Prot Sci CH 6

CHAPTER 6
Purification of Recombinant Proteins

INTRODUCTION
he principle aim of protein overexpression using the various systems described in

Chapter 5 and elsewhere (e.g., Chapter 16 of Ausubel et al., 1997) is to obtain purified
protein, and that is the subject matter of this chapter. The purification of any protein,
recombinant or nonrecombinant, is critically dependent on the starting material (or
source). Some natural proteinsfor example, cellular receptors and growth factorsmay
be present in biological source material only in trace amounts. In these cases, complex
purification schemes are required to obtain micro-amounts of partially or completely pure
protein (Simpson and Nice, 1989, and references therein). With recombinant sources, the
overproduced protein is usually (though not always) abundant, and hence the amount
available is not generally a critical factor. The gene expressing the recombinant protein
must of course have been previously cloned, and in fact may have been done so using
oligonucleotide probes derived from the amino acid sequence data, in turn derived from
the authentic protein isolated by (to use Scopes expression) heroic efforts (UNIT 1.1).
What is at issue with overproduced proteins made by the various host/vector systems is
their authenticity, in terms of both noncovalent (i.e., conformationalis the protein
correctly folded or aggregated?) and covalent structure (i.e., is the correct disulfide bond
pattern present and are post-translational modifications such as glycosylation required?).
In UNIT 6.1, an overview of protein purification is presented; although purification from E.
coli is emphasized, other host systems are also referred to where appropriate. Purification
of recombinant protein can be aided by the fact that the investigator knows the primary
sequence of the recombinant protein and can thus estimate its isoelectric point. Furthermore, the purified protein can thus be checked against this theoretical sequence for
artificial modifications arising from the expression system and purification method using
some of the methods summarized in Chapter 7. This unit has been recently updated and
expanded (2002) and forthcoming revisions will include more detailed discussions of
purification characteristics from hosts other than E. coli.
If the recombinant source contains the protein to be purified in a soluble state, then the
protein can be isolated using standard methods, often involving column chromatography.
In UNIT 6.2, the purification of interleukin 1 (IL-1) is used to illustrate the basic approach
for purifying an abundant and soluble protein expressed in E. coli. Using the basic
fractionation and chromatographic approach described, it is often possible to purify other
soluble recombinant proteins. For situations where the starting material is less abundant,
albeit soluble (e.g., proteins secreted into the medium, or, in the case of E. coli, the
periplasmic space), higher-resolution techniques such as biospecific affinity chromatography may be required. These are discussed in UNIT 6.1 and Chapter 9. The expression of
proteins genetically engineered to contain various affinity tags or carrier proteins that aid
purification are reviewed in UNIT 5.1 as well as in UNITS 6.1, 6.5, 6.6 & 6.7 of this chapter.
IL-1 is somewhat of an ideal protein from the viewpoint of both expression and
purification. The authentic protein is not post-translationally modified and although it
contains two sulfhydryl groups, it contains no disulfide bonds. For this protein, the
authentic and recombinant forms have the same covalent structure, as is discussed in detail
in UNIT 6.2 (Background Information).
Contributed by Paul T. Wingfield
Current Protocols in Protein Science (2002) 6.0.1-6.0.4
Copyright 2002 by John Wiley & Sons, Inc.
Purification of
Recombinant
Proteins
6.0.1
Supplement 30
In many cases high-level expression of protein in the E. coli host leads to the formation
of highly aggregated proteins, called inclusion bodies. The determination of whether a
protein is soluble or not is made using cell lysates and simple centrifugation schemes as
outlined in UNIT 6.1 (see also UNIT 5.3). Proteins in inclusion bodies usually have the correct
primary sequences, identical to those of their native and authentic counterparts, but are
aggregated and inactive due to noncovalent or conformational differences. In UNIT 6.3, the
preparation of insoluble inclusion body protein from E. coli lysates by a simple washing
procedure is described.
Before insoluble proteins in inclusion bodies can be purified, they must be extracted and
solubilized; in this respect their purification is analogous to the extraction of intrinsic
membrane proteins from membranes. The solubilization of inclusion body protein,
however, requires denaturation with reagents such as concentrated solutions of urea or
guanidineHCl (see APPENDIX 3A), whereas the extraction of membrane proteins is normally
carried out under nondenaturing conditions using nonionic or zwitterionic detergents (von
Jagow et al., 1994). As the solubilized recombinant protein is denatured or unfolded, it
must be folded into the correct tertiary and quaternary structures in order for the protein
to acquire its functional and biological properties.
Many nonrecombinant proteins that have been isolated under native conditions can be
reversibly denatured and renatured using well-established methods. A concise account of
protein folding is given in UNIT 6.4 (see also Pain, 1994) to provide some of the theoretical
background required to interpret protein folding experiments.
The preparation of folded and active recombinant proteins from inclusion bodies involves
the process known as preparative protein folding. In traditional protein folding experiments, pure native proteins such as ribonuclease were used to study the reversible
denaturation/renaturation process to gain information about folding pathways (Pain,
1994). These experiments are usually carried out using low protein concentrations (in the
micrograms per milliliter range) to minimize nonspecific inter- and intramolecular
interactions that lead to aggregation. In preparative protein folding, the aim is to obtain
folded protein in as high a yield as possible using relatively high starting concentrations
(in the milligrams per milliliter range) and without using very large reaction volumes.
The various strategies usually used to achieve this are illustrated in UNIT 6.5.
In preparative protein folding, apart from the need to avoid or minimize aggregation,
formation of the correct disulfide bonds is required. After extraction of the recombinant
protein from inclusion bodies using a protein denaturant and reducing agent (UNIT 6.3), the
solubilized protein is unfolded and sulfhydryl groups, if present, are reduced. To form the
correctly folded protein, disulfide bond formation and protein folding must both occur,
and usually in a concomitant manner.
Folding pure or partially purified protein may be advantageous, leading to higher yields
of folded protein. In UNIT 6.3, gel filtration in the presence of guanidineHCl is described
as a simple and rapid method for partially purifying extracted and denatured proteins prior
to folding. A recent example of this approach is the production of the ectodomain of HIV-1
and SIV gp41 (Wingfield et al., 1997). Other methods that can be used to purify proteins
in high concentrations of urea or guanidineHCl are discussed in UNIT 6.1.
Introduction
Three examples of the folding and purification of insoluble proteins expressed in E. coli
are described in UNIT 6.5. Bovine growth hormone (somatotropin) is extracted from
inclusion bodies using guanidineHCl; the protein is then folded and then purified by
conventional chromatographic methods. Aggregation during the folding process is minimized by using a solvent additive cosolvent, in this case urea in a limiting (i.e., nonde-
6.0.2
Supplement 30
Current Protocols in Protein Science
naturing) concentration. Oxidation of the two disulfide bonds is enhanced by inclusion

of an oxido-shuffling system based on oxidized and reduced glutathione (UNITS 6.1 & 6.4).
In the second example, purification of human interleukin-2 (T cell growth factor), a
different approach is used. The protein is extracted from inclusion bodies using acetic
acid, then fractionated by gel filtration in the same acid. The partially purified protein is
folded and air-oxidized by the simple approach of dialysis against water. Because
interleukin-2 contains three sulfhydryl groups, only two of which are involved in an
intramolecular disulfide bond, it is possible for incorrect disulfide bonds to form during
folding. An HPLC-based support protocol is included that allows rapid determination of
the disulfide bonding pattern. Finally, the folded protein is purified to homogeneity using
preparative reversed-phase HPLC. The acid stability of the protein is clearly an advantage
and necessary for the success of the overall process.
The third example describes the purification of the catalytic domain of the immunodeficiency virus (HIV-1) integrase. This protein is essential for the HIV-1 life cycle and is
therefore a potential drug target. The integrase catalytic domain is expressed as a fusion
protein containing an additional 20 amino acids at the N-terminus. This fusion domain
includes a tract of six histidine residues and is commonly called a His tag. The expression
of proteins with His tags is fairly common practice, as it allows proteins to be purified by
metal-chelate chromatography (MCAC) under both native and denaturing conditions (see
UNIT 5.1 for additional discussion). The HIV-1 integrase, extracted with denaturant and
partially purified by gel filtration and MCAC, is folded into native protein using a slow
and continuous addition of denatured protein into a renaturation solution. This approach
was originally described by Ruldolph and his colleagues (see Ruldolph, 1989, and
references therein) and is generally applicable for avoiding and/or minimizing aggregation during folding. The His tag is removed from the folded fusion protein using specific
protease digestion (in this example, the protease used is thrombin, and methods for its
handling and specific removal are also described).
A widely used method for producing fusion proteins in E. coli is the glutathione
S-transferase (GST) system (UNIT 5.1). Analogous to His tag fusions, there is a simple
affinity chromatographic method for purification of GST fusions using immobilized
glutathione as an affinity matrix. The affinity purification of GST fusions is probably
more specific than the metal chelate chromatography used for His tags, but it has the
limitation that it cannot be performed under denaturing conditions. Fusion proteins
usually contain a linker region with a specific proteolytic cleavage site, and often this site
is specific for thrombin. Thus, once the GST fusion protein has been purified, the protein
moiety can be readily released by proteolysis. Further purification may include one more
round of affinity chromatography (to remove GST) and a gel filtration step to remove
excess thrombin and other minor contaminates. Purification may be possible by performing only the gel filtration step, depending on the size of various protein products (GST is
a dimer of 51 kDa and thrombin is 36 kDa). In UNIT 6.6 the expression and purification
of GST fusion proteins is described. Protocols for protein expression using shaker cultures
and purification methods of soluble GST fusion proteins are included. If the GST fusion
protein is insoluble and forms inclusion bodies, the protein must be solubilized and folded
into a native-like conformation prior to affinity chromatography. An extraction and
folding protocol using the protein denaturant urea is described. (It should be noted that
the GST moiety can be readily folded from either urea or guanidineHCl denatured
samples.) Protocols for proteolytic cleavage of the fusion protein and further purification
are also described. Structural biologists may note with interest the recent paper by Kuge
et al. (1997) in which the crystallization of a GST fusion protein was achieved.
Purification of
Recombinant
Proteins
6.0.3
Supplement 30
Another popular gene fusion system is based on the E. coli intracellular enzyme thioredoxin. This 12-kDa protein is very soluble, is monomeric, and has been thoroughly
characterized (UNIT 5.1). The target protein can be positioned either N-terminal (proteinthioredoxin) or C-terminal (thioredoxin-protein) to the fusion partner. This dual orientation, also possible with Hist-tag fusions, represents a difference from GST fusions, as the
GST moiety is normally only N-terminal. It is worth noting that as thioredoxin is a
monomeric protein, it may be a more suitable fusion partner for oligomeric proteins than,
for example, dimeric GST (Hurd and Hornby, 1996). In UNIT 6.7 the construction and
expression of thioredoxin fusion proteins are discussed. Support protocols deal with the
release of the fusion proteins by mechanical lysis and osmotic stress. E. coliderived
thioredoxin exhibits thermal stability, and a heat treatment of cell lysates at 80C may be
a useful initial purification step. This approach is described in the third support protocol.
The commentary section includes a brief discussion of more specific purification methods. However, if ease of purification is of critical importance, the GST fusion system
should be considered as the glutathione-based affinity method is probably more efficient
than the corresponding affinity-based method used for thioredoxin.
It should be emphasized that although most of the protocols described in this chapter are
applied to specific examples, they are fairly representative of the methods and approaches
used in general for laboratory-scale preparation of recombinant proteins from E. coli. The
individual characteristics of a given protein (e.g., solubility, isoelectric point, pH stability,
and number of sulfhydryl residues) will dictate the conditions required for any particular
purification step or folding process. Method optimization is usually empirical unless
characterization of the purified protein provides useful guidelines.
LITERATURE CITED
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K.S. (eds.).
1997. Current Protocols in Molecular Biology. John Wiley & Sons, New York.
Hurd, P.J. and Hornby, D.P. 1996. Expression systems and fusion proteins. In Proteins LabFax (N.C. Price,
ed.) pp. 109-117. BIOS Scientific Publishers, Oxford, UK.
Kuge, M., Fujii, Y., Shimizu, T., Hirose, F., Matsukage, A., and Hakoshima, T. 1997. Use of a fusion protein
to obtain crystals suitable for X-ray analysis: Crystallization of a GST-fusion protein containing the
DNA-binding domain of DNA replication-related element-binding factor, DREF. Protein Sci. 6:17831786.
Pain, R.H. 1994. Mechanisms of Protein Folding. IRL Press, Oxford, UK.
Ruldolph, R. 1989. Renaturation of recombinant, disulfide-bonded proteins from inclusion bodies. In
Modern Methods in Protein and Nucleic Acid Research: Review Articles (H. Tschesche, ed.) pp. 149-171.
Walter de Gruyter, Berlin.
Simpson, R.J. and Nice, E.C. 1989. Strategies for the purification of subnanomole amounts of proteins and
polypeptides for microsequence analysis. In The Use of HPLC in Receptor Biochemistry (A.R. Kerlavage,
ed.) pp. 210-244. Alan R. Liss, New York.
von Jagow, G., Link, T.A., and Schgger, H. 1994. Purification strategies for membrane proteins. In A Practical
Guide to Membrane Protein Purification (G. von Jagow and H. Schgger, eds.) pp. 3-21. Academic Press,
San Diego.
Wingfield, P.T., Stahl, S.J., Kaufman, J., Zlotnick, A., Hyde, C.C., Gronenborn, A.M., and Clore, G.M. 1997.
The extracellular domain of immunodeficiency virus gp41 protein: Expression in Escherichia coli,
purification, and crystallization. Protein Sci. 6:1653-1660.
Paul T. Wingfield
Introduction
6.0.4
Supplement 30
Overview of the Purification of Recombinant

Proteins Produced in Escherichia coli
UNIT 6.1
The expression of recombinant proteins, especially using bacterial vectors and hosts, is
a mature technology. With the appropriate cDNA and PCR methods, expression plasmids
can be rapidly produced. Following sequence determination of the constructs, plasmids
are transformed into expression hosts, single colonies picked, and fermentation performed. With E. coli, a 2-liter fermentation using complex media will generate 50 to 80
g (wet weight of cells). Assuming modest protein expression (2% to 5% of the total
cellular protein), between 100 and 300 mg of recombinant protein is available in the cells.
The problem is, of course, how to isolate it in an active form. Soluble proteins can be
recovered with good yields (>50%), and insoluble proteins, which must undergo a
denaturation and folding cycle, can be recovered with more modest yields (5% to 20%).
Hence, using small-scale fermentations and laboratory-scale processing equipment,
proteins (or subdomains thereof) can usually be produced in sufficient quantities (10 to
100 mg) to initiate most studies including detailed structural determinations. Some
strategies for achieving high-level expression of genes in E. coli have been reviewed by
Makrides (1996) and Baneyx (1999).
Some of the above characteristics also hold true for the production of proteins using yeast
and baculovirus eukaryotic expression systems, although more effort and expertise is
required to construct the vectors and, with the baculovirus system, produce cells for
processing. A yeast expression system may be a wise choice for proteins that form
insoluble inclusions in bacteria, and for the production of membrane-associated proteins
(Cereghino and Clegg, 1999; UNITS 5.6-5.8). The baculovirus system has proven very useful
for producing phosphorylated proteins and glycoproteins (Kost, 1999; UNITS 5.4-5.5) and
for the co-expression of interacting proteins. The construction of stable mammalian
protein expression vectors requires considerably more time and effort but may be the only
approach for producing complex multidomain proteins (UNITS 5.9-5.10). Cells growing to
cell densities of 1-5 109 cells/ml can be expected to typically secrete >10 mg/liter of
product. Alternatively, transient gene expression systems using various viral vectors (e.g.,
vaccinia virus; UNITS 5.12-5.15), can be used to produce lesser amounts of protein, which is
useful for feasibility studies. It is of interest to note that the large-scale transient expression
systems in mammalian cells are being actively developed by biotechnology companies
(Wurum and Bernard, 1999).
The initial choice of host system for the production of recombinant proteins for many
investigators is Escherichia coli. This is due to such factors as ease of genetic manipulation, availability of optimized expression plasmids, and ease of growth. This unit presents
an overview of recombinant protein purification with special emphasis on proteins
expressed in E. coli. Practical aspects and strategies are stressed throughout, and wherever
possible, the discussion is cross-referenced to the example protocols described in the rest
of Chapter 6.
The first section deals with information pertinent to protein purification that can be
derived from translation of the cDNA sequence. This is followed by a brief discussion of
some of the common problems associated with bacterial protein expression (see also UNIT
5.1). Planning a protein purification strategy requires that the solubility of the expression
product be determined; it is also useful to establish the location of the protein in the
celle.g., cytoplasm or periplasm. This unit includes flow charts that summarize approaches for establishing solubility and localization of bacterially produced proteins (see
also UNIT 5.2).
Purification of
Recombinant
Proteins
6.1.1
Supplement 30
Purification strategies for both soluble and insoluble proteins are reviewed and summarized in flow charts (see also Chapter 1). Many of the individual purification steps,
especially those involving chromatography, are covered in detail in Chapters 8 and 9, and
elsewhere (Scopes, 1994; Janson and Ryden, 1998). The methodologies and approaches
described here are essentially suitable for laboratory-scale operations. Large-scale methodologies have been previously reviewed (Asenjo and Patrick 1990; Thatcher, 1996; Sofer
and Hagel, 1997).
A section on glycoproteins produced in bacteria in the nonglycosylated state is included
to emphasize that, although they may not be useful for in vivo studies, such proteins are
well suited for structural studies. The final sections deal with protein handling, scale and
aims of purification, and specialized equipment needed for recombinant protein purification and characterization.
PROTEIN SEQUENCE AND COMPOSITIONAL ANALYSIS
Analyzing the Protein Sequence
The protein sequence translated from the DNA coding sequence is usually available, and
before attempting any laboratory work, it is useful to carry out a literature survey and
basic computer analyses (see Chapter 2). First, if the natural protein has been isolated and
characterized, reviewing the physicochemical properties of the protein and the established
purification techniques used may aid in planning a strategy for isolation from the
recombinant host. Recombinant proteins that accumulate as insoluble aggregates or
inclusion bodies, require folding into native-like conformations (Lilie et al., 1998; De
Bernardez Clark et al., 1999; UNIT 6.4). Information on the conformational properties,
including denaturation/folding curves, can help rationalize the development of preparative folding processes.
Second, for uncharacterized proteins, analyses of related proteins with sequence similarities or known motifs may provide useful clues for selecting purification steps (UNIT 2.1;
see also the PROSITE database of protein families and domains at the ExPASy Molecular
Biology Server at http://ca.expasy.org/prosite). For example, if the protein contains the
well-known kringle domain, lysine affinity chromatography might be a successful purification technique (Cleary et al., 1989). On the other hand, if the protein contains no
recognizable motifs and has no similarity to other proteins, yet contains many cysteine
residues, other strategies and precautions would be warranted as described in UNITS 6.3-6.5.
The amino acid sequence can be used to direct the synthesis of peptides corresponding
to potential epitopes (e.g., 10 to 20 residues; UNIT 2.2). Polyclonal antibodies raised against
the peptides may be suitable for detecting the protein of interest by immunoblotting. This
approach may be especially valuable for monitoring proteins expressed at low levels
e.g., when E. coli secretion vectors are used. The antibodies may also be useful for
immunoaffinity chromatography.
Analyzing the Amino Acid Composition
Purification of
Recombinant
E. coli Proteins
The amino acid composition (UNIT 3.2) of the protein will also allow calculation of some
basic physicochemical parameters. Using average pKa values for ionizable side chains in
proteins (Matthew et al., 1978), the isoelectric point (pI) can be estimated by applying
the well-known Henderson-Hasselbach relationship. The calculations can be performed
using an electronic spreadsheet such as Excel or via the internet using one of the many
molecular biology servers, e.g., ExPASy (http://www.expasy.ch/tools/pi_tool.html). The
values obtained, although only approximate, are useful for guiding the initial selection of
6.1.2
Supplement 30
ion-exchange resins and the pH of column buffers. When eukaryotic hosts are selected
for protein expression, it should be noted that post-translational modifications such as
phosphorylation and glycosylation will affect the pI.
Another parameter that can be estimated from the amino acid composition is the extinction
coefficient (), usually at 280 nm (Pace et al., 1995). Although this information will be
more useful when the protein has been purified, as most columns are monitored by UV
absorption, proteins with an unusually low (no tryptophan and little or no tyrosine) may
be difficult to detect during the early stages of purification.
Other physicochemical parameters that can be calculated include hydrodynamic parameters such as molecular radii and sedimentation coefficients, the program SEDNTERP is
especially useful (http://www.jphilo.mailway.com/download.htm). These parameters may
help in interpreting results of gel-filtration and centrifugational separations.
CHARACTERISTICS OF THE HOST-VECTOR SYSTEM
Choosing an Expression System
Popular protein expression systems include E. coli, yeast, baculovirus-infected insect
cells, and cultured mammalian cell lines (see Chapter 5). If the requirement is to obtain
a protein post-translationally modified via glycosylation (see Chapter 12) or phosphorylation (see Chapter 13), then a eukaryotic expression system must be used. Stable
mammalian expression systems are the most time-consuming to establish and require the
most expertise; however, they may be the only successful system for certain requirements
including, e.g., proteins with authentic glycosylation patterns; large multidomain and
multisubunit proteins, and especially proteins that are insoluble in E. coli. Post-translational modifications may aid purification (e.g., lectin affinity chromatography can be used
for glycoproteins; UNIT 9.1). On the other hand, these modifications may introduce charge
heterogeneityas is commonly observed with glycosylation due to loss of sialic acid
which may then complicate purification, especially with methods such as ion-exchange
chromatography (UNIT 8.2). Specific modification of proteins expressed in E. coli can be
achieved by the co-expression of modifying enzymes, such as phosphorylation of tryrosyl
residues by tyrosine kinase (Ren and Schaefer, 2001; http://www.stratagene.com/manuals/200124.pdf). However, most of the post-translational modifications observed in E. coli
are nonspecific, such as deamidation (Wingfield et al., 1987a) and proteolytic clipping
(Nagata et al., 1986). Other less common sources of protein heterogeneity arising from E.
coli expression are: (1) internal starts in translation (Dale et al., 1994); (2) partial readthroughs
of the termination codon (Danley et al., 1991), and (3) translation errors (Lu et al., 1993).
The initial choice for protein expression is often E. coli but if direct expression of a protein
of interest fails or yields an insoluble product, there are many other options available
including generating fusion proteins and many other approaches discussed elsewhere in
this overview. If other expression hosts are to be screened, there are universal cloning
systems commercially available (e.g., Gateway cloning system at http://www.invitrogen.com) that allow the rapid transfer of the gene of interest into multivector systems
including yeast, baculovirus, and mammalian cells.
Minimizing Proteolysis
If the protein is expressed in the cytoplasm in a soluble state, the purification can be carried
out directly after cell lysis. Soluble recombinant proteins are, however, susceptible to
proteolysis, which can occur before or after extraction from the cell (Maurizi, 1992).
Choosing protease-deficient E. coli host strains (Goff and Goldberg, 1985), manipulating
growth conditions, especially the time of induction for inducible promoters (Allet et al.,
Purification of
Recombinant
Proteins
6.1.3
Supplement 30
1988), and using exogenous protease inhibitors can minimize this problem. Nevertheless,
more extreme steps may be required, such as inducing the expressed protein to form
insoluble inclusion bodies, using a secretion vector to locate the protein to the periplasm
or medium, and changing to a eukaryotic expression system. In addition, there is a protein
engineering approach that requires knowledge of the proteolytic cleavage site(s) to
stabilize the protein. It requires alteration of one or both of the residues forming the scissile
bond by site-directed mutagenesis (Mildner et al., 1994). For more detailed discussions
on strategies to minimize proteolytic degradation, see reviews by Murby et al. (1996) and
Makrides (1996).
Removing the Amino-Terminal Methionine
Another common problem with proteins expressed directly in E. coli is retention of the
N-terminal methionine derived from the initiating N-formylmethionine (the formyl group
is almost always removed). The N-terminal methionine is generally removed when the
second amino acid is alanine, glycine, proline, serine, threonine, or valine (cleavable
residues), but not when it is arginine, asparagine, aspartic acid, glutamic acid, glutamine,
isoleucine, leucine, lysine, or methionine (noncleavable residues; Sherman et al., 1985).
When recombinant proteins are expressed at very high levels, the N-terminal methionine
can be retained regardless of the nature of the second amino acid, presumably due to
saturation of the processing enzymes or depletion of required metal cofactors. Removal
of cleavable N-terminal methionine can be carried out in vitro by digestion with purified
methionine aminopeptidase (Miller et al., 1987) or by co-expression of the processing
enzyme (Ben-Bassat et al., 1987; Hwang, et al., 1999).
The need to remove noncleavable methionines can be circumvented by incorporating an
N-terminal secretion leader sequence that localizes the protein, minus the leader, to the
periplasmic space (Holland et al., 1990). Other approaches utilize the incorporation of
N-terminal fusions with, e.g., ubiquitin, which can be cleaved in vitro or in vivo with a
processing enzyme (ubiquitin hydrolase). This approach involves co-expression of the
hydrolase (Miller et al., 1989). Finally, it should be noted that it is sometimes possible to
resolve proteins containing N-terminal Met from those lacking it by chromatographic
methods (Wingfield et al., 1987b).
Dealing with Inclusion Bodies
The expression of eukaryotic proteins in E. coli often leads to the accumulation of
insoluble protein called inclusion bodies (UNITS 6.3 & 6.5). Inclusion bodies can be easily
observed by phase-contrast microscopy as dense bodies, usually located at the polar
extremities of the cell and they can be isolated by centrifugation (Georgiou and Valax,
1999).
Purification of
Recombinant
E. coli Proteins
The rate of protein biosynthesis in prokaryotes is about ten times faster than in eukaryotes.
Comparison of the rates of in vitro refolding of orthologous prokaryotic and eukaryotic
proteins indicates that the former refolds six times faster. This suggests that the rate of
folding correlates with the rate of elongation of polypeptide chains. Hence, part of the
problem in expressing eukaryotic proteins in bacteria might be due to combination of fast
synthesis and slow folding, which favors aggregation (Widmann and Christen, 2000).
Proteins in the unfolded state at high concentration, even small rapidly folding proteins,
are prone to aggregation due to exposure of hydrophobic surfaces that are normally buried
in the native state (see Fersht, 1999, for further discussion). Some proteins are helped to
fold in vivo by binding to accessory proteins called chaperones (see Protein-Assisted
Folding and Oxidation in the discussion of Performing Protein Folding).
6.1.4
Supplement 30
The formation of inclusion bodies can occasionally protect proteins against proteolysis
and can also allow accumulation of proteins normally toxic to the cell; some examples
include proteases (HIV-1 protease; Cheng et al., 1990) and membrane-spanning domains
(Jones et al., 2000). The formation of inclusion bodies also simplifies purification of the
protein, albeit in a denatured/aggregated state (see below). The main disadvantage is that
the protein must be extracted with protein denaturants and then folded into a native-like
conformation. For small (10- to 20-kDa) single-domain proteins, this is usually not
problematic, although the overall recoveries may only be 5% to 20% of those of similar
or identical proteins expressed in a soluble state. For large (40- to 70-kDa), multiple-domain proteins, recoveries may be negligible, although there have been a number of
successful cases, such as the 69-kDa tissue plasminogen activator (Grunfeld et al., 1992).
The formation of inclusion bodies can sometimes be prevented by changing the promoter,
host strain, and combinations thereof; controlling the growth conditions (especially the
pH of the culture); adding nonmetabolizable sugars such as sucrose and sorbitol to the
fermentation medium; and changing the temperature of induction, usually by lowering it
(for reviews, see Schein, 1989; Wetzel, 1992; Baneyx, 1999).
The recombinant protein may be located in both the insoluble and soluble fractions of the
cell (mixed-phase expression), and in these cases, better yields may be obtained by
processing the soluble material (discarding the insoluble) even though it might constitute
only a minor portion of the total expressed protein (Thatcher and Panayotatos, 1986;
Wingfield et al., 1987c). Soluble protein purified from mixed-phase expressions should
be carefully analyzed to check its authenticity (e.g., by mass spectrometry) as the
solubility may have resulted from minor modifications such as deamidation or proteolysis
of a few residues from either the N or C terminus (P.T. Wingfield unpub. observ.).
A successful approach for avoiding inclusion body formation is the use of an appropriate
secretion vector (Guisez et al., 1998; Cornelius, 2001) The N-terminal secretion signal
directs protein to the periplasmic space (see Localizing Protein), and translocation across
the plasma membrane results in cleavage of the secretion leader sequence. The periplasm
contains enzymes that accelerate folding and formation of disulfide bonds (for reviews,
see Missiakas and Raina 1997). Purification is also simplified as the protein content of
the periplasmic space constitutes only 4% of the total E. coli protein (Beacham, 1979).
Fusion Proteins
Apart from direct expression, there are many examples of fusion protein expression.
Fusion proteins consist of the protein of interest partnered or tagged with proteins or
protein domains appended to either the N- or C-terminus (or both) (UNIT 5.1; Uhlen et al.,
1992; also see Table 3 in Makrides, 1996). The appended moieties are commonly called
tags and are often linked to the host protein by a short linker sequence containing a
specific chemical (e.g., Met or Asp-Pro) or protease cleavage site (e.g., thrombin). One
of the main purposes of constructing fusion proteins is to facilitate the recovery and
purification of the recombinant protein. The most popular fusion partners are the polyhistidine tag (His-tag) and the glutathione-S-transferase (GST-tag), these are discussed
in more detail in UNITS 6.5 & 6.6. A tag may help maintain the solubility of a protein that is
normally expressed in an insoluble form (LaVallie et al., 1993; Zhang et al., 1998).
Alternatively, the tags may promote insolubility, especially useful for protecting short,
partially structured polypeptides, and for expressing proteins that are normally toxic to
E. coli (e.g., proteins with membrane-associating or -spanning regions). The Gateway
universal cloning system, previously mentioned, has been used to screen for improved
solubility by comparing the effects of six different N-terminal fusion proteins and the
Purification of
Recombinant
Proteins
6.1.5
Supplement 30
Table 6.1.1
Protein Expression in Escherichia coli
Protein
expressiona
Native sequence
Nativefusion
Nativesecretion
Locationb
Soluble
Advantages
Disadvantages
Yes
High-level expression
Direct purification with good
recovery
N-terminal Met may be

retained
Susceptible to proteolysis
No
May protect against proteolysis
Toxicity effects of protein to cell
may be avoided
Easy partial purification (washed
pelletssee Fig 6.1.1)
Protein folding must be

carried out
Recovery of purified
native protein can be
low to zero
N-terminal Met may be
retained
Yes
Purification aided with
affinity-tagged protein
Solubility and stability of expressed
protein (or peptide) can be enhanced
by fusion partners
Authentic N terminus after
site-specific cleavage (not always
true)
To obtain native
sequence site-specific
cleavage of fusion
protein required
Overall yield of native
protein may be low
No
See comments for native insoluble

Purification of denatured protein
aided (e.g., His-tag)
Protein folding may be enhanced by
binding to affinity matrix (Sinha et
al., 1994; UNIT 9.4)
See comments for native

insoluble
Protein folding required
No
P/M
Yes
Ease of purification
Correct N terminus
Protein folded and oxidized
Expression level and

recovery may be low
No
Correct N terminus
Expression level may be high
May be protected against proteolysis
Protein folding must be

carried out
Secretion leader
unprocessed,
purification usually not
attempted
aNative, native protein sequence, including any site-specific mutations or deletions; Nativefusion native sequence with N- or C-terminal
extension sequence (e.g., polyhistidine tag); Nativesecretion, native sequence plus N-terminal leader sequence coding for an E. coli
secretory signal (e.g., OmpA).
bC, cytoplasm; P, periplasmic space; M, medium.
His-tag (Hammarstrom et al., 2002). This type of study using conventional cloning and
expression would represent a major undertaking.
Purification of
Recombinant
E. coli Proteins
The expression of fusion proteins with affinity handles, such as those containing stretches
of polyhistidine (His-tagged; see also UNIT 6.5), has become extremely popular due to the
ease of protein purification under both nondenaturing and denaturing solvent conditions
(for more details, see discussion on Purifying Denatured Proteins). The soluble fusion
proteins often have native-like conformations and are biologically active. It cannot be
assumed, however, that a tag will have no effect on the proteins function or activity. From
6.1.6
Supplement 30
cells
break cells
mechanical: French press
enzymatic: lysozyme
extract
centrifuge 30 min at 10,000 x g
low-speed supernatant:
polymers,
soluble proteins
low-speed pellet:
inclusion bodies,
cell wall components
centrifuge 90 min
at >60,000 x g
extract
(Triton/EDTA/urea)
centrifuge 30 min
at 10,000 x g
repeat two times
high-speed pellet:
membrane vesicles,
ribosomal particles
high-speed supernatant:
cytoplasmic proteins,
periplasmic proteins
purify
low-speed
extract supernatant:
cell wall components
low-speed
washed pellet:
inclusion bodies
solubilize
denatured protein
native protein
fold
purify
Figure 6.1.1 Differential centrifugation of E. coli cell lysates. Cells are broken with a French press
or by lysozyme treatment. Insoluble (inclusion body) proteins, from either the cytoplasm or
periplasm, are located in the low-speed pellet, which is subjected to preextraction to remove outer
membrane and peptidoglycan material. Inclusion bodies are extracted from washed pellets with
strong protein denaturants such as guanidineHCl. The solubilized protein, which is denatured and
reduced (free sulfhydryl residues), is either directly folded and oxidized (disulfide bonds formed) or
purified before folding. Soluble proteins (from the periplasm and cytoplasm) are located in the
low-speed and high-speed supernatants. The latter can be used directly for chromatography,
whereas the former requires clarification by other techniques such as ammonium sulfate fractionation or membrane filtration.
Purification of
Recombinant
Proteins
6.1.7
Supplement 30
fermentation broth
supernatant:
secreted protein
pellet: cells
S1
wash in isotonic medium with Mg 2+

pellet:
washed cells
supernatant:
wash
digest with lysozyme (200 g/ ml)

dilute 1:2 with water
suspend in hypertonic medium

(20% sucrose/EDTA/TrisCI)
supernatant:
wash
pellet:
plasmolyzed cells
P1
S2
supernatant:
lyse cells
treat with detergent,
sonicate,
or subject to
hypotonic shock
suspend in
hypotonic medium
(10 mM TrisCI)
centrifuge 90 min
at >60,000 x g
supernatant:
P2
pellet:
spheroplasts
cell lysate
pellet
P3
Figure 6.1.2 Localization of secreted and periplasmic proteins in E. coli. Periplasmic protein
produced via a secretion vector can leak into the medium and be recovered by centrifugation
(supernatant, S1) or filtration. Washing cells with an isotonic solution such as lightly buffered 0.15
M NaCl or 0.25 M sucrose can also release protein (S2). The compartmentalized periplasmic
proteins are released by isotonic shock treatment by directly suspending normal cell paste or
plasmolyzed cell paste into hypotonic medium. Plasmolyzed cell paste is derived by suspending
cells in hypertonic medium and then pelleting. (In hypertonic medium the cell contracts, separating
the inner membrane from the cell wall, and is said to be osmotically sensitized.) The hypertonic
wash often releases protein (P1). The supernatant from shocked cells (P2) will contain constitutive
E. coli proteins and the recombinant product. Osmotically sensitized cells can also be treated with
lysozyme to fragment the outer membrane, thus releasing periplasmic proteins (P3). The pellet from
the lysozyme treatment contains spheroplasts (cells with fragmented outer membranes), which are
easily disrupted by detergents, sonication, or hypotonic shock to release cytoplasmic proteins.
Purification of
Recombinant
E. coli Proteins
a protein purification viewpoint, the main advantage of affinity-tagged proteins is realized

when they are combined with a secretion vector (Skerra et al., 1991); in such a case, the
6.1.8
Supplement 30
cell lysate
(e.g., low-speed supernatant of Fig. 6.1.1)
clarify lysate
centrifuge (90 min at >60,000 x g)
filter
or salt fractionate and exchange buffer
clarified lysate
conduct ion exchange (1)

DEAE-Sepharose
conduct ion exchange (2)

weak cationic (CM)
strong cationic (S)
strong anionic (Q)
weak anionic (DEAE)
phosphocellulose
preference
exchange buffer
order of
perform
affinity methods
perform other
chromatography methods (3)
dye matrix
hydrophobic
hydroxylapatite
chromatofocusing
concentrate
perform gel filtration
sterile-filter
purified protein
Figure 6.1.3 Purification of soluble proteins from E. coli lysates. Abbreviations for ion-exchange
resins are as follows: CM, carboxymethyl; DEAE, diethylaminoethyl; Q, quaternary ammonium; S,
methyl sulfonate. The order of preference for the stages of ion-exchange (2) and other methods (3)
is based on the authors opinion and does not necessarily represent a consensus view. On the other
hand, the use of a DEAE-based matrix at an early stage (1) is common practice. Affinity methods
(see text and Chapter 9) can be performed at any stage following clarification of the lysate.
protein will be translocated to the periplasm or the medium, though often at low
concentrations, and the tagged protein can be readily purified from the culture medium
after osmotically shocking the cells.
Table 6.1.1 briefly summarizes some of the major advantages and disadvantages of the
various expression scenarios using E. coli. If attempts to express the protein in E. coli or
Purification of
Recombinant
Proteins
6.1.9
Supplement 30
to fold inclusion body proteins fail, then a eukaryotic system must be considered. The
decision of which system to use is often dictated by the expertise available to the
laboratory. Alternatively, many companies offer custom expression services using various
protein expression systemsthis can be an expedient, although expensive, solution.
SOLUBILITY AND LOCATION OF THE PROTEIN
Determining Solubility
Figure 6.1.1 shows a simple centrifugation scheme that indicates how to determine the
solubility of a protein expressed in E. coli (see also UNIT 5.2). The recombinant protein in
the various fractions is assayed by SDS-PAGE (UNIT 10.1); if more sensitive methods are
required, immunoblotting or biological assays may be used.
Cell breakage carried out with a French press (UNIT 6.2) will disrupt both the outer and
inner membranes. The peptidoglycan layer, which lies underneath the outer membrane in
Gram-negative bacteria such as E. coli, will be fragmented into sheets. Low-speed
centrifugation (30 min at 10,000 g) separates unbroken cells, bacterial outer membrane,
and peptidoglycan components, and highly aggregated inclusion body proteins (pellet
fraction) from soluble bacterial proteins, soluble recombinant proteins, and polymeric
materials, including ribosomal protein complexes and inner membrane vesicles (supernatant fraction). High-speed centrifugation (90 min at 100,000 g) of the low-speed
supernatant will pellet polymers. Soluble proteins, derived mainly from the cytoplasm
and periplasmic space, can then be recovered from the clarified supernatant. Soluble
proteins in the low-speed or high-speed supernatant are purified directly using conventional methods (UNIT 6.2).
It should be noted that a working definition of solubility is the presence of protein in the
supernatant after centrifugation for 100 min at 100,000 g. This definition applies to
solvents of viscosity or density close to that of water.
Occasionally, recombinant protein will be found in both the pellet and supernatant
fractions after low-speed centrifugation due to the accumulation of both soluble and
inclusion body proteins. If partitioning is observed only following high-speed centrifugation, then specific self-association or nonspecific association involving E. coli proteins
and nucleic acid may be suspected. Recombinant proteins that normally bind RNA or
DNA often bind nonspecifically to bacterial nucleic acid (Sherman and Fyfe, 1990;
Wingfield et al., 1990). Lindwall et al. (2000) have developed a sparse screen approach
to optimizing the buffer composition for extracting and solubilizing folded (non-aggregated) proteins.
Inclusion body proteins, which are located in the low-speed pellet fraction, can be partially
purified by extracting with a mixture of detergent [usually 1% to 5% (v/v) Triton X-100]
and denaturant, either urea or guanidineHCl. The concentration of denaturant used for
pellet washing is determined empirically and should be below the concentration required
for solubilization of the recombinant protein; the usual ranges are 1 to 4 M urea and 0.5
to 1.5 M guanidineHCl. The cloudy extract will consist of complex carbohydrate from
the fragmented peptidoglycan layer, lipopolysaccharide, and outer membrane proteins.
The inclusion body proteins in the washed pellets are then extracted with solvents that
disrupt protein-protein interactions (e.g., 6 to 8 M urea or guanidineHCl) and processed
as described below.
Purification of
Recombinant
E. coli Proteins
6.1.10
Supplement 30
Localizing Protein
When proteins incorporating a secretion vector are expressed in E. coli, advantage can be
taken of the fact that the recombinant proteins will be located in the periplasmic space
and/or the culture medium. Secretion into the medium is due to leakage from the
periplasm and appears to depend on the level of accumulation and the fermentation
conditions. Figure 6.1.2 summarizes approaches used to recover proteins selectively from
the periplasmic space or the medium (see also UNIT 5.2). High-level secretion into the
periplasm sometimes results in the formation of aggregates, analogous to cytoplasmic
inclusion bodies (Bowden et al., 1991). Periplasmic inclusion bodies can be extracted
from the low-speed pellet fraction following normal cell breakage (see Fig. 6.1.1).
Proteins in the medium can be recovered by subjecting the culture medium to centrifugation or filtration, steps that remove intact cells and large debris. The clarified protein
is usually dilute and is often concentrated prior to purification by affinity or conventional
chromatography. Periplasmic proteins can be selectively released by osmotic shock
(preferred method) or by selective disruption of the outer membrane and peptidoglycan
layer using lysozyme.
Apart from its use in dissecting the bacterial compartments, lysozyme is often employed
to prepare complete cell lysates, especially in laboratories that do not have access to a
French press. Cells treated with lysozyme can be disrupted with detergents or by brief
sonication (UNIT 6.5).
Useful microscale (<1 ml) E. coli cell fractionation schemes have been based on osmotic
shock treatment (Yarranton and Mountain, 1992) or repeated freezing and thawing of cells
(Johnson and Hecht, 1994). UNIT 5.2 describes small-scale (1- to 25-ml) procedures for
preparing samples of periplasmic extracts and extracellular media for analysis by SDSPAGE (UNIT 10.1).
STRATEGIES FOR ISOLATION OF SOLUBLE PROTEINS
There are no set formulas for isolating soluble recombinant or nonrecombinant proteins;
there are, however, some basic strategies and precautions that can be followed. A flow
chart summarizing some of the methods commonly used for E. coli is shown in Figure
6.1.3 (see also Chapter 1). In Figure 6.1.3, the step, Perform Affinity Methods, refers not
only to conventional affinity purification methods (see Chapter 9), but also to affinity
methods based on the use of fusion proteins. A specific protocol detailing the purification
of the soluble protein interleukin-1 (IL-1) is presented in UNIT 6.2 and two more recent
examples are discussed below. Comments on the various stages are given in order of their
application.
Determining the Isoelectric Point
The section on Analyzing the Amino Acid Composition mentions how the isoelectric point
of a protein can be estimated from the pKa values for ionizable side-chain groups. The pI
can also be determined experimentally by subjecting the soluble protein extract to 1-D
isoelectric focusing (UNIT 10.2) or 2-D titration curve analysis (Watanabe et al., 1994; UNIT
7.3). If the recombinant protein is not a major component in the cell extract, specific
detection on the 2-D gel by immunoblotting will be required. The calculated pI can be
used to optimize the buffer pH in subsequent ion-exchange steps.
Purification of
Recombinant
Proteins
6.1.11
Supplement 30
Breaking Cells
Cells are efficiently broken by high-pressure homogenization using a continuous-fill
French press, which is suitable for processing volumes of 40 to 250 ml (reviewed by
Hopkins, 1991; see UNIT 6.2). (Yeast cells can also be conveniently broken with the French
press, although two passes are required). For volumes exceeding 500 ml, the MantonGaulin-APV homogenizer (APV Gaulin) should be used. Sonication is also useful for
breaking cells but is best suited for volumes <100 ml. Alternatively, the outer cell wall
can be enzymatically digested with lysozyme (200 g/ml) and the cells broken by
detergents, sonication, or both (Kaback, 1971; Burgess and Jendrisak, 1975; UNIT 6.5).
Proteins that are secreted into the periplasmic space can be selectively released by
hypotonic (osmotic) shock (Heppel, 1967).
The viscosity of the cell lysate may be high due to released nucleic acid. Before
centrifugation, the viscosity must be reduced either by sonicating or by adding DNase
(25 to 50 g/ml plus 5 to 10 mM Mg2+) and RNase (50 g/ml; no Mg2+ requirement). A
standard protease inhibitor mixture should be included in the buffercontaining, for
example, 2 to 5 mM EDTA, 0.5 to 1.0 mM phenylmethylsulfonyl fluoride (PMSF) or 5
mM benzamidine, and 1 M pepstatin A. The serine protease inhibitor 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF) is a water-soluble substitute for PMSF
with a much longer half-life in aqueous solution and is used at 50 M. (Roche Applied
Science: http://www.roche-applied-science.com. Go to the Biochemistry section to download the booklet: The complete guide for protease inhibition that lists properties for most
commercially available reagents). The addition of 2-macroglobulin (1 g/mg recombinant protein) before the final purification step(s) can protect protease-sensitive proteins
(Ultsch et al., 1991; see also section on MAP30 purification below). The crude extracts
should be kept cold and the recombinant protein taken rapidly to a stage of the purification
process where it is stable against contaminating proteases (e.g., as an ammonium sulfate
precipitate).
Clarifying Cell Extract by Centrifugation or Selective Precipitation
The lysate is subjected first to low-speed centrifugation to remove unbroken cells and
large cellular debris, then to high-speed centrifugation to remove ribosomal material and
other particulates (see Fig. 6.1.1). If an ultracentrifuge is not available, the extract can be
clarified by the following techniques: ammonium sulfate or polyethylene glycol fractionation (reviewed by Scopes, 1994), phase partitioning (reviewed by Walter and Johansson,
1986), and membrane filtration (van Reis and Zydney, 2001; useful guides on filtration
technology are available from Millipore at http://www.millipore.com). A fairly recent
technology is expanded bed adsorption where crude extracts can be directly applied to
adsorbents, for example ion exchangers, without initial clarification (see Amersham
Biosciences for literature at http://www.apbiotech.com).
Proteins that bind tightly to nucleic acid can be selectively precipitated with polyethyleneimine and resolubilized by salt extraction (Burgess and Jendrisak, 1975). In practice,
particular properties of the protein can be exploited at this stage; for example, the protein
of interest may be soluble under conditions where most E. coli proteins are insoluble,
such as acidic pH or high temperature.
Applying Clarified Extract to a Weak Anion Exchanger
Purification of
Recombinant
E. coli Proteins
Fractionating the extract with an anion-exchange resin is a useful first step as it removes
host E. coli proteins, many of which have pI values in the range 5.0 to 7.0 and will thus
bind to a column equilibrated in 50 to 100 mM TrisCl, pH 7.5 to 8.0. The positively
charged matrix will also tightly bind nonproteinaceous materials such as nucleic acids
6.1.12
Supplement 30
low-speed washed pellet

(e.g., Fig. 6.1.1):
inclusion body protein
extract
6-8 M GuHCI + DTT,
8 M urea + DTT,
or 10-20% acetic acid
purify protein with
metal chelate
chromatography
(His-tagged proteins)
using urea or
GuHCI as solvent
denatured protein:
monomeric and reduced protein
purify protein with

ion-exchange
chromatography
using urea or
nonionic detergents
as solvent
purify protein
gel filtration using urea or GuHCI as solvent
HPLC using TFA/acetonitrile as solvent
denatured protein:
purified protein
fold protein
fold and oxidize proteins

(1) remove denaturant by dilution or dialysis
(2) include cosolvents (e.g. ,1-4 M urea or
PEG or arginine or nonionic detergents)
(3) include redox system (e.g., 10:1 GSH/GSSG)
folded protein:
purified and oxidized protein
purify protein
conduct gel filtration

chromatography to
remove aggregates and
misfolded protein
product
Figure 6.1.4 Folding and purification of inclusion body proteins from E. coli. The protein is
extracted with protein denaturants such as guanidineHCl (GuHCl), urea, or an organic acid. The
reductant dithiothreitol (DTT) is included to prevent artificial disulfide bond formation (especially
intermolecular bonds). The denatured protein can be purified by various methods and then folded,
or it can be directly folded. Typically, some purification (e.g., gel filtration in GuHCl) prior to folding
is recommended as it often results in higher folding yields. Protein folding and oxidation are carried
out concurrently. Disulfide bond formation is catalyzed by low-molecular-weight thiol/disulfide pairs
such as reduced (GSH) and oxidized (GSSG) glutathione. GSH/GSSG ratios of 5:1 to 10:1 are
normally used, which are similar to those found in vivo in the endoplasmic reticulum (Hwang et al.,
1992). A cosolvent is included to maintain solubility during folding. Folded protein is purified if
necessary (purification is usually needed if the protein is directly folded). Gel filtration is a useful
final step for removing aggregated and or misfolded protein.
and other polyanionic species (e.g., lipopolysaccharide derived from the bacterial outer
membrane). A useful cleanup of the protein will take place whether or not the protein of
interest binds to the column (see UNITS 6.2 & 6.5). The following column sizes are recommended for processing extracts: for 5 g cells, 2.5-cm diameter packed to a height of 10
to 15 cm; for 50 g cells, 5.0-cm diameter packed to a height of 20 cm.
Purification of
Recombinant
Proteins
6.1.13
Supplement 30
cells
break lysozymetreated cells with

