International Journal of Food Microbiology 131 (2009) 162167

Contents lists available at ScienceDirect

International Journal of Food Microbiology

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o

ITS-based detection and quantication of Aspergillus ochraceus and Aspergillus

westerdijkiae in grapes and green coffee beans by real-time quantitative PCR
Jssica Gil-Serna a, Amaia Gonzlez-Salgado b, Ma Teresa Gonzlez-Jan b,
Covadonga Vzquez a, Beln Patio a,
a
b

Department of Microbiology III, Faculty of Biology, University Complutense of Madrid, Jos Antonio Novais 2, E 28040 Madrid, Spain
Department of Genetics, Faculty of Biology, University Complutense of Madrid, Jos Antonio Novais 2, E 28040 Madrid, Spain

a r t i c l e

i n f o

Article history:
Received 9 June 2008
Received in revised form 12 January 2009
Accepted 9 February 2009
Keywords:
Aspergillus ochraceus
Aspergillus westerdijkiae
Real-time qPCR
OTA
Grapes
Green coffee beans
ITS

a b s t r a c t
Aspergillus ochraceus and A. westerdijkiae are considered the most important Ochratoxin A (OTA) producing
species included in Aspergillus section Circumdati which contaminate foodstuffs and beverages for human
consumption. In this work a real-time quantitative PCR protocol was developed to detect both species using
SYBR Green and primers designed on the basis of the multicopy ITS1 region of the rDNA. The assay had high
efciency (94%) and showed no inhibition by host or fungal DNA other than the target species. The lower
detection limit of the target DNA was 2.5 pg/reaction. Accuracy of detection and quantication by qPCR were
tested with genomic DNA obtained from green coffee beans and grapes articially contaminated with spore
suspensions of known concentrations. Spore concentrations equal or higher than 106 spore/ml could be
detected by the assay directly without prior incubation of the samples and a positive relationship was
observed between incubation time and qPCR values. The assay developed would allow rapid, specic,
accurate and sensitive detection and quantication of A. ochraceus and A. westerdijkiae to be directly used in
a critical point of the food chain, before harvesting green coffee and grape berries, to predict and control
fungal growth and OTA production.
2009 Elsevier B.V. All rights reserved.

1. Introduction
Ochratoxin A (OTA) is a widespread mycotoxin with nephrotoxic,
inmunotoxic, genotoxic and teratogenic properties towards several
animal species (Pfohl-Leszkowicz and Manderville, 2007) and has been
classied by the International Agency for Research on Cancer as a possible
human carcinogen (group 2B) (IARC, 1993). The maximum OTA limits
allowed in several food and raw agro-products for human consumption
are under legal regulation in the European Union (Commission
Regulation, 2006). This mycotoxin occurs in various foodstuffs including
cereals and derivatives (Rizzo et al., 2002), coffee (Taniwaki et al., 2003),
grapes and grape-products (Varga and Kozakiewicz, 2006), dried fruits
(Zinedine et al., 2007) and spices (Rizzo et al., 2002).
OTA is a secondary metabolite produced by several fungal species
belonging to the Aspergillus and Penicillium genera. Aspergillus
ochraceus was the rst OTA-producing species described (Van der
Merwe et al., 1965) and it is considered an important species contributing to OTA contamination of coffee, grapes and cereals (Taniwaki
et al., 2003; Magnoli et al., 2007). Other important OTA-producing

Corresponding author.
E-mail address: belenp@bio.ucm.es (B. Patio).
0168-1605/$ see front matter 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.ijfoodmicro.2009.02.008

species of the Section Circumdati are the more recently described A.

westerdijkiae and A. steynii (Frisvad et al., 2004; Samson et al., 2006).
Discrimination among these species and from other closely related
species is difcult when conventional methods based mainly on
morphological features are used and requires considerable expertise.
The application of DNA-based techniques permits rapid, sensitive and
specic detection, necessary to devise strategies to control or reduce
fungal mass and toxin production at early and critical stages of the
food chain, and they are replacing traditional methods in many areas
related with food analyses (Niessen et al., 2005). Real-time quantitative PCR (qPCR) has solved the limitations of conventional PCR,
providing a tool to accurate and sensitive quantication of target DNA.
The most common chemistries, DNA-associating dyes (SYBR Green I)
or uorescently labelled sequence-specic oligoprobes (TaqMan
oligoprobes) are being widely used to develop qPCR assays (Mackay
et al., 2007). The lower cost of qPCR based on SYBR Green is an
advantage of this method for detection and quantication protocols
used in routine analyses of commodities, but it may involve a loss of
specicity if primers-dimers or nonespecic fragments are present
(Kubista et al., 2006). Because of this, additional controls should be
done such as analyzing the reaction products with a melting curve
(Ririe et al., 1997). The target sequence used to design the primers is
also relevant, because it will condition the power of discrimination
and the sensitivity of the assay. Several qPCR assays to detect and
quantify ochratoxigenic fungi have been developed using as target

