A duplex-PCR method for species- and pathovar-level identication and detection of

the quarantine plant pathogen Xanthomonas arboricola pv. pruni

J.F. Pothier
a,1
, M.C. Pagani
b,1,2
, C. Pelludat
a
, D.F. Ritchie
b
, B. Duffy
a,

a
Agroscope Changins-Wdenswil ACW, Plant Protection Division, CH-8820 Wdenswil, Switzerland
b
Department of Plant Pathology, CB 7616, North Carolina State University, Raleigh, NC, 27695, USA
a b s t r a c t a r t i c l e i n f o
Article history:
Received 30 January 2011
Received in revised form 13 March 2011
Accepted 17 March 2011
Available online 6 April 2011
Keywords:
Phytosanitary diagnostics
Prunus
Quarantine pathogen
Stone fruit
Hazelnut
Xanthomonas
A PCR-based method was developed for the stone fruit quarantine pathogen Xanthomonas arboricola pv. pruni
(Xap), which provides rapid, sensitive and specic in planta detection and isolate identication. Primers
specic for Xap were identied using random amplied polymorphic DNA (RAPD). Simplex PCR with these
primers had a limit of detection per PCR reaction of approximately 10 CFU for isolate cultures and 50 CFU for
plant material when used on tenfold dilutions of isolate culture or genomic DNA extracted from spiked
samples, respectively. The primers were adapted as a high-throughput single-step screening based on a
digoxigenin-labeled DNA probe assay with a detection limit of 410
2
CFU fromisolate cultures. A duplex-PCR
method was designed that includes the pathovar-level with species-level primers based on species-specic
regions of the quinate metabolic gene qumA, increasing diagnostic condence and offering the rst molecular
test for all X. arboricola pathovars.
2011 Elsevier B.V. All rights reserved.
1. Introduction
Xanthomonas arboricola pathovar pruni (Xap) (Vauterin et al., 1995,
syn. X. campestris pv. pruni Smith) is a gamma, Gram-negative plant
pathogenic bacterium that causes bacterial spot on a wide-range of
commercial, ornamental and forest Prunus species (Ritchie, 1995). Xap
can persist and be transmitted in budwood, thus buds used in plant
propagation can disseminate the pathogen to areas or countries
previously free of this disease (GoodmanandHattingh, 1986; Zaccardelli
et al., 1998). Outbreaks can signicantly reduce crop yield, and result
in tree or orchard loss, particularly on peach, apricot, nectarine, plum
and prune. Symptoms appear on leaves, fruits and branches, ranging
from necrotic angular lesions on leaves, sunken lesions on fruits to
cankers and dieback of branches. Control options are limited with most
commercial cultivars generally considered susceptible and prophylactic
copper compound sprays constrained by development of pathogen
resistance and environmental concerns with residues (Ritchie, 1995;
1999). In most countries, Xap has quarantine status (Anonymous, 2000,
2006), which entails additional economic impact from inspection and
eradication regulations.
Effective implementation of phytosanitary control and quarantine
strategies depends upon availability of rapid, accurate and sensitive
diagnostics. Current diagnostic methods for stone fruit bacterial spot
and Xap (Anonymous, 2006) are based on pathogen isolation using
Journal of Microbiological Methods 86 (2011) 1624
Corresponding author. Tel.: +41 44 783 6416; fax: +41 44 783 6305.
E-mail address: duffy@acw.admin.ch (B. Duffy).
1
These authors contributed equally as rst authors to this work.
2
Current address: BASF Corporation, Agricultural Products, Research Triangle Park,
NC 27709, USA.
Table 1
Blind collection of Xanthomonas arboricola pv. pruni isolates used in this study.
Geographic origin Host plant Number of
isolates
USA North Carolina Prunus persica var. nectarina (nectarine) 95
P. persica (peach) 4
Prunus salicina (Japanese plum) 3
Prunus armeniaca (apricot) 2
Prunus domestica (plum) 1
South Carolina P. persica 2
Virginia P. persica 3
Georgia P. persica 2
P. persica 1
Brazil
a
P. persica 3
P. persica 1
P. salicina 3
Uruguay
b
P. persica 2
Australia
c
P. persica 5
P. persica 2
P. salicina 9
Switzerland P. armeniaca 27
P. japonica (Korean Cherry) 11
a
Obtained from O. Martin and J. Rodriques Neto, Empresa Brasileira de Pesquisa
Agropecuria (EMBRAPA), Brazil.
b
Processed at Instituto Nacional de Investigacin Agropecuaria (INIA), Uruguay.
c
Obtained as a DNA sample from F.J. Lowes, North Carolina State University, USA.
0167-7012/$ see front matter 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.mimet.2011.03.019
Contents lists available at ScienceDirect
Journal of Microbiological Methods
j our nal homepage: www. el sevi er. com/ l ocat e/ j mi cmet h
Table 2
Xanthomonads and other closely related strains used for specicity testing XapY17, XarbQ and duplex-PCR assays.
Strain
a
Origin
b
Host plant
b
Simplex
XapY17
c
Simplex
XarbQ
c
Duplex-PCR
c
XapY17 XarbQ
Agrobacterium tumefaciens CFBP 1903 USA Prunus sp. cv. Montmorency
Clavibacter michiganensis subsp. michiganensis CFBP 4999
T
Hungary Lycopersicon esculentum
Erwinia amylovora CFBP 1232
T
UK Pyrus communis
CFBP 1430 France Crataegus oxyacantha
Erwinia pyrifoliae DSMZ 12163
T
South Korea Pyrus pyrifolia
Erwinia rhapontici CFBP 3163
T
UK Rheum rhabarbarum
Dickeya chrysanthemi bv. chrysanthemi CFBP 2048
T
USA Chrysanthemum morifolium
Pantoea vagans C9-1 USA Malus domestica Jonathan
Pectobacterium carotovorum subsp. carotovorum, n=1
d
* Solanum sp. NT NT NT
Pseudomonas corrugata, n=1
d
* Lycopersicon sp. NT NT NT
Pseudomonas cichorii, n=1
d
* Lactuca sp. NT NT NT
Pseudomonas uorescens KD China Triticum sp.
