You are on page 1of 12

El gnero Azospirillum

Historia
An cuando Spirillum lipoferum fue descrito en 1925 por Beijerinck, esta bacteria estuvo
olvidada por varias dcadas. Son las observaciones de Pea-Cabriales y Dbereiner en
1973 (50) las que iniciaran la poca moderna de esta bacteria. Estudios taxonmicos de S.
lipoferum (88, 89) conducen a su reclasificacin en un gnero nuevo, Azospirillum (166).
Actualmente son reconocidas seis especies en el gnero Azospirillum. Las dos primeras en
ser descritas fueron A. lipoferum y A. brasilense (166), siendo stas las mas ampliamente
estudiadas. Posteriormente fueron descritas las especies A. amazonense (105), A.
halopraeferans (141), A. irakense (85) y A. largomobile (26) siendo el nombre de esta
especie corregido a A. largimobile (158). Pocos aos antes sta especie fue considerada
como un sinnimo de la especie A. lipoferum (57). Recientemente, en honor de quien
impulsara los estudios con este gnero bacteriano y descubriera otros diaztrofos, se ha
propuesto la especie candidata A. doebereinerae(70).
Pocos aos despus del redescubrimiento de Azospirillum y hasta alrededor de 1993, este
gnero fue el ms estudiado entre las bacterias asociadas a plantas. La capacidad
de Azospirillum para estimular el crecimiento de las plantas y de aumentar el rendimiento
de los cereales promovi numerosos estudios sobre la ecologa, fisiologa y gentica de esta
bacteria. En la actualidad su uso comercial comienza a extenderse en diferentes pases,
includo Mxico.
Aislamiento
El aislamiento de las bacterias del gnero Azospirillum resulta en lo general muy simple, ya
sea a partir de suelo rizosfrico o de la superficie de las races (rizoplano) de numerosas
plantas hospederas. Tambin se le aisla del interior de las races o tallos de algunas plantas.
El medio de cultivo usado por excelencia para el enriquecimiento de las especies
de Azospirillum ha sido el NFb semigelificado "libre" de nitrgeno y con malato como
fuente de carbono (52). No obstante, en este medio de cultivo son aisladas
predominantemente cepas de las especies A. lipoferum y A. brasilense. El medio NFb con
algunas modificaciones en su composicin y pH permiten el aislamiento predominante de
otras especies de Azospirillum (51). Estos medios son usados frecuentemente para evaluar
la actividad reductora de acetileno, como indicativo de la fijacin de nitrgeno. Tubos en
los cuales se observa el crecimiento bacteriano en forma de sombrilla, la cual se transforma
en una pelcula blanca y densa abajo de la superficie del medio de cultivo, y vire del
indicador azl de bromotimol son considerados tentativamente como positivos para el
aislamiento en cultivo puro de la bacteria.
El cultivo puro se logra en diferentes medios de laboratorio (126), siendo muy comunmente
usado un medio adicionado del colorante rojo Congo (146), en el cual A. lipoferum y A.
brasilense toman un color rojo escarlata que permite la diferenciacin de otros gneros
bacterianos. Aun cuando el medio BLCR fue diseado para mejorar el aislamiento de cepas
de Azospirillum brasilense (20), su uso no fue aceptado por haberse demostrado que no era
apropiado para el estudio de poblaciones naturales de esta bacteria (73). Posteriormente se
observ que la concentracin de estreptomicina usada (200 mg/litro) en el medio BLRC era
inhibitoria del crecimiento de un gran nmero de cepas (103).
Adems de los medios y mtodos descritos, tambien existen reportados algunos medios de
cultivo y mtodos para el crecimiento deAzospirillum en cultivo puro y en asociacin con
plantas, as como para su conservacin (2, 126).
Identificacin
El gnero Azospirillum pertenece a la subclase alfa de las proteobacterias (181), siendo A.
lipoferum la especie tipo (166). Caractersticas tiles en la identificacin rutinaria son la
forma vibroide, el pleomorfismo y su movilidad en espiral (51). Las clulas contienen
cantidades elevadas de poli--hidroxibutirato (PHB), hasta 50% del peso seco celular (124),
observndose al microscopio las clulas jvenes con abundantes granulos refringentes. En
cultivos semigelificados y gelificados con mas de 24 h de incubacin se presentan
frecuentemente clulas refringentes con forma ovoide y de paredes gruesas similares a
quistes (96). Una de las caractersticas fenotpicas ms ampliamente usada como criterio
para el reconocimiento tentativo del gnero Azospirillum es el color rojo escarlata que
toman las colonias (Fig. 1) al crecer en un medio adicionado del colorante rojo Congo
(146). No obstante, en este medio pueden hallarse colonias mutantes de Azospirillum de
color blanco debido a la incapacidad de producir polisacridos no identificados (25).
