalin to
frozen and stored at 150C with liquid nitrogen until RNA found conserve region in ORF (Open Reading Frame)
and genomic extraction. Isolation, cloning and sequencing region. Primer were design using primer 3 software untill
of GnRH-II and GnRH-III gene was measured at the estimated the product to amplify the GnRH-III gene. The
Laboratory of Gene Function Animal, Nara Institute genomic DNA also amplify with same primers to found
Science and Technology, Japan. genomic GnRH-II and GnRG-III gene in hard lipped-barb
Genomic DNA Isolation: Total genomic DNA was Thirty cycles of PCR for hard lipped barb cGnRHs-II
extracted from whole brain using TNES, after that add and GnRH-III were carried out using a thermal cycler
RNAse and Proteinase K. After incubated 1 hour add (Robocycler, Stratagene) according to the step program of
phenol Cloroform. Sample were extraction based on 95C for 2 min, 35 cycles to 95C for 30 s, 55C for 30 s,
Etanol-Phenol-chloroform extraction method [21]. The 72C for 60 s, followed by a 5 min extension at 72C
integrity of the DNA was verified in a denaturing agarose [22]. After amplification, the PCR products was
gel, stained with ethidium bromide. electrophoretically separated on a 1.5% agarose gel and
RNA Isolation and RT-PCR: Total mRNA was extracted
from whole brain using blue Sepasol R- RNA super 1 Cloning and Sequencing of PCR Products: PCR products
reagent (nacalai tesque), based on Etanol-phenol- amplified from genomic DNA and cDNA were separated
chloroform extraction method. Sample were treatment with by agarose gel electrophoresis and the incised gels were
DNAse free RNAse (Takara). After that the quality and purified using the DNA gel extraction procedure [23].
concentrations of total RNA were assayed by agarose gel The desired DNA fragments were subcloned into BSKS
electrophoresis and optical density reading at 260 and Eco R1/Xho 1 vector (10 ng) (Takara) and ligation with T4
280 nm, the RNA were loaded in batches and frozen at ligase. Plasmid were transfection to E. coli and spread into
-70C. Total mRNA sample (1,5 ng) was reverve LB medium [24]. The recombinant positive colonies were
transcript using cDNA synthezis kit (PrimeScript screened using ampicilin. Positive colonies were treatment
Reverse Transcriptase) from Takara and the cDNA was with mini scale plasmid preparation for sequencing [23].
amplified by PCR. DNA sequences of these fragments were determined
cDNA Amplification: The primer pairs, Cyprinadae GnRH- specific primers. The data was automatically collected on
II F contain ecor1 and Cyprinadae GnRH-II R contain the ABI PRISM 3100 Genetic Analyzer (PE Applied Bio-
xho1, were designed from cDNA cyprinidae like cyprinus systems).
carpio AY189961.1, carrasius auratus, U30386.1, rutilus
rutilus, (U60668.1) and ctenopharyngodon idella, Sequence Analysis: Genomic DNA and cDNA sequences
(EU981284.1). All sequence were aligment with multalin to for GnRH-II gene and GnRH-III gene were checked using
found conserve region in ORF (Open Reading Frame) BLASTN searches (http://www.ncbi.nlm.nih.gov/
region. Primer were design using primer 3 software untill BLAST/) were performed with default settings on the
estimated the product to amplify the GnRH-II gene complete, non redundant GenBank database nucleotide
(Table 1). sequences. After that genomic DNA and cDNA
ecor1 and Cyprinadae GnRH-III R contain xho1 were
(Table 1).
stained with ethidium bromide.
