Research

Changes in the ratio of type-I and type-II

collagen expression during monolayer culture
of human chondrocytes
S. Marlovits,
M. Hombauer,
M. Truppe,
V. Vcsei,
W. Schlegel
From the University
of Vienna, Austria

S. Marlovits, MD, Trauma

Surgeon and Head of
Trauma Research
Laboratories

V. Vcsei, MD, Professor
and Head

W. Schlegel, PhD, Senior
Scientist
Department of Traumatology, University of Vienna,
Waehringer Guertel 18-20,
A-1090 Vienna, Austria.

M. Hombauer, MSc,
Research Associate

M. Truppe, MSc, Research
Associate
Ludwig Boltzmann Institute
for Biomechanics and Cell
Biology, Waheringer Guertel
18-20, A-1090 Vienna,
Austria.
Correspondence should be
sent to Dr S. Marlovits.
2004 British Editorial
Society of Bone and
Joint Surgery
doi:10.1302/0301-620X.86B2.
14918 $2.00
J Bone Joint Surg [Br]
2004;86-B:286-95.
Received 2 September 2003;
Accepted 30 September 2003
286

We compared the changes in the ratio of type-I and type-II collagen in monolayer cultures of
human articular chondrocytes (HAC). HAC were isolated from samples of cartilage from
normal joints and cultivated in monolayer for up to 46 days. Expression of collagen type-I
and type-II was determined by immunocytochemistry, Western blotting, and the nested
reverse transcription polymerase chain reaction (RT-PCR), and quantified by real-time PCR.
The transition from a spherical morphology to the flattened morphology of an
anchorage-dependent culture was accompanied by a rapid change in the collagen
phenotype with the replacement of collagen type II by collagen type I. This was confirmed
by immunocytochemistry and Western blotting between days 21 and 28. Using techniques
for the analysis of gene transcription (nested RT-PCR and real-time PCR), a complete switch
of collagen gene expression was not observed. Expression of collagen type I increased 100fold during the culture time. That of collagen type II was found during the entire period and
decreased more than 100-fold.
The main finding was that expression of the genes encoding collagen type I and II was
highly time-dependent and the ratio of collagen type II to I (CII/CI), defined as an index of
cell differentiation, was significantly higher (215- to 480-fold) at the beginning of the
culture. At the end of the experimental culture time, ratios between 0.1 and 1 were reached.

Autologous chondrocyte transplantation (ACT)

has been introduced as a new option for the
biological treatment of patients with focal
damage to cartilage.1 This approach is hampered by the need for the prior cultivation of
cells in vitro in order to increase the number of
chondrocytes. The underlying mechanisms of
proliferation and differentiation of chondrocytes need to be evaluated.2
Chondrocytes comprise the single component of adult hyaline cartilage and are to be
terminally differentiated cells which maintain
the matrix of the extracellular cartilage.3 The
major components of the extracellular matrix
synthesised by these specialised cells include
highly cross-linked collagen fibrils, primarily
consisting of type-II collagen molecules which
interact with other cartilage-specific collagens
such as type IX and type XI. Large aggregating
proteoglycan aggrecan, small proteoglycans
and other specific and non-specific matrix proteins are expressed at defined stages during
development and growth.4,5
Collagen is a multigene family of extracellular structural proteins.6 Fibrillar collagen
is a subfamily of these proteins which contain
rigid, rod-like molecules with three chains

folded into a right-handed collagen triple

helix.7 Depending on the type of collagen and
on the tissue, triple helices can either be
homo- or heterotrimers. Collagen type I is
usually an 1(1)2 + 2(1) heterotrimer, while
collagen type II is a homotrimer of the form,
1(11)3.8-10
Various techniques have been used to
describe the synthesis of collagen within
chondrocytes including immunocytochemistry,
SDS-Page, Western blotting, in situ hybridisation, Northern blotting and the reverse
transcription polymerase chain reaction (RTPCR).8,11-13 These techniques are not sensitive
enough to detect low-level gene expression and
are not accurate enough to quantify the full
range of expression. The non-quantitative
technologies are not sensitive enough to detect
low-level gene expression. Real-time PCR has
allowed accurate reproducible quantification
of mRNA without the need for post-PCR
processing.14-16 Assessing the metabolic state
of chondrocytes is potentially useful for characterising and staging injury to and repair of
cartilage.16
Our hypothesis was that real-time PCR
could identify the quantitative patterns of typeTHE JOURNAL OF BONE AND JOINT SURGERY

CHANGES IN THE RATIO OF TYPE-I AND TYPE-II COLLAGEN EXPRESSION DURING MONOLAYER CULTURE OF HUMAN CHONDROCYTES

I and type-II collagen gene transcription of human articular

chondrocytes (HAC) grown in monolayer culture.