J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162167

constitutive genes (Mul et al., 2006; Morello et al., 2007) or genes

involved in toxin biosynthesis (Schmidt et al., 2004; Atoui et al., 2007;
Selma et al., 2008). Sensitivity and specicity of qPCR assays are
enhanced when multicopy sequences are used to design specic
primers (Suarez et al., 2005). However, none of the qPCR protocols
reported so far was designed using the multicopy ITS regions to detect
ochratoxigenic fungi.
The applicability of the assay to detect fungi in natural samples
need special consideration since food matrices are usually very
complex (Hanna et al., 2005) and some of the matrix-associated
compounds can inhibit qPCR or reduce its efciency, such as phenolic
compounds which may cause problems in real-time reaction by
binding or denaturing the polymerase (Wilson, 1997).
Early detection of OTA-producing species is critical to prevent
mycotoxin entering the food chain (Dao et al., 2005) and OTA
concentration can be correlated with the levels of ochratoxigenic
fungus detected on naturally contaminated samples (Lund and
Frisvad, 2003). Hence, identication and quantication of A. ochraceus
and A. westerdijkiae in raw products could predict potential risk of
OTA contamination of foodstuffs.
The aim of the present work was to develop a sensitive and specic
assay not inhibited by matrix effects to detect and quantify A. ochraceus
and A. westerdijkiae in green coffee beans and grapes. An efcient
protocol for extraction of fungal DNA from foodstuffs was developed and
the effect of exogenous DNA on the qPCR efciency was also evaluated.
2. Materials and methods
2.1. Organisms, media and culture conditions
All the isolates used in this study are given in Table 1. Fungal strains
were maintained by regular subculturing on Potato Dextrose Agar
(PDA) (Pronadisa, Madrid, Spain) at 25 + 1 C for 45 days and then
stored as spore suspension in 15% glycerol at 80 C. Fungal strains
were cultured for DNA extraction in Erlenmeyer asks containing
20 ml of Sabouraud Broth (Pronadisa, Madrid, Spain) and incubated at
28 + 1 C in an orbital shaker (140 rpm) for 3 days.
2.2. DNA extraction
DNeasy Plant Mini Kit (Qiagen, Valencia, Spain) was used
according to manufacturer's instructions starting from 20 mg of
ltered mycelium frozen with liquid nitrogen and grinded using a
mortar and pestle. This protocol was also used for DNA extraction from
green coffee beans. The yield of the method was evaluated in ve
independent extractions of A. ochraceus CECT 2092 and A. westerdijkiae ALD and ALF. In the case of DNA extraction from grapes, 0.33%
Polyvinylpyrrolidone (PVP) (Sygma-Aldrich, Steinheim, Germany)
was added to AP1 and AP2 buffers. In all cases, puried DNA was
eluted from the DNeasy spin column using elution buffer (TE) and
optimal results were obtained by eluting twice (2 75 l). DNA
concentrations were determined using a NanoDrop ND-1000
spectrophotometer (Nanodrop Technologies, Wilmington, USA).

163

Table 1
Fungal strains used in this study to validate the quantitative PCR assay designed.
Strain

Species

Source

Amplication with
OCRAQ1/OCRAQ2

178a
242a
325a
CBS 102.14
CBS 310.80
CBS 614.78
IMI 345568
ITEM 4592
M12hip10a
ITEM 4685
B.Me.A26
CECT 2091
ALHb
ALMb
CBS 108.08
CBS 624.78
CECT 2092
CECT 2093
CECT 2969
CECT 2970
Cab5dch6
CBS 112812
CBS 112814
CBS 121991
CBS 121993
Bo75
T.TT.A2
ALBb
ALDb
ALFb
ALGb
CBS 112803
CBS 112791
CBS 121983
CBS 121984
CBS 121986
F4094
FvMM1-2
CECT 2270
CYC 20012
CYC 20013
IMI 311661
CECT 10590
CECT 10113
Pv 1
CECT 1172
CECT 10676
Un 1

