World Applied Programming, Vol (2), Issue (6), June 2012.

377-388
ISSN: 2222-2510
2011 WAP journal. www.waprogramming.com

Graphene:
Synthesis and Applications in Biotechnology - A Review
Mohammad Hakimi

Paransa Alimard

Chemistry Department,
Payame Noor University,
19395-4697 Tehran, Iran
mohakimi@yahoo.com

Chemistry Department
Payame Noor University
19395-4697 Tehran

Abstract: Graphene has emerged as an exotic material of the 21st century, and received world-wide attention
due to its exceptional charge transport, thermal, optical, and mechanical properties. However, the severe
chemical conditions required to prepare graphene from naturally occurring graphite has become the biggest
limiting factor for high scale graphene production and commercialization. Many bioapplications have been
proposed for this material. In this review various synthesis processes of single layer graphene are reviewed
and selectively current advances in the field of graphene bioapplications are analyzed.
Key word: Graphene, synthesis, bioapplication, biotechnology.
I.

INTRODUCTION

Graphene is a two-dimensional (2D) layer of carbon atoms ordered into a honeycomb lattice as shown in Fig. 1.
Graphene, one of the allotropes (carbon nanotube, fullerene, diamond) of elemental carbon, is a planar monolayer of
carbon atoms with a carboncarbon bond length of 0.142 nm [1]. Electrons in graphene behave like massless
relativistic particles, which contribute to very peculiar properties [211] such as dirac spectrum of low-lying
quasiparticles [3], large mean-free-path [4], and high electron mobility [12, 13].

Fig.1. Graphenes honeycomb lattice

Unlike 3D matter, whose bulk is hidden from direct observation and influence, graphenes bulk, its 2D surface, is
always exposed, and its structure may be inspected or modified with greater ease. Furthermore, the Dirac energy
dispersion in 2D implies that graphene is a gapless semiconductor, whose density of states vanishes linearly when
approaching the Fermi energy. As such, it is a bridge material separating the worlds of semiconductors (with an
energy gap between the valence and conducting bands) and metals, with a finite density of electronic states at the
Fermi energy. Depending on the operating regime, graphene can be pushed in either direction. For example, it is
possible to open a gap in a sample with the help of chemical modifications [14, 15], or lateral confinement [1618].
Some graphene samples have spatially-varying electronic properties, due to local modifications on the sample. The
long electronic mean-free-path, which can be of the order of micrometers, implies that electronic signals can travel
unimpeded large distances through a device. These features might be very useful in applications. This review article
presents the various synthesis processes of graphene and selectively summarizes biofunctionalization and
bioapplication of graphene.

377

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

II.

SYNTHESIS OF GRAPHENE

II.1. EXFOLIATION AND CLEAVAGE

It is obvious that the excellent properties of graphene relevant are highly dependent on the exfoliation of the graphite
down to single graphene sheet in the matrices. The key challenge in synthesis and processing of bulk-quantity
graphene sheets is aggregation. Unless well separated from each other, graphene tends to form irreversible
agglomerates or even restack to form graphite through Van der Waals interactions.

II.1.1. MECHANICAL EXFOLIATION IN SOLUTIONS

Mechanical exfoliation is a simple peeling process where a commercially available highly oriented pyrolytic graphite
(HOPG) sheet was dry etched in oxygen plasma to many 5 m deep mesa. The mesa was then stuck onto a photoresist
and peeled off layers by a scotch tape. The thin flakes left on the photoresist were washed off in acetone and
transferred to a silicon wafer. It was found that these thin flakes were composed of monolayer or a few layers of
graphene [19].
On the other hand, although chemical oxidation of graphite and the subsequent exfoliation provide large amount of
graphite oxide monolayer, the invasive chemical treatment inevitably generates structural defects as indicated by
Raman spectroscopic studies [20, 21]. These structural defects disrupted the electronic structure of graphene and
change it to semiconductive. Therefore, physical exfoliation approaches are desirable where it is required to maintain
the graphene structure.
Blake et al. and Hernandez et al. have demonstrated that graphite could be exfoliated in N-methyl-pyrrolidone to
produce defect-free monolayer graphene [22, 23]. The disadvantage of this process is the high cost of the solvent and
the high boiling point of the solvent that makes the following graphene deposition difficult. Lotya and coworkers have
used a surfactant (sodium dodecylbenzene sulfonate, SDBS) to exfoliate graphite in water to produce graphene. The
graphene monolayers are stabilized against aggregation by a relatively large potential barrier caused by the Coulomb
repulsion between surfactant-coated sheets [24]. Similarly, Green and Hersam have used sodium cholate as a
surfactant to exfoliate graphite and moved further to isolate the resultant graphene sheets with controlled thickness
using density gradient ultracentrifugation (DGU) [25].

II.1.2. INTERCALATION OF SMALL MOLECULES BY MECHANICAL EXFOLIATION

Agglomeration in graphite can be reduced appreciably by incorporating small molecules between the layers of graphite
or by non-covalently attaching molecules or polymers onto the sheets, generating graphite intercalation compounds
(GICs). In GICs, the graphite layers remains unaltered with guest molecules located in the interlayer galleries. When
the layers of graphite interact with the guest molecules by charge transfer, the in-plane electrical conductivity
generally increases but when the molecules form covalent bonds with the graphite layers as in fluorides or oxides the
conductivity decreases as the conjugated sp2 system is disrupted.
Acetic acid, acetic acid anhydride, concentrated sulfuric acid and hydrogen peroxide were the examples of few
ultrasonic solvents. Among all those, concentrated sulfuric acid had been proved to be the best ultrasonic solvent to
provide optimum condition for preparing the expandable graphite (EG) with ultrasound irradiation. Such sulfuric acid
intercalated graphite compound consisted of layers of hexagonal carbon structure within which H2SO4 was
intercalated. EG could be prepared either by oxidation with a chemical reagent or electrochemically in the intercalating
acid [26, 27]. Graphite could expand up to a hundred times in volume at high temperature [28] due to the thermal
expansion of the evolved gases trapped between the graphene sheets. So it was reasonably assumed that oxidants and
other molecules could enter in the interlayer space of EG more easily compared to natural graphite.
Li et al. reported the exfoliationreintercalationexpansion of graphite to produce high quality single layer graphene
sheets stably suspended in organic solvents [29]. Commercial expandable graphite was subjected to brief heating (60s)
at 1000 C in forming gas. It was then grounded with NaCl crystals and reintercalated with oleum. The exfoliated
graphite was then dispersed in N, N-dimethylformamide (DMF) and treated with tetrabutylamonium (TBA). TBA

378

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

could insert into and increase the distance between adjacent layers of graphite facilitating the separation of graphene
sheets in surfactant solutions.