Diversas pruebas bioqumicas y fisiolgicas son utilizadas rutinariamente para el
reconocimiento de las especies de Azospirillum. En laTabla 1 se presentan algunas
caractersticas fenotpicas que contribuyen a diferenciar las especies de Azospirillum.
Adicionalmente, la diferenciacin de especies del gnero Azospirillum se logra evaluando
la capacidad de usar diversos aminocidos y su efecto sobre la fijacin de nitrgeno (68),
recomendndose el uso de la histidina para la caracterizacin y aislamiento selectivo de la
especie A. lipoferum.
Los patrones de protenas de membrana (8, 48), as como los patrones de protenas
celulares (141), determinados mediante electroforesis en geles de poliacrilamida-
dodecilsulfato (SDS-PAGE), permiten una clara diferenciacin de las especies A.
lipoferum, A. brasilense, A. amazonense y A. halopraeferens.
En forma complementaria para la identificacin fenotpica de las especies
de Azospirillum pueden ser usadas diversas tcnicas inmunolgicas. La aglutinacin en
tubo, tcnicas de precipitacin en capilar, inmunoelectroforesis (44, 46),
inmunofluoresencia e inmunodifusin (44, 93) fueron mtodos usados exitosamente en la
identificacin y numeracin de Azospirillum spp. El uso de la tcnica de ELISA (Enzyme-
Linked Immnunosorbent Assay) permite la identificacin y numeracin especfica de cepas
de Azospirillum, como fue demostrado con la cepa Cd de A. brasilense (99) permitiendo
evaluar la capacidad de colonizacin de esta cepa en plantas inoculadas.
La identificacin genotpica especfica al nivel de gnero y especies de Azospirillum se
logra en forma reproducible mediante el uso de sondas basadas en secuencias de los genes
23S rRNA (86). Con los oligonuclotidos reportados se logra tanto la identificacin
especfica del gnero Azospirillum como de las especies A. lipoferum, A. brasilense, A.
amazonense, A. halopraeferens y A. irakense, mediante experimentos tipo "dot blot". Estas
sondas tambin pueden ser usadas para la deteccin in situ de las especies de Azospirillum.
Alternativamente, la identificacin genotpica rutinaria de las especies de Azospirillum, as
como su deteccin, se logra fcilmente y en forma reproducible amplificando mediante el
uso de la reaccin en cadena de la polimerasa (PCR) los genes 16S rDNA [p. ej. usando las
secuencias de los oligonuclotidos 27f (5'-GAGAGTTTGATCCTGGCTCAG) y 1495r (5'-
CTACGGCTACCTTGTTACGA)] y cortando los productos amplificados con la enzima de
restriccin AluI (63, 66). Con esta estrategia se obtienen fragmentos de tamaos especficos
para cada especie de Azospirillum, distinguibles fcilmente en geles de agarosa
Caractersticas genmicas
El genoma de cinco de las 6 especies de Azospirillum, excepto el de A. largimobile el cual
no fue analizado, es constitudo por varios megareplicones algunos de los cuales son
aparentemente lineares (107). El tamao global del genoma en las especies
de Azospirillum vara de un mnimo de 4800-kb en A. irakense a practicamente el doble,
9600-kb en A. lipoferum. En A. brasilense y A. amazonenze el tamao es alrededor de
7000-kb. El nmero de replicones vara entre cepas de A. brasilense, encontrndose
comunmente 7-8 replicones (33, 107) (Fig. 2) e incluso hasta 10 en A. lipoferum (107).
Sera de esperarse que uno de los replicones de gran tamao correspondiera al cromosoma,
pero interesantemente, en A. brasilense se mostr por primera vez que el genoma de esta
especie est constituda por mltiples cromosomas (33), correspondiendo stos a replicones
de alrededor de 600-kb, 1000-kb y 1700-kb. La existencia de cromosomas mltiples en A.
brasilense ha sido corroborada, pero se reporta la existencia de un cromosoma extra de
alrededor de 2500-kb (107). En las otras especies de Azospirillum tambin se encontr que
el genoma est constitudo por varios cromosomas (107), confirmndose la hipotesis
sugerida previamente (33) sobre la multiplicidad de cromosomas en el gnero Azospirillum.