using the Big Dye version 3.1 sequencing method with
Table 1: Primer were used to amplify the GnRH-II and GnRH-III
No Primer code Primers PCR Product
1. Cyprinidae GnRH-II F GGA CCTAAG ATGGTGCACATCTGCAGGCT 253 bp
2. Cyprinidae GnRH-II R GGG CTCGAG TCTTTTGGAAATCCCGTATG
3. Cyprinidae GnRH-III F GGA CCTAAG AGCATGGAGTGGAAAGGAAG 285 bp
4. Cyprinidae GnRH-III R GGG CTCGAG CACTCTTCCTCGTCTGTTGG
Middle-East J. Sci. Res., 10 (3): 332-341, 2011
334
sequences for GnRH-II gene and GnRH-III gene were until consistent. Genomic GnRH-II show exclusive
aligned using CLUSTALW software to found intron and fragment, with the length of about 632 bp (JN867722)
exon area. (Figure 1A). The cDNA fragment contained 3 exon
Phylogenetic Analysis: For phylogenetic analyses, (Figure.2A). All intron-exon boundary sequences
hard lipped barb cDNA GnRH-II was compared to cDNA conform to the GT-AG rule. The cDNA including
GnRH-II sequences from nineteen fish species cDNA complete coding sequences, 253 bp in length (Figure 1A),
GnRH-III was compared to cDNA GnRH-III sequences was gotten, which was called GnRH-II cDNA (GenBank
from twentieth fish species. All sequences were retrieved accession JN867720.). The corresponding mRNA and
from NCBI GenBank. The relationship was generated with genomic DNA sequences were called GnRH-II,
CLUSTAL W with scoring method percent and and the respectively.
unrooted tree was generated using Treeview version 1.5.2.
[25]. Cloning of GnRH-III in Hard Lipped Barb: Sequence
RESULT open reading frame of GnRH-III. The same result was
General Result: Amplification of genomic DNA and sequencing repeatedly, until consistent. Genomic GnRH-
cDNA were successfully for GnRH-II and GnRH-III genes. III show exclusive fragment, with the length of about
For the genomic DNA the agarose gel electrophoresis 476 bp (JN867723) (Figure 1B). The cDNA fragment
showed a specific band, about 632 bp for GnRH-II and contained 3 exon (coding region) and 2 intron (non coding
476 bp for GnRH-III (Figure1). For the cDNA the agarose region) (Figure 2B). All intron-exon boundary sequences
gel electrophoresis also showed a specific band, about conform to the GT-AG rule. The cDNA including complete
253 bp for GnRH-II and 285 bp for GnRH-III (Figure 1). coding sequences, 285 bp in length (Figure 1B) was
The specific fragment was incised, reclaimed and gotten, which was called GnRH-III cDNA (GenBank
subcloned into BSKS vector. Then, four positive colonies accession JN867721). The corresponding mRNA and
were sequenced. genomic DNA sequences were called GnRH-III.
Cloning of Genomic and cDNA GnRH-II in Hard Lipped Gene Structure: All GnRH genes (GnRH-II and GnRH-III)
Barb: Amplification of GnRH-II genes in hard lipped barb share the same basic structure. The GnRH-II
showed cDNA fragment contained the open reading frame preprohormone mRNA encodes GnRH and the GnRH-
of GnRH-II. The same result was obtained by sequencing associated peptide (GAP), separated by a canonical
multiple single clones and sequencing repeatedly, cleavage site. The preprohormone mRNAs are encoded
(coding region) and 2 intron (non coding region)
analysis showed that every cDNA fragment contained the
obtained by sequencing multiple single clones and
Fig. 1: PCR product amplification mRNA and genomic DNA ORF gene GnRH in Hard lipped-barb (Osteochillus Hasseltii,
C.V), ( A= GnRH-II, B=GnRH-III).
A S i g n a l Pe p t i d e
M V H I C R L F V V M G M L L C L S A Q
1 A T G G T G C A C A T C T G C A G G C T G T T T G T G G T G A T G G G G A T G T T G C T G T G T C T A A G T G C C C A G
G n R H - I I D E C A P E P T I D E C u t S i t e
F A S S Q H W S H G W Y P G G K R E I D
6 1 T T T G C C A G C T C T C A G C A C T G G T C T C A T G G T T G G T A C C C T G G A G G A A A G A G A G A G A T A G A T
G A P
V Y D T S E
1 2 1 G T T T A C G A C A C T T C A G A G G T G T G T G A A T A T A G C T A C T A A A T G T G G C A C T C G A T G T T T G T T
