J Nanopart Res (2012) 14:1236

DOI 10.1007/s11051-012-1236-3

RESEARCH PAPER

Biosynthesis of selenium nanoparticles by Pantoea

agglomerans and their antioxidant activity
S. K. Torres V. L. Campos C. G. Leon
S. M. Rodrguez-Llamazares S. M. Rojas
M. Gonzalez C. Smith M. A. Mondaca

Received: 9 April 2012 / Accepted: 6 October 2012

Springer Science+Business Media Dordrecht 2012

Abstract The bio-reduction of selenite (Se (IV))

generates nanoparticles with sizes ranging between 30
and 300 nm. Biologic properties of Se nanoparticles,
e.g., antioxidant activity, are dependent on the nanoparticle size; smaller particles have greater activity. In
this study, the bio-reduction of selenite by Pantoea
agglomerans strain UC-32 under aerobic conditions
and room temperature to produce bioactive Se nano-

S. K. Torres  V. L. Campos (&)  C. G. Leon 

M. A. Mondaca
Laboratorio de Microbiologa Ambiental, Departamento
de Microbiologa, Universidad de Concepcion,
P.O. Box 160-C, Correo 3, Concepcion, Chile
e-mail: vcampos@udec.cl
S. M. Rodrguez-Llamazares
Centro de Investigacion de Polmeros Avanzados (CIPA),
Conicyt-Regional R08C1002 Cordillera Av. 2634, Parque
Industrial Coronel, Coronel, P.O. Box 4051, Post 3
Concepcion, Chile
S. M. Rojas  M. Gonzalez
Laboratorio de Fisiologa Vascular, Departamento de
Fisiologa, Universidad de Concepcion, P.O. Box 160-C,
Correo 3, Concepcion, Chile
C. Smith
Departamento de Microbiologa, Universidad de
Concepcion, P.O. Box 160-C, Correo 3,
Concepcion, Chile

particles smaller than 100 nm was demonstrated.

Isolation and purification of the nanoparticles was
performed by alkaline lysis. These purified nanoparticles were stabilized with L-cysteine (4 mM). The
visualization and characterization of nanoparticles
were performed by transmission electron microscopy,
energy dispersive X-ray spectroscopy, and scanning
electron microscopy. The antioxidant activity of
nanoparticles was determined by production of reactive oxygen species using human umbilical vein
endothelial cells. Transmission electron microscopy
images showed the accumulation of spherical selenium nanoparticles as intracellular and extracellular
deposits. The size of Se nanoparticles varied with
incubation time. Amorphous Se nanoparticles with
size in the order of 100 nm were obtained before 24 h
of incubation; but, at 24 h of incubation, the size of the
majority of the nanoparticles was in the desirable order
of 100 nm and they were not aggregated. Energy
dispersive spectroscopy spectra indicated that nanoparticles were composed entirely of selenium. Antioxidant activity of stabilized selenium nanoparticles
demonstrated high antioxidant activity when compared to selenite and selenium nanoparticles without
stabilization. Stabilized biologically synthetized selenium (0) nanoparticles with size less than 100 nm
have a potential application as a food additive with
antioxidant properties relevant to human health.
Keywords Se nanoparticles  Bio-reduction 
Selenite  Antioxidant activity

