Original Article

DOI: 10.1111/vco.12105

Expression of broblast growth factor 23

by canine soft tissue sarcomas
M. R. Hardcastle and K. E. Dittmer
Institute of Veterinary, Animal and Biomedical Sciences, College of Sciences, Massey University, Palmerston
North, New Zealand

Abstract

Keywords
canine, broblast growth
factor 23, phosphatonin,
polymerase chain reaction,
soft tissue sarcoma,
oncogenic osteomalacia

Tumour-induced osteomalacia (TIO) is a rare paraneoplastic syndrome of humans. Some

mesenchymal tumours (often resembling haemangiopericytomas) express molecules that normally
regulate phosphorus metabolism; most frequently, broblast growth factor 23. Patients develop
renal phosphate wasting and inappropriately low serum concentrations of 1, 25 (OH)2 vitamin D3 ,
leading to osteomalacia. Surgical removal of the tumour is curative. The authors examined
expression of canine broblast growth factor 23 in 49 soft tissue sarcomas, and control tissues from
normal adult dogs. RNA extracted from bone or formalin-xed, paran-embedded tissues was
analysed by end point and quantitative reverse transcriptase-polymerase chain reaction. Fibroblast
growth factor 23 expression was detected in bone, lung, kidney, lymph node and thymus. Fifteen of
49 sarcomas (31%) expressed broblast growth factor 23, three of these had high relative expression
and some features resembling phosphatonin-expressing mesenchymal tumours of humans. Further
work is required to determine whether TIO may occur in dogs.

Introduction

Correspondence address:
M. R. Hardcastle
Gribbles Veterinary
Pathology
P.O. Box 12049
Penrose, Auckland 1642,
New Zealand
e-mail:
michael.hardcastle
@gribbles.co.nz

Rickets and osteomalacia are uncommon metabolic

bone diseases affecting humans and animals. Failure of normal mineralization in physeal or articular cartilage of growing children or animals leads
to rickets; the same process in the remodelling
bone of adults leads to osteomalacia.1 Rickets is
most common due to vitamin D or phosphorus
deficiency.1 Rare cases of inherited metabolic disorders and paraneoplastic syndromes are reported
to cause rickets or osteomalacia in humans. These
have been variably linked to well-described defects
of either vitamin D3 or phosphorus metabolism.1 A
small number of well-substantiated cases of canine
inherited rickets have been reported2 ; however,
these diseases appear to be very rare in the canine
population.
Tumour-induced osteomalacia (TIO) is a rare
paraneoplastic syndrome of humans with patients
showing reduced renal phosphate reabsorption,
inappropriately low levels of active vitamin D3

2014 John Wiley & Sons Ltd

and osteomalacia.3 The responsible tumours are

usually small and located in obscure areas such as
the paranasal sinuses4 or within bone3,5,6 although
they are occasionally located subcutaneously.7,8
They are often difficult to diagnose and to resect
completely.3 Advanced imaging (such as scintigraphy, magnetic resonance imaging or positron
emission tomography/computed tomography
scan) has been required to identify sites of osteomalacia and locate the causative tumour,6,9 11
which can nevertheless defy identification in some
affected patients despite such measures.12 Early
investigators noted that removal of the causative
tumour led to the resolution of osteomalacia.3,5,13,14
The majority of tumours causing TIO are designated phosphaturic mesenchymal tumour-mixed
connective tissue variant (PMT-MCT), and have
a consistent morphologic appearance similar to
haemangiopericytomas.5,15 Generally speaking,
PMT-MCT are composed of large numbers of
loosely to densely packed spindle to stellate-shaped

2 M. R. Hardcastle and K. E. Dittmer

cells embedded within a highly vascular myxoid to

chondroid stroma, which is frequently described as
grungy15 due to diffuse mineralization. Immunohistochemical profiling of PMT-MCTs shows scant
staining for smooth muscle-specific actin, and
negative staining for S-100, CD34, desmin and
cytokeratin.15
Predominantly expressed by bone but found
in other organs,16 18 fibroblast growth factor 23
(FGF23) has a physiological and pathological role
in phosphate homeostasis, causing decreased renal
phosphate reabsorption and reduced activation of
vitamin D3 .19 FGF23 exerts these effects through
reducing 25 (OH) vitamin D3 1--hydroxylase
expression, and reducing the numbers of renal
epithelial cell membrane sodium-phosphate
co-transporters. This has led to its appellation
as a phosphatonin.20 When transplanted into
nude mice, Chinese hamster ovary cells expressing human FGF23 caused hypophosphatemia,
phosphaturia, high-serum alkaline phosphatase,
low 1,25 (OH)2 vitamin D3 , bone deformity and
rickets.21
FGF23 is the most important phosphatonin in
TIO patients.22 In situ hybridization, immunohistochemistry, polymerase chain reaction, western
blot and northern blot analysis21,23,24 have shown
FGF23 protein and mRNA to be present and overexpressed in the tumour cells of TIO patients; in
addition, elevated serum concentrations of FGF23
are often detected in TIO patients by enzyme-linked
immunosorbent assay (ELISA), and these quickly
return to normal after the causative tumours are
removed.25 Parallel research has revealed that
FGF23 also plays a key role in most inherited
disorders of phosphorus metabolism.19,26 28
Although murine models of disordered FGF23
metabolism are well established,29,30 its physiology and naturally occurring disorders in animals
are little explored. FGF23 manipulation has been
considered as a means of improving phosphorus
utilization efficiency in production animals,31,32
and has been evaluated in cats with chronic
kidney disease and/or hyperthyroidism.33 36
To the authors knowledge, TIO has not been
reported in dogs, or any other animal species;
furthermore, the phosphatonin system is completely unexplored in dogs. Here, we describe our