Aspergillus carbonarius
Aspergillus carbonarius
Aspergillus carbonarius
Aspergillus elegans
Aspergillus elegans
Aspergillus elegans
Aspergillus elegans
Aspergillus avus
Aspergillus avus
Aspergillus japonicus
Aspergillus niger
Aspergillus niger
Aspergillus ochraceus
Aspergillus ochraceus
Aspergillus ochraceus
Aspergillus ochraceus
Aspergillus ochraceus
Aspergillus ochraceus
Aspergillus ochraceus
Aspergillus ochraceus
Aspergillus parasiticus
Aspergillus steynii
Aspergillus steynii
Aspergillus steynii
Aspergillus steynii
Aspergillus tubingensis
Aspergillus tubingensis
Aspergillus westerdijkiae
Aspergillus westerdijkiae
Aspergillus westerdijkiae
Aspergillus westerdijkiae
Aspergillus westerdijkiae
Aspergillus westerdijkiae
Aspergillus westerdijkiae
Aspergillus westerdijkiae
Aspergillus westerdijkiae
Fusarium thapsinum
Fusarium verticillioides
Penicillium corylophilum
Botrytis cinerea
Botrytis cinerea
Colletotrichum coffeanum
Pichia anomala
Pichia membranifaciens
Plamopara viticola
Saccharomyces cerevisiae
Torulaspora delbrueckii
Uncinula necator

Grapes, Spain
Grapes, Spain
Grapes, Spain

+
+
+
+
+
+
+
+

+
+
+
+
+
+
+
+
+

Wheat, France
Barley, Spain
Grapes, Spain

Coffee, India
Coffee, India
Coffee, Thailand
Coffee, Thailand
Grapes, Spain
Grapes, Spain

Sorghum, South Africa

Coffee, Thailand
Coffee, Thailand
Coffee, Thailand
Laboratory cross
Maize, Spain
Grapes, Spain
Grapes, Spain
Coffee, Tanzania
Grape Juice, Spain
Grapes, Spain
Grapes, Spain
Orange juice, Spain
Grapes, France
Grapes, Spain

Last nine strains corresponding to species that cause common fungal grapes or green
coffee diseases and yeast that could be present as usual ora.
CBS: Centralbureau voor Schimmel Cultures (The Netherlands).
CECT: Spanish Type Culture Collection (Spain).
CYC: Complutense Yeast Collection (Spain).
ITEM: Institute of Sciences of Food Production Culture Collection (Italy).
IMI: CABI Genetic Resource Collection (United Kingdom).
a
Strain supplied by Dr. V. Sanchis (University of Lleida, Spain).
b
Strains supplied by Dr. L. Niessen (Technische University of Mnchen, Germany).
Fungal strains used to test the specicity of the qPCR assay.

2.3. Primer design

2.4. Conventional PCR amplication

Two specic primers to A. ochraceus and A. westerdijkiae, OCRAQ1 and

OCRAQ2 (5'GCACAGCGC TCGCCG 3' and 5'CTGATTGCGATACAATCG 3'
respectively) were designed on the basis of sequence alignments of the
ITS1 region of several strains from different origins and other related
species and genera obtained in our laboratory or retrieved from data bases.
A universal pair of primers based in 5.8 S region, 5.8 S1 (5'CGGCATCGATGAA GAACGC 3') and 5.8 S2 (5'CAATGTGCGTTCAAAGACTCG
3'), was designed following the same approach indicated above to test
amplication in samples where neither A. ochraceus nor A. westerdijkiae
DNA were present.

Specicity of the pair OCRAQ1/OCRAQ2 was tested by conventional PCR in a wide range of isolates shown in Table 1. The assays
were performed in an Eppendorf Mastercycler Gradient (Eppendorf,
Hamburg, Germany). Amplication reactions were carried out in
volumes of 25 L containing 2 L (550 ng) of template DNA, 1 L of
each primer (20 M), 2.5 L of 10 PCR buffer, 1 L of MgCl2 (50 mM),
0.2 L of dNTPs (100 mM) and 0.15 L of Taq DNA polymerase (5 U/L)
supplied by the manufacturer (Biotools, Madrid, Spain).
All genomic DNAs were tested for suitability for PCR amplication
using universal primers ITS1 and ITS4 (White et al., 1990) and the

