1

Earthworms as a Potential Carrier of

Mycobacterium bovis in Bovine Tuberculosis
Transmission
By Nicola Wilton (11203806)













A report submitted in part fulfilment of the examination requirements for the award of a
BSc (Hons) degree title awarded by the University of Lincoln, June 2014, supervised by
Dr Subhajit Biswas.
2




This is to certify that I am responsible for the work
submitted in this thesis, that the original work is my
own, except as specified in the acknowledgements
and in references, and that neither the thesis nor the
original work contained therein has been previously
submitted to any institution for a degree.

Signature:
Name:
Date:






3

Abstract:
Methods of Bovine Tuberculosis transmission in the UK are still relatively unknown
with this study aiming to address one possible route of infection. The idea was to
investigate whether Mycobacterium bovis could be transmitted from cattle to badgers
via invertebrates important to badger diet. It was hypothesized that these invertebrates
may become infected through exposure with infected cattle faeces. The presence of
M. bovis was tested for in earthworm samples (n=29) collected from cattle-occupied
fields in Lincolnshire that were known to be frequented by badgers. Nucleic acid
extraction, M. bovis-specific semi-nested PCR and gel electrophoresis were used to
ascertain a result as to whether identified earthworms harboured this pathogen.
Despite positive PCR controls, no discernible bands were seen resulting in a negative
outcome. However it may be beneficial to implement the use of a TB outbreak farm
of which did not feature within this study.
1. Introduction
1.1 Implications of Bovine Tuberculosis
Bovine Tuberculosis (bTB) remains to be one of the most problematic and
challenging diseases faced by Britain today. It continues to be of great concern to
governmental and farming bodies, both of which are implicated with substantial
financial losses associated with the spread of bTB (Skuce, et al. 2012). The UK
exhibits the highest incidence of bTB than any other country within the European
Union (Smith, et al. 2011) illustrating the problematic incidence of this infectious
disease. Throughout a period of 10 years, DEFRA have released statistics marking a
500 million spend on bTB, with an expectant estimate reaching 1 billion over the
next decade without further action taking place. A recent statement by DEFRA also
expressed an ambition to achieve a Bovine TB free status within a 25 year period in
the UK (Gov, 2013). This makes it all the more important to address areas of
uncertainty regarding this disease and methods involved in transmission.
1.2 What is Mycobacterium bovis?
Mycobacterium bovis, the causative agent of bTB and an ecotype of the M.
paratuberculosis complex initiates this chronic and infectious disease. It is one of the
many components that make up the Mycobacterium tuberculosis complex of which
4

closely related ecotypes include M. microti, M. tuberculosis (a human bacterial
pathogen) and M. africanum (Smith, et al. 2011; Moda, et al. 1996).
M. bovis has a wide host range, not exclusively affecting maintenance hosts
such as cattle and badgers but also spill-over hosts including dogs, llamas, goats, pigs
and cats (Broughan, et al. 2013). bTB is potentially zoonotic, capable of transmission
to humans who ingest milk from infected cattle although since the pasteurisation of
milk, these once high figures are now largely diminished (Torgerson & Torgerson,
2010). Since the year 2000, cases of human M. bovis infection has remained to be
around 0.5% (Stone, 2012) and is very rarely fatal. This contrasts to historical figures
of an estimated 200,000 human deaths from 1900 to 1950 (Smith & Phillips, 2000).
1.3 Epidemiology
From the times when bTB was heavily encountered in cattle, the situation has not
much changed as currently in Britain it is now classed as endemic in areas including
the southwest, parts of central England and southwest Wales. Sporadic outbreaks also
occur throughout the rest of the country (Gilbert, et al. 2005). It is not only
problematic for the UK though, with bTB identified in every cattle-farming continent
of the world (Smith, et al. 2011). Epidemiological factors of the disease are
particularly complex, incorporating inter-species transmission spreading infective M.
bovis bacilli from cattle to cattle as well as through wildlife reservoirs which differ
depending on geographical location (Corner, et al. 2011; Drewe, et al. 2013).
1.4 bTB in the News
Recent cases have recorded the first ever incidence of cat to human bTB transmission
gaining exposure in the popular press, although the occurrence of this is still regarded
as incredibly rare (BBC, 2014). Reports regarding bTB continue to capture public
interest, with the topic of controversial badger culls dividing opinion throughout the
UK (White & Whiting, 2000). With this awareness reaching the public domain, the
importance of continued research is ever highlighted to reduce the incidence of bTB
and its impact on British wildlife and farming.
1.5 Transmission Routes
The Eurasian badger (Meles meles) has been identified as being one of the most
important routes of transmission within the UK (Corner, et al. 2011) however badgers
5

are not the only British mammal responsible for the spread, with deer species
(including Cervus, Capreolus and Dama sp.), red fox (Vulpes vulpes), mink (Mustela
vison) and brown rat (Rattus norvegicus) amongst those implicated (Delahay, et al.
2001). Methods of transmission for this respiratory disease comprise of direct and
indirect routes, with direct being contact between badgers and cattle themselves on a
site such as pasture or indoor cattle housing. Indirect is through infective badger
secretions namely urine and faeces (Skuce, et al. 2012; Wilson, et al. 2011) with
aerosol transmission of airborne bacilli believed to be the main route of transfer
(Mullen, et al. 2013). However the exact means of how cattle contract M. bovis from
badgers and vice versa remains unclear (Olea-Popelka, et al. 2006; Wilson, et al.
2011).
Woodroffe, et al (2006) highlighted the relationship between cattle to badger
transmission, suggesting that better control of the disease occurring in cattle would
help to lower the presentation seen in badgers. This was observed during a time when
TB testing in cattle was reduced. The removal of TB infected cattle was delayed
during a FMD outbreak and as a consequence, the prevalence of bTB in badgers was
seen to rise. It was only when it began to be addressed again in cattle that it started to
fall in badger populations. What is not explained though, is how badgers may contract
the disease from cattle to begin with.
1.6 Earthworms and M. bovis?
The potential impact that the environment may have in terms of the diseases
transmission, especially in relation to ecology has not been extensively researched. As
of yet, no research has been published in the UK regarding the possibility of
invertebrates, such as earthworms, being able to harbour M. bovis, thus presenting a
potential factor in the contraction of bTB within badgers. Earthworms are an
important aspect to a cow pat, and may provide a potential explanation as to how
badgers may become exposed to potentially infective M. bovis material. It is thought
that earthworms migrate away from a cow pat site to be ingested by badgers; thus
becoming an intermediary to the disease. Although Kruuk (1978) also recorded
badgers digging up earthworms from cow pats directly.
Earthworms make up a substantial amount of badger diet, with Mullen, et al.
(2013) even stating that badgers may venture onto cattle-occupied pasture in order to
forage, with preference to the shortly cropped grass regularly grazed by cattle (Kruuk,
6