investigation into FGF23 expression by canine

soft tissue sarcomas and a range of other tissues.

Materials and methods

Case selection and control samples
Fifty-one
formalin-fixed
paraffin-embedded
tumours were selected from the databases of
New Zealand Veterinary Pathology (Palmerston
North, New Zealand) and the Necropsy service,
Pathobiology Department (Institute of Veterinary,
Animal and Biomedical Sciences, Massey University, Palmerston North, New Zealand). The
tumours selected were mesenchymal tumours variously diagnosed on haematoxylin and eosin (H&E)
morphology as spindle cell tumour (5), haemangiopericytoma (6), soft tissue sarcoma (2), spindle
cell tumour/haemangiopericytoma (5), spindle cell
tumour/soft tissue sarcoma/haemangiopericytoma
(17), fibrosarcoma (4), dermatofibroma (1), peripheral nerve sheath tumour/schwannoma (5), mixed
sarcoma (1), sarcoma (3) or poorly differentiated
sarcoma (2). Particular attention in case selection
was given to any historical or clinical features
suggestive of TIO-causing tumours (e.g. location
within a muscle). None was associated with a
diagnosis of osteomalacia.
To establish the normal tissue distribution of
FGF23 expression in dogs, control soft tissues
were taken from three clinically healthy approximately 6-month-old female cross-bred dogs. These
dogs (designated as A, B and C) were humanely
euthanized with intravenous pentobarbitone and
necropsied immediately. No gross abnormalities
were identified. Samples of skin, skeletal muscle,
fat and fascia from the distal limbs, cardiac muscle,
arteries and veins, peripheral nerve, liver, spleen,
kidney and lung were taken from each dog within
60 min of death; in addition, tendon was taken from
dogs B and C, and mesenteric lymph node, thymus,
ovary, pylorus and small intestine from dog C.
These tissues were immediately fixed in neutral
buffered 10% formalin, and then trimmed into tissue cassettes after 24 h of fixation. The tissues were
dehydrated in graded alcohols, and embedded in
paraffin wax. Sections cut at 3 m were stained with
H&E and examined for adequacy of fixation, tissue

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

Expression of FGF23 by canine soft tissue sarcomas 3

preservation and microscopic lesions. Samples of

lung contained small scattered foci of interstitial
eosinophilic or granulomatous inflammation
consistent with migration of Toxocara canis larvae.
Samples of bone were taken from the proximal humerus and femur of a healthy 6-month-old
male dog that had been humanely euthanized with
intravenous pentobarbitone and necropsied immediately (bone 1), and dog C (bone 2), snap-frozen
in liquid nitrogen and then either immediately subjected to the RNA extraction or stored at 80 C
until processed.

RNA extraction
Total RNA was extracted from paraffin-embedded
soft tissue samples using the Roche High Pure
FFPE RNA Micro Kit (Version December 2008,
Cat. No. 04-823-125-001, Roche Applied Science,
Mannheim, Germany) according to the manufacturers instructions, with a few modifications
(DNAse solution was formulated before addition
to the column, and one extra application of DNAse
and wash buffer rinse were used). Samples were
immediately stored at 80 C for later analysis,
excepting a 2-L aliquot which was tested for RNA
quantity with a Nanodrop 1000 Spectrophotometer
(Thermo Scientific, Wilmington, DE, USA).
RNA was extracted from control bones using
the following protocol. Snap-frozen bone was
maintained in liquid nitrogen while pulverized
to a fine powder using a mortar and pestle. The
frozen powder was transferred to a 15-mL tube
containing stainless steel ball bearings and TRI
reagent (Sigma, St. Louis, MO, USA) at a ratio
of 2 mL per 100 mg tissue. The tubes were then
vortexed for 415 min. The homogenate was
transferred to a 15-mL tube and centrifuged at
12 000 g for 510 min. The clear (RNA-containing)
supernatant was transferred to a fresh 15- mL tube
and then allowed to stand for 5 min at room temperature. Total RNA was then extracted according
to the manufacturers instructions. The resulting
pellet was air dried for 510 min and then resuspended in 50200 L of diethylpyrocarbonate
(DEPC)-treated water (Invitrogen, Carlsbad, CA,
USA). Samples were immediately stored at 80 C
for later analysis, excepting a 2-L aliquot which

was tested for RNA quantity with a Nanodrop

ND-1000 Spectrophotometer (Thermo Scientific).