164

J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162167

protocol described elsewhere (Henry et al., 2000). Specic PCR assays

carried out using primers OCRAQ1/OCRAQ2 for A. ochraceus and A.
westerdijkiae were performed according to the following protocol: 4 min
30 s at 95 C, 24 cycles of 30s at 95 C (denaturalization), 20s at 60 C
(annealing), 35s at 72 C (extension) and nally 3 min at 72 C. PCR
products were detected in 3% agarose ethidium bromide gels in TAE 1X
buffer (Tris-acetate 40 mM and EDTA 1.0 mM). The 100 bp DNA ladder
(MBI Fermentas, Vilnius, Lithuania) was used as molecular size marker.
2.5. Quantitative PCR amplication
Quantitative real-time PCR assay was performed and monitored in
an ABI PRISM 7900HT system (Applied Biosystems, Madrid, Spain) in
the Genomic Unit of the Complutense University of Madrid. The
reaction mixture composition in a nal volume of 25 l was: 12.5 l
SYBR Green PCR Master Mix (Applied Biosystems, Madrid, Spain),
1.2 l forward primer 5 M, 1.2 l reverse primer 5 M, 5 l DNA
template in suitable concentration and 5.1 l molecular biology water
(MO-BIO, Carlsbad, USA). qPCR assays were carried out using a
standard program: 95 C for 10 min, 40 cycles at 95 C for 15 s and
60 C for 1 min. All reactions were carried out by duplicate in
MicroAmp 96-well plates (Applied Biosystems, Madrid, Spain).
2.6. Standard curve
Ten-fold serial dilutions of DNA from CECT 2092 strain (from 50 to
5 10 3 ng/l) were used as template in the reactions. Ct values were
plotted against the logarithm of starting quantity of template for each
dilution. Then, amplication efciency was calculated from the slope
of the standard curve (Kubista et al., 2006).
E = 10

1 = slope

% Efficiency = E 1 100

Table 2
qPCR analyses of samples containing DNA of two or more fungal species at different
proportions.
DNA mix

Ratio

Ct value

DNA concentration
(ng/l)

A
A.
A.
A.
A.
A.
A.
A.
A.
A.
A.
A.

100
50:50
50:50
50:50
25:75
50:50
75:25
50:50
25:75
100
33:33:33

21.33 0.20
22.75 0.10
22.82 0.04
22.76 0.09
23.57 0.21
22.86 0.01
22.32 0.13
22.76 0.06
23.25 0.08
30.61 0.04
23.50 0.08

0.078
0.031
0.029
0.030
0.018
0.028
0.041
0.030
0.022
0
0.019

50:50

30.50 0.28 0

100
50:50
50:50
50:50
25:75
50:50
75:25
50:50
25:75
100
33:33:33
50:50

20.45 0.02
21.22 0.00
21.57 0.10
21.65 0.13
22.92 0.02
21.42 0.07
21.15 0.01
21.85 0.00
23.00 0.03
34.34 0.11
22.47 0.25
32.94 0.14

westerdijkiae
westerdijkiae P. corylophilum
westerdijkiae Fusarium sp.
westerdijkiae A. avus
westerdijkiae A. avus
westerdijkiae A. tubingensis
westerdijkiae A. tubingensis
westerdijkiae A. carbonarius
westerdijkiae A. carbonarius
tubingensis
westerdijkiae A. tubingensis A.
carbonarius
P. corylophilum Fusarium sp.
B
A. ochraceus
A. ochraceus P. corylophilum
A. ochraceus Fusarium sp.
A. ochraceus A. avus
A. ochraceus A. avus
A. ochraceus A. tubingensis
A. ochraceus A. tubingensis
A. ochraceus A. carbonarius
A. ochraceus A. carbonarius
A. tubingensis
A. ochraceus A. tubingensis A. carbonarius
P. corylophilum Fusarium sp.

0.140
0.084
0.067
0.063
0.027
0.073
0.088
0.055
0.026
0
0.037
0

A) Assay with mixes containing A. westerdijkiae DNA. B) Assay with mixes containing A.
ochraceus DNA. Ct values obtained in qPCR assays are shown as mean standard deviation of the reaction duplicates. DNA concentration was determined by interpolating
from the standard curve.