Materials and Methods

Cartilage specimens. Samples of articular cartilage were
collected from the hips of eight patients with no history of
joint disease who were scheduled to undergo joint replacement after fracture of the femoral neck. Their mean age was
78.2 years (61 to 87). Non-calcified cartilage from the area
superficial to the tidemark was dissected from the bone
immediately after surgery. The samples were prepared for
cell isolation, fixed in 4% buffered formalin at 4C for 24
hours for histological analysis or homogenised in Trizol
(Life Technologies, Rockville, Maryland) for preparation of
mRNA for immunocytochemistry, Western blotting and
preparation of RNA. Two sample pools of cells from four
patients were used.
Isolation and monolayer culture of human articular
chondrocytes. The samples of cartilage, were collected in

Dulbeccos modified Eagles medium (DMEM; Life Technologies) enriched with 50 g/ml of gentamicin and 5 g/ml
of amphotericin B (Life Technologies). The cartilage was
diced into pieces of 1 to 3 mm2 and placed in DMEM containing 200 U/ml of collagenase (Sigma Chemical, St Louis,
Missouri). The tube was capped, covered with Parafilm,
placed on an orbital shaker at 25 rpm, and incubated at
37C for 20 hours. The following day, the digestate was
resuspended and centrifuged at 1000 rpm for ten minutes.
The supernatant was removed and the pellet gently resuspended with 10 ml of calcium- and magnesium-free phosphate-buffered saline (PBS). The suspension was filtered
through a 100 m mesh into a sterile polypropylene tube.
Cells were centrifuged and washed twice more, then
counted in a haemocytometer, resuspended in medium and
placed into T-75-flasks and chamber slides at a concentration of 1.5 x 104/cm2. The growth medium for all cultures
was Dulbeccos modified Eagle medium with 450 mg/dl of
glucose (Life Technologies). The medium was supplemented with 10% fetal bovine serum, 2 g/l of HEPES, 1%
L-glutamine, 100 g/ml of streptomycin and 2.5 g/ml of
fungizone (all from Life Technologies) and 50 mg/l of ascorbic acid (Sigma Chemical). Cells were passaged at 80%
confluence by release from the dishes with a solution of
0.1% trypsin and 0.1% EDTA (Life Technologies) in a ratio
of 1:3. All the cell cultures were grown in a humidified CO2
incubator (Cytoperm 8080; Heraeus Instruments GmbH,
Hanau, Germany) under 95% air and 5% CO2, at 37C.
Human fibroblasts isolated from the fibrous hip capsule
were cultured as control cells.17
Histological analysis. Fixed samples were dehydrated, embedded in paraffin and cut into sections 5 m in size. Slices
of cartilage were cut vertically from the surface to the bottom. The sections were stained with haematoxylin and
eosin and Safranin O for sulphated glycosaminoglycans
(GAG) and were then evaluated based on the score of
Mankin et al18 by an independent experienced observer.
VOL. 86-B, No. 2, MARCH 2004

287

Immunocytochemistry. The chamber slides of cultivated

cells were fixed at intervals of seven days with acetone for

ten minutes and stained with antibodies against human collagen type I and type II. The antibody against collagen type
I (Southern Biotechnology Associates, Birmingham, Alabama) reacts with conformational determinants of human
collagen type I. The MAb anti-collagen type II, clone 2B1.5
(Neomakers, Fremont, California), recognises the 1(11)
chain of collagen type II. The epitope is localised to the carboxyl-terminal-one quarter of the macromolecule.19,20
Briefly, slides were blocked for endogenous peroxidase
activity with 2% hydrogen peroxide in PBS for 15 to 20
minutes at room temperature. They were then treated with
1 mg/ml of pepsin (Sigma Chemical) in 0.5 M acetic acid
(30 minutes at 37C). The slides were rinsed with PBS and
incubated for 30 minutes at 25C with normal horse serum
diluted 1:10 in PBS. Primary antibodies were diluted 1:100
in PBS/2% bovine albumin (BSA, Sigma Chemical). These
were incubated with the sections in a humidified chamber
for one hour at room temperature. The slides were washed
three times with PBS, after incubation at room temperature
in a humidified chamber for one hour with biotin-conjugated horse anti-mouse secondary antibody (Vector Laboratories, Burlingame, California) diluted 1:100 in PBS/2%
bovine albumin. They were then treated with avidin biotin
(Vectastain ABC Kit; Vector Laboratories) for 30 minutes,
after which they were incubated with alkaline phosphatase
and substrate solution (Sigma Chemical) for approximately
10 to 15 minutes until colour developed, rinsed with PBS,
counterstained with haematoxylin, rinsed with water, dehydrated, and finally sealed using Eukitt (Kindler GmBH,
Freiburg, Germany). All experiments included one positive
and two negative controls. The positive controls were
native human articular cartilage and fibroblasts positive for
the primary antibody used. The negative controls were PBS
only, to test for false binding by the secondary antibody,
and normal serum of the sample species from which the primary antibody had been prepared.
Collagen phenotyping and Western blot. For the analysis of
pepsin-resistant collagens, the cell layers at days 7, 14, 21,
28, 35, and 42 in monolayer culture were solubilised in an
equal volume of serum-free culture medium and 1 M
ammonium hydroxide and prepared according to the
method of Goldring.21 Briefly, solubilised samples were
digested with 0.5 mg/ml of pepsin in 0.5 M acetic acid for
16 hours at 4C and lyophilised. The samples were redissolved in 2 x Laemmli Buffer containing 0.1% -mercaptoethanol and neutralised with additions of 2 M NaOH of
1 l to titrate the colour of the bromphenol blue in the
sample buffer from yellow-green to blue. The protein content of the samples was determined by the dotMETRIC 1 l
Protein Assay (Chemicon International Inc, Temecula, California) according to the manufacturers instructions. Purified human collagen type I (Chemicon International) and
type II, prepared from samples of native human articular
cartilage were used as negative and positive controls for