II.2. CHEMICAL VAPOR DEPOSITION (CVD)

II.2.1. THERMAL CVD
Besides mechanical exfoliation and chemical reduction methods to produce graphene sheets, several promising
approaches including epitaxial growth from SiC, and chemical vapor deposition (CVD) on metal surfaces have been
reported. Among them, the CVD growth appears to be the most promising technique for large-scale production of
mono- or few-layer graphene films.
A typical CVD process (i.e. using Ni as a substrate) involves dissolving carbon into the nickel substrate followed by a
precipitation of carbon on the substrate by cooling the nickel. The Ni substrate is placed in a CVD chamber at a
vacuum of 10-3 Torr and temperature below 1000C with a diluted hydrocarbon gas. The deposition process starts with
the incorporation of a limited quantity of carbon atoms into the Ni substrate at relatively low temperature, similar to
the carburization process. The subsequent rapid quenching of the substrate caused the incorporated carbon atoms to
out-diffuse onto the surface of the Ni substrate and form graphene layers. Therefore, the thickness and crystalline
ordering of the precipitated carbon (graphene layers) is controlled by the cooling rate and the concentration of carbon
dissolved in the nickel which is determined by the type and concentration of the carbonaceous gas in the CVD, and the
thickness of the nickel layer [20, 30-33].
In contrast, the graphene growth on low carbon solubility (<0.001 atomic %) substrate like Cu mainly happens on the
surface through the four-step process described by Li and coworkers as following [34] :
1.

2.
3.
4.

Catalytic decomposition of methane on Cu to form CxHy upon the exposure of Cu to methane and hydrogen.
In this process, the Cu surface is either undersaturated, saturated, or supersaturated with CxHy species,
depending on the temperature, methane pressure, methane flow, and hydrogen partial pressure.
Formation of nuclei as a result of local supersaturation of CxHy where undersaturated Cu surface does not
form nuclear.
Nuclei grow to form graphene islands on Cu surface saturated, or supersaturated with CxHy species.
Full Cu surface coverage by graphene under certain temperature (T), methane flow rate (JMe), and methane
partial pressure (PMe).

An interesting feature of the CVD approach to synthesize graphene is the possibility for substitutional doping by
introducing other gases, such as NH3, during the growth [3537]. The nitrogen atoms can be doped into graphene as
pyridinic, graphitic and pyrrolic forms. These nitrogen doped graphene (N-graphene) layers have
demonstrated interesting properties.

II.2.2. PLASMA ENHANCED CVD

Plasma enhanced chemical vapor deposition (PECVD) offers another route of graphene synthesis at a lower
temperature compared to thermal CVD. Thick graphite structures were observed during the fabrication of
nanostructured graphite-like carbon using a dc discharge PECVD. The first report of the production of mono- and
few layer of graphene by PECVD involved a radio frequency PECVD system to synthesize graphene on a various
substrates where graphene sheets were produced from a gas mixture of 5100% CH4 in H2 (total pressure 12 Pa), at
900W power and 680 C substrate temperature [38,39].
The advantages of the plasma deposition include very short deposition time (<5 min) and a lower growth temperature
of 650 C compared to the thermal CVD approach (1000 C).

II.2.3. THERMAL DECOMPOSITION ON SIC AND OTHER SUBSTRATES

Producing graphite through ultrahigh vacuum (UHV) annealing of SiC surface has been an attractive approach
especially for semiconductor industry because the products are obtained on SiC substrates and requires no transfer

379

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

before processing devices [40,4143]. When SiC substrate is heated under UHV, silicon atoms sublimate from the
substrate. The removal of Si leaves surface carbon atoms to rearrange into graphene layers. The thickness of graphene
layers depends on the annealing time and temperature. The formation of few-layer graphene (FLG) typically
requires few minutes annealing of the SiC surface at temperature around 1200 C [44]. More recently, vapor phase
annealing has been used to produce FLG on SiC. At the expense of a higher temperature (typically 400 C above UHV
temperature) [45] this method leads to the formation of FLG on SiC with an improved thickness homogeneity [46].
Another uncertainty involves the different epitaxial growth patterns on different SiC polar face (i.e. Si-face or C-face).
Unusual rotational graphene stacking were observed in multilayers graphene grown on the C-face surface but not on
Si-face surface. Such mismatch of graphene growth process has profound effects on the physical and electronic
properties of epitaxial graphene. On the C-face, the twisted interface leads to the decoupling between different
layers of graphene, each of which behaves as a single layer [47].

II.3. CHEMICALLY DERIVED GRAPHENE

II.3.1. SYNTHESIS OF GRAPHENE OXIDE AND THE REDUCTION
Graphite oxide (GO) is usually synthesized through the oxidation of graphite using oxidants including concentrated
sulfuric acid, nitric acid and potassium permanganate based on Hummers method [48]. Compared to pristine graphite,
GO is heavily oxygenated bearing hydroxyl and epoxy groups on sp3 hybridized carbon on the basal plane, in addition
to carbonyl and carboxyl groups located at the sheet edges on sp2 hybridized carbon. Hence, GO is highly hydrophilic
and readily exfoliated in water, yielding stable dispersion consisting mostly of single layered sheets (graphene oxide).
It is important to note that although graphite oxide and graphene oxide share similar chemical properties (i.e. surface
functional group), their structures are different. Graphene oxide is a monolayer material produced by the exfoliation of
GO. Sufficiently dilute colloidal suspension of graphene oxide prepared by sonication are clear, homogeneous and
stable indefinitely. The pristine graphite sheet is atomically flat with the Van der Waals thickness of ~0.34 nm,
graphene oxide sheets are thicker due to the displacement of sp3 hybridized carbon atoms slightly above and below the
original graphene plane and presence of covalently bound oxygen atoms. Li et al. showed that the surface charges on
grapheme oxide are highly negative when dispersed in water by measuring the zeta potential due to the ionization of
the carboxylic acid and the phenolic hydroxyl groups [49]. Therefore, the formation of stable
graphene oxide colloids in water was attributed to not only its hydrophilicity but also the electrostatic repulsion.
The chemical structure of graphene oxide such as the type and distribution of oxygen-containing functional groups
have been studied using NMR 13C-labelled graphene oxide [50,51] suggesting that the basal plane of the sheet is
decorated with hydroxyl and epoxy (1,2-ether) functional groups with small amount of lactol, ester, acid and ketone
carbonyl groups at the edge.
These functional groups provide reactive sites for a variety of surface-modification reactions to develop functionalized
graphene oxide- and graphene-based materials. On the other hand, due to the disruption of the conjugated electronic
structure by these functional groups, graphene oxide was electrically insulating and contained irreversible defects and
disorders [20,52], but chemical reduction of graphene oxide could partially restore its conductivity [20,52,53] at values
orders of magnitude below that of pristine graphene.
Chemical reduction of graphene oxide sheets has been performed with several reducing agents including hydrazine
[21, 54-56], and sodium borohydrate [53, 57]. Hydrazine hydrate, unlike other strong reductants, does not react with
water and was found to be the best one in producing very thin and fine graphite-like sheets. During the reduction
process, the brown colored dispersion of grapheme oxide in water turned black and the reduced sheets aggregated and
precipitated [20,52](Fig. 2). Hydrazine takes part in ring-opening reaction with epoxides and forms hydrazino alcohols
[58].
The carboxylic acid groups were unlikely to be reduced by hydrazine and thus remained intact after hydroxyl
reduction. The adjustment of pH with ammonia solution deprotonated the carboxylic acid groups and thus the
electrostatic repulsion among the charged groups on reduced graphene oxide enabled the formation of well-dispersed
graphene colloids in water without any stabilizers. But, unless stabilized by selected surfactants, reduced graphene in
organic solvent tend to agglomerate due to their hydrophobic nature [20, 52]. Another possible route to reduce GO was
using sodium borohydride (NaBH4) [53] in aqueous solution where sodium borohydride is more effective than