Additionally, different serial dilutions of fungal DNAs extracted

from pure culture were evaluated to determine detection limits of the
qPCR assay.
2.7. Specicity of qPCR reactions
The exclusive binding of SYBR Green to the amplicons derived
from specic reactions was tested by analyzing the melting curve
performed after the qPCR program. The protocol was as follows: 15 s
at 95 C, 15 s at 60 C and 20 min slow ramp between 60 and 95 C
after the qPCR program.
The specicity of the pair OCRAQ1/OCRAQ2 to detect A. ochraceus
and A. westerdijkiae strains was also tested in qPCR assays using
genomic DNA from closely related species and genera that usually
contaminate the same products (Table 2). The samples analyzed
containing different proportion of DNA from these species and A.
westerdijkiae ALD (Table 2A) or A. ochraceus CECT 2092 (Table 2B).
Both groups of mixtures were evaluated independently. Ct values
obtained were interpolated from the standard curve to calculate initial
DNA concentration. Reactions with primer set 5.8S1/5.8S2 were also
carried out to test the suitability of genomic DNAs for amplication.
2.8. Evaluation of qPCR inhibition by host DNA
Genomic DNA from 5 DNA independent extractions of pure
cultures of A. ochraceus CECT 2092 and A. westerdijkiae ALD and ALF
were evaluated in qPCR assays using 1:1 dilutions with TE buffer, DNA
of uncontaminated grapes (5 ng/l) and DNA of uncontaminated
green coffee beans (5 ng/l). Ct values were compared to evaluate
inhibition using statistical software SPSS 14.0. Corresponding Student
t-test was applied with a level of signicance p b 0.05.

2.9. Fungal detection in articially contaminated samples

Green coffee beans (Coffea arabica L., Brazil) and grape berries (Vitis
vinifera L., var Vinalopo, Spain) were decontaminated by immersion in
ethanol (70%) and, subsequently, 2 g were inoculated with 1 ml of spore
suspensions at concentrations 102, 104 and 106 spores/ml (low, medium
and high concentration respectively) from CECT 2092, ALD and ALF
strains. Fungal conidia suspensions were prepared from a sporulating
culture (7 day-old) on Rose Bengale Chloramphenicol Agar (Pronadisa,
Madrid, Spain) and ltered through Whatman N1 paper. Concentrations were measured by microscopy using a Thomas counting chamber
and spore suspensions were diluted when necessary.
Inoculated samples were incubated at 28 C for 0, 8, 16 and 24 h
before genomic DNA extraction. As negative control, 2 g of grapes or
green coffee beans were mock inoculated with 1 ml of sterile saline
solution and incubated following the same protocol.
3. Results
3.1. Specicity and sensibility of the qPCR assay designed
The specicity of the primers OCRAQ1 and OCRAQ2 was studied by
conventional PCR in a number of A. ochraceus and A. westerdijkiae
strains from different sources as well as in closely related species or
which frequently occur in the same food matrices (Table 1). A single
fragment of about 75 bp was amplied when genomic DNA from A.
ochraceus or A. westerdijkiae was used. No product was observed with
genomic DNA from isolates of the other species tested.
The standard curve generated with the pair OCRAQ1/OCRAQ2 in
the conditions described above is shown in Fig. 1. Linearity was
observed across all the range used and the very high correlation

J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162167

165

Fig. 1. Standard curve generated from the amplication of ten-fold dilutions from target genomic DNA from CECT 2092. This curve revealed strong linear relationship (R2 = 0.998)
between the decimal logarithm of the starting DNA concentration and the threshold cycle.

coefcient (R2 = 0.998) indicated very low inter-assays variability. The

slope of the standard curve was 3.47 which corresponded to an
amplication efciency of 94%. NTC (non target control) value was
31.27.
Different serial dilutions of DNA obtained from pure culture were
evaluated in qPCR reactions to determine the lowest amount of target
DNA detected by the qPCR protocol developed. The lowest DNA target
concentration was 0.5 pg/l, which corresponded to 2.5 pg/reaction.
The derivative melting curve generated showed a single peak
indicating that a single amplicon was generated by qPCR and primerdimers did not occur (data not shown).
The results of samples with different relative contents of fungal
DNA evaluated by qPCR are shown in Table 2. DNA samples containing
neither A. ochraceus nor A. westerdijkiae DNA were not amplied with
OCRAQ1/OCRAQ2 primer set. qPCR values were in agreement with the
relative amount of initial DNA of A. ochraceus or A. westerdijkiae in the
sample. Positive amplication with the pair 5.8S1/5.8S2 was observed
in all samples analyzed.
3.2. DNA extraction protocol
The efciency of the DNA extraction protocol used was evaluated.
DNA concentration values obtained using the NanoDrop spectrophotometer ranged from 5 and 81 ng/l. All independent DNA
extractions were subsequently analyzed by qPCR and the Ct values
were interpolated from the standard curve obtaining values between
2 and 71 ng/l.
3.3. Evaluation of qPCR inhibition by host DNA
The results of evaluation of PCR inhibition by host DNA are shown
in Table 3. Ct values obtained did not show signicant differences
(p N 0.05) between control assays (A. ochraceus or A. westerdijkiae DNA
diluted in TE) and reactions containing fungal DNA and DNA from
either green coffee beans or grape berries.