288

S. MARLOVITS, M. HOMBAUER, M. TRUPPE, V. VCSEI, W. SCHLEGEL

Western blot analysis.22 For SDS Page and Western blot,

equal amounts of pepsin-digested protein extracts of cultured chondrocytes were separated on 6% PAA gels. One
gel was stained with Coomassie Brilliant Blue R250 for
band visualisation. For Western Blot analysis with antibodies against collagen I and collagen II, gels were blotted
on Immobilon-P membrane with electrophoretic transfer
overnight at 4C, 56V, and 250 mA in blotting buffer containing 10% methanol. Blots were stained with Ponceau S
Red to check the transfer of the proteins. After destaining,
the membrane was blocked for 1.5 hours with 3% BSA0.05% Tween in PBS. It was then incubated for 1.5 hours
with an antibody against human collagen II (Oncogene Science, San Diego, California) diluted 1:5000 in PBS with
1% BSA and 0.05% Tween. After washing four times for
ten minutes with PBS-0.05% Tween, the membrane was
incubated for one hour with the second antibody (goat
anti-mouse IgG, horseradish peroxidase conjugated;
Pierce, New York), diluted 1:30 000 in the solution mentioned above. The membrane was then washed four times
for 15 minutes in the washing solution used above. The
blot was developed using a chemiluminescence system
(SuperSignal Substrate; Pierce Biotechnology Inc, Rockford, Illinois) according to the manufacturers instructions
and subsequently exposed to x-ray film (Amersham Biosciences, Freiburg, Germany) to visualise collagen type-IIspecific bands.
For detection of collagen type I specific bands, the same
blot was stripped under the following conditions. The blot
was washed twice for ten minutes in washing buffer. Then,
it was incubated for one hour in stripping buffer (100 mM
2-mercaptoethanol, 2% SDS, and 62.5 mM Tris-HCI, pH
6.7) at 50C. The following steps for preparation of the blot
for subsequent blocking were performed according to the
SuperSignal Substrate protocol. The blot was blocked
under the conditions mentioned above. Subsequently, it
was incubated for 1.5 hours with an antibody against
human collagen type 1 (Rockland), diluted 1:10 000 in the
dilution buffer. After washing, the membrane was incubated for one hour with the second antibody, diluted 1:35
000 in the dilution buffer. The steps for the development of
the blot were the same as mentioned previously.
RNA preparation. Total RNA was obtained from pooled
cells being cultivated in monolayer culture. Cells were harvested every second day by adding 1 ml of Tri Reagent

(Sigma Chemical). Lysis of the cells was performed directly

on the culture dish. The cell lysate was transferred into a
2.0 ml microcentrifuge tube and 0.2 ml of chloroform were
added. The probes were mixed vigorously and incubated at
room temperature for ten minutes. The resulting mixture
was centrifuged at 12000 x g for 15 minutes at 4C. Centrifugation separated the mixture into three phases: a red
organic phase (containing protein); an interphase (containing DNA); and a colourless upper phase (containing RNA).
The aqueous phase was transferred into a fresh tube and
0.5 ml of isopropanol were added, and the probes were
mixed. The sample was incubated at room temperature for
five minutes. After incubation, the probes were centrifuged
at 12000 x g for ten minutes at 4C. The RNA precipitate
formed a pellet on the side and bottom of the tube. Supernatant was removed and the RNA pellet was washed by
adding 1 ml of 75% ethanol per 1 ml of TRi reagent. The
RNA was briefly dried and dissolved in 0.5% SDS solution.
The purity and amount of RNA were determined by measurement of the OD260/280 ratio. All samples showed purity
indices between 1.5 and 1.8.
cDNA synthesis. Total RNA (0.2 to 1 g) was diluted to a
volume of 12.5 l, and 1 l of oligo(dt)18 primer (20 M)
was added. The RNA was heated for two minutes at 70C
and quenched on ice. Using an Advantage RT-for-PCR Kit
(Clontech; BD Biosciences, Palo Alto, California), a master
reagent mix, containing 4 l of 5 x reaction buffer, 1 l of
dNTP mix (10mM each), 1 l of MMLV reverse transcriptase, and 0.5 l of RNase inhibitor, was prepared,
added to the RNA/Primer mix, and incubated at 42C for
one hour. The cDNA synthesis was stopped by heating the
reaction at 94C for five minutes. The reaction was diluted
by adding 80 l of DEPC-treated water.
Nested PCR. An advantage cDNA PCR Kit (Clontech) was
used to perform nested PCR. The cycle parameters
proposed by the manufacturer were changed as follows:
94C 1 minute; 25 x (94C 30 seconds, 68C 3 minutes)
68C 3 minutes. Primer sequences: Col1 forward primer:
cgaaggttcccctggacgagacg; reverse primer: ggcacaagggatgacacgcgttc; nested PCR: forward primer: gaggcatgtctggttcggcgag; reverse primer: gaagcagacagggccaacgtcg;
Col2A1: forward primer: gacgggtgaaccgggtattgc; reverse
primer:acttctcccttctcgccgttag; nested PCR: forward primer:
cctggtgaagatggtcgtcct; reverse primer: cacctgggaaacctcgttcac.

