[CANCER RESEARCH 59, 3730 3740, August 1, 1999]

Concurrent DNA Hypermethylation of Multiple Genes in Acute Myeloid Leukemia

John R. Melki,1 Paul C. Vincent, and Susan J. Clark2
Kanematsu Laboratories, Royal Prince Alfred Hospital, Camperdown, New South Wales 2050, Australia [J. R. M., P. C. V., S. J. C.]; Faculty of Medicine, University of Sydney,
New South Wales 2006, Australia [J. R. M., P. C. V., S. J. C.]; and CSIRO, Molecular Science, Sydney Laboratory, P. O. Box 184, North Ryde, New South Wales 1670, Australia
[S. J. C.]

ABSTRACT
Hypermethylation in cancer often occurs in CpG islands that span the
promoter regions of tumor suppressor genes. However, it is not clear if
hypermethylation is limited to single target genes or if multiple genes are
simultaneously methylated. To understand the extent of aberrant de novo
methylation, we have analyzed the methylation pattern of a number of
tumor-related genes in leukemia from the same cohort of patients. We
used bisulfite genomic sequencing to characterize the methylation pattern
of the CpG islands associated with the calcitonin, estrogen receptor, Ecadherin, p15, p16, Rb, GST-Pi, and HIC1 genes in the bone marrow from
9 normal and 20 patients with acute myeloid leukaemia (AML). All of the
normal control samples were essentially unmethylated for each of the
eight tumor-related genes studied. In contrast, 19 of 20 (95%) of the AML
patients had an abnormal methylation pattern in at least one gene, and 15
of 20 (75%) had abnormal methylation patterns in two or more of the
target genes. We conclude that there is a general deregulation of CpG
island methylation in leukemia and that hypermethylation is not limited to
single genes, but a number of genes are methylated concurrently. Moreover, the subset of genes that are commonly methylated in leukemia
appear to be cancer type specific.

INTRODUCTION
Methylation patterns are established in a tissue-specific manner
early in mammalian development, mediated by a combination of
demethylation and de novo methylation of cytosine residues primarily
at CpG dinucleotides (reviewed in Ref. 1). The methylation pattern is
maintained through subsequent cell divisions by the action of a DNA
MTase3 enzyme (2). DNA methylation patterns are often altered in
cancer cells, with associated increases in the level of the DNA MTase
enzyme (3 6), widespread genomic hypomethylation, and simultaneous regional increases in DNA methylation patterns (7, 8) having been
reported. Aberrant hypermethylation in cancer cells often occurs in
the CpG-rich promoter regions (CpG islands) of many tumor suppressor genes and is associated with gene inactivation (reviewed in Ref.
9). Approximately half of the mammalian genes have CpG-rich promoter regions, and although most CpG dinucleotides are methylated
in the normal cell, the CpG dinucleotides of CpG islands are essentially unmethylated in all tissues (10). What protects CpG islands from
methylation, or moreover, what triggers hypermethylation in the cancer cell is unknown.
To understand further the process of aberrant hypermethylation in
cancer, we have chosen to study DNA methylation patterns in leukemia. We have demonstrated previously that the levels of DNA MTase
in leukemia are elevated 4 5-fold (6). In addition, DNA methylation
patterns are known to be altered in leukemia; a generalized hypomethylation has been reported for B-cell chronic lymphocytic leuke-

mia (11), as well as specific regions of hypomethylation such as in the

Bcl-2 oncogene (12), and tumor necrosis factor a and b genes (13). In
contrast, hypermethylation of the calcitonin gene has been observed in
acute and chronic leukemias and lymphomas (14, 15) and in patients
with myelodysplastic syndrome (16, 17). Hypermethylation is also
seen in the cyclin-dependent kinase inhibitor gene p15 in patients with
acute leukemias (18, 19). The ER gene is hypermethylated in acute
and chronic leukaemias, as well as in lymphomas (20). The HIC1
gene also has been reported to be frequently methylated in acute
lymphoblastic leukemia but infrequently methylated in AMLs. Therefore, there is mounting evidence that a number of individual genes can
be abnormally methylated in leukemia. However, most of the previous
studies were performed in separate patient groups by restriction enzyme analysis, and consequently, the methylation data are limited to
a few CpG sites in individual genes. Hence, the extent of hypermethylation measured previously in leukemia may not have been
representative.
The mechanism responsible for abnormal methylation in cancer is
unclear. In this study, we address whether aberrant methylation is
limited to single target genes that provide the cell with a growth
advantage, similar to a random mutation, or whether multiple genes
are susceptible to hypermethylation in the same cell, thereby implying
a general deregulation of CpG island methylation in cancer. We have
used sodium bisulfite genomic sequencing (2123) to re-examine in
more detail the patterns of aberrant de novo methylation in leukemia
from the same patient cohort. In comparison to Southern analysis or
MSP (24), bisulfite sequencing permits analysis of every cytosine in
the CpG-rich promoter regions of each target gene. In particular, we
address whether critical CpG sites are commonly hypermethylated
and whether CpG island methylation is confined to a single locus or
multiple loci in the one cohort of patients.
MATERIALS AND METHODS

Tissue Samples. Bone marrow samples were aspirated from 20 patients

presenting with AML. The patients (11 males and 9 females) were between 22
and 88 years of age, with a median age of 53 years. The proportion of marrow
blasts was .70% in all cases. The bone marrow used as a normal control was
aspirated from the sternal cavity from nine patients who were undergoing
cardiac surgery and who had given prior informed consent. The patients (seven
males and two females) were between 19 and 74 years of age, with a median
age of 61 years, and no evidence of leukemia. The study was approved by
the Ethics Committee of Royal Prince Alfred Hospital (protocol number
X93-0073).
Methylation Analysis. DNA was isolated using TriZOL Reagent (Life
Technologies, Inc.) from bone marrow cells that had been lysed in hypotonic
lysis buffer. Bisulfite genomic sequencing was used to analyze the methylation
patterns. The bisulfite reaction was carried out for 16 h at 55C on 12 mg of
Received 1/25/99; accepted 6/2/99.
HindIII-digested patient DNA, under conditions described by Clark et al. (22).
The costs of publication of this article were defrayed in part by the payment of page
After bisulfite conversion, the DNA was ethanol precipitated, dried, resuscharges. This article must therefore be hereby marked advertisement in accordance with
pended in 100 ml of TE buffer [10 mM Tris-HCl (pH 8) and 1 mM EDTA] and
18 U.S.C. Section 1734 solely to indicate this fact.
1
stored at 220C. The primers used for amplification of sodium bisulfiteJ. R. M. is the recipient of the Anthony Rothe Memorial Trust postgraduate scholconverted DNA are summarized in Table 1. Where direct sequencing was to be
arship.
2
To whom requests for reprints should be addressed, at CSIRO, Molecular Science,
performed, the (221)M13 universal primer sequence was incorporated into the
Sydney Laboratory, P. O. Box 184, North Ryde, New South Wales 1670, Australia.
59 end of inner primer 2. Nested PCR amplifications were performed on 13
Phone: (612) 94905148; Fax: (612) 94905005; E-mail: susan.clark@molsci.csiro.au.
3
ml of bisulfite-treated genomic DNA in a reaction mix containing 200 mM of
The abbreviations used are: MTase, methyltransferase; ER, estrogen receptor; AML,
each of the four deoxynucleotide triphosphates and 2 units of AmpliTaq DNA
acute myeloblastic leukemia; MSP, methylation-specific PCR.
3730