French press
break untreated
cells with
French press
low-speed centrifugation
B
s
lp
ib
c
lp
ib
c
washing steps
ib
c
Figure 6.1.5 Preparation of washed pellets using lysozyme and the French press. Cells are
broken with the French press with or without prior treatment with lysozyme. After low-speed
centrifugation using a fixed-angle rotor, the contents of the centrifuge tubes have the characteristics
shown. The contents of tubes A and B are labeled: s, supernatant; lp, loose pellet; ib, inclusion body
protein; and c, unbroken cells and large cellular debris. The loose pellet material is derived from the
outer cell wall and outer membrane (see text for further details). After washing the insoluble material
(UNIT 6.3), the pellet should consist mainly of the inclusion body layer (tube C), and the supernatant
should be fairly clear.
Preparing for Repeat Ion-Exchange Step
Purification of
Recombinant
E. coli Proteins
Before repeating ion exchange, the solvent pH and ionic strength usually need adjustment.
This can be carried out by dialysis (UNIT 6.2) or by gel filtration on a desalting column
using, for example, Sephadex G-25 or G-50 (UNIT 8.3). In preparation for cation-exchange
chromatography, dialysis against slightly acidic buffers (pH 5.0 to 6.0) will result in the
helpful precipitation of some E. coli proteins. It may also be advisable to include a
relatively low concentration of urea (0.5 to 2 M) or a nonionic or zwitterionic detergent
in the dialysis buffer to minimize coprecipitation with contaminants (for an extensive
listing of detergents and properties, see http://psyche.uthct.edu/shaun/SBlack/detergnt.html). Basic proteins (pI >9.0), which do not bind to the DEAE column, can be
6.1.14
Supplement 30
applied after dilution to a cation exchanger equilibrated at pH 7.0 to 7.5 without careful
buffer exchange (Allet et al., 1988).
Repeating Ion-Exchange Chromatography
For a second round of ion-exchange chromatography, one of the ion-exchange resins
indicated in Figure 6.1.3 should be used. Selection kits are available for rapidly screening
and selecting the most suitable ion-exchanger (Amersham Biosciences). For cation-exchange chromatography, phosphate buffer (10 to 50 mM) between pH 5.0 and 7.5 should
be tried first. Cellulose Phosphate (a bifunctional cation exchanger manufactured by
Whatman: http://www.whatman.com) is effective for nucleic acidbinding proteins
(Kelley and Stump, 1979). Protein is usually eluted from cellulose phosphate columns
using phosphate gradients.
After two stages of ion exchange, many proteins will be pure enough for the final
gel-filtration step (see Performing Gel Filtration). However, if the sample contains
contaminants close in size to the protein of interest, then further purification is required.
Some of the frequently used methods are listed in Figure 6.1.3. Hydrophobic-interaction
chromatography (UNIT 8.4) is especially useful following ammonium sulfate fractionation
or salt elution from an ion-exchange resin. Screening kits are also available for rapidly
checking protein binding on several different agarose-dye matrices (Sigma at
http://www.sigmaaldrich.com).
Performing Gel Filtration
The final purification step of gel filtration (using a column 1.5 to 5.0 cm in diameter and
60 to 100 cm in length) will provide good separation of the recombinant protein from
higher- and lower-molecular-weight E. coli protein contaminants. Gel filtration will also
separate aggregated or highly associated recombinant protein from the physically stable
form of the protein (e.g., monomer or dimer). Finally, gel filtration chromatography
allows for easy exchange of the buffer. The protein solution is usually concentrated before
being applied to the column. After chromatography, the protein will be diluted three- to
five-fold (or more) and may therefore require repeat concentration.
Other Methods
In addition to the generalized approach described, affinity methods can be applied at any
stage following clarification of the extract. Biospecific affinity can be exploited with
immobilized natural ligands such as antibodies, substrates, and receptor ligands. Affinity
chromatography, which selects for particular classes of proteins, is carried out with
immobilized lectins (for glycoproteins), dyes (for nucleotide-binding proteins), and
nucleic acids or heparin (for RNA- and DNA-binding proteins). Commercially available
antibodies against post-translationally modified residues (e.g., phosphotyrosine) are also
useful. The application of affinity tags or fusions has been previously described. Affinity
methods are most useful when high degrees of purification are requirede.g., for proteins
secreted into the medium, for small-scale isolations, or for rapid purification requirements.
The most commonly used affinity method is immunoaffinity chromatography. The ideal
reagent is a monoclonal antibody that has been specifically selected to have a moderateto-low affinity for the ligand in question, thus allowing elution under nondenaturing
conditions. Antibodies raised against peptides often have lower affinities for the native
protein than antibodies raised against the intact protein. Elution from peptide-antibody
immunoaffinity columns can be achieved using the competing immunizing peptide
(reviewed by Sutcliffe et al., 1983). Directed immobilization of the antibody, where only
Purification of
Recombinant
Proteins
6.1.15
Supplement 30
the Fc domain is bound to the column matrix and the antigen binding site (Fab domain)
is thus oriented away from the matrix, results in higher binding efficiencies. An oriented
antibody matrix can be made by binding antibody to immobilized protein A-Sepharose
(or protein G-Sepharose) and fixing it in position with a covalent cross-linking reagent
(Schneider et al., 1982; commercial kits can be obtained from Pierce at http://www.piercenet.com/).
Compilations of standard chromatographic fractionation media are available (Table 8.2.2;
Patel, 1993). However, the best source of information is often the literature from the
various manufacturers.
STRATEGIES FOR ISOLATION OF INSOLUBLE PROTEINS
Recombinant proteins expressed in E. coli that are located in the low-speed pellet fraction
(see Fig. 6.1.1) following cell lysis are highly aggregated (i.e., inclusion bodies). Inclusion
bodies are normally derived from protein aggregation in the cytoplasm, or in the periplasm
if a secretion vector was used. As mentioned above, protein can also be located in either
the low- or high-speed pellet fractions because of interaction with bacterial nucleic acids.
Furthermore, if the protein is known to undergo polymerization in vitro (e.g., viral
nucleocapsid subunits), expression in E. coli can also be expected to lead to polymerization in vivo to varying degrees, and such proteins will be partitioned in both the
supernatant and pellet fractions (Wingfield et al., 1995). There are also examples of
membrane proteins that, when expressed in E. coli, associate with the inner cytoplasmic
membrane and can be extracted with nondenaturing detergents (Bibi and Beja, 1994, and
references cited therein).
When apparent insolubility is due to interactions involving folded protein as described
above, extraction under nondenaturing conditions should be attempted, for example, using
various pH buffers containing salt (e.g., 0.25 to 1.0 M NaCl) and nondenaturing detergents
(e.g., 10 mM CHAPS or 2% Triton X-100). Insolubility due to classic inclusion body
formation requires extraction with denaturing solvents, and the remainder of this section
deals with this subject. The flow chart in Figure 6.1.4 illustrates some of the approaches
possible for processing protein extracted from inclusion bodies.
Breaking Cells
Cells can be broken by mechanical means (UNIT 6.2), enzymatically with lysozyme (UNIT
6.5), or by a combination of methods (UNIT 6.5). It is advantageous to break cells as
completely as possible, as any unbroken cells will be located in the low-speed pellet
fraction from which the recombinant, insoluble protein will be extracted.
Preparing Washed Pellets
The object of the initial low-speed centrifugation and pellet washing is to extract as
many E. coli contaminants as possible without solubilizing the recombinant protein. This
is usually carried out as described in the section on Determining Solubility (see also Fig.
6.1.1).
Purification of
Recombinant
E. coli Proteins
When a fixed-angle rotor is used, pellets from the low-speed centrifugation consist of at
least two light-colored layers and a darker, hard-packed pellet at the bottom of the tube
(Fig. 6.1.5). The hard-packed material is probably a small amount of unbroken cells. The
next layer is inclusion body protein, and the top layer (least dense and lightest in color)
is outer membrane and peptidoglycan fragments. Analysis of the top layer by SDS-PAGE
(after heating proteins in SDS sample buffer at >80C) will reveal two strong bands at
35 and 38 kDa representing OmpA and the matrix proteins OmpC and OmpF, respec-
6.1.16
Supplement 30
tively, from the outer membrane (DiRienzo et al., 1978; see also Fig. 6.3.1). The outer
membrane/peptidoglycan layer can be partially removed by resuspending and centrifuging at reduced speed (or time) or by diluting the suspension. Alternatively, the cells can
be pretreated with lysozyme prior to the French-press cell breakage as described in UNIT
6.5. The lysozyme treatment reduces the size of the loosely pelleted outer membrane/peptidoglycan material so it locates predominately in the low-speed supernatant (Fig. 6.1.5).
The recombinant protein in a well-prepared washed pellet will typically be >60% pure
when analyzed by SDS-PAGE (UNIT 6.3).
Extracting Protein
The washed pellets are extracted with high concentrations of protein denaturants such as
6 to 8 M guanidineHCl or urea. It should be noted that some proteins are resistant to
denaturation with high concentrations of these reagents, especially urea. Some washed
pellets extracted with 8 M guanidineHCl can be viscous and unsuitable for direct
chromatography. In these cases, pre-extraction of the washed pellets with a limiting
concentration (0.5 to 2.0 M) of guanidineHCl can often overcome this problem.
Solubilization with the anionic detergent N-lauroylsarcosine (Nguyen et al., 1993; Burgess and Knuth, 1996) and with 10% to 20% acetic acid has also been useful (UNIT 6.5);
other denaturants for extracting inclusion bodies are described elsewhere (UNIT 6.3;
Marston and Hartley, 1990). For background information on the mode of action of protein
denaturants, readers should consult the reviews of Tanford (1968) and Creighton (1993).
If the protein contains cysteine residues, it is essential to include a reducing agent,
preferably 5 to 10 mM dithiothreitol (DTT). Even in the presence of strong protein
denaturants, it may be necessary to sonicate or heat samples briefly to completely disperse
and solubilize the protein.
The extraction process should completely disaggregate and denature the protein into
unfolded monomers. Urea is not recommended for the initial extraction. For example,
even if it is known that a native version of protein can be unfolded with 4 M urea, the
same protein in an E. coli inclusion body will almost certainly not be completely extracted
as unfolded monomers with that same concentration of urea (or in most cases, even with
8 M urea). Initial extraction trials should be carried out with guanidineHCl, which is
more effective than urea. Most proteins will be extracted with 6 to 8 M guanidineHCl.
There should be adequate reductant present to maintain sulfhydryl groups in the reduced
state, and thus prevent artificial disulfide bond formation. The presence of EDTA and a
slightly acidic pH of 6.0 to 6.5 will help minimize cysteine oxidation. The extract may
require clarification by filtration or centrifugation.
Choosing Purification or Folding
The extracted protein can be further purified, or it can be directly folded and then purified.
Protein folding appears to be unaffected by the protein background in bacterial extracts
(London et al., 1974), however, removal of nonproteinaceous material prior to folding has
been reported to be beneficial (Darby and Creighton, 1990). Based on recent work, it is
worth noting that high concentrations of background bacterial protein may promote
aggregation of the unfolded recombinant protein by macromolecular crowding effects
(Ellis, 2001). If purification of protein in the denatured state is possible, use the purified
material to develop a folding protocol. Then use this protocol with clarified protein
extracts, or better still with protein partially purified by DEAE-Sepharose, to observe if
the presence of contaminants has any effect on the yield of folded protein.
Finally, there may be specific reasons for purifying proteins in the denatured state. For
example, some proteolytic enzymes, such as HIV-1 protease, self-digest (undergo auto-
Purification of
Recombinant
Proteins
6.1.17
Supplement 30
proteolysis) in the uninhibited state (Mildner et al., 1994, and references cited therein)
but can be purified intact in the denatured (inactive) state, then refolded when required.
Other proteins once folded may have low solubilities and be especially susceptible to
aggregation, resulting in poor behavior on column matrices (see VP26 purification below).
However, in general, unfolded proteins are more susceptible to chemical and proteolytic
modifications.
Purifying Denatured Proteins
If the protein is extracted with guanidineHCl, gel filtration is a useful first purification
method; often protein >80% pure can be obtained (UNIT 6.3; Wingfield et al., 1997). The
proteins exist as random coils in the denaturant and their elution from the column should
be in order of their molecular weight and not be influenced by shape. If the protein is
located in several peaks there may have been incomplete solubilization during the
extraction. In this case, 8 M guanidineHCl should be used for the extraction and the
protein dispersed by sonication or by heating if necessary. Another possibility is intermolecular disulfide bond formation, in which case the DTT concentration in the sample and
column buffers should be increased. It is worth noting that the column can often be
equilibrated and eluted with lower guanidineHCl concentrations (e.g., 4 M) than those
used for the actual extraction process. Only monomeric protein should be selected for
further processing. The protein at this stage can be stored frozen, ideally at 80C.
The partially purified protein in guanidineHCl can be directly folded (see Performing
Protein Folding), or the denaturant can be exchanged by dialysis or gel filtration for 1%
to 5% (v/v) acetic or formic acids (acetonitrile at 5% to 10% v/v can also be included)
and then lyophilized. Alternatively, the protein can be acidified with trifluoroacetic acid
(TFA; 0.1% v/v) and further purified by reversed-phase chromatography (Wingfield,
1997; Wingfield et al., 1999). Useful high-flow matrices (Source 15RPC from Amersham
Biosciences) can be purchased as bulk media. These matrices may not have the resolution
of traditional prepackaged silica-based reversed-phase columns, but they have high
capacity, can be eluted at higher flow rates, and are stable over a wide range of pH. Proteins
eluted with acetonitrile/TFA are also suitable for lyophilization.
Proteins tagged with histidine residues can be purified in guanidineHCl-, urea-, or even
SDS-containing buffers, using metal chelate chromatography (UNIT 6.5). There are many
reports of on-column protein folding by binding the unfolded protein in guanidineHCl
or urea and then accomplishing folding using a reverse urea gradient (e.g., Gulnik et al.,
2001).
Proteins in urea and non-ionic or zwitterionic detergents (e.g., CHAPS) can be purified
by ion-exchange chromatography (e.g., Wingfield et al., 1990). For ion-exchange chromatography, better results have been reported using protein that has been first extracted
with guanidineHCl, and then exchanged into urea (Shire et al., 1984).
If urea is used either for extraction or for maintaining solubility during refolding, a cyanate
scavenger such as a glycine- or Tris-based buffer should be included to prevent carbamylation of the protein (Stark et al., 1960). For critical work, urea can be deionized with a
mixed bed ion-exchange resin (see discussion of Protein Folding Reagents in APPENDIX 3A).
Performing Protein Folding
Purification of
Recombinant
E. coli Proteins
Protocols for folding proteins basically involve controlled removal of the denaturant under
conditions that minimize aggregation and allow correct formation of disulfide bonds. For
overviews of the practical aspects of protein folding, see UNIT 6.4; Wetzel (1992); Thatcher
6.1.18
Supplement 30
et al. (1996); Rudolph et al. (1997); Lilie et al. (1998); De Bernardez Clark et al. (1999);
and De Bernardez Clark (2001).
To minimize nonproductive aggregation, folding is normally carried out at low protein
concentrations (e.g., 0.01 to 0.10 mg/ml); for small, single-domain proteins, higher
concentrations (e.g., 0.1 to 1.0 mg/ml) can often be tolerated. Dilution and dialysis are
the most common methods for removing the denaturant. Solubility during folding can be
maintained with co-solvents such as nondenaturing concentrations of urea (1 to 4 M;
London et al., 1974; UNIT 6.5) or guanidineHCl (0.1 to 1.5 M; Orsini and Goldberg, 1978),
arginine (0.4 to 0.8 M; De Bernardez Clark et al., 1999), nonionic detergents and lipids
(Zardeneta and Horowitz, 1994), cationic detergents (Puri et al., 1992), and polyethylene
glycol (PEG; Cleland et al., 1992). These various additives function by minimizing
intermolecular associations between sticky hydrophobic surfaces present in folding
intermediates. For further discussion of aggregation versus folding, see Goldberg et al.
(1991) and Kiefhaber et al. (1991). Additives such as ammonium sulfate, glycerol,
sucrose, enzyme substrates or inhibitors, and ligands have also been used to improve
protein folding (see Table 1 in De Bernardez Clark et al., 1999, for a useful list of additives
used in folding).
Protein expressed in the cytoplasm of E. coli is in the reduced state; this is true for both
soluble and insoluble proteins. Once insoluble protein is solubilized, it needs to be
maintained in a reduced state by the presence of reductant until protein folding is initiated.
The oxidative formation of disulfide bonds (one of the rate-limiting steps in protein
folding) can be catalyzed by low-molecular-weight thiol and disulfide pairs such as
reduced and oxidized glutathione (GSH/GSSG). Redox buffers facilitate oxidation
through thiol/disulfide exchange reactions (reviewed by Wetlaufer, 1984; Creighton,
1984; Gilbert, 1995). Normally GSH/GSSG ratios of 5 to 10 are used with a total
glutathione concentration of 1 to 5 mM (Wetlaufer, 1984). To reduce the rate of GSH loss
due to air oxidation, 1 mM EDTA should be included in the buffer (Wetlaufer et al., 1987).
The optimal concentrations and ratios of reagents must be established in an empirical
manner. Folding and oxidation are normally carried out concurrently (for further details,
see Rudolph et al., 1997). Analogous to the approach commonly used to optimize
conditions for protein crystallization, various screens have been developed to establish
initial conditions for protein renaturation and oxidation (Hofmann et al., 1995; Armstrong
et al., 1999) and kits are commercially available (FoldIt Screen from Hampton Research
at http://www.hamptonresearch.com).
For examples of preparative protein folding, see UNIT 6.5. In addition, some recent examples
from the authors laboratory are given below. The refolding of Fab fragments expressed
in E. coli (Buchner and Rudolph, 1992) is illustrative of the systematic and empirical
approach used to optimize folding conditions. Other examples of interest are described
by Kohno et al. (1990) and Grunfeld et al. (1992).
Protein-assisted folding and oxidation
Protein folding in vivo is assisted in both eukaryotes and prokaryotes by two classes of
accessory proteins: folding catalysts (for a review, see Schiene and Fischer, 2000) and
molecular chaperones (Eisenberg, 1999; Feldman and Frydman, 2000). Folding catalysts
accelerate rate-limiting steps in protein folding such as disulfide bond formation (protein
disulfide isomerases) and the rotation of X-Pro bonds (peptidyl prolyl cis-trans isomerase) during protein folding. Chaperones bind denatured or unfolded proteins thus
preventing misfolding and aggregation. The cytoplasm of E. coli is maintained in the
reduced state by thioredoxin and the glutathione/glutaredoxin pathways. In hosts where
the reduction of thioredoxin and glutathione is impaired by mutations to the thioredoxin
Purification of
Recombinant
Proteins
6.1.19
Supplement 30
reductases and glutathione reductase genes, the resultant oxidizing conditions allow the
formation of disulfide bonds in expressed proteins located in bacterial cytoplasm (Bessesste et al., 1999; cells and expression kits are commercially available from Novagen). The
periplasm of E. coli also contains protein disulfide isomerases, the Dsb enzymes, which
have thioredoxin-like folds and act as strong thiol:disulfide oxidants (Missiakkas and
Raina, 1997; Braun et al., 1999). Secretion of proteins into the periplasmic space has been
the traditional approach for producing oxidized proteins in vivo, but with the aforementioned advances in cytoplasmic oxidations, this approach is probably best suited for
proteins that are toxic to the cell when expressed in the cytoplasm (Cornelis, 2000).
As mentioned, molecular chaperones prevent aggregation by interacting transiently with
hydrophobic patches on unfolded proteins and suppressing aggregation and promoting
folding (UNIT 6.4; reviewed by Jaenicke, 1993; Ellis and Hart, 1999; Feldman and Frydman,
2000). There are now many examples of chaperone-assisted protein expression in which
the endogenous levels of the bacterial chaperones GroES and GroEL (1%) are increased
up to ten-fold by co-expression with a target protein (Cole, 1996; Goenka and Rao, 2001).
Often, increases in soluble protein expression are observed, but this is not always the case.
Chaperones have also been used in vitro as protein folding reagents and some examples
of folding in the presence of protein disulfide isomerase, peptidyl prolyl cis-trans
isomerase and GroES/GroEL are given in Rudolph et al. (1997). Protocols for the
high-level expression and rapid purification of E. coli GroEL and GroES are described
by Kamireddi et al. (1997).
Purifying Folded Protein
Once the protein has been folded, any of the purification methods discussed in Chapters
8 and 9 can be used. The number of purification steps required should be fewer than those
for a protein expressed in a soluble state because of the purification factor obtained by
preparation of washed inclusion bodies (UNIT 6.3). One of the purification methods that
should be included is gel filtration, which may be the only one required. A correctly
selected matrix should remove any remaining E. coli proteins and separate aggregated
and misfolded protein from the native folded protein. Misfolded protein may be expected
to have a larger molecular radius (higher apparent mass) than the corresponding native
protein.
Monitoring Protein Folding
The restoration of function (e.g., enzymatic or biological activity) is perhaps the best
criterion for detecting successful folding. However, it is not always practical to use activity
measurements to monitor folding. It is also worth mentioning that an unfolded protein
may become activated following the dilution required for many activity measurements.
Conversely, native proteins can be denatured or inactivated during prolonged incubation
at 37C or by adsorption to microtiter plates. The use of antibodies to monitor protein
folding is briefly reviewed by Goldberg (1991), and reviews of common spectroscopic
methods, such as circular dichroism and fluorescence, are provided in Chapter 7 and by
Schmid (1997).
BACTERIAL EXPRESSION OF PROTEINS NORMALLY GLYCOSYLATED
Purification of
Recombinant
E. coli Proteins
Because E. coli lacks glycosylation machinery, expression of glycoproteins in E. coli

systems results in the synthesis of nonglycosylated variants. Glycoproteins expressed in
E. coli are often, but not always, insoluble. In vitro folding studies with glycosylated and
nonglycosylated forms of proteins indicate that the carbohydrate can stabilize folding
6.1.20
Supplement 30
intermediates, and thus enhance folding, while not necessarily affecting the stability of
the native state (Kern et al., 1993, and references cited therein). In eukaryotic cells,
interference with protein glycosylation can lead to the formation of misfolded, aggregated, and degraded protein. This indicates that in vivo glycosylation (N-linked) may also
prevent the aggregation of folding intermediates (reviewed by Helenius, 1994). Detailed
NMR studies on glycoproteins have clearly shown that carbohydrates stabilize folded
proteins and even prevent marginally stable proteins from unfolding (for a review, see
Wyss and Wagner, 1996).
Despite potential pitfalls, many nonglycosylated protein variants have been successfully
folded from E. coli inclusion bodies. Examples include cytokines of biomedical importance such as granulocyte/macrophage colony-stimulating factor (GM-CSF; Diederichs
et al., 1991) and interleukin 5 (IL-5; Milburn et al., 1993). Inclusion body formation was
avoided in some studies by using secretion vectors; examples include GM-CSF (Walter
et al., 1992) and the extracellular domain of the human growth hormone receptor (deVos
et al., 1992). The aforementioned proteins have been crystallized and their structures
determined by X-ray crystallography, supporting the view that the structural integrity and
conformation of the proteins were not affected by the lack of glycosylation and their
respective preparative histories.
If a glycoprotein of interest is available from a eukaryotic recombinant expression system
or if the natural protein is available, then before investing time with E. coli expression, it
may be worthwhile to determine whether the protein can be denatured and refolded in
vitro. Pilot experiments can be carried out on intact protein and on protein enzymatically
deglycosylated with glycosidases and, if disulfides are present, with and without reduction. Of course, if the protein can be secreted to the periplasm, aggregation and the
necessity for in vitro folding may be avoided.
The production of deglycosylated proteins in E. coli expression systems for in vitro
biochemical and structural studies is obviously of great value; however, the proteins may
not always be suitable for in vivo studies due to low biological activity. Compared to
authentic proteins, nonglycosylated variants can have a reduced circulatory lifetime and
can exhibit increased immunogenicity and protease sensitivity (Rasmussen, 1992).
SOME EXAMPLES OF PROTEIN EXPRESSION AND PURIFICATION
Examples of protein expression and purification can be found in most biochemical
journals, two which may be especially useful: Protein Expression and Purification
(http://www.academicpress.com/pep), which covers advances in the expression and purification of recombinant proteins mainly from E. coli although other expression systems
are often included; and Current Opinion in Biotechnology, which regularly provides
updates on various aspects of recombinant protein production as well as useful reference
lists. Detailed protocols are also given in the units of this Chapter and a few recent
examples of protein expression and purification are discussed below to illustrate some of
the general approaches used to deal with soluble and insoluble E. coli protein expression.
Soluble Proteins
HIV Nef
Nef is a 205-residue myristolylated protein expressed at high levels in the early stages of
HIV infection. The protein is important for the induction of AIDS and is being actively
researched as a potential drug target. Unlike most HIV-1 and related proteins expressed
in bacteria, Nef is recovered from the soluble fraction of E. coli extracts. The purification
Purification of
Recombinant
Proteins
6.1.21
Supplement 30
protocol adopted following cell breakage and low-speed centrifugation is fairly straightforward comprising two stages of ion-exchange chromatography using DEAE-Sepharose
(weak exchanger) followed by Q Sepharose (strong exchanger) and finally gel filtration
using Superdex 75. Characterization of the purified protein yielded the following information.
1. Nef has a maximum solubility of 0.5 to 0.6 mM (10 mg/ml) in low-ionic strength
buffers at pH 7.5 to 8.0, (e.g., 5 mM TrisCl). The solubility can be increased by the
inclusion of nondenaturing concentrations (2 M) of urea, as established by titration studies
monitored by far-UV circular dichroism. Acetonitrile (5% to 10%) also increases the
solubility of protein.
2. The protein contains three cysteines (positions 54, 141, and 205), none of which are
involved in native disulfide bond formation. The cysteines at positions 54 and 205 are
solvent-exposed.
3. Digestion of the purified protein with proteases indicated rapid digestion of the
N-terminal region (residues 1-38). For example, digestion was complete with a few
minutes using relatively low concentration of trypsin (1% w/w).
The above information was exploited to increase the robustness of the purification
protocol. Low solubility was a major issue during purification and this was improved by
including 4 M urea in the extraction buffer and 2 M urea in the two anion exchange column
buffers. For the final gel filtration step, 10% acetonitrile was included to help maintain
both the solubility of Nef and fortuitously cause aggregation of some E. coli contaminants
that eluted in the void volume. Neither the urea nor the acetonitrile at the concentrations
used resulted in Nef denaturation. The problem of cysteine oxidations was circumvented
by mutating cysteines 54 and 205 to alanines. Mutation of cysteine 205 alone and
including 5 mM DTT in all the column buffers was also a satisfactory solution. The high
susceptibly of the N-terminal region to proteolytic processing indicates that it is solventaccessible and likely to be unstructured. In the case of Nef, this region can be deleted
without affecting the folding of the protein and removes the potential for heterogeneity
due to partial processing by E. coli proteases. The NMR structure of HIV Nef was
determined with protein prepared as described above (Grzesiek et al., 1997).
MAP30
MAP30 is a plant protein obtained from bitter melon that has anti-HIV and anti-tumor
activities. The 30-kDa protein is well expressed in E. coli as a soluble protein and is
purified by two stages of exchange chromatography followed by gel filtration. The
clarified extract is first applied to a DEAE-Sepharose column at pH 8.0; the majority of
MAP30 does not bind or weakly binds the exchange resin. The column flow-through and
early eluting fractions are dialyzed against pH 6.5 buffer then fractionated using SPSepharose (strong cation exchanger). The final step is gel filtration using a Superdex 200
column at pH 8.0.
Purification of
Recombinant
E. coli Proteins
There are clear similarities between the MAP30 purification scheme and the one developed for the Nef protein; both utilize an initial clean-up step using DEAE-Sepharose
followed by a second more discriminating ion-exchange step and finally a polishing
step using gel filtration. For Nef, the second ion-exchange step employs an anion-exchange resin while the MAP30 method uses a cation-exchange resin. The choice of resin
for the second step reflects the difference in the isoelectric points of these proteins. Nef
has a calculated pI of 5.95 and is positively charged at pH values greater than this.
MAP30 has a slightly basic pI of 9.00 and is negatively charged at pH values below this.
Thus, Nef binds to DEAE-Sepharose and Q-Sepharose at pH 7.4 and 8.0, respectively.
6.1.22
Supplement 30
On the other hand, MAP30 does not bind to DEAE-Sepharose at pH 7.4 but binds strongly
to a cation exchanger at pH 6.5.
Apart from purification, there is also another similarity between Nef and MAP30, namely
susceptibility to proteolytic processing during purification. As previously mentioned, the
N-terminal region (residues 1-38) of Nef is at risk for proteolysis, and to maintain the
structural integrity, especially during cell breakage and the initial processing, protease
inhibitor cocktails must be included in the buffers. MAP30 also has a region susceptible
to processing, namely, the 20 residues at the C-terminal end of the protein. Again, this
is due to the fact that this region is largely unstructured in an otherwise folded and stable
molecule (Wang et al., 1999). When purifying MAP30, standard protease inhibitors are
included during the early stages of purification and, in addition, -macroglobulin (15 to
2.0 g/mg protein) is added to the protein prior to the gel-filtration step. The macroglobulin inhibits a wide range of proteases by a trapping mechanism (Sottrup-Jensen, 1989).
If proteins are to be used for structural studies, deletion mutants can eliminate unstructured regions at the N- and C- terminal regions. Deletions of such regions from either Nef
or MAP30 do not significantly change the pI of either protein, so the same purification
procedures can be applied to the deletion mutants. Although incremental structural
determination is an important strategy in structural biology, one should always be aware
that regions deleted, even those that appear unstructured, may have important functional
roles. There are many examples of disordered proteins and protein domains that adopt
folded structures upon binding to their biological targets (for a review, see Dyson and
Wright, 2001), and in the case of Nef, it appears that the apparently unstructured
N-terminal region (residues 1-57) mediates binding to the tumor suppressor protein p53,
possibly enhancing HIV-1 replication (Greenway et al., 2002). A dual vector co-expression system for producing heteromeric complexes in E. coli (Johnson et al., 2000) may
be particularly useful for producing proteins requiring binding partners for folding and
stability.
Insoluble proteins
HIV-1 gp41 ectodomain
The membrane-associated glycoproteins of HIV-1 include gp120 and gp41, the latter
mediating membrane fusion with the host cell. These viral envelope proteins have been
the subject of intense structural analysis over the last several years as inhibition of
membrane fusion, hence viral entry, is a potential drug target in the development of
therapeutics for AIDS. A basic strategy in tackling membrane-associated proteins is to
remove the membrane-spanning region by expressing the non-membrane-associated
region or ectodomain.
The gp41 ectodomain is a 150-residue protein that is recombinantly expressed in E. coli
as an insoluble protein. The protein can be extracted from inclusion bodies with 8 M
guanidineHCl and purified by one step of gel filtration in the presence of 4 M guanidineHCl. The guanidine is removed by preparative reversed-phase HPLC and the protein
folded upon dialysis against 50 mM sodium formate at pH 3.0. The yield of folded protein
is >90%. Characterization of the protein indicates that its solubility decreases dramatically below pH 4.0. Between pH 3.0 and 4.0, the protein has an all -helical secondary
structure with a trimeric subunit structure. The protein was demonstrated to have folded
by determining its full structure at pH 3.5 using multidimensional NMR (Caffrey et al.,
1998). The protein was also crystallized from a buffer at pH 3.5 and its structure
determined by X-ray crystallography (Yang et al, 1999).
Purification of
Recombinant
Proteins
6.1.23
Supplement 30
Other insoluble proteins expressed in E. coli that exhibit acid stability similar to the gp41
ectodomain can be processed and folded using a similar scheme as described above. For
example, the HIV protease can be purified and folded with this method. The HIV protease,
after folding at pH 3.5, exhibits fair solubility up to pH 5.0, with solubility decreasing at
higher pH values. Other proteins may only be partially folded or unfolded at acidic pH
values; in these cases, the reversed-phase HPLC step could be used to simply remove the
denaturant, then the protein can be freeze dried from TFA-acetonitrile solvent and used
for folding trials.
The gp41 ectodomain contains two cysteine residues in a loop region connecting N- and
C-terminal helical domains. These cysteines do not form intramolecular disulfides and
can be substituted by alanine residues. This is a common theme. If a protein contains free
solvent-accessible cysteines that play no structural or functional role, it is often a good
idea to substitute them (usually with Ala), especially if structural studies are planned.
Human Tissue Inhibitor of Metalloprotease-2 (TIMP-2) and hepatocyte growth factor isoforms (NK1 and NK2)
The TIMP families of proteins are inhibitors of the matrix metalloproteases and are critical
effectors of extracellular matrix turnover. The hepatocyte growth factor (HGF) is a
multifunctional protein stimulating a wide range of cellular targets. The HGF gene codes
for three distinct proteins: the full-length form and two truncated isoforms that include
an N-terminal domain (N) and one-kringle (NK1) or two-kringle domains (NK2). TIMP-2
(21 kDa), NK1 (21 kDa), and NK2 (30 kDa) contain multiple disulfides that stabilize the
folded conformations. For example, TIMP-2, apart from having 12 cysteines that form 6
disulfides, contains a cysteine as the N-terminal residue. All three proteins were expressed
in E. coli as insoluble proteins, extracted with guanidineHCl and reductant, and the
unfolded protein separated by gel filtration in a similar manner to that previously
discussed. The partially purified proteins can be conveniently stored frozen in guanidineHCl at 80C for several years without deleterious effects on folding or recovery of
active protein. The folding and oxidation of the proteins are detailed in the respective
publications, Stahl et al. (1997) and Wingfield et al. (1999), but briefly, the protocols
involve equilibrium dialysis incorporating urea as a co-solvent to maintain solubility
during folding, and a glutathione-based oxido-shuffling system (redox buffer) to promote
formation of disulfide bonds (this approach is also detailed in Basic Protocol 1 in UNIT
6.5). The final stage of the purification process is gel filtration of the folded proteins, which,
apart from removing host contaminates, separates folded monomers from any misfolded
and aggregated protein.
Purification of
Recombinant
E. coli Proteins
When recombinant expressed proteins are insoluble in E. coli, the purification scheme
can be very simple as illustrated above where one or two steps of gel filtration may be all
that is required; the challenge is determining a method to fold and oxidize the protein. In
all three examples discussed above, the key to efficient folding is maintaining solubility,
whether it be by taking advantage of the acid stability of the protein and working at pH
3.5, or by including the co-solvent urea. As mentioned above, TIMP-2 has an N-terminal
cysteine residue. When this protein was originally expressed, an alanine was appended to
the N-terminus since it had been observed that partial N-terminal processing occurred
when cysteine was the terminal residue. The alanine residue was added in an effort to
produce homogeneous protein for structural studies. The purified Ala+ TIMP-2 appeared
monomeric and folded, yet was devoid of its normal inhibitory activity (Wingfield et al.,
1999). It was determined that the coordination of a zinc atom by the N-terminal cysteine
stabilized substrate binding and required a free amino terminal group. This was demonstrated by exopeptidase digestion (using aminopeptidase 1) of Ala+ TIMP-2, which
6.1.24
Supplement 30
removed the N-terminal alanine making cysteine the N-terminal residue and, thus,
restoring biological activity.
A GST fusion protein
The protein VP26 is a 12-kDa capsid protein of the herpes simplex virus and initial
attempts to directly express this protein in E. coli failed. It was possible, however, to
produce this protein at fairly high levels in E. coli as a GST fusion (Wingfield et al.,
1997a). The insoluble protein was treated in the usual manner: solubilized with guanidineHCl and partially purified by gel filtration also in guanidineHCl. The usual purification for GST fusion proteins is affinity chromatography using immobilized glutathione,
which requires that the GST moiety be folded (UNIT 6.6). Due to the low solubility of VP26
and its high propensity for aggregation, the following approach was used. First, the
VP26-GST fusion was folded from the guanidineHCl solution by equilibrium dialysis
against buffer containing 2.5 M urea, 10 mM CHAPS, and 0.25 M NaCl, and then against
the same buffer lacking the urea. The buffer additives were included to maintain protein
solubility (solubility is improved with >0.25 M NaCl, but the cleavage of the GST moiety
by thrombin is inhibited by high salt concentrations). Following cleavage of GST and
VP26, the proteins were denatured again with guanidineHCl, separated by gel filtration
and the purified VP26 refolded from urea and CHAPS as described above. As an aside,
the GST moiety is readily refolded from guanidineHCl and does not require high salt or
CHAPS to maintain solubility during the dialysis steps. The purification approach used
here may appear inelegant, but the fusion system was used not to facilitate purification,
but to facilitate expression of the protein.
PROTEIN HANDLING
Storing Purified Proteins
Purified protein should be filter-sterilized prior to storage. Millex-GV 0.22-m filters
(Millipore) employ hydrophilic membranes with low binding capacities and are recommended for most proteins. Proteins are best stored at 80C or may be stored on ice;
freezing at 20C is not recommended. Rapid freezing in small aliquots using dry
ice/ethanol mixtures is preferred to slow freezing at 20C . The addition of sucrose or
glycerol often increases protein stability during storage and during freezing and thawing
cycles (Arakawa and Timasheff, 1985; Timasheff and Arakawa, 1997). Lyophilization is
best for long-term storage; however, care should be taken in choosing the protein solvent
(Franks, 1993).
Promoting Protein Solubility and Stability
If the recombinant protein contains reactive unpaired sulfhydryl groups in the native
conformation, 1 to 5 mM DTT should be included in the column buffers during purification. However, reductant should not be used gratuitously, as the native protein may contain
intra- or intermolecular disulfide bonds, disruption of which can reduce the stability and
solubility of the protein. Reductants should be included, for example, during gel filtration
if dimers or higher aggregates need to be converted to active monomeric protein. The
presence of intermolecular (and occasionally intramolecular) disulfide bonds can be
determined analytically by SDS-PAGE under nonreducing conditions (UNIT 6.5) by pretreating proteins sequentially with iodoacetamide (to prevent artificial disulfide exchange) and then with SDS in the absence of reductant. The use of reductants can best be
rationalized once the native protein has been characterized.
Purification of
Recombinant
Proteins
6.1.25
Supplement 30
EDTA (1 to 5 mM) is often included in buffers to remove heavy metals that can catalyze
oxidative processes and inhibit certain proteases. It should be noted that EDTA will bind
to anion exchange resins (Scopes, 1994).
Other components often added to buffers to promote protein solubility during purification
include nonionic or zwitterionic detergents, low concentrations of urea (1 to 2 M), and
salt (0.5 to 1 M NaCl). These additives are compatible with ion-exchange chromatography, except for high-salt concentrations, which are compatible with hydrophobic-interaction chromatography (UNIT 8.4), affinity chromatography (Chapter 9), and gel-filtration
chromatography (UNIT 8.3). Solvent pH is one of the most important variables for maintaining protein solubility; in general, proteins are least soluble at or near their isoelectric
points.
Preventing Contamination
Precautions to prevent contamination of the protein of interest are as follows:
1. To avoid cross-contamination, especially from other recombinant proteins, dedicate
one set of chromatography resins for the purification of each protein. If this is not possible,
or if expensive prepackaged matrices are used, be sure to clean resins thoroughly after
each use. Check the manufacturers recommendations and be aware of the chemical
stability of the resin, especially for extremes of pH.
2. Store resins with preservatives (e.g., 1 mM sodium azide) and avoid storage in
phosphate buffers, which provide a good medium for bacterial growth.
3. To generate reproducible protocols using ion-exchange methods, monitor the pH and
conductivity of all buffers and column effluents (the latter ideally in-line).
4. Avoid protein cross-contamination in concentration equipment such as stirred ultrafiltration cells with ultrafiltration membranes.
5. Keep pH and conductivity probes scrupulously clean, especially when used with
solutions containing proteases. Likewise, use care when using cuvettes for UV measurements.
6. Avoid vigorous stirring of protein solutions to prevent shear denaturation, and handle
soft agarose-based column matrices carefully to prevent bead fragmentation.
Removing Pyrogens
Recombinant proteins used for in vivo studies should be free of endotoxins (pyrogenic
lipopolysaccharide derived from the bacterial outer membrane of Gram-negative bacteria). Yeast and mammalian cell hosts do not contain endotoxins; however, exogenous
contamination from water and others must be avoided. Pyrogens can be detected using
the sensitive Limulus amoebocyte lysate (LAL) assay kits available from Sigma and other
suppliers. As endotoxins are negatively charged, they will be removed by anion-exchange
chromatography. Other methods are reviewed in detail by Petch and Anspach (2000).
SCALE OF OPERATIONS AND AIMS OF PURIFICATION
Determining Scale
Purification of
Recombinant
E. coli Proteins
The amount of protein required and the level of purity will vary dramatically from
laboratory to laboratory and study to study. The following guidelines will help in planning
a strategy.
6.1.26
Supplement 30
If a Coomassie bluestained band corresponding to the expressed protein is observed on

one-dimensional SDS-PAGE analysis of a whole-cell extract, then the protein constitutes
at least 0.5% to 1% of the total protein. Wet E. coli cell paste contains 10% to 15%
protein by weight (reviewed by Neidhardt, 1987). If the level of expression is low to
average (e.g., 5%), then 1 g wet weight of cells will contain 5 mg recombinant protein.
Hence, a cell paste of 20 to 50 g (a typical yield from a 1- to 2-liter benchtop fermentation)
will contain 100 to 250 mg recombinant protein, and often two- to five-fold more.
Shaker-flask fermentations of equivalent volumes might yield 5% or 10% of these
amounts. Thus, for soluble proteins, or insoluble ones that can be refolded (with 5%
yield), significant amounts of protein can be obtained from relatively small fermentations.
For proteins secreted into the periplasm or medium, fermentations on larger scales may
be required, as expression levels are usually considerably lower than that for direct
expression.
Deciding the Aims of the Purification
There are many reasons, both scientific and commercial, for producing purified recombinant proteins. The development of laboratory-scale purification schemes that produce
pure protein (a single band on SDS-PAGE) should be relatively straightforward given the
relatively high abundance of recombinant proteins in cell extracts. Protein present at 1%
of the total cell extract requires only a 100-fold purification compared to the several
thousand-fold sometimes required for the purification of nonrecombinant proteins (reviewed by Stein, 1991). The widely used method of affinity tagging proteins allows the
nonspecialist to rapidly purify protein for biochemical and activity studies without
investment in some of the specialized equipment mentioned below. However, far more
time and expertise is required to develop protocols that produce purified recombinant
proteins having the physical and chemical homogeneity required for clinical use and for
structural determinations. Furthermore, only after detailed characterization of the isolated
protein will chemical and physical heterogeneities be revealed in enough detail for steps
to be taken to either prevent their occurrence or rationalize fractionation of modified
species.
Therapeutic proteins
Mammalian cells are the production host for many current protein therapeutics, however,
E. coli, is also used to produce major biotechnological products including insulin and
bovine growth hormone. Some advances in E. coli production of therapeutic proteins and
methods used to fold solubilized protein for industrial processes have been recently
reviewed (De Bernardez Clark, 2001; Swartz, 2001). Proteins used for clinical studies
must be manufactured according to applicable FDA guidelines that include Good Manufacturing Procedures (GMP). Sofer and Hagel (1997) provide practical coverage of
modern process development, including process chromatography and its scale-up. The
physiochemical characterization of protein pharmaceuticals can be especially challenging
and many of the methods and approaches used rely on mass spectrometry (see Chapter
16).
Structure Determination
For many investigators, a primary goal is to correlate the structure of a protein with its
function (and vice versa). Many proteins produced by recombinant DNA technology are
present only in trace amounts in nature (e.g., interferons and other cytokines; Ealick et
al., 1991), and authentic material is not available for detailed molecular characterization.
Knowledge of the 3-D structure allows a rational approach to protein engineering and the
design of drugs that modulate the biological activity of the protein. The substitution,
Purification of
Recombinant
Proteins
6.1.27
Supplement 30
deletion, and insertion of residues allow a structure-function hypothesis to be tested and

new, sometimes improved protein variants (or mutants) to be produced.
NMR Spectroscopy
It is a major challenge to produce proteins suitable for structural determination, not only
in terms of quality, but in terms of the quantity which may be required, especially for
NMR (UNIT 17.5). Many proteins, although they have native-like structure and biological
activity, are not suitable for structural determination due to, e.g., limited solubility,
conformational flexibility (floppy regions/domains), and heterogeneity of posttranslational modifications (especially carbohydrate). Often, these problems can be resolved by
a combination of protein biochemistry and protein engineering approaches and requires
a close collaboration between the structural biologist and the molecular/protein chemist.
The NMR determination of the HIV-1 Nef structure is an example of this integrated
approach (see above).
Structural determination in solution by multidimensional NMR is presently limited to
proteins 30 to 40 kDa (reviewed by Clore and Gronenborn, 1994). One of the largest
proteins solved to date is the 44-kDa trimeric SIV gp41 ectodomain (Caffrey et al., 1998).
Larger proteins can be studied incrementally (using the dissection approach) if information on the domain boundaries is known (Campbell and Downing, 1998). The sample
demands can be as high as several hundred milligrams, and larger proteins (>10 kDa)
must be uniformly labeled with various combinations of 2H, 13C, and 15N. Some of the
labeling scenarios required to solve the HIV Nef structure are presented in Table 1 of
Grzesiek et al. (1997). New developments in isotope labeling strategies are reviewed by
Goto and Kay (2000). Labeling in E. coli is achieved by growing the bacteria in minimal
medium containing one or more of the following stable (nonradioactive) isotopes:
15
NH4Cl (sole nitrogen source), [13C] glucose (sole carbon source), and 2H2O (UNIT 5.3).
The 15N and 13C labeling of the HIV protease using a 2-liter fermentor is detailed by
Yamazaki et al. (1996). Label incorporation is conveniently monitored by mass spectrometry of the purified protein.
Over the lifetime of the structural study (4 to 12 months), because of the multisample
requirements, a reliable and robust purification method is essential. It should also be noted
that the labeling requirement usually dictates that the protein be produced in bacteria,
although labeled proteins have been produced in yeast and insect cells (Goto and Kay,
2000).
For NMR purposes, the recombinant protein must be homogeneous and soluble at 1 to 3
mM concentrations, preferably with solvents below pH 7.0 and at temperatures >30C.
As measurements take many hours to complete, the presence of trace amounts of proteases
can ruin the experiment. In addition, particular attention must be paid to maintaining
solvent-accessible and reactive cysteines (unpaired) in the reduced state (usually by
including DTT or TCEP) and often cysteines are mutated to alanine residues (Wingfield
et al., 1997).
Protein crystallization and X-ray crystallography
Purification of
Recombinant
E. coli Proteins
The rate-limiting step in structure determination using X-ray crystallography is production of crystals that diffract to high resolution (UNIT 17.4). The scientists involved in the
production and characterization of the protein are often best situated to crystallize the
protein. Furthermore, once crystallization conditions have been optimized, it can be quite
easy to interest structural groups in collaboration.
6.1.28
Supplement 30
Determining optimal crystallization conditions may require as little as a few milligrams

or as much as 100 mg of pure protein. The protein itself must usually be physically and
chemically homogeneous; small amounts of protein impurities may significantly interfere
with crystallization. In general, physical homogeneity is more critical than chemical
homogeneity. Some of the methods used to establish physical and chemical homogeneity
are discussed elsewhere (Chapter 7; Jones et al., 1994). Many investigators use the sparse
matrix sampling technology to screen for initial crystallization conditions and commercial
kits are available for this purpose (e.g., Hampton Research: http://www.hamptonresearch.com/index.html. The company site also has useful tips and protocols).
The phase problem in crystallographic analysis has traditionally been solved by isomorphous replacement with heavy atoms, but over the last 10 years, multiwavelengh anomalous diffraction (MAD) has gained popularity (Hendrickson et al., 1990). For the latter
approach, selenium is incorporated into recombinant proteins via selenomethionine
(seleno-L-methionine; available from Sigma and others) using a methionine-requiring
auxotroph. In studies of the gp41 protein (mentioned above), the T7 expression system
(Novagen, http://www.novagen.com) and the host strain B834/DE3 (Novagen) were used.
Briefly, transformed cells were grown overnight in a 0.5-liter shaker flask containing
minimal media plus 1 mM methionine. Cells were collected and resuspended in 0.5 liters
of media minus methionine. The cells were grown at 37C in a small fermentor and fed
5 ml of 10 mg/ml selenomethionine. The cells were induced for 3 hr with IPTG and fed
an additional 50 mg of selenomethionine (total feed: 100 mg). Cells were collected (7.0
g wet weight) and 130 mg of pure gp41 ectodomain was isolated as described above. Mass
spectrometry indicated that the single methionine was >98% labeled. The protein was
then crystallized as previously described (Wingfield et al., 1997). For more details on
labeling using E. coli, see Chapter 5 (UNIT 5.3). Selenomethionine incorporation into
eukaryotic systems is not as successful as in E. coli; incorporation can be as high as 90%
in baculovirus, but only 60% in yeast.
The production of well-defined protein complexes for structural studies can be straightforward. For example, monomeric proteins can be expressed in bacteria which self-associate into stable complexes ranging from simple dimers (e.g., -IFN) and trimers (e.g.,
-TNF) to complex structures such as viral nucleocapsids (e.g., Hepatitis B Virus core
antigen, 180-mer). These stable (tightly associated) homopolymers are well suited for
structural studies. Heteroprotein complexes can be made by either co-expression of
protein subunits (Johnson et al., 2000; Kholod and Mustelin, 2001) or by in vitro assembly
of individual components. The former approach may be required in the case where
individual subunits are unstable (Nash et al., 1987). In contrast to stable complexes, there
are many biologically significant complexes characterized by weak association. Many
protein-protein interactions of interest, e.g., signal transduction pathways, may be somewhat transitory and involve weak interactions. In these complexes, the dissociation
constants (Kd) between proteins are <106 M, and therefore, tend to exhibit concentrationdependent reversible self-association. This behavior results in physical heterogeneity,
thus, complicating crystallization attempts. NMR has been used to examine weakly
associating systems, e.g., the binding of the CD4 determinant to HIV-1 Nef (Grzesiek et
al., 1996). To study protein-protein complexes characterized by low Kd, it may be
necessary to use protein engineering and other approaches to generate more stable and
tighter interactions.
It has been mentioned that one of the reasons for fusion tagging proteins is to increase
their potential for stable expression and accumulation. The enhancement of a proteins
physical properties, especially solubility, by appending protein (e.g., GST) or peptide
(e.g., FLAG) tags makes these fusion proteins good candidates for crystallization trials.
Purification of
Recombinant
Proteins
6.1.29
Supplement 30
Some investigators have reported problems with His-tagged proteins and it is generally
recommended to either remove this tag for structural work or use another tag.
Biophysical Studies
Low-resolution structural studies using various biophysical methodologies (Jones et al.,
1994) can be made with less material (<1 to 10 mg). Proteins for spectroscopic studies
should be >95% pure and previously fractionated on a gel-filtration column to remove
aggregated and possibly misfolded variants. The removal of aggregates is especially
important for spectroscopic studies including UV/vis, fluorescence and circular dichroism where excessive light scattering must be avoided (see Chapter 7; Colon, 1999).
Various labeling and tagging strategies can be used to aid both structural and functional
studies. The most common approach is to append affinity tags that can then be used to
immobilize the protein in a directed manner (Nilsson et al., 1997). This approach is
especially useful for studying protein interactions. Also, analogous to the in vivo protein
labeling scenarios as described above for selenomethionine, specific residues can be
modified. For example, tryptophan in recombinant proteins can be replaced by 5-hydroxytryptophan by using an E. coli Trp auxotroph. Protein thus labeled has a strong
absorbance at 310 nm that can be exploited in structure-function studies (Laue et al.,
1993).
SPECIALIZED EQUIPMENT
Breaking and Fractionating Cells
For small- to medium-scale work on a regular basis, a French press (Thermo Spectronic,
http://www.thermo.com) with a continuous-fill cell is recommended (UNIT 6.2). It is also
useful for breaking yeast cells. For large-scale work (>500 ml), the Manton-Gaulin-APV
homogenizer (APV Gaulin) is recommended. For further processing of cells and cell
lysates (e.g., UNITS 6.2 & 6.3), an ultrasonic homogenizer is required. An instrument with a
400-W (or higher) capacity is recommended (Branson, http://www.bransonultrasonics.com).
After low-speed centrifugation using standard preparative centrifuges (Beckman Coulter
Preparative Centrifuge, Avanti Series can be found at http://www.beckman.com), highspeed centrifugation is a convenient and rapid cleanup step before column chromatography (Fig. 6.1.3). With Beckman ultracentrifuges, the 45 Ti rotor is recommended. This
six-place rotor has a maximum speed of 235,000 g; with thick-walled polycarbonate
tubes, its capacity is 400 ml.
Chromatographing Proteins
Purification of
Recombinant
E. coli Proteins
Most chromatography is carried out at 4C either in a cold room or, more conveniently,
in a cold cabinet in the laboratory. The basic components of a chromatography system
are as follows: column, column matrix, pumps, a gradient-making device, UV/visible or
other detection system, and a fraction collector. These components can be bought as units
such as the AKTA Explorer or FPLC chromatograph systems (Amersham Bioscience,
http://www.apbiotech.com), which can be used for laboratory-scale to large-scale work.
Systems can also be custom assembled from individual components from Amersham and
other vendors. Column matrices can be purchased prepacked or as bulk media that are
packed in columns by the user. Ion-exchange separations, using standard low- to mediumpressure resins (agarose/dextran/cellulose-based), require at least one narrow (2.5-cm)
and one wide (5.0-cm) column with adjustable flow adapters so that the resin height can
be varied between 5 and 30 cm. Gel filtration requires columns with diameters of 1.25
6.1.30
Supplement 30
and 2.5 cm (5 cm for larger-scale work) and lengths of 60 to 100 cm. Simple gradient
makers with capacities of 150 ml to 2 liters are generally available.
Concentrating Proteins
Stirred ultrafiltration cells are recommended for laboratory-scale work. The cells range
in size from 3 ml to 2 liters and are used in conjunction with variable molecular weight
cutoff membranes (Millipore, http://www.millipore.com). For larger volumes, Millipore
also sells various systems. For smaller volumes (0.5 to 15 ml), centrifugational concentrators are available (Millipore and others). For a review of the equipment used for protein
concentration, see Harris (1989).
Making Analytical Measurements
A protein purification laboratory should have a dependable scanning UV/visible spectrophotometer, ideally an instrument with computerized data collection and analysis.
Hewlett Packard (Agilent) instruments with diode array detectors are recommended for
most routine work (http://www.chem.agilent.com). For laboratories specializing in purifying recombinant proteins from E. coli, access to a spectropolarimeter (e.g., Jasco J-810,
http://www.jascoinc.com) will be helpful for monitoring and developing folding protocols. For rapid chemical characterization and identity check of proteins, access to a mass
spectrometer is also desired (Chapter 16).
Most of the companies mentioned above have excellent Web sites where technical
information is posted. The series of handbooks on chromatographic separations published
by Amersham Biosciences can be conveniently downloaded as pdf files.
Literature Cited
Allet, B., Payton, M., Mattaliano, R.J., Gronenborn, A.M., Clore, G.M., and Wingfield, P.T. 1988. Purification
and characterization of the DNA-binding protein Ner of bacteriophage Mu. Gene 65:259-268.
Arakawa, T. and Timasheff, S.N. 1985. Theory of protein solubility. Methods Enzymol. 114:49-77.
Armstrong, N., De Lencastre, A., and Gouaux, E. 1999. A new protein folding screen: Application to the
ligand binding domain of a glutamate and kainite receptor and to a lysozyme and carbonic anhydrase.
Protein Sci. 8:1475-1483.
Asenjo, J.A. and Patrick, I. 1990. Large-scale protein purification. In Protein Purification Applications: A
Practical Approach (E.L.V. Harris and S. Angal, eds.) pp. 1-27. IRL Press, Oxford.
Baneyx, F. 1999. Recombinant protein expression in Escherichia coli. Curr. Opin. Biotechnol. 10:411-421.
Beacham, I.R. 1979. Periplasmic enzymes in Gram-negative bacteria. Int. Biochem. 10:877-883.
Ben-Bassat, A., Bauer, K., Chang, S.-Y., Myambo, K., Boosman, A., and Chang, S. 1987. Processing of the
initiation methionine from proteins: Properties of the E. coli methionine aminopeptidase and its gene
structure. J. Bacteriol. 169:751-757.
Bessette, P.H., Aslund, F., Beckwick, J., and Georgiou, G. 1999. Efficient folding of proteins with multiple
disulfide bonds in the Escherichia coli cytoplasm. Proc. Natl. Acad. Sci. U.S.A. 96:13703-13708.
Bibi, E. and Beja, O. 1994. Membrane topology of multidrug resistant protein expressed in E. coli. J. Biol.
Chem. 31:19910-19915.
Bowden, G.A., Paredes, A.M., and Georgiou, G. 1991. Structure and morphology of protein inclusion bodies
in E. coli. Biotechnology 9:725-730.
Braun, P., Gerritse, G., van Dijl, J.-M., and Quax, W.J. 1999. Improving protein secretion by engineering
components of the bacterial translocation machinery. Curr. Opin. Biotechnol. 10:376-381.
Buchner, J. and Rudolph, R. 1992. Renaturation and characterization of recombinant Fab fragments produced
in Escherichia coli. Biotechnology 9:157-162.
Burgess, R.R. and Jendrisak, J.J. 1975. A procedure for the rapid, large-scale purification of E. coli
DNA-dependent RNA polymerase involving polymin P precipitation and DNA-cellulose chromatography. J. Biol. Chem. 14:4634-4638.
Purification of
Recombinant
Proteins
6.1.31
Supplement 30
Burgess, R.R. and Knuth, M.W. 1996. Purification of a recombinant protein overproduced in Escherichia
coli. In Strategies for Protein Purification and Characterization: A Laboratory Course Manual (D.R.
Marshak, J.T. Kadonaga, R.R. Burgess, M.W. Knuth, W.A. Brennan, and S.-H. Lin, eds.) pp. 205-217 and
245-262. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Caffrey, M., Cai, M., Kaufman, J., Stahl, S., Wingfield, P.T., Covell, D.G., Gronenborn, A.M., and Clore,
G.M. 1998. Three dimensional solution structure of the 44 kDa ectodomain of SIV gp41. EMBO J.
17:4572-4584.
Campbell, I. and Downing, A.K. 1998. NMR of modular proteins. Nat. Struct. Biol. 5:496-499.
Cereghino, G.P.L. and Clegg, J.M. 1999. Applications of yeast in biotechnology: Protein production and
genetic analysis. Curr. Opin. Biotechnol. 10:422-427.
Cheng, Y.-S.E., McGowan, M.H., Kettner, C.A., Schloss, J.V., Erickson-Viitanen, S., and Yin, F.H. 1990. High
synthesis of recombinant HIV-1 protease and the recovery of active enzyme from inclusion bodies. Gene
87:243-248.
Cleary, S., Mulkerrin, M.G., and Kelley, R.F. 1989. Purification and characterization of tissue plasminogen
activator kringle-2 domain expressed in E. coli. J. Biol. Chem. 28:1884-1891.
Cleland, J.L., Builder, S.E., Swartz, J.R., Winkler,
M., Chang, J.Y., and Wang, D.I.C. 1992. Polyethylene glycol enhanced protein refolding.
Biotechnology 10:1013-1019.
Clore, G.M. and Gronenborn, A.M. 1994. Multidimensional heteronuclear nuclear magnetic resonance of
proteins. Methods Enzymol. 239:249-363.
Cole, P.A. 1996. Chaperone-assisted protein expression. Structure 4:239-242.
Colon, W. 1999. Analysis of protein structure by solution optical spectroscopy. Methods Enzymol. 309:605632.
Cornelis, P. 2000. Expressing genes in different Escherichia coli compartments. Curr. Opin. Biotechnol.
11:450-454.
Creighton, T.E. 1984. Disulfide bond formation in proteins. Methods Enzymol. 107:305-329.
Creighton, T.E. 1993. Proteins: Structures and Molecular Properties, 2nd ed. pp. 292-296. Freeman, New
York.
Dale, G.E., Broger, C., Langen, H., DArcy, A., and Struber, D. 1994. Improving protein stability through
rationally designed amino acid replacements: Solubilization of the trimethoprim-resistant type S1 dihydrofolate reductase. Protein Eng. 7:933-939.
Danley, D.E., Strick, C.A., James, L.C., Lanzetti, A.J., Otterness, I.G., Grenett, H.E., and Fuller, G.M. 1991.
Identification and characterization of a C-terminally extended form of recombinant murine IL-6. FEBS
Lett. 283:135-139.
Darby, N.J. and Creighton, T.E. 1990. Folding proteins. Nature 344:715-716.
De Bernardez Clark, E. 2001 Protein folding for industrial processes. Curr. Opin. Biotechnol. 12:202-207.
De Bernardez Clark, E., Schwartz, E., and Rudolph, R. 1999. Inhibition of aggregation side reactions during
in-vitro protein folding. Methods Enzymol. 309:217-236.
deVos, A.M., Ultsch, M., and Kossiakoff, A.A. 1992. Human growth hormone and extracellular domain of
its receptor: Crystal structure of the complex. Science 255:306-312.
Diederichs, K., Boone, T., and Karplus, A. 1991. Novel fold and putative receptor binding site of granulocyte-macrophage colony stimulating factor. Science 254:1779-1782.
DiRienzo, J.M., Nakamura, K., and Inouye, M. 1978. The outer membrane proteins of Gram-negative
bacteria: Biosynthesis, assembly and function. Annu. Rev. Biochem. 47:481-532.
Dyson, H.J. and Wright, P.E. 2001. Coupling of folding and binding for unstructured proteins. Curr. Opin.
Struct. Biol. 12:54-60.
Ealick, S.E., Cook, W.J., Vijay-Kumar, S., Carson, M., Nagabhushan, T.L., Trotta, P.P., and Bugg, C.E. 1991.
Three-dimensional structure of recombinant human interferon-gamma. Science 252:698-702.
Eisenberg, D. 1999. How chaperones protect virgin proteins. Science 285:1021-1022.
Ellis, R.J. 1994. Role of chaperones in protein folding. Curr. Opin. Struct. Biol. 4:117-122.
Ellis, R.J. 2001. Macromolecular crowding: An important but neglected aspect of the intracellular environment. Curr. Opin. Struct. Biol. 11:114-119.
Ellis, R.J. and Hart, F.U. 1999. Principles of protein folding in the cellular environment. Curr. Opin. Struct.
Biol. 9:102-110.
Purification of
Recombinant
E. coli Proteins
Feldman, D.E. and Frydman, J. 2000. Protein folding in vivo: The importance of molecular chaperones. Curr.
Opin. Struct. Biol. 1026-33.
6.1.32
Supplement 30
Fersh, A. 1999. Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein
Folding. W.H. Freeman and Company. New York.
Franks, F. 1993. Storage stabilization of proteins. In Protein Biotechnology (F. Franks, ed.) pp. 486-531.
Humana Press, Totowa, N.J.
Georgiou, G. and Valax, P. 1999. Isolating inclusion bodies from bacteria. Methods Enzymol. 309:48-58.
Gilbert, H.F. 1995. Thiol/disulfide exchange equilibria and disulfide bond stability. Methods Enzymol.
251:8-28.
Goenka, S. and Rao, C.M. 2001. Expression of recombinant -crystallin in Escherichia coli with the help of
GroEL/ES and its purification. Protein Expr. Purif. 21:260-267.
Goff, S.A. and Goldberg, M.E. 1985. Production of abnormal proteins in E. coli stimulates transcription of
lon and other heat shock genes. Cell 41:587-595.
Goldberg, M.E. 1991. Investigating protein conformation dynamics and folding with monoclonal antibodies.
Trends Biochem. Sci. 16:358-362.
Goldberg, M.E., Rudolph, R., and Jaenicke, R. 1991. A kinetic study of the competition between renaturation
and aggregation during the refolding of denatured-reduced egg white lysozyme. Biochemistry 30:27902797.
Goto, N.K. and Kay, L.E. 2000. New developments in isotope labeling strategies for protein solution NMR
spectroscopy. Curr. Opin. Struct. Biol. 10:585-592.
Greenway, A.L., McPhee, D.A., Allen, K., Johnson, R., Holloway, G., Mills, J., Azad, A., Sankovich, S., and
Lambert, P. 2002. Human immunodeficiency virus type 1 Nef binds to tumor suppressor p53 and protects
cells against p53-mediated apoptosis. J. Virol. 76:2692-2702.
Grunfeld, H., Patel, A., Shatzman, A., and Nishikawa, A.H. 1992. Effector-assisted refolding of recombinant
tissue-plasminogen activator produced in Escherichia coli. Appl. Biochem. Biotechnol. 33:117-138.
Grzesiek, S., Bax, A., Hu, J.-S., Kaufman, J.D., Palmer, I., Stahl, S.J., Tjandra, N., and Wingfield, P.T. 1997.
Refined solution structure and backbone dynamics of HIV-1 Nef. Protein Science 6:1248-1263.
Grzesiek, S., Stahl, S.J., Wingfield, P.T., and Bax, A. 1996. The CD4 determinant for downregulation by
HIV-1 Nef directly binds to Nef: Mapping of the Nef binding surface by NMR. Biochemistry 35:1025610261.
Guisz, Y., Fache, I., Campfield, L.A., Smith, F.J., Farid, A., Plaetinck, G., Van der Heydon, J., Tavernier, J.,
Fiers, W., Burns, P., and Devos, R. 1998. Efficient secretion of biological active recombinant OB protein
(leptin) in Escherichia coli, purification from the periplasm and characterization. Protein Expr. Purif.
12:249-258.
Gulnik, S.V., Afonina, E.I., Gustchina, E., Yu, B., Silva, A.M., Kim, Y., and Erickson, J.W. 2001. Utility of
(His)6 Tag for purification and refolding of proplasmepsin-2 and mutants with altered activation properties.
Protein Expr. Purif. 24:412-419.
Hammarstrom, M., Hellgren, N., Van Den Berg, S., Berglund, H., and Hard, T. 2002. Rapid screening for
improved solubility of small human proteins produced as fusion proteins in Escherichia coli. Protein Sci.
11:313-321.
Harris, E.L. 1989. Concentration of the extract. In Protein Purification Methods: A Practical Approach (E.L.V.
Harris and S. Angal, eds.) pp. 125-172. IRL Press, Oxford.
Helenius, A. 1994. How N-linked oligosaccharides affect glycoprotein folding in the endoplasmic reticulum.
Mol. Biol. Cell. 5:253-265.
Hendrickson, W.A., Horton, J.R., and LeMaster, D.M. 1990. Selenenomethionyl proteins for analysis by
multiwavelengh anomalous diffraction (MAD): A vehicle for direct determination of three-dimensional
structure. EMBO J. 9:1665-1672.
Heppel, L.A. 1967. Selective release of enzymes from bacteria. Science 156:1451-1455.
Hoffman, A., Tai, M., Wong, W., and Glabe, C.G. 1995. A sparse matrix screen to establish initial conditions
for protein renaturation. Anal. Biochem. 230:8-15.
Holland, I.B., Kenny, B., Steipe, B., and Pluckthun, A. 1990. Secretion of proteins in E. coli. Methods
Enzymol. 182:132-143.
Hopkins, T.R. 1991. Physical and chemical cell disruption for the recovery of intracellular proteins. In
Purification and Analysis of Recombinant Proteins (R. Seetharam and S.K. Sharma, eds.) pp. 57-83.
Marcel Dekker, New York.
Hwang, D.D.W., Liu, L.-F., Kuan, I.-C., Lin, L.-Y., Tam, T.-C.S., and Tam, M.F. 1999. Co-expression of
glutathione S-transferase with methionine aminopeptidase: A system of producing enriched N-terminal
processed proteins in E.coli. Biochem J. 338:335-342.
Jaenicke, R. 1993. Role of accessory proteins in protein folding. Curr. Opin. Struct. Biol. 3:104-112.
Purification of
Recombinant
Proteins
6.1.33
Supplement 30
Janson, J.-C. and Ryden, L. 1989. Protein Purification: Principles, High Resolution Methods, and Applications. VCH Publishers, New York.
Johnson, B.H. and Hecht, M.H. 1994. Recombinant proteins can be isolated from E. coli by repeated cycles
of freezing and thawing. Biotechnology 12:1357-1360.
Johnson, K., Clements, A., Venkataramani, R.N., Trievel, R.C., and Marmorstein, R. 2000. Coexpression of
proteins in bacteria using a T7-based expression plasmid: Expression of heteromeric cell cycle and
transcriptional regulatory complexes. Protein Expr. Purif. 20:435-443.
Jones, C., Mulloy, B., and Thomas, A.H. 1994. Microscopy, optical spectroscopy, and macroscopic techniques. Methods Mol. Biol. 22:1-245.
Jones, D.H., Ball, E.H., Sharpe, S., Barber, K.R., and Grant, C.W.M. 2000. Expression and membrane
assembly of a transmembrane region from Neu. Biochemistry 39:1878-1878.
Kaback, H.R. 1971. Bacterial membranes. Methods Enzymol. 22:99-120.
Kamireddi, M., Eisenstein, E., and Reddy, P. 1997. Stable expression and rapid purification of Escherichia
coli GroEL and GroES chaperones. Protein Expr. Purif. 11:47-52.
Kelley, W.S. and Stump, K.H. 1979. A rapid procedure for isolation of large quantities of E. coli DNA
polymerase 1 utilizing a polA transducing phage. J. Biol. Chem. 254:3206-3210.
Kern, G., Kern, D., Jaenicke, R., and Seckler, R.L. 1993. Kinetics of folding and association of differentially
glycosylated variants of invertase from Saccharomyces cerevisiae. Protein Sci. 2:1862-1868.
Kholod, N. and Mustelin, T. 2001. Novel vectors for co-expression of two proteins in E.coli. Biotechniques
31:322-328.
Kiefhaber, T., Rudolph, R., Kohler, H.-H., and Buchner, J. 1991. Protein aggregation in vitro and in vivo: A
quantitative model of the kinetic competition between folding and aggregation. Biotechnology 9:825-829.
Kohno, T., Carmichael, D.F., Sommer, A., and Thompson, R.C. 1990. Refolding of recombinant proteins.
Methods Enzymol. 185:187-195.
Kost, T.A. and Condreay, J.P. 1999. Recombinant baculovirus as expression vectors for insect and mammalian
cells. Curr. Opin. Biotechnol. 10:428-433.
Laue, T.M., Senear, D.F., Eaton, S., and Ross, J.B.A. 1993. 5-Hydroxytryptophan as a new intrinsic probe
for investigating protein-DNA interactions by analytical ultracentrifugation. Study of the effect of DNA
on the self-assembly of the bacteriophage cI repressor. J. Biol. Chem. 32:2469-2472.
LaVallie, E.R., DiBlasio, E.A., Kovacic, S., Grant, K.L., Schendel, P.F., and McCoy, J.M. 1993. A thioredoxin
gene fusion expression system that circumvents inclusion body formation in the E. coli cytoplasm.
Biotechnology 11:187-193.
Lilie, H., Schwartz, E. and Rudolph, R. 1998 Advances in refolding of proteins produced in E.coli. Curr.
Opin. Biotechnol. 9:497-501.
Lindwall, G., Chau, M.-F., Gardner, S.R., and Kohlstaedt, L.A. 2000. A sparse matrix approach to the
solubilization of overexpression proteins. Protein Eng. 13:67-71.
London, J., Skrzynia, C., and Goldberg, M.E. 1974. Renaturation of Escherichia coli tryptophanase after
exposure to 8 M urea. Eur. J. Biochem. 47:409-415.
Lu, H.S., Fausset, P.R., Sotos, L.S., Clogston, C.L., Rohde, M.F., Stoney, K.S., and Herman, A.C. 1993.
Isolation and characterization of three recombinant human granulocyte colony stimulating factor His to
Gln isoforms produced in E. coli. Protein Expr. Purif. 4:465-472.
Markrides, S. 1996. Strategies for achieving high-level expression of genes in Escherichia coli. Microbiol.l
Rev. 60:512-538.
Marston, F.A.O. and Hartley, D.L. 1990. Solubilization of protein aggregates. Methods Enzymol. 182:264276.
Matthew, J.B., Friend, S.H., Botelho, L.D., Lehman, L.D., Hanania, G.I., and Gurd, F.R.H. 1978. Discrete
charge calculations of potentiometric titrations for globular proteins. Biochem. Biophys. Res. Commun.
81:416-421.
Maurizi, M.R. 1992. Proteases and protein degradation in Escherichia coli. Experientia 48:178-201.
Milburn, M.V., Hassel, A.M., Lambert, M.H., Jordon, S.R., Proudfoot, A.E.I., Graber, P., and Wells, T.N.C.
1993. A novel dimer configuration revealed by the crystal structure at 2.4 angstrom resolution of human
interleukin-5. Nature 363:172-176.
Mildner, A.M., Rothrock, D.J., Leone, J.W., Bannow, C.A., Lull, J.M., Reardon, I.M., Sarcich, J.L., Howe,
W.J., Tomich, C.-S.C., Smith, C.W., Heinrikson, R.L., and Tomasselli, A.G. 1994. The HIV-1 protease as
enzyme and substrate: Mutagenesis of autolysis sites and generation of a stable mutant with retained
kinetic properties. Biochemistry 33:9405-9413.
Purification of
Recombinant
E. coli Proteins
6.1.34
Supplement 30
Miller, C.G., Strauch, K.L., Kurral, A.M., Miller, J.L., Wingfield, P.T., Mazzei, G.J., Werlen, R.C., Graber,
P., and Movva, N.R. 1987. N-Terminal methionine-specific peptidase in Salmonella typhimurium. Proc.
Natl. Acad. Sci. U.S.A. 84:2718-2772.
Miller, H.I., Henzel, W.J., Ridgway, J.B., Kuang, W.-J., Chrisholm, V., and Liu, C.-C. 1989. Cloning and
expression of a yeast ubiquitin-protein cleaving activity in E. coli. Biotechnology 7:698-704.
Missiakas, D. and Raina, S. 1997. Protein folding in the bacterial periplasm. J. Bacteriol. 179:2465-2471.
Murby, M., Uhlen, M., and Stahl, S. 1996. Upstream strategies to minimize proteolytic degradation upon
recombinant protein in Escherichia coli. Protein Expr. Purif. 7:129-136.
Nagata, K., Kikuchi, N., Ohara, O., Teraoka, H., Yoshida, N., and Kawade, Y. 1986. Purification and
characterization of recombinant murine immune interferon. FEBS Lett. 205:200-204.
Nash, H.A., Robertson, C.A., Flamm, E., Weisberg, R.A., and Miller, H. 1987. Overproduction of Escherichia
coli integration host factor, a protein with noidentical subunits. J. Bacteriol. 169:4124.
Neidhardt, F.C. 1987. Chemical composition of Escherichia coli. In Escherichia coli and Salmonella
typhimurium: Cellular and Molecular Biology (F.C. Neidhardt, ed.) pp. 3-6. American Society for
Microbiology, Washington, D.C.
Nguyen, L.H., Jenson, D.B., and Burgess, R.R. 1993. Overproduction and purification of sigma-32, the
Escherichia coli heat shock transcription factor. Protein Expr. Purif. 4:425-433.
Nilsson, J., Stahl, S., Lundeberg, J., Uhlen, M., and Nygren, P.-A. 1997. Affinity fusion strategies for detection,
purification, and immobilization of recombinant proteins. Protein Expr. Purif. 11:1-16.
Orsini, G. and Goldberg, M.E. 1978. The renaturation of reduced chymotrypsin A in guanidineHCl. J. Biol.
Chem. 253:3453-3458.
Pace, N.C, Vajdos, F., Fee, L., Grimsley, G., and Gray, T. 1995. How to measure and predict the molar
absorption coefficient of a protein Protein Sci. 4:2411-2423.
Patel, D. 1993. Chromatographic fractionation media. In Biochemistry Labfax (J.A.A. Chambers and D.
Rickwood, eds.) pp. 49-68. BIOS Scientific Publishers and Academic Press, Oxford.
Petsch, D. and Anspach, F.B. 2000. Endotoxin removal from protein solutions. J. Biotechnol. 76:97-119.
Janson, J.-C. and Ryden, L. 1998. Protein purification: Principles, high resolution methods, and applications
(2nd ed.). Wiley-LISS, New York.
Puri, N.K., Crivelli E., Cardamome, M., Fiddes, R., Bertoloini, J., Ninham, B., and Brandon, M.R. 1992.
Solubilization of growth hormone and other recombinant proteins from Escherichia coli by using a
cationic surfactant. Biochem. J. 285:871-879.
Rasmussen, J.R. 1992. Effect of glycosylation on protein function. Curr. Opin. Struct. Biol. 2:682-686.
Ren, Z. and Schaefer, T.S. 2001. Isopropyl-b-D-thiogalactosidase (IPTG)-inducible tyrosine phosphorylation
of protein in E.coli. Biotechniques 31:1254-1258.
Rudolph, R., Bohm, G., Lilie, H., and Jaenicke, R. 1997. Folding proteins. In Protein Function: A Practical
Approach. Second Edition. (T.E. Creighton, ed.) pp. 57-99. IRL Press, Oxford.
Schein, C.H. 1989. Production of soluble recombinant proteins in bacteria. Biotechnology 7:1141-1147.
Schiene, C. and Fisher, G. 2000. Enzymes that catalyze the restructuring of proteins. Curr. Opin. Struct. Biol.
10:40-45.
Schmid, F.X. 1997. Optical spectroscopy to characterize protein conformation and conformational changes.
In Protein Structure: A Practical Approach. Second Edition. (T.E. Creighton, ed.) pp. 261-296. IRL Press,
Oxford.
Schneider, C., Newman, R.A., Sutherland, D.R., Asser, U., and Greaves, M.F. 1982. A one step purification
of membrane proteins using a high affinity immunomatrix. J. Biol. Chem. 257:10766-10769.
Scopes, R.K. 1994. Protein Purification: Principles and Practice, 3rd ed. Springer-Verlag, New York and
Heidelberg.
Sherman, F., Stewart, J.W., and Tsunasawa, S. 1985. Methionine or not methionine at the beginning of a
protein. Bioessays 3:27-31.
Sherman, P.A. and Fyfe, J.A. 1990. Human immunodeficiency virus integration protein expressed in E. coli
possesses selective DNA cleaving activity. Proc. Natl. Acad. Sci. U.S.A. 87:5119-5123.
Shire, S.J., Bock, L., Ogez, J., Builder, S., Kleid, D., and Moore, D.M. 1984. Purification and immunogenicity
of fusion VP1 protein of foot and mouth disease virus. Biochemistry 23:6474-6480.
Skerra, A., Pfitzinger, I., and Pluckthun, A. 1991. The functional expression of antibody Fv fragments in
Escherichia coli: Improved vectors and a generally applicable purification technique. Biotechnology
9:273-278.
Sofer, G. and Hagel, L. 1997. Handbook of process chromatography: A guide to optimization, scale-up, and
validation. Academic Press, San Diego, Calif.
Purification of
Recombinant
Proteins
6.1.35
Supplement 30
Sottrup-Jensen, L. 1989. Alpha-macroglobulins: Structure, shape, and mechanism of proteinase complex