Table I. Description of the designed primers and probes for quantitative real-time PCR

Forward and reverse primers

Primers
concentration
used

Probe

Gene

(5 3)

(nM)

Collagen I

ATGCCTGGTGAACGTGGT
AGGAGAGCCATCAGCACCT
GCCTGGTGTCATGGGTTT
GTCCCTTCTCACCAGCTTTG

900900
300300

Collagen II

(5 3)

Probe
concentration
used (nM)

Amplicon
size
(bp)

ACCAGCATCACCTCTGTCACCCTT

200

87

AAAGGTGCCAACGGTGAGCCT

200

71

THE JOURNAL OF BONE AND JOINT SURGERY

CHANGES IN THE RATIO OF TYPE-I AND TYPE-II COLLAGEN EXPRESSION DURING MONOLAYER CULTURE OF HUMAN CHONDROCYTES

Fig. 1
Photomicrographs of pooled HAC grown in monolayer culture for 42 days using a monoclonal antibody against
collagen type II showing (a to g) staining every seven days during the culture (a, day 0 and g, day 42). The spherical to polygonal cell morphology changed to an elongated fibroblast-like phenotype and collagen type II was
detectable until day 21 (d) in monolayer culture. Human fibroblasts were used as controls (h). ABC staining with
alkaline phosphatase: x 40.

VOL. 86-B, No. 2, MARCH 2004

289

290

S. MARLOVITS, M. HOMBAUER, M. TRUPPE, V. VCSEI, W. SCHLEGEL

Fig. 2
Photomicrographs of pooled HAC grown in monolayer culture for 42 days using a monoclonal antibody
against collagen type I showing (a to g) staining every seven days during the culture (a, day 0 and g, day 42).
Expression of collagen type I was found between day 14 (c) and day 42 (g). Human fibroblasts were used as
controls (h). ABC staining with alkaline phosphatase: x 40.

THE JOURNAL OF BONE AND JOINT SURGERY

CHANGES IN THE RATIO OF TYPE-I AND TYPE-II COLLAGEN EXPRESSION DURING MONOLAYER CULTURE OF HUMAN CHONDROCYTES

Four Southern blotting DNA probes were separated on a

1.2% agarose gel and transferred to a positively charged
nylon membrane (Roche, Basel, Switzerland) using an alkaline transfer procedure and were fixed by baking the membrane at 120C for 20 minutes, Oligonucleotides were 3'
end-labelled using digoxigenin-ddUTP (Roche). Hybridisation was performed overnight at 55C. Oligonucleotide
sequences for hybridisation: Col1: cgccatactcgaactggaatccatcg; Col2: gctttgccaggctcaccgttgg. Filters were washed 2 x
5 minutes at hybridisation temperature with 50 ml 2xSSC,
SDS, 0.1%(w/v) per 100 cm2 filter, and 2 x 5 min at hybridisation temperature with 50 ml 0.1xSSC, SDS, 0.1%(w/v)
per 100 cm2. A DIG Luminescent Detection Kit (Roche)
was used to detect DIG-labelled oligonucleotides according
to the manufacturers instructions.
Real-time PCR. Primers and probes of collagen type I and
type II were designed using the primer3 program23 to create
oligonucleotides with similar melting temperatures and
minimal self-complementarity. To avoid amplification of
genomic DNA, the probes were placed at the junction of
two exons. Gene specificity of the primers and probes and
the absence of DNA polymorphism were confirmed by
BLASTN searches. Primers and probes were synthesised
from GenXpress (Austria). Primer concentrations were
tested for each primer at concentrations of 50 nM, 300 nM,
and 900 nM, using the combination which displayed the
lowest Ct value.14 The efficacy of amplification was determined by serial dilutions of cDNA templates, using human
fibroblasts as reference tissue for collagen type I and human
hyaline cartilage as reference tissue for collagen type II. The
description of the designed primers and probes is shown in
Table I.
PCR amplification was performed and monitored using
an ABI Prism 5700 Sequence Detection System (PerkinElmer; Applied Biosystems, Foster City, California). The
master mix was based on the Brilliant Quantitative PCR
Core Reagent Kit (Stratagene; La Jolla, California). The
best results were obtained when using a final concentration
of Mg 2+ of 2.5 mM. Primers and probes were tested and
used at concentrations ranging from 50 nM to 900 nM.
The thermal cycling conditions comprised the initial steps
at 50C for two minutes and at 95C for ten minutes.
Amplification of the cDNA products was performed with
40 PCR cycles, consisting of a denaturation step at 95C for
15 seconds and an extension step at 60C for one minute.
All probes were normalised to -actin, using the pre-developed Taq Man assay (Applied Biosystems). Beta-actin
rather than GAPDH was chosen as the reference housekeeping gene, based on a variety of articles which have
reported wide variation in the levels of transcription of
GAPDH mRNA between individuals and between samples
taken from an individual at different time points.24 All
cDNA samples (5 l in 25 l) were analysed in triplicate.
The final numeric value was calculated as the ratio of the
collagens to -actin and expressed in arbitrary units. Since
collagen type II is the typical marker for differentiated
VOL. 86-B, No. 2, MARCH 2004