Pseudomonas syringae pv. persicae CFBP 1573
P
France Prunus persica
Stenotrophomonas maltophila CFBP 3035
T
USA Cancer Patient
Xanthomonas albilineans DSMZ 3583
T
Fiji Saccharum ofcinarum
Xanthomonas alfalfae subsp. alfalfae LMG 495
T
India Medicago sativa
X. alfalfae subsp. citrumelonis CFBP 3371
T
USA Citrus paradisi Poncirus trifoliata
Xanthomonas arboricola pv. celebensis CFBP 3523
P
New Zealand Musa acuminata + + + +
LMG 676 New Zealand Musa acuminata + +
LMG 678 New Zealand Musa acuminata
X. arboricola pv. corylina CFBP 1159
P
USA Corylus maxima + + + +
CFBP 2565 France Corylus avellana + + + +
NCPPB 2896 UK Corylus avellana + + + +
NCPPB 2898 UK Corylus avellana + + + +
NCPPB 3037 UK Corylus avellana + + + +
NCPPB 3339 France Corylus avellana + + + +
NCPPB 3776 UK Corylus avellana + + + +
NCPPB 3870 Italy Corylus avellana + + + +
NCPPB 3875 Italy Corylus avellana + + + +
NCPPB 3876 Italy Corylus avellana + + + +
X. arboricola pv. fragariae CFBP 6771
P
Italy Fragariaananassa + +
LMG 19144 Italy Fragariaananassa + +
LMG 19146 France Fragaria sp. + +
NCPPB 4182 Italy Fragariaananassa + +
NCPPB 4183 Italy Fragariaananassa + +
X. arboricola pv. juglandis CFBP 2528
T
New Zealand Juglans regia + +
CFPB 7179 France Juglans regia cv. Fernor + +
NCPPB 362 UK Juglans regia + +
NCPPB 2927 Iran Juglans regia + +
NCPPB 3340 France Juglans regia + +
X. arboricola pv. poinsettiicola type C LMG 5402 New Zealand Euphorbia pulcherrima cv. Red + +
LMG 5403 New Zealand Euphorbia pulcherrima + + + +
LMG 8675 New Zealand Euphorbia pulcherrima + +
LMG 8676 New Zealand Euphorbia pulcherrima + + + +
X. arboricola pv. populi CFBP 3123
P
Netherlands Populus canadensis cv. Robusta
LMG 9713 New Zealand Populus generosa
LMG 12470 France Populus deltoides Populus trichocarpa
LMG 12479 Belgium Populus deltoides
LMG 12485 Belgium Populus trichocarpa
X. arboricola pv. pruni CFBP 3894
P
New Zealand Prunus salicina cv. Victory + + + +
CFBP 3903 Italy Prunus domestica + + + +
CFBP 3904 Italy Prunus persica + + + +
CFBP 5530 Italy Prunus persica + + + +
NCPPB 272 USA * + + + +
NCPPB 923 South Africa Prunus domestica + + + +
Xanthomonas axonopodis pv. axonopodis CFBP 4924
T
Colombia Axonopus scoparius
Xanthomonas axonopodis pv. begoniae, n=3
d
* Begonia sp. NT NT NT
X. axonopodis pv. citri CFBP 2525
P
New Zealand Citrus limon
X. axonopodis pv. dieffenbachiae CFBP 3133
P
Brazil Anthurium sp.
X. axonopodis pv. phaseoli CFBP 6546
P
USA Phaseolus vulgaris
X. axonopodis pv. vesicatoria CFBP 6817 Thailand *
CFBP 6821 USA Capsicum annum
Xanthomonas bromi CFBP 1976
T
France Bromus carinatus
Xanthomonas campestris pv. campestris CFBP 5241
T
UK Brassica oleracea var. gemmifera
n=4
d
* Brassica sp. NT NT NT
Xanthomonas campestris pv. zinniae, n=3
d
* Zinnia sp. NT NT NT
Xanthomonas cassavae CFBP 4642
T
Malawi Manihot esculenta + +
Xanthomonas codiaei CFBP 4690
T
USA Codiacum variegatum
Xanthomonas cucurbitae CFBP 2542
T
New Zealand Cucurbita maxima
Xanthomonas cynarae CFBP 4188
T
France Cynara scolymus
Xanthomonas euvesicatoria CFBP 4645
T
New Zealand Lycopersicon esculentum
Xanthomonas fragariae CFBP 2157
T
USA Fragaria chiloensis var. ananassa
n=3
d
* Fragaria sp. NT NT NT
(continued on next page)
17 J.F. Pothier et al. / Journal of Microbiological Methods 86 (2011) 1624
semi-selective media (Civerolo et al., 1982; Gitaitis et al., 1988) followed
by biochemical proling and plant disease bioassays (Lelliott and Stead,
1987; Randhawa and Civerolo, 1985; Schaad et al., 2001; Vauterin et al.,
1990; 1995). Typically several days are required to return a diagnosis,
delaying action in the eld by inspectors. Serological tests have proven
inadequate regarding specicity and sensitivity, particularly at the
pathovar-level critical for correct enforcement of phytosanitary de-
cisions triggered by identication of pv. pruni. This study reports the
design of a PCRassay to identify putative isolates and detect Xap directly
from symptomatic plant samples.
2. Materials and methods
2.1. Bacterial strains and culture conditions
A geographically and genetically representative blind collection of
Xap isolates from Prunus diagnostic samples (n=176) was used to
validate the PCR assays (Table 1). A collection of related Xanthomonas
species andpathovars (n=85), andout-groups including those bacteria
expected to occur on the same hosts as Xap (n=14) were used in
specicity tests (Table 2). Xanthomonas strains were grown on yeast
extract dextrose calciumcarbonate agar medium(YCD; Stolp and Starr,
1964) or peptone yeast extract glycerol agar medium (NYGA; Turner
et al., 1984), and other bacteria were grown on either KB or LB, with
incubation at 28 C for 2448 h. Quinate metabolism was assayed on
succinate/quinate/yeast extract medium (SQY; Lee and Chou, 2003).
2.2. Bacterial and DNA isolation from symptomatic plant samples
In order to detect naturally-occurring Xap in plant samples, 0.7-cm
discs from symptomatic leaves, whole fruits or woody cankers from
Prunus armeniaca or P. persica were macerated with 4 ml PBS in
polyethylene sample bags (BIOREBA AG, Reinach, Switzerland).
Bacteria were isolated by spread plating 50 l macerate onto YCD
and incubating 23 d at 28 C. In parallel, genomic DNA was extracted
from 1 ml macerate using the protocol of Llop et al. (1999).