1978). Within Great Britain, the most abundant earthworm and often preferred by
badgers themselves is Lumbricus terrestris (Ward, et al. 2010). This type can be
described as anecic and is one of the largest of its species, commonly found in regions
throughout the UK (Griffith, et al. 2013). Earthworms such as this one may
potentially come into contact with M. bovis infected material through cow pats
produced from bovine TB positive cattle. As reported by Beynon, et al. (2012),
earthworms contribute greatly to the later stages of decomposition of dung, normally
after their invertebrate counterparts, such as the beetle, which work to break up the
dung pat. To a temperate ecosystem, earthworms can be regarded as a vital
component to dung removal through its transport into the soil (Svendsen, et al. 2003).
Through this action however, earthworms may be exposed to the M. bovis pathogen,
carrying it on the skin or internally and providing a further means to continue the
spread.
1.7 Mycobacteria Isolates from Earthworms
Previous research showed that Mycobacteria can be isolated from earthworms,
reported by Fischer, et al. (2003), who found that earthworms may become passive
vectors of these organisms. It was also stated that they are capable of protecting the
bacteria from actions that would otherwise kill them such as disinfectants. Amongst
the species of Mycobacteria isolated were: M. paratuberculosis, M. avium and M.
gastri however M. bovis was not incorporated. It was however mentioned that it could
be isolated from fly imagoes that had previously come into contact with tuberculosis
lesions in cattle within a slaughterhouse. Moravkova, et al. (2011) also published a
study on the findings of Mycobacterium species within earthworms and isolated M.
diernhoferi, M. fortuitum and M. smegmatis amongst others showing
Mycobacteriums capability to be found in earthworms.
1.8 Current Study
The current study aimed to investigate the presence of M. bovis within environmental
earthworm samples, relating to the spread of bTB in badgers. It was hoped to isolate
strains of M. bovis by implementing M. bovis-species specific semi-nested PCR as
previously mentioned by Taylor, et al. (2007), to detect this pathogen within
earthworm samples.
7

2. Materials and Methods
2.1 Sampling Site Characteristics
A farm within North Lincolnshire, England was selected for earthworm sampling with
permission obtained from the owner prior to collection. This farm was situated in
Bainton, near Brigg (53 32'34.46"N - 0 30'22.83"W) and had a previous history of
TB cattle reactors with badger activity also observed within the farm. The pasture
type selected for earthworm collection was permanent and ley pasture accommodating
grazing cattle on a rotation basis, however at the time of collection no cattle were
present.
2.1.1 Earthworm Collection
Earthworms (n=29) were collected at random from 2 different ecological parameters.
For the purposes of comparison, samples were recovered directly under the cow pat as
well as within a 50cm margin. Two extraction methods were followed, the first with
use of a 0.02% formalin solution, which worked as an irritant encouraging burrowed
earthworms up to the surface. Once extracted from the soil, these samples were then
washed with distilled water. The second of the 2 methods followed with hand sorting,
manipulating the cow pat and teasing it apart to extract earthworms. At the margin, 25
- 30cm holes were dug to retrieve these samples, which were also washed with
distilled water to remove soil debris.
All earthworms used for study were humanely killed either on ice or with a
10% vodka/ethanol solution. Samples were placed into polythene bags and stored at
4C in preparation for identification and dissection.
2.2 Identification and Dissection
After allowing specimens to warm to room temperature, they were washed in a beaker
of water to remove any further debris. All of the samples were then categorically
identified. An identification key was utilised for this, with supplementary
confirmation using a UV light to highlight the fluorescent properties of setae as
followed by McManus (2007). Dissection then proceeded, incorporating only the tail
or gut for testing, with the exception of smaller earthworms (below 3cm) which were
used whole. Small earthworms which were slightly larger in size were merged and the
tail and gut samples were dissected and pooled. It was important to only fill a 1.5ml
8

eppendorf tube halfway with the sample, to allow an equal measurement of the lysis
buffer later incorporated into the DNA extraction process. Tubes were then stored in
a -80C freezer.
2.3 Selected Samples
A total of 5 earthworms were selected for further testing, including A. rosea (sample
10, tail), A. calignosa (sample 7, whole), L. terrestris (sample 14, gut), E. fetida
(sample 25, whole) and a pooled sample of 3 specimens (A. rosea tails; samples 1-3).
These were chosen to try and incorporate a range of species along with a variety of
tissue types, with a representation of earthworm species found in table 1. Within the
first part of this study (Study 1) DNA from the earthworms were pooled (EP1) but
aliquots of individual sample DNAs were kept separate for further analysis in Study 2.
Table 1 Identification of earthworm species recovered from both cow pat and
margin sites.
Sample
Number
(Cow Pat)
Earthworm Species Sample
Number
(Margin)
Earthworm Species
1 Aporrectodea rosea 14 Lumbricus terrestris
2 Aporrectodea rosea 15 Lumbricus terrestris
3 Aporrectodea rosea 16 Aporrectodea rosea
4 Aporrectodea rosea 17 Eisenia fetida
5 Aporrectodea rosea 18 Aporrectodea longa
6 Aporrectodea rosea 19 Aporrectodea longa
7 Aporrectodea calignosa 20 Lumbricus terrestris
8 Immature Aporrectodea longa 21 Octolasion cyneum
9 Immature Aporrectodea longa 22 Aporrectodea longa
10 Aporrectodea rosea 23 Aporrectodea rosea
11 Aporrectodea rosea 24 Aporrectodea rosea
12 Aporrectodea rosea 25 Eisenia fetida
13 Aporrectodea rosea 26 Lumbricus rubellas
27 Aporrectodea rosea
28 Aporrectodea rosea
29 Immature Aporrectodea longa
9