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

Table 1 Summary of PCR amplification conditions

Gene
(acc. no.)a
Calcitonin
(X15943)

ER
(X62462)

E-Cadherin
(L34545)

p15
(S75756)

p16
(U12818)

Rb
(L11910)

GST-pi
(M24485)

HIC-1
Central region
(L41919)
HIC-1
59 region
(L41919)

Primer (coordinates)

Sequence

Outer1 (18401860)
Outer2 (21972219)
Inner1M13 (18691879)
Inner2 (21692194)
Outer1 (30123036)
Outer2 (32813308)
Inner1M13 (30413063)
Inner2 (32813308)
Outer1 (791820)
Outer2 (11391165)
Inner1M13 (841858)
Inner2 (11391165)
Outer1 (5992)
Outer2 (633607)
Inner1M13 (87105)
Inner2 (564533)
Outer1 (833)
Outer2 (311336)
Inner1M13 (1433)
Inner2 (250273)
Outer1 (16491677)
Outer2 (20572078)
Inner1 (17441774)
Inner2 (20072033)
Outer1 (967993)
Outer2 (13071332)
Inner1 (9991027)
Inner2 (12811306)
Outer1 (12911319)
Outer2 (19071935)
Inner1M13 (14551477)
Inner2 (17601786)
Outer1 (163187)
Outer2 (663693)
Inner1M13 (237260)
Inner2 (663693)

GGTATTAGAGATATTGTTTAGTTTAAGTGT
ATCCCTAAAAAACCTAAATATCC
TGTAAAACGACGGCCAGTTTTTTATAGGGTTTTGGTTG
AAACTAACCTAAACCTATATACAATA
GATTTTTTATATTAAAGTATTTGGG
CTATTAAATAAAAAAAAACCCCCCAAAC
TGTAAAACGACGGCCAGTTTTATTGTATTAGATTTAAGGG
CTATTAAATAAAAAAAAACCCCCCAAAC
ATTTAGTGGAATTAGAATAGTGTAGGTTTT
CTACAACTCCAAAAACCCATAACTAAC
TGTAAAACGACGGCCAGTTTAGTAATTTTAGGTTAGAGGG
CTACAACTCCAAAAACCCATAACTAAC
GTTTTTTGGTTTAGTTGAAAAGGGAATTTTTTGT
AACCCTAAAACCCCAACTACCTAAATC
TGTAAAACGACGGCCAGTTTTTGTGGGTTGGTTTTTT
ACTTCCAAAAACTATCCCACCTTCTCCACTAA
GAGGAGGGGTTGGTTGGTTATTAGAG
TACCTAATTCCAATTCCCCTACAAAC
TGTAAAACGACGGCCAGTGGGTTGGTTGGTTATTAGAG
CTACAAACCCTCTACCCACCTAAA
TGTATTTAGGTTTGGAGGGGGTGGTTTTG
AAAAATTTTAAACCACATAAC
TTAGGTTTTTTAGTTTAATTTTTTATGAT
AACTATAAAAAAACCCCAAAAAAAAC
TTTGTTGTTTGTTTATTTTTTAGGTTT
AACCTAATACTACCAATTAACCCCAT
GGGATTTGGGAAAGAGGGAAAGGTTTTTT
ACTAAAAACTCTAAAAACCCCATCCC
TTTTTTGTGGTTTGGATTTGTTTAAGAAG
CAACTACTCAAAACTAAAAAAACCCTTAC
TGTAAAACGACGGCCAGTTTTTTTAGAAGTTGGAGGAGGT
ATCTCCTCACTACTACTCTTATAATCA
TATTTTTTTTAATTGGGGTAATTTT
ATTAAACTACAACAACAACTACCTAAAATAA
TGTAAAACGACGGCCAGTAAAGTTTTTTGTTTTGAATGAT
ATTAAACTACAACAACAACTACCTAAAATAA

MgCl2 (mM)

a1/a2b (C)

Volume (ml)

1.5

50/50

25

1.5

50/50

25

1.5

50/50

25

1.5

50/50

25

2.0

55/55

25

2.0

55/55

25

1.5

50/50

50

1.5

50/50

50

1.0

50/55

50

1.0

55/60

50

1.5

45/50

25

1.5

50/50

25

1.5

45/50

25

1.5

45/50

25

1.5

50/55

25

1.5

50/55

25

1.5

45/50

50

1.5

50/55

50

acc. no., accession number of each gene.

b
a1 and a2, annealing temperatures used in the PCR.

polymerase (Perkin-Elmer). The reactions were performed in either 25 ml of

reaction mixtures containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), and 100
ng of each primer or in 50-ml reactions containing 67 mM Tris, 16.6 mM
ammonium sulfate, 1.7 mg/ml BSA, and 10 mM b-mercaptoethanol in TE
buffer and 300 ng of each primer. The volume of the PCR for each gene is as
noted in Table 1. Reactions were cycled in a Hybaid DNA Thermal Cycler
with variable MgCl2 concentrations as detailed in Table 1. The standard PCR
reaction was performed by the following cycling conditions: 96C/3 min for 1
cycle; 95C/1 min, a1C/2 min, 72C/3 min, for 5 cycles; 95C/1 min, a2C/2
min, 72C/2 min, for 23 cycles; and 72C/4 min for 1 cycle, where a1 and a2
are annealing temperatures 1 and 2, respectively, described in Table 1. All of
the primers used were shown to amplify methylated and unmethylated DNA
without major bias under these PCR conditions (25).
Direct Sequencing. For automated direct sequencing, the PCR products
were amplified using the internal forward primer that included the (221)M13
universal primer sequence. Direct PCR sequencing reactions were performed
using a PRISM Dye Primer Cycle sequencing kit (221 M13 Fwd) with
AmpliTaq FS (Perkin-Elmer) on an automated 373A DNA Sequencer (ABI).
Sequencing reactions were performed as recommended by the manufacturer.
The amount of methylcytosine of each CpG dinucleotide was quantitated by
comparing the peak height of the cytosine signal with the peak height of the
cytosine plus thymine signal. When using direct sequencing, it is often difficult
to assess methylation levels ,15% due to the variable sequencing background
signal.

