Physiol Genomics 9:1-4, 2002. Doi:10.1152/ physiolgenomics.00105.2001. 25 articles, 13 of which you can access free at: this article cites #BIBL 2 other HighWire hosted articles: this article has been cited by [PDF] [Full Text] [Abstract], September 1, 2003; 20 (9): 1377-1419.
Physiol Genomics 9:1-4, 2002. Doi:10.1152/ physiolgenomics.00105.2001. 25 articles, 13 of which you can access free at: this article cites #BIBL 2 other HighWire hosted articles: this article has been cited by [PDF] [Full Text] [Abstract], September 1, 2003; 20 (9): 1377-1419.
Physiol Genomics 9:1-4, 2002. Doi:10.1152/ physiolgenomics.00105.2001. 25 articles, 13 of which you can access free at: this article cites #BIBL 2 other HighWire hosted articles: this article has been cited by [PDF] [Full Text] [Abstract], September 1, 2003; 20 (9): 1377-1419.
9:1-4, 2002. First published Feb 19, 2002; doi:10.1152/physiolgenomics.00105.
2001 Physiol Genomics
J. T. Streelman and T. D. Kocher expression and growth of salt-challenged tilapia Microsatellite variation associated with prolactin You might find this additional information useful... 25 articles, 13 of which you can access free at: This article cites http://physiolgenomics.physiology.org/cgi/content/full/9/1/1#BIBL 2 other HighWire hosted articles: This article has been cited by
[PDF] [Full Text] [Abstract] , September 1,2003; 20(9): 1377-1419. Mol. Biol. Evol. Romano G. A. Wray, M. W. Hahn, E. Abouheif, J. P. Balhoff, M. Pizer, M. V. Rockman and L. A. The Evolution of Transcriptional Regulation in Eukaryotes
[PDF] [Full Text] [Abstract] , June 1,2004; 21(6): 991-1007. Mol. Biol. Evol. Y.-C. Li, A. B. Korol, T. Fahima and E. Nevo Microsatellites Within Genes: Structure, Function, and Evolution including high-resolution figures, can be found at: Updated information and services http://physiolgenomics.physiology.org/cgi/content/full/9/1/1 can be found at: Physiological Genomics about Additional material and information http://www.the-aps.org/publications/pg This information is current as of June 20, 2006 .
http://www.the-aps.org/. American Physiological Society. ISSN: 1094-8341, ESSN: 1531-2267. Visit our website at July, and October by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright 2005 by the techniques linking genes and pathways to physiology, from prokaryotes to eukaryotes. It is published quarterly in January, April, publishes results of a wide variety of studies from human and from informative model systems with Physiological Genomics
o n
J u n e
2 0 ,
2 0 0 6
p h y s i o l g e n o m i c s . p h y s i o l o g y . o r g D o w n l o a d e d
f r o m
brief communication Microsatellite variation associated with prolactin expression and growth of salt-challenged tilapia J. T. STREELMAN AND T. D. KOCHER Hubbard Center for Genome Studies, University of New Hampshire, Durham, New Hampshire 03824 Received 6 November 2001; accepted in nal form 11 February 2002 Streelman, J. T., and T. D. Kocher. Microsatellite vari- ation associated with prolactin expression and growth of salt-challenged tilapia. Physiol Genomics 9: 14, 2002. First published February 19, 2002; 10.1152/physiolgenomics. 00105.2001.Biologists have long argued that runs of alter- nating purines and pyrimidines could form alternative DNA structures, which might regulate transcription. Here, we report that simple sequence repeat polymorphisms in the tilapia prolactin 1 (prl 1) promoter are associated with dif- ferences in prl 1 gene expression and the growth response of salt-challenged shes. Individuals homozygous for long mic- rosatellite alleles express less prl 1 in fresh water but more prl 1 in half-seawater than shes with other genotypes. Our work provides the rst in vivo evidence that differences in microsatellite length among individuals may indeed affect gene expression and that variance in expression has concom- itant physiological consequences. These results suggest that dinucleotide microsatellites represent an under-appreciated source of genetic variation for regulatory evolution. dinucleotide repeats; gene expression; promoter; evolution TILAPIA ARE AMONG the worlds most important aquacul- tural nshes (13). A multitude of studies have ad- dressed means to grow bigger tilapia faster, experiment- ing with water temperature, salinity, hybridization, and administration of growth-promoting hormones. Notably, tilapiine species differ in salt tolerance and growth re- sponse in different salinities (20). A great deal is known about the role of peptide hormones in sh osmoregulation. Prolactin is a mem- ber of the growth hormone (GH)/Prl gene family whose freshwater adapting role is to increase plasma osmo- lality by reducing gill Na
-K
-ATPase activity (15).