formation. J. Biol. Chem. 264:11539-11542.
Stahl, S.J., Wingfield, P.T., Kaufman, J.D., Pannell, L.K., Cioce, V., Sakata, H., Taylor, W.G., Rubin, J.S., and
Bottaro, D.P. 1997. Functional and biophysical characterization of recombinant human growth factor
isoforms produced in Escherichia coli. Biochem. J. 326:763-772.
Stark, G.R., Stein, W.H., and Moore, S. 1960. Reactions of cyanate present in aqueous urea with amino acids
and proteins. J. Biol. Chem. 235:3177-3181.
Stein, S. 1991. Isolation of natural proteins. In Fundamentals of Protein Biotechnology (S. Stein, ed.) pp.
137-160. Marcel Dekker, New York.
Sutcliffe, J.G., Shinnick, T.M., Green, N., and Lerner, R.A. 1983. Antibodies that react with predetermined
sites on proteins. Science 219:660-665.
Swartz, J.P. 2001. Advances in Escherichia coli production of therapeutic proteins. Curr. Opin. Biotechnol.
12:195-201.
Tanford, C. 1968. Protein denaturation. Adv. Protein Chem. 23:122-275.
Thatcher, D.R. 1996. Industrial scale purification of proteins. In Proteins LabFax (N.C. Price, ed.) pp.
131-137. BIOS Scientific Publishers, Oxford.
Thatcher, D.R. and Panayotatos, N. 1986. Purification of recombinant IFN-2. Methods Enzymol. 119:166177.
Thatcher, D.R., Wilks, P., and Chaudhuri, J. 1996. Inclusion bodies and refolding. In Proteins LabFax (N.C.
Price, ed.) pp. 119-130. BIOS Scientific Publishers, Oxford.
Timasheff, S.N. and Arakawa, T. 1997. Stabilization of protein structure by solvents. In Protein Structure: A
Practical Approach. Second Edition (T.E. Creighton, ed.) pp. 349 -363. IRL Press, Oxford.
Uhlen, M., Forberg, G., Moks, T., Hartmanis, M., and Nilsson, B. 1992. Fusion proteins in biotechnology.
Curr. Opin. Biotechnol. 3:363-369.
Ultsch, M., deVos, A.M., and Kossiakoff, A.A. 1991. Crystals of the complex between human growth hormone
and the extracellular domain of its receptor. J. Mol. Biol. 222:865-868.
Van Reis, R. and Zydney, A. 2001. Membrane separations in biotechnology. Curr. Opin. Biotechnol.
12:208-211.
Walter, H. and Johansson, G. 1986. Partitioning in aqueous two-phase systems: An overview. Anal. Biochem.
155:215-242.
Walter, M.R., Cook, W.J., Ealick, S.E., Nagabhushan, T.L., Trotta, P.P., and Bugg, C.E. 1992. Three-dimensional structure of human recombinant granulocyte-macrophage colony stimulating factor. J. Mol. Biol.
224:1075-1085.
Wang, Y.-X., Neamati N, Jacob, J., Palmer, I., Stahl, S.J., Kaufman, J.D., Huang, P.L., Huang, P.L., Winslow,
H.E., Pommier, Y., Wingfield, P.T., Lee-Huang, S., Bax, A., and Torchia, D.A. 1999. Solution structure of
anti-HIV-1 and anti-tumor protein MAP30: Structural insights into its multiple functions. Cell 99:433-442.
Watanabe, E., Tsoka, S., and Asenjo, J.A. 1994. Selection of chromatographic protein purification operations
based on physicochemical properties. Ann. N.Y. Acad. Sci. 721:348-364.
Wetlaufer, D.B. 1984. Nonenzymatic formation and isomerization of protein disulfides. Methods Enzymol.
107:301-304.
Wetlaufer, D.B., Branca, P.A., and Chen, G.-X. 1987. The oxidative folding of proteins by disulfides plus
thiol does not correlate with redox potential. Protein Eng. 1:141-146.
Wetzel, R. 1992. Principles of protein stability. Part 2Enhanced folding and stabilization of proteins by
suppression of aggregation in vitro and in vivo. In Protein Engineering: A Practical Approach (A.R. Rees,
M.J.E. Sternberg, and R. Wetzel, eds.) pp. 191-216. IRL Press, Oxford.
Widmann, M. and Christen P. 2000. Comparison of folding rates of homologous prokaryotic and eukaryotic
proteins. J. Biol. Chem. 275:18619-18622.
Wingfield, P.T., Mattaliano, R.J., MacDonald, H.R., Craig, S., Clore, G.M., Gronenborn, A.M., and Schmeissner, U. 1987a. Recombinant-derived interleukin 1 stabilized against specific deamidation. Protein Eng.
1:413-417.
Wingfield, P.T., Graber, P., Rose, K., Simona, M.G., and Hughes, G.J. 1987b. Chromatofocusing of
N-terminally processed forms of proteins: Isolation and characterization of two forms of interleukin 1
and bovine growth hormone. J. Chromatogr. 387:291-300.
Wingfield, P.T., Payton, M., Graber, P., Rose, K., Dayer, J.-M., Shaw, A.R., and Schmeissner, U. 1987c.
Purification and characterization of human interleukin 1 produced in Escherichia coli. Eur. J. Biochem.
165:537-541.
Purification of
Recombinant
E. coli Proteins
6.1.36
Supplement 30
Wingfield, P.T., Stahl, S.J., Payton, M.A., Venkatesan, S., Misra, M., and Steven, A. 1990. HIV-1 Rev
expressed in recombinant Escherichia coli: Purification polymerization and conformational properties.
Biochemistry 30:7527-7534.
Wingfield, P.T., Stahl, S.J., Williams, R.W., and Steven, A.C. 1995. Hepatitis core antigen produced in E. coli:
Conformational analysis, and in vitro assembly. Biochemistry 34:4919-4932.
Wingfield, P.T., Stahl, S.J., Kaufman, J., Zlotnick, A., Hyde, C.C., Gronenborn, A.M., and Clore G.M. 1997.
The extracellular domain of immunodeficiency virus gp41 protein: Expression in Escherichia coli,
purification and crystallization. Protein Sci. 6:1653-1660.
Wingfield, P.T., Stahl, S.J., Thomsen, D.R., Homa, F.L., Booy, F.P., Trus, B.L., and Steven, A.C. 1997a.
Hexon-only binding of VP26 reflects differences between the hexon and penton conformations of the
VP5, the major capsid protein of Herpes Simplex Virus. J. Virology 71:8955-8961.
Wingfield, P.T., Stahl, S.J., Kaufman, J., Palmer, I., Chung, V., Sax, J.K., Kleiner, D.E., and Stetler-Stevenson,
G.W. 1999. Functional and biophysical characterization of full length, recombinant human TIMP-2
produced in Escherichia coli: Comparison of wild type and N-terminal alanine substituted variant. J. Biol.
Chem. 274:21362-21368.
Wurm, F. and Bernard, A. 1999. Largescale transient expression in mammalian cells for recombinant protein
production. Curr. Opin. Biotechnol. 10:156-159.
Wyss, D.F. and Wagner, G. 1996. The structure of sugars in glycoproteins. Curr. Opin. Struct. Biol. 7:409-416.
Yamazaki, T., Hinck, A.P., Wang, Y-X., Nicholson, L.K., Torchia, D.A., Wingfield, P.T., Stahl, S.J., Kaufman,
J.D., Chang, C.-H., Domaille, P.J., and Lam, P.Y.S. 1996. Three dimensional solution structure of the
HIV-1 protease complexed with DMP 323, a novel cyclic urea-type inhibitor, determined by nuclear
magnetic resonance spectroscopy. Protein Sci. 5:495-506.
Yang, Z.-N., Mueser, T.C., Kaufman, J., Stahl, S.J., Wingfield, P.T., and Hyde, C. 1999. The structure of the
SIV gp41 ectodomain at 1.47 A. J. Struct. Biol. 126:133-144.
Yarranton, G.T. and Mountain, A. 1992. Expression of proteins in prokaryotic systemsPrinciples and case
studies. In Protein Engineering: A Practical Approach (A.R. Rees, M.J.E. Sternberg, and R. Wetzel, eds.)
pp. 303-324. IRL Press, Oxford.
Zardeneta, G. and Horowitz, P.M. 1994. Detergent, liposome, and micelle-assisted protein refolding. Anal.
Biochem. 223:1-6.
Zhang, Y., Olsen, D.R., Nguyen, K.B., Olson, P.S., Rhodes, E.T., and Mascarenhas, D. 1998. Expressoin of
eukaryotic proteins in soluble form in Escherichia coli. Protein Expr. Purif. 12:159-165.

National Institutes of Health
Bethesda, Maryland
Purification of
Recombinant
Proteins
6.1.37
Supplement 30
Preparation of Soluble Proteins from

Escherichia coli
UNIT 6.2
Once a suitable protein expression system involving Escherichia coli is developed and
optimized (UNITS 5.1 & 5.2), large-scale production of recombinant proteins (UNIT 5.3)
generates large quantities of culture material from which the protein of interest must be
purified. Harvesting (UNIT 5.3) produces cell concentrate or culture medium, depending on
the subcellular localization of the protein. Cell paste is the starting material for purification of proteins expressed in soluble form inside cells, such as interleukin 1 (IL-1).
Human IL-1 is a 153-residue (17.4-kDa) protein cytokine of biomedical importance that
plays a central role in immune and inflammatory responses. Purification of human IL-1
is used as an example of the preparation of soluble proteins from E. coli.
Bacteria containing IL-1 are lysed, and the resulting supernatant is clarified to remove
ribosomes and other particulate matter. The sample is then applied to an anion-exchange
column to separate recombinant IL-1 from cellular contaminants, such as E. coli
proteins, nucleic acids, and lipopolysaccharides. The sample is further purified through
salt precipitation and cation-exchange chromatography, then concentrated. Finally, the
IL-1 protein is applied to a gel-filtration column to separate it from remaining higherand lower-molecular-weight contaminants, the purified protein is stored frozen or is
lyophilized.
The purification protocol described is typical for a protein that is expressed in fairly high
abundance (i.e., >5% total protein) and accumulates in a soluble state. With these
expression levels, only about a 20-fold overall purification is required to obtain pure
protein. Therefore, conventional chromatographic methods can be used, and normally
only three or four purification stages are required (see Table 6.2.1 for an outline of the
procedure as applied to IL-1, including time considerations). The process can be
shortened somewhat through the use of the Pharmacia Biotech BioPilot or FPLC systems
(see Time Considerations).
SDS-PAGE (UNIT 10.1) is used to monitor column fractions for the presence of IL-1, which
is detected as a stained band (UNIT 10.5) at the expected 17.4-kDa location. This is common
practice in recombinant protein purification, as the specific assays for many proteins,
including IL-1, are relatively complex. The original expression and fermentation experiments involving IL-1 (Wingfield et al., 1986) followed procedures similar to those given
in UNIT 5.3.
CAUTION: Avoid direct contact with IL-1-containing solutions. Trace material from
aerosols or from hand contact can cause severe inflammation of the eyes. Safety glasses
and gloves should be worn.
PURIFICATION OF A PROTEIN EXPRESSED IN ESCHERICHIA COLI IN A
SOLUBLE STATE: INTERLEUKIN 1
Materials
DEAE Sepharose CL-4B resin (Pharmacia Biotech)
Anion-exchange buffer (see recipe)
0.26% (w/v) sodium hypochlorite/70% ethanol or 5% (v/v) bleach (e.g.,
Clorox)/70% ethanol
E. coli cells (50 g wet weight) from fermentation (UNIT 5.3) containing IL-1
Lysis buffer (see recipe)
BASIC
PROTOCOL
Purification of
Recombinant
Proteins
6.2.1
CPPS
Bovine pancreas DNase I and RNase A (Worthington; optional, for reducing

solution viscosity)
2 N sodium hydroxide
Ammonium sulfate, ground with mortar and pestle
Cation-exchange buffer (see recipe)
CM Sepharose CL-4B (Pharmacia Biotech)
Cation-exchange buffer/250 mM NaCl (see recipe)
Tris base
Gel-filtration buffer (see recipe)
Ultrogel AcA54 gel-permeation resin (BioSepra)
Lyophilization buffer (see recipe; optional)
2- or 3-liter sintered glass funnel with fritted disc (coarse porosity) and 5-liter
filter flask
Chromatography columns (preferably glass) with adjustable flow adapters: one
(or optionally two) 5 50 cm and one 2.5 100 cm (Pharmacia Biotech,
Amicon, or equivalent)
RK50 packing reservoir (Pharmacia Biotech)
Peristaltic pump, UV monitor, and fraction collector (Pharmacia Biotech or
equivalent)
16 150mm culture tubes
40-ml French pressure cell and rapid-fill kit (SLM-AMINCO)
Aminco laboratory press (SLM-AMINCO)
1-liter Waring commercial blender
Table 6.2.1
Day
Outline of Interleukin Purificationa
Steps (low pressure)
Preparation of DEAE Sepharose column

As for low pressure (steps 1-17)
(steps 1-3)
Cell breakage (steps 4-8)
Clarification of lysate (steps 9 and 10)
DEAE Sepharose chromatography (step 11)
SDS-PAGE of DEAE Sepharose fractions
(step 12)
(NH4)2SO4 fractionation (steps 13-15)
Dialysis (steps 16 and 17)
CM Sepharose chromatography
(steps 18-22)
SDS-PAGE of CM Sepharose fractions
(step 22)
Fast Flow (substitute for CM

Sepharose; steps 18-21)
SDS-PAGE of Fast Flow fractions
(steps 22)
Concentration (step 23a)
Superdex 75 gel filtration (substitute
for Ultrogel; steps 24-26)
Concentration (step 23a or 23b)
SDS-PAGE of Superdex 75 fractions

(step 26)
Concentration (step 27)
Ultrogel gel filtration (steps 24-26)

4
Preparation
of Soluble E. coli
Proteins
Steps (BioPilot or FPLC)
SDS-PAGE of gel-filtration fractions

(step 26)
Concentration (step 27)
aStep numbers in parentheses refer to the Basic Protocol. Chromatography materials as well as the BioPilot and FPLC
systems are from Pharmacia Biotech.
6.2.2
250, 500, and 1000-ml stainless steel beakers

Ice bucket, 4 liter
Tissue-grinder homogenizer (Polytron Model PT 10/35, Brinkmann)
Ultrasonic homogenizer, 400 W, with sound enclosure (Branson or equivalent)
Preparative centrifuge: Beckman J2-21M
Rotors for preparative centrifuge: Beckman JA-14 (capacity 6 250 ml) or JA-20
(capacity 8 50 ml)
Ultracentrifuge: Beckman Optima XL-90
Rotors for ultracentrifuge: Beckman 45Ti (capacity 6 100 ml) or 35Ti (capacity
6 94 ml)
Conductivity meter (Radiometer America)
Spectra/Por 1 dialysis tubing (Spectrum)
Gradient maker: Model 2000 (working volume 0.65 to 2 liters; Life Technologies)
200- or 400-ml stirred ultrafiltration cell and Diaflo ultrafilter PM10 or YM3
membranes (Amicon; optional)
Millex-GV 0.22-m-pore-size filter units (Millipore)
10- or 20-ml syringe
Additional materials and equipment for SDS-PAGE (UNIT 10.1) and dialysis
(APPENDIX 3B)
NOTE: All protocol steps are carried at 4C unless otherwise stated. Forces for centrifugation steps refer to the maximum g (i.e., centrifugal force at the bottom of the tubes).
Prepare anion-exchange column
1. Pour 400 to 500 ml DEAE Sepharose CL-4B ion-exchange resin into a sintered-glass
funnel and wash with several liters water followed by 1 liter anion-exchange buffer
(pH 8.5). Measure the conductivity of the starting buffer and eluted buffer to make
sure they are the same before proceeding to the next step.
The resin is supplied in 500-ml bottles as a slurry in 20% ethanol. When washing the resin,
do not allow it to run dry on the filter funnel. Laboratory vacuum (e.g., water aspirator) is
adequate for filtering.
2. Suspend the washed resin in anion-exchange buffer to 75% settled gel/25% buffer by
volume, per manufacturers recommendations. Degas in a filter flask and pour into a
5 50cm chromatography column fitted with a filling reservoir.
After settling, the height of the resin should be 20 to 25 cm (390 to 490 ml packed resin).
For details on packing columns, see UNIT 8.4. Because the solubility of gases decreases with
increases in temperature, it is usual practice to pack the column at room temperature and
then run it in a cold room or cold box.
3. Elute column with anion-exchange buffer at 100 to 150 ml/hr using a peristaltic pump.
Make sure there is no compression of column contents. Monitor the absorbance of
the effluent at 260 or 280 nm with a UV detector. Collect 15-ml fractions in 16
50mm culture tubes using a fraction collector. Check that the pH and conductivity
of the column effluent are the same as the for anion-exchange buffer applied to the
column (this indicates that the column matrix is correctly equilibrated).
The bed height should not change significantly once the column is packed. Compression
indicates that the pressure applied to the column is too high (see manufacturers recommendations for maximum flow rates).
Break cells with a French press

4. Clean bench areas that may come in direct contact with cells with 0.26% sodium
hypochlorite/70% ethanol.
Purification of
Recombinant
Proteins
6.2.3
5. Assemble the French pressure cell and and chill to 4C either by incubation in ice
or by refrigeration. Install the cell (first dried with paper towels if necessary) in the
Aminco laboratory press.
It is important to cool the equipment because pressurizing will generate heat. The 20K
rapid-fill French pressure cell (1-in.-diameter piston) has a capacity of 40 ml and can be
continuously filled while installed on the press. Before using the pressure cell, replace the
nylon ball at the end of the flow valve assembly or, at the very least, check it for distortion.
For small-scale work, a miniature French pressure cell (3/8-in.-diameter piston) with a
3.7-ml capacity is available.
6. Suspend thawed E. coli cells (50 g wet weight) with 150 ml lysis buffer using a
Waring blender. Place the suspension in a stainless steel beaker and homogenize with
the Polytron tissue-grinder homogenizer until clumps are no longer detected.
IMPORTANT NOTE: Wear disposable gloves and safety glasses while working with E.
coli. The high-pressure homogenization may generate aerosols.
The E. coli cells are stored frozen at 80C as a flattened paste in heat-sealable plastic
bags (UNIT 5.3). The cells are thawed at room temperature. Complete suspension of the cells
with the blender is important, as any visible clumps of bacteria will block the French
pressure cell. A clogged cell may have to be disassembled to clear the blockage.
7. Lyse the cells with two passes through the French press operated at 16,000 to 18,000
lb/in2 (with the high-ratio setting, pressure gauge readings between 1011 and 1135).
Chill the cell suspension to 4C after each pass through the pressure cell by incubation
on ice.
When filling the pressure cell, avoid drawing air into the cylinder to prevent foaming.
If a French press is not available, the cells can be broken by including 200 g/ml lysozyme
(Worthington) and 0.05% (w/v) sodium deoxycholate (Calbiochem) in the lysis buffer and
incubating cells 20 min at 20 to 25C with intermittent homogenization using the tissue
grinder (Burgess and Jendrisak, 1975). Cell breakage by lysozyme treatment and sonication is described in Basic Protocol 3 of UNIT 6.5.
8. Place the suspension (contained in a steel beaker) on an ice bath and, using an
ultrasonic homogenizer, sonicate 5 min at full power with 50% duty cycle (on for 0.5
sec then off for 0.5 sec). While sonicating, stir the suspension using a magnetic stirrer.
IMPORTANT NOTE: Wear sound-protection earmuffs to protect ears from ultrasonic
noise. Because sonication will generate some aerosol, use the sonicator in a microbiological hood if possible.
High viscosity reduces the rate of sedimentation of the various contaminating cellular
material and thus longer (sometimes much longer) centrifugation times are required.
Sonication reduces the viscosity of the suspension prior to centrifugation by shearing the
released DNA and RNA. The viscosity can also be reduced by digesting the lysate 15 to 30
min at 4 to 10C with bovine pancreas DNase I (25 to 50 g/ml) and RNase A (50 g/ml).
If the nucleases are used, EDTA in the lysis buffer should be replaced by 5 mM MgCl2 as
DNase requires Mg2+.
Clarify the lysate

9. Transfer sample from the beaker to centrifuge bottles and centrifuge the cell lysate
40 min at 22,000 g (e.g., in a Beckman J2-21M preparative centrifuge at 12,000
rpm using JA-14 rotor or at 13,500 rpm using JA-20 rotor), 4C. Decant the
supernatants, pool, and recentrifuge 90 min at 100,000 g (30,000 rpm in Beckman
Optima XL-90 ultracentrifuge using Ti45 rotor), 4C.
Preparation
of Soluble E. coli
Proteins
Low-speed centrifugation removes unbroken cells and large cellular debris. Highspeed centrifugation removes smaller particles such as ribosomes and membrane
6.2.4
vesicles; the Beckman 70Ti rotor (capacity 8 39 ml) can be used in the ultracentrifuge
for smaller-scale work. Clarification of the lysate can also be carried out by salt fractionation (see Background Information, section on determining solubility, for further details).
Pellets are usually discarded immediately; but see Critical Parameters and Troubleshooting, section on protein purification for further comments.
10. Dilute the supernatant from step 6 (160 ml) 1:2 (three-fold) with anion-exchange
buffer and adjust to pH 8.5 (if necessary) with 2 N NaOH. Using a conductivity meter,
measure the conductivity of the diluted supernatant. If it is higher than 5.0 to 5.3
mS/cm, reduce by dilution with water.
The conductivity of the protein solution is carefully adjusted to ensure that the proteins (in
this case contaminants) are bound to the matrix. Too high an ionic strength will reduce or
prevent binding.
The DEAE Sepharose column is normally prepared (steps 1 to 3) before lysis of the cells
is initiated. If there are any delays in applying sample to column, store the clarified lysate
at 0 to 4C (for example, in a covered beaker or flask embedded in an ice bucket). The
same applies to the other chromatographic stages.
Chromatograph cleared lysate on anion-exchange resin

11. Apply the clarified lysate (480 to 500 ml) to the DEAE Sepharose column (step 3)
at 150 ml/hr and elute the column with anion-exchange buffer. Continue the elution,
collecting 15-ml fractions, until the effluent absorbance is close to the baseline value.
In solutions above pH 7.0, IL-1 (pI 6.8) is negatively charged. Therefore, the protein
should, in principle, bind to an anion exchanger (positively charged matrix) buffered at pH
8.5. In fact, under the conditions described, IL-1 is only weakly bound to the matrix, which
allows for partial resolution from proteins that do not bind to the matrix. Much of the
unbound protein is of high molecular weight (or highly aggregated) and is partially
separated from IL-1 by the gel filtration effect of the matrix. IL-1 is therefore usually
located in the latter two-thirds (500 ml) of the column flowthrough volume.
12. Assay every second or third column fraction by SDS-PAGE (UNIT 10.1).
See Figure 6.2.1A for an example of results from SDS-PAGE.
For rapid analysis, use precast gels or the Hoefer Pharmacia Phast system. Alternatively,
if speed of purification is important, the entire flowthrough can be used, eliminating the
need to analyze separate fractions. Most protein contaminants bound to the column can
be removed by step elution with 1 M NaCl in column buffer. After use, the resin should be
unpacked from the column and washed on a sintered-glass funnel with 1 liter of 2 M
NaCl/0.5% (w/v) Triton X-100, followed by 10 liters water. If the resin is to be stored,
suspend it in 5% ethanol or 5 mM sodium azide and store at 4C. In order to avoid potential
cross-contamination, dedicate the used resin for repeat purifications of IL-1 only.
Fractionate sample with ammonium sulfate

13. Pool IL-1-containing fractions from the DEAE Sepharose column, record the
volume (500 ml), and transfer the solution to a 1-liter beaker (preferably stainless
steel). Add 30.2 g (NH4)2SO4 per 100 ml solution at 0C (51.3% saturation or 2 M
final concentration): add powdered (NH4)2SO4 slowly over 30 min, mixing gently
with a magnetic stirrer, then allow a further 30 min of mixing.
Methods for calculating the percent saturation of ammonium sulfate solutions, which
specifically refer to 0C, have been described by Wood (1976). When using solid ammonium
sulfate, calculations must include volume increases on addition of the solid to fixed volumes
(as carried out above).
Purification of
Recombinant
Proteins
6.2.5
1.0
1.0
.75
.50
0.75
V0
Vi
200
300
400
Elution volume (ml)
500
A280
.25
0
100
0.50
V0
Vi
0.25
P
0
100
200
300
400
500
Elution volume (ml)
Figure 6.2.1 Purification of IL-1. (A) SDS-PAGE analysis of samples at various stages. Analysis
was conducted on a gel of dimensions 12 cm 16 cm 1.5 mm. Lane a, purified protein (100 g
loaded); lane b, purified protein (10 g loaded); lane d, CM Sepharose pool (80%); lane e, DEAE
Sepharose pool after ammonium sulfate fractionation (56%); lane f, high-speed supernatant
(starting material for DEAE Sepharose column; 13.5%); lane g, cell lysate (12.0%). The percentages
refer to specific IL-1 contents of the fractions determined by densitomeric scanning of the
Coomassie bluestained gel lanes. Lanes c and h contain the following protein standards (low-range
standards supplied by Bio-Rad) in order of increasing migration distance: phosphorylase b (97.4
kDa), bovine serum albumin (66.2 kDa), hen egg white ovalbumin (45 kDa), bovine carbonic
anhydrase (31 kDa), soybean trypsin inhibitor (21.5 kDa), and hen white lysozyme (14.4 kDa). (B)
Analysis of results from gel filtration on Ultrogel AcA54. The excluded volume (V0) and the fully
included volume (Vi) are indicated. Inset, analytical rechromatography of the protein from the pooled
fractions (indicated P in larger chromatogram).
Preparation
of Soluble E. coli
Proteins
6.2.6
14. Centrifuge the slightly cloudy solution 30 min at 22,000 g (12,000 rpm in JA-14),
4C. Decant the supernatant into a beaker and add an additional 17 g (NH4)2SO4 per
100 ml solution (77% saturation or 3 M final concentration). Equilibrate with stirring
and centrifuge 30 min at 22,000 g, 4C.
For the addition of (NH4)SO4 follow the same method as described in step 13.
15. Decant the supernatant and drain the pellets by inverting the tubes on a paper towel.
Save the pellets.
Dialyze the fractionated sample
16. Suspend the pellets in 300 ml cation-exchange buffer and dialyze, using Spectra/Por
1 dialysis tubing, against 5 liters cation-exchange buffer. Change the dialysis buffer
at least once.
The dialysis step is conveniently performed overnight; the CM Sepharose column used in
step 18 can be prepared during this period.
The dialysis tubing is prepared by heating 30 to 60 min at 90 to 95C in 5 mM EDTA. The
tubing is then washed well with water and stored in 10% ethanol at 4C prior to use. A
suitable length of tubing is filled to about one-half to three-quarters capacity with solution
(to allow for expansion) and sealed with two knots at each end. Use gloves when handling
the tubing, check for leaks before use, and make sure the magnetic stir-bar does not rub
against the tubing. See APPENDIX 3B for further information concerning dialysis.
17. After dialysis, remove the slightly cloudy solution from the tubing and centrifuge 30
min at 22,000 g (12,000 rpm in JA-14), 4C. Save the supernatant.
Chromatograph dialyzed sample on cation-exchange resin
18. Prepare 200 to 225 ml CM Sepharose CL-4B resin by washing on a sintered-glass
funnel first with water, then with cation-exchange buffer (pH 5.7; wash as in step 1
except using different buffer). Pack the degassed resin into a 5 50cm column as
in step 2.
The packed column will have a bed height of 11 to 12 cm. The comments made in the
annotation to step 3 also apply here.
19. Elute the column using cation-exchange buffer at 100 to 150 ml/hr with a peristaltic
pump. Monitor the column effluent at 280 or 260 nm using a suitable UV detector.
Check that the pH and conductivity of the column effluent are the same as for the
buffer applied to the column.
20. Check the pH and conductivity of the dialysate supernatant from step 17 and, if
necessary, dilute with water so that the conductivity is in the range 1.0 to 1.2 mS/cm
(at 4 to 6C). Apply the clear solution to the CM Sepharose column at a flow rate
of 150 ml/hr. When the UV absorbance of the column effluent approaches baseline,
proceed to the next step.
21. Prepare a 0 to 250 mM NaCl gradient in cation-exchange buffer by adding 500 ml
buffer to the inner chamber of the gradient maker and 500 ml buffer/250 mM NaCl
to the outer chamber. Apply the gradient to the column at 150 ml/hr. Collect 15-ml
fractions.
The total volume of the gradient is 1 liter (4.5 column volumes).
At pH 5.7, IL-1 (pI 6.8) is positively charged and binds to the negatively charged
cation-exchange resin. IL-1 is eluted from the column with 100 mM NaCl, and it will be
located in the major absorbance peak (see Wingfield et al., 1986, for figure of typical elution
profile).
Purification of
Recombinant
Proteins
6.2.7
22. Monitor the progress of the gradient using an in-line conductivity meter positioned
after the absorbance flow cell. Assay column fractions for IL-1 by SDS-PAGE (UNIT
10.1) and pool fractions containing IL-1.
Deciding what fractions to pool is dictated by the fact that the remaining purification stage
is gel filtration, a method that will not remove contaminants with sizes close to that of IL-1
(17.4 kDa). As IL-1 is a well-expressed protein (>5% total protein), one can afford to be
conservative and pool for purity rather than yield.
The used CM-Sepharose matrix can be cleaned up and stored as described in the annotation
to step 12.
CM Sepharose Fast Flow or SP Sepharose FF (a strong cation exchanger; both resins are
also from Pharmacia Biotech) can be used instead of CM Sepharose CL-4B. Similar results
are obtained with either matrix, with the advantage of faster flow rates.
Concentrate the proteins

23a. To concentrate proteins by ultrafiltration: Adjust the CM Sepharose pool (150 to
250 ml) to pH 7.5 with Tris base. Assemble a 200- or 400-ml stirred ultrafiltration
cell containing a washed ultrafilter membrane, either YM3 (3-kDa cutoff) or PM10
(10-kDa cutoff). Pressurize the cell with nitrogen according to manufacturers
recommendations. Collect the effluent from the cell into a measuring cylinder and
occasionally record the absorbance at 280 nm to check that the membrane is not
leaking. When the volume remaining in the cell is 15 ml, depressurize the cell and
carefully remove the solution using a Pasteur pipet with a small length of polyethylene tubing attached to the end so as not to scratch the membrane. Use 3 ml
gel-filtration buffer to wash the membrane, adding washings to the main concentrate.
Exposure to solutions below pH 4.5 and above pH 10.5 to 11.0 often causes protein
denaturation. Hence, when adjusting the pH of protein solutions, there is less chance of
overshooting the required pH by using concentrated buffer components instead of pure acid
or base. For example, Tris base is used rather than dilute NaOH.
Select the ultrafiltration membrane pore size based on the size of the protein. The membrane
can be reused; store in 5% ethanol at 4C. It is good practice to reserve a membrane for
use with a particular protein (compare comment on resin usage) and to wash the concentration cell carefully after use.
23b. To concentrate proteins by salt precipitation: Adjust the CM Sepharose pool to pH

7.5 with Tris base and slowly add 53.9 g (NH4)2SO4 per 100 ml solution at 0C
(82.2% saturation or 3.2 M final concentration). Follow the basic salt precipitation
method (steps 13 to 15) and suspend the pellets in 18 to 20 ml gel-filtration buffer.
Conduct gel-filtration chromatography
24. Prepare 480 ml Ultrogel AcA54 resin by washing on a sintered-glass funnel with
water, then gel-filtration buffer (as in step 1); suspend washed resin in gel-filtration
buffer to 75% settled gel/25% buffer by volume and degas (step 2). Pour a slurry of
degassed resin into a 2.5 100cm chromatography column fitted with a filling
reservoir. Pack the column at 35 ml/hr.
UNITS 6.3 & 8.3 should be consulted for further details on the preparation and elution of
gel-filtration columns. The column should be prepared in advance so that the protein
samples can be applied as soon as the concentration step is completed.
Preparation
of Soluble E. coli
Proteins
The resin should be free-flowing yet concentrated enough to produce a packed bed with
one pouring. A freshly packed gel-filtration column can be checked for packing
irregularities by prerunning the column with a few colored markers. Blue dextran will
be excluded from the gel matrix and will elute at the void volume (V0, which equals
30% to 35% of the total column volume); cytochrome c (red; 12.4 kDa) will elute close
6.2.8
to the expected position of IL-1; and potassium dichromate (yellow) will be fully included
in the gel matrix and will elute at the included volume (Vi, 480 ml).
Superdex 75 gel-filtration matrix (Pharmacia Biotech) can be substituted for Ultrogel
AcA54. The former allows higher flow rates and thus is more compatible with the FPLC
and BioPilot systems. Both Superdex and the cation-exchange Fast Flow resins mentioned
above can be purchased in various prepacked columns that are useful for method development.
25. Filter the concentrated protein using a Millex-GV 0.22-m filter unit attached to a
10- or 20-ml syringe and apply to the gel-filtration column. The sample can be applied
either directly to the top of the column using a Pasteur pipet (care is required to prevent
breaking the tip and contaminating the column) or via a three-way valve and syringe
without removing the top flow adapter.
The volume of sample applied to the column (20 ml) represents 4% of the total column
volume. For columns with different dimensions, apply the same proportionate volume of
sample. The column should be 60 cm long. For analytical separations, the sample volume
should not exceed 2.5% of the column volume.
26. Elute the column at 35 ml/hr with gel-filtration buffer and collect 10-ml fractions.
The major eluting peak contains the IL-1; monitor the fractions by SDS-PAGE (UNIT
10.1) and pool fractions that contain pure protein. Save side fractions that contain small
amounts of contaminants; this material can be rechromatographed after concentration
as described in step 23a or 23b.
See Figure 6.2.1A for an example of results from SDS-PAGE.
Once the sample has been run into the column, it can be eluted with any buffer or even with
a suitable column storage solvent such as 5 mM sodium azide in water.
Concentrate and store purified protein

27. Concentrate the purified protein, if required, by ultrafiltration (see step 23a). Determine the protein concentration of purified IL-1 by measuring absorbance at 280 nm.
A molar absorbance coefficient () of 10.61 mM1 cm1 is used. This corresponds to an
absorbance of 0.63 for a 1 mg/ml solution using a 1-cm-path length cell.
28. For short-term storage (12 months), filter the protein with a Millex-GV 0.22-m
filter unit, divide the solution into sterile plastic vials, and freeze aliquots rapidly with
dry ice/ethanol. Store at 80C. For long-term storage of IL-1 (>12 months),
lyophilize the protein. Dialyze the sample using a volatile buffer such as 50 mM
ammonium bicarbonate or a nonvolatile buffer such as lyophilization buffer.
To circumvent the dialysis step, the phosphate-based lyophilization buffer can be used for
gel filtration instead of the TrisCl gel-filtration buffer.
REAGENTS AND SOLUTIONS

Use Milli-Q-purified water or equivalent in all recipes and protocol steps. For common stock solutions,
see APPENDIX 2E; for suppliers, see SUPPLIERS APPENDIX. Buffer pH and conductivities are for
solutions at 4 to 6C. Units of conductance are given in siemens (S = 1).
Anion-exchange buffer (50 mM TrisCl, pH 8.5)

Dilute 1 M TrisCl, pH 8.0 20-fold with water and adjust to pH 8.5 with NaOH.
Make immediately before use.
Conductivity of the solution is 1.57 mS/cm.
Purification of
Recombinant
Proteins
6.2.9
Cation-exchange buffer, 10 (15 mM sodium phosphate, pH 5.7/1 mM sodium azide)

19.4 g NaH2PO4H2O
1.4 g Na2HPO42H2O
0.65 g sodium azide
H2O to 1 liter
Store up to 1 month at 4C
Dilute 10-fold immediately prior to use
Conductivity of the solution is 0.9 mS/cm. Sodium azide is an antibacterial agent.
Cation-exchange buffer (1)/250 mM NaCl

14.61g NaCl
100 ml 10 cation-exchange buffer (see recipe)
H2O to 1 liter
Gel-filtration buffer (100 mM TrisCl, pH 7.5/1 mM sodium azide)
Dilute 1 M TrisCl, pH 8.0 10-fold with water and adjust to pH 7.5 with HCl. Add
sodium azide from a 1 M stock solution (65 g/liter). Make immediately before use.
Lyophilization buffer (25 mM sodium phosphate, pH 7.5/0.5 mM sodium azide)
2.2 g NaH2PO4H2O
11.9 g Na2HPO42H2O
1.3 g sodium azide
H2O to 4 liters
Make fresh and use immediately
Usually, 2 liters is required for dialysis, with one buffer change (4 liters total). Gel filtration
requires smaller volumes.
Lysis buffer
100 mM TrisCl, pH 8.0
2 mM EDTA, pH 8.0
5 mM benzamidineHCl (780 mg/liter)
Make immediately prior to use; alternatively, make ahead of time and store up to
several days at 4C.
Conductivity of the solution is 1.57 mS/cm.
It should be noted that a 1C decrease in temperature increases the pH of the Tris buffer by
0.03 pH units. Both TrisCl and EDTA stock solutions are commercially available (e.g., Life
Technologies).
BenzamidineHCl is a water-soluble serine protease inhibitor. An alternative is 50 M
4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF; Perfabloc SC, Boehringer Mannheim), a water-soluble inhibitor with the same spectrum of activity as phenylmethylsulfonyl fluoride (PMSF).
COMMENTARY
Background Information
Preparation
of Soluble E. coli
Proteins
Expression of soluble proteins

The basic stages involved in preparing soluble proteins from E. coli are achieving protein
expression, harvesting and breaking cells (or
collecting culture medium, in the case of secreted proteins), purifying proteins, and characterizing the purified protein. Choices that
must be made at each stage are briefly reviewed.
Optimizing the expression system

The basic requirements for protein expression in E. coli are discussed in UNIT 5.1. Experience has shown that it is usually possible to
express any given protein in E. coli, but
whether the protein will be expressed in a soluble and unmodified state is unpredictable.
Tinkering with the various elements of the
expression plasmid, changing the E. coli host
strains, and altering the fermentation conditions are carried out to optimize the expression
6.2.10
of unmodified soluble protein (UNIT 5.1). Use of

secretion vectors and fusion protein constructs
to prevent aggregation has been discussed elsewhere (UNITS 5.1 & 6.1). Even if efforts to express
soluble protein fail and inclusion bodies are
produced, there is often a good chance that the
protein can be extracted and folded into native
protein (see UNITS 6.4 & 6.5).
There are situations where the intrinsic
properties of a protein can preclude its expression in a soluble and stable form. Examples
include the following: (1) individual subunits
of a heterodimer, which may be unstable and
may degrade or aggregate when expressed
separately (coexpression of the subunits may
solve the problem; Nash et al., 1987); (2) proteins derived from activated precursors (UNIT 6.4;
Hlodan and Hartl, 1994); and (3) proteins in
which the native (authentic) sequences have
been modified by site-directed mutagenesis
(Chrunyk et al., 1993). It is worth noting that
the solubility of proteins that are otherwise
insoluble or poorly soluble can, conversely,
sometimes be improved by site-directed mutagenesis (Dyda et al., 1994).
Once conditions have been found that result
in the expression of soluble protein, the next
hurdle is to recover the protein in an unmodified
form. Avoiding proteolysis and chemical modification during the isolation process is crucial.
Breaking cells
Methods for breaking cells or selectively
extracting proteins are reviewed in UNIT 6.1. In
the protocol for purifying human IL-1, cells
are disrupted with a French press. This method
is the most efficient way to break E. coli cells
and is the method of choice. The equipment,
however, requires dedicated laboratory space
and may be expensive for some laboratories.
Cell breakage with lysozyme (UNIT 6.5) and/or
sonication is also frequently used; such methods are especially suited to small-scale work
(reviewed by Hopkins, 1991).
It is important to consider whether the cell
breakage method influences the final solubility
and stability of the recombinant protein in the
cell lysates. A soluble recombinant protein constituting 12% of the total bacterial protein will
be present in the cytoplasmic space at a concentration of at least 30 mg/ml, assuming a total
protein and RNA concentration in the cytoplasm of 340 mg/ml in nontransformed cells
(Zimmerman and Trach, 1991) and a 2.7:1
weight ratio of protein to RNA (Neidhart,
1987). Cell breakage can be expected to in-
crease the solubility of the recombinant protein

by a dilution effect (discussed by Zimmerman
and Trach, 1991). Cell lysis procedures, however, especially when mechanical shear is used
(e.g., French press and sonication), can produce
local heating that may have a denaturing effect
and lead to aggregation. Mechanical shearing
will also be expected to decrease the size of
nucleic acids and release polyanionic
lipopolysaccharides; both classes of coumpounds can bind nonspecifically to proteins,
especially basic proteins, thereby reducing
their solubility. Including detergents in the
lysozyme treatment may also release potent
membrane-bound proteases.
Despite these potential pitfalls, the recovery
of soluble protein is usually not dramatically
influenced by the cell breakage method, but
there is always the potential that it might be.
Protein recovery as a function of cell breakage
methodology is rarely systematically studied or
reported. Johnson and Hecht (1994) reported
that freezing and thawing of cells selectively
releases recombinant proteins located in the
cytoplasm. The freeze-thaw procedure, in principle, should be the best method for releasing
soluble proteins in an unmodified state, but its
general applicability remains to be seen.
Determining solubility
The solubility of recombinant protein in the
cell lysate or extract is usually established by
differential centrifugation (UNITS 6.1 & 5.3). Alternatively, the extract can be clarified by filtering
and applied to a small gel-filtration column. An
HPLC or FPLC gel-filtration separation in conjunction with a rapid screening method for
assaying column fractions (e.g., SDS-PAGE
using PhastSystem from Hoefer Pharmacia)
can produce a determination of both solubility
and size distribution in 2 hr or less.
Purifying protein
There are many approaches to purifying
proteins, such as expressing fusion proteins that
contain engineered affinity handles or tags (see
UNITS 5.1 & 6.1 for further details). Most soluble
proteins that are well behavedi.e., do not
contain excessive charge heterogeneityare
non-self-associating and can often be purified
by two stages of ion-exchange chromatography
and one or more polishing steps, one of which
should be gel filtration. The basic approach is
outlined in Figure 6.1.3. The purification of
human IL-1 is a typical example. Specific
accounts of the various chromatographic meth-
Purification of
Recombinant
Proteins
6.2.11
ods are found in Chapters 8 and 9; Scopes