RESULTS
We have used bisulfite genomic sequencing to characterize the
overall methylation profile of the CpG islands associated with calcitonin, ER, E-cadherin, p15, p16, Rb, GST-pi, and HIC1 in the bone
marrow of patients with AML. We have shown previously that the
expression of DNA MTase was increased in a number of the AML

patients analyzed in this study (6). Twenty patients with de novo

AML, spanning ages 22 88 years, and nine normal controls, spanning
ages 19 74 years, were assayed. The bone marrow from the AML
patients contained .70% blast cells. Therefore, due to the low amount
of normal cell contamination, the methylation levels that are presented
represent minimal values. The genes that we sequenced were selected
on the basis of being hypermethylated either in leukemia or other
cancers or on the basis on our preliminary Southern analysis data that
indicated the genes were hypermethylated in the AML samples (data
not shown). We chose to analyze the methylation data by direct PCR
sequencing because this provides a semiquantitative estimate of the
methylation levels in the sample, and individual CpG sites could be
assessed in the one reaction. A summary of the genomic sequencing
results for each of the eight individual genes analyzed is presented
below, followed by an overall summary of the methylation state of the
genes for each patient.
Calcitonin Gene. It has been well established that the calcitonin
gene, which lies on chromosome 11p15.2, is a hot spot for methylation in leukemia. The CpG rich 59 region of the calcitonin gene was
found previously to be methylated in 78 95% of acute leukemias by
Southern analysis (16, 26) or genomic sequencing (27). To correlate
the methylation profile of the calcitonin gene in AML with the
methylation profile of the other target genes, we used bisulfite
genomic sequencing. Fig. 1 shows the sequence map of the 19 CpG
sites in the central CpG rich island close to the transcription start site
that were sequenced. There was a low level (,25%) of methylation at
one to two CpG sites in approximately half the normal bone marrow
samples, and these methylated sites were localized downstream to the
start of transcription. In contrast, 12 of 17 (71%) of the AML patients

3731

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

Fig. 1. Methylation map of the calcitonin gene. A, CpG plot across the calcitonin gene. The black boxes show coding regions within the gene. The arrow shows the start of
transcription. B, DNA sequence analyzed by bisulfite genomic sequencing from bases 18912168 (accession number X15943). CpG dinucleotides are in bold and numbered below each
site. The HpaII site is underlined. C, methylation maps derived from direct PCR sequence analysis for normal and leukemic samples. The sample number is in the left column, and
, up to 25% methylation; o, 26 50% methylation; s, 5175% methylation; f, 76 100% methylation; M, no methylation; , the
the CpG sites are numbered across the top row.
methylation at that site was not determined due to enzyme stoppage in the sequence.

had substantial methylation across the entire CpG-rich region. However, the methylation patterns in the AML samples was heterogeneous, varying from extensive methylation at high levels (e.g., R76 and
R86) to low level methylation at four to six CpG sites (e.g., R94 and
R125). The remaining AML patients (5 of 17, 29%) displayed methylation profiles similar to the normal patterns (e.g., R63 and R79).
There does not appear to be any critical sites that are exclusively
methylated in each patient; however, the region encompassing CpG
sites 1 6, which are the sites closest to the transcription start site,
were found to be the most heavily methylated (50 100%). Of the 19
CpG sites studied, only one site (CpG 15) encompassed an informative site for Southern analysis (HpaII site). However, this site was
only methylated in 5 of 17 (29%) of the samples, 1 of which (R63) had
a normal methylation profile. Therefore, using bisulfite sequencing
enabled a more detailed and informative description of the methylation profile of the calcitonin gene.
ER Gene. The ER gene, located on chromosome 6q25.1, has been
shown by Southern blot analysis to be methylated in 50 90% of acute
and chronic leukemias (20). This study assayed the methylation state
of a single NotI site within the first exon of the gene. To determine the
extent of hypermethylation at other CpG sites, we have used bisulfite
genomic sequencing to measure the methylation status of 22 CpG
sites in the CpG-rich promoter region (Fig. 2). We found no evidence

of methylation in this region of the ER in any of the normal bone

marrow samples analyzed. In comparison, we found a low level of
methylation spanning the 22 CpG sites in the bone marrow cells of 6
of 11 (54%) patients with AML. The methylation profile was heterogeneous, but CpG sites from 15 to 20 were most commonly methylated. The methylation state of CpG sites 14 and 15, which incorporate the NotI site used for Southern analysis, therefore, is indicative
of the methylation profile across the region. Interestingly, in comparison to the calcitonin methylation profile, the methylation level for
each CpG in the ER gene was ,50%, possibly indicating hypermethylation of only one allele.
E-Cadherin Gene. The E-cadherin gene, located on chromosome
16q22.1, has not previously had its methylation status determined in
leukemia. However, hypermethylation has been reported in carcinoma
cell lines, including prostate and breast, by Southern analysis (28, 29)
and MSP (30). Moreover, hypermethylation of this region was shown
to correlate with lack of expression (28, 30). In this study, we
sequenced 29 CpG sites that are located in the CpG-rich promoter and
part of exon 1 (Fig. 3). All of the normal bone marrow samples, except
for N34, displayed no methylation in this region. N34 had 5 of 29
CpG sites methylated at a low level (,25%). In contrast, 9 of 13
(69%) bone marrow samples from patients with AML displayed
extensive methylation of the E-cadherin promoter region (Fig. 3).

3732

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

Fig. 2. Methylation map of the ER gene. A, CpG plot of the 59 flanking region. The black box shows the start of the coding region, and the arrow shows the start of transcription.
B, sequence of the CpG island that was analyzed from bases 3066 3250 (accession number X62462). CpG dinucleotides are in bold and numbered below each site. The HpaII site
is underlined in bold, and the NotI site is shown by a dotted line above the sequence. C, methylation maps derived from direct PCR sequencing analysis for normal and leukemic samples.
Symbols are the same as Fig. 1.