291

1(II)

a
C II

CI

7d

14d

21d

14d

21d

28d

35d

42d

1(I)
2(I)

b
C II

CI

7d

28d

35d

42d

Fig. 3
Western blot of pooled HAC grown in monolayer culture for 42 days using
a monoclonal antibody against collagen type II (a) and type I (b) (days 0 to
42). Collagen type II was detectable until day 28 and expression of collagen type I was detected after day 14. Human articular cartilage (C II) and
collagen type I (C I) were used as controls.

chondrocytes in hyaline cartilage, as opposed to collagen

type I, which is expressed in dedifferentiated chondrocytes,
the ratios of mRNA levels of collagen type II to type I (CII/
CI) as a differentiation index was defined.14
Statistical analysis. Descriptive statistical analysis was performed using mean values and the standard error.

Results
Phenotypic characteristics: histology and immunocytochemistry. The mean Mankin score of the cartilage samples

was 1.2 (0.3 to 2.0) and the samples showed few microscopic changes, mostly related to the reduction of Safranin
O staining. In monolayer culture, HAC showed extensive
morphological changes during the cultivation period.
Freshly isolated HAC showed a cell morphology which was
either spherical to polygonal and contained a single nucleus
which was often eccentric. The cultivated cells had an elongated fibroblast-like phenotype. Immunocytochemical
methods showed that the changes in the patterns of expression of cell-associated collagen types occurred around day
21 (14 to 28). Expression of intracellular collagen type II
was found in freshly isolated cells and in cells cultivated in
monolayer normally until day 21, with a maximum of 28
days (Fig. 1). Synthesis of collagen type I was detectable in
cells cultured in monolayer after day 14 and then for the
entire observed cultivation period (Fig. 2).

292

S. MARLOVITS, M. HOMBAUER, M. TRUPPE, V. VCSEI, W. SCHLEGEL

100
Col 1
Col 2

log Col/_actin

10
1

Fig. 4

0.1

Real-time PCR of pooled HAC in monolayer culture

for collagen type I and type II (days 0 to 46). The relative expressions were related to the reference gene,
-actin (mean and SD). The relative expression of collagen type I increased 100-fold during the entire cultivation period, whereas that of collagen type II was
more than 100-fold downregulated.

0.01

0.001
0.0001
C 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 34 36 38 40 42 44 46

Days in culture

1000.0

log Col2/Col1

100.0
Fig. 5

10.0
Collagen II/I ratio of pooled HAC in monolayer culture for 46 days (days 0 to 46) with a 215- to 430-fold
higher expression of collagen type II between days 0
and 8, a constant decrease until day 30, and a plateau
phase with ratios between 0.1 and 1 at the end of the
culture time (mean and SD).

1.0

0.1

0.0

0
2
4
6
8
10 12 14 16 18 20 22 24 26 28 30 34 36 38 40 42 44 46
values 434.1 454.8 482.7 365.8 216.9 28.8 14.1 5.37 4.64 3.07 1.73 1.53 0.74 0.34 0.19 0.14 0.10 0.11 0.12 0.12 0.11 0.11 0.08

Days in culture

Collagen synthesis: collagen typing with Western blot. The

investigation of the synthesised collagen phenotype of HAC
grown for different time periods in monolayer culture by
Western blot analysis with collagen-specific antibodies
showed a synthesis of collage type II until day 28 (Fig. 3).
Detection with collagen type I-specific antibody indicated
the beginning of type-I collagen synthesis after day 14 in
monolayer culture. At days 7 and 14, only type-II collagenspecific bands appeared whereas at days 35 and 42, only
type-I collagen was produced (Fig. 3).
Collagen mRNA expression: nested RT-PCR and real-time PCR.

For the analysis of collagen mRNA, HAC in monolayer culture were harvested every second day (0 to 46 days) and
nested RT-PCR was performed. A significant expression of
collagen type I started at day 12 and continued during the
entire cultivation period. A very weak expression was

detectable after four days in culture. By contrast, collagen

type-II expression was seen during the entire cultivation
time in every preparation. As positive and negative controls, cartilage samples and fibroblasts were used. The specificity of the PCR products was confirmed by Southern
blotting.
For the quantification of mRNA, real-time PCR was performed using the RNA samples harvested every second day
(0 to 46 days) from HAC in monolayer culture. The standard curve for collagen type I was defined with human
fibroblasts and the relative value of 1 was assigned to this
expression. With regard to the reference gene, -actin, the
relative expression of collagen type I for the entire culture
time of 46 days increased 100-fold compared with that at
the beginning of the culture (Fig. 6). After the isolation of
the HAC (day 0), the relative collagen type-I expression
THE JOURNAL OF BONE AND JOINT SURGERY

CHANGES IN THE RATIO OF TYPE-I AND TYPE-II COLLAGEN EXPRESSION DURING MONOLAYER CULTURE OF HUMAN CHONDROCYTES

was 10-4 lower and increased to levels between 10-1 and 102
with maximum levels between days 14 and 30. The relative expression of collagen type II was measured over the
entire culture period in levels between 1 and 10-3 in relation
to the reference gene (-actin) and was downregulated
more than 100-fold. Native cartilage showed a 102 higher
expression. During the first days in culture (days 0 to 4), the
relative expression was downregulated tenfold and reached
the level of 1 after six days. After 16 days, the relative
expression of collagen type II decreased continuously to
levels between 10-2 and 10-3 in relation to the reference gene
(Fig. 4).
The collagen II/I ratio as a differentiation index showed
a sigmoid curve on a logarithmic scale with three phases
(Fig. 5). In the first phase, a maximum peak at days 2 to 6
with a 480-fold expression of collagen type II (fourth day)
was observed. Between days 8 and 28, the ratio decreased
and reached a plateau, with ratios between 0.1 and 1 at the
end of the culture time.