The tilapiine pituitary produces two forms of prolactin, encoded by different genes (prl 1 and prl 2) that differ in both molecular mass (24 and 20 kDa) and number of amino acid residues (188 and 177; Ref. 25). These two forms are roughly 70% identical at the amino acid level and appear to have differential osmoregulatory (1) and somatotropic (17) actions. Experiments suggest that as shes move into saline environments, both prolactin mRNAs and serum levels decrease; this effect is more dramatic for prl 1 (2). The tilapia prl 1 promoter (21) shares noncanonical elements with that of rat. Both promoters have two (CA/GT) n microsatellites interspersed among putative binding sites for the pituitary-specic transcription factor Pit-1 (Fig. 1). Naylor and Clark (12) demon- strated in rat that these repeat sequences formed left- handed Z-DNA in vitro and repressed prl 1 expression. We reasoned that similar regulatory effects might exist in the tilapia prl 1 promoter. Individual differences in microsatellite length might affect prl 1 expression in vivo and might contribute to known variance in salt tolerance and growth at different salinities. Despite the textbook interpretation that noncoding simple sequence repeats evolve in a neutral fashion, recent reports have indicated otherwise (11, 24). In fact, the abundance and position of dinucleotide micro- satellites in eukaryotic genomes coupled with a high rate of mutation suggest a potential and pervasive role in gene regulation (9). Here, we used a natural system to evaluate the association between dinucleotide mic- rosatellite variation, quantitative differences in gene expression and the physiological response to contrast- ing environments. METHODS We initially concentrated on the microsatellite closest to the start of prl 1 transcription (200 bp). We crossed females of Oreochromis mossambicus (salt-adapted) with an O. nil- oticus (freshwater-adapted) male carrying microsatellite al- leles that differed by 17 repeat units (CA 31 vs. CA 14 ). O. mossambicus dams were homozygous for long alleles and the O. niloticus sire was a heterozygote. F 1 individuals were selected for breeding such that there were three genotypes to follow in the F 2 generation: homozygotes for short alleles Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org). Address for reprint requests and other correspondence: J. T. Streelman, Hubbard Center for Genome Studies, Univ. of New Hampshire, 35 Colovos Road, Durham, New Hampshire 03824 (E-mail: jts3@hopper.unh.edu). Physiol Genomics 9: 14, 2002. First published February 19, 2002; 10.1152/physiolgenomics.00105.2001. 1094-8341/02 $5.00 Copyright 2002 the American Physiological Society 1
o n
J u n e
2 0 ,
2 0 0 6
p h y s i o l g e n o m i c s . p h y s i o l o g y . o r g D o w n l o a d e d
f r o m
(hereafter SS), homozygotes for long alleles (LL), and het- erozygotes (SL). Seventy-ve F 2 shes from the same brood were raised in three salinity treatments in separate 200-liter tanks: freshwater [0 parts per thousand (ppt) NaCl], 16 ppt, and seawater (32 ppt). Two-week-old fry were acclimated to treatments over a period of 3 days and maintained until sh mass averaged 15 g (6 mo). Within salt treatments, all three genotypes were grown in the same tank. Fishes were killed, sexed, and weighed. Pituitaries were harvested and stored at 20C in RNAlater (Ambion) until RNA extraction. Pituitary Prl 1 gene expression was measured from F 2 individuals (cDNA preparations) using real-time PCR (8) with B-actin as a reference. Primers and probes were de- signed using Primer Express (version 1.5, Applied Biosys- tems). Probe binding sites were located at intron-exon bound- aries to prevent amplication of genomic DNA. Probes were uorescently labeled at the 3 end. Fluorescence was moni- tored during 40 cycles of PCR on a GeneAmp 5700 sequence detection system (Applied Biosystems; 95C for 15 s, 55C for 30 s, and 65C for 1 min). Critical cycle number was determined when uorescence exceeded a threshold value set close to the background. Prl 1 relative gene expression was determined according to the formula 2 B-actin CT Prl 1 CT where CT is the critical cycle number. Real-time PCR primer and