Again, the methylation patterns were found to be heterogeneous,

ranging from no detectable methylation (R74 and R75) to patients
methylated in each determinable CpG site (R76 and R99). Although
the methylation patterns are heterogeneous, the degree of methylation
is higher in the 39 region (50 100%).
p15 and p16. p15 and p16 are cyclin-dependent kinase inhibitors
proximate to each other on chromosome 9p21. Southern blot analysis
and MSP have found p15 to be inactivated through hypermethylation
of its associated CpG island in 50 80% of patients with acute leukaemia (18). Interestingly, this aberrant hypermethylation was found
to be limited to p15 and was found not to extend to p16.
To enable a more complete analysis of these genes, we determined
the methylation status of 47 CpG sites that encompass the transcription start site and exon 1 of p15 (Fig. 4). This sequence also includes
the region where hypermethylation has been associated with transcriptional silencing (31). We found in some of the normal bone marrow
samples a low level of methylation (,25%) at one to five CpG sites
downstream to the start of transcription. In comparison, we found
hypermethylation of the p15 gene in 13 of 19 (68%) of AML patients
studied. Again, the methylation patterns are heterogeneous, ranging
from no methylation (R79 and R94) to sparse methylation (R59 and
R60) and to methylation encompassing the entire region (R38 and
R102). In general, methylation spanned the entire region analyzed but
was highly mosaic in the individual patients. A similar finding of

variegation in the methylation profile of p15 was also found in AML

by Dodge et al. (19). As for calcitonin, the level of methylation was
often high (75100%) at individual CpG sites, indicating that either
both alleles were methylated or that one allele was heavily methylated
and the other lost.
For the p16 gene, we analyzed 28 CpG sites in a region spanning
the promoter and exon 1 (Fig. 5). Methylation in this region has been
correlated to transcriptional silencing (3234). We found a low level
(,25%) of methylation at one to five CpG sites in three normal
samples. In comparison, we found 6 of 20 (30%) patients with AML
had an equally low level of methylation (,25,50%) at individual
CpG sites, but methylation was found to be more extensive, spanning
714 CpG sites across the region analyzed. Methylation was heterogeneous, and there were no particular CpG sites that were more
commonly methylated. Methylation of the p16 gene has not been
reported before in leukemia. However, it should be noted that Southern analysis would not have detected the low number of individual
sites that are methylated, and MSP analysis may not have detected
methylation because the methylation profile was quite heterogeneous.
It is not clear whether this small amount of p16 promoter methylation
is linked to transcriptional silencing, but the methylation pattern is
clearly different in the leukemic cells versus the normal bone marrow
cells.

3733

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

Fig. 3. Methylation map of the E-cadherin gene. A, CpG plot of the 59 flanking region. The black box shows exon 1. B, sequence of the CpG island that was analyzed from bases
863-1138 (accession number L34545). CpG dinucleotides are in bold and numbered below each site. The HpaII sites are underlined. C, methylation maps derived from direct PCR
sequencing analysis for normal and leukemic samples. Symbols are the same as Fig. 1.

HIC1 Gene. The HIC1 gene located on chromosome 17p13.3 is

unusual in that the entire gene is contained in a CpG-rich region.
Previous methylation studies have shown that hypermethylation of
the five NotI sites spanning the gene are linked with HIC1 gene
silencing in neoplastic cells (35). A number of leukemia subtypes
have also been shown to display HIC1 hypermethylation, including
10% of patients with AML at presentation (36). To determine
whether the HIC1 gene was in fact more extensively methylated
in AML, which is not assessable by NotI digestion, we measured
the methylation pattern of 45 CpG sites by bisulfite genomic
sequencing in a region within the central CpG-rich region of the
gene spanning intron 2 and exon 3 (Fig. 6). The region sequenced
was chosen because it contained no NotI sites and was central to
the HIC1 CpG island. We found significant methylation of the
HIC1 gene in all of the normal and AML DNA samples sequenced.
Heterogeneity in the methylation patterns was found in all samples;
however, in contrast to the AML methylation profile, we found
that methylation in the normal cells was limited to exon 3 and was
not detected in intron 2. Interestingly, hypermethylation was
observed in 10 of 12 (83%) AML samples in both intron 2 and
exon 3. Therefore, methylation of intron 2 appears to be specific to
the leukemic cells. As with the methylation profile of the other
genes analyzed, we found that the methylation patterns in the
intron 2 sequence varied significantly among AML patients, with
some patients having no detectable methylation (R99) and some

patients being methylated in each determinable methylation site

(R36).
Rb and GST-Pi Genes. The Rb gene is located on chromosome
13q14 and is commonly hypermethylated in retinoblastoma tumors
(37, 38), and the GST-Pi gene located on chromosome 11q13 is
commonly methylated in prostate and breast tumors (39 41). The
methylation pattern for both of these genes has not been studied in
detail before in leukemia. To determine whether either Rb or GST-Pi
is methylated in our set of AML samples, we assayed for methylation
of the promoter region using bisulfite analysis. The 59 region of the Rb
gene containing 27 CpG sites (38) was amplified after sodium bisulfite conversion and sequenced by direct PCR sequencing. No methylation was detected at any of the 27 CpG sites for the normal or the
bone marrow samples from the 13 AML patients tested (data not
shown). The 59 region of the GST-Pi gene, containing 38 CpG sites
(39), was amplified following sodium bisulfite conversion and methylation tested by BstU I digestion. There was no methylation evident
at any of the 6 BstU I sites within the promoter sequence in the normal
or in the bone marrow samples from 12 AML patients tested (data not
shown). Lack of methylation of the 59 CpG region of GST-Pi was also
confirmed by methylation-sensitive PCR (data not shown). Therefore,
unlike the other target genes we studied that we found were frequently
methylated in AML, the CpG islands spanning Rb and GST-Pi appear
to be protected from hypermethylation in AML, although they are
predominantly methylated in other specific cancer types.

3734

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

Fig. 4. Methylation map of the p15 gene. A, CpG plot of the 59 region. The black box shows the start of the coding sequence, and the arrow shows the start of transcription. B,
sequence of the CpG island that was analyzed from bases 118 528 (accession number S75756). CpG dinucleotides are in bold and numbered below each site. The HpaII sites are
underlined, and the NotI site is shown by a dotted line above the sequence. C, methylation maps derived from direct PCR sequencing analysis for normal and leukemic samples. Symbols
are the same as Fig. 1.