Discussion
Cultured chondrocytes have served as useful models for
studying the differentiation of chondrocytes and the effects
of cytokines and growth factors which control the maintenance or suppression of differentiated cartilage phenotype.8,25 Freshly isolated human articular chondrocytes
express cartilage-specific type-II collagen and continue to
do so for several days to weeks in primary monolayer culture.26,27 During prolonged culture and serial subcultures,
these cells begin to express type-I and type-II collagens.11,2732
A number of tissue-culture studies have shown these cells
to be capable of switching collagen synthesis from type II to
type I, and vice versa, under a variety of experimental conditions.26,33-36
In our study, the transition of human articular chondrocytes from the spherical morphology to the flattened morphology of an anchorage-dependent culture was also
accompanied by changes in the patterns of collagen expression. Immunocytochemical methods showed that the synthesised cell-associated collagen phenotype changed
dramatically between days 21 and 28 in monolayer culture
with the replacement of collagen type II. This short interval
indicates that most cells had altered their collagen synthesis
very quickly.
The collagen phenotype of differentiated chondrocytes is
marked by the predominant synthesis of 1(11) chains,
while the de-differentiated phenotype is composed primarily of 1(1) chains.27 Switching between the synthesis of
these two collagen chains can be properly evaluated by
fractionating intact collagen chains with SDS electrophoresis and Western blotting. With the use of specific antibodies,
a definitive identification of synthesised collagens is possible in cultures containing a mixture of type-I and type-II
collagen.21 At the beginning of the monolayer culture, the
collagen which was present included collagen type II
(1(11)), and was detectable until day 28. The presence of
VOL. 86-B, No. 2, MARCH 2004

293

collagen type I was determined by the presence of 2(1)

chains. Collagen type-I synthesis was undetectable in the
first two weeks, with very little after 21 days, and predominant after 28 days in culture. With Western blotting, the
short interval for the change in collagen type with the
replacement of collagen type II between days 21 and 28 in
monolayer culture was also observed.
Commonly used methods for the quantification of transcription include Northern blotting and in situ hybridisation,37 RNAse protection assays,38 RT-PCR39 and cDNA
arrays.24 The focus on maximising sensitivity led to the
development of ever-more complex procedures. Seminested,40 nested,41 and even three-step nested42 RT-PCR
techniques increase the sensitivity but compromise the specificity of the reaction.24
In our study, we used nested RT-PCR for the qualitative
alteration of expression of collagen on the mRNA level.
Using this method, collagen type I was detected much earlier in the time course of the cultivation period and started
at day 12, compared with protein synthesis. With immunocytochemistry, day 14 was the earliest time-point for the
detection of the synthesis of collagen type I. In contrast to
the methods for protein typing, the mRNA for collagen
type II was found over the entire cultivation period and was
not completely replaced by collagen type I. Complete
switching and replacement of collagens during the phase of
dedifferentiation, as previously described, were not
observed.11,27
The quantitative changes in the collagen phenotype are
currently the best markers for the completion of dedifferentiation and were analysed using real-time PCR.15 In our
study, collagen type I with levels above 10-3 compared with
the reference gene -actin was expressed very early starting
at day 4 and was the leading collagen type in the second
half of the culture period. Compared with the reference
gene, the expression increased 100-fold and reached levels
between 10-1 and 10-2 during the observed culture period.
As already observed with nested RT-PCR, collagen type II
was measurable during the entire culture time. In the first
two weeks, values of 1 were measured which constantly
decreased in the following weeks. Overall, expression of
collagen type II was downregulated more than 100-fold
and reached levels between 10-2 and 10-3 in relation to the
reference gene. Only in the first days of the monolayer culture was collagen type II reduced. For some specimens of
cartilage, in which mRNA was extracted both from the
intact tissue and from cells after tissue digestion, PCR analysis showed that the expression of all the genes of interest
was markedly and differentially affected by tissue digestion, with differences up to 10 to 15 fold.14
The quantitative analysis of the expression of collagen,
defined as the CII/C1 ratio, expresses the decrease in collagen type II and the increase in collagen type I. This value
was used as a differentiation index to describe the differences between human articular cartilage in normal and
osteoarthritic joints.14 On a logarithmic scale, three periods