2.4 DNA Extraction from Processed Earthworm Samples using the NucliSENS
miniMAG system
NucliSENS miniMAG (bioMrieux) was used for the isolation of nucleic acids
and followed in accordance to the manufacturers instructions in regards to the use of
NucliSENS solutions. The study was run in parallel to a similar protocol set out by
Taylor, et al. 2007 with some modifications to the original protocol adapted for
suitable application. To initiate the lysis stage, 500l of NucliSENS lysis buffer
(containing 5M Guanidinium) was added to each thawed sample. The next stage was
in binding, with glass beads (Supelco) used to aid the release of DNA. These were
vortexed (Genie 2, Mo-bio labs) for 15 minutes at mark 8 and then microfuged
(Microfuge 3000) at 13,000 rpm for 5 minutes. The supernatant was isolated and
centrifuged again at the same rate with 200l of vortexed silica solution then added to
the samples. The samples were washed with 500l of wash buffer 1, 2 and 3;
amended from the original manufacturers protocol.
After addition of the elution buffer, the solution was incubated for 10 minutes
at 70C in the thermoshaker at 1450rpm. All eluate (100l) of extracted samples
were stored in -20C freezer.
In order to obtain maximum yield and to see if any nucleic acids were attached
to the silica, 200l of elute buffer was added and incubated again at 70 in the
thermoshaker. This proved unnecessary however, as maximum yield was already seen
to be obtained prior to this step.
2.5 Assessing Nucleic Acid Purity (NanoDrop)
In order to quantify the amount of DNA obtained, Thermo Scientific NanoDrop 2000
spectrophotometer was utilised and used as per manufacturers instructions.
2.6 PCR methods
A semi-nested PCR protocol was run in accordance to Taylor, et al. (2007), with use
of the same RD4 and IS1081 primers as seen in Table 2. High fidelity (HF) Taq
(Roche) enzyme mix was used for this study and carried out per manufacturers
instructions with recommended amounts applied routinely to all applicable samples.
The first mix comprised of dNTP, primers, RNase free water and DNA template for
each sample. Mix B, the enzyme mix was made up of RNase free water, buffer 2 and
10

Taq enzyme used for both PCR processes.
The first stage of PCR (PCR1), carried out by ThermoCycler PCR,
commenced with the use of F1 and R1 (RD4) and F2 & R1 (IS1081) primers. The
PCR process ran for 45 cycles of amplifications following this specified programme:
the initial denaturation stage started with 95C for 8 minutes (1 cycle); then 45 cycles
of denaturation at 95C for 15 seconds. Annealing was at 58C for 15 seconds
(according to Taylor, et al. 2007) and extension at 72C for 30 seconds. Final
extension occurred at 72C for 5 minutes (1 cycle). The second round PCR (PCR2)
comprised 2l of the product produced from PCR1 used as a template for RD4 and
IS1081. F2 and R1 primers for RD4 and F2 and R3 primers for IS1081 were used for
this process. PCR2 conditions started at 95C for 8 minutes (1 cycle), followed by
95C for 15 seconds. Annealing temperature for PCR2 RD4 and IS1081 were 58.5C
and 56.5C respectively for 15 seconds, with 72C for 40 seconds set to run for 45
cycles. This concluded with 72C at 5 minutes for 1 cycle.
A positive control (237bp product) was also incorporated into PCR1 and
PCR2 including DNA from norovirus attained from another study. The primers 443
and 444 in accordance with La Rosa, et al. (2012) were used for PCR1 and PCR2
respectively, as shown in table 3, with an annealing temperature of 46.5C. The
negative control was made using water as a template. After completion, samples were
frozen in a -20C freezer.
Table 2 PCR primer sequences used within the PCR process. Shows annealing
temperatures and amplicon sizing for IS1081 and RD4 primers. Reproduced from
Taylor, et al. (2007).
PCR Primer Sequence Anneal.
Temp
(C)
Amplicon
Size (bp)
ISI081 F2
R2
R3
5 -CTGCTCTCGACGTTCATCGCCG-3
5'-GGCACGGGTGTCGAAATCACG-3'
5-TGGCGGTAGCCGTTGCGC-3
58 135
113
RD4 F1
F2
R1
5-AATGGTTTGGTCATGACGCCTTC-3
5-TGTGAATTCATACAAGCCGTAGTC-3
5-CCCGTAGCGTTACTGAGAAATTGC-3
58 176
142
11

Table 3 NoV primers used for positive control during PCR, adapted from La Rosa,
et al. (2012).
PCR Primer (fw or
rev)
Pathogen Sequence
443 Reverse GI TCATCATCACCATAGAAIGAG
Forward GI ATACCACTATGATGCAGAYTA
444 Reverse G11 AGCCAGTGGGCGATGGAATTC