(1993) particularly emphasizes first principles.
Characterizing protein
Once a protein has been purified, it is usually
characterized (Chapter 7) in order to establish
chemical homogeneity (primary sequence) and
physical homogeneity (size and conformation).
Not only is this information required for a
fundamental description of the protein, but it
will also give insights on how best to rationalize
the purification process. Moreover, the detection of certain heterogeneities may give clues
on how to avoid their occurrence. For example,
chemical modifications such as deamidation
may be prevented by changing one or more
purification steps that expose the protein to
extremes of pH. Other modifications that arise
from construction of the expression plasmid
itself, once recognized, can often be fixed.
Preparation
of Soluble E. coli
Proteins
Characteristics of recombinant and

authentic interleukin 1
The cytokine IL-1 and the closely related
IL-1 are synthesized mainly by monocytes
and mononuclear cells as 31-kDa cytoplasmic
precursor proteins (reviewed by Dinarello,
1989). A unique cytoplasmic cysteine protease
(IL-1-converting enzyme, or ICE) cleaves the
IL-1 precursor in half, generating the mature
form of the protein comprising the C-terminal
153 residues. The biological activities of IL-
(and IL-1) are initiated by interaction with
either type I or type II cellular receptors
(McMahan et al., 1991). Both receptors have
three immunoglobulin-like extracellular ligand-binding domains and single membranespanning segments. Another form of IL-1, the
interleukin 1 receptor antagonist (IL-1ra), is a
natural competitive antagonist of IL-1.
Authentic IL-1 been isolated from human
monocyte cell cultures by HPLC using anionexchange and gel-filtration (or reversed-phase)
matrices. A 3000-fold purification was required
to obtain 16 g protein from 5 liters of cell
culture extract (Gery and Schmidt, 1985). The
authentic protein was established to be a
nonglycosylated monomer (18 kDa), with a
pI of 6.8 and containing a single N-terminal
sequence (AlaProValArg) as predicted by the
DNA coding sequence.
The recombinant protein produced in E. coli
has the same properties as the natural product
except that N-terminal heterogeneity is often
observed. The recombinant protein usually
contains a mixture of forms with Met (20%),
Ala (67%), or Pro (13%) as the N terminus. The
Met form is derived by incomplete processing

of the initiating Met, and the Pro form is due to
cleavage of the authentic N-terminal Ala by E.
coli protease. Despite the slight differences
among the recombinant variants, partial or
complete separations have been achieved
(Wingfield et al., 1987; Yem et al., 1988).
Both the crystal structure of IL-1 (Priestle
et al., 1988) and its nuclear magnetic resonance
(NMR) structure in solution (Clore et al., 1991)
have been determined using material purified
by the protocol described here. For some NMR
studies it was necessary to produce material
with a single N terminus, and this was fortuitously achieved by replacing the N-terminal
Ala residue with a Cys residue. Purified protein
from cells expressing the mutant (N-terminal
CysProValArg) contain only N-terminal Pro. It
should be noted that deletion of the first four
residues of IL-1 has no effect on activity;
however, the presence of the unprocessed Met
reduces receptor binding 10-fold.
Interleukin 1 does not contain a disulfide
the cysteines are either buried (Cys-71) or partially buried (Cys-8)so there is no need to
include reductants in column buffers. As mentioned earlier, the authentic protein is nonglycosylated even though there is a potential Nglycosylation site (-Asn7-Cys8-Thr9-) near the
N terminus. Interestingly, when IL-1 is expressed in yeast, equal amounts of N-glycosylated (21 kDa) and nonglycosylated protein (17
kDa) are produced (Livi et al., 1991).
Other approaches to purifying recombinant
interleukin 1
Because of the biomedical importance of
IL-1, several reports have described expression and purification of the protein. Some examples are discussed.
Kronheim et al. (1986) acidified E. coli cell
lysates to pH 4 and thus precipitated 70% of
the total protein while most of the IL-1 remained soluble. IL-1 was further purified by
cation-exchange, anion-exchange, and dyematrix chromatographies (UNITS 8.2 & 9.2); 200
mg protein was recovered from 2.5 liters of
culture. The noteworthy feature of this method
is the acid precipitation stage. Extracts of E.
coli contain predominately negatively charged
(anionic) proteins: 60% have pI values between
5.0 and 6.0 and 80% between 4.5 and 6.7
(Sherwood, 1992). Adjustments of cell extracts
to pH 5.0 and below thus result in isoelectric
precipitation of substantial amounts of E. coli
protein. This is a useful purification step as long
6.2.12
as the recombinant protein remains soluble (or

does not coprecipitate) under the conditions.
In another approach, Meyers et al. (1987)
carried out ammonium sulfate fractionation directly on the E. coli extract. The IL-1 protein
was recovered in the fraction corresponding to
50% to 80% saturation. After desalting, the
protein was further purified by ion-exchange
(cation and anion) and gel-filtration chromatographies; 400 mg protein was recovered from
250 g wet weight cells.
The high-speed centrifugation step used to
remove particulate material (see Basic Protocol, step 6) can often be replaced by salt fractionation. For IL-1, advantage can be taken of
the fact that a relatively high (NH4)2SO4 concentration is required to precipitate the protein.
The disadvantage of using this approach early
in the purification is that the protein must be
desalted before being applied to an ion-exchange column.
Finally, it is of interest to note that IL-1 can
be released from E. coli cells by osmotic shock
treatment (Joseph-Liauzun et al., 1990). It is
well known that certain E. coli cytoplasmic
proteins, including thioredoxin, can be released
by osmotic shock.
Scale of procedure
The Basic Protocol described starts with 50
g cell paste and yields 400 mg pure IL-1. For
smaller (1 to 5 g) or larger (100 g) cell quantities, the method can be adapted by simply
reducing or increasing, respectively, the crosssectional area of the chromatography columns.
For example, for 5 g cells, the diameters of the
DEAE and CM Sepharose CL-4B columns are
reduced to 2.5 cm, with column lengths of 20
and 10 cm, respectively. This results in 1:4
reductions in the resin volumes compared to
those for the protocol utilizing 50 g cells. The
original gel-filtration column can be used (2.5
100 cm); however, the volume of 1:4 sample
applied should be reduced to 8 to 10 ml. Alternately, a column of about the same length (60
to 100 cm) but smaller diameter (e.g., 1.25 cm)
should be used. For discussion on scaling up
column chromatography procedures, see UNIT
8.3 (Strategic Planning and Scopes, 1993).
Critical Parameters and

Troubleshooting
High-level protein expression with good cell
yield (UNITS 5.1-5.3) is required to obtain reasonable amounts of pure protein. This is obviously
true no matter how efficient (or inefficient) the
purification protocol. Once the host/vector sys-
tem and the fermentation conditions have been

optimized and, equally important, standardized, the level and solubility of recombinant
protein in the starting material should be consistent. However, it is sensible to check both the
expression level and solubility before starting
each protein purification. The expression level
can usually be monitored by SDS-PAGE; UNIT
5.2 describes how to prepare samples for analysis by SDS-PAGE, and UNIT 10.1 gives electrophoresis procedures. Solubility can be easily
monitored by breaking a small amount of cells
(1.0 g) by sonication (UNIT 5.3) or by treating
cells with lysozyme (UNIT 6.5) and microcentrifuging the resulting cell lysate to judge whether
the protein is highly aggregated.
There are many reasons why protein expression may not be as high as anticipated and,
worse, why the expressed protein may switch
from being soluble to insoluble. For example,
faulty pH control during the fermentation may
cause insolubility. Whatever the situation, one
should be in a position to rationally decide
whether to continue with the purification or
repeat the initial fermentation.
If the protein expression level is normal
(>5%) and the protein has accumulated in a
soluble state, implementing the Basic Protocol,
which uses only standard purification methods,
should be trouble-free. Common mistakes involve buffer preparation and other trivial errors
such as pooling the wrong column fractions. As
discussed later, do not discard column fractions
until they have been completely analyzed.
A classic purification table (see for example,
Table III.1 in Dixon and Webb, 1979), has not
been presented, as the biological activities of
IL-1 could not be measured reliably in crude
E. coli cell extracts by assays available to the
author when the method was developed (Wingfield et al., 1986). As is often the case with
proteins requiring complex biological assays,
protein size analysis by SDS-PAGE is used to
follow purification. During the initial stages, it
is of course necessary to confirm the identity
of the particular band one is following, and this
can be accomplished by eluting or blotting the
protein from SDS-polyacrylamide gels and
performing N-terminal amino acid sequence
analysis. Immunoblotting with specific antibody can be used to monitor protein purification when the recombinant protein is in low
abundance (e.g., for secreted proteins in the cell
medium). Finally, it should be noted that several manufacturers (e.g., R&D Systems and
Genzyme) now supply assay kits for many
cytokines, including IL-1.
Purification of
Recombinant
Proteins
6.2.13
Cell breakage
Efficient cell breakage should be troublefree as long as the French press is operated in
accordance with the manufacturers instructions. It takes a little practice to operate the flow
valve. The aim is to generate as high a flow rate
as possible while maintaining a pressure gauge
reading of 1000. If the flow rate is too fast, the
pressure reading will drop and unbroken cells
will pass into the flow stream. Toward the end
of the run, the flow rate should be reduced, as
it becomes difficult to control the pressure.
After use the French pressure cell should be
cleaned and dried, and the flow valve ball
should be replaced. Store the cell at 4C.
Protein purification
In general, troubleshooting a purification
method will be much easier if fractions are not
discarded until the appropriate monitoring of
the purification steps is complete. When using
an established method, fractions from a chromatographic run are frequently pooled on the
basis of absorbance only and the remainder
quickly discarded. Ammonium sulfate supernatants or pellets are often discarded on the
basis of previous fractionation behavior or pilot-scale work. As stated, do not discard any
fractions until they have been checked, usually
by SDS-PAGE. If there has been a problem, it
can usually be easily sorted out if all the fractions from the various stages are still available.
If in doubt about conditions for storing fractions, freeze selected fractions at as low a temperature as possible (ideally 80C) and discard when appropriate. When freezing material, it is worthwhile to take the extra effort to
dispense small samples (<1 ml) into microcentrifuge tubes amenable for rapid analysis, if
necessary, to avoid having to thaw large volumes merely to take 10 l for SDS-PAGE.
For reproducible results, careful recording
of the pH and conductivity of starting buffers,
protein solutions, and column eluents is necessary. For example, if the protein does not bind
to the cation exchanger (step 19), the ionic
strength of the sample or column buffer may be
too high. Alternatively, the buffer pH may be
too high. Errors of this kind are avoided by
simply measuring the conductivity and pH of
all solutions at each stage. Other precautions
and critical steps relating to chromatography
procedures are mentioned in Chapters 8 and 9.
Preparation
of Soluble E. coli
Proteins
Anticipated Results
Purification results in recovery of 8 mg

purified protein per gram wet weight cells. That
result is based on a 10% expression level; IL-1

expression levels of 10% to 15% are routinely
obtained with the expression system previously
described (Wingfield et al., 1986). With a 1.5liter fermenter, at least 50 g wet weight cells/liter can be obtained using a standard complex
medium (UNIT 5.3). Thus, 400 mg protein is
obtained from 1 liter of culture, and optimal
conditions can lead to nearly twice that amount.
The yield corresponds to an overall recovery of
60% of the IL-1 originally in the cells.
Figure 6.2.1 illustrates the protein content at
various purification stages. The starting material for the final stage of gel filtration (Fig.
6.2.1A, lane d) is mainly contaminated with E.
coli proteins >44 kDa in size, and these are
easily separated from the IL-1 protein (17.4
kDa) by gel filtration. Analytical rechromatography of the protein from the pooled fractions (indicated P in Fig. 6.2.1B) reveals a
single symmetrical peak indicative of purity
and physical homogeneity (Fig. 6.2.1B inset).
A typical cation-exchange chromatogram for
the purification appears elsewhere (Wingfield
et al., 1986).
Time Considerations
Because IL-1 appears to be stable against
proteolytic degradation and other chemical
modications during purification, the speed of
purification was not critical in this case. The
low-pressure chromatographic method described in the Basic Protocol requires 4 days,
which can be shortened to 3 days using the
Pharmacia Biotech BioPilot or FPLC systems
in conjunction with matrices that allow faster
flow rates. The times required for purification
whether using low-pressure chromatography
(as described in the Basic Protocol) or mediumpressure chromatography in the FPLC or BioPilot systems are summarized in Table 6.2.1.
Literature Cited
Burgess, R.R. and Jendrisak, J.J. 1975. A procedure
for the rapid, large-scale purification of E. coli
DNA-dependent RNA polymerase involving polymin P precipitation and DNA-cellulose chromatography. J. Biol. Chem. 14:4634-4638.
Chrunyk, B.A., Evans, J., Lillquist, J., Young, P., and
Wetzel, R. 1993. Inclusion body formation and
protein stability in sequence variants of Interleukin-1. J. Biol. Chem. 268:18053-18061.
Clore, G.M., Wingfield, P.T., and Gronenborn, A.M.
1991. High-resolution structure of interleukin 1
in solution by three- and four-dimensional nuclear magnetic resonance spectroscopy. Biochemistry 30:2315-2323.
6.2.14
Dinarello, C.A. 1989. Interleukin-1 and its biologically related cytokines. Adv. Immunol. 44:153205.
Dixon, M. and Webb, E. 1979. Enzyme isolation. In
Enzymes (3rd ed.) pp. 23-46. Academic Press,
New York.
Dyda, F., Hickman, A.B., Jenkins, T.M., Engelman,
A., Craigie, R., and Davies, D.R. 1994. Crystal
structure of the catalytic domain of HIV-1 integrase: Similarity to other polynucleotidyltransferases. Science 266:1981-1986.
Gery, I. and Schmidt, J.A. 1985. Human interleukin
1. Methods Enzymol. 116:456-467.
Hlodan, R. and Hartl, F.U. 1994. How the protein
folds in the cell. In Mechanisms of Protein Folding (R.H. Pain, ed.) pp. 194-228. IRL Press,
Oxford.
Hopkins, T.R. 1991. Physical and chemical cell
disruption for the recovery of intracellular proteins. In Purification and Analysis of Recombinant Proteins (R. Seetharam and S.K. Sharma,
eds.) pp. 57-83. Marcel Dekker, New York.
Johnson, B.H. and Hecht, M.H. (1994) Recombinant proteins can be isolated from E. coli by
repeated cycles of freezing and thawing.
Bio/Technology 12:1357-1360.
Joseph-Liauzun, E., Legoux, R., Guerveno, V.,
Marchese, E., and Ferra, P. 1990. Human recombinant interleukin-1 isolated from E. coli by
simple osmotic shock. Gene 86:291-295.
Kronheim, S.R., Cantrell, M.A., Deeley, M.C.,
March, C.J., Glackin, P.J., Anderson, D.M., Hemenway, T., Merriam, J.E., Cosman, D., and
Hopp, T.P. 1986. Purification and characterization of human interleukin-1 expressed in
Escherichia coli. Bio/Technology 4:1078-1082.
Livi, G.P., Lillquist, J.S., Ferrara, A., Sathe, G.M.,
Simon, P.L., Meyers, C.A., Gorman, J.A., and
Young, P.R. 1991. Secretion of N-glycosylated
interleukin-1 in Saccharomyces cerevisiae using a leader peptide from Candida albicans.
Effect of N-linked glycosylation on biological
activity. J. Biol. Chem. 266:15348-15348.
McMahan, C.J., Slack, J.L., Mosley, B., Cosman,
D., Lupton, S.D., Brunton, L.L., Grubin, C.E.,
Wignall, J.M., Jenkins, N.A., Brannan, C.I.,
Copeland, N.G., Huebner, K., Croce, C.M., Cannizzarro, L.A., Benjamin, D., Dower, S.K.,
Spriggs, M.K., and Sims, J.E. 1991. A novel IL-1
receptor, cloned from B cells by mammalian
expression, is expressed in many cell types.
EMBO J. 10:2821-2832.
Meyers, C.A., Johanson, K.O., Miles, L.M., McDevitt, P.J., Simon, P.L., Webb, R.L., Chen, M.-J.,
Holskin, B.P., Lillquist, J.S., and Young, P.R.
1987. Purification and characterization of human
recombinant interleukin-1. J. Biol. Chem.
262:11176-11181.
Nash, H.A., Robertson, C.A., Flamm, E., Weisberg,

R.A., and Miller, H. 1987. Overproduction of
Escherichia coli integration host factor, a protein
with nonidentical subunits. J. Bacteriol.
169:4124-4127.
Neidhardt, F.C. 1987. Chemical composition of Escherichia coli. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (F.C. Neidhardt, J.L. Ingraham, K.B. Low,
B. Magasanik, M. Schaechter, and H.E. Umbarger, eds.) pp. 3-6. American Society for Microbiology, Washington, D.C.
Priestle, J.P., Schar, H.-P., and Grutter, M.G. 1988.
Crystal structure of the cytokine interleukin 1.
EMBO J. 7:339-343.
Scopes, R.K. 1994. Protein Purification: Principles
and Practice, 3rd ed. Springer-Verlag, New York
and Heidelberg.
Sherwood, R.F. 1992. Making bacterial extracts
suitable for chromatography. Meth. Mol. Biol.
11:287-305.
Wingfield, P., Payton, M., Tavernier, J., Barnes, M.,
Shaw, A., Rose, K., Simona, M.G., Demczuk, S.,
Williamson, K., and Dayer, J.M. 1986. Purification and characterization of human interleukin1 expressed in recombinant Escherichia coli.
Eur. J. Biochem. 160:491-497.
Wingfield, P.T., Graber, P., Rose, K., Simona, M.G.,
and Hughes, G.J. 1987. Chromatofocusing on
N-terminally processed forms of proteins. J.
Chromatogr. 387:291-300.
Wood, W.I. 1976. Tables for the preparation of ammonium sulfate solutions. Anal. Biochem.
73:250-257.
Yem, A.W., Richard, K.A., Staite, N.D., and Deibel,
M.R. 1988. Resolution and biological properties
of three N-terminal analogues of recombinant
human interleukin-1. Lymphokine Res. 7:8592.
Zimmerman, S.B. and Trach, S. 1991. Estimation of
macromolecular concentrations and excluded
volume effects in the cytoplasm of Escherichia
coli. J. Mol. Biol. 222:599-620.
Key Reference
Wingfield et al., 1986. See above.
The original publication on which Basic Protocol 1
is based.

Bethesda, Maryland
Purification of
Recombinant
Proteins
6.2.15
Preparation and Extraction of

Insoluble (Inclusion-Body) Proteins
from Escherichia coli
UNIT 6.3
High-level expression of many recombinant proteins in Escherichia coli leads to the

formation of highly aggregated protein commonly referred to as inclusion bodies (UNITS
5.1 & 6.1). Inclusion bodies are normally formed in the cytoplasm; alternatively, if a
secretion vector is used, they can form in the periplasmic space.
Inclusion bodies recovered from cell lysates by low-speed centrifugation are heavily
contaminated with E. coli cell wall and outer membrane components. The latter are largely
removed by selective extraction with detergents and low concentrations of either urea or
guanidineHCl to produce so-called washed pellets. These basic steps result in a significant purification of the recombinant protein, which usually makes up 60% of the washed
pellet protein. The challenge, therefore, is not to purify the recombinant-derived protein,
but to solubilize it and then fold it into native and biologically active protein.
Basic Protocol 1 describes preparation of washed pellets and solubilization of the protein
using guanidineHCl. The extracted protein, which is unfolded, is either directly folded
as described in UNIT 6.5 or further purified by gel filtration in the presence of guanidineHCl
as in Basic Protocol 2. A support protocol describes the removal of guanidineHCl from
column fractions so they can be monitored by SDS-PAGE (UNIT 10.1).
PREPARATION AND EXTRACTION OF INSOLUBLE (INCLUSION-BODY)
PROTEINS FROM ESCHERICHIA COLI
BASIC
PROTOCOL 1
Bacterial cells are lysed using a French press, and inclusion bodies in the cell lysate are
pelleted by low-speed centrifugation. The pellet fraction is washed (preextracted) with
urea and Triton X-100 to remove E. coli membrane and cell wall material. GuanidineHCl
(8 M) and dithiothreitol (DTT) are used to solubilize the washed pellet protein. Extraction
with the denaturant simultaneously dissociates protein-protein interactions and unfolds
the protein. As a result, the extracted protein consists (ideally) of unfolded monomers,
with sulfhydryl groups (if present) in the reduced state.
Materials
E. coli cells from fermentation (UNIT 5.3) containing the protein of interest
Lysis buffer (see recipe)
Wash buffer (see recipe), with and without urea and Triton X-100
Extraction buffer (see recipe)
250- and 500-ml stainless steel beakers
0.22-m syringe filters (e.g., Millex from Millipore)
20-ml disposable syringe
Additional equipment for breaking cells, homogenizing cells and pellets and
centrifuging at low and high speeds (UNIT 6.2)
Break cells and prepare clarified lysate
1. Place thawed E. coli cells in a stainless steel beaker. Add 4 ml lysis buffer per gram
wet weight of cells. Keep bacterial cells cool by placing the beaker on ice in an ice
bucket.
The cells can be pretreated with lysozyme prior to lysis in the French press. Lysozyme
treatment involves incubating cells 20 min at 20 to 25C in lysis buffer supplemented
Contributed by Ira Palmer and Paul T. Wingfield
Purification of
Recombinant
Proteins
6.3.1
CPPS
with 200 g/ml lysozyme, with intermittent homogenization using a tissue grinder. It should
be emphasized that this optional step is carried out before French press breakage and is
not simply an alternative method of cell breakage (compare the comments made in the
annotation to step 4 of UNIT 6.2). Its purpose is to aid removal of the peptidoglycan and
outer membrane protein contaminants during the washing steps (steps 6 to 9; for further
details see UNIT 6.1 and Fig. 6.1.5). An example of this approach is given in Basic Protocol
1 of UNIT 6.5.
2. Suspend cells using a Waring blender and homogenize using the Polytron tissuegrinder homogenizer until all clumps are disrupted, as described in UNIT 6.2, step 3.
3. Lyse cells with two passes through the French pressure cell operated at 16,000 to
18,000 lb/in2 (with the high-ratio setting, pressure gauge readings between 1011 and
1135), chilling the cell suspension to 4C after each pass, as described in UNIT 6.2,
steps 2 and 4.
4. Reduce the viscosity of the suspension by sonicating 5 min at full power with 50%
duty cycle (on for 5 sec, off for 5 sec) using an ultrasonic homogenizer, as described
in UNIT 6.2, step 5.
5. Clarify the lysed cell suspension by centrifuging 1 hr at 22,000 g (12,000 rpm in a
JA-14 rotor in a Beckman J2-21M centrifuge), 4C.
Unbroken cells, large cellular debris, and the inclusion body protein will be pelleted.
The JA-14 rotor uses 250-ml centrifuge bottles. For processing smaller volumes the
Beckman JA-20 rotor (or equivalent) with 50-ml tubes can be used, at 13,500 rpm (22,000
g).
The procedure for dealing with insoluble inclusion-body proteins now diverges from that
for purifying soluble proteins (UNIT 6.2).
Prepare washed pellets

6. Carefully pour off the supernatant from the pellet. Using a tissue homogenizer,
suspend the pellet with 4 to 6 ml wash buffer per gram wet weight cells.
Complete homogenization of the pellet is important to wash out soluble proteins and
cellular components. Removal of cell wall and outer membrane material can be improved
by increasing the amount of wash solution to 10 ml per gram cells.
The concentration of urea and Triton X-100 in the wash buffer can be varied. The urea
concentration is usually between 1 and 4 M; higher concentrations may result in partial
solubilization of the recombinant proteins. The usual detergent concentration is 0.5% to
5%. Triton X-100 will not solubilize inclusion body proteins; it is included to help extract
lipid and membrane-associated proteins.
7. Centrifuge the suspension 30 min at 22,000 g (12,000 rpm in JA-14), 4C. Discard
supernatant and, using the tissue homogenizer, suspend the pellet in 4 to 6 ml wash
buffer per gram wet weight of cells.
8. Repeat step 7 two more times.
If the supernatant is still cloudy or colored, continue washing the pellet until the supernatant is clear.
9. Suspend the pellet with wash buffer minus the Triton X-100 and urea, using 4 to 6
ml buffer per gram wet cells. Centrifuge 30 min at 22,000 g (12,000 rpm in JA-14),
4C.
Preparation and
Extraction of
Inclusion Bodies
The final wash removes excess Triton X-100 from the pellet.
6.3.2
If necessary the washed pellets can be stored at 80C. It is better to store material at this
stage rather than after the extraction stage (see comments to step 13).
Extract recombinant protein from washed pellets with guanidineHCl

10. Using the tissue homogenizer, suspend the pellet with guanidineHCl-containing
extraction buffer. Use 0.5 to 1.0 ml buffer per gram wet weight of original cells if the
extract will be subjected to gel filtration, and 2 to 4 ml buffer if the extract will be
used in protein folding procedures. Perform this step at room temperature.
To estimate the amount of recombinant protein in the washed pellets, use the following
guidelines. (1) An expression level of 1% corresponds to 1 mg recombinant protein per 1
g wet cells. (2) The recovery of highly aggregated recombinant protein in the washed pellets
is 75% that originally present in the cells. (3) About 60% of the total washed pellet protein
is recombinant-derived. Thus, if 50 g cells is processed and the expression level is 5%, the
washed pellets contain 200 mg recombinant protein.
The total amount of recombinant-derived protein in washed pellets can be directly determined by measuring the total protein concentration or by analyzing the washed pellets via
SDS-PAGE (see Support Protocol and UNIT 10.1) to determine the proportions of the protein
constituents.
For gel-filtration purposes, the pellets from 50 g wet weight E. coli cells are solubilized
with 40 to 50 ml extraction buffer (see Basic Protocol 2); the concentration of recombinant
protein in the extract will be 4 to 5 mg/ml. For direct protein folding (UNIT 6.5), the pellets
are extracted with 100 to 200 ml buffer, and the concentration of recombinant protein 1 to
2 mg/ml. If the washed pellet is heavily contaminated with outer cell wall and peptidoglycan
material, the extract must be diluted further with extraction buffer (usually 1:1 to 1:3) to
reduce the viscosity before it can be used for chromatography.
11. Centrifuge the suspension 1 hr at 100,000 g (30,000 rpm in Ti45 rotor in a Beckman
Optima XL-90 ultracentrifuge), 4C.
For volumes <250 ml the Beckman 70Ti rotor (capacity 6 39 ml) can be used at 32,000
rpm (100,000 g).
12. Carefully pour off the supernatant from the pellet. Filter the supernatant through a
0.22-m syringe filter attached to a 20-ml disposable syringe.
The filter removes unpelleted large cell wall debris that will clog most chromatography
columns.
13. Use the clarified inclusion body extract for preparing folded protein (UNIT 6.5) or purify
further by gel filtration (see Basic Protocol 2).
The extract can be stored at 80C until required. Freeze in plastic (or polyethylene)
containers rather than glass. Divide sample into 10- to 20-ml aliquots instead of freezing
in one large lot and fill containers to only 50% to 75% capacity.
MEDIUM-PRESSURE GEL-FILTRATION CHROMATOGRAPHY IN THE

PRESENCE OF GUANIDINE HYDROCHLORIDE
BASIC
PROTOCOL 2
Washed, extracted pellets (see Basic Protocol 1) contain >50% recombinant protein and
are used as the starting material for purification of the protein of interest by gel-filtration
chromatography. Superdex 200 gel-filtration medium, which allows high flow rates, is
washed and packed into a column. The column is equilibrated at 4C and the sample is
applied.
Assay of column fractions by gel electrophoresis in the presence of SDS is complicated
by the fact that guanidineHCl forms a precipitate with SDS. Therefore, preparing samples
for gel analysis involves selective precipitation of protein from guanidineHCl prior to
Purification of
Recombinant
Proteins
6.3.3
SDS-PAGE (see Support Protocol). The purified (or partially) purified protein is used as
the starting material for procedures (e.g., UNIT 6.5) in which the denatured protein is folded
into a native and biologically active structure.
Materials
Gel-filtration medium: Superdex 200 PG (preparative grade; Pharmacia Biotech)
5% (v/v) ethanol
Gel-filtration buffer (see recipe)
GuanidineHCl extract of E. coli cells containing the protein of interest (see Basic
Protocol 1)
4- to 6-liter plastic beaker
Chromatography column: Pharmacia Biotech XK 16/100, 26/100, or 50/100
Packing reservoir: Pharmacia Biotech RK 16/26 (for 16- and 26-mm-i.d. columns)
and RK 50 (for 50-mm-i.d. column)
Chromatography pump: Pharmacia Biotech P-6000 or P-500
Injection valve (to select between sample loop and pump)
UV monitor and fraction collector
Sample loop (volume determined by size of column)
NOTE: The various components of the chromatography system (pumps, valves, monitors,
and sample loops) listed separately above are supplied as components of the BioPilot
chromatography system (Pharmacia Biotech), which is used to run the XK 50/100
column. The smaller XK columns (2.6 and 2.5 cm i.d.) are run using the FPLC chromatography system (also from Pharmacia Biotech), which is designed for small- to mediumscale work. For further details on this equipment see the manufacturers literature (e.g.,
Process Products, Pharmacia Biotech).
NOTE: Perform steps 1 to 11 at room temperature. After the column is packed, equilibrate
and elute at 4C.
Pack the column
1. Wash the gel-filtration medium in a large plastic beaker with 5% ethanol. Let the
medium settle and adjust the volume of liquid to give a gel slurry concentration of
65% to 75%.
The XK 16/100, 26/100, and 50/100 columns are 100 cm long and have inner diameters of
16, 26, and 50 mm, respectively. Hence, for an XK 50/100 column, column volume = radius
(2.5 cm)2 3.1416 bed height (97 cm) 1900 ml, and 2 liters preparative-grade
Superdex 200 is required. To pack this column, the gel medium is suspended in 5% ethanol
to give a total volume of 3 liters which corresponds to 70% gel slurry (it should be noted
that the RK 50 reservoir has a capacity of 1 liter, so the 3 liters of gel slurry can be poured
in a single operation).
2. Fix the chromatography column in an upright position, using a level to adjust the
position. Attach the packing reservoir.
3. Add sufficient 5% ethanol to displace the air from a few centimeters of the bottom
of the column. Clamp off the bottom of the column.
4. Gently mix the gel-filtration medium in the plastic beaker to an even slurry of 70%
medium suspended in 5% ethanol.
5. Degas the suspension 5 to 10 min using a vacuum flask and laboratory vacuum.
Preparation and
Extraction of
Inclusion Bodies
The ethanol is included to reduce the surface tension and density of the solvent, thus
allowing air bubbles that form to rise to the surface more quickly.
6.3.4
6. Carefully pour the slurry of medium into the column, introducing material along the
side of the column to avoid creating air bubbles.
7. Let the column stand 5 min and then unclamp the bottom of the column.
8. Attach the chromatography pump to the packing reservoir and pump 5% ethanol
(degassed) into the column at an appropriate flow rate (based on manufacturers
instructions). Pack the column at a pressure greater than the pressure at which the
column will be run (up to twice as high), but not greater than the maximum pressure
rating of the column.
The XK 50/100 column (rated to 0.5 MPa) is packed at 20 to 30 ml/hr and 0.4 MPa.
9. After the medium has settled, turn off the pump and close the bottom of the column.
Pipet fluid from the reservoir and remove the reservoir.
Once the column has been packed, be careful to prevent air from entering the column bed.
Air will disturb the bed and reduce the column separation resolution.
10. Attach the column top adapter to the column. Place the top of the adapter onto the
top of the packed medium and gently compress the medium.
11. Reattach the pump to the column and wash the column with water at a flow rate that
will generate the maximum pressure to be used. If the medium continues to settle,
readjust the top adapter to maintain a firm fit against the gel.
From this point onward, perform all steps at 4C.
Equilibrate the column
12. Equilibrate the column with at least 1 column volume of gel-filtration buffer.
Although the proteins were extracted with buffer containing 8 M guanidineHCl (see Basic
Protocol 1), the gel-filtration buffer contains only 4 M guanidineHCl. The concentration
is reduced to allow faster flow rates and for reasons of economy. Most proteins remain
unfolded at the lower guanidineHCl concentration. If, however, the protein elutes in an
anomalous manner (e.g., in more than one peak or at an elution position not consistent
with its size), and assuming there is adequate reducing agent present, then try increasing
the guanidineHCl concentration in the gel-filtration buffer.
13. Measure the actual flow rate while running the column at a flow rate that generates
a back pressure about one-half of that generated when packing the column (step 8).
For an XK 50/100 column packed using Superdex 200 at 0.4 MPa, a running pressure of
0.2 MPa is used, which generates flow rates of 5 to 10 ml/min that are equivalent to linear
flow rates of 15.3 to 30.6 cm/hr. The linear flow rate equals the flow rate (ml/hr)/cross-sectional area (cm2). At these flow rates it takes between 3 and 6 hr to complete the
chromatography.
14. Connect tubing from the end of the column to the UV monitor and the fraction
collector.
Apply the sample
15. Load the sample loop with the guanidineHCl extract to be separated.
Avoid loading a sample volume >5% of the total column volume; the optimum sample size
is 2% (40 ml for the XK 50/100 column). The sample consists of washed pellets extracted
with guanidineHCl (see Basic Protocol 1). A sample size of 40 to 50 ml is usually derived
from 50 g wet weight cells. With smaller sample sizes, use columns with proportionally
smaller diameters (e.g., XK 16/100 or 26/100 columns). If purchase of only one column is
possible, a 2.5 100cm size is a good compromise for variable sample loading.
Purification of
Recombinant
Proteins
6.3.5
16. Monitor column effluent with the UV monitor and collect fractions with the fraction
collector.
For an XK 50/100 column, collect 15- to 20-ml fractions in 16 20mm culture tubes.
The eluent from the column is usually monitored at 280 nm or, if the protein has a
particularly low extinction coefficient, at 230 nm (guanidineHCl strongly absorbs below
225 nm). For an XK 50/100 column, fractions need only be collected after 500 ml of
elution. The excluded volume (void volume) is 570 ml. Run one column volume (1900 ml)
to ensure all of the load material is eluted from the column.
17. Prepare the fractions to be assayed for SDS-PAGE (see Support Protocol and UNIT
10.1).
SUPPORT
PROTOCOL
PREPARATION OF SAMPLES CONTAINING GUANIDINE

HYDROCHLORIDE FOR SDS-PAGE
Because guanidineHCl forms a precipitate with SDS, it is necessary to remove the former
before carrying out SDS-PAGE. Protein in column fractions is separated from guanidineHCl by precipitation using 90% ethanol (Pepinsky, 1991).
Materials
Sample containing the protein of interest
100% ethanol, 0 to 4C
1 SDS sample buffer (UNIT 10.1)
Gilson Pipetman (Rainin Instrument)
Additional reagents and equipment for gel electrophoresis (UNIT 10.1)
1. Pipet 25 l sample containing the protein of interest into a 1.5-ml microcentrifuge
tube.
2. Add 225 l cold (0 to 4C) ethanol to the sample in the tube.
The final ethanol concentration is 90% by volume.
3. Mix the sample and ethanol well. Chill 5 to 10 min at 20C or colder (e.g., 80C).
4. Microcentrifuge the sample 5 min at maximum speed (15,000 g), 4C. Carefully
withdraw the supernatant and retain the pellet.
The pellet may be difficult to see. Be careful not to draw the pellet out of the microcentrifuge
tube with the supernatant.
5. Suspend the pellet with 250 l cold 90% (v/v) ethanol. Mix thoroughly using a vortex
mixer.
The 90% ethanol is made by mixing 225 l ethanol and 25 l H2O.
6. Microcentrifuge the sample 5 min at maximum speed, 4C. Carefully pipet off the
supernatant and suspend the pellet in 25 l of 1 SDS sample buffer.
Some proteins are more difficult than others to suspend from an ethanol precipitate.
Electrophoresis sample buffer containing 8 M urea is helpful for such proteins (UNIT 10.1).
Sonication with a microtip probe can also be used to disperse the sample. A volume of
sample buffer >25 l may be required in this case (e.g., 50 l), and great care must be taken
to prevent foaming of the sample caused by excessive sonication power.
Preparation and
Extraction of
Inclusion Bodies
6.3.6
7. Heat the sample 3 to 5 min at 90 to 100C. Load on an SDS-polyacrylamide gel

(UNIT 10.1).
see APPENDIX 2E; for suppliers, see SUPPLIERS APPENDIX.
Extraction buffer
5 mM EDTA
8 M guanidineHCl (764 g/liter)
5 mM DTT (770 mg/liter)
If the buffer is cloudy, filter through a 0.45- to 0.5-m filter (the solution should be
clear if high-quality guanidineHCle.g., ultrapure grade, ICN Biomedicalsis
used; see APPENDIX 3A). Buffer can be stored minus DTT at least 1 month at 4C.
Gel-filtration buffer
4 M guanidineHCl (382 g/liter; ultrapure, ICN Biomedicals)
Buffer can be stored minus DTT at least 1 month at 4C. Filter (as for extraction
buffer; see recipe) and degas before use.
Higher concentrations of guanidineHCl (up to 8 M) may be required for some proteins (see
comment at step 12).
Lysis buffer
5 mM EDTA
Prepare immediately before use
The TrisCl and EDTA are diluted from concentrated stock solutions. The other components
are added to the diluted buffer before use.
Wash buffer
5 mM EDTA
2 M urea (120 g/liter; ultrapure, ICN Biomedicals)
2% (w/v) Triton X-100 (20 g/liter; Calbiochem-Novabiochem)
Add DTT, urea, and Triton X-100 to the other components directly before use.
Prepare this buffer in two forms: one with and one without the urea and Triton X-100
(the latter for use in Basic Protocol 1, step 9).
Purification of
Recombinant
Proteins
6.3.7
COMMENTARY
The decision of whether to work with insoluble recombinant protein or to put more effort
into generating soluble protein (e.g., by modifying the expression vector or changing the host
strain and fermentation conditions) can be dictated by the nature of the protein. A small
protein (10 to 17 kDa) with only one or two
cysteine residues might be expected to fold in
reasonable yield from extracted inclusion bodies. Larger proteins (>25 kDa) with many cysteine residues may be more problematical, and
lower folding yields can normally be expected.
In the latter case, if only small amounts of
material are needed then yield is not such an
important issue.
It should be emphasized that, unless proved
otherwise, a protein folded from insoluble inclusion bodies can be expected to have the same
structural and conformational integrity as the
same protein directly purified from soluble extracts (also see UNIT 6.1). It is similarly true that
a purified soluble protein can be denatured and
renatured (reversible denaturation) without
structural or conformational modifications (reviewed by Anfinson, 1973; Ghelis and Yon,
1982).
Preparation and
Extraction of
Inclusion Bodies
How inclusion bodies are formed

Inclusion bodies are noncrystalline, amorphous structures; however, there is some evidence that the constituent densely packed proteins may have nativelike secondary structures
(Oberg et al., 1994). This suggests that the
aggregates are formed by the association of
partially folded protein or so-called folding
intermediates. Furthermore, the aggregation
appears to take place late, rather than early, in
the folding pathway.
Although inclusion body formation and its
prevention are of great academic and commercial interest, the pragmatic situation is clearly
summarized by Seckler and Jaenicke (1992),
who state: That inclusion bodies are aggregates of otherwise intact polypeptides in nonnativelike conformations has been proven repeatedly by the successful refolding of active
proteins after dissociation of the aggregates by
chemical dissociation. It must be noted that
the work of Oberg et al. (1994) does not invalidate this statement. It is simply a matter of
terminology: the protein in aggregates may
have nativelike secondary structures, but compared with soluble folded protein it must still
be considered nonnative.
The propensity of a protein to form inclusion

bodies is not related to the presence of sulfhydryl residues, as proteins without sulfhydryls
still form such aggregates. Furthermore, where
carefully studied, it has been found that aggregates derived from proteins that in their native
state contain disulfides consist mainly of reduced protein (Langley et al., 1987). This also
supports the view that inclusion bodies are not
aggregates of completely unfolded protein because, if so, random disulfide bond formation
would occur despite the reducing environment
of the E. coli cytoplasm. Regardless of the
sulfhydryl state in the aggregates, once the
protein has been solubilized, reducing agents
must be included to prevent the formation of
nonnative disulfide bonds.
Extracting inclusion body protein
Proteins are extracted from inclusion bodies
using strong protein denaturants. Protein denaturation can be induced by the following
solvent conditions or reagents.
1. pH. Protein denaturation occurs because
of the ionization of side chains. Generally, proteins retain less residual structure (are more
denatured) when exposed to high pH (e.g.,
>10.5) compared to low pH (<4.5). Acidic or
basic pH may be used in conjunction with urea
or inorganic salts. An example of acidic pH
extraction is given in UNIT 6.5.
2. Organic solvents. Examples of organic
solvents include ethanol and propanol. Generally, proteins are not completely unfolded in
these solvents. Organic solvents are infrequently used for the primary extraction of inclusion bodies but can be useful cosolvents to
enhance protein folding (Chang and Swartz,
1993).
3. Organic solutes. Examples of organic
solutes include guanidineHCl (used at 6 to 8
M; effectiveness independent of solvent pH but
temperature-dependent) and urea (used at 6 to
9 M; effectiveness modulated by pH, ionic
strength, and temperature). Organic solutes are
the most versatile and most commonly used
denaturants for solubilizing inclusion bodies.
The denaturing power of guanidinium salts
increases in the order Cl < Br < I < SCN.
4. Detergents. The most common examples
of protein-denaturing detergents are sodium
dodecyl sulfate (SDS, an anionic detergent)
and cetyltrimethylammonium bromide
(CTAB, a cationic detergent). Both are effective protein denaturants, but they are not nor-
6.3.8
mally used to solubilize inclusion bodies as

they interfere with recovering folded protein in
reasonable yields (e.g., see van Kimmenade et
al., 1988).
5. Inorganic salts. Salts at high concentration (>1 M) often denature proteins. The denaturing power increases in the following order
for anions: SO42 < CH3COO < Cl < Br <
ClO4 < SCN; for cations, the order is
(CH3)4N+, NH4+, K+, Na+ < Li+ < Ca2+ < Gdn+
(reviewed by von Hippel and Schleich, 1969).
The organic guanidinium ion (Gdn) is included
for comparative purposes. Salts have not been
widely used for solubilizing inclusion bodies.
On the other hand, they are frequently used for
selective extraction of extrinsic membrane proteins and in principle should be useful for
preextracting inclusion bodies. Denaturing
salts such as KSCN or LiBr are sometimes
referred to as chaotropes (tending to disorder).
6. Temperature. Thermally induced extraction is rarely used as it often results in irreversible protein denaturation (Zale and Klibanov, 1986). However, denaturants such as
guanidineHCl and urea are more effective at
elevated temperatures (e.g., 37 to 60C). Care
must be taken when heating urea solutions
because of the increased rate of cyanate formation, which will covalently modify amino
groups on the protein, especially at pH >6.
A comparison of some protein denaturants
and their relative effectiveness is described by
Pace and Marshall (1980, and references cited
therein). Monera et al. (1994) provide an explanation of why guanidineHCl is usually two to
three times per mole (2- to 3-fold) more effective than urea at unfolding proteins. The mechanism of protein denaturation is reagent-specific; this topic has been reviewed by Tanford
(1968), Ghelis and Yon (1982), and Creighton
(1993).
The extraction conditions can be empirically determined on a small scale (<1 ml) by
taking aliquots of washed pellet suspension and
microcentrifuging. If preweighed microcentrifuge tubes are used, the extraction conditions
can be related to a given wet weight of pellet.
A fixed volume of extraction buffer is added
plus a reducing agent (5 to 20 mM DTT).
Initially, guanidineHCl (4 to 8 M) or urea (6
to 9 M) should be tried. The pellets are resuspended by vortexing, then incubated for various
times at different temperatures. (Suspension of
the pellet is aided by brief sonication or by using
a tissue homogenizer.) After equilibration, solutions are clarified either by filtration or by
centrifugation. For the latter, a benchtop ultracentrifuge such as the Beckman XL-100 or
Airfuge is ideal. The comparative effectiveness
of extractants can determined by measuring the
amount of protein solubilized from the washed
pellets using standard protein estimation methods and/or SDS-PAGE (UNIT 10.1).
It should be noted that solubilized protein
must at some stage be folded into the native
conformation; hence, the most effective solubilizing conditions might not necessarily be the
best, especially if they cause irreversible denaturation. Irreversible denaturation appears to
result from chemical modification of the protein and is induced by such factors as high
temperature, extremes of pH, and tight binding
of denaturants such as SDS.
The extraction process (Basic Protocol 1)
should result in protein that is both monomeric
(assumed to be unfolded) and contains cysteine
residues in the reduced state. This provides a
defined starting point from which to develop a
reproducible folding protocol or from which to
further purify the protein by, for example, gel
filtration under denaturing conditions (Basic
Protocol 2). Extraction of inclusion bodies with
some denaturants, such as urea, may not completely convert the protein to monomers, resulting in physically heterogeneous mixtures. As
pointed out in UNIT 6.1, extraction can be accomplished with strong denaturants (e.g., guanidineHCl) that can then be exchanged by dialysis
or gel filtration for weaker ones (e.g., urea).
This particular solvent exchange often results
in much better yields of folded protein compared to that obtained by the direct removal of
guanidineHCl (e.g., UNIT 6.5).
Gel-filtration chromatography (Basic Protocol 2) is not commonly considered a high-resolution separation technique. However, as the
recombinant-derived protein content of wellprepared washed pellets will be >50% of the
total (see Fig. 6.3.1, lanes h and i), only a 2-fold
purification is required to obtain pure protein.
Protein extracted with guanidineHCl in the
presence of reductant will ideally be in a random coil conformation with all sulfhydryl residues in the reduced state. Under such conditions, the order in which proteins elute from a
gel-filtration matrix in guanidineHCl can be
directly correlated with molecular size (Mann
and Fish, 1972).
Selection of the proper chromatography
resin is critical for success (for detailed discussion, see Critical Parameters and Troubleshooting). The main disadvantage of gel filtration in
Purification of
Recombinant
Proteins
6.3.9
guanidineHCl, especially when using some of

the (soft) agarose-based resins (e.g., Sepharoses and Bio-Gels), is that flow rates can be
very slow due to the high viscosity of the
gel-filtration buffer. Basic Protocol 2 uses a
Superdex matrix that permits fast flow rates in
the presence of high guanidineHCl (or urea).
A column size of 5 100 cm allows 40 to 50
ml guanidineHCl-containing extract to be
processed. For smaller sample sizes, columns
with proportionally smaller diameters are used.
Because the proteins separated by gel filtration in the presence of guanidineHCl are unfolded, they have no biological activity, so the
column fractions are usually assayed by SDSPAGE. Direct addition of SDS to samples containing guanidineHCl results in the formation
of the insoluble guanidinium salt of dodecyl
sulfate. The guanidineHCl must therefore be
removed before addition of the sample buffer
used for SDS-PAGE analysis (UNIT 10.1). The
approach used in Support Protocol 1 takes advantage of the fact that guanidineHCl is soluble in 90% ethanol whereas the protein is not.
An alternative is to simply remove the guanidineHCl by dialysis. Small samples (10 to 100
l) can be dialyzed using one of various microdialyzing systems commercially available
(e.g., the Microdialyzer System 100 from
Pierce, which allows simultaneous dialysis of
up to 12 samples) or a simple homemade device
that uses modified microcentrifuge tubes (Falson, 1992).
Critical Parameters and

Troubleshooting
Preparation and
Extraction of
Inclusion Bodies
Breaking cells and preextracting inclusion

bodies
Once it has been established that the recombinant protein is insoluble (UNIT 6.1), extra care
should be taken to ensure complete cell lysis.
If unbroken cells are present in the low-speed
pellets, they will leach contaminants when the
pellets are extracted with strong protein denaturants. Proper operation of the French press is
described in UNIT 6.2. Other major sources of
contamination are outer membrane and cell
wall material, most of which can be preextracted with detergents such as Triton X-100
(0.5% to 5%) and urea (1 to 4 M).
The proper concentration of urea in the wash
buffer is determined empirically in small-scale
extractions. It is probably safe to use 2 M urea
for most aggregates. The effectiveness of the
wash process at removing the cell wall and
outer membrane material can be improved by
increasing the volume of wash buffer (see Basic

Protocol 1, step 6: use 10 ml instead of 6 ml
buffer per gram cells). Treatment of the cells
with lysozyme prior to homogenization with
the French press will also help remove this
material (UNIT 6.5, Basic Protocols 1 and 2).
Although insoluble proteins are less susceptible than native proteins to proteolysis, inclusion of EDTA and a serine protease inhibitor
such as benzamidineHCl or AEBSF is recommended. The choice of cell lysis buffer is not
critical; however, the buffer pH should be >6.5,
as many soluble E. coli proteins precipitate at
slightly acidic pH values.
After preextraction, wash the aggregates
with buffer alone to remove excess detergent.
When attempting to develop a reproducible
folding protocol, note that varying amounts of
detergent carryover may influence the outcome. In fact, nonionic detergents can be used
as cosolvents to aid folding (UNIT 6.1); even so,
it is important to know how much detergent is
present.
Extracting inclusion bodies with
guanidineHCl
The washed pellets containing the insoluble
inclusion body proteins are extracted with
guanidineHCl (see Basic Protocol 1, step 10).
To obtain complete dissolution of the pellets,
some form of mechanical dispersion is often
required. Homogenization at room temperature
with a tissue grinder (as described) is often
adequate; however, sonication should be used
if the pellet is especially recalcitrant. Heating
the solution will also aid protein solubilization;
10 to 15 min at 50 to 60C is usually a good
starting point. Excess heating, whether direct
or caused by sonication without adequate cooling, should be avoided. It is worth remembering
that if extraction involves extremes of heat and
or pH, such conditions will favor deamidation
of Asn and may also promote cleavage at the
labile Asp-Pro bond and other chemical modifications of the protein (Zale and Klibanov,
1986).
It is best to use the extract directly after
preparation rather than storing it frozen. In
general, an unfolded protein in solution is much
more susceptible to proteolytic degradation and
chemical modification than its native (folded)
counterpart.
Selecting medium and column for gel
filtration in guanidineHCl
Selecting the proper gel-filtration resin is
one of the most critical steps. First of all, the
6.3.10
Table 6.3.1 Gel-Filtration Matrices Suitable for Use with Solutions Containing
Guanidine Hydrochloride
Mass range (kDa)
Matrixa
Native proteins
Sepharose CL-6B
Bio-Gel A-5m
Sepharose CL-4B
Sephacryl S-100 HR
Sephacryl S-200 HR
Sephacryl S-300 HR
Sephacryl S-400 HR
Superdex 75
Superdex 200
Unfolded proteinsb
10-4,000
10-5,000
60-20,000
1-100
5-250
10-1,500
20-8,000
3-70
10-600
1-80
1-80
10-300
<1-30c
1-50
1-100c
1->100c
<1-25
1-80
Reference
Mann and Fish (1972)
Belew et al. (1978)
I.P. and P.T.W. (unpub. observ.)