294

S. MARLOVITS, M. HOMBAUER, M. TRUPPE, V. VCSEI, W. SCHLEGEL

of the CII/I ratio of chondrocytes in monolayer culture were

observed. The values in the first week formed a plateau
with levels between 215- and 430-fold higher for expression of collagen type II. The maximum peak of 480 was
reached at day 4. In this period (days 0 to 8), a differentiated phenotype is present with collagen type II as the leading collagen. The values in this phase are similar to the
reported values of normal articular cartilage, with a range
of 136.3 to 444.2 and a mean value of 294.6.14 Between
days 10 and 30, the ratio decreased constantly from levels
of 28.8 (day 10) to 0.14 (day 30). In this transition phase,
collagen type II is nearly completely replaced by collagen
type I. The decrease in the CII/I ratio is mainly caused by a
change in, and constant downregulation of expression of
collagen type II, whereas that of collagen type I changed
much less. After day 30, the CII/I ratio reached a steady
state with levels around 0.1. The CII/CI ratio can be used to
quantify the collagen gene expression in cultured chondrocytes and thus improve the understanding of the process of
chondrocyte de- and redifferentiation. Furthermore, this
ratio can be used to monitor chondrocytes and their differentiation status in monolayer culture for experimental
models or therapeutic use in autologous chondrocyte transplantation.
It should be emphasised that one limitation of our study
is that the overall isolation of mRNA was done on pooled
cells in culture and therefore the results cannot account for
individual differences in the rates of dedifferentiation. The
necessity of pooling cells to ensure that sufficient RNA was
available limits individual variations in cell growth and differentiation. Because of the heterogeneity of the cell growth
as a result of the age of the patient, culture conditions, and
individual factors, further studies are needed to evaluate
potentially occurring phenotypic changes in certain circumstances. Exploring chondrocyte gene expression in the
models of joint injury and repair could help to determine
which cellular processes may be suitable targets for therapeutic intervention.
This work was supported in part by the Lorenz-Boehler-Society (grant 5/96 and
4/01) and the medical scientific grant of the Major of Vienna (grant 1774).
No benefits in any form have been received or will be received from a commercial party related directly or indirectly to the subject of this article.

References
1. Brittberg M, Lindahl A, Nilsson A, et al. Treatment of deep cartilage defects in the
knee with autologous chondrocyte transplantation. N Engl J Med 1994;331:889-95.
2. Hunziker EB. Articular cartilage repair: basic science and clinical progress: a review
of the current status and prospects. Osteoarthritis Cartilage 2002;10:432-63.
3. Buckwalter JA, Mankin HJ. Articular cartilage. Part I: Tissue design and chondrocyte-matrix interactions. J Bone Joint Surg [Am] 1997;79-A:600-11.
4. Mayne R, Brewton RG. Extracellular matrix of cartilage: collagen. In: Woessner JF,
Howell DS, eds. Joint cartilage degradation: basic and clinical aspects. New York:
Marcel Dekker, 1993:81-108.
5. Heinegard D, Oldberg A. Structure and biology of cartilage and bone matrix noncollagenous macromolecules. Faseb J 1989;3:2042-51.
6. Ottani V, Martini D, Franchi M, Ruggeri A, Raspanti M. Hierarchical structures in
fibrillar collagens. Micron 2002;33:587-96.
7. Linsenmayer TF, Chen QA, Gibney E, et al. Collagen types IX and X in the developing chick tibiotarsus: analyses of mRNAs and proteins. Development 1991;111:191-6.