2.7 Agarose Gel Electrophoresis (AGE)
In order to ascertain the amount of product within the sample, gel electrophoresis was
selected as recommended by Taylor, et al. (2007). To make a 1.5% agarose gel,
100ml of TBE buffer was made to 900ml of distilled water before mixing 2.25 g of
agarose powder with ready-made buffer. This was then added to150ml of buffer and
microwaved at 900w for 1 minute and then a further 1 minute and 30 seconds. 15l
safeview nucleic acid stain (at 1ml/ 10ml gel NBS Biologicals) was added and
emptied into the gel tray. After combe removal bromopherol blue (Bioline) and the
DNA ladder of 100bp (Hyperladder IV, Bioline) were vortexed and 5l of loading
dye was added to 10l of the sample. Ladders were positioned at either side of the
samples along with positive and negative PCR controls to be used in aiding
interpretation of the results. Finally, 75V was set for 60 minutes, further extended to
90 minutes and viewed under a UV transilluminator.
2.8 Further DNA Purification
Use of the DNeasy Blood & Tissue Kit (Qiagen) was incorporated into the first study;
in order to further purify total DNA, with the process following the protocol as
outlined by the manufacturer.
2.9 Repeats (Study 2)
This study was also repeated again, with the same 5 earthworm samples tested
individually, with slight alterations made to some of the protocols. The main
modification was the use of ISI081 only, ran in accordance to Taylor, et al. (2007).
During gel electrophoresis, a 3% agarose gel was made as opposed to 1.5%, in the
12

hope that it would be more sensitive, with changes made to original mixtures in order
to accommodate a higher concentrated gel.
3. Results
3.1 Species Identified After Collection.
During identification, earthworms were separated into 2 groups: cow pat and margin.
These represented the earthworms collected in separate ecological areas, with a higher
number (n=16) retrieved from the margin in comparison to n=13 found within the
cow pat. A surprising result observed was that the majority of earthworm isolates
from the cow pat were predominantly A. rosea. A representation of the percentages
found within the cow pat can be seen in figure 1.
A wider variety of species can be seen within the margin extraction, with
double the amount of identified species found within the cow pat. In comparison to
the cow pat site, even though A. rosea was also found to be the most abundant, except
the boundary was not as large. Diagrammatic representations of this can be seen in
figure 2.









77%
15%
8%
A. rosea
A. longa
A. calignosa
Figure 1 - Earthworm prevalence and species identified in collected samples from a
cow pat.

13











3.2 Assessment of DNA Purity
After nucleic acid isolation, the amount of DNA obtained was analysed in the pooled
sample (study 1) along with the assessment of sample purity, the results of which can
be seen in figure 3. A total of 66.7 ng/l of DNA was gathered and showed very little
levels of contamination overall.









Figure 3- Results from the NanoDrop, 2000 of DNA quantification for the earthworm sample
EP1.
32%
25%
19%
12%
6%
6%
A. rosea
A. longa
L. terrestris
E. fetida
O. cyaneum
L. rubellas
Figure 2 -Earthworm prevalence and identified species collection from the margin of a
cow pat.

14

3.3 Gel Electrophoresis
Results for both ISI801 and RD4 were negative (figure 4) which is further highlighted
when compared to the positive control. With a comparison of primers, it was observed
that IS1081 picked up more of a result reported in Taylor, et al. (2007) than its RD4
counterpart. With this in mind, a second experiment was run in order to clarify the
result and determine if the ISI801 primer would produce more of a result due to its
increased sensitivity (Taylor, et al. 2007). This was carried out with 5 individual
earthworm samples as opposed to pooled. Due to the high percentage of gel (3%)
upon the removal of the combes, it was noted that many of the wells were broken and
unsuitable for use, meaning only 2 out of the 5 samples (E10 and E12) were tested
for. The results of which can be observed in figure 5.















Figure 4 Results of the first gel electrophoresis after semi-nested PCR ran on a 1.5% agarose
gel. Wells 1, 11: ladders (100bp), 2 and 4 shows EP1 pooled samples for RD4 and IS1081
respectively. Samples from another study were also run on the gel (well 3, 5). Well 6: negative
control, 7: positive control (443 PCR, 237 bp, La Rosa, et al. 2012). Wells 8-10 contained samples
from a different project.
15














The 2 samples that were run presented a negative result, with the positive and
negative controls displaying that the gel was run correctly. It also showed the
occurrence of primer dimers similar to those seen in the first gel. If results within this
study were to register positive, clear bands would have been present on the gel, as
observed with the positive control. RD4 PCR 2 would have generated a band at 176
amplicon size (bp) with IS1081 PCR 2 at 113 bp.
4. Discussion
There are many aspects about bTB that are not yet understood, especially in terms of
transmission and mechanisms of occurrence. The question as to how badgers could
come into contact with a potential source of infection was aimed to be addressed
within this study. Earthworms can be questioned in their role of bTB contraction with
the potential scenario of earthworms infecting UK badgers as their major dietary
component. This therefore implicated them as a potential transmission route. The
Figure 5 Results from the second gel run on a 3% agarose gel. Not all of the samples seen
on this gel are the subject of this study; other similar projects were also run in parallel. Wells
1,16,17 and 32: ladders (100bp) . 2-13: N/A. 14: Positive Control, 15: Negative Control. 18,
27 show the samples run in this study both with IS1081 primers using E10 and E12 samples.
19-26, 28-29: broken wells. 30, 31: N/A. Red pixilation observed on the gel is due to
saturation of the camera and the bands being too bright.