1 8 1 A A A T A G A A A T A G T T T T G A A C A G T A T A A A T G T C T T T A C T G T C A C T T A G G T T A T G T T T T G T A
2 4 1 T A A C A A T A A T G T G T A T T G C G C T T T T T C A G C G T C G T G T G T C T T A C G T A T T T G C G T G G T A C A
3 0 1 A A T G T G T T T T A C A T G T T T A T T A G C A T T T G T T T A T G T A A A G G T C T A T T T T G A T A A C T T T A A
G A P
V S E E I K L C
3 6 1 G C T A T C G T G T T A C T T T C T A T T T T A C T T T A A A A T C A G G T T T C A G A G G A A A T T A A A C T C T G T
E A G K C S Y L R P Q G R N I L K T I
4 2 1 G A G G C G G G A A A A T G C A G C T A C C T G A G A C C C C A G G G A A G A A A C A T T C T G A A G A C A A T T G G T
4 8 1 G A G T A C A G A T G T T G T T T A A G C T C T G T T T T T C C G T C A G T C G T T A C A T A A G C T A G T C A T A A C
Q
5 4 1 G G G A T A T T G T G A A T G T T T C T C T G A A A C T G G A C T T A C T T G A C T A A T G T A A T G G C T T T A A C A
G A P
L D A I I R D F Q K
6 0 1 G C T G G A T G C C A T C A T A C G G G A T T T C C A A A A G A
B S i g n a l Pe p t i d e
M E W K G R L L V Q L L M L V C V L E
1 A G C A T G G A G T G G A A A G G A A G G T T G C T G G T C C A G T T G T T A A T G C T G G T G T G T G T G T T G G A G
G n R H - I I I D E C A P E P T I D E C u t S i t e
V S L C Q H W S Y G W L P G G K R S V G
6 1 G T T A G T C T T T G C C A G C A C T G G T C A T A T G G T T G G C T T C C T G G T G G A A A A A G A G T G T T G G T G
G A P
E V E A T F R
1 2 1 A A G T G G A G G C A A C A T T C A G G G T G A G A T T A T C C T C T T G T G G T T C T G A A A A T G T T A A A A T A T
M M D A G
1 8 1 T A A A G T A C T G A T G T A T G A G T A C T A A C A A A A T T C T G T C T C C G T C A T T A T G A T G G A T G C T G G
G A P
D A V L S I P A D S P M E R L S P I H I
2 4 1 T G A T G C A G T A C T G T C T A T T C C T G C A G A C T C T C C A A T G G A G C G G C T T T C A C C G A T A C A C A T
3 0 1 A G T A A G A G C A C A A C T G T T C C T C T T T C T T A C T G G A A A A C A T C T G C A G C T T T C A T T T T C C A G
V N D V
3 6 1 A G T G A A A A C T G A T C A C T G A T T T T T C C T C C T T T T T T A T A A A T C A C A G G G T G A A T G A T G T G G
G A P
D A E G L P L K E Q R F P N R R G R V
4 2 1 A T G C T G A A G G T T T G C C T C T G A A A G A A C A G A G A T T T C C C A A C A G A C G A G G A A G A G T G
Middle-East J. Sci. Res., 10 (3): 332-341, 2011
335
Fig. 2: Nucleotide sequences of GnRH-II and GnRH-III in hard lipped barb. A. Sequences of GnRH-II, B. Sequences
of GnRH-III, C. Sequences of genomic GnRH-II and D. Sequences of genomic GnRH-III (Red color: exon, black
color: intron).
by three exons (Figure. 2A). Exon 1 encodes the signal Structure for GnRH-II and GnRH-III had most similar
peptide, GnRH decapeptide, the proteolytic cleavage site in length for exons 1 and 2, but the intron sizes for GnRH-
and the N-terminus of GAP. Exon 2 encodes the central II compared with GnRH-III are the most different. The
portion of GAP and exon 3 encodes the C terminus of level of similarity in the coding sequences can be read
GAP. Similar with GnRH-II preprohormone mRNA, the from the phylogenetic tree distances (Figure.7). The
GnRH-III prehormone encodes GnRH and the GnRH- greatest differences within the preprohormone are within
associated peptide (GAP), separated by a canonical the GAP coding sequences. The striking contrast between
cleavage site. The preprohormone mRNAs are encoded conservation of the GnRH coding sequence and lack
by three exons (Figure. 2B). Exon 1 encodes the signal thereof in the GAP coding sequence is evidence of
peptide, GnRH decapeptide, the proteolytic cleavage differential selective pressure within the gene. This is
site and the N-terminus of GAP. Exon 2 encodes the evident in cases where the identity and similarity of GnRH
central portion of GAP and exon 3 encodes the C terminus and GAP coding sequences have been compared for
of GAP. mRNAs of different GnRH genes within a species [9,16].