I.P. and P.T.W. (unpub. observ.)
aAll resins are from Pharmacia Biotech except Bio-Gel A-5m, which is from Bio-Rad. The Sepharose and Bio-Gel matrices
are normally run under low pressure; all other resins can be run under low or medium pressure. Medium pressure is achieved
using one of the chromatography pumps indicated in Basic Protocol 2; the pumps are normally included in the Pharmacia
Biotech FPLC or BioPilot systems.
bData on the fractionation range in the unfolded state refer to proteins unfolded with guanidineHCl; however, the guidelines
also apply to proteins unfolded and eluted with urea (assuming they are random coils).
cEstimates based on fractionation range for native proteins.
chromatography medium must have high

chemical stability that permits prolonged exposure to high concentrations of denaturing solvents such as guanidineHCl and urea. It must
also have high physical strength that allows
high flow rates with viscous solvents. Suitable
media are listed in Table 6.3.1. The Sepharoses
and Bio-Gels are cross-linked agaroses,
Sephacryl is dextran cross-linked with bisacrylamide, and Superdex is cross-linked agarose
with bonded dextran. All the matrices listed are
stable in high concentrations of urea and
guanidineHCl. Details on the properties of
various media can be obtained from the manufacturers.
Second, selecting a medium with the proper
pore size is important for good separation.
Manufacturers provide information about the
separation ranges of their products. These
ranges are determined for proteins in an aqueous buffer. In guanidineHCl, denatured proteins (assuming they are random coils) will
have a radius 3- to 4-fold greater than an average folded globular protein of the same mass.
Thus, the mass range values for unfolded proteins in Table 6.3.1 should be used rather than
the native protein values.
Third, the pressure rating of the column
must be adequate. Because 4 M guanidineHCl
has a higher viscosity than most aqueous buff-
ers, higher pressures are needed to achieve the

same flow rates. The column should be capable
of safely withstanding moderate pressures of
around 0.5 MPa (5 bar) or 75 lb/in2 (the XK
columns are rated to 0.5 MPa). The proteins
separate as they pass through the column, so
column length is important. A column 60 to 100
cm in length will generally be suitable. Some
manufacturers offer prepacked columns with a
choice of media. If column packing is to be
done in the laboratory, then selecting a column
with a packing reservoir is helpful.
Prepacked columns (diameters 1.6, 2.6, 3.5,
and 6.0 cm and length 60 cm) prepacked with
Sephacryl resin (Sephacryl S-100, S-200, or
S-300) or Superdex resin (Superdex 200 and
75) are commercially available from Pharmacia
Biotech. Superdex 200 and 75 PG (preparative
grade) 60/600 columns (6.0 cm i.d. 60 cm
length) are used with the BioPilot system (Pharmacia Biotech) either individually or sequentially to obtain, in many cases, pure protein (for
example, see Fig. 6.3.1).
Performing gel filtration in guanidineHCl
The general guidelines and critical parameters that apply to gel-filtration chromatography
in general and are detailed elsewhere (UNIT 8.3)
also apply here. The main distinction from
typical gel filtration is the use of a highly
Purification of
Recombinant
Proteins
6.3.11
Preparation and
Extraction of
Inclusion Bodies
viscous solvent, which requires robust matrices

to obtain reasonable flow rates. On the other
hand, it should be noted that the presence of
high concentrations of guanidineHCl gives
higher-resolution separations than those obtained with normal solvents because the high
viscosity of the solvent reduces diffusion, which
otherwise tends to broaden elution peaks.
It is important to ensure that all connections
and tubing are leak-free. Concentrated guanidineHCl is highly corrosive to metal and electronic components.
The sample derived from extraction of
highly aggregated protein must be clarified
before being applied to the column. Furthermore, to prevent the sample from precipitating
near or at the top of the column, it should be
equilibrated to the same temperature as the
column matrix and buffer. This is especially
important if chromatography is carried out at
4C and the sample was heated during extraction.
The column must be equilibrated with
freshly made buffer before use. The column
buffer contains the sulfhydryl reagent DTT,
which will oxidize over time, thus lessening its
effectiveness and increasing the background
UV absorbance of the buffer.
If the recombinant protein has been effectively solubilized, it will be physically homogeneous and its elution position will be proportional to its mass. If the protein elutes anomalously (i.e., is located in more than one peak),
there are several possible reasons.
1. Incomplete protein solubilization. Try
more drastic extraction conditionsin particular, increase the denaturant concentration and
temperature during extraction. Use a stronger
chemical denaturant, especially if urea was
originally used.
2. Aggregation/precipitation of protein(s)
in the column. Ensure that the concentration of
guanidineHCl in the column buffer will maintain the solubility of all proteins during chromatography. The column can be run at room
temperature (as opposed to 4C), and reasonable flow rates can still be obtained with buffers
containing 6 to 7 M guanidineHCl (4 M is used
in Basic Protocol 2).
3. Conformational heterogeneity. Related
to the above two situations is the case where
the protein, although monomeric, contains both
unfolded and partially folded species. The
folded protein will elute later (appear smaller)
than the unfolded protein. Conformational heterogeneity is usually not a major problem in
high (>4 M) guanidineHCl concentrations.
4. Oxidation of sulfhydryl residues. The

formation of intermolecular disulfide bonds is
indicated by the appearance of protein eluting
earlier than expected and corresponds to the
formation of multimers (dimers, trimers, etc.).
Disulfide interchange occurs more readily at
high pH; thus, use of a slightly acidic buffer
(pH 6.0 to 5.0) and inclusion of fresh reductant
in both the sample and column buffer are recommended. For analytical separations, cysteine residues are normally capped by alkylation
with iodoacetamide; cysteines can also be reversibility modified by sulfitolysis (Glazer et
al., 1975).
5. Proteolysis. (a) The sample contains partially proteolyzed protein, with proteolysis by
E. coli proteases occurring before or after cell
breakage: In fully denatured protein, it should
be possible to separate clipped protein from
unmodified protein if there is sufficient mass
difference. Once the protein has been separated
by gel filtration, it should be checked by mass
spectrometry to confirm its integrity. If the
protein is not fully denatured, clipped protein
may have similar elution properties as unmodified protein; however, the processing will be
revealed when the protein is boiled in SDS and
analyzed by gel electrophoresis.
(b) Where the recombinant protein is itself
a protease: As pointed out by Fish et al. (1969),
Since denaturation is a kinetic process, the
dissolution of proteases in guanidineHCl
might result in a condition where the fraction
of the protein not denatured at a given instance
may digest the unfolded protein leading to low
molecular weight estimate. The converse of
this situation is also true: if proteases are extracted under conditions where they are fully
denatured and, thus, inactive (e.g., 8 M guanidineHCl), changes in the solvent conditions
(e.g., reducing the guanidineHCl concentration or exchanging for urea) might lead to a
fraction of the protein folding into an active
conformation. If autolytic processing is suspected, include an appropriate inhibitor or
choose a solvent pH where the enzyme has
minimal activity.
Ancipitated Results
Cell lysis and preparation of washed pellets
Pelleted aggregates after washing contain
30% dry weight, of which 90% is protein.
SDS-PAGE of a typical washed pellet preparation (Fig. 6.3.1, lanes h and i) indicates that
recombinant bovine growth hormone (21 kDa)
makes up >60% of the total protein. The
6.3.12
Figure 6.3.1 Analysis by SDS-PAGE of fractions from low-speed centrifugation of E. coli cell
lysates containing aggregated bovine growth hormone. A 12.5% acrylamide gel of dimensions 12
cm 16 cm 1.5 mm was used with the Laemmli buffer system (UNIT 10.1). Lanes a and g contain
standard proteins (low-range standards, Bio-Rad) in order of increasing migration distance:
phosphorylase b (97.4 kDa), bovine serum albumin (66.2 kDa), hen egg white ovalbumin (45 kDa),
bovine carbonic anhydrase (31 kDa), soybean trypsin inhibitor (21.5 kDa), and hen egg white
lysozyme (14.4 kDa). After low-speed centrifugation of the clarified lysate and of the washed pellet
homogenate (see Basic Protocol 1, steps 5 and 7), the supernatants will be cloudy (lane f) and the
pellets usually consist of two layers (see Fig. 6.1.5). The bottom layer is inclusion body protein plus
unbroken cells (lanes b and c) and the top layer consists of outer membrane and peptidoglycan
fragments (lanes d and e). The outer membrane proteins OmpA (35 kDa) and OmpF/C (38 kDa)
are indicated by and , respectively. After the washing steps, the growth hormone (marked , 21
kDa) is the major constituent (lanes h and i) together, in this example, with another plasmid-encoded
protein, namely kanamycin phosphotransferase (marked , 30.8 kDa), the product of the gene
conferring resistance to the antibiotic kanamycin.
washed pellets analyzed in Figure 6.3.1 are

typical starting materials for the protein folding
and purification described in UNIT 6.5 (Basic
Protocol 1). The multiple bands in the background are either derived from unbroken cells
(most likely) or are E. coli cytoplasmic proteins
coprecipitated or trapped during aggregate formation. The gel analysis indicates the presence
of another plasmid-encoded protein, namely,
kanamycin phosphotransferase (30.8 kDa), a
product of the gene conferring resistance to the
antibiotic kanamycin (Kane and Hartley,
1991). The washing procedure described only
partially extracts the phosphotransferase but
removes most of the outer membrane proteins.
For further details, see the legend to Figure
6.3.1.
Gel filtration in guanidineHCl

Fractionation of human immunodeficiency
virus type 1 (HIV-1) protease illustrates expected results from gel-filtration chromatography. The protein is expressed in E. coli as a
17-kDa precursor that at some stage undergoes
autolytic processing to form the mature-sized
protease (10.7 kDa). The protease and undigested precursor accumulate as insoluble inclusions in the E. coli cytoplasm. Washed pellets
prepared and extracted with 6 M guanidineHCl
as described (see Basic Protocol 1) were applied to a Superdex 200 column. The protease
eluted in a single peak (Fig. 6.3.2, fractions 66
to 72), well separated from unprocessed protein
(e.g., fraction 60) and larger molecular mass
proteins (e.g., fractions 50 to 55). The fractions
Purification of
Recombinant
Proteins
6.3.13
2.00
A280
1.50
S 50 55 60 65 70 75
1.00
0.50
P
0.00
0
20
40
60
80
100
Fraction number
Figure 6.3.2 Gel filtration using Superdex 200 in 4 M guanidineHCl. Column dimensions, 6 60
cm; buffer, 50 mM TrisCl (pH 7.5)/4 mM guanidineCl/2 mM DTT; flow rate, 5 ml/min (300 ml/hr).The
sample was an extract containing HIV-1 protease, which has a mass of 10 kDa. Protein fractions
66 to 72 (pool P) was further purified under the same conditions using a Superdex 75 matrix. The
inset shows SDS-PAGE analysis of selected fractions. The protein markers (lane S) correspond to
standards with mass values of 66.2, 45, 30, 21.5, and 14.4 kDa, respectively (migration order top
to bottom).
Preparation and
Extraction of
Inclusion Bodies
indicated in Figure 6.3.2 by P were pooled and

the protein further purified by repeat chromatography on a Superdex 75 column under the
same conditions. The protein at this stage is
>95% pure and after solvent exchange is folded
into active protein. (As it happens, the native
protease is a 20-kDA homodimer that is very
susceptible to autolytic digestion; hence, purification in the denatured, inactive state is highly
advantageous).
In the inset of Figure 6.3.2, analysis by
SDS-PAGE of fraction 60 illustrates incomplete dissociation of the sample, a problem
commonly observed when electrophoresing
samples precipitated with ethanol and trichloroacetic acid (TCA). If necessary, repeat the
analysis using SDS sample buffer (UNIT 10.1; see
Support Protocol).
The fractionation of HIV-1 protease is somewhat of a best-case scenario due to the small
size of the protein. Usually it is not possible to
purify the recombinant protein completely, especially for proteins close in size to the main
E. coli contaminants (30 to 45 kDa). In general,

small proteins (<25 kDa) are best suited for the
method; however, any protein will be purified
to some extent, and further purification can be
attempted using some of the methods discussed
in UNIT 6.1. Moreover, partial purification may
be all that is required to enhance protein folding
significantly.
Recovery of recombinant protein from gelfiltration chromatography is close to quantitative, and the purified (or partially purified)
protein can be folded or can be stored in aliquots
at 80C. On thawing the protein, add fresh
DTT (an additional 1 or 2 mM) and warm the
solution at 37 to 40C for several minutes
before use. The protein concentration can be
conveniently estimated by UV spectroscopy.
Time Considerations
Cell lysis and preparation of washed pellets
French press lysis of 150 to 200 ml cell
suspension will take 30 to 35 min. Preparation
6.3.14
and extraction of the washed pellet take about

half a day.
Gel filtration in guanidineHCl
Using Superdex resins in conjunction with
an FPLC or BioPilot system, gel-filtration
chromatography takes 3 to 6 hr and the gel
analysis 1.5 to 2 hr. With low-pressure resins,
elution takes much longer. For example, a
Sephacryl S-300 column (2.5 98 cm) eluted
with 6 M guanidineHCl runs at 25 to 30 ml/hr.
An average-sized protein (15 to 30 kDa) is
eluted after 10 to 12 hr. A column can be loaded
in late afternoon and run overnight.
Literature Cited
Anfinson, C.B. 1973. Principles that govern the
folding of protein chains. Science 181:223-230.
Belew, M., Fohlman, J., and Janson, J.-C. 1978. Gel
filtration on Sephacryl S-200 superfine in 6 M
guanidineHCl. FEBS Lett. 91:302-304.
Chang, J.Y. and Swartz, J.R. 1993. Single-step solubilization and folding of IGF-1 aggregates from
Escherichia coli. In Protein Folding: In Vivo and
in Vitro (J.L. Cleland, ed.) pp. 178-188 (ACS
Symposium Series No. 526). American Chemical Society, Washington, D.C.
Creighton, T.E. 1993. Proteins: Structures and Molecular Properties, 2nd ed., pp. 293-296. W.H.
Freeman, New York.
Falson, P. 1992. An efficient procedure to dialyze
volumes in the range of 10-200 l. BioTechniques 13:20.
Fish, W.W., Mann, K.G., and Tanford, C. 1969. The
estimation of polypeptide chain molecular
weights by gel filtration in 6 M guanidine hydrochloride. J. Biol. Chem. 244:4989-4994.
Ghelis, C. and Yon, Y. 1982. Simulation of protein
folding: Studies of in-vitro denaturation-renaturation. In Protein Folding, pp. 225-243. Academic
Press, San Diego.
Glazer, A.N., Delange, R.J., and Sigman, D.S. 1975.
Modifications of sulfhydryl and disulfide
groups. In Chemical Modification of Proteins,
pp. 101-120 (Laboratory Techniques in Biochemistry and Molecular Biology Series).
North-Holland Publishing Company, New York.
Kane, J.K. and Hartley, D.L. 1991. Properties of
recombinant protein-containing inclusion bodies in E. coli. In Purification and Analysis of
Recombinant Proteins (R. Seetharam and S.K.
Sharma, eds.) pp. 121-145. Marcel Dekker, New
York.
Langley, K.E., Berg, T.F., Strickland, T.W., Fenton,

D.M., Boone, T.C., and Wypych, J. 1987. Recombinant-DNA-derived growth hormone from
Escherichia coli: Demonstration that the hormone is expressed in the reduced form, and
isolation of the hormone in the oxidized, native
form. Eur. J. Biochem. 163:313-321.
Mann, K.G. and Fish, W.W. 1972. Protein polypeptide chain molecular weights by gel chromatography in guanidinium chloride. Methods Enzymol. 26:28-42.
Monera, O.D., Kay, C.M., and Hodges, R.S. 1994.
Protein denaturation with guanidine hydrochloride provides a different estimate of stability
depending on the contributions of electrostatic
interactions. Protein Sci. 3:1984-1991.
Oberg, K., Chrunyk, B.A., Wetzel, R., and Fink,
A.L. 1994. Nativelike secondary structure in interleukin-1 inclusion bodies by attenuated total
reflectance FTIR. Biochemistry 33:2628-2634.
Pace, C.N. and Marshall, H.F. 1980. A comparison
of protein denaturants for -lactoglobulin and
ribonuclease. Arch. Biochem. Biophys. 199:270276.
Pepinsky, B.R. 1991. Selective precipitation of proteins from guanidine hydrochloride-containing
solutions with ethanol. Anal. Biochem. 195:177181.
Seckler, R. and Jaenicke, R. 1992. Protein folding
and protein refolding. FASEB J. 6:2545-2552.
Tanford, C. 1968. Protein denaturation. Adv. Prot.
Chem. 23:122-275.
van Kimmenade, A., Bond, M.W., Schumacher,
J.H., Laquoi, C., and Kastelein, R.A., 1988, Expression, renaturation and purification of recombinant human interleukin 4. Eur. J. Biochem.
173:109-114.
von Hippel, P.H. and Schleich, T. 1969. Ion effects
on the solution structure of biological macromolecules. Acc. Chem. Res. 2:257-265.
Zale, S.E. and Klibanov, M. 1986. Why does ribonuclease irreversibly inactivate at high temperature? J. Biol. Chem. 25:5432-5444.
Contributed by Ira Palmer and

Paul T. Wingfield
Bethesda, Maryland
Purification of
Recombinant
Proteins
6.3.15
Overview of Protein Folding

HOW PROTEINS FOLD
Where proteins are expressed as insoluble
aggregatesi.e., bacterial inclusion bodies
the obligatory first step in the recovery of functional protein is to disperse the inclusion bodies
in a denaturant such as 6 M guanidineHCl
(guanidinium chloride; GdmCl), which will
yield a solution of unfolded and essentially
noninteracting polypeptide chains. The next
problem is the one that faced Anfinsen in his
pioneering work on the mechanism of protein
foldingi.e., how to recover the protein in its
unique, functional, three-dimensional conformation. The main factors determining the folding of proteins, and hence their three-dimensional conformation, are summarized in the
following three sections.
All the Information is in the Sequence

Anfinsen (1973) showed that proteins fold
up solely as a result of thermodynamic drive,
which leads to the creation of the specific noncovalent interactions and disulfide bonds characteristic of the functional state. In other words,
a protein folds because, under folding conditions, its native state is more stable than the
unfolded statethe information determining the
relative stabilities of the two states resides
solely in the primary sequence. No additional
energy or information, for example, in the form
of a template, is required.
Other factors that may increase the yield and
rate of folding such as chaperone proteins,
protein disulfide isomerase (PDI), and peptidyl
prolyl cis-trans isomerase (PPI), all depend on
this thermodynamic drive for the intrinsic ability of the intact polypeptide chain to fold.
Proteins Fold Along a Limited

Number of Pathways
Like a large river, proteins in the process of
folding start from a large number of sources or
conformationsi.e., the unfolded state(s).
These rapidly condense, reducing the number
of paths (intermediate states) available to the
flow, until the ocean (the functional, folded
state) is finally reached through something like
a single pathway. As the protein folds, the
number of possible intermediate states becomes increasingly limited, and further folding
is thus confined to pathways by which the vast
majority of conformational states potentially
accessible to the polypeptide chain are precluded. In this way, proteins can fold in vivo at
Contributed by Roger H. Pain
a rate that can keep pace with the rate of synthesis; in vitro, protein molecules can fold with
half-times varying from tens to thousands of
milliseconds.
Consider first proteins that do not contain
disulfide bonds in the native state. Very early in
the folding pathway, in less than a few milliseconds, the chain collapses to intermediates in
which substantial proportions of the secondary
structure and hydrophobic core are assembled.
The stabilization of secondary structure elements and the packing of side chains continues
until a compact intermediate termed the molten globule is formed. This contains essentially all the native secondary structure and, in
many proteins, has been shown to accumulate
to a significant extent (Ptitsyn et al., 1990).
Although the topology of the molten globule is
similar to that of the protein in the native state,
the specific and persistent tertiary interactions
characteristic of the native state are still lacking.
This accounts for its ability to bind the hydrophobic probe 8-anilino-1-naphthalene sulfonic
acid (ANS) and presumably also for its observed tendency to aggregate. The molten globule finally folds to the native state in a reaction
that usually constitutes the rate-limiting step of
folding.
Although several proteins have been shown
to exhibit multiple kinetic phases and hence
small energy barriers during folding, the early
stages are fast (t12 = 1 to 25 msec). Many of the
slower steps observed in folding are rate-limited by the slow cis-trans isomerization of peptide bonds joining X-Pro residues (Nall, 1994).
This isomerization, with half-times on the order
of a minute, occurs at later stages of folding,
and therefore within rather collapsed forms of
the protein. The variable accessibility of the
bonds involved in cis-trans isomerization, resulting from the collapsed state of the polypeptide chain, explains the somewhat variable success of peptidyl prolyl cis-trans isomerase
(PPI) in catalyzing the reaction in vitro.
In comparison to these generally fast folding
processes, disulfide bondcontaining proteins
fold somewhat more slowly in vitro. Where the
noncovalent interactions are relatively strong
and constitute the main factors driving the folding (at least up to a molten globule state), the
stages of folding prior to disulfide formation
will be similar to those described above. In
some disulfide-containing proteins, however,
the noncovalent interactions are weaker; thus
UNIT 6.4
Purification of
Recombinant
Proteins
6.4.1
CPPS
quently through large nonpolar surfacesit is

not surprising to find that the occurrence of
aggregation during folding is a much greater
problem.
The dependence of yield on aggregation is
illustrated in Figure 6.4.1.
the drive to shift the equilibrium toward the

compact folded state must come from the formation of the native disulfide bonds. In such
cases the intermediate that accumulates during
folding will be relatively expanded.
Protein disulfide isomerase (PDI) is located
in the lumen of the endoplasmic reticulum and
is important in catalyzing formation of disulfide bridges in proteins as they fold in vivo. The
isolated enzyme can, in many cases, be used to
increase the rate of folding in vitro. This application of PDI has had variable success, which
is accounted for (as in the case of PPI, discussed
above) by the variable accessibility of the protein thiols. As PDI is a low-efficiency enzyme,
large amounts are required to achieve catalysis.
HOW TO FOLD PROTEINS

The three principles outlined in the discussion of How Proteins Fold lead to three sets of
conditions necessary for the successful recovery of functional proteins after denaturation: (1)
the folded protein should be the most stable
state (see All the Information is in the Sequence,
above), (2) kinetic barriers that slow down or
block the folding pathway should be minimized
(see Proteins Fold Along a Limited Number of
Pathways), and (3) intermolecular aggregation
between folding intermediates should be reduced to acceptable limits (see Aggregation is
the Main Competitor to Folding). These three
goals will be considered as they bear on the
practical problems involved in folding recombinant proteins. They will thus provide a rationale for the protocols in UNIT 6.5.
Aggregation is the Main Competitor

to Folding
Most proteins tend to exhibit some tendency toward association, reflecting the high
proportion (usually 50%) of their surface that
is nonpolar. In the case of folding intermediates, which have somewhat higher proportions
of nonpolar groups exposed to the solvent, it
is not surprising that aggregation is a frequently experienced hazard. Aggregation during folding in vivo has been well-documented
in the cases of phage tail spike protein mutants
(Haase-Pettingell and King, 1988) and a-1-antitrypsin (Lomas et al., 1993). It has also been
established that a major role of the families of
chaperone proteins is to prevent aggregation
from competing with folding in the cell (Hlodan and Hartl, 1994). In the case of multimeric
proteins, whose subunit chains have evolved
to interact strongly with each otherfre-
X1
Stabilizing the Native Functional State

The simple case
Some proteinse.g., phosphoglycerate kinaseare composed of a single intact polypeptide chain, constituting the simple case in which
all the information required to define the folding and stability of the three-dimensional conformation is present in the sequence. In such a
case, the native state will represent the most
readily accessible stable state. Where disulfide
X2 .... Xn
As
Overview of
Protein Folding
Al
Figure 6.4.1 Illustration of the dependence of yield on aggregation. The unfolded protein (U) folds
through the intermediate forms (X1 to Xn), then through the molten globule (I) to the native state
(N). Some or all of the intermediates will be capable of associating, reversibly at first, to form small
aggregates (As). Subsequently, however, these will associate irreversibly to form larger insoluble
aggregates (Al). The rate of aggregation (ra) will depend on the concentrations of the intermediates
(and hence on the rate constants for the individual steps in the folding pathway) and also on the
rate constant (ki,aggr) for aggregation of each intermediate (Xi) according to the equation ra = ki,aggr
[Xi]. Aggregation will therefore depend on the overall protein concentration as well as the solubility
properties of each intermediate.
6.4.2
110
100
90
80
% Native circular dichroism
70
60
50
40
30
20
10
0
10
0
Guanidine-HCl (mol/liter)
Figure 6.4.2 Graphical illustration of reversible unfolding transition of recombinant interleukin 1

in guanidineHCl, monitored by circular dichroism (CD). Near-ultraviolet CD, which indicates
changes in tertiary structure, was measured at 260 nm (triangles), 287 nm (circles), and 295 nm
(squares). The plateau regions are marked for the native (top; N) and unfolded (bottom; U) states
respectively, and represent regions of denaturant concentration within which there is no change in
protein conformation detectable by CD. CD measurements in the far-ultraviolet range, which reflect
changes in secondary structure, resulted in a curve that was coincident with this one, indicating
that at equilibrium, this transition is largely two-statei.e., only the native and unfolded states are
significantly populated (Craig et al., 1987).
bonds are involved, they supplement the noncovalent interactions in contributing to the stability and specificity of the native three-dimensional conformation and the folding intermediates (see discussion of Disulfide-bonded
proteins, below). Covalently bonded ligands
(e.g., heme in cytochrome c) may also contribute to the stability of both the native and intermediate forms and therefore play an important
role in folding (Roder and Elve, 1994).
When such proteins are subjected to dena-
turing agent, such as guanidineHCl, a reversible unfolding transition is normally observed

(Fig. 6.4.2). For the majority of proteins, the
equilibrium transition region reflects the varying proportions of the native and unfolded
states only, because the concentrations of folding intermediates are rather low at equilibrium.
To fold a protein from inclusion bodies solubilized with 6 M guanidineHCl, for example,
the concentration of denaturant must be reduced to a value within the native plateau re-
Purification of
Recombinant
Proteins
6.4.3
Overview of
Protein Folding
gion. It is useful therefore to have access to an

experimentally determined transition curve
such as that for interleukin 1 illustrated in
Figure 6.4.2.
Effects of denaturants. Within the plateau
region of the folding transition curve (Fig.
6.4.2), the stability of the native protein decreases with increasing concentration of denaturant. The possible disadvantage of limiting
the concentration of denaturant in the interest
of protein stability may be balanced, however,
by the fact that the tendency to associate will
be decreased. This may apply also to the transient intermediates formed during folding.
GuanidineHCl is not only a more powerful
denaturant than urea (2.5-fold more effective
on a molar basis), but its solubilizing effect on
different chemical groups in proteins is different from that of urea. In particular, the ratio of
the solubilizing power for the peptide bond
relative to that for the average nonpolar side
chain is greater for guanidineHCl than for urea
(Lapanje et al., 1978; Mitchinson and Pain,
1985). Thus, for a folding intermediate, where
secondary structure (in which peptide bonds are
shielded from the solvent) has formed but
where nonpolar groups are more exposed, urea
may be more effective than guanidineHCl in
stabilizing the intermediate against aggregation
(assuming denaturant concentrations at which
both urea and guanidine-HCl have the same
effect on overall protein stability). Hence, urea
is occasionally used as an intermediate solvent
during renaturation.
Effects of cosolvents. Cosolvents such as
glycerol and ethylene glycol, glucose and sucrose, certain anions such as phosphate and
sulfate, and certain cations such as 2-(N-morpholino)ethanesulfonic acid (MES) can stabilize proteins markedly against denaturation by
urea or guanidineHCl. They exhibit little or no
effect on the folding rate constant, but dramatically decrease the unfolding rate constant. In
certain favorable cases, the unfolded protein
can be refolded simply by adding sulfate to the
solution containing denaturant (Mitchinson
and Pain, 1985). However these cosolvents,
which act by stabilizing hydrophobic interactions, also stabilize aggregates; hence their usefulness is likely to be limited, probably to proteins with a relatively high proportion of polar
residues.
of a number of chains. Functional proteins that

are derived from precursors activated in this
manner pose a more complex problem for folding in vitro. Some of the information required
to define the conformation, originally resident
in the intact precursor protein, has been lost
during activation and the conformation is stabilized by the disulfide bonds. For example,
reduction of the disulfide bonds in insulin results in unfolding and subsequent aggregation
even in the absence of denaturant (Anfinsen,
1967). Penicillin acylase, which contains no
disulfide bonds, is more difficult to fold in the
absence of the linking peptide present in the
proenzyme (Lindsay and Pain, 1991). In both
of these cases, at least part of the function of
the linking peptide is thought to be to increase
the frequency of productive interactions between the two elements of structure (Hlodan et
al., 1991).
Denaturation of such proteins is not a simple
thermodynamically reversible process. In cases
where it is not possible to produce and activate
the preprotein to obtain the functional protein,
each chain may have to be produced separately
and alternative folding and assembly strategies
may have to be explored. For example, one
chain that aggregates when folded by itself may
be stabilized in its folded state if folding is
carried out by diluting it into a solution of the
already folded second chain (Lindsay and Pain,
1991). Stabilizing cosolvents may induce native-like conformation in the isolated chains,
encouraging assembly of the chains into a functional molecule.
Proteolytically processed proteins

Other proteinse.g., chymotrypsinare
derived from precursors that have been processed by proteolytic cleavage and are composed
Figure 6.4.3 Equilibrium for noncovalent interactions during protein folding, where n is the
number of disulfide bonds in the native, functional protein.
Disulfide-bonded proteins
Disulfide bonds contribute to the stability of
the native conformation to an extent that varies
from one protein to another. The overall stability may be expressed thermodynamically in
terms of the equilibria for the sidechain and
backbone noncovalent interactions (Fig. 6.4.3)
and the covalent interaction (Fig. 6.4.4) in
which two thiol groups produce a disulfide
bond.
U(SH)2n
N(SH)2n
6.4.4
X SH + HS Y
X S S Y
Figure 6.4.4 Equilibrium for the covalent interactions (formation of disulfide bonds) during
the folding of a protein, X and Y are cysteine
residues in the amino acid sequence of the
folding protein that interact specifically in the
folded structure.
At one extremewhere the conditions of

folding (e.g., denaturant concentration and pH)
lead to noncovalent interactions that are strong
enough to stabilize the protein in a native-like
form, with the native pairs of thiol groups
forced close to one another (i.e., the equilibrium
illustrated in Fig. 6.4.3 lies to the right)very
little oxidizing pressure will be needed to form
the disulfide bonds. If, on the other hand, the
noncovalent interactions are relatively weak
(i.e., the equilibrium illustrated in Fig. 6.4.3 lies
well over to the left and hence toward the
expanded state of the protein), more energya
stronger oxidation potentialwill be required
to drive the equilibrium to the native state
(Gilbert, 1994).
To fold proteins containing disulfide bonds,
it is necessary to pay attention to the chemistry
of the covalent bonds involved in cysteine thiol
oxidation. Two principal folding routes are possibleone utilizing air oxidation in the presence of trace heavy metals (Fig. 6.4.5) and the
SH
S
+ RSSR
+ 2e + 2H+
SH
Figure 6.4.5 Formation of disulfide

bond by air oxidation of thiol groups in
the presence of trace heavy metals.
S
heavy metals
other involving formation of mixed-disulfide

intermediates (Fig. 6.4.6).
The former route (Fig. 6.4.5), although
cheaper when using large volumes, is less easy
to optimize and control. The latter route (Fig.
6.4.6) utilizes a low-molecular-weight dithiol
(R-S-S-R), usually glutathione. In practice, a
redox pair of reduced glutathione (GSH) and
oxidized glutathione (GSSG) is needed to create the appropriate oxidizing pressure that
will allow the disulfides in the folding intermediates to make and break, so that the noncovalent interactions can shuffle the protein to its
lowest free energy state. Because of the energy
balances discussed above, the lowest free energy state will be expected to vary from protein
to protein; hence the optimal redox conditions
will also differ. However, a GSH:GSSG molar
ratio of 10:1 (at a concentration of 2 to 5 mM
GSH) gives maximal rates of folding to the
native structure for a number of proteins. Because each step in the oxidation involves nucleophilic attack by an S group (see Fig. 6.4.6),
the rate of disulfide formation is expected to
increase within the range of pH 6 to 10. However, pH may also affect the stability of folding
intermediates in an unpredictable way. In cases
where the noncovalent interactions alone do not
lead to a condensed intermediate (i.e., where
the equilibrium illustrated in Fig. 6.4.3 lies to
the left; see discussion above), addition of a
stabilizing cosolvent such as phosphate or sulfate can drive the equilibrium in the direction
of condensation, thereby offering the possibility of increasing the rate of disulfide formation
SSR
+ RS
+ RS
P
S
Figure 6.4.6
Formation of disulfide
bond through mixeddisulfide intermediates.
Purification of
Recombinant
Proteins
6.4.5
and interchange. Other factors (e.g., ionic

strength and temperature) that can affect the
stability of intermediates will also influence the
kinetics and yield of folding.
Achieving an Acceptable Rate of

Folding
Within the plateau region of the unfolding
transition (see Fig. 6.4.2), the rate of folding
will generally be in inverse proportion to the
concentration of denaturant. The rate of folding
will increase with temperature, up to that of
thermal denaturation. For certain proteins
whose folding is rate-limited by proline cistrans isomerization (see Proteins Fold Along a
Limited Number of Pathways, above), the rate
can be increased by the addition of peptidyl
prolyl cis-trans isomerase (Nall, 1994). However, when working with proteins lacking disulfide bonds, rate is not as important for practical purposes as yield.
The rate of folding for disulfide-bonded proteins in vitro can be very slow, with half-times
of the order of minutes or hours, and conditions
must be arranged to reduce the time required to
realize an acceptable yield. The linkage between noncovalent and disulfide stability (see
discussion of disulfide-bonded proteins under
Stabilizing the Native Functional State) has
important consequences in defining conditions
for folding disulfide-bonded proteins. Certain
intermediates in some folding pathways have
been shown to possess nonnative disulfides
(Gilbert, 1994). The energy barriers involved
in making and breaking both covalent disulfide
links and noncovalent interactions must therefore not be too high if such a pathway is to be
followed. If, as a result of the redox conditions,
the nonnative disulfides in the intermediates are
so strong that they cannot be broken to allow
them to shuffle, the native noncovalent interactions will not be able to form. It is necessary
therefore to create a redox potential such that
the equilibrium illustrated in Figure 6.4.4 is
appropriately balanced. The converse of this
requirement is that the equilibrium in Figure
6.4.3 must be appropriately balanced to allow
the noncovalent interactions to shuffle and
thereby allow the native disulfide pairs to form.
This can be achieved by adjusting the concentrations of denaturant and cosolvent.
Limiting Aggregation
Aggregates of unfolded proteins are intrinsically more stable than the folded, monomeric
state, as is shown by the formation of inclusion

bodies. A major factor in stabilizing aggregates
appears to be hydrophobic interaction; therefore factors that can decrease the strength of
such interaction or increase the solubility of
other parts of the protein chain will help relieve
problems of low yield stemming from aggregation. The characteristic inverse dependence of
stability on temperature in hydrophobic interactions suggests that lower temperatures should
lessen aggregation. Nondenaturing concentrations of urea or guanidineHCl have been also
used with considerable success to lessen aggregation. These concentrations have usually been
arrived at empirically, by dialyzing denaturant
out of the denaturation mixture. Increasing the
net charge by moving away from the isoelectric
point and/or lowering the ionic strength may
also lessen aggregation, other factors being
equal.
Chaperone proteins, notably GroEL, have in
certain cases been shown to dramatically increase the yield of refolding proteins in vitro
(Goloubinoff et al., 1989). This multimeric
protein, cylindrical in shape with a cylindrical
core, will bind partially folded protein monomers, effectively removing them from free solution, and thereby protecting them against aggregation. The protein is then released with the
cooperation of a second chaperone protein,
GroES, under the influence of ATP.
The obvious factor governing aggregation
is protein concentration (Hlodan et al., 1991;
Thatcher and Hitchcock, 1994). Diluting the
unfolded protein into larger volumes of buffer
should increase the proportion of molecules
that fold, although problems of recovery will
also increase. Dropwise addition of the solution
of unfolded protein to a volume of buffer over
a longer period of time can reduce the concentration of sticky intermediates at any given
time. Removal of denaturant from the protein
while the protein is isolated in reverse micelles
or a gel-exclusion medium, or while it is in
equilibrium with unfolded protein bound to an
ion-exchange column, are possible approaches
to refolding at higher concentrations of protein
(Thatcher and Hitchcock, 1994).
It should be emphasized that the problem of
aggregation is a kinetic one depending on the
ratio of rates (see Fig. 6.4.1) under the particular
working conditions. Although general principles can provide a rationale for possible methods, success will come from largely empirical
application of the principles.
Overview of
Protein Folding
6.4.6
LITERATURE CITED
Anfinsen, C.B. 1967. The formation of the tertiary
structure of proteins. Harvey Lect. 61:95-116.
Anfinsen, C.B. 1973. Principles that govern the
folding of protein chains. Science 181:223-230.
Craig, S., Schmeissner, U., Wingfield, P., and Pain
R.H. 1987. Conformation, stability and folding
of interleukin-1. Biochemistry 26:3570-3576.
Gilbert, H.F. 1994. The formation of native disulfide
bonds. In Mechanisms of Protein Folding (R.H.
Pain, ed.) pp. 109-111. Oxford University Press,
Oxford.
Goloubinoff, P., Christeller, J.T., Gatenby, A.A., and
Lorimer, G.H. 1989. Reconstitution of active
dimeric ribulose bisphosphate carboxylase from
an unfolded state depends on two chaperone
proteins and ATP. Nature 342:884-889.
Haase-Pettingell, C.A. and King, J. 1988. Formation
of aggregates from a thermolabile in vivo folding
intermediate in P22 tail spike maturation. J. Biol.
Chem. 263:4977-4983.
Hlodan, R., Craig, S., and Pain, R.H. 1991. Protein
folding and its implications for the production of
recombinant proteins. Biotechnol. & Genet. Eng.
Rev. 9:47-88.
Hlodan, R. and Hartl, F.U. 1994. How the protein
folds in the cell. In Mechanisms of Protein Folding (R.H. Pain, ed.) pp. 194-228. Oxford University Press, Oxford.
Lapanje, S., Skerjane, J., Glavnik, S., and Zibret, S.
1978. Thermodynamic studies of the interactions
of guanidinium chloride and urea with some
oligoglycines and oligolysines. J. Chem. Thermodynam. 10:425-433.
assembly of penicillin acylase, an enzyme composed of two polypeptide chains that result from
proteolytic activation. Biochemistry 30:90349040.
Lomas, D.A., Evans, D.Ll., Stone, S.R., Chang,
W.-S.W., and Carrell, R.W. 1993. Effect of the Z
mutation on the physical and inhibitory properties of 1-antitrypsin. Biochemistry 32:500-508.
Mitchinson, C. and Pain, R.H. 1985. Effects of
sulfate and urea on the stability and reversible
unfolding of -lactamase from Staphylococcus
aureus. J. Mol. Biol. 184:331-342.
Nall, B.T. 1994. Proline isomerization as a rate-limiting step. In Mechanisms of Protein Folding
(R.H. Pain, ed.) pp. 80-103. Oxford University
Press, Oxford.
Ptitsyn, O.B., Pain, R.H., Semisotnov, G.V.,
Zerovnik, E., and Razgulaev, D.I. 1990. Evidence for a molten globule state as a general
intermediate in protein folding. FEBS (Fed. Eur.
Biochem. Soc.) Lett. 262:20-24.
Roder, H. and Elve, G.A. 1994. Early stages of
protein folding. In Mechanisms of Protein Folding (R.H. Pain, ed.) pp. 37-40. Oxford University
Press, Oxford.
Thatcher, D. and Hitchcock, A. 1994. Protein folding in biotechnology. In Mechanisms of Protein
Folding (R.H. Pain, ed.) pp. 242-250. Oxford
University Press, Oxford.
Contributed by Roger H. Pain

Jozef Stefan Institute
Ljubljana, Slovenia
Lindsay, C.D. and Pain, R.H. 1991. Refolding and
Purification of
Recombinant
Proteins
6.4.7
Folding and Purification of Insoluble

(Inclusion Body) Proteins from
Escherichia coli
UNIT 6.5
Heterologous expression of recombinant proteins in E. coli often results in the formation

of insoluble and inactive protein aggregates, commonly referred to as inclusion bodies.
To obtain the native (i.e., correctly folded) and hence active form of the protein from such
aggregates, four steps are usually followed. In the first step, the bacterial cells are lysed
and the aggregates collected by low-speed centrifugation (UNITS 6.2 & 6.3). In the second
step (which is usually but not always included) the aggregates are preextracted to remove
cell wall and outer membrane components, producing washed pellets (UNIT 6.3). In the
third step, the aggregates are solubilized (or extracted) with strong protein denaturants
e.g., guanidineHCl, 8 M urea, or organic acids at high concentrations (UNIT 6.3). In the
fourth step, the solubilized, denatured proteins are folded with concomitant oxidation of
reduced cysteine residues into the correct disulfide bonds to obtain the native protein.
Basic Protocols 1, 2, and 3 in this unit feature three different approaches to the final step
of protein folding and purification.
Basic Protocol 1 describes the extraction of bovine growth hormone (BGH) using
guanidineHCl, after which the solubilized protein is folded (before purification) in an
oxido-shuffling buffer system to increase the rate of protein oxidation. A nondenaturing
concentration of urea (a cosolvent; see UNIT 6.4) is added to the buffer used in the folding
step to increase the yield of folded protein by minimizing the formation of aggregated,
misfolded protein. The folded protein is then purified by chromatography.
Basic Protocol 2 describes folding and purification of the cytokine interleukin 2 (IL-2).
This procedure differs from Basic Protocol 1 in that (1) acetic acid is used to solubilize
(i.e., extract) the protein, (2) the acid-soluble protein is partially purified by gel filtration
before folding, and (3) protein folding and oxidation are carried out with no additives;
the protein (in acid solution) is simply dialyzed against water, thereby allowing the pH
to slowly increase and air oxidation of the protein to occur. The folded protein is further
purified by reversed-phase high-performance liquid chromatography (RP-HPLC). A
support protocol is included for rapidly determining the amount of folded protein that
contains the correct disulfide linkage pattern.
Basic Protocol 3 describes the folding and purification of a fusion protein containing the
catalytic domain of the human immunodeficiency virus 1 (HIV-1) integrase. The fusion
partner is a 20-amino-acid peptide containing a track of six histidine residues (a His tag;
see UNIT 5.1). The protein is extracted with guanidineHCl (as with BGH), then purified by
gel filtration in guanidineHCl (UNIT 6.3). The protein is further purified by metal-chelate
affinity chromatography, which takes advantage of the His tag. Next, the purified protein
is folded by very slow dilution into a folding buffer containing additives required to
maintain the solubility of the folded protein. The His tag is removed by digestion with
the protease thrombin, the thrombin is removed by affinity chromatography using an
immobilized substrate, and finally the cleaved protein is run through a gel-filtration
column to remove any aggregated protein.
Purification of
Recombinant
Proteins
Contributed by Paul T. Wingfield, Ira Palmer, and Shu-Mei Liang
6.5.1
CPPS
BASIC
PROTOCOL 1
FOLDING AND PURIFICATION OF BOVINE GROWTH HORMONE

The high-level expression of bovine growth hormone (BGH) in E. coli results in the
formation of highly aggregated protein (inclusion bodies). To restore the BGH to its
native, functional state, the E. coli cells are first lysed with the French press and the
inclusion bodies are partially purified by selective extraction of soluble and particulate
E. coli contaminants. The inclusion bodies are solubilized with guanidineHCl to give
protein that is unfolded and reduced (i.e., with four free sulfhydryl residues). The protein
is then simultaneously folded and oxidized by the slow removal of protein denaturant,
resulting in the formation of two disulfide bonds from the sulfhydryl residues. The
solubility of the protein during folding is maintained using a cosolvent (urea) and the
oxidation of cysteine residues is catalyzed by a mixture of reduced and oxidized glutathione (GSH/GSSG; see also APPENDIX 3A). The folded, oxidized protein is finally
purified to homogeneity by anion exchange and gel-filtration chromatography.
Materials
E. coli cells expressing BGH: 50 g wet weight from a 1.5-liter fermentation
(UNIT 5.3), and stored as a flattened paste in a sealed polyethylene bag at 80C
BGH break buffer A (see recipe), 4C
BGH break buffer B (see recipe), 4C
BGH wash buffer A (see recipe), 4C
BGH wash buffer B (see recipe), 4C
BGH extraction buffer (see recipe), 4C
BGH folding buffer A (see recipe), 4C
BGH folding buffer B (see recipe), 4C
2 M HCl
BGH column buffer A (see recipe), 4C
DEAE Sepharose CL-4B ion-exchange resin (Pharmacia Biotech)
Sephadex G-100 gel filtration resin (Pharmacia Biotech)
BGH column buffer B (see recipe), 4C
Blender (e.g., Waring; 1 liter capacity)
Tissue homogenizer (e.g., Polytron, Brinkmann)
Beckman J2-21M centrifuge and JA-20 rotor (or equivalent)
Sonicator, 400 W, with sound enclosure (Branson or equivalent)
0.7-m glass-microfiber filters, 4.7-cm diameter (Whatman GF/F) with vacuum
filtration apparatus (optional)
Spectra/Por 1 dialysis tubing, 40-mm diameter (MWCO 6000 to 8000; Spectrum)
5 50cm and 5 100cm glass chromatography columns with adjustable flow
adaptors (Pharmacia Biotech)
Stirred cell with Diaflo PM 10 ultrafiltration membrane (Amicon)
Millex-GV 0.22-m filter units (Millipore)
Additional reagents and equipment for cell breakage using a French press
(UNIT 6.2), dialysis (APPENDIX 3B), ion-exchange chromatography (UNIT 8.2),
gel-filtration chromatography (UNIT 8.3), and SDS-PAGE (UNIT 10.1)
NOTE: All steps are carried at 4C unless otherwise stated.
Break cells
1. Resuspend 50 g (wet weight) of E. coli cells expressing BGH in 250 ml BGH break
buffer A using a blender.
Folding and
Purification of
Insoluble Proteins
from E. coli
The lysozyme in BGH break buffer A aids in removal of the peptidoglycan and outer
membrane protein contaminants (see UNIT 6.1).
6.5.2
2. Stir cell suspension 30 min at 20 to 25C using a heavy-duty magnetic stirrer. To

reduce viscosity of the suspension, homogenize with tissue homogenizer until no
clumps are detected, then centrifuge 35 min at 20,000 g (13,500 rpm in JA-20 rotor),
4C.
3. Resuspend pellet in 150 ml BGH break buffer B using tissue homogenizer. Break
cells using French press as described in UNIT 6.2, Basic Protocol 1, steps 1 to 5.
The viscosity can also be reduced by digestion with DNase and RNase as described in UNIT
6.2, in which case the EDTA in BGH break buffer B should be replaced with 5 mM MgCl2.
Prepare and extract washed pellet

4. Centrifuge suspension 40 min at 20,000 g. Resuspend pellet in 250 ml BGH wash
buffer A using the tissue homogenizer, then centrifuge 30 min at 20,000 g. Repeat
centrifugation and resuspension once using BGH wash buffer A and again using BGH
wash buffer B. Discard the cloudy supernatants and save the washed pellet.
If not to be used immediately, the washed pellet may be stored at 80C.
5. Resuspend washed pellet in 150 ml BGH extraction buffer. Sonicate briefly to

completely disperse protein, then clarify solution by centrifuging 30 min at 20,000
g or by filtering through a 0.7-m glass-microfiber filter under vacuum.
Generally, when protein is extracted with guanidineHCl, the reductant dithiothreitol is
included in the buffer system to ensure that the protein is fully reduced prior to folding. In
this procedure it was established that >80% of the protein in the inclusion bodies was
already in the reduced state (P.T.W., unpub. observ.). In the extraction buffer used here,
therefore, only the relatively weak reductant glutathione is included. This compound serves
to maintain thiols in the reduced state, and is a component of the redox buffer that will be
used later to oxidize the protein. It cannot, however, be assumed that other inclusion-body
proteins contain only free thiols.
Fold protein
6. Dilute the clear amber-colored solution with an equal volume of BGH folding buffer
A and pour into prewashed dialysis tubing.
Use two or three pieces of tubing and fill dialysis bags only three-quarters of the way to
allow for any volume increase during dialysis.
The BGH concentration from step 5 should be 2 to 4 mg/ml, and after dilution should not
exceed 1.0 to 2.0 mg/ml. If higher concentrations are found, the solution must be diluted
further with folding buffer A. BGH concentration can be estimated by diluting the sample
with 4 M guanidineHCl in water and measuring the absorbance at 280 nm and 260 nm
in a cell with a 1-cm path length. The total protein concentration (mg/ml) is estimated as
1.55 A280 0.76 A260 nm (Stoscheck, 1990). The BGH content may either be assumed to be
60% of the total protein or, more accurately, be estimated by performing SDS-PAGE and
densitometry using the washed pellet from step 4.
Urea is included in folding buffer A as a cosolvent to maintain solubility of the protein
during refolding. Removal of guanidineHCl by dialysis or dilution results in precipitation
if no cosolvent is used. The urea concentration chosen (in this case 4 M) should be low
enough to allow the native structure to form (see UNIT 6.4). Urea unfolding/folding profiles
for BGH (i.e., equilibrium-denaturation curves in which protein conformation is measured
as a function of denaturant concentration; see UNIT 6.4) were available in the literature
prior to development of this method (Edelhoch and Burger, 1966). The urea concentration
that induces protein unfolding can be determined rapidly by urea gradient electrophoresis
(Goldenberg, 1989).
7. Dialyze solution 12 to 16 hr (or overnight) against 5 liters of BGH folding buffer A,

then dialyze an additional 6 to 8 hr against 5 liters of BGH folding buffer B.
The second dialysis can be continued overnight if necessary.
Purification of
Recombinant
Proteins
6.5.3
Figure 6.5.1 SDS-PAGE of bovine growth hormones on 12.5% polyacrylamide gel. Lane A,
BGH-expressing E. coli cells minus the expression vector; lanes B and C, BGH-expressing E. coli
cells with A-4 and A-9 BGH expression vectors, respectively; lane D, purified recombinant A-9
BGH; lane E, BGH purified from pituitary (supplied by A.F. Parlow, UCLA); lane F, purified
recombinant A-9 BGH with no reductant in sample buffer; lane G, BGH purified from pituitary with
no reductant in sample buffer. In lane E (pituitary BGH), the two bands correspond to full-length
protein and protein truncated at the N-terminus by 4 residues. It can be seen that the bottom band
has the same mobility as E. coli extracts containing the A-4 BGH construct. In lane G, it it may be
noted that the two bands are not resolved under nonreducing conditions.
Oxidation of the protein during dialysis can be monitored by SDS-PAGE (UNIT 10.1).
SDS-denatured oxidized BGH is more compact than SDS-denatured reduced BGH and thus
migrates faster as a result of the lower apparent molecular weight (i.e., 18 kDa for the
oxidized form versus 22 kDa for the reduced form). SDS-PAGE band patterns of oxidized
and reduced BGH are shown in Figure 6.5.1. Any free thiol groups in the sample are
quenched by addition of 20 mM iodoacetamide. SDS sample buffer (UNIT 10.1) minus
reductant is then added. The pH of the SDS-treated sample may have to be readjusted with
dilute alkali. The proportion of oxidized versus reduced protein is finally determined by
densitometry of the Coomassie bluestained gel. It should be noted that this approach does
not prove whether or not the correct disulfide bond(s) have been formed. The shift in
mobility upon reduction occurs because of the formation of the disulfide bond linking
Cys-51 to Cys-163. BGH in which the second disulfide bond (linking Cys-180 to Cys-188)
has been selectively reduced (Graf et al., 1975) still exhibits the gel shift. Despite these
potential pitfalls, the gel method is useful and correlates with other approachese.g., direct
monitoring of disulfide formation using 2-nitro-5-thiosulfobenzoate in the presence of
sodium sulfite after the free sulfhydryls have been quenched and the buffer components
removed (Thannhauser et al., 1984). Sulfhydryl groups can be assayed using Ellmans
reagent (Riddles et al., 1979).
8. Centrifuge the slightly cloudy solution 30 min at 20,000 g. Discard pellet and adjust
supernatant to pH 9.0 with 2 M HCl.
The volume of the supernatant should be 300 to 320 ml.
Folding and
Purification of
Insoluble Proteins
from E. coli
Purify protein by ion-exchange and gel filtration chromatography

9. Pack a 5 50cm column with DEAE Sepharose CL-4B to give a bed height of 10
cm and equilibrate with BGH column buffer A. Apply the solution from step 8 at a
flow rate of 60 ml/hr and begin collecting 15-ml fractions.
See UNIT 8.2 for further information on preparing an ion-exchange column.
6.5.4
10. Elute with BGH column buffer A at the same flow rate and continue fraction
collection until A280 or A260 of eluant approaches a baseline value. Assay fractions by
SDS-PAGE and pool fractions containing BGH.
Under the ion-exchange conditions used, BGH does not bind to the matrix and is located
in the flowthrough fractions. The more acidic E. coli contaminants bind tightly to the top
portion of the column, which turns brown. Some of the earlier flowthrough fractions may
be slightly contaminated with aggregated protein that separates from soluble protein as a
result of the gel-filtration effect of the matrix. A BGH concentration of 0.2 to 0.3 mg/ml in
400 to 450 ml of pooled eluant should be obtained. This should exhibit a single band on
the SDS-PAGE gel.
Pooled fractions can be stored 1 to 2 days at 4C and for longer periods at 80C.
11. Concentrate pooled BGH-containing fractions to 50 to 60 ml (i.e., to 2 to 3 mg/ml

protein concentration) using a stirred cell with Diaflo PM 10 ultrafiltration membrane. Centrifuge filtrate 15 min at 20,000 g to remove any precipitated protein.
12. Pack a 5 100cm column with Sephadex G-100 to a bed height of 95 cm and
equilibrate with BGH column buffer B. Apply the filtrate from step 11 at a flow rate
of 40 ml/hr and begin collecting 15-ml fractions.
See UNIT 8.3 for additional information on preparing gel-filtration columns. If a 5 100cm
column is not available, a 2.5 100cm column can be used. Depending on the amount of
sample, the smaller-diameter column may be run several times, loading 18 to 20 ml of
sample per run.
13. Elute with BGH column buffer B at the same flow rate and continue fraction
collection until A280 or A260 of eluant approaches a baseline value. Assay fractions by
SDS-PAGE and pool fractions containing BGH.
The protein elutes in a single but slightly asymmetrical peak.
The gel-filtration elution peak has a sharp front edge, whereas the descending portion is
more diffuse and trailing. This elution behavior results from the fact that BGH is a rapidly
associating/dissociating monomer/dimer system (with a Kd of 0.8 to 1.0 105 M; see
Ackers, 1970, for discussion of theory). The apparent molecular weight estimated by gel
filtration is 30 to 35 kDa (with a monomer mass of 22 kDa).
The slightly alkaline pH of the column buffer and folding buffers is required to maintain
solubility of the protein.
14. Repeat step 11, then filter sterilize filtrate using a Millex-GV 0.22-m filter unit.
Store purified BGH in aliquots at 80C.
For long-term storage the protein can be lyophilized. If this is to be done, the pooled
fractions from step 10 should be directly dialyzed (APPENDIX 3B) against 0.1 M ammonium
bicarbonate (pH 9.2 to 9.4, adjusted with ammonium hydroxide), and the dialysate
filter-sterilized and freeze-dried. If an essentially salt-free protein is required, two cycles
of freeze-drying should be performed and the protein reconstituted with water alone after
the first drying cycle.
The concentration of the purified BGH can be conveniently determined by UV absorbance
measurementi.e., 1 mg/ml native BGH has an A280 of 0.7 in a 1-cm quartz cuvette. Protein
concentration may also be estimated in crude extracts using the Bio-Rad Protein Assay Kit
(based on the Bradford method) and in partially purified fractions as described in the
annotation to step 6. Biological activity of the protein is measured as described in Wingfield
et al. (1987a).
Purification of
Recombinant
Proteins
6.5.5
BASIC
PROTOCOL 2
FOLDING AND PURIFICATION OF HUMAN INTERLEUKIN 2

Human interleukin 2 (hIL-2) is a hydrophobic, acid-stable polypeptide with a molecular
weight of 15 kDa. Recombinant hIL-2 expressed in E. coli is deposited in inclusion bodies.
Extraction of the inclusion bodies with denaturants followed by folding in aqueous
solution often results in formation of insoluble hIL-2 aggregates. In this protocol,
inclusion bodies containing recombinant hIL-2 are first extracted with acetic acid and the
soluble monomeric hIL-2 is separated from other hIL-2 aggregates by gel-filtration
chromatography. The soluble protein is then folded and oxidized by dialysis against water.
Correctly folded hIL-2 is finally separated from unfolded hIL-2 and other E. coli
contaminants by reversed-phase high-performance liquid chromatography (RP-HPLC).
Materials
hIL-2 break buffer (see recipe), 4C
E. coli cells expressing hIL-2: 20 g wet weight from a 3-liter fermentation
(UNIT 5.3), and stored as a flattened paste in a sealed polyethylene bag at 80C
Sucrose
Lysozyme (Worthington)
hIL-2 wash buffer: 0.75 M guanidineHCl/1% (w/v) Tween 20 (prepare
immediately before use), 4C
PBS (APPENDIX 2E), 4C
10% and 20% (v/v) acetic acid, 4C (prepare fresh from glacial acetic acid)
Sephadex G-100 gel-filtration resin (Pharmacia Biotech)
Acetonitrile (HPLC grade)
Trifluoroacetic acid (TFA; HPLC grade)
7 250mm 300- octyl Aquapore RP-300 semiprep column (Brownlee column;
Thomson Instrument)
RP-HPLC solvent A (see recipe), room temperature
RP-HPLC solvent B (see recipe), room temperature
25 mM acetic acid, 4C
30C water bath
Sorvall RC-5C centrifuge with SS-34 rotor (or equivalent)
2.6 100cm glass chromatography column
Spectra/Por 3 dialysis tubing, 11.5- and 45-mm diameters (MWCO 3500;
Spectrum)
Sterivex-GS 0.22-m filter units (Millipore)
HPLC system with pumps, UV detector, and fraction collector (Waters)
Additional reagents and equipment for cell breakage using a French press
(UNIT 6.2), gel-filtration chromatography (UNIT 8.3), and dialysis (APPENDIX 3B)
Break cells
1. Add 60 ml hIL-2 break buffer to 20 g (wet weight) of E. coli cells expressing hIL-2
in a 250-ml glass beaker. Mix well using tissue homogenizer.
UNIT 6.2
describes use of a tissue homogenizer to resuspend E. coli cells.
2. Add 21 g sucrose and mix well with cell paste using tissue homogenizer. Add 34 mg
lysozyme and mix again using tissue homogenizer. Incubate 30 min in a 30C water
bath, then dilute with 100 ml hIL-2 break buffer and cool on ice.
Folding and
Purification of
Insoluble Proteins
from E. coli
3. Break cells by passing suspension through a French press twice as described in UNIT
6.2. Centrifuge 30 min at 13,000 g (10,400 rpm in SS-34 rotor), 4C. Save pellet.
The wet weight of the pellet should be 1.5 g.
6.5.6
4. Wash pellet by resuspending in 30 ml hIL-2 wash buffer and centrifuging 30 min at

13,000 g. Repeat wash once with hIL-2 wash buffer and again using 30 ml PBS in
place of the wash buffer.
Washed pellets should be used immediately or stored at 70C until required.
Extract protein with acid and prepare gel-filtration column

5. Add 12.5 ml of 20% acetic acid to the washed pellet and mix using tissue homogenizer. Centrifuge 30 min at 13,000 g, 4C, and save the supernatant.
6. Pack a 2.6 100cm column with Sephadex G-100 to give a bed height of 95 cm and
equilibrate with 10% acetic acid.
For convenience the column may be packed the day before use.
7. Repeat step 5 and pool the two clear supernatants (total volume should be 25 ml).
Isolate hIL-2 monomer from solubilized protein by gel filtration
8. Immediately apply pooled supernatants to column prepared in step 6. Perform gel
filtration chromatography at 4C as described in UNIT 8.3 and construct a chromatogram, pooling the fractions that make up the third peak.
The solution should be applied to the column immediately after extraction to prevent any
covalent modification of the protein.
The column eluate usually shows three major peaks in A280. The first peak (in the void
volume) contains aggregates, the second peak contains dimeric hIL-2, and the third peak
contains monomeric hIL-2 (S.M.L., unpub. observ.). A T cell proliferation assay shows that
the third peak contains the highest biological activity of hIL-2 (Liang et al., 1986; Bottomly
et al., 1991).
9. Using 45-mm diameter Spectra/Por 3 dialysis tubing (MWCO 3500), dialyze the
pooled fractions (60 ml) making up the third peak at 4C overnight against 5 liters
of Milli-Q water, then for an additional 3 to 4 hr against 5 liters of fresh Milli-Q water.
The pooled eluate fractions should be extensively dialyzed against water to remove acetic
acid. The dialysate should have a volume of 60 ml with an hIL-2 concentration of 0.2
mg/ml. After dialysis, the hIL-2 monomer can be stored at 20C until required.
As the acetic acid is removed; sample pH slowly increases, thereby allowing hIL-2 thiols
to form disulfide bonds.
Purify protein by RP-HPLC

10. Filter the dialysate through a 0.22-m filter unit, then add 30 ml acetonitrile (33%
v/v final) and 0.09 ml TFA (0.1% v/v final).
11. Prepare and test the HPLC system according to manufacturers instructions. Place a
300- octyl Aquapore RP-300 reversed-phase chromatography column in line.
Other reversed-phase columns; e.g., the 2.2 15cm TMS-250 (TosoHaas) can also be
used (Kato, 1985).
12. Fill the reservoirs of the HPLC system gradient maker with RP-HPLC solvent A and
RP-HPLC solvent B. Carry out a blank run (at room temperature) with the following
gradient program:
0 min: 0% solvent B/100% solvent A
Purification of
Recombinant
Proteins
6.5.7

210 min: 0% solvent B/100% solvent A.
Repeat blank run as necessary to ensure that the baseline profile has stabilized.
13. Pump sample from step 10 into column at a flow rate of 4 ml/min. Run the gradient
program described in step 12 at a flow rate of 1 ml/min at room temperature. Collect
8-ml fractions at a rate of 1 ml/min and pool the fractions making up the correctly
folded hIL-2 peak, which elutes at 70 min.
Care should be taken to avoid introducing air bubbles while pumping the sample into the
column, as these will generate false peaks in the chromatogram. If the peaks in the HPLC
profile are too broad, the gradient program should be varied to improve the separation (see
Chapter 8).
14. Using 11.5-mm diameter Spectra/Por 3 dialysis tubing (MWCO 3500), dialyze the
pooled hIL-2 fractions against Milli-Q water or 25 mM acetic acid at 4C. Filter the
purified protein solution using a 0.22-m filter unit and store at 20C or below.
SUPPORT
PROTOCOL
RESOLUTION OF NATIVE AND MISFOLDED FORMS OF hIL-2