380

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

hydrazine as a reductant of graphene oxide although it can be slowly hydrolyzed by water. The NaBH4 treatment
eliminated all the parent oxygen containing groups and the resultant solid became IR inactive like pure graphite.
Other chemical reduction routes including using hydroquinone [59], gaseous hydrogen (after thermal expansion) [60],
and strongly alkaline solutions [61] have also been investigated. Thermal reduction is another approach to reduce GO
to reduced graphene oxide that utilizes the heat treatment to remove the oxide functional groups from graphene oxide
surfaces [62, 63].
Recently, Dubin et al. reported a simple one-step, solvothermal reduction method to produce reduced graphene oxide
dispersion in organic solvent [64]. The solvothermally reduced graphene oxide layers remained in a stable dispersion
after the reaction. This approach provides a simple, low-temperature method to produce reduced graphene oxide.

II.3.2. SURFACE FUNCTIONALIZATION OF GRAPHENE OXIDE (GO)

The surface functionalization has taken two approaches: covalent functionalization and non-covalent functionalization.
In covalent functionalization, oxygen functional groups on graphene oxide surfaces, including carboxylic acid groups
at the edge and epoxy/hydroxyl groups on the basal plane can be utilized to change the surface functionality of
graphene oxide. Graphene oxide had been treated with organic isocyanates to give a number of chemically modified
GO.
Treatment of isocyanates reduced the hydrophilicity of graphene oxide by forming amide and carbamate esters from
the carboxyl and hydroxyl groups of graphene oxide, respectively (Fig. 3).
The subsequent addition of nucleophilic species, such as amines or alcohols, produced covalently attached functional
groups on graphene oxide via the formation of amides or esters. The resultant amine functionalized graphene oxide has
demonstrated various applications in optoelectronics [65], drug-delivery materials [66], biodevices [67], and polymer
composites [68]. The attachment of hydrophobic long, aliphatic amine groups on hydrophilic graphene oxide
improved the dispersability of modified graphene oxide in organic solvents [69], while porphyrin-functionalized
primary amines and fullerene-functionalized secondary amines introduced interesting nonlinear optical properties [70].
The amine groups and hydroxyl groups on the basal plane of graphene oxide have also been used to attach polymers
through either grafting-onto or grafting-from approaches. To grow a polymer from graphene oxide, an atom transfer
radical polymerization (ATRP) initiator was attached to graphene surfaces [71]. Besides the carboxylic acid groups,
the epoxy groups on graphene oxide can be used to attach different functional groups through a ring-opening reaction
[59].
The non-covalent functionalization of graphene oxide utilizes the weak interactions (i.e. pp interaction,Van der Waals
interactions and electrostatic interaction) between the graphene oxide and target molecules. The sp2 network on
graphene oxide provides pp interactions with conjugated polymers and aromatic compounds that can stabilize
reduced graphene oxide resulted from chemical reduction and produce functional composite materials [72-77].
During the chemical reduction of graphene oxide, reduced graphene oxide nanosheets are stabilized via the pp
interaction between aromatic molecules and reduced graphene oxide nanosheets. Aromatic molecules have large
aromatic plane and can anchor onto the reduced graphene oxide surface without disturbing its electronic conjugation,
providing stability for reduced graphene oxide.
Dye-labeled DNA has also been used to functionalize graphene oxide to detect proteins and DNA [78]. In the presence
of a target, the binding between the dye-labeled DNA and target molecule will alter the conformation of dye labeled
DNA, and disturb the interaction between the dye-labeled DNA and graphene oxide. Such interactions will release the
dye-labeled DNA from the GO, restoring of dye fluorescence.

381

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

Fig. 2. (a) Oxidation of graphite to graphene oxide and reduction to reduced graphene oxide. (b) A proposed reaction
pathway for epoxy reduction by hydrazine.

Fig. 3. Isocyanate treatment of GO where organic isocyanate reacts with the hydroxyl and carboxyl groups of the
grapheme oxide sheets.

382

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

III.

BIOAPPLICATIONS OF GRAPHENE

III.1. GRAPHENE-BASED FRET BIOSENSORS

There is increasing interest in the use of graphene for the development of FRET biosensors. FRET involves the
transfer of energy from a donor fluorophore to an acceptor fluorophore, and is one of the advanced tools available for
measuring nanometer-scale distance and changes, both in vivo and in vitro [79]. Recent theoretical and experimental
studies have shown that graphene can be a highly efficient quencher for various organic dyes and quantum dots (QDs)
[80]. Compared with organic quenchers, graphene has shown superior quenching efficiency for a variety of
fluorophores, with low background and high signal-to-noise ratio [81,82]. Graphene and GO have been reported to
interact strongly with nucleic acids (NAs) through pp stacking interactions between the ring structures in the NA
bases and the hexagonal cells of graphene and GO; whereas double-stranded DNA (dsDNA) cannot be stably adsorbed
onto the surface because of efficient shielding of nucleobases within the negatively charged dsDNA phosphate
backbone [83,84]. The development of graphene based FRET biosensors has been motivated greatly by reliance on
this particular principle and integrating it with the advantages of graphene. Here, we selectively summarize recent
progress in biosensors that integrate the super quenching property of graphene and the recognition properties of NAs
(Table 1).