2.3. PCR amplications
PCR amplications were performed using 1 l of DNA either
extracted from bacterial colonies or liquid cultures or from naturally
infected plant tissues (see Section 2.2). For colony lysate preparation,
one loop from 24 to 48 h old colonies was diluted in 300 l twice-
distilled water (ddH
2
O) and boiled at 99 C for 20 min. After
centrifugation at 7250 g for 1 min, the supernatant was transferred
into a fresh micro-centrifuge tube and diluted 1:10 with ddH
2
O.
Amplications were carried out in a nal volume of 20 l using
HotStarTaq Master Mix or multiplex PCR kits (Qiagen, Basel, Switzerland)
and 0.2 M (specicity tests) or 0.5 M (sensitivity tests and in planta
detection) of each primer. Similar results were obtained using Taq
polymerase from different vendors (i.e., Promega, Charbonnires-les-
Bains, France; Quanta Biosciences, Gaithersburg, MD, USA). Primarily, PCR
assays were routinely performedwitha labcycler (SensoQuest, Gttingen,
Germany), but similar results were obtained using alternative thermo-
cyclers (i.e., Biometra, Chtel-St-Denis, Switzerland; Applied Biosystems,
Rotkreuz, Switzerland). All reactions were run for 30 cycles (35 cycles for
DNAextractedfromplant samples), eachconsistingof 30 s at 95 C, 30 s at
55 C, and 60 s at 72 C, with an initial activation step of 15 min at 95 C
andnal extensionof 7 minat 72 C. Amplicons werevisualizedunder UV
after electrophoresis on1.2or 1.5%agarosegels containingethidiumbromide.
2.4. General DNA manipulation
DNA fragments were extracted from agarose gel with a QIAquick
Gel extraction kit (Qiagen, Valencia, CA, USA) for cloning and with a
GeneClean kit (Bio 101, San Diego, CA, USA) for digoxigenin (DIG) DNA
probe preparation. When necessary, fragments were cloned into a
pCR4-TOPO vector using a TOPO TA Cloning kit (Invitrogen, Carlsbad,
CA, USA) according to the manufacturer's instructions. Plasmids
were extracted using Plasmid Mini Kit II (OmegaBio-Teck, Dietikon,
Switzerland). Cloning was performed following standard procedures
(Sambrooket al., 1989). Enzymes were suppliedby Fermentas (LeMont-
sur-Lausanne, Switzerland).
2.5. Sequencing and sequence analysis
Sequencing was performed on an ABI Prism DNA automatic
sequencer (AppliedBiosystems). Sequences were analyzedwithBLASTN
and BLASTX algorithms on the National Center for Biotechnology
Information website (Altschul et al., 1997). DNAsequences and deduced
protein sequences were aligned using the multiple alignment software
CLUSTAL Wv1.4 implemented in BioEdit version 7.0.9 (Thompson et al.,
Table 2 (continued)
Strain
a
Origin
b
Host plant
b
Simplex
XapY17
c
Simplex
XarbQ
c
Duplex-PCR
c
XapY17 XarbQ
Xanthomonas fuscans CFBP 6165
T
Canada Phaseolus vulgaris
Xanthomonas gardneri NCPPB 881
T
Yugoslavia Lycopersicon esculentum
Xanthomonas hortorum pv. hederae LMG 733
T
USA Hedera helix
Xanthomonas hyacinthi CFBP 1156
T
Netherlands Hyacinthus orientalis
Xanthomonas melonis CFBP 4644
T
Brazil Cucumis melo
Xanthomonas oryzae pv. oryzae CFBP 2532
T
India Oryza sativa
n=1
d
* Oryza sp. NT NT NT
X. oryzae pv. oryzicola CFBP 2286
P
Malaysia Oryza sativa
Xanthomonas perforans NCPPB 4321
T
USA Lycopersicon esculentum
Xanthomonas pisi CFBP 4643
T
Japan Pisum sativum
Xanthomonas populi CFBP 1817
T
France Populus canadensis cv. Regenerata.
Xanthomonas sacchari CFBP 4641
T
France Saccharum ofcinarum
Xanthomonas theicola CFBP 4691
T
Japan Camellia sinensis
Xanthomonas transluscens pv. transluscens CFBP 2054
T
USA Hordeum vulgare
X. transluscens pv. graminis CFBP 3524
P
Switzerland Dactylis glomerata
Xanthomonas vasicola pv. holcicola CFBP 2543
T
New Zealand Sorghum vulgare
Xanthomonas vesicatoria CFBP 4645
T
New Zealand Lycopersicon esculentum
a
Xanthomonas nomenclature follows Vauterin et al. (1995). Culture collections providing strains are abbreviated in the strain names as CFBP (Collection Franaise de Bactries
Phytopathognes), DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen), LMG (Collection of the Laboratorium voor Microbiologie en Microbiele Genetica), NCPPB
(National Collection of Plant Pathogenic Bacteria). Superscripts following strain names indicate
T
the type strain of a species and
P
the pathotype strain for a pathovar.
b
* indicates strain origin is unknown.
c
XapY17 PCR using XapY17-F and XapY17-R; XarbQ PCR using XarbQ-F and XarbQ-R; duplex-PCR using XarbQ-F, XarbQ-R, XapY17-F and XapY17-R; +: positive reaction;
: negative reaction; NT: not tested.
d
Indicates number of strains used for specicity testing in Pagani (2004).
18 J.F. Pothier et al. / Journal of Microbiological Methods 86 (2011) 1624
1994; Hall, 1999). Sequence data obtained in the current work are
deposited under GenBank with accession numbers HQ896469 to
HQ896480. Additional bacterial sequences were obtained from the
National Center for Biotechnology Information (NCBI) databases.