3.4. Fungal detection and quantication in articially contaminated samples

A. ochraceus and A. westerdijkiae detection in articially contaminated food matrices after different times of incubation are shown in
Fig. 2. When grapes (Fig. 2A) or green coffee beans (Fig. 2B) were
inoculated with a suspension 106 spores/ml, target fungal DNA was
detected even without incubation showing higher sensitivity on green
coffee than on grapes. Intermediate values of spore concentration did
reveal the occurrence of A. ochraceus or A. westerdijkiae after 16 h of
incubation in green coffee beans and after 24 h in grapes. None of
these species was detected by qPCR in samples inoculated with a low
concentrated spore suspension (102 spores/ml). No detectable signal
was observed in negative control grapes or coffee beans mockinoculated with saline solution.
4. Discussion
In this work, a specic and sensitive protocol was developed to
detect and quantify A. ochraceus and A. westerdijkiae contamination in
grapes and green coffee beans by qPCR.
Optimization of a qPCR assay is very important, mainly when SYBR
Green dye is used. The analysis of the melting curve and the
parameters calculated from the standard curve showed that the

Table 3
Evaluation of qPCR inhibition by host DNA.
Ct values
Fungal DNA

Fungal coffee DNA Fungal grape DNA

A. ochraceus
CECT 2092 13.13 0.36 13.09 0.48
A. westerdijkiae ALD
16.39 2.38 16.29 2.21
ALF
15.11 1.21 15.14 1.84

13.77 1.12
17.87 2.50
15.59 2.23

The mean of Ct values of the ve independent extractions of each strain are shown
(mean standard deviation). Differences among results were not statistically signicant when fungal DNA was analysed alone or with coffee or grape DNA (p N 0.05).

166

J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162167

Fig. 2. Fungal DNA detection by qPCR of inoculated grape berries (A) and green coffee beans (B). Each value corresponds to the mean of the results of the three strains at different
incubation times (0, 8, 16 and 24 h) and spore concentration: 102 (grey), 104 (black) and 106 (dotted). Under no circumstances, controls with saline solution gave a detectable signal
in the qPCR assay with OCRAQ1/OCRAQ2 pair of primers.

method designed was highly optimized. The efciency obtained (94%)

and the high R2 coefcient are considered good indicators of a robust
and reproducible assay and the melting curve showed that only one
fragment was amplied and primer-dimers did not form.
The ITS1-5.8S-ITS2 region within the rDNA unit is frequently used
to discriminate at the species level (Edwards et al., 2002). Conventional PCR assays have demonstrated the specicity of the pair of
primers OCRAQ1/OCRAQ2 in a wide representation of A. ochraceus
and A. westerdijkiae strains, related and other species causing grape
and coffee diseases or those frequently present in the same substrates.

The alignment of ITS1-5.8S-ITS2 region of several strains of A.

ochraceus and A. westerdijkiae performed revealed differences in few
bases. This allowed development of a single assay to detect both
species, being the most important OTA-producing species in terms of
relative amounts of OTA produced (Frisvad et al., 2004). On the other
hand, the use of ITS regions to develop specic primers instead of
single copy genes (either constitutive or toxin biosynthetic genes)
enhances the sensitivity of the assay due to its multi-copy character
(Suarez et al., 2005). A previous qPCR assay targeting genes involved
in OTA synthesis to detect A. ochraceus could detect up to 4.7 pg per