Table 1. FRET biosensors fabricated with graphene-based nanomaterials

Graphene
category
Graphene

Probe type

Probe sequence

Target

ssDNA

Graphene
oxide
Graphene
oxide

ssDNA

Graphene
oxide

ssDNA
dsDNA

Graphene
oxide

ssDNA

Graphene
oxide

Hairpinstruct
ured
DNA
Aptamer

5-FAM-AATCAACTG
GGA
GAA
TGTAACTG-3
5-FAM-AGTCAGTGTGGAAAATCTCTAGC3
5-FAMTCTCTCAGTCCGTGGTAGGGCAGGTTGGGG
TGACT-3
5-FAMGGAATTCTAATGTAGTATAGTAATCCGCTC
-3
5(T)15GAGCGGATTACTATACTACATTAGAA
TTCC-3
5-FAM- TCGTTGGAGTTTGTCTG-3
5-Cy5-CCCTAATCCGCCCAC-3
5-ROX-CCTGGTGCCGTAGAT-3
5-DabcylCGACGGAGAAAGGGCTGCCACGTCG-FAM3
5-FAMCTCTCTTCTCTTCATTTTTCAACACAACACA
C-3
5-FAM-GGTTGGTGTGGTTGG-3

Graphene
oxide

Aptamer

SDBSgraphene
Graphene
oxide

Aptamer

Graphene
oxide

ssDNA

MB

and

5-DabcylCGACGGAGAAAGGGCTGCCACGTCG-Cy53
5-H2N-(T)6GCACACGCGCAC-3

383

cDNA

LO(n
M)
N/A

Ref
s
[81]

cDNA

N/A

[83]

Human
thrombin

2.0

[83]

SCV helicase

0.625

[84]

cDNA

0.1

[85]

cDNA

2.0

[86]

Silver (I) ions

[87]

Bovine
thrombin
survivin
mRNA

0.0313

[88]

N/A

[89]

200

[90]

Au
labeled
cDNA

NP-

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

III.2. DNA DETECTION

The first graphene-based FRET biosensor included a fluorescein amidite (FAM)-labeled ssDNA adsorbed onto GO
[83]. As a result of the FRET effect between FAM and GO, fluorescence is quenched rapidly; however, binding
between probe ssDNA and a complementary ssDNA alters the conformation, and consequently, releases FAMssDNA
from the GO surface and results in fluorescence recovery. Detection of cDNA is therefore realized. Similarly,
multicolor DNA analysis has been accomplished with graphene based FRET biosensors [85]. The planar GO surface
allows simultaneous quenching of multiple ssDNA probes labeled with different dyes, which leads to a multicolor
sensor for the detection of multiple DNA targets. In this case, a graphene-based FRET biosensor is able to detect
different DNA targets with various sequences by using ssDNA probes with different sequences. In another example, a
graphene-based FRET platform has been developed for detection of helicase-mediated unwinding of duplex DNA
[84]. By reliance on the preferential binding of GO to ssDNA over dsDNA, the dsDNA substrate that contains a
fluorescent dye at the end of one strand is prepared first. As helicase unwinding of dsDNA proceeds, the fluorescence
decreases and is quenched completely because of strong interaction of GO with unwound ssDNA. Helicase activity
can thus be monitored in real time.
To enhance the sequence-specific detection of target DNA, molecular beacons (MBs) have been employed to fabricate
graphene-based FRET biosensors [91]. Typically, the two ends of an MB are labeled with a fluorophore and a
quencher. MBs do not fluoresce until they have hybridized with the target NAs. The unique thermodynamics and
specificity of MBs have led to their broad application in biotechnology [92]. In studies of MB-based FRET biosensors,
graphene can serve as a nanoquencher for fluorophores as well as a nanoscaffold for MBs. The incorporation of
graphene into a MB-based FRET biosensor not only provides a more convenient synthesis/purification protocol
compared to conventional MBs, but also improves the sensitivity. As an example, GO has been employed as the
nanoquencher, with increased sensitivity and single-base mismatch selectivity for target DNA [86]. An MB-based
GO FRET biosensor has also been integrated with QDs as fluorophores owning to its broad absorption and narrow
emission spectra [92].

III.3. ION, SMALL MOLECULE, AND PROTEIN DETECTION

Aptamers are selected single-strand oligonucleotides isolated from random-sequence DNA or RNA libraries by an in
vitro selection process. Aptamers boast high specificity to a wide range of targets, which is advantageous for many
bio-analytical applications [82]. By using aptamers as probes, we can extend the targeting field of graphene-based
FRET biosensors from DNA to ions, small molecules, and proteins. Ag+ ion detection has been realized by using GO
and an Ag+-specific aptamer [87]. The target-induced conformational change of the aptamer leads to the recovery of
FAM fluorescence. Ag+ ions can be easily differentiated when some other metal ions are present with a 10-fold higher
concentration, which demonstrates a sensitive responding ability of the proposed grapheme FRET biosensor. Another
highly specific FRET sensor has been developed for detection of bovine thrombin, based on a dye-labeled aptamer
probe and grapheme [83, 88]. To obtain a good water-dispersion graphene sample, sodium dodecyl benzene sulfonate
(SDBS) has been used for the chemical reduction of graphite oxide to produce SDBS-graphene [88]. Thrombin
aptamer labeled with FAM was first incubated with SDBSgraphene. When thrombin was introduced into the
aptamer/graphene solution, obvious fluorescence recovery was observed. This is mainly due to the quadruplex
structure formed by thrombin and its aptamer, which owns the weak affinity to graphene. The graphene-based FRET
aptasensor has a sensitive detection ability for thrombin in buffer (down to 31.3 pM) and in serum solutions (Table 1).
The graphene- based FRET aptasensor has exhibited an extraordinary response in buffer and serum solutions.