Asi, el gneroAzospirillum se suma al reducido grupo de bacterias [Agrobacterium
tumefaciens (4), Brucella spp. (79), Burkholderia cepacia (36),Rhodobacter
spheroides (163), Vibrio parahaemolyticus (180)] que presentan varios cromosomas en
lugar de un solo cromosoma circular.
Aspectos de la gentica de Azospirillum y de los genes que participan en la interaccin con
las races de las plantas, as como los involucrados en la fijacin, asimilacin y regulacin
de nitrgeno han sido revisados recientemente por Steenhoudt y Vanderleyden (161).
La presencia de plsmidos es comn en A. lipoferum y A. brasilense, siendo sta una de las
primeras caractersticas genmicas reportadas para el gnero Azospirillum (Fig. 2). En
general cada cepa muestra un perfil plasmdico nico conformado por 1 a 6 plsmidos, con
tamaos en el rango de 6- a 550-kb (59, 62, 136). Aun cuando se reportaron algunas
discrepancias en el perfil de plsmidos, analizando incluso la misma cepa (p. ej. Sp 7), la
presencia de un plsmido de 90-Mda (llamado p90; aprox. 135-kb) es comn entre las
cepas de A. brasilense. Debido a que el p90 no ha podido ser curado en A. brasilense, se
considera que ste plsmido codifica funciones celulares esenciales (41, 131). Adems de la
presencia de plsmidos en cepas de Azospirillum, tambin fue reportada la presencia de
minicromosomas (179), y aunque su designacin fue hecha solamente sobre la base de su
gran tamao, 2775-kb aproximadamente, su presencia fue confirmada solo recientemente
(33, 107).
Con excepcin del p90, involucrado en la biosntesis de cido indol actico (84) y en la
adherencia a las races (41, 111) no se conoce la funcin de los otros plsmidos en las
especies de Azospirillum. No obstante, algunes genes como los nodPQ o exoB y exoC han
sido identificados en el p90 mediante ensayos de hibridacin o complementacin gentica
(113, 175). Recientemente ha sido identificado el genrepA (origen de replicacin del
plsmido) en el p90 de A. brasilense (173). El mapa fsico del p90 fue constuido a partir
del plsmido obtenido de la cepa tipo de Azospirillum brasilense Sp7 (131).
Distribucin
Los azospirilla muestran una muy amplia distribucin geogrfica alrededor del mundo. An
cuando son mas abundantes en las regiones tropicales, tambin se les encuentra en las
regiones templadas, fras y desrticas (45, 52, 65, 169). En las regiones templadas del sur
de Brasil, los Estados Unidos y Kenia la presencia de Azospirillum es menor al 10% en las
muestras analizadas (52). El pH del suelo juega un papel importante en la presencia de las
especies del gnero Azospirillum. Las especies de A. brasilense y A. lipoferum se
encuentran en mayor abundancia en suelos con valores de pH cercanos a la neutralidad, an
cuando a pH abajo de 5 se les encuentra en forma esporadica y no logrndose su
aislamiento de suelos con pH menor a 4.5 (52, 49, 120). Un estudio en el que se evaluaron
23 tipos de suelos con caractersticas diferentes mostr que algunos factores abiticos tales
como porcentaje de arcilla, contenido de materia orgnica, capacidad de retencin de agua
y contenido de nitrgeno afectan positivamente la sobrevivencia de A. brasilense (24), en
tanto que el tamao de las partculas de arena y especialmente la alta concentracin de
carbonato de calcio afectan negativamente la sobrevivencia de esta especie en ausencia de
plantas. No obstante, la sobrevivencia de A. brasilense en la rizosfera es independiente de
la aridez del suelo.
Las bacterias del gnero Azospirillum han sido aisladas de la superficie de la raz de una
muy amplia variedad de plantas y de su rizosfera, incluyendo cereales como maz, trigo,
arroz, sorgo, avena (85, 91, 135, 94, 151, 156, 178), pastos forrajeros como Cynodon
dactylon(34, 121), Poa pratensis, Festuca arundinacea (162), de diferentes especies
de Pennisetum (87, 169) y Panicum (34, 103, 104, 169). Especies de Azospirillum fueron
aisladas incluso del henequn [Agave fourcroydes (103)], y plantas cactceas que incluyen
diferentes especies de Opuntia y Stenocereus (109, 138). En algunos casos se logr
confirmar el aislamiento de A. brasilense y A. amazonense de semillas de pastos
esterilizadas superficialmente (162). Aun cuando no fueron identificados al nivel de
especie, algunas cepas deAzospirillum fueron aisladas de esporocarpos de los hongos
ectomicorrzicos Hebeloma crustuliniforme, Laccaria laccata andRhizopogon
vinicolor (100).