123

Page 2 of 9

Introduction
Selenium (Se), as a functional material, is an important
semiconductor and photoelectric element due to its
special physical properties (Zhang et al. 2011).
Therefore, Se is used in many applications ranging
from photocells, photographic exposure meters and
solar cells to semiconductor rectifiers.
When amorphous, Selenium nanoparticles (SeNPs), possess unique photoelectric, semiconducting and
X-ray-sensing properties (Dhanjal and Cameotra
2010). The SeNPs also have Biologic activity and
good adsorptive ability due to interaction between the
nanoparticles and NH, C=O, COO, and CN functional groups of proteins (Zhang et al. 2004). Studies
on the biological toxicity of selenium and its nanoforms revealed that SeNPs showed efficiency to
increase the activities of both glutathione peroxidase
and thioredoxin reductase (Okuno et al. 2001; Zhang
et al. 2005). In addition, Gao et al. (2002) and Wang
et al. (2007), demonstrated the antioxidant properties
of selenium hollow spherical nanoparticles, reducing
the risk of selenium toxicity.
Recently, there has been increasing interest in the
synthesis of nanoparticles using biologic systems,
leading to the development of various biomimetic
approaches (Mohampuria et al. 2008). However, most
methods used to synthesize SeNPs are characterized
by elevated temperatures and high pressures and are
hazardous to the environment (Zhang et al. 2011).
Oremland et al. (2004) reported the biogenesis of
SeNPs under anaerobic conditions. Se (0) nanoparticles formed by the Se-respiring bacteria, such as
Sulfurospirillum barnesii, Bacillus selenitireducens,
and Selenihalanaerobacter shriftii, are structurally
unique when compared to Se (0) formed by chemical
synthesis. However, anaerobic conditions have limitations, such as culture conditions and isolate characteristics that make biosynthesis processes tedious and
challenging (Prakash et al. 2009).
Selenium-tolerant aerobic microorganisms may
provide an opportunity to overcome these limitations
in the biosynthetic processes. Very few studies have
reported the aerobic formation of SeNPs by microorganisms (Klonowska et al. 2005; Hapuarachchi et al.
2004). The generation of SeNPs by soil bacteria
Pseudomonas aeruginosa and Bacillus sp. under aerobic conditions has recently been reported; however,
these studies only include the partial characterization of

123

J Nanopart Res (2012) 14:1236

selenium nanospheres (Prakash et al. 2009; Yadav et al.

2008).
The characterization of the nanospheres in relation
to size is of great importance, both in industrial and
biologic activities. Recent reports describe that Se (0)
nanoparticles with a size under 100 nm have a greater
bioavailability (Dhanjal and Cameotra 2010; Thakkar
et al. 2009). In addition, other studies mention that a
smaller size increases the ability to trap free radicals
with greater antioxidant effect (Huang et al. 2003).
Peng et al. (2007) mentioned that the size of Se (0)
nanoparticles plays an important role in their biologic
activity and, as expected, 5200 nm nano-Se can
directly scavenge free radicals in vitro in a sizedependent fashion.
The aim of this work was to characterize the SeNPs
obtained from the transformation of selenite to
elemental selenium by Pantoea agglomerans, under
aerobic conditions, and to evaluate their antioxidant
activity.

Materials and methods

Bacterial strains isolation
Sediments (upper 2 cm) were collected from Camarones River, Atacama Desert (Northern Chile). Sediment samples were kept at 4 C during transportation
to laboratory facilities. Bacteria were isolated by
adding 1 g of homogenized sediments to 10 mL of
NaCl (0.85 %) and shaking at 100 rpm for 5 min.
Sediments were diluted and 0.1 mL aliquots were
plated onto R2A agar with sodium selenite (0.5 mM)
(Sigma-Aldrich Chemical Co.), and incubated at
25 C for 48 h (Escalante et al. 2009). After growth,
a significant number of different colonies of red color
were isolated (Klonowska et al. 2005), Selenium
tolerance levels were studied according to Escalante
et al. (2009) and the one showing the greatest tolerance
to Se was selected.
Bacterial identification
The bacterial strain selected, as described above, was
identified according to its biochemical properties
using RapID ONE System (Remel). Then, PCR
amplification of 16S rRNA gene was performed. For
the 16S rRNA gene analysis, the genomic DNA was

J Nanopart Res (2012) 14:1236

extracted using Ultra Clean Microbial DNA isolation

Kit (MoBio Laboratories) followed by PCR amplifications. The PCR product was purified using Ultra
Clean 15 kit (MoBio Laboratories) directly used for
sequencing with the bacteria universal primers EUB
9-27 (GAGTTTGATCCTGGCTCAG) and EUB 1542
(AGAAAGGAGGTGATCCAGCC). The sequence
obtained was BLAST searched and compared with
sequences of other closely related species retrieved
from the GenBank database.
Culture and inoculum
The selected bacterial strain (hereon named UC-32)
was maintained on agar slants at 4 C and subcultured
every 5 days. The inoculum was cultured in 100 mL
of tryptic soy broth (TSB) using 250 mL Erlenmeyer
flasks (Wang et al. 2010).
Bacterial growth under selenite stress
UC-32 cells were grown in TSB supplemented with
1 mM sodium selenite (Sigma-Aldrich Chemical Co.).
The medium was inoculated with 1 % (V/V) of an
overnight culture and incubated at 25 C. Samples
were aseptically withdrawn at different time intervals.
The appearance of red color in the culture flasks
suggested the formation of Se (0) (Klonowska et al.
2005). Escherichia coli K-12 was used as negative
control.