BY RP-HPLC
Human interleukin 2 (hIL-2) contains three cysteine residuesat positions 58, 105, and
125. In the correctly folded (native) protein, the cysteines at positions 58 and 105 form a
disulfide bond that is important for biological activity of the protein (Robb et al., 1984;
Wang et al., 1984; Liang et al., 1985).
As hIL-2 contains three cysteines, three possible intramolecular disulfidelinked forms
can exist, only one of which is the native form. RP-HPLC can separate these isomers, and
is used to verify that the purified IL-2 contains the native disulfide.
Additional Materials (also see Basic Protocol 2)
0.46 10cm SynChropak RP-P C18 column (Thomson Instrument)
RP-HPLC solvent C (see recipe)
25 mM acetic acid
Purified folded hIL-2 solution (see Basic Protocol 2)
1. Prepare and test HPLC system according to manufacturers instructions. Place a 0.46
10cm SynChropak RP-P C18 column in line.
2. Fill the reservoirs of the HPLC system gradient maker with RP-HPLC solvent A and
RP-HPLC solvent C. Apply 20 l of 25 mM acetic acid as a blank sample. Perform
a blank run at room temperature using a gradient program starting with 100% solvent
A for 5 min, followed by a linear gradient starting at 100% solvent A/0% solvent C
and ending at 0% solvent A/100% solvent C, at a flow rate of 1 ml/min. Repeat as
necessary to check that the baseline profile is reproducible.
3. Prepare a solution of 5 mg/ml purified folded hIL-2 solution in 25 mM acetic acid
and filter through a 0.22-m filter.
Folding and
Purification of
Insoluble Proteins
from E. coli
4. Apply 20 l of purified folded hIL-2 solution in 25 mM acetic acid to the column

and carry out RP-HPLC at room temperature using the gradient program described
in step 2. Collect the fractions containing the properly folded hIL-2.
6.5.8
A214
0.3
0.2
0.1
0.0
C
D
1
0.3
0.2
0.1
0.0
40
80
120
40
80
120
Time (min)
Figure 6.5.2 Chromatograms illustrating peaks produced by (A) correctly folded hIL-2 (in absence
of denaturant); (B) correctly folded hIL-2 (in presence of denaturant but at pH 3.5, which is too low
for disulfide-bond exchange); (C) scrambled hIL-2 isomers (resulting from denaturant treatment at
pH 8.5); (D) unfolded hIL-2 (resulting from denaturant/reductant treatment).
Properly folded hIL-2 usually elutes at 54% acetonitrile and unfolded hIL-2, which has
no intramolecular disulfide bond, elutes at 57% acetonitrile.
In the presence of denaturants such as guanidineHCl, hIL-2 rapidly scrambles into a
mixture of three disulfide-linked isomers. The incorrectly folded hIL-2 elutes at a lower
acetonitrile concentration (<54%) as shown in Figure 6.5.2. For each separation in Figure
6.5.2, two Vydac C4 columns were connected in series and run at 40C with a 1 ml/min
flow rate. The sample was eluted with an acetonitrile gradient that increased from 0% to
44% in 15 min, and then to 64% in 120 min. In the separation represented by the
chromatogram in panel A, 100 g hIL-2 in 40 l of 50 mM acetic acid was dissolved in
400 l of 20% formic acid and chromatographed. The elution peak (at 57.3% acetonitrile)
represents native hIL-2. In panel B, hIL-2 was added to 300 l of 6 M guanidineHCl/0.2
M acetic acid, pH 3.5, and incubated 10 min at room temperature. 200 l of 20% formic
acid was added and the sample was chromatographed. Note that the chromatogram has
not changed, as the pH is below the point where isomerization (disulfide-bond exchange)
occurs. In panel C, hIL-2 was added to 300 l of 6 M guanidineHCl/0.05 M TrisCl, pH
8.5, incubated 5 min at room temperature, then quenched with formic acid as in the
separation represented by panel B. Peak 1 represents the scrambled isomer with a disulfide
bond between Cys-105 and Cys-125, whereas peak 2 is probably the scrambled isomer
with a disulfide bond between Cys-58 and Cys-125. Finally, in panel D, hIL-2 was added
to 6 M guanidineCl as in panel C. 50 mM DTT was then added and the sample was
incubated 40 min at room temperature, then quenched with formic acid as in panel B. The
peak (at 59.4% acetonitrile) represents completely reduced (unfolded) hIL-2. (see also
Browning et al., 1986).
IMPORTANT NOTE: If the pressure in the HPLC column exceeds 4000 psi, the column
should be cleaned.
Purification of
Recombinant
Proteins
6.5.9
BASIC
PROTOCOL 3
FOLDING AND PURIFICATION OF A HISTIDINE-TAGGED

PROTEIN: HIV-1 INTEGRASE
This protocol describes the folding and purification of the central core domain of the
HIV-1 integrase, which consists of residues 50 to 212 (IN50-212). The protein is expressed
in E. coli with an N-terminal extension of 20 residues that includes a track of six histidines
(i.e., a His tag; see UNIT 5.1). Cell are first broken using lysozyme and sonication. The
protein is then extracted from inclusion bodies using 8 M guanidineHCl and partially
purified by gel filtration in the presence of 4 M guanidineHCl. Further purification by
metal-chelate affinity chromatography (MCAC; also see UNIT 9.4) takes advantage of the
His tag. The purified protein, which at this stage is unfolded, is then folded by removal
of guanidineHCl through dilution into a buffer containing the zwitterionic detergent
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS). The His tag
is removed from the folded protein by digestion with the protease thrombin, and the
thrombin is removed by affinity chromatography using immobilized p-aminobenzamidine. A final cleanup of the protein is carried out by gel filtration.
Materials
E. coli cells expressing HIV-1 integrase: 100 g wet weight from a 3.5-liter
fermentation (UNIT 5.3), stored as a flattened paste in a sealed polyethylene
bag at 80C
IN break buffer (see recipe), 4C
Suspension buffer: IN break buffer (see recipe) prepared without lysozyme, 4C
IN extraction buffer (see recipe), 4C
6 60cm Superdex 200 prep grade prepacked gel-filtration column (Pharmacia
Biotech)
IN column buffer A (see recipe), 4C
Ni-NTA-Sepharose CL-6B MCAC resin (Qiagen)
IN column buffer B (see recipe), 4C
IN column buffer C (see recipe), 4C
IN column buffer D (see recipe), 4C
6 60cm Superdex 75 prep grade prepacked gel-filtration column (Pharmacia
Biotech)
IN column buffer E (see recipe), 4C
4 M guanidineHCl/5 mM DTT (4C)
IN folding buffer (see recipe), 4C
50 mM TrisCl (pH 7.5 at 4C)/10 mM CHAPS, 4C
2000 NIH unit/ml thrombin (see recipe)
IN column buffer F (see recipe), 4C
9 M urea, 4C
IN column buffer G (see recipe), 4C
p-aminobenzamidine immobilized on Sepharose 6B (Pierce, Pharmacia Biotech,
or Sigma)
0.1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF; Boehringer
Mannheim or ICN Biomedicals)
Folding and
Purification of
Insoluble Proteins
from E. coli
Blender (e.g., Waring; 1 liter capacity)

1-liter steel beaker
Sonicator, 400 W, with sound enclosure (Branson or equivalent)
Centrifuge with Beckman J-14 rotor (or equivalent)
Ultracentrifuge with Beckman 45Ti rotor (or eqivalent)
5 50cm chromatography column with adjustable flow adaptors
6.5.10
Stirred cells (400-ml and 2-liter capacities) with Diaflo PM 10 ultrafiltration

membranes (Amicon)
Peristaltic pump
Millex-GV 0.22-m pore size filter units (Millipore)
28C water bath
1 10 to 1 20cm chromatography column
Additional reagents and equipment for gel-filtration chromatography (UNIT 8.3) and
SDS-PAGE (UNIT 10.1)
NOTE: All steps are carried at 4C unless otherwise stated.
Break cells and prepare washed pellets
1. Resuspend 100 g (wet weight) of E. coli cells expressing HIV-1 integrase in 400 ml
IN break buffer using a blender. Stir with a magnetic stirrer at room temperature (20
to 25C) for 30 min.
2. Pour the viscous suspension into a 1-liter steel beaker in an ice bath. Sonicate 20 min
at full power with a 60% duty cycle (i.e., on for 0.6 sec, then off for 0.4 sec), with
stirring.
Be sure that the temperature does not rise above 20C.
3. Centrifuge 1 hr at 30,000 g (14,000 rpm in J-14 rotor), 4C. Resuspend pellet with
500 ml suspension buffer and centrifuge 1 hr at 30,000 g.
Extract washed pellet and purify by gel filtration
4. Dissolve pellet in 40 ml IN extraction buffer using tissue homogenizer. Centrifuge
45 min at 100,000 g (35,000 rpm in 45Ti rotor), 4C.
5. Apply the clear supernatant to a 6 60cm Superdex 200 gel-filtration column (UNIT
8.3) equilibrated with IN column buffer A. Elute at 300 ml/hr using IN column buffer
A, collecting 15-ml fractions. Assay fractions by SDS-PAGE (UNIT 10.1) and pool those
containing IN50-212.
IN50-212 should be the major band visible on SDS-PAGE after gel filtration, representing
20% to 50% of the total protein.
Purify IN50-212 by MCAC

6. Apply the IN50-212 sample to a 5 50cm column that has been packed with
Ni-NTA-Sepharose CL-6B MCAC resin to a bed height of 5 cm and equilibrated with
IN column buffer B at a flow rate of 300 ml/hr. Continue washing column with buffer
until absorbance approaches the baseline.
7. Continue washing the column with 5 to 10 column volumes (490 to 980 ml) of IN
column buffer C.
The absorbance of the column eluate should be close to baseline before the sample is
applied.
Histidine is bound to the Ni-NTA resin by coordination bonding of the nonprotonated
nitrogen atom of the imidazole side chain to Ni2+ ions. Because the pH of the IN column
buffer C (6.4) is close to the average pKa of histidine (6.0 to 7.0), only proteins that contain
a track of six histidines (i.e., the His tag) are bound strongly enough to be retained. The
sample applied to the column should not contain EDTA, and if reductant is required 1 mM
2-mercaptoethanol should be used rather than dithiothreitol.
The Ni-NTA matrix is reported to have a binding capacity of 5 to 10 mg protein per ml
resin.
Purification of
Recombinant
Proteins
6.5.11
8. Elute bound protein with a linear pH gradient in a total volume of 980 ml (10 column
volumes) beginning at pH 6.4 and ending at pH 4.5: make the gradient by placing
490 ml IN column buffer C (pH 6.4) and 490 ml of IN column buffer D (pH 4.5) in
the appropriate reservoirs of the gradient maker. Elute column at 300 ml/hr, collect
10-ml fractions and pool those making up the major peak (containing IN50-212; eluted
at pH 5.5).
After elution, the column can be cleaned by washing with 0.2 M acetic acid/6 M guanidineHCl, then reequilibrated with IN column buffer B. Under the conditions described, the
column can be used two or three times before it turns from light blue-green to brownishgray, indicating that regeneration is required. The column can be regenerated by passing
2 column volumes of 100 mM EDTA to strip Ni from the resin, washing the column
sequentially with 2 column volumes each of 0.1 M NaOH and 6 M guanidineHCl, and
finally passing 2 column volumes of 10 mM NiSO4 through the column to charge the resin
with Ni. The column is then washed with water and equilibrated with IN column buffer B.
Further details on use of the Ni-NTA resin are given in the manufacturers literature
(Qiagen, 1992) and in UNIT 9.2.
9. Concentrate pooled IN50-212-containing fractions to 40 ml (i.e., 8 to 10 mg/ml

protein) using a stirred cell with Diaflo PM 10 ultrafiltration membrane.
10. Apply concentrated sample to a 6 60cm Superdex 75 gel-filtration column
equilibrated with IN column buffer E. Pool the peak fractions.
Reductants (either dithiothreitol or 2-mercaptoethanol) are included in the buffers to
maintain the IN50-212 cysteine thiol groups in the reduced state. It should be noted that
IN50-212 contains three cysteine residues that do not participate in disulfide bond formation.
Pooled fractions may be stored in 10 to 20 ml aliquots at 80C until ready to use.
This gel-filtration step removes minor protein contaminants and metal ions leached from
the MCAC column. It also exchanges the protein into fresh buffer containing DTT.
Alternatively, the pooled fractions from step 8 can be concentrated by ultrafiltration to 1
mg/ml protein, then dialyzed (APPENDIX 3B) against IN column buffer E.
Fold protein by dilution

11. Dilute pooled fractions from step 10 to 1 mg/ml protein using 4 M guanidineHCl/5
mM DTT. Pump 30 ml (or other volume as required) of the diluted solution into 1
liter IN folding buffer using a peristaltic pump at a flow rate of 3 ml/hr while stirring
gently with a magnetic stirrer (see Fig. 6.5.3).
~3 ml/hr flow rate
folding buffer
stir bar
HIV-1
integrase
peristaltic pump
Folding and
Purification of
Insoluble Proteins
from E. coli
magnetic stirrer
Figure 6.5.3 Setup for folding of HIV-1 integrase by dilution into buffer.
6.5.12
After dilution, the final protein concentration will be 30 g/ml.

Protein concentration can be estimated using A280 = 1.46 for 1 mg/ml folded IN50-212 (still
containing the His tag) measured in a cuvette with a 1-cm path length.. If A280 is >2.0,
dilute with 4 M guanidineHCl in water.
The scale of operation at this step is limited by the large dilution of the protein. This step
can be scaled up if equipment suitable for concentration of large volumes is available (see
annotation to step 12). Otherwise, the step can be repeated if more protein is needed.
Protein folding is usually carried out at a low concentration to avoid aggregation, which
is thought to arise from partially folded protein in the folding pathway (i.e., folding
intermediates; Goldberg et al., 1991; Jaenicke, 1991; also see UNIT 6.4). Because aggregation is an intermolecular event, it is concentration-dependent. In this step the protein
concentration is increased very slowly, allowing the protein already in solution to fold
before additional unfolded protein is added. It is assumed that folded protein does not
participate in aggregation.
12. Concentrate solution to 1 mg/ml protein using a stirred cell with Diaflo PM 10
ultrafiltration membrane. Filter concentrated solution (25 to 30 ml volume) through
a Millex-GV 0.22-m filter.
If it is not be be used immediately, the concentrated solution can be stored at 80C for
several months.
The largest stirred cell produced by Amicon has a 2-liter maximum capacity (i.e., the Model
2000). This cell can be used to concentrate the solution to 100 ml, and this must be further
concentrated using a smaller cell (e.g., with a 200- or 400-ml capacity). For volumes >2
liters, or for a more rapid process, the Minitan tangential-flow membrane system (Millipore) can be used. This system allows a concentration rate of 0.5 to 1.0 liter/hr.
Cleave histidine tag with thrombin

13. Dilute folded protein from step 12 1:1 with 50 mM TrisCl (pH 7.5)/10 mM CHAPS
(0.5 mg/ml final protein concentration).
This dilution is carried out because thrombin digestion (in step 14) works best at NaCl
concentrations <200 mM.
14. Add 300 l of 2000 NIH unit/ml thrombin (600 NIH units) to 60 ml of diluted protein
from step 13 (30 mg IN50-212). Incubate 30 min at 28C with occasional mixing. Add
an additional 300 l of 2000 NIH unit/ml thrombin and incubate another 30 min.
Cool solution on ice to 4C and proceed immediately to step 15.
Digestion conditions are optimized by conducting small-scale digestions (using <1.0 ml of
protein solution from step 13). See Critical Parameters and Troubleshooting for details.
The substrate/enzyme ratio used here is 0.02% (w/w).
Thrombin digestions are more reproducible when carried out on a relatively small scale
e.g., 20 to 30 mg protein per batch. If more cleaved protein is required, several batches
can be processed concurrently.
Remove excess thrombin by affinity chromatography

15. Pack a 1 10cm column with p-aminobenzamidine immobilized on Sepharose 6B.
Equilibrate with IN column buffer F.
16. Add 7.5 ml of 9 M urea (final concentration 1 M) to the 60-ml thrombin digest
prepared in step 14.
Purification of
Recombinant
Proteins
6.5.13
17. Apply digest to equilibrated column from step 15 at a flow rate of 2 ml/min. Collect
the column flowthrough, then wash with IN column buffer F until A280 is close to the
baseline (this usually requires 1 to 2 column volumes).
IN50-212 cannot be separated from thrombin by gel filtration because the IN50-212 (mol. wt.
18,200) undegoes self-association (Hickman et al., 1994), and therefore elutes with a
molecular weight close to that of thrombin (36,000). Affinity chromatography using the
thrombin inhibitor p-aminobenzamidine is therefore employed.
The 1 M urea is added to the sample and column buffers to prevent nonspecific binding of
IN50-212 to the column.
The affinity column may be regenerated by washing with several column volumes of 6 M
guanidineHCl in water to remove the bound thrombin; alternatively, the thrombin can be
eluted under native conditions with 50 mM TrisCl (pH 7.8)/10 mM benzamidineHCl.
18. Pool flowthrough and wash fractions, add 0.1 mM AEBSF, then concentrate to 2
mg/ml (in 10 ml) using a stirred cell with Diaflo PM 10 ultrafiltration membrane.
Peform final purification and assay protein
19. Purify protein by gel filtration as in step 10, using IN column buffer G in place of IN
column buffer E for equilibration and elution.
The column size can be reduced to 2.6 60 cm for fractionation of smaller (30 mg)
quantities of protein; the sample volume should be 5 to 10 ml.
20. Pool IN50-212-containing fractions and filter sterilize with Millex-GV 0.22-m filter.
The final protein solution can be concentrated if required. However, it should be noted that
when CHAPS-containing solutions are concentrated by ultrafiltration, the detergent will
also be concentrated. The excess detergent can be slowly removed by dialysis (APPENDIX
3B; the critical micellar concentration of CHAPS is 8 mM and its micellar size is 8 kDa).
Unfortunately, radiolabeled CHAPS is not available for monitoring the removal of that
detergent; however, an enzymatic assay is available (Talalay, 1960; Coleman et al., 1979).
21. Measure A280 of protein solution in a cuvette with a 1-cm path length.
Native IN50-212 (after the His tag has been cleaved) at a concentration of 1 mg/ml will have
an A280 = 1.54.

BGH break buffer A

100 mM TrisCl, pH 7.8 (pH as determined at 4C)
20 mM EDTA (from 0.5 M stock)
10% (w/v) sucrose (100 g/liter)
200 g/ml lysozyme (200 mg/liter)
Folding and
Purification of
Insoluble Proteins
from E. coli
BGH break buffer B

0.5 mM phenylmethylsulfonyl fluoride (PMSF)
PMSF can be added as 2.5 ml/liter of 0.2 M PMSF stock solution.
6.5.14
BGH column buffer A

60 mM ethanolamineHCl, pH 9.0
Ethanolamine (molecular weight 61.08; density 1.02) is a strong base (pKa = 9.4). The pH
9.6 buffer can made by dissolving 3.7 ml liquid ethanolamine free base or 5.9 g ethanolamineHCl salt (molecular weight 97.5) per liter, and adjusting the pH to 9.6 with HCl or
NaOH.
BGH column buffer B

Solution A: 0.5 M (62 g/liter) anhydrous Na2HCO3 (mol. wt. 84)
Solution B: 0.5 M (53 g/liter) anhydrous Na2CO3 (mol. wt. 106)
Mix 52 ml solution A and 148 ml solution B and dilute to 1 liter with water.
The solution may also be made directly by dissolving 7.8 g NaHCO3 and 2.2 g Na2CO3. The
0.5 M stock solutions may be stored at least 1 month at 4C.
BGH extraction buffer

To 420 ml H2O add (in the order indicated):
17.2 ml 150 g/liter (2 M) glycine stock (50 mM final; store stock at 4C)
7.8 ml 2 M NaOH
7.7 g reduced glutathione (GSH) or 50 ml 0.1 M GSH stock (see recipe; 5 mM final)
764 g guanidineHCl (8 M final)
H2O to 1 liter
Because of the volume increase on addition of guanidineHCl (i.e., 1 g increases the volume
0.76 ml), buffer components must be added to 420 ml water and total volume adjusted to 1
liter at the end.
The buffer should be pH 9.6 as determined at 4C; if it is not, it can be adjusted with 2 M
NaOH or 2 M HCl. If solid glutathione (which is acidic) is added, pH will require adjustment.
If high-quality guanidineHCl is used, the solution will be colorless and clear (see APPENDIX
3A).
BGH folding buffer A

To 500 ml H2O add (in the order indicated):
17.2 ml of 150 g/liter (2 M) glycine stock (50 mM glycine final; store stock at
4C)
7.8 ml 2 M NaOH
100 g sucrose (10% w/v final)
2 ml 0.5 M EDTA (1 mM final)
310 mg reduced glutathione (GSH) or 10 ml of 0.1 M GSH stock (see recipe; 1
mM final)
60 mg oxidized glutathione (GSSG) or 1 ml of 0.1 M GSSG stock (see recipe;
0.1 mM final)
240 g urea (4 M final)
Add 4C H2O to 1 liter
The buffer should be pH 9.6 as determined at 4C; if it is not it can be adjusted with either
2 M NaOH or 2 M HCl.
Because of the volume increase on addition of urea (i.e., 1 g increases the volume 0.76 ml),
buffer components must be added to 500 ml and total volume adjusted to 1 liter at the end.
There is no need to deionize urea if ultrapure-grade material is used.
Purification of
Recombinant
Proteins
6.5.15
BGH folding buffer B

60 mM ethanolamineHCl, pH 9.6 (pH as determined at 4C)
0.1 mM reduced glutathione (GSH)
0.01 mM oxidized glutathione (GSSG)
GSH and GSSG can be added from stock solutions (1 ml of 0.1 M GSH and 0.1 ml of 0.1 M
GSSG per liter) or as solids. If solid glutathione (which is acidic) is added, pH may require
adjustment.
Ethanolamine (molecular weight 61.08; density 1.02) is a strong base (pKa = 9.4). The pH
9.6 buffer can made by dissolving 3.7 ml liquid ethanolamine free base per liter or 5.9 g
ethanolamineHCl salt (molecular weight 97.5) per liter, and adjusting the pH to 9.6 with
HCl or NaOH. It can be stored several days at 4C.
BGH wash buffer A

2% (w/v) Triton X-100 (20 g/liter)
4 M urea (240 g/liter)
0.5 M DTT (77 mg/liter)
When preparing solution, allow for volume increase on addition of urea; 1 g urea will
increase solution volume by 0.76 ml. There is no need to deionize urea if ultrapure-grade
material is used.
Triton X-100 is a viscous liquid at 20 to 25C; for the use intended here, there is no need
for highly purified Triton.
BGH wash buffer B

0.5 mM DTT (77 mg/liter)
It is preferable to add DTT as a solid, but it may also be added as 0.2 M stock in water (30.8
g/liter; store at or below 20C; stable 1 month).
Glutathione stock solutions, 0.1 M

Reduced glutathione: Dissolve 30.73 mg/ml reduced glutathione (GSH) in water
and adjust pH to 7 with NaOH. Store at or below 20C (stable 1 month).
Oxidized glutathione: Dissolve 61.3 mg/ml oxidized glutathione (GSSG) in water
and adjust pH to 7 with NaOH. Store at or below 20C (stable 1 month).
hIL-2 break buffer
0.1 M TrisCl, pH 7.5 (pH as determined at 4C)
50 mM EDTA (from 0.5 M stock; APPENDIX 2E)
Folding and
Purification of
Insoluble Proteins
from E. coli
IN break buffer
0.1 mg/ml lysozyme (100 mg/liter)
It is preferable that DTT be added as a solid, but it may also be added as 0.2 M stock in
water (30.8 g/liter; store at or below 20C; stable 1 month).
6.5.16
IN column buffer A
1 mM 2-mercaptoethanol (2-ME; 0.070 ml/liter)
0.76 ml), buffer components must be added to 420 ml water and total volume adjusted to 1
liter at the end.
Concentrated 2-ME (14.3 M) should be stored at 4C and opened bottles replaced every 2
or 3 months.
IN column buffer B
To 500 ml H2O add:
10 ml 1 M TrisCl, pH 8.0 (pH as determined at 4C; 10 mM final)
0.73 g NaH2PO4H2O (monobasic; mol. wt. 137.99)
13.44 g Na2HPO4 (dibasic; mol. wt. 141.96)
0.07 ml 2-mercaptoethanol (2-ME; 1 mM final)
After salts have dissolved add:
573.2 g guanidineHCl (6 M final)
Bring temperature to 4C and add 4C H2O to 1 liter
Adjust pH to 8.0 (as determined at 4C) if necessary with 2 M NaOH or 2 M HCl
0.76 ml), buffer components must be added to 500 ml and total volume adjusted to 1 liter
at the end.
Concentrated 2-ME (14.3 M) should be stored at 4C and opened bottles replaced every 2
or 3 months.
IN column buffer C
Titrate IN column buffer B (see recipe) to pH 6.4 (as determined at 4C) with HCl.
Prepare immediately before use.
IN column buffer D
Prepare 100 mM (13.8 g/liter) NaH2PO4H2O. If necessary adjust to pH 4.5 with 2
M NaOH or 2 M HCl.
IN column buffer E
Immediately before use, prepare IN column buffer B (see recipe), replacing the
2-ME with 5 mM DTT.
IN column buffer F
0.25 M NaCl (14.6 g/liter)
10 mM 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate
(CHAPS; mol. wt. 614.9; 6.2 g/liter)
1 mM EDTA (prepare from 0.5 M stock)
1 M urea (60 g/liter)
IN column buffer G
Prepare IN column buffer F (see recipe), but omit urea.
Purification of
Recombinant
Proteins
6.5.17
IN extraction buffer
0.76 ml), buffer components must be added to 420 ml and total volume adjusted to 1 liter at
the end.
If high-quality guanidineHCl is used, the solution will be colorless and clear (see APPENDIX
3A).
IN folding buffer
50 mM TrisCl. pH 7.5 (pH as determined at 4C)
0.5 M NaCl (29.2 g/liter)
10 mM 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate
(CHAPS; mol. wt. 614.9; 6.2 g/liter)
RP-HPLC solvents A, B, and C

Solvent A: Prepare 0.1% (v/v) acetonitrile in water (both HPLC grade; e.g., Sigma).
Solvent B: Prepare 0.1% (v/v) TFA in acetonitrile (both HPLC grade)
Solvent C: Mix 800 ml acteonitrile and 1 ml TFA (both HPLC grade). Dilute with
HPLC-grade water to 1 liter.
Prepare all solutions fresh; filter and degas before use.
Thrombin, 2000 NIH units/ml
Immediately before use reconstitute contents of a 1030 NIH-unit vial (2100 NIH
units/mg) of thrombin from human plasma (Sigma) with 0.5 ml water to give a
solution containing 50 mM sodium citrate, pH 6.5, 0.15 M NaCl, and 2000 NIH
units/ml thrombin.
The A280 of 1 mg/ml thrombin is 1.83 in a cuvette with a 1-cm path length. Store the lyophized
powder at or below 20C.
COMMENTARY
Folding and
Purification of
Insoluble Proteins
from E. coli
Bovine growth hormone (BGH)

There has been much commercial interest
over the past fourteen years in producing large
quantities of recombinant growth hormones.
Human growth hormone is used as a pharmaceutical agent for treating dwarfism. Nonhuman growth hormones, including bovine and
porcine growth hormones, are used in agriculture for stimulating growth and lactation in
animals. These hormones were among the first
group of proteins pursued by the biotechnology
industry; they had been investigated decades
before by protein chemists.
Bovine growth hormone (BGH; also known

as bovine somatotropin) is a pituitary hormone,
and the mature protein contains 191 residues
(mol. wt. 21,876) with two disulfide bonds
one between residues 51 and 163 and another
between residues 180 and 188. The closely
related porcine growth hormone (pGH) was the
first growth hormone for which the three-dimensional structure was determined (AbdelMeguid et al., 1987). Since then, the structure
of the human growth hormone (hGH) as a
complex with its receptor has also been determined (deVos et al., 1992). It should be noted
that hGH and pGH share 68% and 91% sequence similarity, respectively, with BGH.
6.5.18
In Basic Protocol 1, conditions are chosen

that allow the unfolded, reduced protein to be
folded and oxidized at relatively high protein
concentrations (1 to 2 mg/ml). The procedure
is based on the original work of Goldberg
(Orsini and Goldberg, 1978; see also references
therein), who pioneered the use of cosolvents
(e.g., urea in Basic Protocol 1; also see UNIT 6.4
and Maeda et al., 1994) to help maintain solubility during refolding. The use of redox buffer
systems containing low-molecular-weight
thiol-disulfide pairs (e.g., reduced and oxidized
glutathione) to enhance the rate of disulfidebond formation during the folding of reduced
protein is based on Wetlaufers work (Wetlaufer, 1984; see also references therein).
Although the methodology of Basic Protocol 1 was developed in 1982-1983, it remains
a fairly typical example of a technique for
preparative protein folding. Details of BGH
expression in E. coli can be found in Wingfield
et al. (1987a).
BGH folding and thiol oxidation
The structure of both porcine and human
growth hormone consists of four antiparallel
-helices (Abdel-Meguid et al., 1987). The
topology of BGH is almost certainly similar to
that of pGH, due to the high degree of sequence
and functional similarity. In pGH, one disulfide
bond is formed between Cys-53 (found in the
middle of the region connecting helices 1 and
2) and Cys-164 (located in helix 4). The other
disulfide bond links the C-terminal region (at
Cys-189) to helix 4 (at Cys-181).
Examination of the solution conditions for
folding and oxidation of the reduced pituitaryderived BGH has shown that reduced and unfolded proteinin 6 M guanidineHCl diluted
into 4.5 M ureacan be air-oxidized with a
high (90%) yield (Holzman et al., 1986). These
conditions are similar to those used in Basic
Protocol 1, except that in the latter, the protein
concentration is >5-fold higher (>1 mg ml) and
a redox buffer is used.
For further information on in vitro folding
of BGH and the closely related pGH, consult
Brems and Havel (1989) and Bastiras and Wallace (1992). Havel et al. (1989) present a concise and useful review of the some of the spectroscopic methods used to monitor protein conformation and structure (e.g., UV absorption,
circular dichroism, and fluorescence) with examples of studies on BGH.
Comparison of authentic and recombinant

BGH
Natural BGH is purified from bovine pituitaries, and examples of purifications leading to
crystallizable protein are described by Bell et
al. (1985) and Spitsberg (1987). The method
that appears to give the most homogeneous
product (Wood et al., 1989) involves extraction
of pituitaries with 4.5 M urea (pH 8.8) followed
by purifications employing anion- and cationexchange chromatography in the presence of
urea. The urea maintains solubility of the protein during purification; at the concentration
used (4.5 M) it does not perturb or unfold the
protein. The urea is finally removed from the
purified protein by dialysis at pH 10. A single
bovine pituitary yields 16 mg of pure protein
by this method.
Preparations of the natural protein often
show varying degrees of N-terminal heterogeneity, depending on the method of purification.
This may involve truncations of either one
(A- 1) or four (A-4) residuese.g.,
(Ala)PheProAlaMetSerLeuSerGlyLeuCys
AlaPhewhere the residue in parentheses is
lost in a A-1 truncation and the four boldface
residues are lost in a A-4 truncation. An example of a A-4 truncation is shown in Figure 6.5.1,
lane E, where the two closely migrating bands
at 23 and 22 kDa correspond to full-length and
N-terminal-deleted (A-4) protein, respectively
(for further details see Wingfield et al., 1987b,
and references therein; also see Langley et al.,
1987a). The two forms can be resolved under
native conditions by chromatofocusing, which
takes advantage of the small difference in their
isoelectric points; full-length and A-4 BGH
have pI values of 8.2 and 8.0, respectively
(Wingfield et al., 1987b). Protein purified by
the method of Wood et al. (1989) has a single
and correct N-terminus.
Recombinant hormones have been expressed that contain the full BGH sequence
(e.g., Langley et al., 1987a), as well as others
with the A-1 deletion (e.g., Wingfield et al.,
1987a; Bogosian et al., 1989) and the A-9
deletion (Wingfield et al., 1987a). Purified A-1
BGH retains the initiating Met at the N-terminus (MetPhePro...), but when the initiating Met
is placed in front of the Ala, the Met is removed
to give the authentic sequence (AlaPhePro...).
Deletion of at least the first nine N-terminal
residues does not appear to effect the biological
activity of BGH.
Another source of chemical heterogeneity
in both authentic and recombinant growth hor-
Purification of
Recombinant
Proteins
6.5.19
mones is the deamidation of specific Asn and

Gln residues (Secchi et al., 1986). This is partly
responsible for the multiple band patterns observed in isoelectric focusing gels (Wingfield
et al., 1987a; 1987a). In typical authentic and
recombinant BGH preparations, 20% of the
protein is deamidated. However, because these
modified forms have lower pIs than unmodified
protein, they can be separated by chromatofocusing (Wingfield et al., 1987a). The cationexchange chromatography step (at pH 6.9 in
4.5 M urea) used by Wood et al. (1989) for
purification of pituitary BGH also appears to
separate deamidated from unmodified protein.
Deamidated protein is more positively charged
than unmodified protein, and will therefore
bind more tightly to a negatively charged cation-exchange matrix.
Authentic and recombinant BGH both exhibit self-association with the characteristics of
a rapid monomer-dimer equilibrium. The dissociation constant (Kd) for authentic BGH is
6.6 106 M (Fernandez and Delfino, 1983),
which is similar to that determined for both the
A-1 and A-9 recombinant forms of BGH
(P.T.W., unpub. observ.). At concentrations of
1.0 and 0.1 mg/ml, 76% and 42% of the
protein will be dimeric, respectively. Under
physiological conditions, the monomer appears
to be the active species. Monomeric protein
binds to two molecules of the extracellular
domain of the cell-surface receptor, forming a
1:2 molar complex analogous to the human
growth hormone (Staten et al., 1993).
Folding and
Purification of
Insoluble Proteins
from E. coli
Other approaches used to extract and fold

recombinant BGH
Langley et al. (1987a) extracted protein
from inclusion bodies using 6 M guanidineHCl
(pH 8.0) as the denaturant. The extract was
allowed to oxidize in air >72 hr at room temperature in the presence of the denaturant. Oxidized protein was fractionated by gel filtration
in guanidineHCl, the fractions making up the
monomer peak pooled, and the protein folded
by removal of denaturant using dialysis. The
rationale for this method is that, in a protein
with four cysteine residues that form two disulfide bonds (such as BGH), there are three possible intramolecular disulfide linkage combinations. Hence, even if the oxidation proceeds in
a random manner as expected for unfolded
protein, at least 33% of the protein produced
will have the correct pattern. In practice, the
recovery of correctly folded oxidized protein
was significantly higher than 33%suggest-
ing that even in 6 M guanidineHCl, BGH may

contain some elements of native-like structure.
This method is geared toward large-scale protein production and gives good protein recovery. However, the long incubation period in
guanidineHCl appears to result in 50% of the
protein being deamidated (Langley et al.,
1987b).
Bogosian et al. (1989) used 4.5 M urea at
pH 10.7 to extract BGH from inclusion bodies.
The extract was then stirred for 48 hr, allowing
the protein to oxidize in air. This method is
mentioned because it results in formation of a
novel concatenated dimer, formed by the interlocking of disulfide loops (Violand et al., 1989).
It is most likely that under the conditions used
for extraction, the protein folding and oxidation
is initiated from partially folded associated protein.
Ovine growth hormone (which is closely
related to BGH) was folded and purified with
an overall recovery of 30% by a procedure
similar in approach to Basic Protocol 1 (Wallis
and Wallis, 1989). This method, however, used
2 M guanidineHCl instead of urea as the cosolvent to maintain solubility during folding. It
also employed air oxidation for 24 hr instead
of the redox buffer system.
Interleukin 2
Interleukin 2 (IL-2) is a member of the
cytokine family. It is composed of a compact
core bundle of four antiparallel -helices
(Bazan, 1992; McKay, 1992). IL-2 plays important roles in the proliferation and differentiation of T lymphocytes as well as in regulation
of the immune system. The biological effects
of IL-2 are mediated via binding to IL-2 receptors (Minami et al., 1993).
The human IL-2 (hIL-2) gene has been
cloned and expressed in E. coli as insoluble
inclusion bodies (Devos et al., 1983). The purification of recombinant hIL-2 has been described and the protein thoroughly characterized (Liang et al., 1985; Kato et al., 1985;
Weir and Sparks, 1987). Basic Protocol 2 details the solubilization, refolding, and purification of recombinant hIL-2. This procedure can
be scaled up to yield hIL-2 on the scale of
hundreds of milligrams.
hIL-2 has three cysteines; hence, three possible disulfide-linked forms can exist. The native isomer consists primarily of one form
i.e., the one that contains a disulfide linkage
between Cys-58 and Cys-105 (Robb et al.,
1984; Wang et al., 1984; Liang et al., 1985).
6.5.20
Reversed-phase-HPLC has been used to separate these isomers (Browning et al., 1987; also
see Fig. 6.5.3).
HIV-1 integrase
An early part of the life cycle of all
retroviruses (including the human immunodeficiency virus, HIV) is the integration of a DNA
copy of the viral genome into the host chromosome. This step is essential for viral replication.
Retroviral DNA integration is carried out by a
defined set of DNA cutting and joining reactions, catalyzed by integrase protein (Katz and
Skalka, 1994).
The HIV-1 integrase is a 288-residue protein
(mol. wt. 32,200) which has been expressed in
E. coli (Sherman and Fyfe, 1990). The protein
is located in the pellet obtained by low-speed
centrifugation following cell breakage, but is
apparently not highly aggregated into inclusion
bodies, as it can be extracted into high-ionicstrength solution (e.g., 1 M NaCl) without a
denaturant. The insolubility of the protein is
probably a result of nonspecific binding to E.
coli nucleic acid. The salt-extraction procedure
was originally used by Terry et al. (1988) for
extraction of avian sarcoma-leukosis virus integrase expressed in E. coli.
Dissection of the HIV-1 integrase by preparation of a series of deletion mutants (Bushman
et al., 1993; see also references therein) demonstrated that a central core region of residues
50 to 212 was enzymatically active, carrying
out a subset of the reactions catalyzed by the
full-length enzyme. This deletion mutant is
interesting for structural studies as it has better
solubility than the full-length enzyme, which
is notoriously difficult to handle as a result of
limited solubility in the usual aqueous solvents.
The HIV-1 integrase deletion mutant
(IN50-212) is expressed in E. coli as a fusion
protein with the N-terminal extension sequence
GlySerSerGlyHisHisHisHisHisHisSerSer
GlyLeuValProArgGlySerHisMet. This sequence (a His tag) contains a six-residue histidine repeat which is responsible for the selective high-affinity binding of the fusion protein
to a nickel-chelate column. The boldface portion of the His tag sequence indicates the location of the specific thrombin-cleavage site between Arg-16 and Gly-17, which is exploited
in removal of the tag using thrombin.
In Basic Protocol 3 the His-tagged IN50-212
is expressed as an insoluble (i.e., inclusionbody-type) protein, and is purified under denaturing conditions, taking advantage of the fact
that metal-chelate affinity chromatography
(MCAC) can be carried out in the presence of

protein denaturants such as guanidineHCl.
Following purification, the protein is folded
and the His tag removed by exploiting the
specific thrombin-cleavage site of the tag sequence (underlined above). The cleaved protein
has the N-terminal sequence GlySerHisMetHisGlyGln.... The Met at position 4 corresponds to Met 50 of the wild-type integrase and
residues 1 to 3 (GlySerHis) are derived from
the tag. Excess thrombin is removed by affinity
chromatography using an immobilized inhibitor (p-aminobenzamidine). In the last step of
the purification, the IN50-212 is subjected to
gel-filtration to remove any aggregated multimers. The protein produced is 166 residues
long, the molecular weight estimated from the
DNA coding sequence is 18,200, and the calculated isoelectric point is 7.
Although the folded deletion mutant has
enhanced solubility as compared with the wildtype enzyme, the zwitterionic detergent
CHAPS is included in buffers to maintain solubility, especially during protein folding. Following protein purification the detergent can be
removed or exchanged for other buffer additives.
Substitution of Phe-185 for a Lys residue
appears to increase the solubility of IN50-212.
This mutant protein, expressed in E. coli with
the N-terminal His tag, was extracted with 1 M
salt and purified by MCAC. The extraction with
high-ionic-strength salt solution in the absence
of denaturant is analogous to the procedure
used with the full-length protein, discussed
above. The crystal structure of this protein has
been determined at 2.5- resolution. The overall topology consists of five -sheets flanked
by helical regions, showing that the integrase
domain belongs to a superfamily of polynucleotidyl transferases that includes ribonuclease H (Dyda et al., 1994).
Critical Parameters
Protein extraction. The protein should be
extracted from the inclusion bodies in a
monomeric and fully reduced state. This provides a defined starting point from which to
develop a reproducible folding protocol. Based
on pilot-scale experiments in which washed
pellets (from step 4 of Basic Protocol 1) were
extracted with various protein denaturants
(P.T.W., unpub. observ.; also see UNIT 6.3), 8 M
guanidineHCl was chosen for solubilization of
aggregated BGH. The most effective ones were
Purification of
Recombinant
Proteins
6.5.21
Supplement 4
Folding and
Purification of
Insoluble Proteins
from E. coli
urea and guanidineHCl at 6 M to 8 M concentrations, each of which solubilized >80% of the

protein. The extracts were further analyzed by
gel filtration on Sephacryl S-300 in the presence of the same concentration of the particular
denaturant used for the initial extraction. The
results indicated that guanidineHCl at concentrations >6 M yielded solubilized protein of
which >80% was monomeric. Although 8 M
urea also solubilized >80% of the protein, only
20% of this protein was monomeric, the remainder consisting of dimers and higher-order
aggregates.
Protein folding and oxidation. Basic Protocol 1 describes an empirical approach based on
some of the principles discussed in UNITS 6.1 &
6.4. The determination of basic physicochemical/conformational properties for a particular
protein will take some of the guesswork out of
developing a suitable folding protocol. For
BGH, purified authentic protein from bovine
pituitary glands was available, and had been
fairly well characterized before recombinant
proteins were produced. This situation is not
common, as the natural counterparts of many
recombinant proteins are rare and may never
have been purified. The optimal ratio of reduced to oxidized glutathione in the folding
buffers used in Basic Protocol 1 was empirically determined. However, it is commonly
observed that the highest folding yields are
obtained when the ratio of GSH/GSSG is between 5 and 10 and the total reduced and oxidized glutathione concentration is in the range
of 1 to 10 mM.
Deamidation. As mentioned above, BGH is
susceptible to deamidation. Although deamidated forms (charge isomers) can be resolved
by ion-exchange methods (Wingfield et al.,
1987a), their formation should be minimized.
This is achieved by limiting the amount of time
the protein spends in the fully unfolded state,
especially at pH 9.5. For example, the guanidineHCl extract should be processed immediately and diluted as described in step 6 of Basic
Protocol 1. The dialysis steps (at pH 9.5) should
be performed for the times indicated, not
longer. The folded protein is stable and does
not appear to deamidate spontaneously on storage.
Scaleup. For larger-scale production, a
Manton-Gaulin-APV homogenizer (UNIT 6.1) is
used to break cells instead of the French press.
In addition, a larger Sephadex G-100 column
(e.g., 5.0 90cm) is used in step 12 of Basic
Protocol 1.
Interleukin-2
Protein purification. Recombinant hIL-2
should be extracted as a monomer (see Basic
Protocol 2, step 5). The extraction has been
tested with various concentrations of acetic to
determine the optimal condition; 20% acetic
acid has been found to extract the maximum
amount of monomeric hIL-2 from inclusion
bodies. However, in the gel-filtration step (see
Basic Protocol 2, step 8), 20% acetic acid is too
corrosive for the metal parts of the chromatography system (e.g., the stands, pump, and fraction collector); thus 10% acetic acid is recommended.
Protein folding. The hIL-2 monomer that
elutes from the Sephadex G-100 column (see
Basic Protocol 2, step 8) yields two peaks upon
analytical reversed-phased chromatography
(see Support Protocol). These two peaks represent the refolded, oxidized hIL-2 and unfolded,
reduced hIL-2. The proportion of the oxidized
form is increased by the dialysis step (see Basic
Protocol 2, step 9). The time and volume recommended in the dialysis step have been determined empirically to produce the best yield of
oxidized hIL-2. Longer periods of dialysis (e.g.
48 hr) causes do not increase the yield of oxidized hIL-2.
Scaleup. The parameters for larger-scale
production are the same as those for BGH (see
above).
HIV-1 integrase
MCAC. It is important to use low concentrations of 2-mercaptoethanol in the sample and
column buffer (1 mM is safe) and to completely
avoid dithiothreitol, as either reductant will
strip Ni2+ from the MCAC matrix (see UNIT 9.4).
Protein folding. Because HIV-1 integrase is
not a very soluble protein and has a high tendency toward self-association and aggregation
(Hickman et al., 1994), the solubility and stability of the folded protein must be maintained
by including a relatively high salt concentration
as well as the detergent CHAPS in the folding
buffer and in all subsequent column buffers.
The buffer additives indicated for HIV-1 integrase are usually not required for folding of the
average protein.
Thrombin cleavage. It is necessary to perform pilot-scale experiments to optimize the
conditions for removing the His tag using
thrombin. The usual parameters to vary are
enzyme/substrate ratios and incubation time
and temperature. Thrombin is a serine protease,
and can be irreversibly inhibited with either
PMSF or AEBSF. Removal of the tag can be
6.5.22
Supplement 4
monitored by SDS-PAGE (UNIT 10.1), in which

case the thrombin should be quenched with 1
mM PMSF or AEBSF prior to addition of SDS
and heating. There is an 2-kDa mass difference between tagged and nontagged protein
(see Fig. 6.5.2). The digestion should be as
complete as possible at the specific cleavage
site (see Background Information); overdigestion may result in nonspecific cleavage at other
sites. It is also important to avoid denaturation
of the (thrombin) (e.g., by vigorous stirring or
overheating), as partially denatured proteases
often exhibit some loss of specificity, cleaving
at unpredictable sites.
Troubleshooting
Most precautions and guidelines for folding
and oxidation are given in annotations to the
individual steps of Basic Protocol 1. It should
be cautioned that, when using a mixture of
oxidized and reduced glutathione for oxidizing
proteins that contain both free and disulfidelinked cysteines in the native state (e.g., IL-2),
the potential exists for glutathionylation, in
which the unpaired cysteine(s) form a mixed
disulfide with glutathione. This modification
will cause charge heterogeneity, and can be
readily detected by electrospray ionization
mass spectrometry (ESI-MS), which will indicate a mass increase of 305.3 for each GSH
moiety incorporated.
Interleukin-2
Low-molecular-weight impurities extracted
together with monomeric hIL-2 in acetic acid
(see Basic Protocol 2, step 5) are usually eluted
earlier than the oxidized form of hIL-2 in RPHPLC (see Basic Protocol 2, step 12) and can
thus be removed. If the RP-HPLC peak containing the oxidized form of hIL-2 is contaminated
by low-molecular-weight impurities, SDSPAGE analysis of each fraction composing the
peak is recommended to avoid pooling fractions
containing impurities. Additional information
regarding troubleshooting is given in annotations to individual steps of Basic Protocol 2.
HIV-1 integrase
MCAC. Protein will not bind to the column
if the His tag has been nonspecifically degraded
or removed by E. coli proteases. SDS-PAGE
(UNIT 10.1) of the cell extracts and fractions
during the purification should indicate if the tag
is present. The His tag adds 2 kDa to the
apparent mass of the protein. The denaturant

concentration should be high enough to maintain solubility of the protein during chromatography. Insoluble or aggregated protein will not
bind to the column and will be located in the
column flowthrough or will clog the top of the
matrix. If protein aggregates on the column, a
higher concentration of denaturant should be
tried, although aggregation should not happen
using 6 M guanidineHCl in column buffer A.
Further details on troubleshooting the use of
the Ni-NTA resin are given in the manufacturers literature (Qiagen, 1992).
Thrombin cleavage. If undigested (Histagged) protein still remains after digestion, the
standard procedure is to reapply the mixture to
an MCAC column, whereupon the matrix will
specifically bind the unprocessed protein containing the His tag. The processed (cleaved)
protein is not bound and elutes in the column
flowthrough. This approach, although satisfactory for monomeric proteins, is complicated
with multimeric proteins and those that exhibit
reversible self-associatione.g., HIV-1 integrase. For example, in a partially digested dimeric protein, the subunits can be arranged in
three possible configurationsTT, TM, and
MMwhere T is still tagged and M has had
the tag cleaved. It may be possible to separate
TT and TM by gradient elution from the MCAC
column, as the former might be expected to bind
more tightly than the latter. A simpler approach
is to use solvent conditions that dissociate the
protein subunits without denaturing them. For
HIV-1-integrase, this can be achieved with 2 to
3 M urea.
Anticipated Results
BGH
The purification of A-9 BGH is summarized in Table 6.5.1. About 90 to 100 mg of
protein are obtained from 50 g (wet weight) of
cells with an overall yield in the range 15% to
25%. For larger and/or multidomain proteins,
much lower yields (1% to 5%) may be more
typical. Gel analysis of the BGH in cell extracts
and in purified protein is shown in Figure 6.5.1.
Interleukin-2
If the expression of hIL-2 in E. coli is 10%,
20 g of cell pellet will yield 4 to 5 mg of purified
protein, with a specific activity of 5 106 U/mg.
The purity of the hIL-2 should be >98% as
indicated by analytical C18 column chromatography (see Support Protocol).
Purification of
Recombinant
Proteins
6.5.23
Table 6.5.1
Purification of a Recombinant Bovine Growth Hormone Analoga
Total Proteinc
(mg)
Stage of Purificationb
Cells
Washed pellet (step 4)
Dialysis supernatant (step 8)
DEAE-Sepharose pool (step 11)
Sephadex G-100 pool (step 14)
5000
375
200
131
95
Specific BGH
contentd (%)
7.5
60
75
95
99
Total BGH
(mg)
375
225
150
125
94
Yield (%)
100
60
40
33
25
aThe summary refers specifically to a biologically active analog of BGH (-9 BGH) in which the full-length sequence is
truncated at the N-terminus by eight residues and serine is substituted for glycine at the first position. Similar relative
yields were obtained with a -1 analog in which the N-terminal Ala of the native sequence was replaced by Met, but the
amount of this protein expressed in E. coli was several-fold lower than that obtained for -9 BGH (Wingfield et al., 1987a)
bThe numbers in parentheses refer to Basic Protocol 1 steps.
cDeterminations were made using the Bio-Rad Protein Assay Kit, except those for the DEAE and Sephadex pools, which
were made by UV absorbance measurements.

dPercentage of total protein that is BGH. Estimates made by densitometric scanning of Coomassie blue stained
SDS-polyacrylamide gels.
In a scaled-up process (see Critical Parameters), 25 to 30 mg of purified hIL-2 may be

obtained from 200 g of E. coli cell pellet.
Folding and
Purification of
Insoluble Proteins
from E. coli
HIV-1 integrase
Figure 6.5.4 shows results of SDS-PAGE of
the purified IN50-212 before (lane B) and after
(lane A) removal of the His tag by thrombin
digestion. The molecular weight difference of
2000 kDa corresponds to the removal of the
Figure 6.5.4 Results of SDS-PAGE of

H1V-1 integrase50-212 on a 12.5%
polyacrylamide gel stained with Coomassie
blue. Lane A, recombinant HIV-1
integrase50-212; lane B, recombinant HIV-1
integrase50-212 with N-terminal His tag; lane
C, extract of HIV-1 integraseexpressing E.
coli cells used for purification.
16 amino acid residues comprising the N-terminal His tag.

The overall recovery of purified protein is
30%. For example, from 1 g (wet weight) of
cells (containing 5% IN50-212) 1.5 mg of
purified protein are obtained (see Figure 6.5.4,
lane C, for SDS-PAGE analysis of whole IN50212expressing E. coli). Most of the steps, including protein folding, have high recoveries
(80% to 95%). The yield of thrombin-digested
6.5.24
protein from purified tagged protein is between

60% to 70%.
The enzymatic and biophysical properties
of the protein are detailed in Hickman et al.
(1994).
Time Considerations
BGH
Basic Protocol 1 for the purification of BGH
takes 5 days. Protein can be stored at 80C at
the end of step 4 (as washed pellets) or step 10
(as pooled fractions from ion-exchange).
Day 1: Cell breakage, preparation of washed
pellets and extraction with guanidineHCl
(steps 1 to 5) requires 12 day of work. The
protein extract is then dialyzed overnight (step
5).
Day 2: After changing the dialysis buffer
(step 7), dialysis is continued at least 6 hr. At
this step the dialysis can be left overnight or
directly processed by ion-exchange chromatography (steps 8 to 10), which takes 6 to 8 hr
and can be run overnight.
Day 3: Ion-exchange chromatography is
run, or if ion-exchange was performed on day
2, the pooled fractions are concentrated for
several hours (step 11), then applied to the
gel-filtration column and chromatographed for
several hours (steps 12 and 13). The gel-filtration column is run is overnight if a low-pressure
matrix (e.g., Sephadex G-100) is used or on the
same day if a medium-pressure matrix (e.g.,
Superdex 200) is used.
Day 4: The protein is analyzed (e.g., by
SDS-PAGE or isoelectric focusing), concentrated if required (step 14), and frozen or prepared for lypohilization.
Interleukin-2
In Basic Protocol 2, preparation and lysis of
the cells (steps 1 and 2) will take 1 hr, cell
breakage and preparation of washed pellets
(steps 3 and 4) will take 3 hr, acid extraction
(steps 5 and 6) will take 1 hr, Sephadex G-100
column chromatography (step 7) will take 12
hr, dialysis of the pooled fractions will be carried out overnight, and RP-HPLC (steps 9 to
12) will require 7.5 hr. The final dialysis is run
overnight. In the Support Protocol for resolution of native and misfolded forms of hIL-2, it
will take 1 hr to run a sample after the blank
runs to establish the baseline profile have been
completed.
HIV-1 integrase
Basic Protocol 3 is usually carried in two
stages. In stage 1, purification of the unfolded
protein that still contains the His tag (steps 1 to
8) is usually carried out on a relatively large
scale (using 100 g of cells). If the Superdex 200
column used in step 5 and the MCAC column
used in step 6 are run using the Pharmacia
Biotech Biopilot system, this stage will take 3
to 4 days to complete. It will take longer if
low-pressure columns are used. In stage 2,
protein folding (steps 11 and 12), removal of
the His tag by thrombin cleavage (steps 13 and
14), affinity chromatography (steps 15 to 17),
and gel filtration (step 19) are performed. This
stage is carried out repeatedly with relatively
small amounts of protein (i.e., 30 mg; this
represents <10% of the protein produced in the
Stage 1). Using the Pharmacia Biotech FPLC
system for the chromatography steps, stage 2
takes 2 days.
Literature Cited
Abdel-Meguid, S.S., Shieh, H.-S., Smith, W. W.,
Dayringer, H.E., Violand, B.N., and Bentle, L.A.
1987. Three-dimensional structure of a genetically engineered variant of porcine growth hormone. Proc. Natl. Sci. U.S.A. 84:6434-6437.
Ackers, G.K. 1970. Analytical gel chromatography
of proteins. Adv. Protein Chem. 24:343-446.
Bastiras, S. and Wallace, J. C. 1992. Equilibrium
denaturation of recombinant porcine growth hormone. Biochemistry 31:9304-9309.
Bazan, J.F. 1992. Unraveling the structure of IL-2.
Science 257:410-413.
Bell, J.A., Moffat, K., Voderhaar, B.K., and Golde,
D.W. 1985. Crystallization and preliminary Xray characterization of bovine growth hormone.
J. Biol. Chem. 260:8520-8525.
Bogosian, G., Violand, B.N., Dorward-King, E.J.,
Workman, W.E., Jung, P.E., and Kane, J.F. 1989.
Biosynthesis and incorporation into protein of
norleucine by Escherichia coli. J. Biol. Chem.
264:531-539.
Bottomly, K., Davis, C.S., and Lipsky, P.E. 1991.
Measurement of human and murine interleukin2 and interleukin-4. In Current Protocols in Immunology (J.E. Coligan, A.M. Kruisbeek, D.H.
Marguiles, E.M. Shevach, and W. Strober, eds.)
pp. 6.3.1-6.3.12. John Wiley & Sons, New York.
Brems, D.N. and Havel, H.A. 1989. Folding of
bovine growth hormone is consistent with the
molten globule hypothesis. Proteins Struct.
Funct. Genet. 5:93-95.
Browning, J.L., Mattaliano, R.J., Chow, E.P., Liang,
S.-M., Allet, B., Rosa, J., and Smart, J.E. 1986.
Disulfide scrambling of interleukin-2: HPLC
resolution of the three possible isomers. Anal.
Biochem. 155:123-128.
Purification of
Recombinant
Proteins
6.5.25
Bushman, F.D., Engelman, A., Palmer, I., Wingfield,

P., and Craigie, R. 1993. Domains of the integrase protein of human immunodeficiency virus
type 1 responsible for the polynucleotidyl transfer and zinc binding. Proc. Natl. Acad. Sci.
U.S.A. 90:3428-3432.
Coleman, R., Iqbal, S., Godfrey, P.P., and Billington,
D. 1979. Membranes and bile formation. Composition of several mammalian biles and their
membrane-damaging properties. Biochem. J.
178:201-208
deVos, A.M., Uttsch, M., and Kossiakoff, A.A. 1992.
Human growth hormone and extracellular domain of its receptor: Crystal structure of the
complex. Science 255:306-312.
Devos, R., Plaetinc, G., Cheroutr, H., Simons, G.,
Degrave, W., Tavernie, J., Remaut, E., and Fiers,
W. 1983. Molecular cloning of human interleukin-2 carrier DNA and its expression in Escherichia coli. Nucl. Acids Res. 11:4307-4323.
Dyda, F., Hickman, A.B., Jenkins, T.M., Engelman,
A., Craigie, R., and Davies, D.R. 1994. Crystal
structure of the catalytic domain of HIV-1 integrase: Similarity to other polynucleotidyl transferases. Science 266:1981-1986.
Edelhoch, H. and Burger, H.G. 1966. The properties
of bovine growth hormone. II. Effects of urea. J.
Biol Chem. 241:458-463.
Fernandez, H.N. and Delfino, J.M. Covalent crosslinking of the bovine somatotropin dimer. Biochem. J. 209:107-115.
Goldberg, M.E., Ruldolph, R., and Jaenicke, R.
1991. A kinetic study of the competition between
renaturation and aggregation during the refolding of denatured-reduced egg white lysozyme.
Biochemistry 30:2790-2797.
Goldenberg, D.P. 1989. Analysis of protein conformation by gel electrophoresis. In Protein Structure: A Practical Approach (T.E. Creighton, ed.)
pp. 225-250. IRL Press, Oxford.
Graf, L., Li, C.H., and Bewley, T. 1975. Selective
reduction and alkylation of the COOH-terminal
disulfide bridge in bovine growth hormone. Int.
J. Pep. Prot. Res. 7:467-473.
Havel, H.A., Chao, R.S., Haskell, R.J., and
Thamann, T.J. 1989. Investigations of protein
structure with optical spectroscopy: Bovine
growth hormone. Anal. Chem. 61:642-650.
Hickman, A., Palmer, I., Engelman, A., Craigie, R.,
and Wingfield, P. 1994. Biophysical and enzymatic properties of the catalytic domain of HIV-1
integrase. J. Biol. Chem. 269:29279-29287.
Holzman, T.F., Brems, D.N., and Dougherty, J.J.
1986. Reoxidation of reduced bovine growth
hormone from a stable secondary structure. Biochemistry 25:6707-6917.
Jaenicke, R. 1991. Protein folding: Local structures,
domains, subunits, and assemblies. Biochemistry
30:3147-3161.
Folding and
Purification of
Insoluble Proteins
from E. coli
Kato, K., Yamada, T., Kawahara, K., Onda, H.,

Asano, T., Sugino, H., and Kakinuma, A., 1985.
Purification and characterization of recombinant
human interleukin-2 produced in Escherichia
coli. Biochem. Biophys. Res. Commun. 130:692699.