III.4. GRAPHENE-BASED BIOTECHNOLOGY FOR LIVING CELL STUDIES

III.4.1. CELLULAR PROBING AND REAL-TIME MONITORING
An aptamerFAM/GO nanosheet (aptamerFAM/GO-nS) complex has been designed for in situ molecular probing of
ATP in JB6 Cl 41-5a mouse epithelial cells [93]. The aptamerFAM/GO-nS complex, coupled with a wide-field
fluorescence microscope, serves as a real-time sensing platform. ATP recognition by the ATP aptamer has been used
as amodel systemto elucidate certain properties and advantages of the GO nanosheet: (i) GO-nS can serve as a
transporter of DNA aptamers into living cells; (ii) GO-nS shows efficient protection of oligonucleotides

384

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

fromenzymatic cleavage during delivery to inter- or intracellular spaces; and (iii) GO-nS can act as a real-time sensing
platform in living cells with high fluorescence quenching efficiency [93].
The capability of graphene for DNA protection from cleavage during cellular delivery has indeed been demonstrated:
MBs can be used as oligonucleotide probes in conjunction with GO-nS to deliver DNA to HeLa cells [89].
III.4.2. GRAPHENE FET FOR LIVING CELL DETECTION
Nanomaterial-based FETs have been proven to be powerful building elements for nanoscale bioelectronic interfaces
with cells and tissues, owing to their ability to form coupled interfaces with cell membranes. Graphene-based FETs
have been reported in recent studies as promising chemical and biological sensors in living cells [94, 95]. For example,
a graphene-based FET has been used to investigate electrogenic cells [94]. The FET conductance signals that are
recorded from beating chicken embryonic cardiomyocytes yields well-defined extracellular signals with a signaltonoise ratio routinely above 4, which exceeds typical values for other planar devices. A graphene-based FET (with
active channel of 20.89.8 m) has also been used as a biosensor to detect hormonal catecholamine molecules in
neuroendocrine PC12 rat adrenal medulla cells [95]. This patterned GO film-based FET has realized the label-free and
real-time monitoring of catecholamine secretion from living cells.

III.4.3. DRUG DELIVERY AND CELL IMAGING

Another exciting area of graphene research is drug delivery in living cells. For instance, modified GO has been
investigated as a cargo for the delivery of water-soluble cancer drugs [96]. Nanoscale GO (NGO) was first
functionalized with polyethylene glycol (PEG) to render high solubility in aqueous solutions, as well as stability in
physiological solutions [97]. To enhance the loading efficiency and targeting ability of anticancer drugs, NGO can be
covalently modified with folic acid (FA) [98]. Controlled loading of two anticancer drugs, doxorubicin and CPT-11
onto the FA-conjugated NGO (FA-NGO) has been investigated. In this case, FANGO loaded with the two anticancer
drugs shows specific targeting to MCF-7 human breast cancer cells and remarkably high cytotoxicity compared to
unmodified NGO loaded with doxorubicin or irinotecan. In a final example, PEGmodified nanoscale graphene sheets
(NGSs) have been prepared, and the strong optical absorbance of NGSs in the near-infrared region has been utilized to
achieve ultra-high in vivo tumor uptake of anticancer drugs, which can be used for photothermal therapy of cancer
[99]. The behavior of PEGylated NGSs in mice has been studied by fluorescence imaging, and surprisingly high tumor
accumulation was observed. NGSs with a biocompatible coating might therefore constitute a novel type of 2D
nanomaterial with great potential in cancer therapy. With the success of the above studies, it is likely that graphenebased nanocarriers will find widespread application in biomedicine in the future.

IV.

CONCLUSIONS

It has become evident that the exceptional properties of graphene made it compelling for various engineering and
bioapplications. However, grapheme as a new material still faces many challenges ranging from synthesis and
characterization to the final device fabrication. The synthesis of graphene has made substantial progress, especially
over the past decade. Grapheme has been synthesized by a wide range of chemical synthetic procedures.
As a result of the fascinating properties of graphene, with respect to structures that can be oriented and surfaces that
can be modified, we believe that it offers some important advantages for biotechnological applications, especially in
the areas of bioelectronics, biosensors and medicine.
In this review the various synthesis processes of graphene and selectively biofunctionalization and bioapplication of
grapheme are analyzed.
ACKNOWLEDGEMENTS
Support of this work by the Payame Noor University is gratefully acknowledged.

385

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

REFERENCES
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]