Ambiente rizosfrico
Aparentemente, una bacteria del suelo deber sobrevivir a las mltiples interacciones que
se presentan con la compleja comunidad microbiana que habita el mismo microambiente,
antes de que ocurra cualquier interaccin con las races de la planta. En el inicio de una
interaccin con las races de la planta hospedera, el microorganismo especfico deber
llegar a la superficie de las races, adherirse y multiplicarse para colonizarla. Si la bacteria
tiene la capacidad de invadir los tejidos internos, se diseminar en el interior de la raz e
incluso en otros rganos de la planta.
La adaptacin de Azospirillum al futuro ambiente rizosfrico probablemente se inicia con la
germinacin de la semilla, la cual exuda infinidad de compuestos orgnicos que forman
parte fundamental de la espermosfera. Posteriormente, la exudacin de compuestos ser a
travs de las races durante el desarrollo de la planta (43). Aun cuando las especies
de Azospirillum difieren en su capacidad para utilizar diferentes compuestos como fuentes
de carbono y nitrgeno, estas bacterias usan para su crecimiento unos pocos mono y
disacridos asi como alcoholes polihidroxilados, y principalmente diversos cidos
orgnicos tales como mlico y succnico y algunos aminocidos (68,166). Para el uso de
diferentes fuentes de carbono, tanto A. lipoferum como A. brasilense tienen todas las
enzimas de la via de Embden-Meyerhof-Parnas y de la va de Entner-Doudoroff (108, 177),
as como todas las enzimas del ciclo de los cidos tricarboxlicos (108). Tanto A.
lipoferum como A. brasilense tienen la capacidad de crecer autotrficamente con H
2
y CO
2
,
proceso en el que participa la ribulosa-1,5-difosfato carboxilasa (106, 168). A pesar de que
el uso de cido poligalacturnico y pectina fue reportado en A. brasilenseSp7 (170, 171) y
que se detect actividad pectato liasa (167), existen evidencias contradictorias en cuanto al
uso de polisacridos por esta especie. A. brasilense puede metabolizar varios mono y
disacridos constituyentes de la pared celular de las races de Pennisetum
americanum (118). Sin embargo, estos autores no pudieron confirmar que la cepa Sp7 fuera
capaz de usar cidos poligalacturnicos, o pectina, ni otros polisacridos tales como
xilanos, polipectatos y celulosa.
La riqueza en compuestos orgnicos en la espermosfera/rizosfera conduce a intensas
actividades e interacciones microbianas. Algunos estudios indican que la quimiotaxis a los
exudados de raz es uno de los factores que influyen en la llegada de los microorganismos a
la rizosfera (154). Tanto en A. lipoferum como en A. brasilense se demostr una fuerte
actividad quimiotctica hacia diversos azcares, cidos orgnicos y aminocidos
(13, 15, 71, 140), as como hacia compuestos aromticos (102) y exudados radicales
(5, 61, 71). La respuesta quimiotctica a diferentes fuentes de carbono es variable
dependiendo de la especie de Azospirillum e incluso es cepa-especfica (140). Tambin una
respuesta hacia el oxgeno (aerotaxia) fue observada en A. brasilense (14, 15). Zonas de
baja concentracin en oxgeno fueron las preferidas por las clulas bacterianas para su
crecimiento y multiplicacin, siendo repelidas por altas concentraciones de oxgeno y
condiciones anaerbicas (14, 139). La aerotaxia parece ser especialmente importante bajo
condiciones de fijacin de nitrgeno, permitindole a las clulas de Azospirillum alcanzar
concentraciones de oxgeno lo suficientemente bajas para que se exprese la actividad
nitrogenasa. Se sugiere que tanto la respuesta quimio y aerotctica son caractersticas que
contribuyen en el proceso de colonizacin de las races de las plantas, ya que el consumo de
oxgeno durante el crecimiento activo de las races enriquece el ambiente con sustratos
orgnicos y genera gradientes de oxgeno al consumirse ste durante la respiracin (112).