2.6. Identication of targets for pathovar- and species-level PCR-primers
design
Pathovar specic primers were designed using a RAPDngerprinting
approach carried out using a set of 61 arbitrary primers (10-base-
oligonucleotides). The total reactionvolume of 25 l contained2550 ng
of genomic DNA, 2.5 mMMgCl
2
, 100 g of bovine serumalbumin per ml,
0.2 M primer, 1.2 U of Taq DNA polymerase (Boehringer-Mannheim,
Ridgebury, CT, USA), 0.2 mM each dNTP (Boehringer-Mannheim) in
10 mMTrisHCl (pH8.3) and50 mMKCl. ADNAthermal cycler (Perkin-
Elmer Cetus) was used with 40 cycles of 2 min at 95 C, 1 min at 92 C,
1 min at 35 C, 2 min at 72 C and a nal extension period of 5 min at
72 C. Aliquots (10 l) of PCR products were analyzed by electrophoresis
as described above. Fingerprint proles generated with all primers were
visually assessed on the basis of migration patterns of the amplied
products. The Xap pathovar-level primers were designed after cloning
and sequencing of a DNA band unique to Xap. The X. arboricola species-
level primers weredesignedusingFastPCRsoftware v5.4(Kalendar et al.,
2009) after alignment of qumA sequences present in the NCBI database.
2.7. Sensitivity and specicity
Sensitivity of detection of PCR assays was quantied both in pure
cultureandinplant extracts. Suspensions of 110
8
CFU/ml (0.5OD
450nm
)
were prepared from overnight YCD cultures of Xap strain CFBP 5530
suspended in PBS. For each PCR assay, 1 l of each ten-fold dilution series
in PBS was added to PCR mixtures in order to determine the minimum
number of cells required to give an amplicon with pure culture.
The initial bacterial suspension was also used to determine the
sensitivity of detection of the pathogen fromspiked apricot leaves using
inltration with a needle as described by Randhawa and Civerolo
(1985). Briey, fresh pathogen-free apricot leaves were placed abaxial
side upward on paper towel layers. Inoculum, held in a plastic 10 ml
syringe without a needle, was inltrated by applying gentle and steady
pressure while holding the open end of the syringe against the leaf until
a 2- to 4-mm-diameter area of mesophyl tissue was water soaked. Leaf
discs were then removed and treated with the protocol described above
for strain isolation and DNA extraction. Genomic DNA extracted from
initial spiked samples were then ten-fold diluted in DNA extract
obtained from apricot leaves spiked with ddH
2
O. 1 l of each ten-fold
dilution series was added to PCR mixtures (see Section 2.3) in order to
determine the minimum number of cells required to give an amplicon
and correlated to colony counting results obtained from the same plant
macerate.
2.8. Dot blot assay
A DIG DNA probe was constructed after PCR-amplication of a 943-
bp Xap-specic fragment. The amplicon was extracted fromagarose gel
andrandomly labeledwithdigoxigenin-11-UTP (DIG-UTP) according to
manufacturer's instruction (Boehringer-Mannheim). Dot blots were
prepared with plant lesion extracts and 510
8
CFU/ml bacterial
cultures. A sample of 1 l of each dilution was spotted on nitrocellulose
membranes and allowed to air-dry. Dots of cell suspensions were lysed
by placing the membranes on 1.5 M NaCl and 0.5 M NaOH for 15 min
and neutralized for 15 min in 1.0 M TrisHCl and 1.5 M NaCl. After
neutralization, membranes were air-dried and UV cross-linked (Cross-
linker XL-1500 UV; Spectronics, Westbury, NY, USA). Prehybridization,
hybridizationandwashings wereperformedat 65 Candresolutionwas
done by colorimetric detection with NBT and BCIP following manufac-
turer recommendations (Boehringer-Mannheim).
3. Results
3.1. Xap pathovar-level PCR-primers design
To identify RAPD patterns specic for Xap, 61 unique 10-base
arbitrary primers were tested using three strains of the pathogen.
Primer Y17 (Table 3) delivered the most promising DNA pattern,
yielding three major bands of approximately 3.0, 1.5 and 0.95 kb
(Fig. 1A). While the 1.5 kb band was present in all xanthomonad and
pseudomonad strains tested, the 3.0-kb amplicon was additionally only
observed in the Pectobacterium carotovorum subsp. carotovorum strain.
The 0.95-kb amplicon was unique to the Xap strains. Primer Y17
consistently generated two DNAfragments (1.5 and 0.95 kb-amplicons,
Fig. 1B) for all the 176 Xap strains tested. The generated pattern was
clearly distinguishable from those produced by the non-Xap strains
tested (n=167).
The 0.95-kb DNA band unique to Xap was cloned and sequenced. A
BLASTNsearch with the 943-bp DNA sequence revealed no signicant
similarity to sequences of the NCBI database. In contrast its deduced
amino acid sequence showed signicant identity to the ATP-binding
proteins of bacterial ABC transporters (e.g., Xanthomonas albilineans
and Xanthomonas oryzae pv. oryzicola BLS256; 84% identity) but
disrupted by a stop codon.
Primers XapY17-F and XapY17-R (Table 3), located near the 3 and
5 end of the Y17 fragment, were designed to generate a specic Xap
PCR. The applicability of this amplicon was rst analyzed by screening
a blind collection of 176 Xap isolates (Table 1) for the predicted size
fragment through PCR reaction. All 176 amplications resulted in a
single DNA fragment of 943-bp length (Fig. 2).
Specicity validation using 85 Xanthomonas genus strains represent-
ing 27 species and 14 non-Xanthomonas strains (Table 2) showed cross-
reactiononly withX. arboricola pv. corylina strains, a quarantine pathogen
of hazelnut not reported from Prunus, one of three X. arboricola pv.
celebensis (the pathotype strain), a pathogen from banana not reported
fromPrunus, andtwoof four X. arboricolapv. poinsettiicolatypeCstrains, a
pathogen from poinsettia only reported from New Zealand and not from
Prunus (Fig. 2). When a blind collection of 68 saprophytic and epiphytic
isolates associatedwithPrunus plants was tested, no cross-reactions were
observed. Specicity of the Xap amplicon was also validated after
construction of a XapY17 DIG-labeled probe and hybridization to a
panel of 138 Xap strains and 167 non-Xap strains. All Xap strains tested
gave a strong hybridization signal with the probe but the probe did not
hybridize to any of the other strains tested (Fig. 3A).
3.2. X. arboricola species-level PCR-primer design
Quinate metabolismand the associated gene qumA were reported as
being extensively conserved and specic for the DNA-homology group
of X. arboricola (Lee et al., 1992; Lee et al., 1999). Thus, for broader
detection of X. arboricola pathovars, qumA was chosen as a target for
X. arboricola species-level PCR-primer design. Based on sequence
alignment with sequence from our Xap draft genome, sequences from
the databases and mismatches maximization with other available
sequences (Fig. 4), primers XarbQ-F and XarbQ-R (Table 3) were
retained. These primers were rst testedon38 X. arboricola strains. Inall
but one of the three strains of pathovar celebensis (LMG 678) and all of
Table 3
Nucleotide sequences of PCR primers developed in this study.