probe sequences are: F primer, cccatcaacgaactgttcga; R primer, gcatgatcaccctgcctat- agg; probe, ctcacccaggagctggactctcacttccctc. F 2 individuals were genotyped as described (10) or by a Sac II restriction fragment length polymorphism (RFLP) in prl 1 cDNA, which distinguishes parental alleles. Differences among genotypes per treatment and treatments per genotype were evaluated by one-way ANOVA and appropriate post hoc multiple com- parison tests. RESULTS AND DISCUSSION Females were larger than males across all salinity treatments but did not differ from males in prl 1 expression. Mean sh mass increased with increasing salinity (P 8.4 10 06 ). Expression differed among genotypes at 0 ppt (P 0.006); SS individuals ex- pressed approximately two times and seven times as much prl 1 as SL and LL shes, respectively (Fig. 2A; Table 1). Expression differed among genotypes at 16 ppt (P 0.0005) with a nearly opposite pattern to that seen in freshwater; individuals of genotype LL ex- pressed twice as much prl 1 as did shes of genotypes Fig. 1. Schematic representation of the tilapia prl 1 promoter region. Identica- tion of putative transcription factor bind- ing sites (e.g., Pit 1) follows Ref. 21. Fig. 2. Prl 1 expression and sh mass differ across salt treatments. Graphs in AD depict means 1SE. The y-axes of A, B, and E are normalized Prl 1 expres- sion levels determined according to the formula 2 B-actinCTPrl 1CT where CT is the critical cycle number. *P 0.05 and **P 0.005, levels of signicance from Tukeys post hoc multiple comparison tests (see Table 1 for explanation). 2 MICROSATELLITES AND GENE EXPRESSION Physiol Genomics VOL 9 www.physiolgenomics.org
o n
J u n e
2 0 ,
2 0 0 6
p h y s i o l g e n o m i c s . p h y s i o l o g y . o r g D o w n l o a d e d
f r o m
SS and SL (Fig. 2B, Table 1). Notably, LL individuals were only one-half as big as those of other genotypes at 16 ppt (Fig. 2D, Table 1). There were no differences among genotypes in either prl 1 expression or sh mass at 32 ppt (Table 1). We detected signicant genotype environment inter- actions. For all genotypes, both prl 1 expression and mass differed across salt treatments (SS, P 1.5 10 05 and P 0.03; SL, P 3.8 10 06 and P 0.008; LL, P 0.0008 and P 0.06; for expression and mass, respec- tively). Individuals of genotype SS and SL showed dra- matic decreases (10 fold) in prl 1 expression from0 to 16 ppt. This response was not nearly as apparent for geno- type LL (Fig. 2E). Each genotype grew best at a different salinity treatment (Fig. 2F), and mean growth of geno- types was inversely correlated with mean prl 1 expres- sion across salinities (SS, r 2 0.957; SL, r 2 0.971; LL, r 2 0.530). Figure 2, E and F, demonstrates divergent norms of reaction for each genotype in response to exter- nal salt concentration. In natural populations, these crossover interactions are prima facie evidence for the adaptive maintenance of genetic variation in uctuating environments (5). The possibility that runs of alternating purines and pyrimidines might affect gene expression was sug- gested nearly 20 years ago (6, 7, 14). We speculate that repeats of varying length can induce promoter confor- mations that differ in their ability to bind transcrip- tional regulators. There is good evidence that tilapia prl 1 expression is regulated in response to plasma osmolality (18), perhaps via interactions with Pit-1. Long prl 1 microsatellite alleles may thus act as insu- lators, restricting access of enhancers (freshwater) and repressors (saltwater) to Pit-1 sites. The similarity between our results and those of Nay- lor and Clark (12) are both unexpected and uncanny, suggesting either the conservation of a regulatory func- tion for CA/GT microsatellites in the prl promoter over 400 million years of vertebrate evolution or the con- vergent acquisition of this biological role. Numerous reports have conrmed that variably sized simple se- quence repeats in eukaryotic promoters can elicit dif- ferential expression when cloned into vectors (7, 12, 19, 22). Shimajiri et al. (19) indicate that the matrix met- alloproteinase gene is downregulated by shortening of a promoter microsatellite. Interestingly, Tae et