Middle-East J. Sci. Res., 10 (3): 332-341, 2011
336
Phylogenetic Analyses: Phylogenetic analyses were (ctenopharyngodon idella, EU981284.1). The GnRH-II
performed to establish an evolutionary context for the precursor encoded by cDNAs contained 84 amino acid
GnRH-II and GnRH-III gene. Genetic distances (measured residues. The GnRH-II precursor was composed of a 24
as substitutions per site) showed moderate low values amino acids signal peptide, GnRH-II decapeptide and a 47
and the topology was well-supported by strong bootstrap amino acids GAP linked by the processing site (Gly-Lys-
values. As expected, GnRH-II and GnRH-III in hard lipped Arg) (Figure. 2A).
barb was included within a sub-cluster of the carp The nucleotide sequence identity of GnRH-III cDNAs
(cyprinus carpio, carrasius auratus) with high bootstrap was 95% with goldfish(carrasius Auratus, AB017271.1),
values (Figure 7). 94 % with carp (cyprinus carpio, AF521130.2) 92 % with
DISCUSSION (ctenopharyngodon idella, EU981295.1) and 91% with
This paper reports the clone of two differing GnRH-III precursor encoded by cDNAs contained 95
cDNAs encoding the GnRH-II and GnRH-III from brain amino acid residues. The GnRH-III precursor was
tissues of hard lipped barb for the first time. composed of a 23 amino acids signal peptide, GnRH-III
Comparison the GnRH-II gene structure with decapeptide and a 59 amino acids GAP linked by the
previously reported gene structures of other fish species processing site (Gly-Lys-Arg) (Figure 2B). The structure
shows a high conservation of exon size (Figure 4). The characteristics of GnRH-II and GnRH-III precursors in
nucleotide sequence identity of GnRH-II cDNAs was 96% Hard Lipped Barb are similar with the other GnRH
with carp (cyprinus carpio AY189961.1), 95 % with variants. The results showed that GnRH-II gene and other
goldfish (carrasius auratus, U30386.1), 94 % with roach GnRH genes might evolve from a common ancestral
(rutilus rutilus, U60668.1) and 94% with grass carp molecule.
roach (rutilus rutilus, U60667.1), 92% with grass carp
zebrafish (Danio Rerio, AY557019.1) (Figure.5). The
Fig. 4: Nucleotides alignment and BLAST of GnRH-II cDNA in hard lipped barb with another teleost.
Middle-East J. Sci. Res., 10 (3): 332-341, 2011
337
Fig. 5: Nucleotides alignment and BLAST of GnRH-III cDNA in hard lipped barb with another teleost.
From this result showed that Hard-lipped barb had a The amino acid sequences of common carp GnRH-III
high similarity with carp and goldfish. For the GnRH-II precursors encoded by cDNA were compared with that of
maximum identity were cyprinus carpio (96%) and for the some identified GnRH-II precursors (table 6B), such as the
GnRH-III maximum identity were carrasius auratus (95%). precursors of teleost fishes roach (Rutilus rutilus),
From this result we suggest that hard lipped barb only goldfish (Carassius auratus), carp (Cyprinus carpio),
had two molecule form of GnRH like GnRH-II and GnRH- Zebrafish (danio rerio)..The result showed that the amino
III same with carp [18,26,27] and with goldfish [28-31]. acid homology of GnRH-III precursors between
The amino acid sequences of common carp GnRH-II cyprinoids was 83-94%. However, when comparing with
precursors encoded by cDNA were compared with that of some other teleosts GnRH-III precursors, the amino acid
some identified GnRH-II precursors (table 6A), such as homology of GnRH-III precursors in teleosts was only
the precursors of teleost fishes roach (Rutilus rutilus), 35-64%.
goldfish (Carassius auratus), carp (Cyprinus carpio), The comparison results of amino acid sequences
grass carp (ctenopharyngodon idella), Zebrafish (danio of GnRH-II and GnRH-III precursors from different
rerio)..The result showed that the amino acid homology vertebrates showed that the GnRH-II and GnRH-III
of GnRH-II precursors between cyprinoids was 84-97%. decapeptide and adjacent processing site (Gly-Lys-Arg)
However, when comparing with some other teleosts were very conservative. A signal peptide is a peptide
GnRH-II precursors, the amino acid homology of GnRH-II chain that directs the transport of a protein. So,
precursors in teleosts was only 40-67%. both the encoding characteristic of GnRH-II and
Middle-East J. Sci. Res., 10 (3): 332-341, 2011
338
(A)
(B)
Fig. 6: Amino acids alignment of GnRH cDNA in hard lipped barb with another teleost. A: Amino acids alignment of
GnRH-II cDNA and B: Amino acids alignment of GnRH-III cDNA.