Primer
a
Gene Sequence (53) Amplicon (bp)
Y17 RAPD GACGTGGTGA
XapY17-F ftsX GACGTGGTGATCAGCGAGTCATTC } 943
XapY17-R ftsX GACGTGGTGATGATGATCTGC
XarbQ-F qumA GCGCGAGATCAATGCGACCTCGTC } 402
XarbQ-R qumA GGTGACCACATCGAACCGCGCA
a
F indicates the forward, and R indicates the reverse primer.
19 J.F. Pothier et al. / Journal of Microbiological Methods 86 (2011) 1624
the ve strains of pathovar populi tested, a 402-bp PCR amplicon was
obtained (Table 2). Sequencing the amplied fragment conrmed this
product to be the predicted qumA fragment. With the exception of
X. arboricola pv. celebensis LMG 678, for X. arboricola strains production
of a deep-green color around the bacterial colony with the quinate
metabolismtest was correlatedwiththepresenceof the402-bpamplicon.
Specicity of the XarbQ PCR primers using 71 Xanthomonas genus
strains representing27species andpathovars, and11non-Xanthomonas
strains was conrmed for all of these, with the only exception of
the manioc foliar pathogen Xanthomonas cassavae (Table 2). Although
sequencing conrmed the presence of qumA in this strain, no quinate
metabolismactivity was observed using a standard plate bioassay (data
not shown; Lee and Chou, 2003).
3.3. Duplex-PCR design
Pathovar and species assays XapY17 PCR (XapY17-F/XapY17-R) and
XarbQ PCR (XarbQ-F/XarbQ-R) (Table 3) were combined in a single-
tube duplex-PCR assay. When tested against a panel of pure isolates
(Table 2), no interaction was observed between primers yielding three
combinations of two distinct PCR amplicons of 943 bp and 402 bp from
XapY17 PCR and XarbQ PCR, respectively. Two PCR amplicons were
observed for all Xap and X. arboricola pv. corylina strains tested, one of
the three X. arboricola pv. celebensis and two of the four X. arboricola
pv. poinsettiicola type C strains. In a second case, only the 402-bp PCR
ampliconwas observedfor all X. arboricola pv. fragariae and X. arboricola
pv. juglandis strains tested, one of the X. arboricola pv. celebensis strains,
two X. arboricola pv. poinsettiicola as well as X. cassavae. In a third case,
no amplication bands were observed for all X. arboricola pv. populi
tested and one of the X. arboricola pv. celebensis.
3.4. Direct detection in symptomatic plant samples
The duplex-PCR assay was able to detect the pathogen in
symptomatic apricot samples after total genomic DNA extraction
(Fig. 5). As expected, 402-bp and 943-bp amplicons of the pathogen
A
B
3 4 5 6 7 8 9 10 11 12 13 14
3 4 5 6 7 8 9 10 11 12 13 14
1 2 15 16 17 18 19
18 19
20
1 2 15 16 17 20
3.0
0.95
1.5
0.95
kb
kb
1.5
Fig. 1. RAPD products amplied with primer Y17. A, Performed on xanthomonads and other bacterial strains. Numbered lanes 1 and 20, 1 Kb DNA ladder; 2, Pectobacteriumcarotovorum
subsp. carotovorum; 3, Xanthomonas axonopodis pv. begoniae; 4, X. axonopodis pv. begoniae; 5, X. axonopodis pv. begoniae; 6, X. fragariae; 7, X. fragariae; 8, X. fragariae; 9, Pseudomonas cichorii;
10, X. arboricola pv. pruni; 11, X. oryzae pv. oryzae; 12, X. campestris pv. campestris; 13, Pseudomonas corrugata; 14, X. campestris pv. campestris; 15, X. campestris pv. campestris;
16, X. campestris pv. campestris; 17, X. campestris pv. zinniae; 18, X. campestris pv. zinniae; 19, X. campestris pv. zinniae. B, Performedonseveral X. arboricola pv. pruni isolates. Numberedlanes
indicate: 1 and 20, 1 Kb DNAladder; 2, XapL1; 3, XapL2; 4, XapCLE2; 5, XapCLE5; 6, XapCLE7; 7, XapW1; 8, XapW3; 9, XapGJ1; 10, XapGJ2; 11, XapSenC2-1; 12, Xap19-1F-5; 13, Xap19-1F-7;
14, XapSH5; 15, XapSH7; 16, XapPlumB31; 17, XapOH-4-C2; 18, XapOH-7; and 19, XapR2-1.
Fig. 2. XapY17 PCR results performed with Xanthomonas arboricola pathotypes and 11 X. arboricola pv. pruni isolates. Lanes 1 and 20, GeneRuler DNA ladder mix; 2, X. arboricola pv.
celebensis CFBP 3523
P
; 3, X. arboricola pv. corylina CFBP 1159
P
; 4, X. arboricola pv. fragariae CFBP 6771
P
; 5, X. arboricola pv. juglandis CFBP 2528
T
; 6, X. arboricola pv. pruni CFBP 3894
P
;
7, X. arboricola pv. poinsettiicola LMG5403; 8, X. arboricola pv. populi CFBP 3123
P
; 9, negative control (distilledH
2
O); and10 to 19, X. arboricola pv. pruni isolates fromapricot plant samples.
20 J.F. Pothier et al. / Journal of Microbiological Methods 86 (2011) 1624
were ampliedbythe duplex-PCRassay fromthe infectedsamples, with
only a few samples not yielding double bands (Fig. 5, lanes 14 and 15).
Simplex-PCR XapY17 or XarbQ performed on the same DNA templates
also failed in giving the appropriate amplicon thus suggesting that after
genomic DNA extraction from plant samples, either the DNA was
degraded or there are still PCR inhibitors. No amplicons were obtained
from healthy plant samples (Fig. 5).