No obstante, la colonizacin de la rizosfera y la superficie o el interior de las races ser el
resultado del enriquecimiento selectivo de los microorganismos mejor adaptados a estos
ambientes. Por ejemplo, la capacidad para producir bacteriocinas por algunas cepas de A.
brasilense y A. lipoferum (129, 130, 157,165) podra representar ventajas competitivas
sobre las cepas de estas especies o ntimamente relacionadas que sean sensibles a estas
biomolculas. Adems, la capacidad de producir siderforos (agentes quelantes del hierro)
por algunas cepas de A. brasilense (9, 155,165) (Fig. 3) pudiera ser de gran importancia
durante la colonizacin del ambiente rizosfrico y de la superficie de las races al ejercer
efectos antagnicos contra otros miembros de la comunidad microbiana, incluyendo a
microorganismos deletreos o patgenos de las plantas (Fig. 4). Es concebible que en el
ambiente rizosfrico las especies de Azospirillum puedan ser antagonizadas. Alrededor de
la tercera parte de ms de 400 actinomicetos aislados de la rizosfera del centeno fueron
reportadas como antagonistas de Azospirillum spp. y A. lipoferum (92). Esta actividad
antagonista correlaciona con la alta sensibilidad de A. brasilense a los antibiticos
estreptomicina, tetraciclina y cloranfenicol (103) producidos por actinomicetos del suelo,
en comparacin a la elevada resistencia a los antibiticos del tipo -lactmicos producidos
por hongos. La expresin constitutiva de la actividad -lactamasa fue observada entre
numerosas cepas de A. brasilense (103). Estos resultados sugieren que el antagonismo
causado por hongos contra Azospirillum es limitado. Tambin es concebible que se
presenten efectos sinrgicos entre Azospirillum y otros miembros de la comunidad
rizosfrica. Por ejemplo, el filtrado de un cultivo de Phialophora radicicola, hongo usado
como agente de biocontrol, promueve el crecimiento de A. lipoferum y A. brasilense (58).
De manera similar, la interaccin entre A. brasilense y Azotobacter
chrococcum o Streptomyces mutabilis conduce a incrementos de sus respectivas
poblaciones en la rizosfera de trigo (53).
Diversas condiciones tales como el envejecimiento celular y la presencia de metales
pesados provocan que las clulas vibroides deAzospirillum cambien su morfologa y tomen
la forma de "quistes" (conocidos como formas C), conduciendo a la agregacin celular y
formando grumos visibles de gran tamao (19). Aparentemente, residuos de arabinosa
presentes en el exopolisacrido y en el polisacrido capsular estan involucrados en la
agregacin de A. brasilense (31). La agregacin y la formacin de quistes mejora la
sobreviviencia deAzospirillum, situacin en la que la acumulacin de poli--hidroxibutirato
(PHB) parece desempear una funcin importante al servir como almacen de carbono y
energa (125). Adems, diversas funciones fisiolgicas son atribuidas al PHB, destacndose
la mayor resistencia a la desecacin (96, 147, 148), a la luz ultravioleta y al choque
osmtico (164). Se ha sugerido que la formacin de quistes pudiera desempear una
funcin importante en la sobreviviencia de Azospirillum en el ambiente rizosfrico, e.g.,
cuando los nutrientes son limitados, previo a la asociacin con las races de la planta
(164, 127). Recientemente, ha sido publicada una amplia revisin sobre las caractersticas
de A. brasilense en relacin con la agregacin celular (29).
Interaccin con la planta
Probablemente, una vez que las clulas de Azospirillum se han adaptado a las condiciones
del ambiente rizosfrico y han logrado llegar a la superficie de las races, debido a sus
caractersticas quimio y aerotcticas, se iniciar el establecimiento de la asociacin.
Diferentes estudios han mostrado que A. brasilense tiene la capacidad para adherirse a las
races de plantas gramneas como el mijo (Pennsisetum purpureum) y Digitaria
decumbens (171), trigo (77), maz (61), as como a las races de plantas de otras familias
que incluyen al algodn y tomate (98), e incluso a superficies inhertes como poliestireno y
arena (22, 23, 98). La capacidad de Azospirillum para adherirse a las races, al menos a las
de mijo, es significativamente mayor que la mostrada por otras bacterias de la comunidad
rizosfrica comoRhizobium, Azotobacter, Klebsiella o Pseudomonas, e incluso que E.