Katz, R.A. and Skalka, A.M. 1994. The retroviral
enzymes. Annu. Rev. Biochem. 63:133-173.
Langley, K.E., Berg, T.F., Strickland, T.W., Fenton,
D.M., Boone, T.C., and Wypych, J. 1987a. Recombinant-DNA-derived bovine growth hormone from E. coli. I. Eur. J. Biochem. 163:313321.
Langley, K.E., Lai, P.-H., Wypych, J., Everett, R.R.,
Berg, T.F., Krabill, L.F., and Souza, L.M. 1987b.
Recombinant-DNA-derived bovine growth hormone from E. coli. II. Eur. J. Biochem. 323-330.
Liang, S.-M., Allet, B., Rose, K., Hirschi, M., Liang,
C.-M., and Thatcher, D.R. 1985. Characterization of human interleukin 2 derived from
Escherichia coli. Biochem. J. 229:429-439.
Liang, S.-M., Thatcher, D., Liang, C.-M., and Allet,
B. 1986. Studies of structure activity relationships of human interleukin-2. J. Biol. Chem.
261:334-337.
Maeda, Y., Ueda, T., Yamada, H., and Imoto, T. 1994.
The role of net charge on the renaturation of
reduced lysozyme by sulfhydryl-disulfide interchange reaction. Prot. Engineering 7:12491254.
McKay, D.B. 1992. Unraveling the structure of IL2-response. Science 257:412-413.
Minami, Y., Kono, T., Miyazaki, T., and Taniguchi,
T. 1993. The IL-2 receptor complex: Its structure, function, and target genes. Annu. Rev. Immunol. 11:245-267.
Orsini, G. and Goldberg, M.E. 1978. The renaturation of reduced chymotrypsin A in guanidine
HCl. J. Biol. Chem. 253:3453-3458.
Qiagen. 1992. The QIAexpressionist, 2nd ed.
Qiagen, Chatsworth, Calif.
Riddles, P. W., Blakeley, R.L., and Zerner, B. 1979.
Ellmans reagent: 5,5-dithiobis(2-nitrobenzoic
acid)a reexamination. Anal Biochem. 94:7581.
Robb, R.J., Kutney, R.M., Panico, M., Morris, H.R.,
and Chowdhry, V. 1984. Amino acid sequence
and post-translational modification of human interleukin-2. Proc. Natl. Acad. Sci. U.S.A.
81:6486-6490.
Secchi, C., Biondi, P. A., Negri, A., Borrini, R., and
Ronchi, S. 1986. Detection of desamido forms
of purified bovine growth hormone. Int. J. Pept.
Prot. Res. 28:298-306.
Sherman, P.A. and Fyfe, J.A. 1990. Human immunodeficiency virus integration protein expressed
in Escherichia coli possesses selective DNA
cleavage activity. Proc. Natl. Acad. Sci. U.S.A.
87:5119-5123.
Spitsberg, V.L. 1987. A selective extraction of
growth hormone from bovine pituitary gland and
its further purification and crystallization. Anal.
Biochem. 160:489-495.
Staten, N.R., Byatt, J.C., and Krivi, G.G. 1993.
Ligand-specific dimerization of the extracellular
6.5.26
domain of the bovine growth hormone receptor.

J. Biol. Chem. 268:18467-18473.
isomerization of protein disulfides. Methods Enzymol. 107:301-304.
Stoscheck, C.M. 1990. Quantitation of protein.

Methods Enzymol. 182:50-67.
Wingfield, P.T., Graber, P., Buell, G., Rose, K.,

Simona, M., and Burleigh, B.D. 1987a. Preparation and characterization of bovine growth hormones produced in recombinant Escherichia
coli. Biochem. J. 243:929-839.
Talalay, P. 1960. Enzymic analysis of steroid hormones. Biochem. Anal. 8:119-142.

Terry, R., Soltis, D.A., Katzman, M., Cobrinik, D.,
Leis, J., and Skalka, A.M. 1988. Properties of
avian sarcoma-leukosis virus pp32-related polendonucleases produced in Escherichia coli. J.
Virol. 62:2358-2365.
Thannhauser, T.W., Konishi, Y., and Scheraga, H.A.
1984. Sensitive quanititative analysis of disulfides in polypeptides and proteins. Anal. Biochem. 138:181-188.
Violand, B.N., Takano, M., Curran, D.F., and Bentle,
L.A. 1989. A novel concatenated dimer of recombinant bovine somatotropin. J. Prot. Chem.
8:619-628.
Wallis, O.C. and Wallis, M. 1989. Purification and
properties of recombinant DNAderived ovine
growth hormone analogue (oGH1) expressed in
Escherichia coli. J. Mol. Endocrinology 4:61-69.
Wang, A., Lu, S.-D., and Mark, D. 1984. Studies of
structure-activity relationships of human interleukin-2. Science 224:1431-1433.
Weir, M.P. and Sparks, J., 1987. Purification and
renaturation of recombinant human interleukin2. Biochem. J. 245:85-91.
Wetlaufer, D.B. 1984. Nonenzymatic formation and
Wingfield, P.T., Graber, P., Rose, K., Simona, M.G.,

and Hughes, G.J. 1987b. Chromatofocusing of
N-terminally processed forms of proteins: Isolation and characterization of two forms of interleukin-1 and bovine growth hormone. J. Chromatogr. 387:291-300.
Wood, D.C., Salsgiver, W.J., Kasser, T.R., Lange,
G.W., Rowold, E., Violand, B.N., Johnson, A.,
Leimgruber, R.M., Parr, G.R., Siegel, N.R., Kimack, N.M., Smith, C.E., Zobel, J.F., Ganguli,
S.M., Garbow, J.R., Bild, G., and Krivi, G.G.
1989. Purification and characterization of pituitary bovine somatotropin. J. Biol. Chem.
264:14741-14747.
Contributed by Paul T. Wingfield (BGH

and HIV-1 integrase) and Ira Palmer
(HIV-1 integrase)
Bethesda, Maryland
Shu-Mei Liang (interleukin-2)
North American Vaccine Corp.
Beltsville, Maryland
Purification of
Recombinant
Proteins
6.5.27
Expression and Purification of GST

Fusion Proteins
UNIT 6.6
This unit describes how pGEX vectors (available from Pharmacia Biotech) can be used
for high-level inducible intracellular expression of polypeptides as fusions with glutathione-S-transferase (GST) in Escherichia coli. GST fusion proteins are easily purified
under nondenaturing conditions by affinity chromatography (Chapter 9) using a glutathioneSepharose 4B conjugate. The amino-terminal GST moiety can then be cleaved
from the protein of interest using a specific protease cleavage site located between the
GST moiety and the recombinant polypeptide. Finally, the GST moiety can be removed
by rechromatographing the sample on the glutathione-Sepharose column.
Potential applications of the system include the expression and purification of large
quantities of individual polypeptides for use in structural determinations using either
nuclear magnetic resonance (NMR) or crystallography, immunological studies, vaccine
production, and structure-function studies involving protein-protein and DNA-protein
interactions.
The basic protocols are chromatography-based adaptations of the manufacturers recommendations and include batch and column purification methods. The experience of this
laboratory is that, although batch purifications may be slightly faster, column-based
purification steps usually provide higher protein yields and higher purity of the final
product.
GST fusion proteins can be expressed at high levels in E. coli grown using an environmental shaker (see Basic Protocol 1). The soluble fusion protein is purified using a
single-step glutathioneSepharose 4B affinity column (see Basic Protocol 2). Fusion
proteins that are found in inclusion bodies can be extracted using denaturants and then
refolded before affinity chromatography using a glutathioneSepharose 4B column (see
Alternate Protocol 1). Soluble fusion proteins can also be purified batchwise using
glutathioneSepharose 4B affinity matrix (see Alternate Protocol 2). The fusion protein
can be cleaved with either thrombin or factor Xa in solution to separate the protein of
interest from glutathione (see Basic Protocol 3). The protein of interest can also be
released by protease digestion of the fusion protein immobilized on a glutathione
Sepharose 4B column (see Alternate Protocol 3), or by batchwise protease cleavage and
separation from the resin (see Alternate Protocol 4). Affinity purification using glutathioneSepharose 4B can be used to remove the GST moiety after enzymatic cleavage
(see Support Protocol 1). HPLC gel filtration is used as a final purification step to obtain
>98% pure protein (see Support Protocol 2). The relationships between the protocols are
shown in Figure 6.6.1.
STRATEGIC PLANNING
A variety of pGEX expression vectors are commercially available (Pharmacia Biotech)
that contain a tac promoter for chemically inducible, high-level protein expression. The
available pGEX vectors have an open reading frame encoding glutathione-S-transferase
(GST) followed by multiple cloning sites. These are followed by termination codons in
each reading frame (Figs. 6.6.2 and 6.6.3). A fragment of DNA containing the genetic
sequence for the polypeptide of interest is ligated into an appropriate pGEX vector and
transformed into E. coli. It should be noted that although expression in E. coli is efficient,
there is no post-translational modification machinery. Successful expression of GST
Contributed by Sandra Harper and David W. Speicher

Purification of
Recombinant
Proteins
6.6.1
Supplement 9
expression of GST fusion

protein (Basic Protocol 1)
on-column affinity
purification (Basic Protocol
2 or Alternate Protocol 1)
cleavage on column
(Alternate Protocol 3)
elution
batchwise purification
with affinity resin
elution
cleavage in solution
(Basic Protocol 3)
elution
cleavage bound to resin

cleavage in solution
(Basic Protocol 3)
protein purification by
affinity chromatography
(Support Protocol 1) and/or
HPLC (Support Protocol 2)
Figure 6.6.1 Flow chart showing the relationships between the various protocols in this unit.
fusion proteins using baculovirus systems (Davies et al., 1993) and yeast (Mitchell et al.,
1993) have also been reported.
One factor that influences which pGEX vector to choose is whether or not the GST moiety
will ultimately be cleaved away from the protein of interest. The pGEX-2T and pGEX-4T
series of vectors contain a protease cleavage site for thrombin, and the pGEX-3X and
pGEX-5X series of vectors contain protease cleavage sites for factor Xa. A more recently
developed expression vector is the pGEX-6P series, which contains a cleavage site for
PreScission protease (Pharmacia Biotech). PreScission protease has the advantage that it
is effective at low temperatures (5C). It is also a GST fusion protein, a feature that
facilitates removal of the protease from the target protein after cleavage. Fusion proteins
with a thrombin recognition site have the advantage that relatively small amounts of
thrombin and short digestion times at 37C will often cleave the fusion protein with high
efficiency. Thrombin digestions are often the most cost effective on a per milligram of
cleaved target polypeptide basis. Factor Xa is more expensive and typically requires use
of much higher enzyme-to-substrate ratios for efficient cleavage. Solutions of factor Xa
also have a more limited shelf life since freezing and thawing inactivates this enzyme.
Expression and
Purification of
GST Fusion
Proteins
For preparation of cDNA inserts encoding the desired polypeptide, see Ausubel et al.
(1994) or Sambrook et al. (1989). Briefly, a set of oligonucleotides is designed for
polymerase chain reaction (PCR) amplification of the region of interest of a pertinent
cDNA. These oligonucleotides should also contain appropriate restriction sites adjacent
to the desired coding region that are compatible with a restriction site in the cloning site
of the selected pGEX vector (see Figs. 6.6.2 and 6.6.3). PCR amplification is performed,
6.6.2
Supplement 9
pGEX-1T
thrombin
Leu Val Pro Arg Gly Ser Pro Glu Phe Ile Val Thr Asp
CTG GTT CCG CGT GGA TCC CCG GAA TTC ATC GTG ACT GAC TGA CGA
BamHI
stop codons
EcoRI
Tth111I
Aat II
BalI
glutathione-S- transferase
Ptac
pSj10Bam7Stop7
Ap
BspMI
PstI
pGEX
~4950 bp
la
NarI
EcoRV
BssHII
ApaI
Bst EII
MluI
Alw NI
p4.5
cl
pBR322
ori
Figure 6.6.2 pGEX vectors are plasmid expression vectors that express a cloned gene as a fusion
protein with glutathione-S-transferase (GST). The lac repressor gene binds to the lac promoter (ptac)
and represses expression of the GST fusion protein until induction with isopropyl-1-thio--D-galactopyranoside (IPTG). The polypeptide of interest can be inserted immediately after the GST gene
using the polylinker site shown in brackets (pGEX-1T, shown here, is the most common; see Fig.
6.6.3 for other PGEX polylinkers). Protease cleavage sites (brackets above the polylinker sequences) are located between the GST carrier protein and the protein of interest so that the GST
moiety can be removed. Restriction endonuclease sites are indicated below the sequence of the
polylinker and on the plasmid. An important consideration in selecting a vector and appropriate
cloning sites is to minimize the number of extraneous residues introduced into the N-terminal of the
target polypeptide. Vector map courtesy of Pharmacia Biotech.
followed by digestion of the PCR product and the pGEX vector with the appropriate
restriction enzymes. The PCR product is then ligated into the pGEX vector and transfected
into a suitable E. coli host. Several transformants should be grown in minicultures and
induced with isopropyl-1-thio--D-galactopyranoside (IPTG) to check for expression of
the desired fusion protein. Fusion protein expression can be monitored by SDS-PAGE
(UNIT 10.1) or by Western blot (UNIT 10.10) detection of the GST fusion protein using an
antibody specific for either the target protein or the GST moiety. Once successful
expression is achieved, the integrity of the DNA should be verified by sequencing to
ensure that no errors were introduced during PCR.
Before conducting a large-scale purification, it is worthwhile to perform a small pilot
purification (10-fold less than protocol descriptions) to determine optimal conditions.
The purification can then easily be scaled up. All stages of purification should be
monitored using SDS-PAGE (UNIT 10.1). In most cases, GST fusion protein expression is
very high and a major band at the expected molecular weight (the GST moiety contributes
26 kDa to the molecular weight) is obvious when uninduced and induced cells are
compared on SDS gels (Fig. 6.6.4). This band can then be monitored at each step of the
purification. However, as noted above, if the level of protein expression obtained is low
or band identification is ambiguous, the fusion protein can be monitored by Western blot
Purification of
Recombinant
Proteins
6.6.3
Supplement 9
pGEX-2T
thrombin
Leu Val Pro Arg Gly Ser Pro Gly Ile His Arg Asp
CTG GTT CCG CGT GGA TCC CCG GGA ATT CAT CGT GAC TGACTG ACG
stop codons
BamHI SmaI EcoRI

pGEX-2TK
kinase
thrombin
Leu Val Pro Arg Gly Ser Arg Arg Ala Ser Val
CTG GTT CCG CGT GGA TCT CGT CGT GCA TCT GTT GGA TCC CCG GGAATT CATCGT GAC TGA
stop codon
BamHI SmaI EcoRI

pGEX-4T-1
thrombin
Leu Val Pro Arg Gly Ser Pro Glu Phe Pro Gly Arg Leu Glu Arg Pro His Arg Asp
CTG GTT CCG CGT GGA TCCCCG GAATTC CCG GGT CGA CTC GAG CGGCCG CAT CGT GAC TGA
BamHI
SalI
EcoRI SmaI
stop codons
NotI
XhoI
pGEX-4T-2
thrombin
Leu Val Pro Arg Gly Ser Pro Gly Ile Pro Gly Ser Thr Arg Ala Ala Ala Ser
CTG GTTCCG CGT GGA TCC CCA GGA ATT CCC GGG TCGACT CGA GCG GCC GCA TCG TGA
BamHI
EcoRI SmaI
SalI
stop codons
NotI
XhoI
pGEX-4T-3
thrombin
Leu Val Pro Arg Gly Ser Pro Asn Ser Arg Val Asp Ser Ser Gly Arg Ile Val Thr Asp
CTG GTT CCG CGT GGA TCC CCG AAT TCC CGG GTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA
BamHI
factor Xa
EcoRI SmaI
SalI
stop codons
NotI
XhoI
pGEX-3X
Ile Glu Gly Arg Gly Ile Pro Gly Asn Ser Ser
ATC GAA GGT CGT GGG ATC CCC GGG AAT TCA TCG TGA CTG ACT GAC
stop codons
BamHI SmaI EcoRl

pGEX-5X-1
factor Xa
Ile Glu Gly Arg Gly Ile Pro Glu Phe Pro Gly Arg Leu Glu Arg Pro His Arg Asp
ATC GAA GGT CGT GGG ATC CCC GAATTC CCG GGTCGA CTC GAG CGG CCG CAT CGT GAC TGA
BamHI
EcoRl SmaI
Sall
XhoI
Not l
stop codons
pGEX-5X-2
factor Xa
Ile Glu Gly Arg Gly Ile Pro Gly Ile Pro Gly Ser Thr Arg Ala Ala Ala Ser
ATC GAA GGT CGT GGG ATC CCC GGA ATTCCC GGG TCG ACT CGA GCGGCC GCATCG TGA
BamHI
EcoRl SmaI
Sall
XhoI
Not l
stop codons
pGEX-5X-3
factor Xa
Ile Glu Gly Arg Gly Ile Pro Arg Asn Ser Arg Val Asp Ser Ser Gly Arg lle Val Thr Asp
ATC GAA GGT CGT GGG ATC CCC AGG AAT TCC CGGGTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA
BamHI
EcoRI SmaI
SalI
XhoI
NotI
Stop codons
Figure 6.6.3 Variations on the polylinker site shown in Figure 6.6.2 (courtesy of Pharmacia
Biotech).
Expression and
Purification of
GST Fusion
Proteins
6.6.4
Supplement 9
95
66
43
36
66
25
17
29
6
18
S
30 C
Figure 6.6.4 SDS gel

stained with Coomassie brilliant blue showing the expression of a glutathione-S-transferase (GST) fusion protein.
Lane 1, total cell lysate before induction with isopropyl1-thio--D-galactopyranoside
(IPTG). Lane 2, total cell
lysate after 3-hr induction
with IPTG. The position of the
fusion protein is indicated by
the arrow.
S
25 C
18 C
Figure 6.6.5 SDS gel stained with Coomassie brilliant blue

showing the effects of different growth temperatures on solubility of an expressed glutathione-S-transferase (GST) fusion protein. E. coli transfected with a recombinant pGEX-2T vector
were grown at different temperatures as indicated. Proportional
aliquots of whole-cell lysate after sonication (L), the supernatant
after centrifuging the lysate (S), and the remaining pellet (P) are
shown. This recombinant was primarily in inclusion bodies (P)
at 37C (not shown), 30C, and 25C. At 18C, however, nearly
all of the expressed protein was in a soluble native form.
analysis (UNIT 10.10) using a GST-specific antibody (Pharmacia Biotech). It is recommended that the lysed cell extract, extracted pellet, and all other collected fractions from
the purification be saved on ice until after careful analysis of the entire purification by
SDS-PAGE and/or immunoblotting to ensure that fractions containing the fusion protein
are not mistakenly discarded.
Basic Protocol 1 describes protein production in cells grown at 37C; however, at this
temperature some fusion proteins may be found in inclusion bodies in a denatured form.
As an alternative to attempting to renature the protein after extraction from inclusion
bodies (UNIT 6.1), expression at lower temperatures, such as 30, 25, 20, or 15C, can be
evaluated to determine whether the protein can be obtained in good yield in the soluble
fraction (Fig. 6.6.5). When expressing fusion proteins at lower temperatures, the initial
overnight culture can be grown at 37C followed by growth at a lower temperature prior
to induction.
EXPRESSION OF GLUTATHIONE-S-TRANSFERASE FUSION PROTEIN
Transformed E. coli cells expressing the glutathione-S-tranferase (GST) fusion protein
of interest are grown in culture in the presence of isopropyl-1-thio--D-galactopyranoside
(IPTG) at the desired preparative scale. Since the expression level of GST fusion proteins
is usually very high, adequate amounts of protein can usually be conveniently obtained
by preparing a few liters of cells grown in shaker cultures. This protocol describes the
preparation of 1.8 liters of transfected E. coli in three 600-ml units using 2-liter flasks in
a shaker incubator. Moderate further scale-up is feasible by using more or larger flasks.
BASIC
PROTOCOL 1
Purification of
Recombinant
Proteins
6.6.5
Supplement 9
Further scale-up can be accomplished using a fermentor (see UNITS 5.3 & 5.4). This protocol
describes protein production in cells grown at 37C. At this temperature, however, some
fusion proteins may be recovered from inclusion bodies in a denatured form, and culture
conditions may need to be modified to improve protein yield in the soluble fraction (see
Strategic Planning).
Culture growth can be monitored by reading the optical density at 550 nm (OD550) as well
as by analysis of the bacterial culture using SDS-PAGE. Cells should not be allowed to
grow for extended periods of time after induction as cell lysis can occur; this releases
proteases that may degrade the fusion protein. Visual inspection of the cells using a
microscope is a useful method for identifying cell breakage (see UNITS 5.1-5.3 & 6.1-6.5 for
additional details concerning recombinant protein expression in E. coli).
Materials
Luria broth (LB medium; UNIT 5.2; pH adjusted to 7.2)
5 mg/ml ampicillin (see recipe)
Glycerol culture of transformed E. coli cells expressing GST fusion protein of
interest in a pGEX vector
100 mM isopropyl-1-thio--D-galactopyranoside (IPTG; see recipe)
2-liter culture flasks
500-ml culture flasks
Large centrifuge bottles (e.g., 1-liter capacity)
Low-speed refrigerated centrifuge (e.g., Beckman J6-B and JS-4.2 rotor or
equivalent), 4C
Additional reagents and equipment for SDS-polyacrylamide gel electrophoresis
(SDS-PAGE; UNIT 10.1)
Grow bacterial cells
1. Prepare LB medium and add 600 ml to each of three 2-liter flasks and 100 ml to each
of two 500-ml flasks. Autoclave 20 to 30 min at a slow exhaust (liquid) setting.
Flasks should be filled to only 20% to 30% of their capacity to ensure adequate aeration
of the medium during cell growth. Autoclave LB medium immediately after preparing it to
prevent any incidental bacterial growth from occurring. It can then be stored up to 1 month
at room temperature under sterile conditions.
2. Allow medium to cool to room temperature. Add 1 ml of 5 mg/ml ampicillin to one

flask containing 100 ml LB medium.
It is important to allow medium to cool before proceeding, because ampicillin is inactivated
at temperatures >50C. Flame the opening of all bottles and flasks to reduce the risk of
contamination.
3. Using an inoculating loop, transfer some of the glycerol culture containing the
transfected E. coli expressing the GST fusion protein of interest to the flask containing
100 ml LB medium with ampicillin.
Sterile flame the inoculating loop as well as the opening of all bottles. Allow the loop to
cool before transferring the inoculating culture. If the loop temperature is too high, all the
cells could be killed during the transfer.
4. Incubate the inoculated culture on an environmental shaker set at 250 to 300 rpm
overnight at 37C.
Expression and
Purification of
GST Fusion
Proteins
5. The next morning, remove the culture from the shaker and read the optical density at
550 nm (OD550) using a UV/visible light spectrophotometer.
The OD550 of the overnight culture should be 1.0. Use medium from the second 500-ml
flask that did not receive ampicillin as a reference to zero the spectrophotometer.
6.6.6
Supplement 9
6. Using sterile technique, add 6 ml of 5 mg/ml ampicillin to each 2-liter flask containing
600 ml LB medium (0.1 mM final concentration).
7. Dilute the overnight culture 1:20 by adding 30 ml to each of the three 2-liter flasks
containing 600 ml LB medium.
8. Incubate the 600-ml cultures on a shaker at 37C at 250 to 300 rpm until the OD550
is 0.5 to 0.7.
It should take 2 hr for the culture to reach this early log stage of growth at 37C. If cells
are grown at lower temperatures to shift the expressed protein from inclusion bodies into
the soluble fraction, this time must be increased, since the cells will grow more slowly at
lower temperatures.
Induce expression of fusion protein

9. Remove a 1-ml sample from each flask and save for gel analysis. Induce cells by
adding 6 ml of 100 mM IPTG per flask (1.0 mM final). Incubate at 37C for an
additional 2.5 to 3 hr.
Optimal growth conditions (OD550 at time of induction, growth temperature, and growth
time after induction) for each recombinant protein should be empirically determined. The
conditions given here will generally be suitable for growth at either 37 or 30C. At lower
temperatures (25C), longer growth times will definitely be needed, and the best protein
yields will usually be obtained if the OD550 prior to induction is 0.65 to 0.85.
10. Remove cultures from the shaker 2.5 to 3 hr after induction. Remove 1 ml from each
culture and save for gel analysis. Check final OD550.
Culture growth can be monitored at OD550. When the cells reach saturation, they will stop
dividing. A typical SDS-PAGE gel of an uninduced control culture and an induced culture
after 3 hr growth is shown in Figure 6.6.4.
Recover bacterial cells

11. Pour each culture into a large centrifuge bottle and centrifuge 20 min at 4000 g,
4C.
Medium from the second 500-ml flask without ampicillin can be used to balance the
centrifuge bottles.
12. Carefully decant the supernatant, leaving 15 to 50 ml in the centrifuge bottle.

Resuspend the pelleted cells in the remaining supernatant. Transfer the cell suspension to a 50-ml centrifuge tube.
13. Centrifuge 20 min at 4000 g, 4C. Decant the supernatant.
14. Freeze cell pellet by placing in a 80C freezer.
15. Analyze saved 1-ml samples from before and after induction using SDS-PAGE (UNIT
10.1) to check for protein expression.
As noted above, a 1-ml aliquot of culture is removed prior to induction and a second 1-ml
sample is removed after the 3-hr induction. These aliquots can be centrifuged for 2 min
and the supernatants carefully removed with a pipet. These samples can be stored at 0 to
4C overnight prior to running a gel; for longer-term storage prior to gel analysis, store
frozen (20C) to prevent proteolysis. The cell pellet can be directly resuspended in SDS
sample buffer (200 l) and heated 3 to 5 min at 90C. Typical results are shown in Figure
6.6.4.
Purification of
Recombinant
Proteins
6.6.7
Supplement 9
BASIC
PROTOCOL 2
AFFINITY CHROMATOGRAPHY PURIFICATION OF A SOLUBLE GST

FUSION PROTEIN
Soluble glutathione-S-transferase (GST) fusion proteins can easily be purified from cell
lysate supernatants by affinity chromatography on glutathioneSepharose 4B using either
batch or column loading of the sample. Protease inhibitors should be added to the lysis
buffer to minimize potential proteolysis. As an aid for cell lysis, 1% (v/v) Triton X-100
may be added to the lysis buffer. After cells are lysed, centrifugation is used to pellet any
unlysed cells and inclusion bodies. Location of the fusion protein can usually easily be
determined by analyzing a small aliquot of both the supernatant and the pellet by
SDS-PAGE (UNIT 10.1). The glutathioneSepharose 4B can be regenerated and reused for
subsequent purifications. To avoid potential cross-contamination of different proteins or
mutant forms of a single protein, however, it is recommended that a given column or batch
of resin be reserved for use with a single protein. Preequilibration of the glutathione
column (steps 1 to 4) can be performed either prior to or in parallel with cell lysis. All
steps except SDS-PAGE (room temperature) should be performed in a cold room at 4C,
unless otherwise noted.
Materials
GlutathioneSepharose 4B resin (Pharmacia Biotech)
PBS (APPENDIX 2E)
Glutathione buffer (see recipe)
PBS/EDTA/PMSF buffer (see recipe)
Pelleted E. coli culture expressing fusion protein (see Basic Protocol 1, step 14)
Lysis buffer (see recipe), ice cold
Wash buffer (see recipe), ice cold
PBS/EDTA (see recipe)
2.5 8cm glutathioneSepharose 4B column (e.g., Bio-Rad Econo)
Peristaltic pump
Sonicator equipped with microtip probe (e.g., Branson)
Dounce homogenizer
60-ml centrifuge bottles (capable of handling force of 48,000 g)
High-speed refrigerated centrifuge (e.g., Beckman JZ-21M centrifuge and JA-18
rotor or equivalent), 4C
Additional reagents and equipment for pouring chromatographic columns (UNIT 8.3)
and for SDS-PAGE (UNIT 10.1)
Preequilibrate glutathione column
1. Pour 20 ml glutathioneSepharose 4B resin into 2.5 8cm column (glutathione
column; see UNIT 8.3 for details of pouring procedure).
This amount of resin should be adequate for purification of fusion protein from three 600-ml
cultures that contain 20 to 40 mg fusion protein per culture. Although glutathione
Sepharose 4B has an advertised minimum binding capacity of 8 mg/ml resin, the actual
capacity may be substantially different and should be empirically determined. The actual
amount of resin used and column size can be increased or decreased depending on the
amount of fusion protein to be purified.
2. Wash the glutathione column with 5 to 10 bed volumes PBS at a flow rate of 1.5
ml/min to remove the ethanol storage solution.
Expression and
Purification of
GST Fusion
Proteins
A bed volume is one-half the amount of glutathioneSepharose 4B that was added to the
column as a 50% slurry.
6.6.8
Supplement 9
New columns should be prepared as described in steps 1 to 4. Previously used columns

should be preequilibrated using steps 3 to 4 only, to ensure that the column is completely
reduced and has maximal binding capacity.
Use of a peristaltic pump is recommended for convenient control of flow rates. Compression
of the resin bed indicates that the column pressure is too high and that the flow rate should
be lowered.
3. Wash the glutathione column with 3 to 5 bed volumes glutathione buffer at 1.5
ml/min.
Previously used columns may become partially oxidized on storage and should be
preequilibrated (steps 3 to 4) within 24 hr before use.
4. Wash the glutathione column with 10 bed volumes PBS/EDTA/PMSF at 1.5 ml/min.
Lyse cells
5. Resuspend each pelleted 600-ml culture in 15 ml ice-cold lysis buffer.
Pellets should be resuspended in 25 to 50 l buffer per milliliter of culture.
6. Sonicate the suspension using a probe-tip sonicator ten times for 10 sec each, with
1-min rests between sonications to lyse the cells. Save a sample (100 l) of the lysate
for gel analysis and transfer remainder to a 60-ml centrifuge tube.
The cells are usually adequately lysed at the point when the suspension turns a slightly
darker color and becomes clearer. To minimize proteolysis in the sample, it is essential to
keep the cells on ice throughout the sonication procedure, and sonication should be
performed in short bursts to minimize sample heating. Avoid excessive sonication, as this
can lead to co-purification of E. coli host proteins along with the fusion protein of interest.
Avoid frothing during sonication, which can denature the fusion protein.
7. Centrifuge the lysate 20 min at 48,000 g, 4C.

Unbroken cells, large cellular debris, and inclusion-body protein will be pelleted.
8. Decant the supernatant containing the soluble fusion protein into a clean 50-ml
centrifuge tube.
9. Add a volume of ice-cold wash buffer equal to the volume of lysis buffer used in step
5 to the pellet. Use a dounce homogenizer to resuspend the pellet.
Pellets should be resuspended in 25 to 50 l buffer per milliliter of culture.
10. Analyze the lysate, supernatant, and resuspended pellet using SDS-PAGE (UNIT 10.1)
to verify that the fusion protein is in the supernatant.
If the fusion protein is in the supernatant, proceed to the next step. If the protein is in the
pellet, it is necessary to purify the GST fusion proteins from inclusion bodies (see Alternate
Protocol 2) or to start over, shifting the protein into the supernatant by growing the cultures
at a lower temperature (see Troubleshooting and Fig. 6.6.5).
Load the column

11. Load the supernatant onto a preequilibrated glutathione column (see step 4). Collect
fractions and analyze multiple fractions across the unbound peak by SDS-PAGE (UNIT
10.1) to verify that the fusion protein has bound and that column capacity was not
exceeded.
For a 2.5-cm diameter column, a sample-loading flow rate of 0.1 ml/min is recommended
to permit complete binding of the fusion protein to the resin. Faster flow rates may decrease
the yield of bound fusion protein due to slow kinetics of association at 4C, unless a large
excess of resin is used. This step is most conveniently performed overnight; the flow rate
Purification of
Recombinant
Proteins
6.6.9
Supplement 9
can be adjusted so that most of the supernatant will be loaded by the next morning. Do not
allow the column to run dry.
SDS-PAGE analysis of fractions collected during sample loading will reveal whether the
fusion protein is bound to the column or is present in the unbound fractions. Absence of
fusion protein in early unbound fractions combined with its appearance in late unbound
fractions indicates that column capacity has been exceeded. If this condition is observed,
reduce the protein load or increase the column size.
12. Wash the column with 5 to 10 bed volumes PBS/EDTA/PMSF at 1.5 ml/min.
13. Wash the column with 10 bed volumes PBS/EDTA at 1.5 ml/min to remove the PMSF.
If samples are to be cleaved with thrombin or factor Xa, any serine protease inhibitor (e.g.,
PMSF) must be removed from the sample before cleavage.
Elute the fusion protein

14. Elute the fusion protein from the column by washing the column with 5 bed volumes
glutathione buffer.
A flow rate of 0.3 ml/min for a 2.5-cm column is recommended to elute the fusion protein
in a minimal volume. Elution of the fusion protein can be monitored at A280 either with an
online UV monitor or by reading the absorption of individual fractions.
15. Analyze the fractions by SDS-PAGE (UNIT 10.1) and pool fractions containing the GST
fusion protein. Store at 0 to 4C.
Fusion protein should typically be >90% pure at this point.
ALTERNATE
PROTOCOL 1
AFFINITY CHROMATOGRAPHY PURIFICATION OF GST FUSION

PROTEIN FROM INCLUSION BODIES
In some cases, fusion proteins are entirely or primarily located in a denatured, aggregated
form in inclusion bodies. Glutathione-S-transferase (GST) fusion proteins can often be
purified from inclusion bodies after solubilization in urea or another denaturant followed
by renaturation by dialysis (UNIT 6.3). Other methods of solubilization include addition of
detergents such as Sarkosyl (N-laurylsarosine; Grieco et al., 1992; Frangioni, 1992). After
denaturation and renaturation, it is important to ensure that the protein has regained its
native conformation and function (UNITS 6.4 & 6.5). Although denatured GST will not bind
to the glutathione column and hence will not be recovered by this method, the possibility
that the GST moiety has refolded when the fusion partner has not folded properly should
also be considered. As an alternative to purifying proteins from inclusion bodies, growing
the cells at a lower temperature will often shift the fusion protein into the supernatant
while still producing 10 mg of fusion protein per liter of culture when pGEX vectors are
used (see Strategic Planning and see Troubleshooting). All steps should be performed in
a cold room at 4C unless otherwise noted.
U buffer (see recipe)
Triton X-100
PBS/glycerol buffer (see recipe)
equivalent), 4C
Additional reagents and equipment for dialysis (APPENDIX 3B)
Expression and
Purification of
GST Fusion
Proteins
1. Preequilibrate the glutathione column, lyse the cells, and separate the lysate pellet,
which includes the inclusion bodies, and supernatant (see Basic Protocol 2, steps 1
to 9).
6.6.10
Supplement 9
2. Centrifuge washed pellet (see Basic Protocol 2, step 9) 20 min at 48,000 g, 4C.
Decant the supernatant and resuspend the pellet in 12 ml freshly prepared U buffer
per 600 ml original culture. Incubate 2 hr on ice.
Pellets should be resuspended in 20 l U buffer per ml of culture.
3. Centrifuge 20 min at 48,000 g, 4C. Carefully transfer the supernatant to a clean

50-ml centrifuge tube.
The extracted fusion protein should now be in the supernatant.
4. Add Triton X-100 to the supernatant to give a final concentration of 1% (v/v).

5. Dialyze the sample (APPENDIX 3B) 2 to 3 hr in PBS/glycerol buffer.
Dialysis buffer volume should be 20 times the sample volume.
6. Dialyze sample overnight in PBS/EDTA/PMSF.

Dialysis buffer volume should be >100 times the sample volume.
7. Remove the sample from the dialysis bag and centrifuge 20 min at 4000 g, 4C.
8. Column purify the fusion protein (see Basic Protocol 2, steps 11 to 15).
BATCH PURIFICATION OF GST FUSION PROTEIN
Soluble glutathione-S-transferase (GST) fusion proteins in cell lysate supernatants or
renatured proteins extracted from inclusion bodies can be batch purified on glutathione
Sepharose 4B as an alternative to column-based purification (see Basic Protocol 2 and
see Alternate Protocol 1). Batch purification requires less equipment and is relatively
quick and easy, but resulting protein yield and sample purity are lower than in a
chromatographic separation. In addition, the room temperature incubations recommended by the resin manufacturer (Pharmacia Biotech), especially the batch incubation
of E. coli lysate supernatant or inclusion body extract with glutathione-Sepharose,
increase the risk of proteolytic degradation of the fusion protein.
ALTERNATE
PROTOCOL 2
Prepare fusion protein

1. Extract soluble fusion proteins (see Basic Protocol 2, steps 5 to 10).
If the fusion protein is in inclusion bodies, lyse the cells and collect the pellet (Basic
Protocol 2, steps 5 to 9, followed by Alternate Protocol 1, steps 2 to 7).
Prepare resin slurry

2. Prepare a 50% slurry of glutathioneSepharose 4B in PBS: For each milliliter of bed
volume, centrifuge 1.33 ml of a 75% slurry of glutathioneSepharose 4B for 5 min
at 500 g, room temperature. Discard the supernatant. Wash with 10 bed volumes
PBS. Invert tube containing resin several times to mix, then centrifuge 5 min at 500
g, room temperature, and remove supernatant. Add 1 ml PBS for each 1.33 ml of
original slurry. Mix well before using.
Bind fusion protein to resin
3. Add 2 ml of 50% slurry of equilibrated glutathione-Sepharose to each 100 ml
bacterial lysate supernatant. Incubate 30 min at room temperature with gentle
agitation on a platform or orbital shaker.
4. Centrifuge the suspension 5 min at 500 g, room temperature. Remove supernatant
and save at 0 to 4C for later analysis by SDS-PAGE (UNIT 10.1) to determine the
efficiency of binding of the fusion protein to the resin.
Purification of
Recombinant
Proteins
6.6.11
Supplement 9
5. Wash the pellet with 10 bed vol PBS.

A bed volume is one-half the volume of the 50% slurry that was added to the column.
6. Centrifuge the suspension 5 min at 500 g, room temperature. Discard the supernatant.
7. Repeat the wash and centrifugation steps for a total of three washes with 10 bed
volumes each of PBS.
Elute fusion protein
8. Elute the bound fusion protein by gently resuspending the sedimented resin in 1.0 ml
glutathione buffer per milliliter resin bed volume. Incubate 10 min at room temperature with gentle agitation.
9. Centrifuge the suspension 5 min at 500 g, room temperature. Transfer supernatant
to a separate tube.
10. Repeat the elution and centrifugation (steps 8 to 9) a total of three times. Store at 0
and 4C.
The supernatants may be pooled into one tube or analyzed separately by SDS-PAGE (UNIT
10.1) to monitor for fusion protein content.
The yield of fusion protein can be monitored by measuring the absorbance at 280 nm (A280).
The extinction coefficient will partially depend on the absorbance characteristics of the
experimental component of the fusion protein. For the GST moiety alone, the concentration
can be estimated using 1 A280 = 0.6 mg/ml protein.
As noted above, batch purification at room temperature increases the risk of proteolytic
digestion of the target protein. To minimize such degradation, this procedure can alternatively be performed in a cold room at 4C with incubation times in steps 3 and 8 increased
2- to 4-fold.
BASIC
PROTOCOL 3
PROTEASE CLEAVAGE OF FUSION PROTEIN IN SOLUTION TO REMOVE

GST AFFINITY TAG
The glutathione-S-transferase (GST) affinity tag is removed by cleaving with thrombin
(pGEX-T vectors) or factor Xa (pGEX-X vectors). Conditions for optimal cleavage of
each recombinant fusion protein must be empirically determined. Some of the parameters
that can be varied include temperature, enzyme-to-substrate ratio, length of incubation,
and buffer conditions. Proteolysis can usually be performed in the glutathione buffer used
to elute the fusion protein from the column, either with or without addition of NaCl or
Ca2+. After proteolysis, the glutathione must be removed by dialysis prior to rechromatography on the glutathione column to separate the cleaved target protein from the GST
moiety and uncleaved fusion protein.
Materials
Solution of affinity-purified fusion protein (see Basic Protocol 2, step 15, or
Alternate Protocol 2, step 10)
Thrombin (Sigma) reconstituted in water at 0.5 U/l or 1 g/l factor Xa
(Boehringer Mannheim)
0.15 M PMSF in isopropanol
Beckman J6-B centrifuge and JS-4.2 rotor (or equivalent), 4C
Expression and
Purification of
GST Fusion
Proteins
Additional reagents and equipment for dialysis (APPENDIX 3B) and SDS-PAGE
(UNIT 10.1)
6.6.12
Supplement 9
1. To the solution of affinity-purified fusion protein, add an appropriate amount of

thrombin (when using pGEX-T vectors) or factor Xa (when using pGEX-X vectors)
per microgram of purified fusion protein and digest protein 2 to 8 hr in a shaking
water bath at 37C (thrombin) or 25C (factor Xa).
The appropriate amount of enzyme must first be empirically determined for each fusion
protein by surveying a range of conditions in a pilot analytical proteolysis experiment. A
convenient method is to digest 100 g fusion protein per condition over a range of
enzyme-to-substrate ratios and for differing incubation times. Typical digestion times range
from 2 to 8 hr and typical enzyme-to-substrate-ratios are 1:100, 1:350, 1:1000, and 1:3000
(in units of enzyme per microgram fusion protein) at 37C for bovine plasma thrombin, or
1:10, 1:25, 1:50, 1:100, 1:300 (microgram enzyme per microgram fusion protein) at 25C
for bovine plasma factor Xa. At the desired times, proteolysis is stopped by adding an
aliquot of the sample to boiling SDS sample buffer, and samples are analyzed on an SDS
minigel (UNIT 10.1; 2 g/lane) to determine the best digestion conditions. If digestion is
incomplete at the highest enzyme-to-substrate ratio tested with digestion times of 6 to 8 hr,
consider reengineering the protease cleavage site by introducing a linker between the GST
moiety and target polypeptide to decrease steric hindrance. In some cases, >10-fold
improvement in cleavage efficiency can be achieved by adding as few as two glycines next
to the thrombin site. The SDS gel in Figure 6.6.6 shows a typical thrombin digestion
optimization experiment where the amount of enzyme has been varied.
2. Stop preparative digestion by adding a 1:500 dilution of 0.15 M PMSF stock solution.
Incubate sample an additional 15 min at 37C for thrombin or 30 min at 25C for
factor Xa to covalently inhibit the enzyme with the PMSF.
3. Dialyze the sample (APPENDIX 3B) twice versus 2 liters PBS/EDTA/PMSF for a
minimum of 4 hr per buffer change at 4C.
Complete removal of glutathione is important if samples are to be rechromatographed on
glutathione-Sepharose to remove the GST moiety and uncleaved fusion protein. Larger
volumes of dialysate may be necessary depending on sample volume: e.g., if the sample
volume is >40 ml, increase the dialysis buffer volume to 4 liters per change or use three
changes of buffer. In addition, since glutathione equilibrates slowly during dialysis, when
66
36
18
14
6
1
10
Figure 6.6.6 SDS gel stained with Coomassie brilliant blue showing pilot thrombin digestions of
two recombinant glutathione-S-transferase (GST) fusion proteins. Samples were digested 3 hr at
37C in buffer with varying enzyme-to-substrate ratios. Lane 1, a 78-kDa fusion protein. Lanes 2 to
5, thrombin digestion of the 78-kDa fusion protein using enzyme-to-substrate ratios of 1:3000,
1:1000, 1:350 and 1:100, respectively. Lane 6, a 45-kDa fusion protein. Lanes 7 to 10, thrombin
digestion of the 45-kDa fusion protein using substrate ratios of 1:3000, 1:1000, 1:350, and 1:100,
respectively. In each case, an enzyme-to-substrate ratio of 1:1000 was chosen as the optimal
digestion condition
Purification of
Recombinant
Proteins
6.6.13
Supplement 9
dialysis tubing with a MWCO <12,000 is used, the dialysis conditions should be increased
to at least three changes with 2 liters dialysis buffer per change.
4. Centrifuge the dialyzed sample 20 min at 4000 g, 4C, to remove any precipitated
material. Transfer the supernatant to a clean tube at 0 to 4C and analyze by
SDS-PAGE (UNIT 10.1).
The cleaved protein of interest can be separated from the GST moiety and uncleaved fusion
protein by rechromatographing it on the glutathione column (see Support Protocol 1).
ALTERNATE
PROTOCOL 3
PROTEASE CLEAVAGE OF FUSION PROTEIN BOUND TO A

GLUTATHIONE-SEPHAROSE COLUMN
The target polypeptide can be cleaved from the glutathione-S-transferase (GST) moiety
while the fusion protein is immobilized on the affinity matrix as described by Gearing et
al. (1989). The fusion protein is loaded onto the glutathione column after cell lysis in the
normal manner. Rather than elute the fusion protein with glutathione buffer, a solution of
thrombin (or factor Xa) is loaded onto the column and allowed to incubate at room
temperature for several hours. The cleaved protein is then eluted from the column by
washing with PBS. This method is much faster and can yield higher purity products than
batch protease digestions and in some cases, secondary cleavages can be avoided or
minimized using the on-column method. Disadvantages of this method include much less
effective protease cleavage, much lower final polypeptide yields, decreased control of
digestion conditions, and inability to easily monitor the extent of cleavage using on
column digestion.
PBS (APPENDIX 2E)
GlutathioneSepharose 4B column containing bound fusion protein (see Basic
Protocol 2, step 13)
1. For each milliliter of glutathioneSepharose 4B column containing bound fusion
protein, dilute desired amount of reconstituted thrombin to 1.0 ml using PBS.
Enzyme concentrations must be empirically determined for each fusion protein (see Basic
Protocol 3, step 1 annotation).
2. Load the thrombin reaction mixture onto the column. When the reaction mixture has
been added, replace the bottom cap and allow the column to stand at room temperature
for 2 to 16 hr.
Incubation times must be empirically determined for each fusion protein.
3. Elute the protein of interest by washing the column with PBS and immediately add
an aliquot of 0.15 M PMSF stock solution to give a final PMSF concentration of 0.3
mM (e.g., 6 l PMSF stock solution per 3.0-ml fraction).
The protein of interest will be in the flowthrough and the GST moiety and undigested fusion
protein will remain bound to the glutathione-Sepharose.
4. Remove the GST moiety and uncleaved fusion protein from the column by washing
with 5 bed volumes glutathione buffer at 0.3 ml/min.
5. Immediately after collecting fractions, store all fractions at 0 to 4C.
Expression and
Purification of
GST Fusion
Proteins
6. Evaluate unbound and bound peaks using SDS-PAGE (UNIT 10.1).

A large proportion of the fusion protein is usually not cleaved by this method.
6.6.14
Supplement 9
BATCH PROTEASE CLEAVAGE AND SEPARATION OF FUSION PROTEIN

ON GLUTATHIONE RESIN
ALTERNATE
PROTOCOL 4
As a subsequent step to batch purification of soluble glutathione-S-transferase (GST)

fusion proteins (see Alternate Protocol 2), the GST affinity tag can be cleaved from the
protein of interest using thrombin (pGEX-2T) or factor Xa (pGEX-3X) before elution
from the glutathioneSepharose 4B resin in a manner analogous to the on-column
cleavage described in Alternate Protocol 3. In this protocol, the fusion protein on the
glutathione-Sepharose resin is incubated in the presence of protease, and the cleaved
protein is released into the supernatant and collected by centrifugation.
GlutathioneSepharose 4B resin with bound fusion protein (see Alternate Protocol
2, step 7)
PBS (APPENDIX 2E)
1. For each milliliter of glutathioneSepharose 4B resin with bound fusion protein,
dilute the desired amount of reconstituted thrombin to 1.0 ml with PBS.
Enzyme concentrations must be empirically determined for each fusion protein (see Basic
Protocol 3, step 1 annotation).
2. Add the reconstituted thrombin reaction mixture to the pelleted glutathioneSepharose resin containing the bound fusion protein (from Alternate Protocol 2, step
7).
3. Gently resuspend the glutathione-Sepharose and agitate on an orbital shaker 2 to 16
hr at room temperature.
Incubation times must be empirically determined for each fusion protein.
Cleavage may be monitored by removing an aliquot of the slurry from the incubation
mixture at different time points, centrifuging the slurry to separate the resin and supernatant, and analyzing the fractions by SDS-PAGE (UNIT 10.1).
4. Centrifuge the slurry 5 min at 500 g, room temperature. Transfer supernatant to a

separate tube.
The supernatant will contain the protein of interest, while the GST moiety and uncleaved
fusion protein will remain bound to the resin.
5. Inhibit the reaction by adding a 1:500 dilution of 0.15 M PMSF stock solution (0.3
mM PMSF final). Incubate the sample an additional 15 min at 37C for thrombin or
an additional 30 min at 25C for factor Xa to covalently inhibit the enzyme with the
PMSF. Store the samples at 0 to 4C.
6. Analyze the final fractions by SDS-PAGE (UNIT 10.1).
AFFINITY CHROMATOGRAPHY PURIFICATION OF POLYPEPTIDES
AFTER ENZYMATIC CLEAVAGE
SUPPORT
PROTOCOL 1
The target polypeptide is affinity purified by rechromatography on a glutathione

Sepharose 4B column after enzymatic cleavage of the fusion protein and dialysis to
remove glutathione present in the buffer from the initial column eluate. Uncleaved fusion
protein and the glutathione-S-transferase (GST) moiety both bind to the column, and the
protein of interest is in the column flowthrough. All steps should be performed in a cold
room at 4C unless otherwise indicated.
Purification of
Recombinant
Proteins
6.6.15
Supplement 9
Materials
Solution of fusion protein that has been cleaved with thrombin or factor Xa and
dialyzed into PBS/EDTA/PMSF buffer (see Basic Protocol 3, step 4)
2.5 8cm glutathioneSepharose 4B column (e.g., Bio-Rad Econo)
Additional reagents and equipment for SDS-PAGE (UNIT 10.1)
1. Wash the glutathioneSepharose 4B column with >3 bed volumes glutathione buffer
at 1.5 ml/min.
A bed volume is one-half the amount of glutathione-Sepharose that was added to the
column.
The same 2.5 8cm column used for initial purification of a given fusion protein can be
used for repurification of the same target polypeptide after protease cleavage. GlutathioneSepharose must be fully reduced in order for the GST moiety to bind efficiently. If the column
was washed with glutathione buffer <48 hr before, this step may be skipped.
2. Wash the glutathione column with 10 bed vol PBS/EDTA/PMSF at 1.5 ml/min.
3. Load the solution of fusion protein that has been cleaved onto the column using a
flow rate of 0.1 ml/min. Collect fractions for later analysis by SDS-PAGE (UNIT 10.1)
and store at 0 to 4 C.
The protein of interest will be in the unbound or column flowthrough peak, and the GST
moiety will bind to the glutathione-Sepharose. A low flow rate for sample application, such
as 0.1 ml/min, should be used to ensure complete binding of GST to the column. Faster
flow rates are likely to result in elution of excessive amounts of the GST moiety in the
unbound fraction.
4. Wash the column with 2 to 3 bed volumes PBS/EDTA/PMSF at 1.5 ml/min.

5. Elute the bound GST moiety from the resin by washing with 5 bed volumes
glutathione buffer at 0.3 ml/min.
6. Analyze bound and unbound peaks by SDS-PAGE (UNIT 10.1), pool the fractions
containing the cleaved target polypeptide, and store at 0 to 4C.
SUPPORT
PROTOCOL 2
Expression and
Purification of
GST Fusion
Proteins
FURTHER PURIFICATION OF CLEAVED RECOMBINANT PROTEIN

USING HPLC GEL FILTRATION
Cleaved proteins after rechromatography on glutathione columns (see Support Protocol
1) or eluted after on-column protease cleavage (see Alternate Protocol 3) contain the
inactivated protease used to cleave the protein. These samples also typically contain small
amounts of aggregates, a small amount of glutathione-S-transferase (GST) moiety that
did not rebind to the column, and possibly other minor contaminants, including proteolytic
cleavage products or host cell proteins. Although the protein is typically 90% pure at
this stage, a further purification step may be desirable for many applications. HPLC gel
filtration is a fairly rapid high-resolution purification step that usually separates properly
folded polypeptides from aggregates and incorrectly folded chains. Selection of appropriate matrices and column dimensions for particular applications is discussed in UNIT 8.3.
Alternatively, ion-exchange chromatography (UNIT 8.2) can be used as a further purification
strategy, either instead of or in addition to HPLC gel filtration. This protocol describes
the HPLC gel filtration purification of cleaved polypeptides after rechromatography. All
steps, including HPLC, should be performed at 4C unless otherwise indicated.
6.6.16
Supplement 9
Materials
Cleaved fusion protein (see Support Protocol 1, step 6, or Alternate Protocol 3,
step 5)
PBS (APPENDIX 2E)
Centriprep concentrator with appropriate MWCO (Amicon)
equivalent, 4C), or 0.22-m low-protein-binding filter (Costar)
Gel-filtration columns (see UNIT 8.3)
1. Concentrate the unbound cleaved fusion protein using a Centriprep concentrator.
Samples should be concentrated to a volume of no greater than 0.5% to 1% of the column
volume to be used for the separation.
2. Centrifuge the concentrated sample 20 min at 4000 g, 4C. Remove the supernatant,
being careful not to disturb any pellet that may have formed (precipitated material
formed during concentration).
Alternatively, a 0.22-m low-protein-binding filter may be used to remove particulates. It
is especially important to remove particulates to avoid clogging of the HPLC column end
frits.
3. Inject the concentrated sample onto gel filtration column(s) equilibrated in PBS.
4. Monitor the absorbance at 280 nm (A280) using an online HPLC detector and collect
fractions.
5. Analyze the fractions by SDS-PAGE (UNIT 10.1) to determine fractions of interest and
to evaluate the purity of the target polypeptide, which should be in the major peak.
6. Pool the desired fractions and store at 0 to 4C.
Use Milli-Q-purified water or its equivalent for the preparation of all buffers. For common stock solutions,
Ampicillin, 5 mg/ml
500 mg ampicillin
100 ml H2O
Filter sterilize using 0.22-m filter
Store up to several months at 4C
Do not autoclave the solution; ampicillin is inactivated above 50C.
Glutathione buffer
50 mM Tris base
10 mM reduced glutathione (Sigma)
Adjust pH to 8.0 with 6 M HCl
Bring to final volume with cold H2O
Prepare fresh daily and store at 4C until needed
Isopropyl-1-thio--D-galactopyranoside (IPTG), 100 mM
1 g IPTG
42 ml sterile H2O
Divide into 6-ml aliquots in sterile tubes
Store up to 1 year at 20C
Purification of
Recombinant
Proteins
6.6.17
Supplement 9
Lysis buffer
50 mM NaCl
50 mM Tris base
5 mM EDTA
1 g/ml leupeptin
1 g/ml pepstatin
0.15 mM phenylmethylsulfonyl fluoride (PMSF) in isopropanol
1 mM diisopropyl fluorophosphate (DFP)
Prepare fresh daily
CAUTION: DFP is a dangerous neurotoxin. Handle the neat reagent with double gloves in
a chemical fume hood only. Carefully follow all precautions supplied by the manufacturer
for this chemical.
PBS/EDTA
1 PBS (APPENDIX 2E)
5 mM EDTA
Adjust pH to 7.4 with 1 M NaOH
Store up to 1 month at 4C
PBS/EDTA/PMSF buffer
1 PBS (APPENDIX 2E)
5 mM EDTA
Store up to 1 week at 4C
PBS/glycerol buffer
1 PBS (APPENDIX 2E)
20% (v/v) glycerol
1% (v/v) Triton X-100
5 mM 2-mercaptoethanol (2-ME)
5 mM EDTA
0.1 g/ml leupeptin
0.1 g/ml pepstatin
0.1 mM diisopropyl fluorophosphate (DFP)
Prepare fresh daily
for this chemical.
Expression and
Purification of
GST Fusion
Proteins
U buffer
5 M urea
50 mM Tris base
5 mM EDTA
5 mM 2-mercaptoethanol (2-ME)
1 g/ml leupeptin
1 g/ml pepstatin
continued
6.6.18
Supplement 9

1 mM diisopropyl fluorophosphate (DFP)
Prepare fresh daily
for this chemical.
Wash buffer
50 mM Tris base
5 mM EDTA
1 g/ml leupeptin
1 g/ml pepstatin
Prepare fresh daily
COMMENTARY
The pGEX vectors were designed for highlevel, inducible, intracellular expression of glutathione-S-transferase (GST) fusion proteins
produced in Escherichia coli. GST is a common
26-kDa protein of eukaryotes. The GST gene
used in the development of the pGEX vectors
was originally cloned from the parasitic
helminth Schistosoma japonicum (Smith and
Johnson, 1988).
Purification of fusion proteins from a wholecell lysate is readily achieved through the
strong affinity of the GST moiety for glutathione, which is immobilized on Sepharose
beads. The fusion protein can be displaced
under mild conditions from the glutathioneSepharose beads using neutral-pH buffers containing free reduced glutathione.
The main advantages of this system are the
very high level of fusion protein expression
(often >10 to 50 mg/liter of E. coli culture
grown on an environmental shaker) and the
facile purification methods for both initial isolation and subsequent separation of cleaved
polypeptide and GST moiety. Since nondenaturing purification conditions are employed,
polypeptides that do not normally contain posttranslational modifications usually retain their
functional and antigenic properties. Other advantages of this system include availability of
several alternative protease cleavage sites and
the large number of bacterial hosts that can be
used.
Purification of most soluble GST fusion
proteins is straightforward, and success in the
purification of insoluble products is determined

largely by the ability to refold the fusion protein
after extracting it from inclusion bodies. Since
the GST moiety refolds fairly readily after urea
solubilization, the presence of this moiety may
facilitate refolding of the adjacent polypeptide.
However, the high protein expression level of
the vector, even at lower growth temperatures
means that the preferred strategy for solubilizing proteins that are initially expressed in inclusion bodies is to attempt to grow the transfected cells at lower temperatures, where the
protein often remains in the soluble fraction
(see Fig. 6.6.5 and Troubleshooting). Difficulties with vector construction, protein expression, and protease cleavage may be greater
when the molecular weight of the desired
polypeptide is >100 kDa.
The GST moiety can usually be easily removed from the protein of interest by cleavage
with thrombin or factor Xa. For some studies,
such as some immunological or functional assays, removal of the GST moiety may not be
required. An important consideration is that the
GST moiety is a dimer; hence, steric hindrance
effects and nonequivalence of functional sites
on the associated fusion partner within this
dimeric structure must be considered.
Troubleshooting
Contamination of the glutathione-S-transferase (GST) fusion protein after affinity purification with E. coli host cell proteins is usually
an indication that sonication has been too severe. Other contaminants may represent de-
Purification of
Recombinant
Proteins
6.6.19
Supplement 9
Expression and
Purification of
GST Fusion
Proteins
graded fragments of the fusion protein that

might be eliminated by the addition of protease
inhibitors and/or carefully keeping all samples,
buffers, and sample tubes as cold as possible
(i.e., keeping the materials at 0C, on ice, often
results in noticeably lower proteolysis than occurs where samples are kept at 4C in a refrigerator). Degradation of fusion proteins during
expression can sometimes be minimized by
adding isopropyl-1-thio--D-galactopyranoside (IPTG) later in the bacterial culture
growth with cells at higher OD at time of
induction and by decreasing the duration of the
induction period.
If the fusion protein does not completely
bind to the glutathione-Sepharose resin, several
options may be tried: increasing the quantity of
glutathione-Sepharose, decreasing the protein
loading flow rate, ensuring that the column is
completely reduced by pretreating it with a
freshly prepared glutathione buffer within 24
hr prior to using the column for purification,
and ensuring that any denaturants or reducing
reagents used to treat the sample have been
completely removed through exhaustive dialysis.
Expression of GST fusion protein in inclusion bodies can be addressed in several ways.
The preferred method is to lower the growth
temperature from 37 to 30, 25, 20, or 15C.
The optimal growth temperature is that temperature where >50% of the expressed protein
is in the supernatant. This strategy is efficient
even if the expressed fusion protein yield decreases somewhat at the lower growth temperatures. It is usually more time and cost effective
to grow a larger quantity of cells than to attempt
to renature fusion protein extracted from inclusion bodies since the latter method nearly doubles the time required to purify the fusion protein. In one study, when the authors laboratory
expressed eleven GST fusion proteins at 37C,
four proteins were primarily in inclusion bodies
and the remaining seven proteins were partially
in the supernatant, although a substantial
amount of fusion protein was also in inclusion
bodies. When these eleven fusion proteins were
expressed at 30C, ten were primarily (>80%)
in the soluble fraction. The remaining recombinant protein was primarily in inclusion bodies
at either 30 or 25C, but could be switched to
the soluble fraction and produced in high yield
by growing the cells at 18C, as shown in Figure
6.6.5. If lowering the growth temperature does
not result in expression of a soluble protein,
renaturing the protein after extracting inclusion
bodies with a chaotropic reagent such as urea
can be attempted (see Alternate Protocol 1).