al. (22) report that the negative effect of a dinucleotide repeat in the acetyl-CoA carboxylase gene is CAAT box depen- dent and can be overcome by the presence of CAAT enhancer binding protein. These studies suggest that there is no general trend in the direction of effects induced by microsatellite mutation (e.g., enhancer or repressor) and that such effects are likely to be com- plicated by the cellular milieu. Because F 2 shes are not isogenic lines segregating for different microsatellite alleles, we cannot formally exclude the possibility that the alleles we followed are in linkage disequilibrium with an unmeasured, causal polymorphism. However, sequence from 1.2 kb of the prl 1 promoter in SS vs. LL individuals revealed no consistent substitutions in known regulatory element binding sites. In fact, additional sequence differences in this region are found in the second simple sequence repeat 800 bp upstream of the start codon (Fig. 1). Individuals of genotype SS had shorter alleles (ho- mozygous for GT 14 ) than LL shes (homozygous for GT 39 ). Taken together, both microsatellites in the prl 1 promoter of SS shes are less than half the size of the corresponding sequence in LL individuals, a pattern of positive covariance contrasting with data from other bony shes (4). It is possible that the simple sequence repeats in the prl 1 promoter physically interact with one another to elicit transcriptional change. The negative correlation between prl 1 expression and sh mass is more difcult to explain. Prolactin and GH are activated by Pit-1 in distinct pituitary cell lineages (3), and these hormones have antagonistic affects on sh osmoregulation (16). Our data do not discern whether growth effects are mediated via osmo- regulatory differences or transcriptional inhibition/in- terconversion of GH-expressing somatotropes by Prl- expressing lactotropes. From an evolutionary perspective, our results run counter to the textbook interpretation that dinucle- otide microsatellite variation lacks functional conse- quences. These loci are rapidly evolving and ubiquitous components of eukaryotic genomes. Found preferen- tially in noncoding DNA (23), dinucleotide repeats pro- vide a cellular means to alter the amount of gene product among individuals without changing amino acid sequence. The association of microsatellites with a long list of transcription factors and environmentally Table 1. Summary of data discussed in the text Salt Genotype Expression Signicance Mass, g Signicance Freshwater (0 ppt) SS 14.383.56 7.751.47 SL 7.961.47 10.561.42 LL 2.750.38 P 0.05 9.941.19 16 ppt SS 0.660.08 16.692.3 SL 0.660.07 15.261.8 LL 1.370.13 P 0.005 8.770.22 P 0.05 32 ppt SS 0.220.11 15.02.38 SL 0.150.04 16.741.04 LL 0.120.04 14.321.72 Values for Expression and Mass are means 1SE, respectively. Signicance values are the results of Tukeys post hoc multiple comparison tests. For instance, in the freshwater treatment, genotype LL exhibits signicantly less Prl 1 expression than the other two genotypes, which do not differ signicantly from one another. SS, short alleles; LL, long alleles; SL, heterozygotes; ppt, parts per thousand. 3 MICROSATELLITES AND GENE EXPRESSION Physiol Genomics VOL 9 www.physiolgenomics.org
o n
J u n e
2 0 ,
2 0 0 6
p h y s i o l g e n o m i c s . p h y s i o l o g y . o r g D o w n l o a d e d
f r o m
regulated genes suggests an under-appreciated role in the ne-scale modulation of gene expression. Research was supported by NSF/Alfred P. Sloan Foundation Grant DBI-9803946 and USDA/NRICGP Grant 00352059267 to J. T. Streelman. REFERENCES 1. Auperin B, Rentier-Delrue F, Martial JA, and Prunet P. Evidence that two tilapia prolactins have different osmoregula- tory functions during adaptation to a hyperosmotic environment. J Mol Endocrinol 12: 1324, 1994. 2. Ayson FG, Kaneko T, Hasegawa S, and Hirano T. Differen- tial expression of two prolactin and growth hormone genes dur- ing early development of tilapia (Oreochromis mossambicus) in fresh water and seawater: implications for possible involvement in osmoregulation during early life stages. Gen Comp Endocrinol 95: 143152, 1994. 