GnRH-III cDNA decapeptide and processing site Subgroup I contains GnRH-II from goldfish (carrasius
were entirely conservative in vertebrate evolution. auratus), carp (cyprinus carpio), sub group II from nila
However, the amino acid divergence of GnRH-II and (orechromus nilaticus) until thunus thunus, and third
GnRH-III signal peptide and GAP between subgroup were lates (Figure.7). This phylogenetic trees
vertebrates from different evolution lineages was means that hard lipped barb were evolution from carp
much higher than that between neighboring species. (cyprinus carpio).
Then, it was presumed that the function of GnRH-II and Phylogenetic analysis shows that GnRH-III
GnRH-III peptide might change in different evolution can be separated into 3 major groups. Subgroup I
lineages for adapting the natural selection during contains GnRH-III from goldfish (carrasius auratus),
evolution. carp (cyprinus carpio), sub group II from nila
The present study is the first description of (orechromis nilaticus) and third subgroup were
GnRH-II and GnRH-III genes in hard lipped barb, thunnus thunnus (Fig.7). This phylogenetic trees
providing new evolutionary information on this gene means that hard lipped barb were evolution from the other
family in the brain. GnRH-II and GnRH-III in hard teleost such as goldfish (carrasius auratus) and carp
lipped barb is grouped together with other teleost in (cyprinus carpio). For GnRH-II and GnRH-III are similar to
the phylogenetic tree, suggesting a common ancestor teleost GnRH, indicated they also have some same
for both groups of genes. Phylogenetic analysis shows features and function, for example with pejjerey [7] and
that GnRH-II can be separated into 3 major groups. carp [27].
Middle-East J. Sci. Res., 10 (3): 332-341, 2011
339
Fig. 7: Phylogenetic relationship of precursors derived from known amino acid encoding gonadotropin-releasing
hormone (GnRH). The relationship was generated with CLUSTAL W and the unrooted tree was generated using
Treeview version 1.5.2. The scale bar represents the estimated evolutionary distance as 0.1 amino acid
substitutions per site.
In summary, the present work has reported for the Coregonus clupeaformis:
first time the genomic DNA and cDNA sequence of two AY245102; Cyprinus carpio: AY147400; Danio rerio:
GnRH variants in an Hard-lipped barb, the phylogenetic AF511531; Dicentrarchus labrax: AF224281; Macaca
results presented in this work support the idea that all mulatta: AF097356; Micropogo- nias undulatus:
GnRH genes share the same basic structure. That was AY324669; Monopterus albus: AY786183; Morone
meaning GnRH-II and GnRH-III in Hard lipped barb saxatilis: AF056313; Mugil cephalus: AY373451;
very conserve, that assumed had a same function with Odontesthes bonariensis: AY744687; Oncorhynchus
another teleost. We also suggest that hard lipped barb mykiss: AF125973; Oreochromis niloticus: AB101666;
only had two molecule form of GnRH type like GnRH-II Oryzias latipes: AB041330; Rutilus rutilus: U60668; Sci-
and GnRH-III. aenops ocellatus: AY677171; Sparus aurata: U30325;
ACKNOWLEDGEMENTS AF193516; Tupaia belangeri: U63327; Typhlonectes
This work was supported by the Sandwich Grant from
Gadjah Mada University Indonesia in colaboration with GnRH III clade: Carassius auratus: AB017271;
Nara Institute Science and Technology Japan. Also Coregonus clupeaformis: AY245103; Cyprinus
Thanks to Dr. Chio Oka and dr. Supandji from their carpio: AY189960; Danio rerio: NM_182887;
assistance and knowledge. Dicentrarchus labrax: AF224280; Micropogonias
APPENDIX 1 Mugil cephalus: AY373449; dontesthes bonariensis:
Accession numbers of the GnRH sequences from Oreochromis niloticus: AB101667; Oryzias latipes:
teleost fishes, downloaded from GenBank. AB041332; Pagrus major: D26108; Porichthys
GnRH II clade: Anguilla japonica: AB026990; X79709; Salmo trutta: X79713: AB047325; Sparus aurata:
Carassius auratus: U30386; Clarias gariepinus: X78047; U30311.