J.C. Slonczewski, and P.R.Weiss. Band structure of graphite. Phys. Rev. 109:272, 1958.
A.K.Geim, K.S. Novoselov.The rise of grapheme. Nat. Mater. 6:183, 2007.
A.H.Castro Neto, F.Guinea, N.M.R. Peres, K.S.Novoselov, and A.K. Geim. The electronic properties of grapheme. Rev. Modern Phys. 81:
109, 2009.
K.Novoselov, A.Geim, S.Morozov, D. Jiang, Y. Zhang, S. Dubonos, I. Grigorieva, and A. Firsov. Electric field effect in atomically thin
carbon films. Science 306: 666, 2004.
D.S.L. Abergel, V. Apalkov, J. Berashevich, K. Ziegler, T. Chakraborty. Properties of graphene: a theoretical perspective. Adv. Phys. 59: 261,
2010.
M.J. Allen, V.C. Tung, and R.B. Kaner. Honeycomb carbon: a review of graphene. Chem. Rev. 110, 132.
Yazyev, O.V., 2010. Emergence of magnetism in graphene materials and nanostructures. Rep. Progr. Phys. 73: 056501, 2010.
A. Cresti, N. Nemec, B. Biel, G. Niebler, F. Triozon, G. Cuniberti, and S. Roche. Charge transport in disordered graphene-based low
dimensional materials. Nano Res. 1: 361, 2008.
C.W.J. Beenakker. Colloquium: Andreev reflection and Klein tunneling in graphene. Rev. Modern Phys 80: 1337, 2008.
S. Das Sarma, S. Adam, E.H. Hwang, and E. Rossi. Electronic transport in two dimensional graphene. http://arxiv.org/abs/1003.4731, 2010.
E.R. Mucciolo, and C.H. Lewenkopf. Disorder and electronic transport in grapheme. J. Phys.: Condens. Matter. 22: 273201, 2010.
K.I. Bolotin, K.J. Sikes, J. Hone, H.L. Stormer, P. Kim. Temperature-dependent transport in suspended grapheme. Phys. Rev. Lett 101:
096802, 2008.
X. Du, I. Skachko, A. Barker, and E.Y. Andrei. Approaching ballistic transport in suspended graphene. Nat. Nano 3: 491, 2008.
M.H.F. Sluiter, and Y. Kawazoe. Cluster expansion method for adsorption: application to hydrogen chemisorption on graphene. Phys. Rev. B
68: 085410, 2003.
J.O. Sofo, A.S. Chaudhari, and G.D. Barber. Graphane: a two-dimensional hydrocarbon. Phys. Rev. B 75: 153401, 2007.
M. Fujita, M. Igami, and K. Nakada. Lattice distortion in nanographite ribbons. J. Phys. Soc. Japan 66: 1864, 1997.
M.Y. Han, B. zyilmaz, Y. Zhang, P. Kim. Energy band-gap engineering of graphene nanoribbons. Phys. Rev. Lett. 98: 206805, 2007.
Z. Chen, Y.-M. Lin, M.J. Rooks, and P. Avouris. Graphene nano-ribbon electronics. Physica. E. 40: 228, 2007.
K.S. Novoselov, A.K. Geim, S.V. Morozov, D. Jiang, Y. Zhang, S.V. Dubonos, I. V. Grigorieva, A. A. Firsov.Electric field effect in
atomically thin carbon films. Science. 306: 666, 2004.
S. Stankovich, D.A. Dikin, R.D. Piner, K.A. Kohlhaas, A. Kleinhammes, Y. Jia, y. Wu, S. B. T. Nguyen, and R. S. Ruoff.Synthesis of
graphene-based nanosheets via chemical reduction of exfoliated graphite oxide. Carbon. 45: 1558, 2007.
G. Eda, G. Fanchini, M. Chhowalla. Large-area ultrathin films of reduced graphene oxide as a transparent and flexible electronic material.
Nature Nanotechnol. 3: 270, 2008.
P. Blake, P.D. Brimicombe, R.R. Nair, T.J. Booth, D. Jiang, F. Schedin, L. A. Ponomarenko, S. V. Morozov, H. F. Gleeson, E. W. Hill, A. K.
Geim, K. S. Novoselov. Graphene-based liquid crystal device. Nano Lett. 8: 1704, 2008.
Y.Hernandez, V. Nicolosi, M. Lotya, F.M. Blighe, Z. Sun, S. De, et al.. High-yield production of graphene by liquid-phase exfoliation of
graphite. Nat. Nanotechnol. 3: 563, 2008.
M. Lotya, Y. Hernandez, P.J. King, R.J. Smith, V. Nicolosi, L.S. Karlsson, et al.. Liquid phase production of graphene by exfoliation of
graphite in surfactant/water solutions. J. Am. Chem. Soc. 131: 3611, 2009.
A.A. Green, and M.C. Hersam. Solution phase production of graphene with controlled thickness via density differentiation. Nano Lett. 9:
4031, 2009.
F.L. Kang, T.Y. Zhang. Influences of H2O2 on synthesis of H2SO4-GICs. J. Phys. Chem. Solids. 57: 889, 1996.
F. Kang, T.Y. Zhang, Y. Leng. Electrochemical behavior of graphite in electrolyte of sulfuric and acetic acid. Carbon. 35: 1167, 1997.
Y.X. Pan, Z.Z. Yu, Y.C. Ou, G.H. Hu. A new process of fabricating electrically conducting nylon 6/graphite nanocomposites via intercalation
polymerization. J. Polym. Sci. Part B Polym. Phys. 38: 1626, 2000.
X. Li, G. Zhang, X. Bai, X. Sun, X. Wang, E. Wang, et al.. Highly conducting graphene sheets and LangmuirBlodgett films. Nat.
Nanotechnol. 3: 538, 2008.
J.W. May. Platinum surface LEED rings. Surf. Sci. 17:267, 1969.
J.C. Shelton, H.R. Patil, J.M. Blakely. Equilibrium segregation of carbon to a nickel (111) surface: a surface phase transition.Surf. Sci. 43:
493, 1974.
M. Eizenberg, J.M. Blakely. Carbon monolayer phase condensation on Ni (111). Surf. Sci. 82: 228, 1979.
P.R. Somani, S.P. Somani, M. Umeno. Planer nano-graphenes from camphor by CVD. Chem. Phys. Lett. 430: 56, 2006.
X. Li, W. Cai, L. Colombo, R.S. Ruoff. Evolution of graphene growth on Ni and Cu by carbon isotope labeling. Nano Lett. 9: 4268, 2009.
D. Wei, Y. Liu, Y. Wang, H. Zhang, L. Huang, G. Yu. Synthesis of N-doped graphene by chemical vapor deposition and its electrical
properties. Nano Lett. 9: 1752, 2009.
L. Qu, Y. Liu, J.-B. Baek, L. Dai. Nitrogen-doped graphene as efficient metal-free electrocatalyst for oxygen reduction in fuel cells. ACS
Nano. 4: 1321, 2010.
A.L.M. Reddy, A. Srivastava, S.R. Gowda, H. Gullapalli, M. Dubey, P.M. Ajayan. Synthesis of nitrogen-doped graphene films for lithium
battery applications. A.C.S. Nano. 4: 6337, 2010.
J.J. Wang, M.Y. Zhu, R.A. Outlaw, X. Zhao, D.M. Manos, B.C. Holoway. Free-standing subnanometer graphite sheets. Appl. Phys. Lett. 85:
1265, 2004.
J.J. Wang, M.Y. Zhu, R.A. Outlaw, X. Zhao, D.M. Manos, B.C. Holoway. Synthesis of carbon nanosheets by inductively coupled radiofrequency plasma enhanced chemical vapor deposition. Carbon. 42: 2867, 2004.