J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162167

reaction (Schmidt et al., 2004) and, in this work, the lowest detection
limit achieved was 2.5 pg per reaction. Currently, several authors
prefer to express sensitivity of qPCR method in number of haploid
genomes detected (Mul et al., 2006; Selma et al., 2008). Nevertheless, it was not possible in our case because genomic size of these
species is not known yet.
Since the applicability of a qPCR protocol can be seriously
compromised by the food matrix (Hanna et al., 2005), we have tested
several rapid and easy DNA extraction protocols which could result in
efcient removal of matrix compounds which might inhibit qPCR
reaction. DNeasy Plant Mini Kit yielded good quality DNA obtained
either from fungal pure culture or green coffee beans and suitable for
qPCR. The protocol was further improved to be used for grapes,
because efciency was considerably lower than in coffee beans (data
not shown), probably due to phenolic compounds present in the grape
juice which can inhibit qPCR (Wilson, 1997). Addition of PVP in the
corresponding steps, as indicated above, improved the qPCR assay to
achieve quantication values closer to those obtained for coffee beans.
Once these protocols were optimized, the sensitivity of the qPCR assay
was tested in grapes and green coffee beans articially contaminated
with known concentrations of spore suspensions. When a highly
concentrated spore suspension (106 spores/ml) was used, a detectable uorescent signal was obtained even without incubation. DNA
extraction from spores is more difcult because of their strong cell
wall but when fungi occur in food products, they normally exist as
hyphal structures so the method could detect lower levels of
contamination without incubation.
This assay was useful not only to detect these species but also to
quantify them. Concentration values obtained by qPCR in samples
with different ratios of fungal DNA were related with the initial
amounts of A. westerdijkiae and A. ochraceus DNA. Moreover, the
application of the method to quantify these fungi in articially
contaminated matrices was conrmed and detection was increased at
longer times of incubation both in grapes and green coffee beans. The
possibility to quantify contamination levels in food matrices is
essential because previous studies have demonstrated that levels of
ochratoxigenic fungi can be related with OTA concentration that
exceed legal limits (Lund and Frisvad, 2003).
In conclusion, we describe an integrated qPCR method to detect
and quantify A. ochraceus and A. westerdijkiae in grapes and green
coffee beans. This method was rapid, specic and the sensitivity
achieved higher than previously reported protocols, providing a useful
tool for early detection of A. ochraceus and A. westerdijkiae and
prediction of OTA contamination in commodities susceptible to be
colonized by these species.
Acknowledgments
This work was supported by the Spanish Ministry of Science and
Innovation (AGL 2007-66416-C05-02/ALI) and by the UCM-CM
(CCG07-UCM/AGR-2612). J. Gil-Serna was supported by a FPU
fellowship by the Spanish Ministry of Science and Innovation.
References
Atoui, A., Mathieu, F., Lebrihi, A., 2007. Targeting a polyketide synthase gene for Aspergillus
carbonarius quantication and ochratoxin A assessment in grapes using real-time PCR.
International Journal of Food Microbiology 115, 313318.