16

study endeavoured to discover whether earthworms were able to harbour or contract
M. bovis through contact with infected material.
4.1 How Might Earthworms Become Infected?
Earthworms may be exposed to M. bovis in the environment when they undertake the
natural process of aiding decomposition of organic matter e.g. cow dung. Some
farmers even partake in vermicomposting of organic wastes, using earthworms to
break down this matter. This reduces the use of synthetic fertilisers (Wani, et al. 2013)
but creates an abundance of earthworms making an attractive site for foraging
badgers. With active M. bovis agents shed in the dung (Phillips, et al. 2003),
earthworms may contract the pathogen either on the skin or ingest internally which
may infect badgers through ingestion of this contaminated food source.
4.2 Sample Choice
During dissection, the gut and tails of the earthworms were specifically chosen to test
for the presence of M. bovis, justified due to the potential of finding these organisms
within these particular isolates. The tails, along with coelomic fluid was hypothesized
to be of importance. Within earthworms, they have developed a special adaptation of
regenerating damaged caudal segments or replicating those that have been lost.
Especially in the case of E. fetida who shed segments when insoluble waste is no
longer able to be stored within the coelom (Sims & Gerard, 1985). This draws further
inferences that M. bovis may be shed out in segments in an effort to rid itself of
toxins.
Attached to the end of caudal segments, coelomic fluid could be observed
from the majority of the samples collected in this study. They are believed to have
many properties, including: preventing desiccation, protection from predators and in
the promotion of cutaneous respiration. It has also been found to be a good source of
DNA as reported by Minamiya, et al. (2011). Earthworm guts were also of interest
due to the presence of ingested bacteria able to live within the gut, as experimented by
Adnan & Joshi, (2013), who stated that earthworms help in microbe distribution and
therefore fulfilling their role as a vector. So if ingestions of M. bovis were a
possibility, isolating gut samples would be the best mechanism to detect this.
4.3 PCR & Gel Electrophoresis
17

An ample amount of DNA was extracted from earthworm samples (as shown by
figure 3) however after the first study run on the agarose gel, these results came back
negative for the presence of M. bovis in a pooled sample collection.
Looking particularly at EP1, this was tested using 2 semi-nested PCRs, RD4
and ISI801. This was paralleled by a study from Taylor, et al. (2007), who found RD4
to be less efficient as shown by a weaker result. They reported RD4 to be ten times
less sensitive than ISI801, with a 50% sensitivity value compared to 70% for ISI801.
This influenced a modification made to the second study within this experiment; this
time only using the ISI801 primer. Amongst the modifications it also featured the use
of a 3% agarose gel solution as opposed to the 1.5% used in the first study for better
resolution of PCR mixtures. Due to the thickness of the gel, some of the wells were
broken upon extraction of the combe, meaning only some of the original individual
samples were able to be run. These 2 samples also came back negative for the
presence of M. bovis after electrophoresis and can be hypothesized that the 3 that were
not run would also have attained a similar result. This would be consistent with the
results observed from the first half of the study, as pooling all of the samples into 1
heralded no match with M. bovis. This therefore provides the basis for the assumption
that the individual samples contained within this would also be negative. This can be
inferred through analysing the average DNA concentration (ng/ml) of the samples as
seen in table 4. The mean of these samples totals 69.65 ng/ml of which is comparably
similar to the pooled sample of 66.7 ng/ml as seen in figure 3, suggesting little DNA
was lost.
Semi-nested PCR was a fitting technique to use and chosen due to its abilities
to amplify small amounts of target DNA, applied to the scenario expected to be
encountered within this study. Enhanced sensitivity and detecting potentially
problematic DNA is also amongst the listed perks for use of this technique (Gupta, et
al. 2013).
Table 4 Figures of DNA quantification for individual non-pooled earthworm
samples after Nanodrop analysis.
Sample Ng/ml 260/280 260/230
E10 9.6 1.18 0.01
E7 11.3 1.29 0.02
E13 81.3 1.76 0.5
18

E1-3 176.4 1.54 0.06

4.4 Reasoning for Obtained Results
The negative results observed in both study 1 and study 2 could be due to numerous
reasons. It can be inferred that there was no presence of M. bovis to begin with within
the samples, as the samples were not at fault due to the high presence of DNA
obtained and observed after NanoDrop analysis. The farms included in this study were
not outbreak farms, so no confirmed presence of bTB can be implied, thus this also
applies to the presence of M. bovis. This gives a potential reason for the negative
result as if there was no M. bovis to be contracted within the farm by the earthworms,
that there would be no way for them to become infected in the first place. However,
the study provides a basis for further investigation, to replicate and refine the
methodology as created within this experiment, applied on an outbreak farm to rule
out this method of transmission completely.
High levels of DNA in EP1 (66.7 ng/l) compared nicely to levels expected
to be seen in what is considered to be a good sample for testing. The DNA that was
gathered showed very little contamination when compared to pure samples as set out
by the manufacturers guidelines. Referring to the 260/280 reading which represents
protein contamination, a value at 1.8 would normally be considered pure of which the
result 1.98 is comparably similar. 260/230 representing other contaminants, saw a
reading of 2.14 which can be compared to a 2-2.2 value considered to be pure and
contamination free (Nanodrop, 2013). This then rules out any problem with the
samples as there were both pure and clean, further demonstrated by extra cleaning by
the DNeasy Blood & Tissue Kit as carried out in study 1. The positive and negative
controls also showed up clearly in comparison, further suggesting no problem with
the samples or the gel that was run.
4. 5 Primer Dimerization after Gel Electrophoresis
Results obtained from the gel electrophoresis raised suggestions that primer dimers
may have been present. These have an effect of the final yield of DNA produced (Das,
et al. 1999) and can be found at high primer concentrations resulting in the occurrence
of weak interactions (Brownie, et al. 1997). The likelihood of its occurrence has been
likened to lengthy primers and insufficiency during small fragment removal, where
19

sometimes this step fails to remove these dimers. The possibility of a high amount
seen within this study could have interfered with their removal, resulting in their
observation. Vandenbroucke, et al. (2011) reported primer dimer formation from
hybridization of primer molecules combined with partial complementary sequences.
These can be amplified during the stages of PCR, resulting in short amplicons being
observed. These non-specific by-products are created through a duplex formation
between 2 primers, which not only have the effect to decrease primer concentration
but also create these non-specific products of DNA (Das, et al. 1999). For future
reference, it is important to reduce the occurrence of primer dimerization, which can
be achieved through a variety of methods. Following stringent conditions, careful
primer design and the incorporation of enzymes, for example AmpliTaq Gold
TM