Reverse transcriptase-polymerase chain

reaction
Primers (Table 1) were designed using the
nucleotide Basic Local Alignment Search Tool
[BLASTn, National Centre for Biotechnology Information (NCBI), Bethesda, MD, USA; http://blast.
ncbi.nlm.nih.gov/Blast.cgi] to match reference
canine RNA sequences for FGF23 (XM_849487.1),
secreted frizzled-related protein 4 (SFRP4)
(XM_851504.1) and glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) (XM_534639.2) and to
cross exonexon boundaries. Potential unwanted
homology to extraneous targets was also examined.
A protocol for detecting the expression of FGF23,
SFRP4 and GAPDH mRNA was validated in control
bone samples (as FGF23 expression is reported to
be highest in bone of other species17 ), with purification and sequencing of amplicons confirming
their 100% identity to reference sequences (data
not shown). GAPDH and SFRP4 were selected for
amplification as house-keeping genes to confirm
the presence of detectable RNA of a similar or
longer amplicon length to the FGF23 target.
Reverse transcriptase-polymerase chain reaction (RT-PCR) testing was performed using the
SuperScript One-Step RT-PCR with Platinum Taq
Kit (Invitrogen) according to the manufacturers
instructions. A PCR mix containing 1 reaction
mix, 0.2 M of each primer, 1 L of RT/Platinum
Taq mix, RNA template (19.4518.99 ng RNA)
and PCR-grade water was added to thin-walled
0.2-mL PCR tubes to a final volume of 25 L. In
all reactions a negative control was included to
test for the presence of contaminants. Samples
were gently mixed and subjected to the following PCR conditions: 55 C for 30 min, 94 C for
2 min, 40 cycles of 95 C for 30 s, 58 C for 30
s, 72 C for 1 min and finally 72 C for 10 min.
PCR products were analysed on an ethidium
bromide-labelled 1.33% (w/v) UltraPure agarose
gel (Invitrogen) and visualized under transilluminator UV light. Selected products were purified,
sequenced and analysed to confirm successful
demonstration of gene expression. Positive samples

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

4 M. R. Hardcastle and K. E. Dittmer

Table 1. Primer sets for RT-PCR (all from Invitrogen Custom Primers, except FGF23 (Biosearch Technologies, Novato, CA,

USA)
Target

Forward (5 3 ) primer

Reverse (5 3 ) primer

Product (bp)

Tm (1 M Na+) For./Rev

FGF23
GAPDH
SFRP4

CGGTCAGAGGATGCCGGCTTT
GGCGTGAACCATGAGAAGTATGA
CGCCATGTACGCGCCCATCT

TCCGGGCTGAAGAGGTGTGAT
CCCTCCACGATGCCAAGT
CATGAGCGGCTCGCAGTCGT

107
119
163

75/73
72/69
74/74

Tm, melting temperature; For., forward; Rev., reverse.

were retested up to five times to ensure that positive results were repeatable. In several cases (e.g.
tumour 5) fresh samples were re-extracted from
formalin-fixed paraffin-embedded tissues before
repeat PCR.
The RNA sample concentration at the lower limit
of detection for the FGF23 PCR assay was determined to be 15 ng L1 . Tissues of sufficient concentration to amplify FGF23 mRNA, but negative,
were tested using the one-step protocol for expression of GAPDH or SFRP4 as previously described
for FGF23, save for the use of 63 C as the annealing
temperature. A fibrosarcoma and a haemangiopericytoma were negative for GAPDH or SFRP4 expression; these were excluded from further study.

Real-time quantitative polymerase chain

reaction
Tumours that were positive for FGF23 expression using conventional RT-PCR, and control
dog tissues were analysed using real-time quantitative polymerase chain reaction (qPCR). The
reference genes selected were ribosomal protein
L13a (RPL13A) and hydroxymethylbilane synthase
(HMBS). RPL13A in particular has been shown to
have stable expression in canine skin, connective
tissues and bone,37,38 while HMBS has relatively
stable expression in a number of canine tissues.39
The primer sequences for RPL13A have previously
been reported.38 HMBS and new FGF23 primers
were devised specifically for real-time PCR using
nucleotide BLASTn (NCBI) to match reference
canine RNA sequences for FGF23 (XM_849487.1)
and HMBS (XM_546491.3). The primers were
designed for a product less than 120 bp in size,
to span an exonexon boundary and to lack
complementarity to extraneous targets. Primer
sequences for qPCR are reported in Table 2.