167

Commission Regulation, 2006. EC No 1881/2006 setting maximum levels for certain

contaminants in foodstuffs. Ofcial Journal of the European Union, Brussels.
Dao, H.P., Mathieu, F., Lebrihi, A., 2005. Two primer pairs to detect OTA producers by
PCR method. International Journal of Food Microbiology 104, 6167.
Edwards, S.G., O, 'Callaghan, J., Dobson, D.W., 2002. PCR-based detection and
quantication of mycotoxigenic fungi. Mycological Research 106, 10051025.
Frisvad, J.C., Frank, J.M., Houbraken, J.A.M.P., Kuijpers, A.F.A., Samson, R.A., 2004. New
ochratoxin A producing species of Aspergillus section Circumdati. Studies in Mycology
50, 2343.
Hanna, S.E., Connor, C.J., Wang, H.H., 2005. Real-time polymerase chain reaction for the food
microbiologist: technologies, applications, and limitations. Journal of Food Science 70,
R49R53.
Henry, T., Iwen, P.C., Hinrichs, S.H., 2000. Identication of Aspergillus species using internal
transcribed spacer regions 1 and 2. Journal of Clinical Microbiology 38, 5101515.
IARC, 1993. IARC Vol. 56: some naturally occurring substances: some food items and
constituents, heterocyclic aromatic amines and mycotoxins. IARC Monographs on
the Evaluation of Carcinogenic Risks to Humans 56.
Kubista, M., Andrade, J.M., Bengtsoon, M., Forootan, A., Jonk, J., Lind, K., Sindelka, R.,
Sjback, R., Sjgreen, B., Strmbom, L., Stahlberg, A., Zoric, N., 2006. The real-time
polymerase chain reaction. Molecular Aspects of Medicine 27, 95125.
Lund, F., Frisvad, J.C., 2003. Penicillium verrucosum in wheat and barley indicates
presence of ochratoxin A. Journal of Applied Microbiology 95, 11171123.
Mackay, I.M., Mackay, J.F., Nissen, M.D., Sloots, T.P., 2007. Real-time PCR: history and
uorogenic chemistries. In: Mackay, I.M. (Ed.), Real-Time PCR in Microbiology:
From Diagnosis to Characterization. Horizon Scientic Press, Norfolk, pp. 140.
Magnoli, C.E., Astoreca, A.L., Chiacchiera, S.M., Dalcero, A.M., 2007. Ocurrence of
ochratoxin A and ochratoxigenic mycoora in corn and corn based foods and feeds
in some South American countries. Mycopathologia 163, 249260.
Morello, L.G., Sartori, D., De Oliveira Martinez, A.L., Vieira, M.L.C., Taniwaki, M.H.,
Fungaro, M.H.P., 2007. Detection and quantication of Aspergillus westerdijkiae in
coffee beans based on selective amplication of -tubulin gene by using real-time
PCR. International Journal of Food Microbiology 119, 270276.
Mul, G., Susca, A., Logrieco, A., Stea, G., Visconti, A., 2006. Development of a real-time
PCR assay for the detection of Aspergillus carbonarius in grapes. International
Journal of Food Microbiology 111, S28S34.
Niessen, L., Schmidt, H., Mhlencoert, E., Frber, P., Karolewiez, A., Geisen, R., 2005.
Advances in the molecular diagnosis of ochratoxin A-producing fungi. Food Additives
and Contaminants 22, 324334.
Pfohl-Leszkowicz, A., Manderville, R.A., 2007. Ochratoxin A: an overview on toxicity and
carcinogenicity in animals and humans. Molecular Nutrition & Food Research 51,
6199.
Ririe, K.M., Rasmussen, R.P., Wittwer, C.T., 1997. Product differentiation by analysis of
DNA melting curves during the polymerase chain reaction. Analytical Biochemistry
245, 154160.
Rizzo, A., Eskola, M., Atroshi, F., 2002. Ochratoxin A in cereals, foodstuffs and human
plasma. European Journal of Plant Pathology 108, 631637.
Samson, R.A., Hong, S.B., Frisvad, J.C., 2006. Old and new concepts of species differentiation
in Aspergillus. Medical Mycology 44, S133S148.
Schmidt, H., Bannier, M., Vogel, R.F., Niessen, L., 2004. Detection and quantication of
Aspergillus ochraceus in green coffee by PCR. Letters in Applied Microbiology 38,
464469.
Selma, M.V., Martnez-Culebras, P.V., Aznar, R., 2008. Real-time PCR based procedures
for detection and quantication of Aspergillus carbonarius in wine grapes.
International Journal of Food Microbiology 122, 126134.
Suarez, M.B., Walsh, K., Boonham, N., O'Neill, T., Pearson, S., Baker, I., 2005. Development
of a real-time PCR (TaqMan) assays for the detection and quantication of Botrytis
cinerea in planta. Plant Physiology and Biochemistry 43, 890899.
Taniwaki, M.H., Pitt, J.I., Teixeira, A.A., Iamanaka, B.T., 2003. The source of ochratoxin A in
Brazilian coffee and its formation in relation to processing methods. International
Journal of Food Microbiology 82, 173179.
Van der Merwe, K.J., Steyn, P.S., Fourie, L., 1965. Ochratoxin A, a toxic metabolite
produced by Aspergillus ochraceus Wilh. Nature 205, 11121113.
Varga, J., Kozakiewicz, Z., 2006. Ochratoxin A in grapes and grape-derived products.
Trends in Food Science & Technology 17, 7281.
White, T.J., Burns, T., Lee, S., Taylor, J.W., 1990. Amplication and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelgard, D.H.,
Sninsky, J.J., White, T.J. (Eds.), PCR protocols: a guide to methods and applications.
Academic Press, New York, pp. 315322.
Wilson, I.G., 1997. Inhibition and facilitation of nucleic acid amplication. Applied and
Environmental Microbiology 63, 37413751.
Zinedine, A., Soriano, J.M., Juan, C., Mojemmi, B., Molto, J.C., Bouklouze, A., Cherrah, Y.,
Idrissi, L., El Aouad, R., Manes, J., 2007. Incidence of ochratoxin A in rice and dried
fruits from Rabat and Sal area, Morocco. Food Additives and Contaminants 24,
285291.