Page 3 of 9

initial concentration of L-cysteine of 4 mM. The

solution was stirred at 120 rpm for 24 h at room
temperature. Then, the solution was centrifuged at
4,100 rpm for 5 min to separate and eliminate Lcysteine residues not bound to the nanoparticles (Chen
et al. 2009). The pellet obtained was finally resuspended in 10 mL of M199.
Transmission electron microscopy (TEM)
Cells grown in the absence or at different time intervals
in the presence of 1 mM sodium selenite (1 mM) were
harvested and washed with distilled water. Washed
cells were collected as pellet (after centrifuging at
5,000 rpm for 10 m) and fixed (Oremland et al. 2004).
Transmission electron micrographs were recorded
using a JEOL JSM 1200EX-II transmission electron
microscope equipped with electron diffraction pattern.
The mean diameter of SeNPs was measured from the
images obtained by TEM (Tam et al. 2010).
Energy dispersive X-ray spectroscopy (EDS)
analysis
Analysis of SeNPs composition was carried by EDS
microanalysis. The samples were processed by a
similar method to that used for TEM studies. The
selected areas within SEM sections were subjected to
elemental composition analysis using an EDX microanalysis system coupled to a transmission electron
microscope (Dhanjal and Cameotra, 2010).

Recovery of SeNPs from the culture

Scanning electron microscopy (SEM)
Se (0) particles were removed from the cellular
material by a procedure modified from Oremland
et al. (2004). Briefly, cell suspensions containing Se
(0) were sonicated in an ultrasonic bath (Elma/S30) at
100 W for 2 min and centrifuged at 10,0009g for
10 min. Pellets were resuspended, sonicated, and
centrifuged (10,0009g) sequentially in SDS 0.1 %/
1 M NaOH and finally the cleaned Se (0) was
resuspended in distilled water. Se (0) nanoparticles
were analyzed by transmission electron microscopy
(TEM) and scanning electron microscopy (SEM).
Stabilization of SeNPs
The pellet of purified nanoparticles was resuspended
in 10 mL of 199 cell culture medium (M199) with an

Strain UC-32 was grown in TSB supplemented with

sodium selenite (1 mM) at 25 C. Then 24 h of
incubation, samples were observed using a JEOL JSM
6380LV scanning electron microscope. Treatment of
the samples involves washing, fixing, and drying of
cells. Harvested cells were washed three times with
phosphate buffered saline (PBS, pH 7.4) and layered
onto polylysine coated cover slips. Fixation was done
with modified Karnovskys fixative (2 % paraformaldehyde and 3 % glutaraldehyde in 0.1 M sodium
phosphate buffer, pH 7.4). Cells were again washed
with PBS and distilled water. Fixed cells were dehydrated through a series of alcohol dehydration steps
(30, 50, 70, 90, and 100 %) and finally layered with
t-butyl alcohol for freeze drying and were sputter

123

Page 4 of 9

coated. The samples were coated with gold using an

Edwards S 150 Sputter coater. The samples were
visualized under SEM.
Antioxidant activity of SeNPs
To study the biologic effect (antioxidant properties) of
the stabilized SeNPs, human umbilical vein endothelial cells (HUVEC) were isolated using 0.25 mg/mL
Clostridium histolyticum Type II Collagenase (Boehringer, Mannheim, FRG) digestion from umbilical
cord veins (HUVEC) and cultured up to confluence
(Gonzalez et al. 2004; Casanello et al. 2009). Experiments were performed with normal (5 mM) or high Dglucose (25 mM) in the presence or absence (24 h) of
sodium selenite, Se nanoparticles, or Se-stabilized
nanoparticles. After this incubation period, cells were
exposed to 1 lM of the fluorescent probe 20 70 diclorodihidroflurorescena diacetate acetyl ester
(DCF, Molecular Probes, Leiden, England) for
30 min, which is sensitive to oxidation by increasing
reactive oxygen species (ROS) (Ye et al. 2003). The
fluorescence was determined using a microplate reader
(Bio-Rad) at 485-nm excitation and 583-nm emission.
Statistical analysis
Data are presented as the mean SD. The differences
between the groups were examined by MannWhitney-test. A p value of less than 0.05 was considered
statistically significant.