386

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

[40] I. Forbeaux, J.M. Themlin, J.M. Debever. Heteroepitaxial graphite on 6H SiC(0001): interface formation through conductionband electronic
structure. Phys. Rev. B. 58: 16396, 1998.
[41] J. Hass, W.Ad. Heer, E.H. Conrad. The growth and morphology of epitaxial multilayer graphene. J. Phys: Condens. Matter. 20: 323202, 2008.
[42] W.A. de Heer, C. Berger, X. Wu, P.N. First, E.H. Conrad, X. Li, et al.. Epitaxial graphene. Solid State Commun. 143: 92, 2007.
[43] F. Varchon, R. Feng, J. Hass, X. Li, B.N. Nguyen, C. Naud, et al.. Electronic structure of epitaxial graphene layers on SiC: effect of the
substrate. Phys. Rev. Lett. 99: 126805, 2007.
[44] J. Penuelas, A. Ouerghi, D. Lucot, C. David, J. Gierak, H. Estrade-Szwarckopt, et al.. Surface morphology and characterization of thin
graphene films on SiC vicinal substrate. Phys. Rev. B. 79: 033408, 2009.
[45] J.T. Tedesco, G.G. Jernigan, J.C. Culbertson, J.K. Hite, Y. Yang, K.M. Daniels, et al.. Morphology characterization of argon-mediated
epitaxial graphene on C-face SiC. Appl. Phys. Lett. 96: 222103, 2010.
[46] K.V. Emtsev, A. Bostwick, K. Horn, J. Jobst, G.L. Kellogg, L. Ley, et al.. Towards wafer-size graphene layers by atmospheric pressure
graphitization of silicon carbide. Nat. Mater. 8: 203, 2009.
[47] M. Sprinkle, D. Siegel, Y. Yu, J. Hicks, A. Tejeda, A. Taleb-Ibrahimi, et al. First direct observation of a nearly ideal grapheme band structure.
Phys. Rev. Lett. 103: 226803, 2009.
[48] W.O.R. Hummers. Preparation of graphite oxide. J. Am. Chem. Soc. 80: 1339, 1958.
[49] D. Li, M.B. Muller, S. Gilje, R.B. Kaner, G.G. Wallace. Processable aqueous dispersions of graphene nanosheets. Nat. Nanotechnol. 3: 101,
2008.
[50] W.W. Cai, R.D. Piner, F.J. Stademann, S. Park, M.A. Shaibat, Y. Ishii, et al. Synthesis and solid-state NMR structural characterization of 13Clabeled graphite oxide. Science. 321: 1815, 2008.
[51] W. Gao, L.B. Alemany, L. Ci, P.M. Ajayan. New insights into the structure and reduction of graphite oxide. Nat. Chem. 1: 403, 2009.
[52] S. Stankovich, R.D. Piner, X.Q. Chen, N.Q. Wu, S.T. Nguyen, R.S. Ruoff. Stable aqueous dispersions of graphitic nanoplatelets via the
reduction of exfoliated graphite oxide in the presence of poly (sodium 4-styrenesulfonate). J. Mater. Chem. 16: 155, 2006.
[53] B. Athanasios, D.G. Bourlinos, D. Petridis, T. Szabo, A. Szeri, I. Dekany. Graphite oxide: chemical reduction to graphite and surface
modification with aliphatic amines and amino acids. Langmuir. 19: 6050, 2003.
[54] H.A. Becerril, J. Man, Z. Liu, R.M. Stoltenberg, Z. Bao, Y. Chen. Evaluation of solution-processed reduced graphene oxide films as
transparent conductors. ACS Nano. 2: 463, 2008.
[55] C. Gomez-Navarro, R.T. Weitz, A.M. Bittner, M. Scolari, A. Mews, M. Burghard, et al. Electronic transport properties of individual
chemically reduced graphene oxide sheets. Nano Lett. 7: 3499, 2007.
[56] C.-G. Lee, S. Park, R.S. Ruoff, A. Dodabalapur. Integration of reduced graphene oxide into organic field-effect transistors as conducting
electrodes and as a metal modification layer. Appl. Phys. Lett. 95: 023304, 2009.
[57] H.-J. Shin, K.K. Kim, A. Benayad, S.-M. Yoon, H.K. Park, I.-S. Jung, et al. Efficient reduction of graphite oxide by sodium borohydride and
its effect on electrical conductance. Adv. Funct. Mater. 19: 1987, 2009.
[58] Z.L.l. Zalan, F. Fueloep. Chemistry of hydrazinoalcohols and their heterocyclic derivatives. Part 1: synthesis of hydrazinoalcohols. Curr. Org.
Chem. 9: 657, 2005.
[59] S. Wang, P.J. Chia, L.L. Chua, L.H. Zhao, R.Q. Png, S. Sivaramakrishnan, et al. Band-like transport in surface-functionalized highly solutionprocessable graphene nanosheets. Adv. Mater. 20: 3440, 2008.
[60] Z.-S. Wu, W. Ren, L. Gao, B. Liu, C. Jiang, H.-M. Cheng. Synthesis of high-quality graphene with a pre-determined number of layers.
Carbon. 47: 493, 2009.
[61] X. Fan, W. Peng, Y. Li, X.Li, S. Wang, G. Zhang, et al. Deoxygenation of exfoliated graphite oxide under alkaline conditions: a green route to
graphene preparation. Adv Mater. 20: 4490, 2008.
[62] H.C. Schniepp, J.L. Li, M.J. McAllister, H. Sai, M. Herrera-Alonso, D.H. Adamson, et al. Functionalized single graphene sheets derived from
splitting graphite oxide. J. Phys. Chem. B. 110: 8535, 2006.
[63] M.J. McAllister, J.-L. Li, D.H. Adamson, H.C. Schniepp, A.A. Abdala, J.Liu, et al. Single sheet functionalized graphene by oxidation and
thermal expansion of graphite. Chem. Mater. 19: 4396, 2007.
[64] S. Dubin, S. Gilje, K. Wang, V.C. Tung, K. Cha, A.S. Hall, et al. A one-step, solvothermal reduction method for producing reduced graphene
oxide dispersions in organic solvents. ACS Nano. 4: 3845, 2010.
[65] Y. Xu, Z. Liu, X. Zhang, Y. Wang, J. Tian, Y. Huang, et al. A graphene hybrid material covalently functionalized with porphyrin: synthesis
and optical limiting property. Adv. Mater. 21: 1275, 2009.
[66] Z. Liu, J.T. Robinson, X. Sun, H. Dai. PEGylated nanographene oxide for delivery of water-insoluble cancer drugs. J. Am. Chem.Soc. 130:
10876, 2008.
[67] N. Mohanty, V. Berry. Graphene-based single-bacterium resolution biodevice and DNA transistor: interfacing grapheme derivatives with
nanoscale and microscale biocomponents. Nano Lett. 8: 4469, 2008.
[68] L. M. Veca, F. Lu, M. J. Meziani, L. Cao, P. Zhang, G. Qi, L. Qu, M. Shrestha, Y.-P. Sun. Polymer Functionalization and Solubilization of
Carbon Nanosheets. Chem. Commun. 2565, 2009.
[69] S. Niyogi, E. Bekyarova, M.E. Itkis, J.L. McWilliams, M.A. Hamon, R.C. Haddon. Solution Properties of Graphite and Graphene. J. Am.
Chem. Soc. 128: 7720, 2006.
[70] Z.-B. Liu, Y.-F. Xu, X,-Y. Zhang, X.-L. Zhang, Y.-S. Chen, J.-G. Tian. Porphyrin and Fullerene Covalently Functionalized Graphene Hybrid
Materials with Large Nonlinear Optical Properties. J. Phys. Chem. B. 113: 9681, 2009.
[71] M. Fang, K. Wang, H. Lu, Y. Yang, S. Nutt. Covalent polymer functionalization of graphene nanosheets and mechanical properties of
composites. J. Mater. Chem. 19: 7098, 2009.
[72] H. Bai, Y. Xu, L. Zhao, Y. Hou. Non-covalent functionalization of graphene sheets by sulfonated polyaniline. Chem. Commun.13: 1667,
2009.
[73] A. Chunder, J. Liu, L. Zhai. Reduced graphene oxide/poly (3-hexylthiophene) supramolecular composites. Macromol. Rapid. Commun. 31:
380, 2010.

387

Mohammad Hakimi and Paransa Alimard, World Applied Programming, Vol (2), No (6), June 2012.