3.5. Sensitivity of simplex- and duplex-PCR assays
Sensitivity of the simplex- and duplex-PCR assays was determined
with agar cultures and directly from apricot leaf tissue after DNA
extraction. Sensitivity results for each assay against each dilution
series are listed in Table 4. The PCR amplication of the pure culture
dilution series yielded a limit of detection of about 5 (0.2)10
1
CFU
and 5 (0.2)10
2
CFU per reaction of Xap for XapY17 and the XarbQ
based assays, respectively. A dilution series of pathogen-spiked plant
DNA extract determined a detection limit of 5 (0.2)10
1
CFU and 5
(0.2)10
2
CFU per reaction for the XapY17 and the XarbQ based
assays, respectively. Sensitivity of the duplex-PCR was then estab-
lished at 5 (0.2)10
2
CFU per reaction of Xap because the XarbQ
amplicon was not consistently observed at lower dilutions.
3.6. Dot blot assay sensitivity and specicity
The sensitivity of the XapY17 DIG-probe was determined by directly
spotting aliquots of a dilution series of Xap cells onto hybridization
membrane where as few as 410
2
CFU were detectable (Fig. 3B). The
XapY17 probe specically hybridizedto Xapindot blot assays containing
as fewas 410
2
bacterial cells. Additionally, in a validation screening of
symptomatic eld samples, dot blot assays specically identied100%of
presumptive bacterial spot lesions.
4. Discussion
This study describes the design of PCR assays for reliable identi-
cation of the species X. arboricola and the quarantine pathovar pruni.
These add to recently published methods for real-time PCR (Palacio-
Bielsa et al., 2011) basedonXapY17 described by Pagani (2004) or using
the hrpgene as a PCRtarget (Park et al., 2010). The simplex- andduplex-
PCR assays developed offer a molecular tool to expedite phytosanitary
diagnostics, which will improve the implementation of quarantine,
eradication and sanitation control measures aimed at preventing
pathogen dissemination via plant material in interstate or international
commerce. The assays also offer a high-throughput pathogen monitor-
ing tool to facilitate epidemiological studies of bacterial spot critical for
the identication of inoculum reservoirs and the development of new
integrated pest management (IPM) strategies.
A XapY17 pathovar-level PCR assay was designed by identication of
a pathovar specic DNA fragment using RAPD, an approach that has
previously been useful for marker identication in other phytopatho-
genic xanthomonads (Birch et al., 1997; Khoodoo andJaufeerally-Fakim,
2004; Trbaol et al., 2001). Among the DNA ngerprints generated, that
obtained with primer Y17 consistently generated a specic amplicon for
all Xap genotypes tested. The deduced amino acid sequence of the Y17
ampliconshowedsignicant identity toATPbindingproteins of bacterial
ABC transporters.
This pathovar-specic target was further developed by DIG-labeling
the 943-bp amplicon obtained with the XapY17 primers. In our assays,
dot blot hybridizations were detected using a colorimetric method. In a
validation screening of symptomatic eld samples, dot blot assays
identied 100% of presumptive bacterial spot lesions, with clear easily
interpreted signals differentiating positive and negative samples.
Positive dot blot results were conrmed to have Xap and negative
results were conrmed to lack Xap using standard culture/biochemical
Fig. 3. Dot blot hybridizations with the DIG-labeled probe XapY17. A, Specicity of the XapY17 DIG-probe assay was tested on a panel of strains. Dots inside the white box (i.e., A1-12,
B1-12, C1-12, D1-12, E1-12, F1-12, G1-12, H1-12 and I12) represent different Xanthomonas arboricola pv. pruni strains. Dots I1-11 and J1-12 represent non-X. arboricola pv. pruni
strains. Approximately 510
5
cells were used for each dot. B, Sensitivity of the XapY17 DIG-probe assay. Dot blot hybridizations of 10-fold serial dilutions of X. arboricola pv. pruni
strain Xap14 were probed with the XapY17 DIG labeled probe. Dots numbered 1 to 5 contained 410
8
, 410
7
, 410
6
, 410
5
and 410
4
CFU of X. arboricola pv. pruni per ml with
1 l of each dilution spotted directly onto the membrane.
21 J.F. Pothier et al. / Journal of Microbiological Methods 86 (2011) 1624
techniques. This DIG adaptation offers a sensitive tool with the capacity
to efciently process a large number of phytosanitary samples, as has
been shown with other phytopathogenic bacteria (Kuu and Cuppels,
1997; Ward and De Boer, 1994).
A XarbQ species-level simplex-PCR assay was designed based on the
quinate metabolism gene qumA of Xap identied in our draft genome
sequence and reported to be a typical feature for other X. arboricola
subspecies (Lee et al., 1999). While homologues of the qumA gene were
identied in a diversity of other bacteria, sequence divergence between
X. arboricola and other qumA sequences enabled selection of X. arboricola
species-specic regions. When tested on all X. arboricola subspecies, this
assay consistently generated a specic amplicon except with pathovar
populi, which we conrmed lacked qumA. Specicity of the test against
other taxa, including Xanthomonas species and subspecies (pathovars),
found cross-reaction only with the manioc leaf-pathogen X. cassavae.
Presenceor absenceof amplicons was correlatedwithpositiveor negative
reactions using a quinate metabolismplate assay, which could be a useful
conrmatory test for putative Xap isolates. The only exceptions were
X. cassavae and one of the three strains of X. arboricola pv. celebensis (LMG
678), which has been reported to give variable biochemical results (Lee
et al., 1992). Sequencing of XarbQ-PCR amplicons revealed no point
mutations or frameshifts that might explain these exceptions.
The duplex-PCR assay developed by combining the XarbQ species-
level and XapY17 pathovar-level primers was shown to provide
sensitive and specic identication and detection of Xap in symp-
tomatic leaves, woody cankers and fruit. In the duplex-PCR assay, the
Xap pathovar-specic XapY17 primers had a detection limit of 510
1
cells per PCR reaction after DNA extraction from apricot leaf tissue.