(Brownie, et al. 1997) are amongst a few of the methods that can be employed if this
study was to be repeated.
4. 6 Recommendations for the Future
In order to gain clarity of these results, it would be highly beneficial to build on this
study in terms of methodology and repeat in the future. There is room to improve
upon this study, learning from mistakes and observations acquired throughout its
duration. It would be justified to use ISI801 primers due to its increased sensitivity as
well as increasing the time during gel electrophoresis in order to give it more time to
develop. It is also reasonable to say that a 3% agarose gel may have been too high a
percentage for this particular study, so in the future it must be preceded with a degree
of caution, especially in the removal of combes to avoid leaking or broken wells. In
regards to selecting the most appropriate gel percentage, generally speaking, a higher
concentration of agarose helps to separate smaller fragments of DNA. Whereas a
smaller percentage enables faster migration of DNA fragments, which works well
when applied to the separation of larger DNA fragments (Barill & Nates, 2012).
Smaller DNA fragments were aimed to be separated within this study, further
justifying the use of a higher percentage agarose gel. For future investigation, running
a 2% agarose may also be beneficial for consideration.
Expanding the sample size and including differing farms from different areas
of the country can be recommended upon repetition of the study, helping to better
represent the possibility of the occurrence of M. bovis within collected samples. This
study only incorporated the use of one, non TB outbreak farm so in using outbreak
20

farms known and confirmed to have a spread of bTB, it may better signify a
possibility to isolate M. bovis in earthworms.
The time of year in which samples are collected may also provide a role in the
detection of M. bovis, with all earthworms retrieved within this study collected over
the winter period. During times of adverse weather, such as temperatures below
freezing or extreme highs, earthworms demonstrate a decrease in activity and can be
found in a state of diapause. Once conditions are no longer dry and have become
favourable, they resume their normal activity (Edwards & Bohlen, 1996). It is
therefore inferred that collection during summer or a period where they present more
activity, are more likely to encounter M. bovis.
Due to collection in the cold winter months, cows were only on rotation within
the field, meaning cattle were not constantly present on the pasture and thus would
have provided earthworms will less opportunity to interact with M. bovis if present.
Due to a decrease in cattle on the field, cow pats used were not completely fresh
however this could be observed as an advantageous occurrence. Sampled cow pats
were between 9 and 22 days old, with still relatively raw faecal matter contained
within the core areas. The effect of time upon a once fresh cow pat means the longer it
has to deviate away from the stage, the more advanced stages of decomposition this
organic material will be; becoming colonised, broken down and incorporated into the
soil through earthworms (Lee & Wall, 2006). This is especially applicable to the
margin areas. However in future studies, it may be deemed beneficial to test both
fresh and old cow pats along with the earthworms distribution in and around these
sites.
4.7 Expanding the Area of Study
In order to provide a controlled study within this area, it may be interesting to induce
a population of earthworms to a cow pat known to be bTB-positive, thus exposing the
earthworm to contaminated material. From here, it would be interesting to observe
whether the earthworm fulfilling its normal ecological processes would be privy to M.
bovis contraction. It could also be confirmed whether they are able to harbour the
pathogen after contact with infected material. Testing soil samples along with
earthworms may provide a positive addition to the study as earthworms are imperative
to the health and quality of soil. They are also implicated in distributing the pathogen
and bacteria into the soil as reported by Adnan & Joshi, (2013). This has been
21

similarly demonstrated in a study by Moravkova, et al. (2011) who isolated several
Mycobacterium species within soil samples in an enclosure housing a flock infected
with M. avium. Isolated species included M. a. hominissuis, M. chelonae, M. fortuitum
and M. scrofulaceum with some of the birds found to be cross infected with
M.a.hominissuis also.
Overall, there are several things that can be learnt after completion of this
investigation and applied to similar areas testing field samples for M. bovis. The
foundation for the methodology has already been set for further repetition if desired,
to help further explore routes of bTB transmission.
Conclusion
With the ever-expanding issues posed by bTB and the devastating effects it causes
yearly, research into the disease and its processes has never been more important to
pursue. This report has aimed to investigate one of the many mechanisms for
transmission, addressing an area that has not yet been extensively researched.
Earthworms as potential carriers of bTB composed the focus of the study, with
the presence of M. bovis tested for within field-collected samples. Even though the
samples registered as negative with the use of a non TB outbreak farm, it can be
stressed that further research would be highly beneficial to address and overcome
problems experienced throughout the study. Expanding the subject area to include
other environmental samples such as soil and other invertebrates would also be a
beneficial implementation.
It is hoped that through research and further study, it will shed more light on
bTB, helping to implement strategies to help tackle this increasing problem. In
knowing more about how bTB spreads it may hold the key to understanding and
therefore may provide important pieces of the puzzle to address this devastating
disease.
Hopefully, in the near future, through continued dedication in research and
the development of vaccines, it will bring hope in the eradication of Bovine TB,
striving for the Bovine TB free status that the UK is so hoping for.


22

ACKNOWLEDGMENTS
I would like to express a heartfelt appreciation to my
supervisor, Dr Subhajit Biswas, who was always there to
answer my endless questions and queries and without his
helpful input, feedback and support would never have
been able to finish this dissertation. His help and
guidance within the lab were also something I am ever
grateful for and thank him for his patience and infectious
enthusiasm.
I would also like to thank Professor Roy Brown, of
which I benefited endlessly from his expertise, support
and informative feedback. His assistance in field
collection was greatly appreciated, along with collection
and identification of field samples and dissections.
For their help and company in the lab, I thank Ciorstaidh
Macgillivry, Charlotte ONeill and Kimberly Braid. As
well as to my friends who were always there to help.
Finally I thank my family, for their love, unwavering
support and advice who let me talk their ears off about
Bovine TB even if they didnt understand it.
Thank you all.
23