Concurrent Hypermethylation. By studying the methylation profile of a number of target genes from the same cohort of patients, we
have been able to assess whether hypermethylation is limited to single
target genes or whether multiple genes are susceptible to hypermethylation in the one cell. Fig. 7A summarizes the methylation patterns
for the eight target genes studied in the normal and AML bone
marrow samples. To aid in the interpretation of the results, we scored
the gene as significantly methylated only if the samples were methylated at any one CpG site at levels .25% or if the samples were
methylated in at least 25% of determinable sites. It is clear that except
for methylation in the calcitonin gene that was found in one normal
sample (N47) and HIC1 which showed differential methylation in
exon 2, the rest of the genes studied from normal bone marrow
samples were essentially unmethylated in the CpG-rich island regions
analyzed. In contrast, the methylation profile in the AML patients was
extensive. Moreover, hypermethylation was not limited to a single
target gene but often was found in multiple genes in each patient
studied. In fact, 15 of 20 (75%) AML patients displayed concordant
methylation in at least two genes. Interestingly, the subset of genes
methylated varied in each patient. For example, in R128, only p15 was
methylated; in R103, p15 and ER were both methylated; and in R14,
p15 and calcitonin were both methylated. There are also patients with
multiple genes methylated; for example in R36, calcitonin, E-cad-

herin, p15, p16, and HIC1 were methylated, and in R38, all of the
genes tested were methylated except for GST-Pi and Rb. In fact,
GST-Pi and Rb were not methylated in any of the AML samples
tested. Fig. 7B shows that .50% of the patients were methylated in
the calcitonin, E-cadherin, ER, p15, and HIC1 genes, and .80% of
the patients were methylated in HIC1. However, it is of interest to
note that no single gene was always methylated.
To determine whether there is a correlation between methylation
profiles and DNA methyltransferase levels, we compared the methylation patterns from eight patients to the expression of DNA MTase
as measured by competitive reverse transcription-PCR (6). We previously have shown that DNA MTase is increased 2.510-fold in
AML, but there appears to be no apparent correlation between DNA
MTase expression and the number of target genes methylated (Fig.
7A). For example, in patient, R99 DNA MTase levels were found to
be 10.1-fold higher than the average normal DNA MTase levels, and
three genes were found to be hypermethylated, whereas six genes
were hypermethylated in patient R38 that had a 5.6-fold increase in
DNA MTase levels. In addition, there appears to be no apparent
correlation between the number of genes methylated and the age or
sex of the patient. Our results obtained in leukemia cells suggest that
aberrant methylation in malignancy is due to a general deregulation of
the methylation machinery in the cell rather than a specific targeting

3735

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

Fig. 5. Methylation map of the p16 gene. A, CpG plot of the 59 region. The black box represents the start of the coding sequence. B, sequence of the CpG island that was analyzed
from bases 41248 (accession number U12818). CpG dinucleotides are in bold and numbered below each site. The HpaII sites are underlined. C, methylation maps derived from direct
PCR sequencing analysis for normal and leukemic samples. Symbols are the same as Fig. 1.

of single genes. However, the methylation pattern of all CpG islandassociated genes are not affected, because there appears to be an
individual variability in the range of genes hypermethylated in the
same cell type.
DISCUSSION
Although alterations in DNA methylation patterns are commonly
found in essentially all cancers (9), little is known about the underlying mechanism. In this study, we asked whether multiple genes are
simultaneously methylated in the same cancer cell and whether the
methylation pattern is cancer cell type specific. We analyzed the
methylation pattern across the CpG-rich promoter regions of eight
tumor-related genes in the same cohort of AML patients using bisulfite analysis. Methylation studies to date generally have been limited
to the study of the few CpG dinucleotides that lie in the restriction
enzyme recognition site and therefore provide little information about
the nature of de novo methylation. Furthermore, the methylation
studies for different genes often were performed on different cohorts
of patients, making it difficult to assess concurrent methylation within
the one sample. By using bisulfite sequencing, we could address
whether aberrant de novo methylation was targeted to specific CpG
sites or was extensive across the CpG island promoter regions associated with tumor-related genes.
The main conclusion from our study is that aberrant methylation is

not confined to single target genes in AML but rather can occur
concurrently across many different genes spanning different chromosomes in an individual patient. The HIC1 gene (spanning intron 2)
was the most commonly methylated, with .80% of the AML samples
tested showing hypermethylation. Calcitonin, E-cadherin, ER, and
p15 were also commonly methylated, with .50% of the AML samples showing hypermethylation. In comparison, p16 was less frequently methylated, and Rb and GST-Pi were found to be never
methylated in the AML samples tested. Interestingly, the methylation
portfolio of each AML patient was remarkably different from each
other, with quite a variation in the combination of genes selected. In
addition, there was no obvious correlation between ages of the patients with AML and the number of genes or subset of genes methylated. In particular, the methylation of the ER did not appear to be
age specific in either the normal or cancer samples, as reported by Issa
et al. (42) and Ahuja et al. (43) for colon cancer. This difference may
be due to the fact that different tissues were examined in the latter
study, or our sample size was limited. However, we have taken care
to ensure that the median ages between normal and AML samples
were matched to differentiate AML-specific methylation from agerelated methylation.
It is clear from our results that, although there is a heterogeneity in
the profile of genes methylated within the AML patients, there also
appears to be cancer cell type-specific differences. For example, Rb

3736

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

Fig. 6. Methylation map of the HIC1 gene. A, CpG plot of the HIC1 gene. The black boxes represent the exons, and the arrow shows the start of transcription. The NotI sites are
marked on the gene and represented by an N. B, sequence of the CpG island that was analyzed from bases 1478 1758 (accession number L41919). CpG dinucleotides are in bold and
numbered below each site. The HpaII sites are underlined, and the EagI site is underlined with a dotted line. C, methylation maps derived from direct PCR sequencing analysis for
normal and leukemic samples. Symbols are the same as Fig. 1.