Finally, even when most of a protein is primarily in inclusion bodies, there may be enough
protein in the soluble fraction that it can be
purified in low milligram yields per liter of
culture.
In some cases, using high enzyme-to-substrate ratios and prolonged incubation times is
not sufficient to cleave the fusion protein in
good yield. To minimize steric hindrance at the
thrombin cleavage site, modified pGEX vectors
that contain a glycine-rich, nine-amino-acid
kinker region immediately before or after the
thrombin cleavage site (Guan and Dixon, 1991;
Hakes and Dixon, 1991) can be tried. Sometimes introduction of as few as one or two extra
glycines immediately after to the thrombin site
may substantially improve the rate of protease
cleavage.
The probability that extraneous residues on
the N-termini of cleaved polypeptides could
significantly affect structural and functional
properties of expressed polypeptides is very
likely to increase as the length of the extraneous
sequence increases. Hence, the number of extra
residues remaining on the target polypeptide
after protease cleavage should be minimized.
Although thrombin cleavage is usually more
cost effective than factor Xa cleavage, a minimum of two extra residues from the thrombin
recognition site (GS) are left on the cleaved
peptide. Although no residues from the factor
Xa recognition site are left on the cleaved
polypeptide, at least several extraneous amino
acids are introduced onto the N-terminal of all
pGEX-X vectors from the sequence remaining
at the cloning site (see Figs. 6.6.2 and 6.6.3).
Depending upon the pGEX vector and cloning
site utilized, as few as two and as many as
thirteen extra amino acids may remain on the
cleaved N-terminal end of the target protein.
The yield of GST fusion proteins is typically
quite high, i.e., 10 to 50 mg of fusion protein
per liter of culture when cells are grown on an
environmental shaker. When low protein expression does occur, it can often be improved
by optimizing the bacterial culture growth conditions: for example, growing the cells to a
somewhat higher OD550 at the time of induction, increasing the length of the induction
period, using another strain of E. coli such as a
protease-negative strain, or growing the cells at
higher temperatures (although proteins are
more likely to be in inclusion bodies at higher
temperatures; see Background Information).
Caution should be taken when using higher cell
ODs and longer growth times after induction,
6.6.20
Supplement 9
since the cells may start to lyse under these

conditions.
For additional information concerning GST
fusion protein expression, Pharmacia Biotech
publishes a reference list, bulletin number 181117-27, that classifies related publications
into several useful categories to assist in troubleshooting a variety of parameters.
Anticipated Results
Yields of fusion protein can vary widely.
Typical yields are 10 to 50 mg/liter, but can
occasionally be much lower, especially if the
fusion protein is toxic to the cells or is unstable.
In some cases, >50 mg/liter can be obtained
when expression conditions have been well
optimized. A single-step affinity purification
should yield fusion protein that is >90% pure
in most cases. The relationship between yield
of fusion protein and yield of cleaved, repurified recombinant target polypeptide is in part
due to the mass of the target polypeptide. A
good final yield of a cleaved protein after repurification on a glutathione column followed by
HPLC gel filtration might be 2 mg/liter for a
10-kDa protein and 10 mg/liter for a 50-kDa
protein.
Time Considerations
Protein expression takes 1.5 days of intermittent work requiring approximately 3 to 4 hr
of operator time. Longer induction periods may
be required at temperatures lower than 30C,
but total operator time remains the same. A
small-scale batch purification can be completed in 1 day. A large-scale column purification, cleavage of fusion protein, and repurification of the cleaved peptide by affinity and gel
filtration chromatography will take 5 to 8 days
of intermittent work requiring several hours of
operator time per day. The purification should
be completed in as short a time as practical to
minimize proteolysis, aggregation, and precipitation of impure fractions.
Literature Cited
Ausubel, F.M., Brent, R., Kingston, R.E., Moore,
D.D., Seidman, J.G., Smith, J.A., and Struhl, K.
(eds.). 1994. Current Protocols in Molecular Biology. John Wiley & Sons, New York.
Davies, A.H., Jowett, J.B.M., Jones, I.M. 1993. Recombinant baculovirus vectors expressing glutathione-S-transferase fusion proteins. Bio/Technology 11:933-936.
Frangioni, J.V. 1992. Solubilization and purification
of enzymatically active glutathione-S-transferase (pGEX) fusion proteins. Anal. Biochem.
210:179-187.
Gearing, D.P., Nicola, N.A., Metcalf, D., Foote, S.,
Willson, T.A., Gough, N.M., and Williams, R.L.
1989. Production of leukemia inhibitory factor
in Escherichia coli by a novel procedure and its
use in maintaining embryonic stem cells in culture. Bio/Technology 7:1157-1161.
Grieco, F., Hull, J., and Hull, R. 1992. An improved
procedure for the purification of protein fused
with glutathione-S-transferase. Biotechniques
13:856-857.
Guan, K.L. and Dixon, J.E. 1991. Eukaryotic proteins expressed in Escherichia coli: An improved
thrombin cleavage and purification procedure of
fusion proteins with glutathione-S-transferase.
Anal. Biochem. 192:262-267.
Hakes, D.J. and Dixon, J.E. 1991. New vectors for
high level expression of recombinant proteins in
bacteria. Anal. Biochem. 202:293-298.
Mitchell, D.A., Marshall, T.K., and Deschenes, R.J.
1993. Vectors for the overexpression of glutathione-S-transferase fusion proteins in yeast.
Yeast 9:715-722.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989.
Molecular Cloning: A Laboratory Manual, 2nd
ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, New York.
Smith, D.B. and Johnson, K.S. 1988. Single-step
purification of polypeptides expressed in Escherichia coli as fusions with glutathione-Stransferase. Gene 67:31-40.
Key Reference
Smith and Johnson, 1988. See above.
Original description of the pGEX system.
Contributed by Sandra Harper and

David W. Speicher
The Wistar Institute
Philadelphia, Pennsylvania
Purification of
Recombinant
Proteins
6.6.21
Supplement 9
Expression and Purification of Thioredoxin

Fusion Proteins
UNIT 6.7
This unit describes a gene fusion expression system that uses thioredoxin, the product of
the Escherichia coli trxA gene, as the fusion partner. The system is particularly useful for
high-level production of soluble fusion proteins in the E. coli cytoplasm; in many cases
heterologous proteins produced as thioredoxin fusion proteins are correctly folded and
display full biological activity. Although the thioredoxin gene fusion system is routinely
used for protein production, high-level production of peptidesi.e., for use as antigens
is also possible because the prominent thioredoxin active-site loop is a very permissive
site for the introduction of short amino acid sequences (10 to 30 residues in length). The
inherent thermal stability of thioredoxin and its susceptibility to quantitative release from
the E. coli cytoplasm by osmotic shock can also be exploited as useful tools for thioredoxin
fusion protein purification. In addition, a more generic method for purification of any
soluble thioredoxin fusion employs a modified form of thioredoxin (called His-patch
Trx), which has been designed to bind to metal chelate resins. Protein fusions to
His-patch Trx can usually be purified in a single step from cell lysates (see Strategic
Planning).
The first step is construction of a fusion of trxA to any desired gene and expression of the
fusion protein in an appropriate host strain at 37C (see Basic Protocol). Additional
protocols describe E. coli cell lysis using a French pressure cell and fractionation (see
Support Protocol 1), osmotic release of thioredoxin fusion proteins from the E. coli
cytoplasm (see Support Protocol 2), and heat treatment to purify some thioredoxin fusion
proteins (see Support Protocol 3).
STRATEGIC PLANNING
The thioredoxin gene fusion expression vectors pTRXFUS and hpTRXFUS, both of
which carry the E. coli trxA gene (Fig. 6.7.1), are used for high-level production of
C-terminal fusions to thioredoxin. The vector hpTRXFUS differs from pTRXFUS in that
it contains a modified E. coli trxA gene which produces a mutant protein (His-patch
thioredoxin) that can specifically bind to metal chelate matrices charged with nickel or
cobalt, otherwise known as native metal-chelate affinity chromatography (MCAC; UNIT
9.4). The trxA translation-termination codon has been replaced in both vectors by DNA
encoding a ten-residue peptide linker sequence that includes an enterokinase (enteropeptidase; LaVallie et al., 1993a) cleavage site. This highly specific site can be cleaved with
enterokinase following purification of the fusion protein to release the protein of interest
from its thioredoxin fusion partner. Immediately downstream of the DNA encoding the
enterokinase site in pTRXFUS and hpTRXFUS lies a DNA polylinker sequence containing a number of unique restriction endonuclease sites that can be used for forming
in-frame translational fusions of any desired gene to trxA. Downstream of the DNA
polylinker lies the E. coli aspA transcription terminator. Replication of these vectors is
controlled by a modified colE1 replication origin similar to that found in pUC vectors
(Norrander et al., 1983). Plasmid selection and maintenance is ensured by the presence
of the -lactamase gene on the vector. The vector pALtrxA-781 (Fig. 6.7.1) is very similar
to pTRXFUS. However in this plasmid the trxA gene is followed by a translation
termination codon, and the sequences encoding the enterokinase-site peptide linker are
absent. A unique RsrII site, present in both pALtrxA-781 and pTRXFUS, allows for the
easy insertion of short peptide-encoding DNA sequences into trxA within the region that
encodes the active-site loop.
Contributed by John McCoy and Edward LaVallie
Purification of
Recombinant
Proteins
6.7.1
Supplement 10
BLA
ori
pALtrxA781
pTRXFUS
p L hpTRXFUS
trxA
aspA
Rsr II
TGGTGCGGTCCGTGCAAA
W
C
G33 P34 C
K
Sfi I
pALtrxA781:
Xba I
Sal I
Pst I
AACCTGGCCTAGCTGGCCATCTAGAGTCGACCTGCAG
N L
A *
aspA
terminator
thioredoxin
Kpn I Bam HI Xba I
pTRXFUS:
Sal I
Pst I
AACCTGGCCGGTTCTGGTTCTGGTGATGACGATGACAAGGTACCCGGGGATCCTCTAGAGTCGACCTGCAG
thioredoxin
fusion
point
aspA
terminator
linker peptide
enterokinase site
Figure 6.7.1 Thioredoxin gene fusion expression vectors pTRXFUS, hpTRXFUS, and pALtrxA-781. pALtrxA-781
contains a polylinker sequence at the 3 end of the trxA gene. pTRXFUS and hpTRXFUS contain a linker region encoding
a peptide that includes the enterokinase cleavage site between the trxA gene and the polylinker. The sequence
surrounding the active site loop of thioredoxin has a single RsrII site that can be used to insert peptide coding sequence.
The asterisk indicates a translational stop codon. Abbreviations: trxA, E. coli thioredoxin gene; BLA, -lactamase gene;
ori, colE1 replication origin; pL, bacteriophage major leftward promoter; aspA terminator, E. coli aspartate amino-transferase transcription terminator.
Expression and
Purification of
Thioredoxin
Fusion Proteins
pTRXFUS, hpTRXFUS, and pALtrxA-781 carry the strong bacteriophage promoter

pL (Shimatake and Rosenberg, 1981) positioned upstream of the trxA gene. Transcription
initiation at the pL promoter is controlled by the intracellular concentration of repressor
protein (cI). cI857-containing strains (Shatzman et al., 1990) can be used for heat inductions
of pL at 42C; alternatively, in the strains carrying the wild-type repressor, pL can be
induced by a prior induction of the E. coli SOS stress response. However, it is often
desirable to express heterologous genes in E. coli at temperatures considerably lower than
42C, or under conditions where cells are not undergoing a physiological stress. Strains
GI698, GI724 and GI723 were designed to allow the growth and induction of pL
expression vectors, including pTRXFUS, hpTRXFUS, and pALtrxA-781, under mild
conditions over a wide range of temperatures (see Table 6.7.1; Mieschendahl et al., 1986).
Each of these strains carries a wild-type allele of cI stably integrated into the E. coli
chromosome at the nonessential ampC locus. A synthetic trp promoter integrated into
ampC upstream of the cI gene in each strain directs the synthesis of cI repressor only
when intracellular tryptophan levels are low. When tryptophan levels are high, synthesis
of cI is switched off; therefore, the presence of tryptophan in the growth medium of GI698,
GI723, or GI724 will block expression of repressor and thus will turn on pL. Because
the three strains carry ribosome-binding sequences of different strengths at the 5-end of
6.7.2
Supplement 10
Table 6.7.1 E. coli Strains for Production of Thioredoxin

Fusion Proteins at Varying Temperatures
Strain
Desired
production
temperature (C)
Pre-induction
growth
temperature (C)
Induction
period (hr)
GI698
15
25
20
GI698
GI698
20
25
25
25
18
10
GI724
GI724
30
37
30
30
6
4
GI723
37
37
their respective cI genes, they maintain intracellular concentrations of repressor that

increase in the order GI698 < GI724 < GI723. The choice of which strain to use for a
particular application is dependent on the desired culture conditions as described below.
Although some thioredoxin fusion proteins produced at 37C are insoluble, expression
at lower temperatures can often result in the fusion protein being produced in a soluble
form. Each of the three pL host strains GI698, GI723, and GI724 is suitable for the
production of thioredoxin fusion proteins over a particular temperature range. Table 6.7.1
indicates the correct strain for expression of thioredoxin fusion proteins at any temperature between 15C and 37C. The induction protocol at any of these temperatures is the
same as that described for induction of GI724 at 37C (see Basic Protocol), except the
preinduction growth temperature and the length of the induction period vary according
to the strain used and the temperature chosen. Cultures should be grown at the indicated
preinduction growth temperature until they reach a density of 0.4 to 0.6 OD550/ml. They
should then be moved to the desired induction temperature and induced by the addition
of 100 g/ml tryptophan.
Low-temperature inductions are best performed in strain GI698. However, this strain
makes only enough cI repressor protein to maintain the vectors in an uninduced state at
temperatures below 25C. GI698 should therefore never be grown above 25C when it
carries a pL plasmid. A nonrefrigerated water bath can be maintained below room
temperature by placing it in a 4C room and setting the thermostat to the desired
temperature.
It is often a good idea to collect time points during the course of a long induction period
and to fractionate cells from these time points (see Support Protocol 1, steps 9 to 13).
Although a particular fusion protein may be soluble during the early part of an induction,
during the later phases of induction it may become unstable or its concentration inside
the cell may exceed a critical threshold above which it will precipitate and appear in the
insoluble fraction.
Purification of
Recombinant
Proteins
6.7.3
Supplement 10
BASIC
PROTOCOL
CONSTRUCTION AND EXPRESSION OF A THIOREDOXIN

FUSION PROTEIN
This protocol describes construction and subsequent expression of a gene fusion between
trxA (encoding thioredoxin) and a gene encoding a particular protein or peptide. After a
clone carrying the correct fusion sequence is constructed, analyzed, and isolated, cultures
are grown and expression is induced. The protocol is described in terms of the E. coli host
strain GI724 with expression at 30C; it may also be applied to strains GI698 and GI723
(also available from Genetics Institute) for expression at other temperatures by using the
parameters specified in Table 6.7.1 (see Strategic Planning).
Materials
DNA fragment encoding desired sequence
Thioredoxin expression vectors (Fig. 6.7.1): pTRXFUS or pALtrxA-781 (Genetics
Institute or Invitrogen) or hpTRXFUS (Genetics Institute)
E. coli strain GI724 (Genetics Institute or Invitrogen), grown in LB medium and
made competent
LB medium (UNIT 5.2)
IMC plates (see recipe) containing 100 g/ml ampicillin
CAA/glycerol/ampicillin 100 medium (see recipe)
IMC medium (see recipe) containing 100 g/ml ampicillin
10 mg/ml tryptophan (see recipe)
SDS-PAGE sample buffer (see recipe)
30C convection incubator
18 50mm culture tubes
Roller drum (New Brunswick Scientific)
250-ml culture flask
70C water bath
Microcentrifuge, 4C
Additional reagents and equipment for SDS-PAGE (UNIT 10.1), and Coomassie
brilliant blue staining (UNIT 10.5)
Construct the trxA gene fusion
1. Use DNA fragment encoding the desired sequence to construct either an in-frame
fusion to the 3-end of the trxA gene in pTRXFUS or hpTRXFUS, or a short peptide
insertion into the unique RsrII site of pALtrxA-781.
A precise fusion of the desired gene to the enterokinase linker sequence in pTRXFUS or
hpTRXFUS can be made by using the unique KpnI site trimmed to a blunt end with the
Klenow fragment of E. coli DNA polymerase. The desired gene can usually be adapted to
this blunt-end construct by using a synthetic oligonucleotide duplex ligated between it and
any convenient downstream restriction site close to the 5 end of the gene. When designing
the fusion junction, note that enterokinase is able to cleave DDDDKX, where X is
any amino acid residue except proline. Synthetic oligonucleotides encoding short peptides
for insertion into the thioredoxin active-site loop at the RsrII site will insert only in the
desired orientation, because the RsrII sticky end consists of three bases.
2. Transform the ligation mixture containing the new thioredoxin fusion plasmid into
competent GI724 cells. Plate transformed cells onto IMC plates containing 100 g/ml
ampicillin to select transformants. Incubate plates in a 30C convection incubator
until colonies appear.
Expression and
Purification of
Thioredoxin
Fusion Proteins
Strains GI698, GI723, and GI724 are all healthy prototrophs that can grow under a wide
variety of growth conditions, including rich and minimal media and a broad range of
growth temperatures (see Table 6.7.1). These strains can be prepared for transformation
with pL-containing vectors by growing them in LB medium at 37C. LB medium may also
6.7.4
Supplement 10
be used for these strains during the short period of outgrowth immediately following
transformation. This growth period of 30 min to 1 hr is often used to express drug-resistance
phenotypes before plating out plasmid transformations onto solid medium. Subsequently,
however, these strains should be grown only on minimal or tryptophan-free rich media,
such as IMC medium containing 100 g/ml ampicillin (for expression of the fusion protein)
or CAA/glycerol/ampicillin 100 medium (for plasmid DNA preparations). Except during
transformation, LB medium should never be used with these three strains when they carry
pL plasmids because LB contains tryptophan. The pL promoter is extremely strong and
should be maintained in an uninduced state until needed so that expression of the protein
will not lead to selection of mutant or variant cells with lower expression due to undesirable
genetic selections or rearrangements in the expression strain.
3. Grow candidate colonies in 5 ml CAA/glycerol/ampicillin 100 medium overnight at

30C. Prepare minipreps of plasmid DNA and check for correct gene insertion into
pTRXFUS by restriction mapping.
4. Sequence plasmid DNA of candidate clones to verify the junction region between
thioredoxin and the gene or sequence of interest.
Induce expression
5. Streak out frozen stock culture of GI724 containing thioredoxin expression plasmid
to single colonies on IMC plates containing 100 g/ml ampicillin. Grow 20 hr at
30C.
Occasionally there is induction of pL plasmids grown in GI698 and GI724 at 37C, even
in medium containing no tryptophan. Such induction appears to be a temperature-dependent phenomenon. If growth at 37C prior to pL induction is essential, then GI723 should
be used as the host strain because GI723 produces higher levels of cI repressor than both
GI698 and to GI724. Otherwise, plasmid-containing GI698 should be grown at 25C and
plasmid-containing GI724 should be grown at 30C prior to induction (see Table 6.7.1).
6. Pick a single fresh, well-isolated, colony from the plate and use it to inoculate 5 ml
IMC medium containing 100 mg/ml ampicillin in an 18 150mm culture tube.
Incubate overnight at 30C on a roller drum.
7. Add 0.5 ml overnight culture to 50 ml fresh IMC medium containing 100 g/ml
ampicillin in a 250-ml culture flask (1:100 dilution). Grow at 30C with vigorous
aeration until absorbance at 550 nm reaches 0.4 to 0.6 OD/ml (3.5 hr).
8. Remove a 1-ml aliquot of the culture (uninduced cells). Measure the optical density
at 550 nm and harvest the cells by microcentrifuging 1 min at maximum speed, room
temperature. Carefully remove all the spent medium with a pipet and store the cell
pellet at 80C.
9. Induce pL by adding 0.5 ml of 10 mg/ml tryptophan (100 g/ml final) to remaining
cells immediately.
10. Incubate 4 hr at 37C. At hourly intervals during this incubation, remove 1-ml aliquots
of the culture and harvest cells as in step 8.
11. Harvest the remaining cells from the culture 4 hr post-induction by centrifuging 10
min at 3000 rpm (e.g., in a Beckman J6 rotor), 4C. Store the cell pellet at 80C.
Procedures for further analysis of these cells are outlined in the support protocols.
Verify induction
12. Resuspend the pellets from the induction intervals (steps 8 and 10) in 200 l of
SDS-PAGE sample buffer/OD550 cells. Heat 5 min at 70C to completely lyse the
cells and denature the proteins. Run the equivalent of 0.15 OD550 cells per lane (30
l) on an SDS-polyacrylamide gel (UNIT 10.1).
Purification of
Recombinant
Proteins
6.7.5
Supplement 10
13. Stain the gel 1 hr with Coomassie brilliant blue (UNIT 10.5). Destain the gel and check
for expression.
Most thioredoxin fusion proteins are produced at levels that vary from 5% to 20% of the
total cell protein. The desired fusion protein should exhibit the following characteristics:
it should run on the gel at the mobility expected for its molecular weight; it should be absent
prior to induction; and it should gradually accumulate during induction, with maximum
accumulation usually occurring 3 hr post-induction at 37C.
SUPPORT
PROTOCOL 1
E. COLI LYSIS USING A FRENCH PRESSURE CELL

A small, 3.5-ml French pressure cell can be used as a convenient way to lyse E. coli cells.
The whole-cell lysate can be fractionated into soluble and insoluble fractions by microcentrifugation. Other lysis procedures may be usedfor example, sonication (UNIT 6.6) or
treatment with lysozyme-EDTA (UNIT 6.5). For use of the larger 40-ml French pressure
cell, see UNIT 6.2.
Materials
Cell pellet from 4-hr post-induction culture (see Basic Protocol)
20 mM TrisCl, pH 8.0 (APPENDIX 2E), 4C
Lysis buffer: 20 mM TrisCl (pH 8.0) with protease inhibitors (optional)0.5 mM
phenylmethylsulfonyl fluoride (PMSF), 1 mM p-aminobenzamidine (PABA),
and 5 mM EDTA
French press and 3.5-ml mini-cell (SLM Instruments), 4C
Lyse the cells
1. Resuspend cell pellet from 4-hr post-induction culture in 20 mM TrisCl, pH 8.0, to
a concentration of 5 OD550/ml.
Protease inhibitors can be included in the resuspension if desired. Cells can also be
resuspended at densities of 100 OD550/ml or greater; however, at high densities cell lysis
may be less efficient.
2. Place 1.5 ml resuspended cell pellet in the 3.5-ml French pressure cell. Hold the cell
upside down with the base removed, the piston fully extended downwards, and the
outlet valve handle that holds the nylon ball seal in the open position (loose).
Before filling the pressure cell, check that the nylon ball, which seals the outlet port and
sits on the end of the outlet valve handle, is not deformed. If it is, replace it with a new one.
Both the condition of the nylon ball and its seat in the pressure-cell body are critical for
the success of the procedure.
3. Bring the liquid in the pressure cell to the level of the outlet port by raising the piston
slowly to expel excess air from the cell. With the outlet valve open and at the same
time maintaining the piston in position, install the pressure-cell base. Gently close
the outlet valve.
CAUTION: Do not over-tighten the valve as this will deform the nylon ball and may
irreparably damage its seat on the pressure-cell body.
4. Turn the sealed cell right-side-up and place it in the hydraulic press.
Expression and
Purification of
Thioredoxin
Fusion Proteins
5. Turn the pressure regulator on the press fully counter-clockwise to reset it to zero
pressure. Set the ratio selector to medium. Turn on the press.
CAUTION: The larger (50-ml) pressure cell is usually used with the selector set on high.
The small (3.5-ml) cell is only used on medium ratio.
6.7.6
Supplement 10
6. Slowly turn the pressure regulator clockwise until the press just begins to move. Allow
the press to compress the piston.
The press will stop moving after a few seconds.
7. Position a collection tube under the pressure-cell outlet. Slowly increase the pressure
in the cell by turning the pressure regulator clockwise. Monitor the reading on the
gauge and increase the pressure to 1000 on the dial, corresponding to an internal cell
pressure of 20,000 lb/in2.
8. While continuously monitoring the gauge, very slowly open the outlet valve until
lysate begins to trickle from the outlet.
The lysate should flow slowly and smoothly, and the cell pressure should not drop more
than 100 divisions on the dial.
At 20,000 lb/in2 and 5 OD550/ml, cell lysis will be complete after one passage through the
press. Lower pressures and/or higher cell densities may require a second passage.
Fractionate the lysate

9. Remove a 100-l aliquot of the lysate and freeze at 80C (whole-cell lysate).
10. Fractionate the remainder of the lysate by microcentrifuging 10 min at maximum
speed, 4C.
11. Remove a 100-l aliquot of the supernatant and freeze at 80C (soluble fraction).
Discard the remainder of the supernatant.
Because this is a pilot experiment, it would not produce enough material to warrant saving
any remaining supernatant.
12. Resuspend the pellet in an equivalent volume of lysis buffer. Remove a 100-l aliquot
and freeze at 80C (insoluble fraction).
13. Lyophilize the 100-l aliquots to dryness in a Speedvac evaporator. Solubilize in 100
l SDS-PAGE sample buffer. Analyze 30-l samples by SDS-PAGE (UNIT 10.1).
This crude fractionation provides a fairly reliable indication of whether a protein has folded
correctly. Usually proteins in the soluble fraction have adopted a correct conformation and
proteins in the insoluble fraction have not. However, occasionally proteins found in the
soluble fraction are not truly soluble; instead they form aggregates that do not pellet in the
microcentrifuge. Conversely, sometimes a protein found in the insoluble fraction may be
there because it has an affinity for cell-wall components and cell membranes, and it may
not be intrinsically insoluble. Occasionally proteins can be recovered from these insoluble
fractions by extracting with agents such as mild detergents.
OSMOTIC RELEASE OF THIOREDOXIN FUSION PROTEINS

Thioredoxin and some thioredoxin fusion proteins can be released with good yield from
the E. coli cytoplasm by a simple osmotic shock procedure.
SUPPORT
PROTOCOL 2
Materials
Cell pellet from 4-hr post-induction cultures (see Basic Protocol)
20 mM TrisCl (pH 8.0)/2.5 mM EDTA/20% (w/v) sucrose, ice-cold
20 mM TrisCl (pH 8.0)/2.5 mM EDTA, ice-cold
1. Resuspend cell pellet from 4-hr post-induction cultures at a concentration of 5
OD550/ml in ice-cold 20 mM TrisCl (pH 8.0)/2.5 mM EDTA/20% sucrose. Incubate
10 min on ice.
2. Microcentrifuge 30 sec at maximum speed, 4C, to pellet the cells.
Purification of
Recombinant
Proteins
6.7.7
Supplement 10
3. Discard the supernatant and gently resuspend the cells in an equivalent volume of
ice-cold 20 mM TrisCl (pH 8.0)/2.5 mM EDTA. Incubate 10 min on ice and mix
occasionally by inverting the tube.
Osmotic release from the cytoplasm occurs at this stage.
4. Microcentrifuge 30 sec at maximum speed, 4C. Save the supernatant (osmotic

shockate). Resuspend the cell pellet in an equivalent volume 20 mM TrisCl (pH
8.0)/2.5 mM EDTA (retentate).
5. Lyophilize 100-l aliquots of osmotic shockate and retentate to dryness in a Speedvac
evaporator.
6. Solubilize each in 100 l SDS-PAGE sample buffer. Analyze 30-l aliquots by
SDS-PAGE (UNIT 10.1).
The osmotic-shock procedure provides a substantial purification step for some thioredoxin
fusion proteins. This procedure will remove most of the contaminating cytoplasmic proteins
as well as almost all of the nucleic acids. However the shockate will contain as contaminants about half of the cellular elongation factor-Tu (EF-Tu) and most of the E. coli
periplasmic proteins.
SUPPORT
PROTOCOL 3
PURIFICATION OF THIOREDOXIN FUSION PROTEINS BY

HEAT TREATMENT
Wild-type thioredoxin is resistant to prolonged incubations at 80C. A subset of thioredoxin fusion proteins also exhibit corresponding thermal stability, and heat treatment at
80C can sometimes be used as an initial purification step. Under these conditions the
majority of contaminating E. coli proteins are denatured and precipitated.
Materials
Cell pellet from 4-hr post-induction cultures (See Basic Protocol)
20 mM TrisCl (pH 8.0)/2.5 mM EDTA
80C water bath
10-ml glass-walled tube
Additional reagents and equipment for lysis using a French pressure cell (Support
Protocol 1) and SDS-PAGE (UNIT 10.1)
1. Resuspend cell pellet from 4-hr post-induction cultures at a concentration of 100
OD550/ml in 20 mM TrisCl (pH 8.0)/2.5 mM EDTA.
It is important to start off with a high protein concentration in the lysate to ensure efficient
precipitation of denatured proteins.
2. Lyse the cells at 20,000 lb/in2 in a French pressure cell (see Support Protocol 1, steps
2 to 8). Collect whole-cell lysate in a 10-ml glass-walled tube.
3. Incubate whole-cell lysate 10 min at 80C. Remove 100-l aliquots after 30 sec, 1
min, 2 min and 5 min and plunge immediately into ice. At 10 min, plunge the
remaining heated lysate into ice.
Expression and
Purification of
Thioredoxin
Fusion Proteins
A glass-walled tube (not plastic) provides good thermal conductivity to provide a rapid
rise in temperature to 80C and then a rapid drop in temperature to 4C. A suitable volume
to use in a 10-ml glass tube is 1.5 ml lysate. For large-scale work, a glass-walled vessel
should be used and the lysate should be mixed well during both heat treatment and cooling.
4. Microcentrifuge the aliquots 10 min at maximum speed, 4C to pellet heat-denatured,

precipitated proteins.
6.7.8
Supplement 10
5. Remove 2-l aliquots of the supernatants and add 28 l SDS-PAGE sample buffer.
Analyze the samples by SDS-PAGE (UNIT 10.1) to determine the heat stability of the
fusion protein and the minimum time of heat treatment required to obtain a good
purification.
Use deionized, distilled water in all recipes and protocol steps. For common stock solutions, see
APPENDIX 2E; for suppliers, see SUPPLIERS APPENDIX.
Casamino Acids (CAA), 2% (w/v)

20 g Casamino Acids (Difco-certified)
H2O to 1 liter
Autoclave or filter sterilize through a 0.45-m filter
Store 2 months at room temperature
Do not use technical-grade Casamino Acids because it has a higher NaCl content.
CAA/glycerol/ampicillin 100 medium

800 ml 2% (w/v) Casamino Acids (see recipe; 1.6% final)
100 ml 10 M9 salts (see recipe; 1 final)
100 ml 10% (v/v) glycerol (sterile; 1% final)
1 ml 1 M MgSO4 (sterile; 1 mM final)
0.1 ml 1 M CaCl2 (sterile; 0.1 mM final)
1 ml 2% (w/v) vitamin B1 (sterile; 0.002% final)
10 ml 10 mg/ml ampicillin (sterile; 100 g/ml final)
Prepare fresh
IMC medium
200 ml 2% (w/v) Casamino Acids (see recipe; 0.4% final)
40 ml 20% (w/v) glucose (sterile; 0.5% final)
658 ml glass-distilled H2O (sterile)
10 ml 10 mg/ml ampicillin (sterile; optional; 100 g/ml final)
Use fresh
IMC plates
15 g agar [Difco; 1.5% (w/v)]
4 g Casamino Acids [Difco-certified; 0.4% (w/v)]
858 ml glass-distilled H2O (sterile)
Autoclave 30 min
Cool in a 50C water bath
40 ml 20% (w/v) glucose (sterile; 0.5% final)
10 ml 10 mg/ml ampicillin (sterile; optional; 100 g/ml final)
Mix well and pour into petri plates
Store 1 month at 4C
Purification of
Recombinant
Proteins
6.7.9
Supplement 17
M9 salts, 10
60 g Na2HPO4 (0.42 M)
30 g KH2PO4 (0.24 M)
5 g NaCl (0.09 M)
10 g NH4Cl (0.19 M)
H2O to 1 liter
Adjust pH to 7.4 with NaOH
Autoclave or filter sterilize through a 0.45-m filter
Store 6 months at room temperature
SDS-PAGE sample buffer
15% (v/v) glycerol
0.125 M TrisCl, pH 6.8 (APPENDIX 2E)
5 mM Na2EDTA
2% (w/v) SDS
0.1% (w/v) bromphenol blue
1% (v/v) 2-mercaptoethanol (2-ME; add immediately before use)
Store indefinitely at room temperature
Tryptophan, 10 mg/ml
Heat 500 ml glass-distilled H2O to 80C. Stir in 5 g L-tryptophan until dissolved.
Filter sterilize the solution through a 0.45 m filter and store 6 months in the dark
at 4C.
COMMENTARY
Expression and
Purification of
Thioredoxin
Fusion Proteins
Two significant problems plague researchers who hope to express heterologous

proteins in Escherichia coli: inefficient initiation of translation of many eukaryotic mRNA
sequences on bacterial ribosomes (Stormo et
al., 1982), and proteins that often form insoluble aggregates, called inclusion bodies, that
are composed of misfolded or denatured proteins (Mitraki and King, 1989). Although successful protocols for refolding eukaryotic proteins from inclusion bodies can be developed,
the process is always uncertain and usually
time-consuming; in most instances it is preferable to prevent inclusion-body formation in the
first place. The use of trxA fusions provides a
solution to both problems.
Inefficient initiation of translation of eukaryotic messages in E. coli can often be improved by modifying sequences at the 5 end of
the gene. A more reliable technique that avoids
the problem entirely is to use a gene-fusion
strategy in which the gene of interest is linked
in-frame to the 3 end of a highly translated
partner gene. In this case protein synthesis
always initiates on the same efficiently translated fusion-partner mRNA, thus ensuring
high-level expression. Some earlier gene-fusion expression systems, for example the trpE
and lacZ systems, offer very reliable ways of
producing large quantities of any desired eukaryotic protein. However, these gene-fusion
systems still suffer from the pervasive inclusion-body problem. They are thus mainly useful for the production of antigens, rather than
correctly folded, biologically active proteins.
More recently the maltose binding protein
(MBP; Riggs, 1994; UNIT 5.1) and glutathioneS-transferase (GST) gene fusion expression
systems (see UNIT 6.6) have proven more successful in producing soluble fusion proteins;
these systems retain the translation advantage
of the earlier fusion systems. Apart from the
obvious advantages in making a correctly
folded product, the synthesis of soluble fusion
proteins also allows for the development of
generic purification schemes based on some
unique property of the fusion partner.
Why would any particular eukaryotic protein produced in the E. coli cytoplasm be more
soluble when it is linked to a fusion partner than
it would be by itself? It is likely that physical
properties of the fusion-partner protein are important, with efficient self-folding and high
solubility being useful in this role. It is possible
that some good fusion partners (proteins that
fold efficiently and are highly soluble), by virtue of their desirable physical qualities, are able
to keep folding intermediates of linked heterologous proteins in solution long enough for
6.7.10
Supplement 17
them to adopt their correct final conformations.

In this respect the fusion partner may serve as
a covalently joined chaperone protein, in many
ways fulfilling the role of authentic chaperone
proteins (McCoy, 1992), analogous to the covalent chaperone role proposed for the N-terminal pro regions of a number of protein precursors (Silen et al., 1989; Shinde et al., 1993).
Many of the known properties of E. coli
thioredoxin (Holmgren, 1985) suggested that
it would make a particularly effective fusion
partner in an expression system. First, thioredoxin, when overproduced from plasmid vectors, can accumulate to 40% of the total cellular
protein, yet even at these expression levels all
of the protein remains soluble. Second, the
molecule is small (11,675 Mr) and would contribute a relatively modest amount to the total
mass of any fusion protein, in contrast to other
systems such as the lacZ system. Third, the
tertiary structure of thioredoxin (Katti et al.,
1990) reveals that both the N- and C-termini of
the molecule are accessible on the surface and
in good position to link to other proteins. The
structure also shows that the molecule has a
very tight fold, with >90% of its primary sequence involved in strong elements of secondary structure. This provides an explanation for
thioredoxins observed high thermal stability
(Tm = 85C), and suggests that the molecule
might possess the robust folding characteristics
that could make it a good fusion-partner protein. In support of this view, complete thioredoxin domains are found in a number of naturally occurring multidomain proteins, including E. coli DsbA (Bardwell et al., 1991), the
mammalian endoplasmic reticulum proteins
ERp72 (Mazzarella et al., 1990), and protein
disulfide isomerase (PDI; Edman et al., 1985).
These proteins can all be considered as natural
precedents for thioredoxin fusion proteins.
The synthesis of small peptides in E. coli is
often difficult, with the products frequently
being extensively degraded or insoluble. The
thioredoxin tertiary structure revealed that the
characteristic active site, CGPC, protrudes from the body of the protein as a surface
loop, with few interactions with the rest of the
molecule. The loop does not seem to contribute
to the overall stability of thioredoxin, so the
production of peptides as insertions at this site
was an attractive possibility. In this location
they would be protected from host-cell aminoand carboxypeptidases, and thioredoxins high
solubility should help keep them in solution. In
addition, the conformation of peptides inserted
at this position would be constrained, which
could be an advantage for applications in which

it is desirable for the peptide to adopt a particular form.
Thioredoxin has indeed proven to be an
excellent partner for the production of soluble
fusion proteins in the E. coli cytoplasm (LaVallie et al., 1993b). Figure 6.7.2 demonstrates the
production of soluble fusion proteins between
thioredoxin and eleven human and murine cytokines and growth factors using the trxA vectors. All of these mammalian proteins had been
previously produced in E. coli only as insoluble
inclusion bodies. As thioredoxin fusions, the
growth factors are not only made in a soluble
form, but in most cases they are also biologically active in in vitro assays.
Experience gained while working with these
and a number of other trxA fusion proteins
shows that two further characteristics of thioredoxin can be exploited as purification tools. The
first is the inherent thermal stability of the
molecule, a property that is retained by some
thioredoxin fusion proteins. This enables heat
treatment to be used as an effective purification
step. The second additional property relates to
thioredoxins cellular location. Although E.
coli thioredoxin is a cytoplasmic protein, it has
been shown to occupy a special position within
the cellit is primarily located on the cytoplasmic face of the adhesion zones that exist between the inner and outer membranes of the E.
coli cell envelope (Lunn and Pigiet, 1982).
From this location thioredoxin is quantitatively
released to the exterior of the cell by simple
osmotic shock or freeze/thaw treatments, a remarkable property that is retained by some
thioredoxin fusion proteins, thus providing a
simple purification step.
A more generic method for purification of
any soluble thioredoxin fusion employs a
modified form of thioredoxin (called Hispatch Trx), which has been designed to bind
to metal chelate resins (Lu et al., 1996; UNIT 9.4).
If the fusion protein is soluble after lysis or
osmotic release (see Support Protocols 1 and
2), then any of the conventional purification
methods described in Chapter 8 can be used.
Alternatively, an affinity-based purification
method can be used where an immobilized
arsenical compound forms an adduct with the
redox-sensitive vicinal dithiols present at the
active site of thioredoxin. This affinity matrix
was originally prepared by covalently linking
4-aminophenylarsenine oxide to cyanogen bromideactivated Sepharose 4B (Hannestad et
al., 1982). Hoffman and Lane (1992) coupled
the same ligand to Affi-Gel 10 (Bio-Rad); the
Purification of
Recombinant
Proteins
6.7.11
Supplement 10
10
11
12
MW(kDa)
97.4
66.2
45.0
31.0
21.5
14.4
Figure 6.7.2 Expression of thioredoxin gene fusions. The gel shows proteins found in the soluble
fractions derived from E. coli cells expressing eleven different thioredoxin gene fusions. Lane 1, host
E. coli strain GI724 (negative control, 37C); lane 2, murine interleukin-2 (IL-2; 15C); lane 3, human
IL-3 (15C); lane 4, murine IL-4 (15C); lane 5, murine IL-5 (15C); lane 6, human IL-6 (25C); lane
7, human MIP-1a (37C); lane 8, human IL-11 (37C); lane 9, human macrophage colony-stimulating factor (M-CSF; 37C); lane 10, murine leukemia inhibitory factor (LIF; 25C); lane 11, murine
steel factor (SF; 37C); and lane 12, human bone morphogenetic protein-2 (BMP-2; 25C).
Temperatures in parentheses are the production temperature chosen for expressing each fusion.
This is a 10% SDS-polyacrylamide gel, stained with Coomassie brilliant blue.
Expression and
Purification of
Thioredoxin
Fusion Proteins
resultant affinity matrix has a 10-atom spacer

which makes it more useful for affinity chromatography. The resin is commercially available from Invitrogen (ThioBond) and Sigma.
Protocols detailing the affinity-based purification approach can be obtained on-line from the
I nvitr og en web site (http://www.invitrogen.com/manuals.html), and a recent example
from the literature is the expression of human
glutamate decarboxylase (Papouchado et al.,
1997). Other specific purification approaches
include immunoaffinity chromatography using
antibodies against either the target protein or
against the thioredoxin moiety (monoclonal
antibodies against thioredoxin are commercially available). Thioredoxin fusions with additional histidine tags or thioredoxin fusions
based on mutant thioredoxins with metalchelating affinity (Lu et al., 1996) can be purified using metal-chelate chromatography (see
UNIT 9.4). Finally, if the fusion protein is insoluble, then attempts to solubilize and fold the
fusion protein can be made prior to purification,
in a technique analogous to that used with

insoluble GST fusion proteins (see UNIT 6.6).
Thioredoxin from E. coli is a very soluble
protein that can be readily denatured and refolded (Kelley et al., 1987).
Critical Parameters
Lack of protein solubility leading to inclusion-body formation in E. coli is a complex
phenomenon with many contributing factors:
simple insolubility as a result of high-level
expression, insolubility of protein-folding intermediates, lack of appropriate bacterial
chaperone proteins, and lack of glycosylation
mechanisms in the bacterial cytoplasm. Fusion
of heterologous proteins to thioredoxin or to
other fusion partners can help address most of
these solubility issues. However, another important factor contributing to inclusion body
formation is the inability to form essential disulfide bonds in the reducing environment of
the bacterial cytoplasm, which leads to incorrect folding. Thermal lability of even correctly
6.7.12
Supplement 10
folded heterologous proteins in the absence of

these stabilizing disulfide cross-links is a significant problem, so the expression of fusion
genes should be attempted over a wide range
of temperatures, even as low as 15C (the limit
for E. coli growth is 8C). Thermal denaturation is a time-dependent process, so it is also
prudent to monitor the solubility of the expressed fusion protein over the time course of
induction.
A great many proteins contain distinct structural domains. For example, hormone receptor
proteins usually have an extracellular ligandbinding domain, a transmembrane region, and
an intracellular effector domain. Sometimes,
expressing these domains individually as fusion proteins can yield better results than expressing the entire protein. The exact positions
chosen for boundaries of the domains to be
expressed in the fusion protein are important
and can be determined from a knowledge of the
tertiary structure of the protein of interest, by
homology comparisons with similar proteins,
by limited proteolysis or other domain-mapping experiments, or empirically by generating
multiple fusions that test different boundary
positions.
It is important to be consistent in treating
samples for loading on gels. For example, using
different heating conditions from one experiment to the next can result in a mobility shift
for the protein of interest.
Anticipated Results
Thioredoxin fusion protein yields are usually in the range of 5% to 20% of total cell
protein. At these expression levels, a 1-liter
induction culture in a shaker flask will yield
3 g (wet weight) of cells, 300 mg total protein,
and 15 to 60 mg of thioredoxin fusion protein.
The final recovered yield will depend on factors
such as solubility of the fusion protein and the
efficiency of downstream purification procedures.
Time Considerations
From a single colony on a plate, the basic
induction protocol requires an overnight
growth to prepare a liquid inoculum and a
3.5-hr preinduction growth at 30C the next
day, followed by a 4-hr 37C induction period.
These times are significantly longer if lower
induction temperatures are required (see Table
6.7.1). Lysis of a sample in the French pressure
cell should require 5 min, and both the heattreatment and osmotic-shock procedures require <1 hr each. SDS-PAGE takes 2.5 hr.
Literature Cited
Bardwell, J.C.A., McGovern, K., and Beckwith, J.
1991. Identification of a protein required for
disulfide bond formation in vivo. Cell 67:581589.
Edman, J.C., Ellis, L., Blacher, R.W., Roth, R.A.,
and Rutter, W.J. 1985. Sequence of protein disulphide isomerase and implications of its relationship to thioredoxin. Nature 317:267-270.
Hannestad, U., Lundqvist, P., and Sorbo, B. 1982.
An agarose derivative containing an arsenical for
affinity chromatography of thiol compounds.
Anal. Biochem. 126:200-204.
Hoffman, R.D. and Lane, M.D. 1992. Isodophenylarsine oxide and arsenical affinity chromatography: New probes for dithiol proteins. J. Biol.
Chem. 267:14005-14011.
Holmgren, A. 1985. Thioredoxin. Ann. Rev. Biochem. 54:237-271.
Katti, S.K., LeMaster, D.M., and Eklund, H. 1990.
Crystal structure of thioredoxin from Escherichia coli at 1.68 angstroms resolution. J.
Mol. Biol. 212:167-184.
Kelley, R.F., Shalongo, M., Jagannadham, M.V., and
Stellwagen, E. 1987. Equilibrium and kinetic
measurements of the conformational transition
of reduced thioredoxin. Biochemistry 26:14061411.
LaVallie, E.R., Rehemtulla, A., Racie, L.A.,
DiBlasio, E.A., Ferenz, C., Grant, K.L., Light,
A., and McCoy, J.M. 1993a. Cloning and functional expression of a cDNA encoding the catalytic subunit of bovine enterokinase. J. Biol.
Chem. 268:23311-23317.
LaVallie, E.R., DiBlasio, E.A., Kovacic, S., Grant,
K.L., Schendel, P.F., and McCoy, J.M. 1993b. A
thioredoxin gene fusion expression system that
circumvents inclusion body formation in the E.
coli cytoplasm. Bio/Technology 11:187-193.
Lu, Z., DiBlasio-Smith, E.A., Grant, K.L., Warne,
N.W., LaVallie, E.R., Collins-Racie, L.A.,
Follettie, M.T., Williamson, M.J., and McCoy,
J.M. 1996. Histidine patch thioredoxins. Mutant
forms of thioredoxin with metal chelating affinity that provide for convenient purifications of
thioredoxin fusion proteins. J. Biol. Chem.
271:5059-5065.
Lunn, C.A. and Pigiet, V.P. 1982. Localization of
thioredoxin from Escherichia coli in an osmotically sensitive compartment. J. Biol. Chem.
257:11424-11430.
Mazzarella, R.A., Srinivasan, M., Haugejorden,
S.M., and Green, M. 1990. ERp72, an abundant
luminal endoplasmic reticulum protein, contains
three copies of the active site sequences of protein disulfide isomerase. J. Biol. Chem.
265:1094-1101.
McCoy, J.M. 1992. Heat-shock proteins and their
potential uses for pharmaceutical protein production in microorganisms. In Stability of Protein Pharmaceuticals, Part B. (T. Ahern and M.
Manning, eds.) pp 287-316. Plenum Press, New
York.
Purification of
Recombinant
Proteins
6.7.13
Supplement 10
Mieschendahl, M., Petri, T., and Hanggi, U. 1986.

A novel prophage independent trp regulated
lambda pL expression system. Bio/Technology
4:802-808.
Shinde, U., Chatterjee, S., and Inouye, M. 1993.

Folding pathway mediated by an intramolecular
chaperone. Proc. Natl. Acad. Sci. U.S.A.
90:6924-6928.
Mitraki, A. and King, J. 1989. Protein folding intermediates and inclusion body formation.
Bio/Technology 7:690-697.
Silen, J.L., Frank, D., Fujishige, A., Bone, R., and

Agard, D.A. 1989. Analysis of prepro--lytic
protease expression in Escherichia coli reveals
that the pro region is required for activity. J.
Bacteriol. 171:1320-1325.
Norrander, J., Kempe, T., and Messing, J. 1983.

Construction of improved M13 vectors using
oligonucleotide-directed mutagenesis. Gene
26:101-106.
Stormo, G.D., Schneider, T.D., and Gold, L. 1982.

Characterization of translation initiation sites in
E. coli. Nucl. Acids Res. 10:2971-2996.
Papouchado, M.L., Valdez, S.N., Ghiringhelli, D.,

Poskus, E., and Ermacora, M.R. 1997. Expression of properly folded human glutamate decarboxylase 65 as a fusion protein in Escherichia
coli. Eur. J. Biochem. 246:350-359.
Key Reference
Riggs, P. 1994. Expression and purification of maltose-binding protein fusions. In Current Protocols in Molecular Biology (F.M. Ausubel, R.
Brent, R.F. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp.16.6.116.6.14. John Wiley & Sons, New York.
A source of protocols for cloning and analyzing

DNA.
Shatzman, A.R., Gross, M.S., and Rosenberg, M.

1990. Expression using vectors with phage
regulatory sequences. In Current Protocols in
Molecular Biology (F.M. Ausubel, R. Brent, R.F.
Kingston, D.D. Moore, J.G. Seidman, J.A.
Smith, and K. Struhl, eds.) pp. 16.3.1-16.3.11.
John Wiley & Sons, New York.
Shimatake, H. and Rosenberg, M. 1981. Purified
regulatory protein cII positively activates promoters for lysogenic development. Nature
292:128-132.
Ausubel, F.M., Brent, R., Kingston, R.F., Moore,

D.D., Seidman, J.G., Smith, J.A., and Struhl, K.
(eds.) 1997. Current Protocols in Molecular Biology. John Wiley & Sons, New York.
Internet Resources
http://www.invitrogen.com/manuals.html
Source for protocols on affinity-based purification.
Contributed by John McCoy

and Edward LaVallie
Genetics Institute
Cambridge, Massachusetts
Expression and
Purification of
Thioredoxin
Fusion Proteins
6.7.14
Supplement 10

Prot Sci CH 6

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Prot Sci CH 6

Uploaded by

Copyright:

Available Formats

CHAPTER 6

Purification of Recombinant Proteins

he principle aim of protein overexpression using the various systems described in

Current Protocols in Protein Science

naturing) concentration. Oxidation of the two disulfide bonds is enhanced by inclusion

Current Protocols in Protein Science

Overview of the Purification of Recombinant

Current Protocols in Protein Science

Current Protocols in Protein Science

Protein Expression in Escherichia coli

N-terminal Met may be

Protein folding must be

See comments for native insoluble

See comments for native

Expression level and

Protein folding must be

Current Protocols in Protein Science

centrifuge 30 min at 10,000 x g

centrifuge 30 min at 10,000 x g

wash in isotonic medium with Mg 2+

digest with lysozyme (200 g/ ml)

suspend in hypertonic medium

a protein purification viewpoint, the main advantage of affinity-tagged proteins is realized

Current Protocols in Protein Science

conduct ion exchange (1)

conduct ion exchange (2)

Current Protocols in Protein Science

Current Protocols in Protein Science

low-speed washed pellet

purify protein with

fold and oxidize proteins

conduct gel filtration

break lysozymetreated cells with

centrifuge 30 min at 10,000 x g

centrifuge 30 min at 10,000 x g

Preparing for Repeat Ion-Exchange Step

Current Protocols in Protein Science

Current Protocols in Protein Science

Current Protocols in Protein Science

Because E. coli lacks glycosylation machinery, expression of glycoproteins in E. coli

Current Protocols in Protein Science

Current Protocols in Protein Science

Current Protocols in Protein Science

Current Protocols in Protein Science

If a Coomassie bluestained band corresponding to the expressed protein is observed on

deletion, and insertion of residues allow a structure-function hypothesis to be tested and

Current Protocols in Protein Science

Determining optimal crystallization conditions may require as little as a few milligrams

Current Protocols in Protein Science

Current Protocols in Protein Science

Current Protocols in Protein Science

Sottrup-Jensen, L. 1989. Alpha-macroglobulins: Structure, shape, and mechanism of proteinase complex

Current Protocols in Protein Science

Contributed by Paul T. Wingfield

Preparation of Soluble Proteins from

Bovine pancreas DNase I and RNase A (Worthington; optional, for reducing

Outline of Interleukin Purificationa

Steps (low pressure)

Preparation of DEAE Sepharose column

Fast Flow (substitute for CM

Concentration (step 23a or 23b)

SDS-PAGE of Superdex 75 fractions