References
Adnan, M., Joshi, N. (2013) The Uniqueness of Microbial Diversity from the Gut of
Earthworms and Its Importance. Journal of Microbiology and Biotechnology
Research.Vol.3 (1) pg. 111-115.
Barill, P., Nates, S. (2012) Gel Electrophoresis: Principles and Basics. Shanghai:
Intech.
BBC (2014) Pet Cats Infect Two People with TB. [online] Available from:
http://www.bbc.co.uk/news/health-26766006 [Accessed: 29 March 2014]
Beynon, S.A., Peck, M., Mann, D.J., Lewis, O.T. (2012) Consequences of
Alternative and Conventional Endoparasite Control in Cattle for Dung-Associated
Invertebrates and Ecosystem Functioning. Agriculture, Ecosystems and Environment.
Vol. 162 (11) pg. 36-44.
Broughan, J.M., Downs, S.H., Crawshaw, T.R., Upton, P.A., Brewer, J., Clifton-
Hadley, R.S. (2013) Mycobacterium bovis Infections in Domesticated Non-Bovine
Mammalian Species. Part 1: Review of Epidemiology and Laboratory Submissions in
Great Britain 2004-2010. The Veterinary Journal. Vol. 198 (2) pg. 339-345.
Brownie, J., Shawcross, S., Theaker, J., Whitcombe, D., Ferrie, R., Newton, C.,
Little, S. (1997) The Elimination of Primer-Dimer Accumulation in PCR. Nucleic
Acids Research. Vol. 25 (16) pg. 3235-3241.
Corner, L.A.L., Murphy, D., Gormley, E. (2011) Mycobacterium bovis Infection in
the Eurasian Badger (Meles meles): the Disease, Pathogenesis, Epidemiology and
Control. Journal of Comparative Physiology. Vol. 144 (1) pg. 1-24.
Das, S., Mohapatra, S.C., Hsu, J.T. (1999) Studies on Primer-Dimer Formation in
Polymerase Chain Reaction (PCR) Biotechnology Techniques. Vol. 13 (10) pg. 643-
646.
Delahay, R.J., Cheeseman, C.L., Clifton-Hadley, R.S. (2001) Wildlife Disease
Reservoirs: The Epidemiology of Mycobacterium bovis Infection in the European
Badger (Meles meles) and Other British Mammals. Tuberculosis. Vol. 81 (1-2) pg.
43-49.
24

Drewe, J.A., OConnor, H.M., Weber, N., McDonald, R.A., Delahay, R.J. (2013)
Patterns of Direct and Indirect Contact Between Cattle and Badgers Naturally Infected
with Tuberculosis. Epidemiology and Infection. Vol. 141 (7) pg. 1467-1475.
Edwards, C.A., Bohlen, E.P.J. (1996) Biology and Ecology of Earthworms. 3
rd

edition. London: Chapman & Hall.
Fischer, O,A., Matlova, L., Bartl, J., Dvorska, L., Svastova, P., du Maine, R.,
Melicharek, I., Bartos, M., Pavlik, I. (2003) Earthworms (Oligochaeta,
Lumbricidae) and Mycobacteria. Veterinary Microbiology. Vol. 91 (4) pg. 325-338.
Gilbert, M., Mitchell, A., Bourn, D., Mawdsley, J., Clifton-Hadley, R., Wint, W.
(2005) Cattle Movements and Bovine Tuberculosis in Britain. Nature. Vol. 435
(7041) pg. 491-496.
Griffith, B., Turke, M., Weisser, W.W., Eisenhauer, N. (2013) Herbivore
Behaviour in the Anecic Earthworm Species Lumbricus terrestris L. European
Journal of Soil Biology. Vol. 55 (?) pg. 62-65.
Gov (2013) Bovine TB Strategy Launched to Make England Disease Free within 25
Years. [online] Accessed from:
https://www.gov.uk/government/organisations/department-for-environment-food-
rural-affairs [Accessed: 28 January 2014].
Gupta, V.K., Tuohy, M.G., Ayyachamy, M., ODonovan, A., Turner, K.M.
(2013) Laboratory Protocols in Fungal Biology: Current Methods in Fungal Biology.
New York: Springer
Kruuk, H. (1978). Foraging and Spacial Organisation of the European Badger Meles
meles. Behavioural Ecology and Sociobiology. Vol. 4 (1) pg. 75-89.
La Rosa, G., Fratini, M., Vennarucci, S., Guercio, A., Purpari, G., Muscillo, M.
(2012) GIV Noroviruses and Other Enteric Viruses in Bivalves: A Preliminary Study.
New Microbiologica. Vol. 35 (1) pg. 27-34.
Lee, C.M., Wall, R. (2006) Cow-dung Colonization and Decomposition Following
Insect Exclusion. Bulletin of Entomological Research. Vol. 96 (3) pg. 315-322.
25

McManus, S.A. (2007) Auto fluorescence in Earthworm Setae. Megadrilogica. Vol.
11(1) pg. 1-3.
Minamaya, Y., Ohga, K., Hayakawa, H., Ito, K., Fukuda, T. (2011) Coelomic
Fluid: A Noninvasive Source of DNA in Earthworms. Molecular Ecology Resources.
Vol. 11 (4) pg. 645-649.
Moda, G., Daborn, C.J., Grange, J.M., Cosivi, O. (1996) The Zoonotic Importance
of Mycobacterium bovis. Tubercle and Lung Disease. Vol. 77 (2) pg. 103-108.
Moravkova, M., Lamka, J., Kriz, P., Pavlik, I. (2011) The Presence of
Mycobacterium avium subsp. Avium in Common Pheasants (Phasianus colchicus)
Living in Captivity and In Other Birds, Vertebrates, Non-Vertebrates and the
Environment. Veterinarni Medicina. Vol. 56(7) pg. 333-343.
Mullen, E.M., MacWhite, T., Maher, P.K., Kelly, D.J., Marples, N.M., Good, M.
(2013) Foraging Eurasian Badgers Meles meles and the Presence of Cattle in Pastures.
Do Badgers Avoid Cattle? Applied Animal Behaviour Science. Vol. 144 (3-4) pg.
130-137.
Nanodrop. (2013) Assessment of Nucleic Acid Purity. [pdf] [online] Available from:
http://www.nanodrop.com/Library/T042-NanoDrop-Spectrophotometers-Nucleic-
Acid-Purity-Ratios.pdf [Accessed: March 1 2014].
Olea-Popelka, F.J., Phelan, J., White, P.W., McGrath, G., Collins, J.D.,
OKeeffe, J., Duggan, M., Colins, D.M., Kelton, D.F., Berke, O., More, S.J.,
Martin, S.W. (2006) Quantifying Badger Exposure and the Risk of Bovine
Tuberculosis for Cattle Herds in Kilkenny, Ireland. Preventative Veterinary Medicine.
Vol.75 (1-2) pg. 34-46.
Phillips, C.J.C., Foster, C.R.W., Morris, P.A., Teverson, R. (2003) The
Transmission of Mycobacterium bovis Infection in Cattle. Research in Veterinary
Science. Vol. 74 (1) pg. 1-15.
Sims, R.W., Gerard, B.M. (1985) Earthworms. Bath: The Pitman Press.
26