Results and discussion

Nine strains, isolated from the Atacama Desert, were able
to grow in the present of 4 mM Se (IV) and only one
bacterial strain, named UC-32, was able to tolerate
concentrations above 8 mM. The UC-32 strain was
identified by biochemical profiles and 16S rRNA gene
sequencing (accession number FR863613). The
sequence was compared to sequences available in the
GenBank by the BLAST application. The closest GenBank matches of the DNA sequences identified UC-32 as
P. agglomerans, confirmed with 100 % similarity.
The reduction of Se (IV) to Se (0) by P. agglomerans was detected by the red colored precipitate in the
culture, indicating the reduction of selenite and/or
selenate to red Se (0) precipitate, as proposed by

123

J Nanopart Res (2012) 14:1236

Klonowska et al. (2005) and Garbisu et al. (1996). Red

precipitates were not detected in cultures of E. coli
K-12, used as negative control (data not shown).
Transmission electron microscopy of the culture
grown in the presence of selenite demonstrated the
presence of the spherical intracellular and extracellular deposits of SeNPs (Fig. 1bd). In addition, nanoparticles were not detected in the culture without
selenite (Fig. 1a). After 15 h of incubation, nanoparticles were detected only inside bacterial cells
(Fig. 1b). After 20 and 24 h of incubation it was
observed that nanoparticles were released from the
bacterial cells (Fig. 1c, d). This is demonstrated by the
observations of TEM longitudinal sections of cells
showing the intracellular presence of nanoparticles
during the early stages of incubation (Fig. 2a) and
their expulsion after 20 h of incubation, possibly
through a modification of the membrane (Fig. 2b).
These observations allow us to propose that the
reduction of Se (IV) to Se (0) by P. agglomerans
occurs at the intracellular level.
A similar report was published by Belzile et al.
(2006), describing the possible intracellular reduction
of selenium and subsequent expulsion of the compound. Moreover, Dhanjal and Cameotra (2010)
proposed a mechanism for biogenesis of nanoparticles
involving a reductase enzyme associated with the
membrane, able to produce reduced Se (0) through
electron transport enzymes.
The size of SeNPs depended on the incubation
times, showing a direct relationship between incubation time and the nanoparticle size. Increasing the
incubation time increases the size of SeNPs detected
(Fig. 1c, d). Similar results were reported by Tam et al.
(2010) in the generation of Se (0) nanoparticles by
Shewanella sp HN-41 showing an increase of size and
amount of nanoparticles in time.
Scanning electron microscopy associated to EDS
analysis showed the presence of bacillary bacteria and
of nanoparticles (Fig. 3a). EDS derived from a
nanoparticle indicated that it was composed entirely
of selenium (Fig. 3b). Other peaks were detected for
Na and Cl, salt of the culture medium (0.85 % NaCl
saline) with which the samples were washed. Also, C
and O peaks associated with the cellular exudate were
detected (Fig. 3b).
Since Huang et al. (2003) reported the relationship
between size of nanoparticles and their biologic
activity; we determined the size distribution of

J Nanopart Res (2012) 14:1236

Page 5 of 9

Fig. 1 TEM images of the Se nanoparticles produced by P. agglomerans in TSB Medium. a Control cells grown in TSB without
selenite for 24 h; bd cells grown in TSB plus 1 mM selenite after 15, 20, and 24 h incubation, respectively

Fig. 2 TEM images of longitudinal sections of P. agglomerans cells grown in the presence of 1 mM selenite. a 10 h of incubation
b 24 h of incubation. Arrows indicate the presence of nanoparticles

nanoparticles after different incubation times (Fig. 4).