Suncus murinus: AF107315; Trichosurus vulpecula:
natans: AF167558; Verasper moseri: AB066359.
undulatus: AY324670; Monopterus albus: AY858055;
AY744688; Oncorhynchus mykiss: AF232212;
notatus: U41669; Rutilus rutilus: U60667; Salmo salar:
Middle-East J. Sci. Res., 10 (3): 332-341, 2011
340
REFERENCES 11. Sherwood, N.M., L. Eiden, M. Brownstein, J. Spiess,
1. Gibson, M.J., T.J. Wu, G.M. Miller and
A.J. Silverman, 1997. What natures knockout teaches
us about GnRH activity: Hypogonadal mice and
neuronal grafts. Horm Behav., 31: 212-20.
2. Sayed, A.M., Y.F. Mohammad and B.K. Froud,
2010. Effect of GnRHa(D-ala6, des-gly10
mGnRHa) LHRHa(des-gly10, D-ala6 LH-RH
Ethylamid) and carp pituitary in Artificial
propagation og Gattan, Barbus Xantrovetus
(Heckel,1843). World Journal of Fish and Marine
Science, 2(4): 280-284.
3. Gharaei, A., R. Abdolali and G. Mostafa, 2011.
Induced Spawning of Schizothorax zarudnyi
(Cyprinidae) By Using Synthetic Hormones (Ovaprim
and HCG). World Journal of Fish and Marine
Sciences, 3(6): 518-522.
4. Matsuo, H., Y. Baba, R.M.G. Nair, et al. 1971.
Structure of the porcine LH- and FSH-releasing
hormone (I). The proposed amino acid sequence,
Biochem. Biophys. Res. Commun., 43: 1334-1339.
5. Yaron, Z., 1995. Endocryne control of gametogenesis
and spawning induction in the carp. Aquaculture,
129: 49-73.
6. Kah, O., C. Lethimonier, G. Somoza, L.G. Guilgur,
C. Vaillant and J.J. Lareyre 2007. GnRH and GnRH
receptors in metazoa: A historical, comparative and
evolutive perspective. Gen Comp Endocrinol.,
153: 346-364.
7. Leonardo, G. Guilgur, Guillermo Orti, Pablo H. Strobl-
Mazzulla, Juan I. Fernandino, Leandro A. Miranda
and Gustavo M. Somoza, 2007. Characterization
of the cDNAs Encoding Three GnRH Forms
in the Pejerrey Fish Odontesthes bonariensis
(Atheriniformes) and the Evolution of GnRH
Precursors. J. Mol. Evol., 64: 614-627.
8. Morgan, K. and R.P. Millar, 2004. Evolution of
GnRH ligand precursors and GnRH receptors in
protochordate and vertebrate species. Gen Comp
Endocrinol., 139: 191-197.
9. White, R. and R. Fernald, 1998. Genomic structure
and expression sites of three gonadotropin-
releasing hormone genes in one species. Gen Comp
Endocrinol., 112: 17-25.
10. Sealfon, S.C., H. Weinstein and R.P. Millar, 1997.
Molecular mechanisms of ligand interaction with
the gonadotropin-releasing hormone receptor.
Endocr. Rev., 18: 180-205.
J. Rivier and W. Vale, 1983. Characterization of a
teleost gonadotropin-releasing hormone. Proc. Natl.
Acad. Sci., USA., 80: 2794-2798.
12. Volkoff, H. and R.E. Peter, 1999. Actions of
two forms of gonadotropin releasing hormone and
GnRH antagonists on spawning behavior of the
goldfish Carassius auratus. Gen Comp Endocrinol.,
116: 347-355.
13. Sherwood, N.M., D.A. Lovejoy and I.R. Coe,
1993. Origin of mammalian gonadotropin-releasing
hormones. Endocr, Rev., 14: 241-254.
14. Muske, L.E., 1998. Evolution of gonadotropin-
releasing hormone (GnRH) neuronal systems. Brain
Behav. Evol., 42: 215-230.
15. Rissman, E.F., X. Li, J.A. King and R.P. Millar, 1997.
Behavioral regulation of gonadotropin-releasing
hormone production. Brain Res. Bull., 44: 459-464.