Skuce, R.A., Allen, A.R., McDowell, S.W.J. (2012) Herd-Level Risk Factors for
Bovine Tuberculosis: A Literature Review. Veterinary Medicine International. Vol.
2012 (1) pg. 1-10.
Smith, N.H., Berg, S., Dale, J., Allen, A., Rodriguez, S., Romero, B., Matos, F.,
Ghebremichael, S., Karoui, C., Donati, C., Machado, A.C., Mucavele, C.,
Kazwala, R.R., Hilty, M., Cadmus, S., Ngandolo, B.N.R., Habtamu, M., Oloya,
J., Muller, A., Milian-Suazo, F., Andrievskaia, O., Projahn, M., Barandiaran, S.,
Macias, A., Muller, B., Zanini, M.S., Ikuta, C.Y., Rodriguez, C.A.R., Pinheiro,
S.R., Figueroa, A., Cho, S.N., Mosavari, N., Chuang, P., Jou, R., Zinsstag, J.,
Soolingen, D.V., Costello, E., Aseffa, A., Proano-Perez, F., Portaels, F., Rigouts,
L., Cataldi, A.A., Collins, D.M., Boschiroli, M.L., Hewinson, G.L., Neto, J.S.F.,
Surujballi, O., Tadyon, K., Botelho, A., Zarraga, A.M. (2011) European 1: A
Globally Important Clonal Complex of Mycobacterium bovis. Infection, Genetics and
Evolution. Vol. 11 (6) pg. 1340-1351.
Smith, D.F., Phillips, J. (2000) Food, Science, Policy and Regulation in the
Twentieth Century: International and Comparative Perspectives. London: Routledge
Stone, M.J., Brown, T.J., Drobniewski, F.A. (2012) Human Mycobacterium bovis
Infection in London and Southeast England. Journal of Clinical Microbiology. Vol.
50 (1) pg. 164-165.
Svendsen, T.S., Gronvold, J., Holter, P., Sommer, C. (2003) Field Effects of
Ivermectin and Fenbendazole on Earthworm Populations and the Disappearance of
Dung Pats From Bolus-Treated Cattle. Applied Soil Ecology. Vol. 24 (3) pg. 207-218.
Taylor, G.M., Worth, D.R., Palmer, S., Jahans, K., Hewinson, R.G. (2007) Rapid
Detection of Mycobacterium bovis DNA in Cattle Lymph Nodes with Visible Lesions
using PCR. BMC Veterinary Research. Vol. 3 (12) pg. 1-11.
Torgerson P.R., Torgerson, D.J.(2010) Public Health and Bovine Tuberculosis:
Whats all the Fuss About? Trends In Microbiology Vol.18 (2) pg. 67-72..
Vandenbroucke, I., Van Marck, H., Verhasselt, P., Thys, K., Mostmans, W.,
Dumont, S, Van Eygen, V., Coen, K., Tuefferd, M., Aerssens, J. (2011) Minor
Variant Detection in Amplicons Using 454 Massive Parallel Pyrosequencing:
27

Experiences and Considerations for Successful Applications. BioTechniques. Vol. 51
(3) pg. 167-177.
Wani, K.A., Mamta, S.K., Rao, R.J. (2013) Bioconversion of Garden Waste,
Kitchen Waste and Cow Dung into Value-Added Products Using Earthworm Eisenia
fetida. Saudi Journal of Biological Sciences. Vol. 20 (2) pg. 149-154.
Ward, A.I., Judge, J., Delahay, R.J. (2010) Farm Husbandry and Badger Behaviour:
Opportunities to Manage Badger to Cattle Transmission of Mycobacterium bovis.
Preventative Veterinary Medicine. Vol. 93 (1) pg. 2-10.
White, P.C.L., Whiting, S.J. (2000) Public Attitudes Towards Badger Culling to
Control Bovine Tuberculosis in Cattle. Veterinary Record: Journal of the British
Veterinary Association. Vol. 147 (7) pg. 179-183.
Wilson, G.J., Carter. S.P., Delahay, R.J. (2011) Advances and Prospects for
Management of TB Transmission Between Badgers and Cattle. Veterinary
Microbiology. Vol. 151 (1-2) pg. 43-50.
Woodroffe, R., Donnelly, C.A., Jenkins, H.E., Johnston, W.T., Cox, D.R.,
Bourne, F.J., Cheeseman, C.L., Delahay, R.J., Clifton-Hadley, R.S., Gettinby, G.,
Gilks, P., Hewinson, R.G., McInerney, J.P., Morrison, W.I. (2006) Culling and
Cattle Controls Influence Tuberculosis Risk for Badgers. Proceedings of the National
Academy of Sciences. Vol. 103 (40) pg. 14713-14717.