In our work, the size of particles purified from the
culture incubated for15 h varied with an average
between 90 and 110 nm (Fig. 4a). At 20 h of incubation, there was an increase of nanoparticles in the
range of 100120 nm (Fig. 4b) being more apparent
after 24 h incubation (Fig. 4c) where a decrease of
particles of other sizes is evident. These results show
that 2024 h of incubation produces nanoparticles of
the size optimal for biologic activity (Dhanjal and
Cameotra 2010). In addition, studies conducted by

Fesharaki et al. (2009), in Klebsiella pneumoniae,

reported nanoparticles of larger size (245 nm) than
those of P. agglomerans after 24 h of incubation
reported here. Zhang et al. (2004) used SeNPs below
200 nm, chemically synthesized, for the investigation
of size effect, demonstrating that SeNPs in different
sizes (5200 nm) have equal capacity in the induction
of seleno-enzymes in cultured cells and in mice.
Purified Se (0) nanoparticles were observed by
TEM. The results demonstrate that in aqueous solution,
the nanoparticles have variable sizes and are dispersed

123

Page 6 of 9

J Nanopart Res (2012) 14:1236

Fig. 3 SEMEDS analysis. a SEM image of Se nanoparticles formed by P. agglomerans grown in the presence of 1 mM selenite and
b EDS of the particle indicated by an arrow in a

Fig. 4 Size distribution of SeNPs obtained from P. agglomerans cultures in the presence of 1 mM selenite. a 15 h, b 20 h and c 24 h of
incubation

(Fig. 5a). In addition, analysis of the structure of the

nanoparticles by selected area electron diffraction
patterns (Fig. 5b) indicated that the nanoparticles have

123

an amorphous structure of the type that is characteristic

of elemental selenium obtained by biologic reduction,
as indicated Burriel et al. (1994).

J Nanopart Res (2012) 14:1236

Page 7 of 9

Fig. 5 TEM images a and selected area electron diffraction (SAED) patterns b of synthesized SeNPs

Furthermore, the purification and subsequent analysis

of intracellular nanoparticles by electron microscopy
demonstrated that they have smaller sizes than those
found in the extracellular space since in this space the
nanoparticles agglomerate and lose their shape, increasing in size. Similar results were reported by Dhanjal and
Cameotra (2010) for Bacillus cereus, detecting larger
SeNPs in the extracellular space. Therefore, the purification involving bacterial lysis allows to obtain the
smaller nanoparticles found in the intracellular space.
In this study, we found that after 20 h of incubation,
nanoparticles obtained had sizes in the order of 100 nm.
The size of these nanoparticles and their surface
modification with a stabilizing agent provides Se
nanoparticles with desirable biologic properties. The
aminoacid L-cysteine has proven effective as stabilizing
agent for nanoparticles due to the presence of the SH
group in its structure. (Xue et al. 2011). SEMEDS
analysis showed that the stabilization is produced by the
anchoring of the thiol group of cysteine to the surface of
the nanoparticles (Fig. 6). Thus, for example, by chemical synthesis, Li et al. (2010) obtained crystalline SeNPs
using L-cysteine as reducing agent and stabilizer,

demonstrating that the optimal selenite and cysteine

proportion was 1:4, respectively. In this way, we
obtained nanoparticles with diameters of 100 nm. The
disadvantage of chemical synthesis using L-cysteine as a
reducing agent is the obtention of nanoparticles with
amorphous non-structural pattern, while pattern is of
importance for different applications.
Increased extracellular D-glucose induces an increase
in fluorescence resulting from intracellular accumulation
of ROS, whereas this increase was not observed when
cells were preincubated with selenite, nanoparticles, and
cysteine. When cells were preincubated with cysteinefunctionalized nanoparticles, the level of fluorescence
decreased to a value still lower than in the untreated cells
(control) (Fig. 7). The determination of the antioxidant
activity of stabilized nanoparticles indicated a decrease
in fluorescence resulting from the oxidation of intracellular DCF. This shows that when human endothelial cells
treated with stabilized nanoparticles, it induces a reduction in oxidative stress generated by an experimental
physiopathological condition, as is the increase in
extracellular concentrations of D-glucose. Mishra et al.
(2005) reported that stabilized nanoparticles increased