The species-specic primers XarbQ had a slightly lower sensitivity
with a detection limit of 510
2
cells per PCR reaction after DNA
Fig. 4. Alignment of the qumA sequence froma draft genome of X. arboricola pv. pruni strain CFBP 5530 against homologues available in GenBank. Regions where X. arboricola species-level
primers weredesignedarehighlightedwithshadedboxes. Identical residues conservedinall thesequences areindicatedbywhiteletters inblackbackgroundand, inthe5 and3 ends, those
identical to X. arboricola species-level PCR-primers are indicated with dots to highlight mismatches. Sequences from top to bottom were from primers XarbQ-F and XarbQ-R (Pr.XarbQ-F/
XarbQ-R, this study), X. arboricola pv. pruni CFBP 5530, (X.arb.pruni CFBP5530, HQ896471), X. arboricola pv. juglandis C5 (X.arb.juglandis C5, AF508804), X. arboricola consensus sequence
derivedfromthose of X. arboricola pv. pruni XA1.15, X. arboricola pv. pruni XA1.29, X. arboricola pv. pruni XA1.51, X. arboricola pv. corylina CFBP 1159
P
, X. arboricola pv. celebensis CFBP 3523
P
,
X. arboricola pv. fragariae CFBP 6771
P
, X. arboricola pv. juglandis NCPPB 411
T
and X. arboricola pv. poinsettiicola LMG 5403 (X.arb.CONSENSUS, HQ896472 to HQ896479, respectively),
X. cassavae CFBP 4642
T
(X. cassavae CFBP4642, HQ896480), Pseudomonas entomophila L48 (P.entomophila L48, CT573326), Pseudomonas putida KT2440 (P.putida KT2440, AE015451),
P. putida W619 (P.putida W619, CP000949), P. putida GB-1 (P.putida GB-1, CP000926), P. putida F1 (P.putida F1, CP000712), Pseudomonas uorescens Pf0-1 (P.uo.Pf0-1, CP000094),
Pseudomonas syringae pv. phaseolicola 1448A (P.syr.phaseolicola, CP000058), and Agrobacterium tumefaciens C58 (A.tumefaciens C58, AE007870).
22 J.F. Pothier et al. / Journal of Microbiological Methods 86 (2011) 1624
extraction from plant material. The duplex-PCR assay was able to
detect the full range of Xap genotypes (Boudon et al., 2005). Cross-
reactivity (for the pathovar-level amplicon) was limited to the banana
pathogen X. arboricola pv. celebensis (only the pathotype strain), the
poinsettia pathogen X. arboricola pv. poinsettiicola (only two of four
strains), and the hazelnut pathogen X. arboricola pv. corylina (all
strains). Such cross-reactivity will not interfere with accurate
diagnosis of stone fruit bacterial spot since these related pathovars
are unlikely to be present in Prunus samples. Actually, this restricted
cross-reactivity is a benet of the duplex-assay that can be exploited
for additional diagnostic applications of the duplex-PCR assay to
detect these three pathogens, for which other PCR methods are
currently not available. This will be particularly valuable in phytosa-
nitary diagnostics for the quarantine pathogen X. arboricola pv.
corylina where regulatory issues similar to those for Xap arise.
Conserved qumA and quinate metabolism identied during develop-
ment of this duplex-PCR assay also presents a possible target for
developing innovative control measures that disable pathogen ability
to metabolize quinate metabolismto gallic acid depriving bacteria of a
critical defense against cytotoxicity and SOS responses induced by
host hydrogen peroxide bursts (Duffy et al., 2003; Teramoto et al.,
2009).
Acknowledgments
The authors thank J. Vogelsanger, M. Genini and M. Bnter for
providingphytosanitary diagnostic samples, andT.H.M. Smits, P. Llop, M.
Scortichini and P. Ferrante for helpful discussion. This work was
supported by the Swiss Secretariat for Education and Research (SBF
C07.0139) and by the North Carolina Agricultural Research Service and
USDA-APHIS. It was conducted in part within the European Science
Foundation funded research network COST Action 873.
References
Altschul, S.F., Madden, T.L., Schffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J.,
1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res. 25, 33893402.
Anonymous, 2000. Council Directive 2000/29/EC of 8 May 2000 on Protective Measures
against theIntroductionintotheCommunityof Organisms Harmful toPlants andPlant
Products and Their Spread within the Community. Ofcial Journal L169, 10.7.2000.
Anonymous, 2006. Xanthomonas arboricola pv. pruni. EPPO Bull. 36, 129133.
Birch, P.R.J., Hyman, L.J., Taylor, R., Opio, A.F., Bragard, C., Toth, I.K., 1997. RAPD PCR-
based differentiation of Xanthomonas campestris pv. phaseoli and Xanthomonas
campestris pv. phaseoli var. fuscans. Eur. J. Plant Pathol. 103, 809814.
Boudon, S., Manceau, C., Nottghem, J.-L., 2005. Structure and origin of Xanthomonas
arboricola pv. pruni populations causing bacterial spot of stone fruit trees in Western
Europe. Phytopathology 95, 10811088.
Civerolo, E.L., Sasser, M., Helkie, C., Burbage, D., 1982. Selective medium for
Xanthomonas campestris pv. pruni. Phytopathology 66, 3943.
Duffy, B., Schouten, A., Raaijmakers, J.M., 2003. Pathogen self-defense: mechanisms to
counteract microbial antagonism. Annu. Rev. Phytopathol. 41, 501538.
Gitaitis, R.D., Hamm, J.D., Bertrand, P.F., 1988. Differentiation of Xanthomonas campestris
pv. pruni from other yellow-pigmented bacteria by the refractive quality of bacterial
colonies on an agar medium. Plant Dis. 72, 416417.
Goodman, C.A., Hattingh, M.J., 1986. Transmission of Xanthomonas campestris pv. pruni
in plum and apricot nursery trees by budding. HortScience 21, 995996.
Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 9598.
Kalendar, R., Lee, D., Schulman, A.H., 2009. FastPCR software for PCR primer and probe
design and repeat search. Genes Genomes Genomics 3, 114.
Khoodoo, M.H.R., Jaufeerally-Fakim, Y., 2004. RAPD-PCR ngerprinting and Southern
analysis of Xanthomonas axonopodis pv. dieffenbachiae strains isolated from
different aroid hosts and locations. Plant Dis. 88, 980988.
Kuu, K.M., Cuppels, D.A., 1997. Development of a diagnostic DNA probe for xanthomonads
causingbacterial spot of peppers andtomatoes. Appl. Environ. Microbiol. 63, 44624470.
Lee, Y.-A., Chou, S.-L., 2003. Quinatemetabolismandutilizationas phenotypic properties to
identify Erwinia cypripedii and E. rhapontici. Plant Pathol. Bull. 12, 242246.