and GST-Pi were both found to be unmethylated in the AML patients,

whereas these genes are frequently methylated in retinoblastoma
tumors and prostate tumors, respectively (38, 39, 44). p16 was also
methylated at a low level in ;30% of samples in this study, but p16
is frequently methylated in lung cancer and melanoma (45). Liang et
al. (46), using a genome scanning analysis of three different tumors,
also reported tissue-specific variation in the methylation patterns
between the tumors. The fact that multiple genes are frequently
methylated in cancer suggests that the mechanism that normally
protects CpG islands from methylation is defective in the cancer cell.
The fact that different combinations of a subset of genes can be
methylated in the one cell type suggests that methylation is stochastic.
The set of genes that are commonly methylated possibly reflects the
genes that, when silenced, provide the cell with a selective growth
advantage in different cell types. However, the cancer specificity
observed may reflect the different set of tissue-specific factors found
in the different cell types.
The mechanism that protects CpG islands from methylation is
unclear, and what triggers hypermethylation in cancer is still unresolved. An increase in DNA MTase was proposed to be important in
the initiation and progression of cancer and in establishing altered
DNA methylation patterns (35, 9). However, it is clear from our
results that simply an increase in DNA MTase is insufficient to
explain the altered methylation patterns. The AML samples screened

had DNA MTase levels 2.510-fold higher than normal bone marrow
(6), but the methylation patterns of these patients were variable and
bore no obvious relationship to the level of DNA MTase in the cell.
It is, however, possible that other methylation enzymes, such as
dnmt3a and dnmt3b (47), may play a role in abnormal methylation in
leukemia.
Active transcription also has been proposed as a mechanism to
protect CpG islands from methylation (48). It is possible that in the
cancer cell, a subset of CpG island promoters are silenced, permitting
subsequent de novo methylation. This is an attractive hypothesis and
may help to explain how hypermethylation appears to be stochastic
but also limited to a specific subset of genes for the different cancer
types. Unfortunately, because the samples we tested contained a low
level of normal cell contamination, it was not possible to accurately
quantitate the level of expression for each gene in the sample and
demonstrate that the genes were indeed silenced. It is also unclear
from our results whether the variable methylation patterns we observed influenced the level of gene transcription within the individual
genes tested. However methylation, as determined by Southern analysis, has been associated with inactivation of expression in many of
the genes we analyzed (28, 30, 3235, 42, 49). We suggested previously that transient CpNpG methylation of Sp1 sites in the promoter
regions of CpG islands may be one mechanism that may lead to gene
silencing and subsequent de novo methylation of CpG islands (50).

3737

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

Fig. 7. Summary of hypermethylation results in AML. A, individual genes were scored as hypermethylated if they were methylated by genomic sequencing if levels in the sample
were .25% at any one CpG site or in 25% or more of the determinable CpG sites. Black ovals, methylated; white ovals, unmethylated; no oval, not determined. Methylation status
for p15 in patients R103 and R86 and for ER in patient R103 was determined by Southern analysis only. Footnote a, chromosome loci of the genes are given below the gene name.
Footnote b, hypermethylation of HIC1 intron 2. Footnote c, MTase levels represent the fold increase of DNA MTase to the mean of the normal controls DNA MTase level (6). B:
f, proportion of AML samples methylated for each target gene; M, proportion of normal samples (N) methylated for each target gene.

However, in this analysis, we found no evidence of CpNpG methylation at detectable levels. Because our data were obtained by direct
PCR sequencing, methylation levels ,15% are difficult to assess
above background.
We chose to analyze the individual methylation patterns for each

gene by sequencing to gain an insight into the mechanism responsible

for the specific methylation profiles. We found that for each gene, the
methylation profile across the CpG island was heterogeneous, and no
one CpG site appeared to be always methylated. This is similar to our
previous findings of mosaic methylation found in both cancer and

3738

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

normal cells (38, 39, 51, 52). It therefore appears that the de novo
methylation process is stochastic and supports the hypothesis that it is
the density of methylation across a region that is important rather than
methylation of individual target sites. Interestingly, for the HIC1 gene,
we did note a marked boundary of methylation that occurred between
intron 2 and exon 3 in the normal cell that was lacking in the cancer
cell. The existence of such a methylation boundary, which is clearly
lost in the cancer cell, may provide clues in the future as to the
mechanism that normally protects sequences from methylation in the
normal cell (53).
The results of this study have allowed us to answer some important
questions about de novo DNA methylation in cancer cells: (a) although a deregulation of the methylation machinery is implicated in
abnormal hypermethylation, an increase in DNA MTase alone is not
sufficient to mediate this hypermethylation; (b) hypermethylation in
AML is not confined to a single locus but rather is a multiple loci
event covering CpG-rich gene regions; and (c) the aberrant de novo
methylation found in AML appears to be a stochastic process acting
at individual CpG sites within different CpG islands combined with a
cell type selectivity. Moreover, the cancer specificity may reflect the
different set of factors found in different cell types. The next step is
to determine what the factors are protecting CpG islands from methylation in the normal cell and what triggers the breakdown of the
protective process in the malignant cell.
ACKNOWLEDGMENTS
We thank Cheryl Paul for the excellent automated sequencing and Dr. Doug
Millar for advice and helpful discussions.

REFERENCES
1. Turker, M. S., and Bestor, T. H. Formation of methylation patterns in the mammalian
genome. Mutat. Res., 386: 119 130, 1997.
2. Holliday, R. DNA methylation and epigenetic inheritance. Philos. Trans. R. Soc.
Lond. B Biol. Sci., 326: 329 338, 1990.
3. el-Deiry, W. S., Nelkin, B. D., Celano, P., Yen, R. W., Falco, J. P., Hamilton, S. R.,
and Baylin, S. B. High expression of the DNA methyltransferase gene characterizes
human neoplastic cells and progression stages of colon cancer. Proc. Natl. Acad. Sci.
USA, 88: 3470 3474, 1991.
4. Issa, J. P., Vertino, P. M., Wu, J., Sazawal, S., Celano, P., Nelkin, B. D., Hamilton,
S. R., and Baylin, S. B. Increased cytosine DNA-methyltransferase activity during
colon cancer progression. J. Natl. Cancer Inst., 85: 12351240, 1993.
5. Belinsky, S. A., Nikula, K. J., Baylin, S. B., and Issa, J. P. Increased cytosine
DNA-methyltransferase activity is target-cell-specific and an early event in lung
cancer. Proc. Natl. Acad. Sci. USA, 93: 4045 4050, 1996.
6. Melki, J., Warnecke, P., Vincent, P., and Clark, S. Increased DNA methyltransferase
expression in leukemia. Leukemia (Baltimore), 12: 311316, 1998.
7. Jones, P. A., Rideout, W. M., Shen, J-C., Spruck, C. H., and Tsai, C. Methylation,
mutation, and cancer. Bioessays, 14: 3336, 1992.
8. Schmutte, C., Yang, A. S., Nguyen, T. T., Beart, R. W., and Jones, P. A. Mechanisms
for the involvement of DNA methylation in colon carcinogenesis. Cancer Res., 56:
23752381, 1996.
9. Baylin, S. B., Herman, J. G., Graff, J. R., Vertino, P. M., and Issa, J. P. Alterations
in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72:
141196, 1998.
10. Bird, A. P. CpG-rich islands and the function of DNA methylation. Nature (Lond.),
321: 209 213, 1986.
11. Wahlfors, J., Hiltunen, H., Heinonen, K., Hamalainen, E., Alhonen, L., and Janne,
J. Genomic hypomethylation in human chronic lymphocytic leukemia. Blood, 80:
2074 2080, 1992.
12. Hanada, M., Delia, D., Aiello, A., Stadtmauer, E., and Reed, J. C. bcl-2 gene
hypomethylation and high-level expression in B-cell chronic lymphocytic leukemia.
Blood, 82: 1820 1828, 1993.
13. Kochanek, S., Radbruch, A., Tesch, H., Renz, D., and Doerfler, W. DNA methylation
profiles in the human genes for tumor necrosis factors a and b in subpopulations of
leukocytes and in leukemias. Proc. Natl. Acad. Sci. USA, 88: 5759 5763, 1991.
14. Palotie, A., and Syvanen, A. C. Development of molecular genetic methods for
monitoring myeloid malignancies. Scand. J. Clin. Lab. Invest. Suppl., 213: 29 38,
1993.
15. Nelkin, B. D., Przepiorka, D., Burke, P. J., Thomas, E. D., and Baylin, S. B.
Abnormal methylation of the calcitonin gene marks progression of chronic myelogenous leukemia. Blood, 77: 24312434, 1991.
16. Ihalainen, J., Pakkala, S., Savolainen, E. R., Jansson, S. E., and Palotie, A. Hypermethylation of the calcitonin gene in the myelodysplastic syndromes. Leukemia
(Baltimore), 7: 263267, 1993.