16. Russell, D. Fernald and Richard B. White,
1999. Gonadotropin-Releasing Hormone Genes:
Phylogeny, Structure and Functions. Frontiersin
Neuroendocrinology, 20: 224-240
17. Troskie, B., N. Illing, E. Rumbak, Y.M. Sun,
J. Hapgood, S. Sealfon, D. Conklin and R. Millar,
1998. Identification of three putative receptor
sub-types in vertebrates. Gen Comp Endocrinol.,
112: 296-302.
18. Wang, L. and H.R. Lin, 1998. Distribution and
variations of sGnRH in discrete brain areas from
common carp (Cyprinus carpio L.) of different ages
and gonad conditions, Zoological Research (in
Chinese), 19(3): 197-202.
19. Adams, B.A., E.D. Vickers, C. Warby, M. Park, W.H.
Fischer, A.G. Craig, J.E. Rivier and N.M. Sherwood,
2002. Three forms of gonadotropin- releasing
hormone, including a novel form, in a basal salmonid,
Coregonus clupeaformis. Biol. Reprod., 67: 232-239.
20. Temple, J.L., R.P. Millar and E.F. Rissman, 2003.
An evolutionarily conserved form of gonadotropin-
releasing hormone coordinates energy and
reproductive behavior. Endocrinology, 144: 13-19.
21. Jaferian, A, M. Mehdi, A.Q. Seyed and J.H. Seyed,
2010. A Simple and Efficient Novel Method for
DNA Extraction from Eleutheronema tetradactylum
(Shaw, 1804). World Journal of Fish and Marine
Science, 2(5).
22. Setaita, H. Sleem and Tarek G. Ali, 2008. Application
of RAPD-PCR in Taxonomy of Certain Freshwater
Bivalves of Genus Caelatura. Global journal of
Moleculer Sciences, 3(1).
Middle-East J. Sci. Res., 10 (3): 332-341, 2011
341
23. Kawaichi, M., 2001. Protocol for Isolation DNA, 28. Kim, M.E., Y. Oka, M. Amano, M. Kobayashi,
Cloning and Sequencing. Gene Function Animal. K. Okuzawa, Y. Hasegawa, S. Kawashima, Y. Suzuki,
NAIST. Japan and Aida, 995. Immunocytochemical localization of
24. Mohamed, S.A. Shabeb, Magdi A.M. Younis and sGnRH and cGnRH-II in the brain of goldfish,
Moustafa A. Nour-Eldein, 2008. Cloning and Carassius auratus. J. Comp Neurol., 356: 72-82.
Induction of E. coli Pyruvate Kinase by IPTG. Global 29. Chik, C.C., C.H. Chow, X.W. Lin, K.W. Dong,
Journal of Moleculer Sciences, 4(2). R.E. Peter and K.L. Yu, 1997. Characterization
25. Magdy, Z. Mattar, E.H. Elsayed, Gamal A. Al-Ameri of two chicken GnRH-II genes in goldfish. In 13th
and H.E.N. Sobhi, 2007. Phylogenetic Relationships International Congress of Comparative Endocri-
among Enterotoxigenic Clinical Staphylococcus nology, Yokohama, Japan, Abstract pp: 4-72.
aureus Isolates. Global Journal of Moleculer 30. Lin, X.W. and R.E. Peter, 1997. Cloning and
Sciences, 2(2). expression pattern of a second [His5Trp7Tyr8]
26. Lin, X.W. and H.R. Lin, 1994. In vitro studies of the gonadotropin-releasing hormone (chicken GnRH-II)
effect of salmon GnRH on the growth hormone mRNA in goldfish: Evidence for two distinct genes,
secretion by the pituitary of common carp (Cyprinus Gen. Comp. Endocrinol., 170: 262-272.
carpio L.), Acta Zoological Sinica (in Chinese), 31. Yu, K.L., N.M. Sherwood and R.E. Peter, 1988.
40(1): 30-38. Differential distribution of two molecular forms of
27. Shuangfei, L., H. Wei, W. Yaping and Z. Zuoyan, gonadotropin-releasing hormone in discrete brain
2003. Cloning and expression analysis in mature areas of goldfish (Carassius auratus). Peptides,
individuals of two chicken type-II GnRH (cGnRH-II) 9: 625-630.
genes in common carp (Cyprinus carpio). Science in
China Ser. C Life Sciences, 47(4): 349-358.