Lee, Y.-A., Hildebrand, D.C., Schroth, M.N., 1992. Use of quinate metabolismas a phenotypic
property to identify members of Xanthomonas campestris DNA homology group 6.
Phytopathology 82, 971973.
Lee, Y.-A., Lo, Y.C., Yu, P.P., 1999. A gene involved in quinate metabolism is specic to one
DNA homology group of Xanthomonas campestris. J. Appl. Microbiol. 87, 649658.
Lelliott, R.A., Stead, D.E., 1987. Methods for the Diagnosis of Bacterial Diseases of Plants.
Blackwell Scientic Publications, Oxford, UK.
Llop, P., Caruso, P., Cubero, J., Morente, C., Lpez, M.M., 1999. A simple extraction
procedure for efcient routine detection of pathogenic bacteria in plant material by
polymerase chain reaction. J. Microbiol. Meth. 37, 2331.
Pagani, M.C., 2004. An ABC transporter protein and molecular diagnosis of Xanthomonas
arboricola pv. pruni causing bacterial spot of stone fruits. PhD Thesis, Department of
Plant Pathology, North Carolina State University, Raleigh, NC.
Palacio-Bielsa, A., Cubero, J., Cambra, M.A., Collados, R., Berruete, I.M., Lpez, M.M.,
2011. Development of an efcient real-time quantitative PCR protocol for detection
of Xanthomonas arboricola pv. pruni in Prunus species. Appl. Environ. Microbiol. 77,
8997.
Park, S.Y., Lee, Y.S., Koh, Y.J., Hur, J.-S., Jung, J.S., 2010. Detection of Xanthomonas
arboricola pv. pruni by PCR using primers based on DNA sequences related to the
hrp genes. J. Microbiol. 48, 554558.
Randhawa, R.S., Civerolo, E.L., 1985. A detached-leaf bioassay for Xanthomonas
campestris pv. pruni. Phytopathology 75, 10601063.
Ritchie, D.F., 1995. Bacterial spot. In: Ogawa, J.M., Zehr, E.I., Bird, G.W., Ritchie, D.F., Uriu,
K., Uyemoto, J.K. (Eds.), Compendium of Stone Fruit Diseases. APS Press, St. Paul,
MN, USA, pp. 5052.
Ritchie, D.F., 1999. Sprays for control of bacterial spot of peach cultivars having different
levels of disease susceptibility, 1998. Fung. Nematic. Tests 54, 63.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual,
second edition. Cold Spring Harbour Laboratory, NY, USA.
Fig. 5. Direct detection of Xanthomonas arboricola pv. pruni in symptomatic apricot samples using the XapY17-XarbQ duplex-PCR assay. Numbered lanes indicate: 1 and 18, the
GeneRuler DNA ladder mix; 2 to 5, DNA extracted from apricot symptomatic fruits; 6, DNA extracted from apricot asymptomatic fruit; 7 and 8, DNA extracted from apricot branch
canker; 9 to 11, DNA extracted from apricot asymptomatic branches; 12 to 15, DNA extracted from symptomatic apricot leaves; 16, DNA extracted from asymptomatic apricot leaf;
and 17, positive control (X. arboricola pv. pruni CFBP 5530 DNA).
Table 4
Amplicons generated with XarbQ PCR, XapY17 PCR and duplex-PCR assays when used
with Xanthomonas arboricola pv. pruni (Xap) cultures or apricot leaf extracts.
a
Xap CFU
per PCR
reaction
XapY17 PCR XarbQ PCR Duplex-PCR
Pure
culture
Leaf
disc
Pure
culture
Leaf
disc
Pure culture Leaf disc
XapY17 XarbQ XapY17 XarbQ
510
4
+ + + + + + + +
510
3
+ + + + + + + +
510
2
+ + + + + + + +
510
1
+ + + +
510
0

a
Samples presented with a +symbol indicates a positive reaction; and samples with
a symbol indicates a negative reaction with PCR.
23 J.F. Pothier et al. / Journal of Microbiological Methods 86 (2011) 1624
Schaad, N.W., Jones, J.B., Chun, W., 2001. Laboratory Guide for Identication of Plant
Pathogenic Bacteria, third edition. APS Press, St. Paul, MN, USA.
Stolp, H., Starr, M.P., 1964. Bacteriophage reactions and speciation of phytopathogenic
xanthomonads. Phytopath. Z. 51, 442478.
Teramoto, H., Inui, M., Yukawa, H., 2009. Regulation of expression of genes involved in
quinate and shikimate utilization in Corynebacterium glutamicum. Appl. Environ.
Microbiol. 75, 34613468.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity
of progressive multiple sequence alignment through sequence weighting, position-
specic gap penalties and weight matrix choice. Nucleic Acids Res. 22, 46734680.
Trbaol, G., Manceau, C., Tirilly, Y., Boury, S., 2001. Assessment of the genetic diversity
among strains of Xanthomonas cynarae by randomly amplied polymorphic DNA
analysis and development of specic characterized amplied regions for the rapid
identication of X. cynarae. Appl. Environ. Microbiol. 67, 33793384.
Turner, P., Barber, C., Daniels, M., 1984. Behaviour of the transposons Tn5 and Tn7 in
Xanthomonas campestris pv. campestris. Mol. Gen. Genet. 195, 101107.
Vauterin, L., Hoste, B., Kersters, K., Swings, J., 1995. Reclassication of Xanthomonas. Int.
J. Syst. Bacteriol. 45, 472489.
Vauterin, L., Swings, J., Kersters, K., Gillis, M., Mew, T.W., Schroth, M.N., Palleroni, N.J.,
Hildebrand, D.C., Stead, D.E., Civerolo, E.L., Hayward, A.C., Maraite, H., Stall, R.E.,
Vidaver, A.K., Bradbury, J.F., 1990. Towards an improved taxonomy of Xanthomonas.
Int. J. Syst. Bacteriol. 40, 312316.
Ward, L.J., De Boer, S.H., 1994. Specic detection of Erwinia carotovora subsp. atroseptica
with a digoxigenin-labeled DNA probe. Phytopathology 84, 180186.
Zaccardelli, M., Malaguti, S., Bazzi, C., 1998. Biological and epidemiological aspects of
Xanthomonas arboricola pv. pruni on peach in Italy. J. Plant Pathol. 80, 125132.
24 J.F. Pothier et al. / Journal of Microbiological Methods 86 (2011) 1624