coli (171). La asociacin de Azospirillum con las races de las plantas se desarrolla en dos
etapas completamente independientes (111). La primera consiste en una adsorcin rpida,
dbil y reversible, la cual es dependiente de protenas de la superficie bacteriana del tipo de
las adhesinas en conjunto con la participacin del flagelo polar (40,111). La segunda fase
consiste de un anclaje lento pero firme e irreversible que alcanza su mximo nivel 16 h
despus de la inoculacin, el cual parece ser dependiente de un polisacrido extracelular
de Azospirillum (111). Los resultados de un estudio reciente sugieren la posibilidad de que
una protena de la membrana externa de Azospirillum participe en el proceso de adherencia
a las races de las plantas (31). El proceso de adherencia de Azospirillum a las races de las
plantas ha sido revisado recientemente (29). En diversos casos se ha reportado la aparicin
de material fibrilar que contribuye al anclaje de Azospirillum a las races de diversas plantas
(98, 171), describindose como esencial para el anclaje a las partculas de arena (23). An
en la actualidad, la naturaleza del material fibrilar no ha sido elucidada (47, 161), aunque
parece ser de origne bacteriano. Recientemente se ha publicado una revisin sobre la
capacidad deAzospirillum para adherirse a superficies abiticas del suelo (18).
La inoculacin de diversas plantas con Azospirillum ha mostrado que los principales sitios
de colonizacin son las areas de elongacin celular y las bases de los pelos radicales
(98, 82). Slo algunas clulas de Azospirillum llegan a adherirse a la cofia o a los pelos
radicales (82). Sin embargo, fue observada la presencia de Azospirillum dentro del mucigel
que se acumula en la cofia (171). La inoculacin de races de trigo con una cepa
de Azospirillum que expresa constitutivamente el gen reportero gusA mostr que en los
primeros das de la asociacin las clulas bacterianas colonizan especficamente los sitios
de emergencia de las races laterales y las regiones de los pelos radicales, tanto de la raz
primaria como de las races secundarias y posteriormente la superficie de la raz (172). En
plantas de trigo fue observado que la inoculacin de Azospirillum induce cambios en la
morfologa de los pelos radicales, siendo stos cambios significativamente mayores que los
causados por Rhizobium leguminosarum o Azotobacter chrococcum, los cuales son
mnimos (77,80). Adems, fue observado que la inoculacin con 105 a 106 clulas
de Azospirillum causa tanto la elongacin como el aumento de la superficie total de la raz
(Fig. 5), en tanto que la inoculacin de 108 a 109 clulas causan la inhibicin del desarrollo
de sta (82). Aparentemente, el incremento del tamao del sistema radical se debe, al
menos parcialmente, al aumento de la divisin celular y al intenso crecimiento de la zona
de elongacin de las races (97). Es de inters sealar que los sitios que
coloniza Azospirillum lipoferum son diferentes, dependiendo de la variedad de la planta, al
menos en el caso del arroz (116). La capacidad de Azospirillum para colonizar las races de
las plantas es variable dependiendo de la cepa. Con el uso de microscopia confocal de rayos
lasser y sondas de oligonucletidos fluorescentes (6) y con el uso de anticuerpos
monoclonales cepa-especficos (153) ha sido mostrado que algunas cepas de A. brasilense,
incluyendo a la cepa tipo Sp7, se encuentran restringidas al ambiente rizosfrico y son
capaces de formar colonias solamente en la superficie de la raz de plntulas de trigo, en
tanto que otras cepas son encontradas frecuentemente en altas densidades en los espacios
intercelulares de la raz, as como en el interior de los pelos radicales. Resultados similares,
usando otras metodologias, habian sido reportados con algunas de las mismas cepas
de Azospirillum inoculadas en trigo creciendas en condiciones de campo (11).
Experimentos de inoculacin
Considerando la capacidad de Azospirillum para asociarse con plantas de inters agrcola,
as como su capacidad para fijar N
2
en medios de cultivo, se disearon numerosos
experimentos para evaluar el efecto de la inoculacin sobre el crecimiento de las plantas.