Fig. 6 SEM image a and spectrum EDX b of SeNPs stabilized

123

Page 8 of 9

Fig. 7 ROS synthesis determined by the oxidation of the

fluorescent probe dichlorofluorescein (DCF) in HUVEC preincubated with selenite, nanoparticles, functionalized nanoparticles, and cysteine, and displayed (24 h) at 5 or 25 mM Dglucose. The results are expressed as mean values SE.
**p B 0.005 versus control 5 mM D-glucose; &p = 0.009
versus control 25 mM D-glucose; #p = 0.002 versus control
25 mM D-glucose (n = 5)

biologic activity when compared to non-stabilized

selenite. In addition, Li et al. (2011) indicated that the
functionalized nanoparticles showed a higher antioxidant
activity by inhibiting the formation of free radicals.
This work demonstrated the antioxidant activity of
biologically synthesized, L-cysteine-stabilized SeNPs
by P. agglomerans. Since most of the studies have
focused on cell lines derived from hepatocytes, this is
the first work reporting the potential biologic effect of
nanoparticles using primary cultures of umbulical vein
endothelial cells (HUVEC) as model.
In conclusion, P. agglomerans has the ability to
produce amorphous SeNPs under aerobic conditions
with a size optimal for biotechnological use (such as
trapping free radicals in the induction of selenoenzymes) after at least 20 h of incubation. These
results are of great importance due to the low culture
requirements of UC-32 strain with the subsequent low
cost of biologically active SeNPs production.
Acknowledgments The authors acknowledge the assistance
of the staff of Electron Microscopy Laboratory of the University
of Concepcion, Chile. This work was supported by DIUC208.036.035-1.0 (Chile), Proyecto Basal Conicyt-Regional
R08C1002 Chile), and FONDECYT 11100192 (Chile).

References
Belzile N, Wu J, Chen Y, Appanna VD (2006) Detoxification of
selenite and mercury by reduction and mutual protection in
the assimilation of both elements by Pseudomonas fluorescens. Sci Total Environ 367:704714

123

J Nanopart Res (2012) 14:1236

Burriel F, Lucena F, Arribas S, Hernandez J (1994) Qumica
analtica cualitativa. Paraninfo, Madrid
Casanello P, Krause B, Torres E, Gallardo V, Gonzalez M,
Prieto C, Escudero C, Faras M, Sobrevia L (2009)
Reduced L-arginine transport and nitric oxide synthesis in
human umbilical vein endothelial cells from intrauterine
growth restriction pregnancies is not further altered by
hypoxia. Placenta 30:625633
Chen Z, Shen Y, Xie A, Zhu J, Wu Z, Huang F (2009) L-Cysteine-assisted controlled synthesis of selenium nanospheres and nanorods. Cryst Growth Des 9:13271333
Dhanjal S, Cameotra S (2010) Aerobic biogenesis of selenium
nanospheres by Bacillus cereus isolated from coalmine
soil. Microb Cell Fact 9:111
Escalante G, Campos VL, Valenzuela C, Yanez J, Zaror C,
Mondaca MA (2009) Arsenic resistant bacteria isolated
from arsenic contaminated river in the Atacama Desert
(Chile). Bull Environ Contam Toxicol 83:657661
Fesharaki P, Nazari P, Shakibaie M, Rezaie S, Banoee M, Abdollahi M, Reza A (2009) Biosynthesis of selenium nanoparticles using Klebsiella pneumoniae and their recovery
by a simple sterilization process. Braz J Microbiol
41:461466
Gao X, Zhang J, Zhang L (2002) Hollow sphere selenium
nanoparticles. Their in vitro anti-hydroxyl radical effect.
Adv Mater 14:290293
Garbisu C, Ishii-Terrance T, Buchanan B (1996) Bacterial
reduction of selenite to elemental selenium. Chem Geol
132:199204
Gonzalez M, Flores C, Pearson JD, Casanello P, Sobrevia L
(2004) Cell signalling-mediating insulin increase of
mRNA expression for cationic amino acid transporters 1
and 2, and membrane hyperpolarization in human umbilical vein endothelium. Pflugers Arch Eur J Physiol
448:383394
Hapuarachchi S, Swearingen J, Chasteen T (2004) Determination of elemental and precipitated selenium production by a
facultative anaerobe grown under sequential anaerobic/
aerobic conditions. Process Biochem 39:16071613
Huang B, Zhang J, Hou J, Chen C (2003) Free radical scavenging efficiency of Nano-Se in vitro. Free Radic Bio Med
35:805813
Klonowska A, Heulin T, Vermeglio A (2005) Selenite and
Tellurite Reduction by Shewanella oneidensis. Appl
Environ Microbiol 71:56075609
Li Q, Chen T, Yang F, Liu J, Zheng W (2010) Facile and controllable one-step fabrication of selenium nanoparticles
assisted by L-cysteine. Mater Lett 64:614617
Li Y, Li X, Wong Y, Chen T, Zhang H, Liu C, Zheng W (2011)
The reversal of cisplatin-induced nephrotoxicity by selenium nanoparticles functionalized with 11-mercapto-1undecanol by inhibition of ROS-mediated apoptosis. Biomaterials 32:90689076
Mishra B, Priyadarsini K, Mohan H (2005) Formation of redox
active nanoselenium on reactions of oxiding free radicals
with selenourea. Found Day 273:262267
Mohampuria P, Rana N, Kumar Y (2008) Biosynthesis of
nanoparticles: technological concepts and future applications. J Nanopart Res 10:507517
Okuno T, Kubota T, Ueno H, Nakamuro K (2001) Contribution
of enzymic [alpha], [gamma]-elimination reaction in