17. Dhodapkar, M., Grill, J., and Lust, J. A. Abnormal regional hypermethylation of the
calcitonin gene in myelodysplastic syndromes. Leuk. Res., 19: 719 726, 1995.
18. Herman, J. G., Civin, C. I., Issa, J. P., Collector, M. I., Sharkis, S. J., and Baylin, S. B.
Distinct patterns of inactivation of p15INK4B and p16INK4A characterize the major
types of hematological malignancies. Cancer Res., 57: 837 841, 1997.
19. Dodge, J. E., List, A. F., and Futscher, B. W. Selective variegated methylation of the
p15 CpG island in acute myeloid leukemia. Int. J. Cancer, 78: 561567, 1998.
20. Issa, J. P., Zehnbauer, B. A., Civin, C. I., Collector, M. I., Sharkis, S. J., Davidson,
N. E., Kaufmann, S. H., and Baylin, S. B. The estrogen receptor CpG island is
methylated in most hematopoietic neoplasms. Cancer Res., 56: 973977, 1996.
21. Frommer, M., McDonald, L. E., Millar, D. S., Collis, C. M., Watt, F., Grigg, G. W.,
Molloy, P. L., and Paul, C. L. A genomic sequencing protocol that yields a positive
display of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad.
Sci. USA, 89: 18271831, 1992.
22. Clark, S. J., Harrison, J., Paul, C. L., and Frommer, M. High sensitivity mapping of
methylated cytosines. Nucleic Acids Res., 22: 2990 2997, 1994.
23. Clark, S. J., and Frommer, M. Bisulphite genomic sequencing of methylated cytosines. In: G. R. Taylors (ed.), Laboratory Methods for the Detection of Mutations
and Polymorphisms in DNA, pp. 151162. New York: CRC Press, 1997.
24. Herman, J. G., Graff, J. R., Myohanen, S., Nelkin, B. D., and Baylin, S. B. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc.
Natl. Acad. Sci. USA, 93: 98219826, 1996.
25. Warnecke, P. M., Stirzaker, C., Melki, J. R., Millar, D. S., Paul, C. L., and Clark, S. J.
Detection and measurement of PCR bias in quantitative methylation analysis of
bisulphite-treated DNA. Nucleic Acids Res., 25: 4422 4426, 1997.
26. Baylin, S. B., Hoppener, J. W., de Bustros, A., Steenbergh, P. H., Lips, C. J., and
Nelkin, B. D. DNA methylation patterns of the calcitonin gene in human lung cancers
and lymphomas. Cancer Res., 46: 29172922, 1986.
27. Leegwater, P. A., Lambooy, L. H., De Abreu, R. A., Bokkerink, J. P., and van den
Heuvel, L. P. DNA methylation patterns in the calcitonin gene region at first
diagnosis and at relapse of acute lymphoblastic leukemia (ALL). Leukemia (Baltimore), 11: 971978, 1997.
28. Yoshiura, K., Kanai, Y., Ochiai, A., Shimoyama, Y., Sugimura, T., and Hirohashi, S.
Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in human
carcinomas. Proc. Natl. Acad. Sci. USA, 92: 7416 7419, 1995.
29. Graff, J. R., Herman, J. G., Lapidus, R. G., Chopra, H., Xu, R., Jarrard, D. F., Isaacs,
W. B., Pitha, P. M., Davidson, N. E., and Baylin, S. B. E-Cadherin expression is
silenced by DNA hypermethylation in human breast and prostate carcinomas. Cancer
Res., 55: 51955199, 1995.
30. Graff, J. R., Herman, J. G., Myohanen, S., Baylin, S. B., and Vertino, P. M. Mapping
patterns of CpG island methylation in normal and neoplastic cells implicates both
upstream and downstream regions in de novo methylation. J. Biol. Chem., 272:
2232222329, 1997.
31. Herman, J. G., Jen, J., Merlo, A., and Baylin, S. B. Hypermethylation-associated
inactivation indicates a tumor suppressor role for p15INK4B. Cancer Res., 56:
722727, 1996.
32. Costello, J. F., Berger, M. S., Huang, H. S., and Cavenee, W. K. Silencing of
p16/CDKN2 expression in human gliomas by methylation and chromatin condensation. Cancer Res., 56: 24052410, 1996.
33. Merlo, A., Herman, J. G., Mao, L., Lee, D. J., Gabrielson, E., Burger, P. C., Baylin,
S. B., and Sidransky, D. 59 CpG island methylation is associated with transcriptional
silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nat. Med.,
1: 686 692, 1995.
34. Otterson, G. A., Khleif, S. N., Chen, W., Coxon, A. B., and Kaye, F. J. CDKN2 gene
silencing in lung cancer by DNA hypermethylation and kinetics of p16INK4 protein
induction by 5-aza 29deoxycytidine. Oncogene, 11: 12111216, 1995.
35. Makos-Wales, M., Biel, M. A., el Deiry, W., Nelkin, B. D., Issa, J. P., Cavenee,
W. K., Kuerbitz, S. J., and Baylin, S. B. p53 activates expression of HIC-1, a new
candidate tumour suppressor gene on 17p13.3. Nat. Med., 1: 570 577, 1995.
36. Issa, J. P., Zehnbauer, B. A., Kaufmann, S. H., Biel, M. A., and Baylin, S. B. HIC1
hypermethylation is a late event in hematopoietic neoplasms. Cancer Res., 57:
1678 1681, 1997.
37. Sakai, T., Toguchida, J., Ohtani, N., Yandell, D. W., Rapaport, J. M., and Dryja, T.
Allele-specific hypermethylation of the retinoblastoma tumor-suppressor gene. Am. J.
Hum. Genet., 48: 880 888, 1991.
38. Stirzaker, C., Millar, D. S., Paul, C. L., Warnecke, P. M., Harrison, J., Vincent, P. C.,
Frommer, M., and Clark, S. J. Extensive DNA methylation spanning the Rb promoter
in retinoblastoma tumors. Cancer Res., 57: 2229 2237, 1997.
39. Millar, D. S., Ow, K. K., Paul, C. L., Russell, P. J., Molloy, P. L., and Clark, S. J.
Detailed methylation analysis of the glutathione S-transferase Pi (GSTP1) gene in
prostate cancer. Oncogene, 18: 13131324, 1999.
40. Lee, W. H., Morton, R. A., Epstein, J. I., Brooks, J. D., Campbell, P. A., Bova, G. S.,
Hsieh, W. S., Isaacs, W. B., and Nelson, W. G. Cytidine methylation of regulatory
sequences near the pi-class glutathione S-transferase gene accompanies human prostatic carcinogenesis. Proc. Natl. Acad Sci. USA, 91: 1173311737, 1994.
41. Jhaveri, M. S., and Morrow, C. S. Methylation-mediated regulation of the glutathione S-transferase P1 gene in human breast cancer cells. Gene (Amst.), 210:
17, 1998.
42. Issa, J-P. J., Ottaviano, Y. L., Celano, P., Hamilton, S. R., Davidson, N. E., and
Baylin, S. B. Methylation of the oestrogen receptor CpG island links ageing and
neoplasia in human colon. Nat. Genet., 7: 536 540, 1994.
43. Ahuja, N., Li, Q., Mohan, A. L., Baylin, S. B., and Issa, J. P. Aging and DNA
methylation in colorectal mucosa and cancer. Cancer Res., 58: 5489 5494,
1998.
44. Ohtani-Fujita, N., Dryja, T. P., Rapaport, J. M., Fujita, T., Matsumura, S., Ozasa, K.,
Watanabe, Y., Hayashi, K., Maeda, K., Kinoshita, S., Matsumura, T., Ohnishi, Y.,