[74] X. Qi, K.-Y. Pu, X. Zhou, H. Li, B. Liu, F. Boey, et al. Conjugated-polyelectrolyte-functionalized reduced graphene oxide with excellent
solubility and stability in polar solvents. Small. 6: 663, 2010.
[75] R. Hao, W. Qian, L. Zhang, Y. Hou. Aqueous dispersions of TCNQ-anion-stabilized graphene sheets. Chem. Commun. 48: 6576, 2008.
[76] A. Chunder, T. Pal, S.I. Khondaker, L. Zhai. Reduced graphene oxide/copper phthalocyanine composite and its optoelectrical properties. J.
Phys. Chem. C. 114: 15129, 2010.
[77] J. Geng, H.-T. Jung. Porphyrin functionalized graphene sheets in aqueous suspensions: from the preparation of grapheme sheets to highly
conductive graphene films. J. Phys. Chem. C. 114: 8227, 2010.
[78] C.-H. Lu, H.-H. Yang, C.-L. Zhu, X. Chen, G.-N. Chen. A graphene platform for sensing biomolecules. Angew. Chem. Int. Ed. 48: 4785,
2009.
[79] P.R. Selvin. The renaissance of fluorescence resonance energy transfer. Nat. Struct. Biol. 7: 730, 2000.
[80] D.Chen, L. Tang, J. Li. Graphene-based materials in electrochemistry. Chem. Soc. Rev. 39: 3157, 2010.
[81] Z.W. Tang, , H. Wu, J.R. Cort, G.W. Buchko, Y. Zhang, Y. Shao, I.A. Aksay, J. Liu, Y. Lin. Constraint of DNA on functionalized grapheme
improves its biostability and specificity. Small. 6: 1205, 2010.
[82] Y. Lu, J.W. Liu. Functional DNA nanotechnology: emerging applications of DNAzymes and aptamers. Curr. Opin. Biotechnol. 17: 580, 2006.
[83] C.H. Lu, H.H. Yang, C. L. Zhu, X. Chen, G.N. Chen. A graphene platform for sensing biomolecules. Angew. Chem. Int. Ed. 48: 4785, 2009.
[84] H. Jang, Y. K. Kim, H. M. Kwon, W. S. Yeo, D. E. Kim, D. H. Min. A graphene-based platform for the assay by helicase. Angew. Chem. Int.
Ed. 49: 5703, 2010.
[85] S.J. He, B. Song, D. Li, C. Zhu, W. Qi, Y. Wen, L. Wang, S. Song, H. Fang and C. Fan. A graphene nanoprobe for rapid, sensitive, and
multicolor fluorescent DNA analysis. Adv. Funct. Mater. 20: 453, 2010.
[86] C.H. Lu, J. Li, J.J. Liu, H.H. Yang, X. Chen, G.N. Chen. Increasing the sensitivity and single-base mismatch selectivity of the molecular
beacon using graphene oxide as the nanoquencher. Chem. Eur. J. 16: 4889, 2010.
[87] Y.Q. Wen, F. Xing, S. He, S. Song, L. Wang, Y. Long, D. Li, C. Fan. A graphene-based fluorescent nanoprobe for silver (I) ions detection by
using graphene oxide and a silver-specific oligonucleotide. Chem. Commun. 46: 2596, 2010.
[88] H.X. Chang, et al. Graphene fluorescence resonance energy transfer aptasensor for the thrombin detection. Anal. Chem. 82: 2341, 2010.
[89] C.H. Lu, C.L. Zhu, J. Li, J.J. Liu, X. Chen, H.H. Yang. Using graphene to protect DNA from cleavage during cellular delivery. Chem.
Commun. 46: 3116, 2010.
[90] F. Liu, J. Y. Choi, T. S. Seo. Graphene oxide arrays for detecting specific DNA hybridization by fluorescence resonance energy transfer.
Biosens. Bioelectron. 25: 2361, 2010.
[91] N.E. Broude. Stem-loop oligonucleotides: a robust tool for molecular biology and biotechnology. Trends. Biotechnol. 20: 249, 2002.
[92] H.F. Dong, et al. Fluorescence resonance energy transfer between quantum dots and graphene oxide for sensing biomolecules. Anal. Chem.
82: 55115517, 2010.
[93] Y. Wang, Z.H. Li, D.H. Hu, et al. Aptamer/graphene oxide nanocomplex for in situ molecular probing in living cells. J. Am. Chem. Soc. 132:
9274, 2010.
[94] T. Cohen Karni, Q. Qing, Q. Li, Y. Fang, C. M. Lieber. Graphene and nanowire transistors for cellular interfaces and electrical recording.
Nano Lett. 10: 1098, 2010.
[95] Q.Y. He, H.G. Sudibya, Z. Yin, S. Wu, H. Li, F. Boey, W. Huang, P. Chen, H. Zhang. Centimeter-long and large-scale micropatterns of
reduced graphene oxide films: fabrication and sensing applications.ACS Nano. 4: 3201, 2010.
[96] Z. Liu, J.T. Robinson, X. Sun, H. Di. PEGylated nanographene oxide for delivery of water-insoluble cancer drugs. J. Am. Chem. Soc. 130:
10876, 2008.
[97] X.M. Sun, Z. Liu , K. Welsher, J.T. Robinson, A. Goodwin, S. Zaric, H. Dai. Nano-graphene oxide for cellular imaging and drug delivery.
Nano Res. 1: 203,2008.
[98] L.M. Zhang, J.G. Xia, Q.H. Zhao, et al. Functional graphene oxide as a nanocarrier for controlled loading and targeted delivery of mixed
anticancer drugs.Small. 6: 537, 2010.
[99] K. Yang, S. Zhang, G. Zhang, et al. Graphene in mice: ultrahigh in vivo tumor uptake and efficient photothermal therapy. Nano Lett. 10: 3318,
2010.

Mohammad Hakimi received the B. Sc degree in chemistry from the Ferdowsi University of Mashhad, Iran in
1993 and the Ph. D. degree in inorganic chemistry from Ferdowsi University of Mashhad in 2003. He has
published over 40 peer-reviewed journal papers and contributed to more than 30 conference papers and
presentations. He was collaborated in chemistry group of Newcastel University during 2008. His research
activities include synthesis of Co, Cu, Ag, Au and Cd complexes in low oxidation, metal triazole and triazine
complexes, Amino alcohols complexes, mixed ligand complexes, nano polyoxometales & theirs catalysis and
macrocyclic chemistry. He has published three books in advance inorganic chemistry and inorganic chemistry
issue one and two during 2007 to 2011.

Paransa Alimard was born in 1981 in Iran. She achieved a Masters degree in inorganic chemistry at the Islamic
Azad University of Shahr- e-Rey Branch in 2011. At present, she is in the first year of her Ph.D thesis at Payame
Noor University. Her research interests are in the synthesis of graphene and its chemical applications.

388