Similarity between language of nature and language of computers

I attended 2014 summer school at the Center for Computational Biology and Bioinformatics (CCBB) at
University of Texas, Austin. I was overwhelmed by my first experience with intense course on computer
programming languages (I am a geneticist). Summer school at CCBB helped me a lot in understanding
the bioinformatics (interdisciplinary field combining biology and computer science) but more
importantly, on the second day of my class when the instructor talked about ASCII (American Standard
Code for Information Interchange) which is code of ones and zeros that make binary or computer
language, it occurred to me (and its very apparent to anyone who is a biologist/geneticist) that the
similarity between basic structure of language of nature which is A, T, G and C (four letters or
nucleotides) and language of computer (1 and 0) is fascinating.
Let me first explain the way natures language (genetic code) works. DNA is a long chain or linear
polymer of four nucleotides A, T, G and C (Adenine, thymine, Guanine and Cytosine). Specific sequence
of these nucleotides, generally thousands of them, make a gene. This sequence of nucleotides/ gene,
codes for specific protein which has specific function in cells of living beings. Humans have about 20,000
different genes (exact number is still debated) that code for hundreds of thousands of proteins using
various combinations of nucleotides and make us human. Each and every well defined living thing on the
planet Earth is coded by different combinations of nucleotides A, T, G and C making different genes
(sometimes similar between and among different species) and produce the incredible diversity that we
find on this planet; millions of species of plants and animals and microorganisms like bacteria, fungi and
viruses.

Source: "RNA-codons" by TransControl -
http://en.wikipedia.org/skins-
1.5/common/images/magnify-clip.png. Licensed
under Creative Commons Attribution-Share Alike
3.0 via Wikimedia Commons -
http://commons.wikimedia.org/wiki/File:RNA
codons.png#mediaviewer/File:RNA-codons.png

U (Uracil) in RNA is T (Thymine) in DNA

To be more specific the way genetic code works is that nucleotide sequences are read in triplets (known
as codons), for example if the sequence of gene is ATGCTAGCGGCTAATCCGTACTAGATACCGAATAG,
ATG would be read as its first codon which codes for a specific amino acid (building blocks of protein).
ATG is very special code because it generally is place where protein synthesis begins (start codon), i.e. it
indicates start of a gene. Similarly, there is a code which tells where to stop protein synthesis (stop
codon) or end of a gene along long DNA molecule. Sequence between the start and stop codon codes
for different proteins for different metabolic function. Reading these start and stop codon along the
genome of organisms using computer programs, bioinformaticians predict number of genes in an
organisms genome.









Source: http://leavingbio.net/heredity-higher%20level.htm
Start codon ATG or AUG indicates
start of a gene and stop codon TAA or
UAA indicated termination of a gene.



Genetic code chart
Source: http://courses.bio.indiana.edu/L104-Bonner/F11/imagesF11/Genetics_MPs/MPs.html

The genetic code work in very similar way as computer code/ASCII. In computer codes, for example, the
combination of zeros and ones make code for alphabets or instructions given through keys. To be more
specific, if you type F on your computer, the binary code in which computer stores or recognize it is
1000110. Apart from all the alphabets, ASCII has defined binary code for numbers and special
characters. Not only that, there is a binary code defined by ASCII for space between words and new
line as well.


Even with this fundamentally similar principle (use of simple notations to code for more complex things)
behind ASCII and genetic code, it is surprising to me that ASCII was not inspired by the genetic code,
rather, ASCII was developed from manual telegraphic codes dating way back from the discovery of
genetic code. It is interesting to note that technology we developed and evolved is based on similar
principle on which we ourselves are evolved. It is very tempting to speculate that the way simple A, T, G
and C has given rise to intelligence in form of extremely complex brains through evolution for millions of
years, the computer coding might give rise to an artificial intelligence given sufficient time and training
to the machines. Proponents of Intelligent design might say that the way ASCII, which is created by
humans, can give rise to artificial intelligence, we humans ourselves are also creation of something
superior, however, I do not subscribe to or advocate this idea.
A chart of ASCII
from a 1972
printer manual.
Source: Wikipedia
http://en.wikipe
dia.org/wiki/AS
CII