3. Dasen JS and Rosenfeld MG. Combinatorial codes in signal- ing and synergy: lessons from pituitary development. Curr Opin Genet Dev 9: 566574, 1999. 4. Dermitzakis ET, Clark AG, Batargias C, Magoulas A, and Zouros E. Negative covariance suggests mutation bias in a two-locus microsatellite system in the sh Sparus aurata. Ge- netics 150: 15671575, 1998. 5. Gillespie JH and Turelli M. Genotype-environment interac- tions and the maintenance of polygenic variation. Genetics 121: 129138, 1989. 6. Hamada H, Petrino MG, and Kakunaga T. A novel repeated element with Z-DNA-forming potential is widely found in evolu- tionary diverse eukaryotic genomes. Proc Natl Acad Sci USA 79: 64656469, 1982. 7. Hamada H, Seidman M, Howard BH, and Gorman CM. Enhanced gene expression by the poly(dT-dG)-poly(dC-dA) se- quence. Mol Cell Biol 4: 26222630, 1984. 8. Heid CA, Stevens J, Livak KJ, and Williams PM. Real time quantitative PCR. Genome Res 6: 986994, 1996. 9. Kashi Y, King D, and Soller M. Simple sequence repeats as a source of quantitative genetic variation. Trends Genet 13: 7478, 1997. 10. Lee WJ and Kocher TD. Microsatellite mapping of the prolac- tin locus in the tilapia genome. Anim Genet 29: 6869, 1998. 11. Majewski J and Ott J. GT repeats are associated with recombina- tion on human chromosome 22. Genome Res 10: 11081114, 2000. 12. Naylor LHand Clark EM. d(TG)n-d(CA)n sequences upstream of the rat prolactin gene form Z-DNA and inhibit gene transcrip- tion. Nucleic Acids Res 18: 15951601, 1990. 13. Naylor RL, Goldburg RJ, Primavera JH, Kautsky N, Bev- eridge MC, Clay J, Folke C, Lubchenco J, Mooney H, and Troell M. Effects of aquaculture on world sh supplies. Nature 405: 10171024, 2001. 14. Nordheim A and Rich A. The sequence (dC-dA)n-(dG-dT)n forms left-handed Z-DNA in negatively supercoiled plasmids. Proc Natl Acad Sci USA 80: 18211825, 1983. 15. Sakamoto T, Shepherd BS, Madsen SS, Nishioka RS, Si- harath K, Richman NH III, Bern HA, and Grau EG. Osmo- regulatory actions of growth hormone and prolactin in an ad- vanced teleost. Gen Comp Endocrinol 106: 95101, 1997. 16. Seidelen M and Madsen SS. Prolactin antagonizes the seawa- ter adaptive effect of cortisol and growth hormone in anadro- mous brown trout. Zoo Sci 14: 249256, 1997. 17. Shepherd BS, Sakamoto T, Nishioka RS, Richman NH III, Mori I, Madsen SS, Chen TT, Hirano T, Bern HA, and Grau EG. Somatotropic actions of the homologous growth hormone and prolactins in the euryhaline teleost, the tilapia Oreochromis mossambicus. Proc Natl Acad Sci USA 94: 20672072, 1997. 18. Shepherd BS, Sakamoto T, Hyodo S, Nishioka RS, Ball C, Bern HA, and Grau EG. Is the primitive regulation of pituitary prolactin (tPRL177 and tPRL188) secretion and gene expression in the euryhaline tilapia (Oreochromis mossambicus) hypothalamic or environmental? J Endocrinol 161: 121129, 1999. 19. Shimajiri S, Nobuyuki A, Tanimoto A, Murata Y, Hamada T, Wang KY, and Sasaguri Y. Shortened microsatellite d(CA)21 sequence down-regulates promoter activity of matrix metalloproteinase 9 gene. FEBS Lett 455: 7074, 1999. 20. Suresh AV and Lin CK. Tilapia culture in saline waters: a review. Prog Fish Cult 448: 161167, 1992. 21. Swennen D, Poncelet AC, Sekkali B, Rentier-Delrue F, Martial JA, and BelayewA. Structure of the tilapia (Oreochro- mis mossambicus) prolactin I gene. DNA Cell Biol 11: 673684, 1992. 22. Tae HJ, Luo X, and Kim KH. Roles of CCAAT/enhancer binding protein and its binding sites on repression and derepres- sion of acetyl-CoA carboxylase gene. J Biol Chem 269: 10475 10484, 1994. 23. To th G, Ga spa` ri Z, and Jurka J. Microsatellites in different eukaryotic genomes: survey and analysis. Genome Res 10: 967 981, 2000. 24. Turpeinen T, Tenhola T, Manninen O, Nevo E, and Nissila E. Microsatellite diversity associated with ecological factors in Hordeum spontaneum populations in Israel. Mol Ecol 10: 1577 1591, 2001. 25. Yamaguchi K, Specker JL, King DS, Yokoo Y, and Ni- shioka RS. Complete amino acid sequence of a pair of sh (tilapia) prolactins, tPRL177 and tPRL188. J Biol Chem 263: 91139121, 1988. 4 MICROSATELLITES AND GENE EXPRESSION Physiol Genomics VOL 9 www.physiolgenomics.org
o n
J u n e
2 0 ,
2 0 0 6
p h y s i o l g e n o m i c s . p h y s i o l o g y . o r g D o w n l o a d e d