No existen reportes que indiquen efectos patognicos en las plantas causadas por la
inoculacin de Azospirillum. El nico reporte existente en esta direccin indica que ninguna
de las especies de Azospirillum causa sintomas visibles de enfermedad sobre la raz o las
hojas de plantas de trigo, algodn o tomate (17). Con la inoculacin de Azospirillum se
observ frecuentemente un mayor desarrollo del sistema radical (Fig. 6)
(123, 133, 135, 174) el cual se traduce en mayor superficie de absorcin de nutrientes, as
como en mayor desarrollo de la parte area de las plantas (Figs. 7 y 8)
(7, 117, 123, 133, 135, 150). Tambin fueron observados incrementos en el contenido de
nitrgeno, fsforo, potasio y otros minerales en las plantas inoculadas
(32, 101, 117, 133, 149, 160). Principalmente con A. brasilense y A. lipoferum se llevaron a
cabo gran cantidad de experimentos en muchos pases para evaluar su efecto sobre el
rendimiento de los cultivos
(3, 10, 11, 27,32, 37, 56, 60, 80, 83, 110, 114, 119, 123, 134, 145, 149, 159, 176). Una
amplia revisin sobre los resultados de los experimentos desarrollados entre los aos 1974-
1994 fue realizada por Okon y Labandera (128). Esta evaluacin revel que el xito de la
inoculacin fue en el rango del 60 al 70% de los experimentos realizados en suelos y
regiones climticas diferentes (Fig. 9), con incrementos significativos, generalmente en el
rango de 5 a 30%, en el rendimiento de los cultivos (Fig. 10). Sin embargo, cuando se
evalu el efecto de la inoculacin en conjunto con la aplicacin de niveles intermedios de
fertilizacin con nitrgeno, fsforo y potasio, el xito de los experimentos se incrementa
hasta 90% (128). Frecuentemente se observ que la inoculacin de los cultivos
con Azospirillum permite reducir en 40-50% el nivel de los fertilizantes sin que exista
disminucin en el rendimiento de la cosecha. Recientemente fueron observados
incrementos en la biomasa de pastizales naturales inoculados con A. brasilense aun bajo
condiciones de crecimiento subptimas (75).
Mecanismos de estimulacin del crecimiento de las plantas
La capacidad de Azospirillum para estimular el crecimiento de las plantas ha sido
demostrado en decenas de experimentos, tanto de campo como de invernadero. Varios son
los mecanismos que se han sugerido como responsables del efecto estimulatorio observado
en las plantas inoculadas.
En numerosos estudios de inoculacin con Azospirillum, adems del mejor crecimiento de
las plantas, fueron observados incrementos en el contenido de nitrgeno total de las plantas
inoculadas respecto a las testigo (10, 37, 81, 80, 117, 122, 133, 152, 160) y en la
incorporacin de
15
N (90, 142, 143). No obstante, en la mayora de estos estudios no fueron
observadas diferencias significativas en el porciento de nitrgeno o en el contenido de
protena entre plantas inoculadas y no inoculadas, razn que contribuy a desechar la idea
de que la fijacin biolgica de nitrgeno fuera el mecanismo responsable de los efectos
benficos observados. Debido a que los efectos de la inoculacin con Azospirillum sobre el
crecimiento de la raz y la parte area de las plantas son similares a los que se presentan
cuando las plantas son tratadas con fitohormonas (144, 167) fue sugerido que estas
sustancias podran ser responsables del mejor crecimiento de las plantas, as como de los
incrementos observados en el contenido de minerales y en el rendimiento de los cultivos
(10, 27, 32, 80, 114,119, 122, 135, 160)
Recientemente ha sido revisada la funcin de las fitohormonas en las asociaciones planta-
microorganismo (72). Azospirillum tiene la capacidad de producir auxinas, citocininas y
giberelinas en medios de cultivo (28, 55, 74, 109, 132, 144, 167). No obstante, el
mecanismo analizado con mayor amplitud ha sido la produccin de auxinas, especialmente
la del cido indol actico (AIA) (16, 67, 69, 78, 115, 182). El AIA producido por las
bacterias puede modificar el contenido de fitohormonas de las plantas conduciendo a la
estimulacin del crecimiento de las mismas (12).
En cultivos de Azospirillum, adems de AIA se han encontrado otros compuestos indlicos
y metabolitos relacionados tales como el cido indol pirvico (38), indol lctico (39, 42),
indol acetamida (12, 39, 69), indol acetaldehdo (38), indol etanol e indol metanol (42),
triptamina, antranilato y otros compuestos indlicos no identificados (69). En diferentes
estudios se ha tratado de obtener mutantes incapaces de sintetizar AIA, sin embargo, en el
mejor de los casos solamente se logr obtener mutantes hipoproductoras de este compuesto.
Esto sugiri la existencia de ms de una va biosinttica del AIA en Azospirillum (1, 69).
Actualmente se conoce queAzospirillum puede sintetizar AIA a travs de tres vas. En tanto
que las vas del cido indol pirvico (38) y la del indol acetamida (12) son dependientes del
triptofano, la tercera es una va independiente de este aminocido (137), desconocindose el
precursor del AIA. Resultados recientes permiten sugerir que la indol piruvato
descarboxilasa es una enzima comn tanto a la va del indol pirvico como a la va no
dependiente de triptofano (95).