J Nanopart Res (2012) 14:1236

detoxification pathway of selenomethionine in mouse liver.
Toxicol Appl Pharmacol 176:1823
Oremland RS, Herbel MJ, Switzer-Blum J, Langley S, Beveridge
TJ, Ajayan PM, Sutto T, Ellis AV, Curran S (2004) Structural
and spectral features of selenium nanospheres produced by
Se-respiring bacteria. Appl Environ Microbiol 70:5260
Peng D, Zhang J, Liu Q, Taylor EW (2007) Size effect of elemental
selenium nanoparticles (Nano-Se) at supranutritional levels
on selenium accumulation and glutathione S-transferase
activity. J Inorg Biochem 101:14571463
Prakash N, Sharma N, Prakash R, Raina K, Fellowes J, Pearce C,
Lloyd J, Pattrick R (2009) Aerobic microbial manufacture
of nanoscale selenium: exploiting natures bio-nanomineralization potential. Biotechnol Lett 31:18571862
Tam K, Ho C, Lee J, Min-Lai C, Rheem Y, Chen W, Myung NV
(2010) Growth Mechanism of Amorphous Selenium
Nanoparticles Synthesized by Shewanella sp. HN-41.
Biosci Biotechnol Biochem 74:696700
Thakkar KN, Mhatre SS, Parikh RY (2009) Biological synthesis
of metallic nanoparticles. Nanomedicine: NBM 6:257262
Wang H, Zhang J, Yu H (2007) Elemental selenium at nano size
possesses lower toxicity without compromising the fundamental effect on selenoenzymes: comparison with selenomethionine in mice. Free Radic Biol Med 42:15241533
Wang T, Yang L, Zhang B, Liu J (2010) Extracellular biosynthesis and transformation of selenium nanoparticles and
application in H2O2 biosensor. Colloids Surf B 80:94102

Page 9 of 9
Xue Y, Zhao H, Wu Z, Li X, He Y, Yuan Z (2011) Colorimetric
detection of Cd2 ? using gold nanoparticles cofunctionalized with 6-mercaptonicotinic acid and L-cysteine. Analyst 136:37253730
Yadav V, Sharma N, Prakash R, Raina K, Bharadwaj LM,
Prakas N (2008) Generation of selenium containing nanostructures by soil bacterium, Pseudomonas aeruginosa.
Biotechnol 7:299304
Ye G, Metreveli N, Ren J, Epstein N (2003) Metallothionein
prevents diabetes-induced deficits in cardiomyocytes by
inhibiting reactive oxygen species production. Diabetes
52:777783
Zhang J, Wang W, Yongping B, Zhang L (2004a) Nano red
elemental selenium has no size effect in the induction of
seleno-enzymes in both cultured cells and mice. Life Sci
75:237244
Zhang Y, Zhang J, Wang HY, Chen HY (2004b) Synthesis of
selenium nanoparticles in the presence of polysaccharides.
Mater Lett 58:25902594
Zhang J, Wang H, Yan X, Zhang L (2005) Comparison of shortterm toxicity between Nano-Se and selenite in mice. Life
Sci 76:10991109
Zhang W, Chena Z, Liua H, Zhang L, Gaoa P, Daping L (2011)
Biosynthesis and structural characteristics of selenium
nanoparticles by Pseudomonas alcaliphila. Colloids Surf B
88:196201

123