3739

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

DNA METHYLATION IN LEUKEMIA

45.

46.

47.
48.

Hotta, Y., Takahashi, R., Kato, M. V., Ishizaki, K., Sasaki, M. S., Horsthemke, B.,
Minoda, K., and Sakai, T. Hypermethylation in the retinoblastoma gene is associated
with unilateral, sporadic retinoblastoma. Cancer Genet. Cytogenet., 98: 43 49, 1997.
Belinsky, S. A., Nikula, K. J., Palmisano, W. A., Michels, R., Saccomanno, G.,
Gabrielson, E., Baylin, S. B., and Herman, J. G. Aberrant methylation of p16(INK4a)
is an early event in lung cancer and a potential biomarker for early diagnosis. Proc.
Natl. Acad. Sci. USA, 95: 1189111896, 1998.
Liang, G., Salem, C. E., Yu, M. C., Nguyen, H. D., Gonzales, F. A., Nguyen, T. T.,
Nichols, P. W., and Jones, P. A. DNA methylation differences associated with tumor
tissues identified by genome scanning analysis. Genomics, 53: 260 268, 1998.
Okano, M., Xie, S., and Li, E. Cloning and characterization of a family of novel
mammalian DNA (cytosine-5) methyltransferases. Nat. Genet., 19: 219 220, 1998.
Cross, S. H., and Bird, A. P. CpG islands and genes. Curr. Opin. Genet. Dev., 5:
309 314, 1995.

49. Ottaviano, Y. L., Issa, J. P., Parl, F. F., Smith, H. S., Baylin, S. B., and Davidson,
N. E. Methylation of the estrogen receptor gene CpG island marks loss of estrogen
receptor expression in human breast cancer cells. Cancer Res., 54: 25522555, 1994.
50. Clark, S. J., Harrison, J., and Molloy, P. L. Sp1 binding is inhibited by (m)Cp(m)CpG
methylation. Gene (Amst.), 195: 6771, 1997.
51. Warnecke, P. M., Mann, J. R., Frommer, M., and Clark, S. J. Bisulfite sequencing in
preimplantation embryos: DNA methylation profile of the upstream region of the
mouse imprinted H19 gene. Genomics, 51: 182190, 1998.
52. Warnecke, P. M., and Clark, S. J. DNA methylation profile of the mouse skeletal
a-actin promoter during development and differentiation. Mol. Cell. Biol., 19: 164
172, 1999.
53. Melki, J. R., Vincent, P. C., and Clark, S. J. Cancer-specific region of hypermethylation identified within the HIC1 putative tumour suppressor gene in acute myeloid
leukaemia. Leukemia (Baltimore), 13: 877 883, 1999.

3740

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.

Concurrent DNA Hypermethylation of Multiple Genes in Acute

Myeloid Leukemia
John R. Melki, Paul C. Vincent and Susan J. Clark
Cancer Res 1999;59:3730-3740.

Updated version

Access the most recent version of this article at:

http://cancerres.aacrjournals.org/content/59/15/3730

Cited Articles

This article cites by 52 articles, 28 of which you can access for free at:
http://cancerres.aacrjournals.org/content/59/15/3730.full.html#ref-list-1

Citing articles

This article has been cited by 57 HighWire-hosted articles. Access the articles at:
http://cancerres.aacrjournals.org/content/59/15/3730.full.html#related-urls

E-mail alerts
Reprints and
Subscriptions
Permissions

Sign up to receive free email-alerts related to this article or journal.

To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at pubs@aacr.org.
To request permission to re-use all or part of this article, contact the AACR Publications
Department at permissions@aacr.org.

Downloaded from cancerres.aacrjournals.org on February 22, 2015. 1999 American Association for Cancer
Research.