8. Lippiello L, Hall D, Mankin HJ. Collagen synthesis in normal and osteoarthritic

human cartilage. J Clin Invest 1977;59:593-600.
9. Eyre DR. Collagen: molecular diversity in the bodys protein scaffold. Science 1980;
207:1315-22.
10. Nimni M, Deshmukh K. Differences in collagen metabolism between normal and
osteoarthritic human articular cartilage. Science 1973;181:751-2.
11. Binette F, McQuaid DP, Haudenschild DR, et al. Expression of a stable articular
cartilage phenotype without evidence of hypertrophy by adult human articular
chondrocytes in vitro. J Orthop Res 1998;16:207-16.
12. Aigner T, Zhu Y, Chansky HH, et al. Reexpression of type IIA procollagen by adult
articular chondrocytes in osteoarthritic cartilage. Arthritis Rheum 1999;42:1443-50.
13. Aigner T, Reichenberger E, Bertling W, et al. Type X collagen expression in osteoarthritic and rheumatoid articular cartilage. Virchows Arch B Cell Pathol Incl Mol
Pathol 1993;63:205-11.
14. Martin I, Jakob M, Schafer D, et al. Quantitative analysis of gene expression in
human articular cartilage from normal and osteoarthritic joints. Osteoarthritis Cartilage 2001;9:112-8.
15. Gebhard PM, Gehrsitz A, Bau B, et al. Quantification of expression levels of cellular differentiation markers does not support a general shift in the cellular phenotype
of osteoarthritic chondrocytes. J Orthop Res 2003;21:96-101.
16. Matyas JR, Huang D, Chung M, Adams ME. Regional quantification of cartilage
type II collagen and aggrecan messenger RNA in joints with early experimental osteoarthritis. Arthritis Rheum 2002;46:1536-43.
17. Freshney RI. Culture of animals cells: a manual of basic technique. Third Edition.
New York: Wiley-Liss, 1994.
18. Mankin HJ, Dorfman H, Lippiello L, Zarins A. Biochemical and metabolic abnormalities in articular cartilage from osteo-arthritic human hips. II. Correlation of morphology with biochemical and metabolic data. J Bone Joint Surg [Am] 1971;53-A:
523-37.
19. Poole CA, Glant TT, Schofield JR. Chondrons from articular cartilage. (IV). Immunolocalization of proteoglycan epitodes in isolated canine tibial chondrons. J Histochem Cytochem 1991;39:1175-87.
20. Caterson B, Christner JE, Baker JR. Identification of a monoclonal antibody that
specifically recognizes corneal and skeletal keratan sulfate: monoclonal antibodies to
cartilage proteoglycan. J Biol Chem 1983;258:8848-54.
21. Goldring MB. Human chondrocyte cultures a models of cartilage-specific gene regulation. In: Jones GE, ed. Methods in molecular medicine: human cell culture protocols. Tatowa: Humana Press, 1996:217-32.
22. Mayne R, van der Rest M, Bruckner P, Schmidt TM. Approaches for isolating and
characterizing the collagens of cartilage (Types II, IX, X and XI) and the Type IX-related
collagens of other tissues (Types XII and XIV). Oxford: IRL Press, 1995:73-9.
23. www.genome.wi.mit edu/genome_software/other/primer3.html (last accessed May
2002).
24. Bustin SA. Absolute quantification of mRNA using real-time reverse transcription
polymerase chain reaction assays. J Mole Endocrinol 2000;25:169-93.
25. Goldring MB. Degradation of articular cartilage in culture: regulatory factors. In:
Woessner JF, Howell DS, eds. Joint cartilage degradation: basic and clinical aspects.
New York: Marcel Dekker, 1993:281-345.
26. Green WT Jr. Behaviour of articular chondrocytes in cell culture. Clin Orthop 1971;
75:248-60.
27. Benya PD, Shaffer JD. Dedifferentiated chondrocytes reexpress the differentiated
collagen phenotype when cultured in agorose gels. Cell 1982;30:215-24.
28. Benya PD, Padilla SR, Nimni ME. Independent regulation of collagen types by
chondrocytes during the loss of differentiated function in culture. Cell 1978;15:
1313-21.
29. von der Mark K, Gauss V, von der Mark H, Muller P. Relationship between cell
shape and type of collagen synthesised as chondrocytes lose their cartilage phenotype in culture. Nature 1977;267:531-2.
30. Schnabel M, Marlovits S, Eckhoff G, et al. Dedifferentiation-associated changes
in morphology and gene expression in primary human articular chondrocytes in cell
culture. Osteoarthritis Cartilage 2002;10:62-70.
31. Fuss M, Ehlers EM, Russlies M, Rohwedel J, Behrens P. Characteristics of
human chondrocytes, osteoblasts and fibroblasts seeded onto a type I/III collagen
sponge under different culture conditions: a light, scanning and transmission electron
microscopy study. Anat Anz 2000; 182:303-10.
32. Stewart MC, Saunders KM, Burton-Wurster N, Macleod JN. Phenotypic stability of articular chondrocytes in vitro: the effects of culture models, bone morphogenetic protein 2, and serum supplementation. J Bone Miner Res 2000;15:166-74.
33. Kuettner KE, Memoli VA, Pauli BU, et al. Synthesis of cartilage matrix by mammalian chondrocytes in vitro. II. Maintenance of collagen and proteoglycan phenotype.
J Cell Biol 1982;93:751-7.
34. Bassleer C, Gysen P, Foidart JM, Bassleer R, Franchimont P. Human chondrocytes in tridimensional culture. In Vitro Cell Dev Biol 1986;22:113-9.
THE JOURNAL OF BONE AND JOINT SURGERY

CHANGES IN THE RATIO OF TYPE-I AND TYPE-II COLLAGEN EXPRESSION DURING MONOLAYER CULTURE OF HUMAN CHONDROCYTES

35. Gibson GJ, Schor SL, Grant ME. Effects of matrix weight collagen species by cells
cultured within collagen gels. J Cell Biol 1982;93:767-74.
36. Aydelotte MB, Kuettner KE. Differences between sub-populations of cultured
bovine articular chondrocytes. I. Morphology and cartilage matrix production. Connect Tissue Res 1988;18:205-22.
37. Parker RM, Barnes NM. mRNA: detection by in situ and northern hybridization.
Methods Mol Biol 1999;106:247-83.
38. Hod Y. A simplified ribonuclease protection assay. Biotechniques 1992;13:852-4.
39. Weis JH, Tan SS, Martin BK, Wittwer CT. Detection of rare mRNAs via quantitative RT-PCR. Trends Genet 1992;8:263-4.

VOL. 86-B, No. 2, MARCH 2004

295

40. Wasserman L, Dreilinger A, Easter D, Wallace A. A seminested RT-PCR assay

for HER2/neu: initial validation of a new method for the detection of disseminated
breast cancer cells. Mol Diagn 1999;4:21-8.
41. Israeli RS, Miller WH Jr, Su SL, et al. Sensitive nested reverse transcription
polymerase chain reaction detection of circulating prostatic tumor cells: comparison
of prostate-specific membrane antigen and prostate-specific antigen-based assays.
Cancer Res 1994;54:6306-10.
42. Funaki NO, Tanaka J, Itami A, et al. Detection of colorectal carcinoma cells in circulating peripheral blood by reverse transcription-polymerase chain reaction targeting cytokeratin-20 mRNA. Life Sci 1997;60:643-52.