A pesar de que existe la tendencia de atribuir a las fitohormonas, especialmente al AIA, los
efectos benficos de la inoculacin conAzospirillum, tambin existe la propuesta de que
tales beneficios son el resultado de diversos mecanismos (21, 101, 133, 135, 174). Se han
sugerido otros mecanismos como responsables de los efectos estimulatorios causados por la
inoculacin de Azospirillum (183) y algunos de stos han sido revisados por Bashan y
Holguin (19).
Aplicacin
Algunas compaias en diferentes pases han registrado inoculantes de Azospirillum para
maz y otros cultivos (75, 128). Burdman y col. (30) refieren que en Sudafrica se lleva a
cabo la produccin de inoculantes a base de Azospirillum para 150,000 hectreas de maz y
12,000 de trigo. Algunas caractersticas de la produccin de inoculantes a base
de Azospirillum han sido discutidas (54, 76, 128).
Aun cuando el uso de Azospirillum como bioestimulante del crecimiento de las plantas no
se ha generalizado mundialmente, en Mxico la aplicacin de sta bacteria en diferentes
cultivos ha revasado con mucho lo hecho en otros pases. En el ciclo agrcola primavera-
verano (PV) del ao 1999 la Secretara de Agricultura, a travs de su Instituto Nacional de
Investigaciones Forestales Agrcolas y Pecuarias (INIFAP) y de la Fundacin Mexicana
para la Investigacin Agropecuaria y Forestal, A.C., en colaboracin con el Centro de
Investigacin sobre Fijacin de Nitrgeno-UNAM, llev a cabo la inoculacin de alrededor
de 450,000 hectreas de maz y 150,000 hectreas de sorgo, cebada y trigo, empleando
cepas de Azospirillum seleccionadas por su capacidad para promover el crecimiento de las
plantas e incrementar el rendimiento de los cultivos.
La evaluacin del rendimiento de grano en alrededor de 675 hectreas de los diversos
cultivos, que comprendieron cerca de 170 sitios de Mxico con caractersticas edficas en
regiones climticas diferentes mostr el xito de la inoculacin en el rango de 62 a 95% de
los casos analizados, con incrementos que fluctuaron en el rango de 6 a 98%. En la Tabla
2 se presenta un resumen de los resultados obtenidos en el ciclo agrcola PV-1999. El
incremento promedio en la produccin de los cultivos de maz, trigo, cebada y sorgo bajo
las diferentes condiciones evaluadas fue del 26%. Los resultados fueron dependientes de la
variedad y cultivo, tipo de suelo, uso y nivel de fertilizantes (35). La mejor respuesta a la
inoculacin se present en suelos de tipo ligero (arenosos), con niveles intermedios de
fertilizacin en el rango de 45-90 Kg N/ha, y con las variedades "criollas" de maz.
Considerando la cantidad de variedades, cultivos, suelos y condiciones climticas
evaluadas, los resultados de la inoculacin con Azospirillum reflejan claramente la
capacidad de la bacteria para promover el desarrollo de las plantas y el impacto positivo
sobre el rendimiento de los cultivos de grano. El programa de "Biofertilizacin" se continu
durante el ciclo PV-2000, inoculndose alrededor de un milln y medio de hectreas.
El temor o las precauciones expresadas en algunas revisiones sobre el tema, por cierto muy
escasas, para extender el uso de Azospirilluma niveles comerciales debido a la
"inconsistencia de la inoculacin" tienen poco valor ante los resultados de produccin
obtenidos en decenas de experimentos, as como los obtenidos en miles de hectreas con
diferentes cultivos, variedades y condiciones edficas y climticas.
An en la actualidad hacen falta muchos estudios de investigacin bsica, tanto sobre la
bacteria como en su interaccin con la planta, para un mejor entendimiento de la
asociacin Azospirillum-planta. No obstante, en mi opinin, la aplicacin
de Azospirillum como bioestimulante que incrementa la produccin de los cultivos deberia
extenderse a todos aqullos lugares donde la aplicacin de fertilizantes es nula o escasa,
como lamentablemente ocurre en no pocos pases que tienen una agricultura
subdesarrollada. En las regiones donde se practica una agricultura moderna, la inoculacin
con Azospirillum permitira reducir las elevadas cantidades de fertilizantes que
generalmente se aplican y con ello disminuir tanto el costo de produccin como los
problemas derivados de su uso, principalmente la contaminacin, sin detrimento de la
produccin.