PET28a-LIC vector is used for expression of recombinant proteins with the addition of a 19 amino acid N-terminal fusion tag containing a 6X his-tag followed by a thrombin protease cleavage site. Two stop codons are included in the vector at the cloning site.
PET28a-LIC vector is used for expression of recombinant proteins with the addition of a 19 amino acid N-terminal fusion tag containing a 6X his-tag followed by a thrombin protease cleavage site. Two stop codons are included in the vector at the cloning site.
PET28a-LIC vector is used for expression of recombinant proteins with the addition of a 19 amino acid N-terminal fusion tag containing a 6X his-tag followed by a thrombin protease cleavage site. Two stop codons are included in the vector at the cloning site.
Description The pET28a-LIC vector was derived from expression plasmid pET28a (Novagen). It is used for T7 promoter driven expression of recombinant proteins with the addition of a 19 amino acid N-terminal fusion tag containing a 6X His-tag followed by a thrombin protease cleavage site. Two stop codons are included in the vector at the C-terminal cloning site.
Antibiotic resistance Kanamycin, 50 ug/ml Promoter T7 - lacO Cloning Methods Insertion of DNA sequence into the cloning/expression region is preformed using BD-Biosciences Infusion enzyme mediated directional recombination between complementary 15 nucleotide DNA sequences at the ends of the insert (PCR product) and BseRI linearized vector. Insertion of target sequence involves replacement of a SacB gene stuffer sequence, which provides for negative selection of the original plasmid on 5% sucrose. Initiation Codon NcoI site in vector at 5071 bp N terminal fusion sequence MGSSHHHHHHSSGLVPRGS
Termination codons TGATGA included in 3 PCR primer and vector cloning site. No amino acid residues added at cloning junction Additional features 5 primer for amplification of insert 5 GTT CCG CGT GGT AGT --- 3
5 primer for amplification of insert without tag for NcoI/BseRI cloning 5 AAG AAG GAG ATA TAC CAT G --- 3 3 primer for amplification of insert 5 CAA GCT TCG TCA TCA --- 3
5 sequencing primer T7- Fwd 5 AATTAATACGACTCACTATAGGG 3 3 sequencing primer T7- Rev 5 ATGCTAGTTATTGCTCAGCGG 3
pET28a-LIC vector map
T7 promoter 4984-5000 N-terminal tag coding sequence 5071-5127 N-terminal cloning site 5113-5127 C-terminal cloning site 7143-7157 T7 terminator 7257-7303 f1 origin 12-467 aph coding sequence 563-1375 pBR322 origin 2084 lacI coding sequence 3518-4597 sacB coding sequence 5649-7067
T7 promoter T7 Terminator Kan Resistance ori lacI SacB gene NcoI (5069) BglII (4964) BseRI (5138) BseRI (7127) HindIII (7151) XhoI (7166) XbaI (5030) f1 origin N-terminal tag pET28a-LIC 7328 bp
pET28a-LIC cloning/expression region
T7 FWD lac operator ~~~~~~~~~~~~~~~ 4968 ct cgat cccg cgaaat t aat acgact cact at aggggaat t gt gagcgga gagct agggc gct t t aat t a t gct gagt ga t at cccct t a acact cgcct
~~~~~~~~~~ 5018 t aacaat t cc cct ct agaaa t aat t t t gt t t aact t t aag aaggagat at at t gt t aagg ggagat ct t t at t aaaacaa at t gaaat t c t t cct ct at a
NcoI M G S S H H H H H H S S G L V P 5068 accat gggca gcagccat ca t cat cat cat cacagcagcg gcct ggt t cc t ggt acccgt cgt cggt agt agt agt agt a gt gt cgt cgc cggaccaagg
R G S BseRI 5118 gcgt ggt agt / at t at gagt t ct cct c- - - - - SACB casset t e( 2 kb) - - - cgcaccat ca/ t aat act caa gaggag
BseRI st op Hi ndI I I XhoI 7127 gaggagat ca t gcaca/ t gat gacgaagct t gcggccgcac t cgagcacca ct cct ct agt acgt gt / act a ct gct t cgaa cgccggcgt g agct cgt gga
7174 ccaccaccac cact gagat c cggct gct aa caaagcccga aaggaagct g ggt ggt ggt g gt gact ct ag gccgacgat t gt t t cgggct t t cct t cgac
T7 REV
7227 agt t ggct gc t gccaccgct gagcaat aac t agcat aacc cct t ggggcc t caaccgacg acggt ggcga ct cgt t at t g at cgt at t gg ggaaccccgg
(Encyclopedia of Plant Physiology 17) H. F. Linskens, J. Heslop-Harrison (Auth.), Professor Dr. Hans F. Linskens, Professor Dr. John Heslop-Harrison (Eds.)-Cellular Interactions-Springer-Verlag Berlin