The RNA previously extracted (see earlier) was

converted to cDNA using the Roche Transcriptor cDNA synthesis Kit (Roche Applied Science)
as per the manufacturers instructions. RNA to be
used in real-time PCR had the concentration determined using a Qubit 2.0 fluorometer (Life Technologies, Carlsbard, CA, USA) as this has recently
been shown to be more accurate than a spectrophotometer for determining RNA concentration from
FFPE sections. 40 A mix of 2.5 M oligo(dT), 60 M
random hexamers, 1 mM each dNTP, 20 U RNase
Inhibitor, 10 U RT, 5 reaction buffer, 4 L RNA
(25300 ng RNA) and water, up to a final volume
of 20 L, was added to each tube. Samples were gently mixed and incubated at 25 C for 10 min, 55 C
for 30 min and 85 C for 5 min. For qPCR, 2 L
of cDNA product was used in a reaction mix with
5 L of FastSYBR master mix (Applied Biosystems,
Life Technologies, Foster City, CA, USA), variable
forward and reverse primer concentrations (as per
Table 2) and water, up to a final volume of 10 L.
Real-time qPCR was performed using the StepOne
Plus real-time PCR machine (Applied Biosystems,
Life Technologies) and the qPCR conditions were
as follows: 95 C for 20 s, followed by 40 cycles
of 95 C for 3 s and 60 C for 30 s. A melt curve
was performed at the end of each qPCR run to
check for non-specific amplification. Negative controls of water, and reaction mix without RT were
included in every qPCR run. All samples were run
in duplicate. Five-point standard curves were produced for each target using bone 2 and sample
5 to determine the accuracy (R2 ) and efficiency
(%) of the real-time PCR reactions (Table 2). The
real-time data were analysed using the comparative 2 C T method and the arithmetic mean of
the reference genes by the StepOne plus software
(Applied Biosystems, Life Technologies) to produce
relative expression ratios. Selected amplicons for

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

Expression of FGF23 by canine soft tissue sarcomas 5

Table 2. Primer sets for real-time qPCR (Biosearch Technologies)

Target

Forward (5 3 ) primer

Reverse (5 3 ) primer

For.
(nM)

Rev.
(nM)

Product
(bp)

R2

E (%)

FGF23
HMBS
RPL13A

TGGATGGCACACCTCATCAGACCA
AGACTCTGCTTCGCTGCATT
CTGCCCCACAAGACCAAG

ACACCTGTTATCACCACAAAGCCG
CAGTCAGGTACAGTTGCCCA
GGGATCCCATCAAACACCT

250
300
100

250
100
500

82
114
65

1.00
0.97
1.00

103.3
98.8
95.0

For., forward primer concentration; Rev., reverse primer concentration; R2 , coecient of correlation; E, eciency.

each target were sent for sequencing as described

earlier.

Results
Tumour samples RT-PCR findings
Of the 49 GAPDH and/or SFRP4 positive tumours,
15 (31%) were positive for expression of FGF23
(example shown in Fig. 1). The positive tumours
varied in anatomic site, original diagnosis and
histological features (Table 3). Ten were subcutaneous/dermal, three were intramuscular and one
each was found within a nerve sheath and the
pharyngeal submucosa. Twelve were located on or
close to a limb, one was located over the thorax,
one over the abdominal wall and one was found
in the retropharynx. Four had original diagnoses
of spindle cell tumour/haemangiopericytoma,
one of spindle cell tumour/soft tissue sarcoma/haemangiopericytoma, one of spindle cell
tumour, two of fibrosarcoma, two of sarcoma, two
of soft tissue sarcoma, and one each of haemangiopericytoma, poorly differentiated sarcoma and
mixed sarcoma (example shown in Fig. 2).

Tumour samples real-time qPCR findings

All 15 tumours analysed expressed FGF23, HMBS
and RPL13A. Expression of FGF23 in soft tissue
sarcomas was compared with expression of FGF23
in the two bone samples. Thirteen of the tumours
had greater FGF23 expression than bone 1; three of
these also had greater FGF23 expression than bone
2 (Table 3 and Fig. 3).
The assays produced a single melt peak on a
melt curve, and amplicons showed 100% identity
with their respective target gene sequence (FGF23,
HMBS or RPL13A). Negative controls and negative
RT controls showed no amplification of DNA.

Figure 1. One-step RT-PCR for FGF23 in a tumour

sample. No. 5 is a FGF23 positive tumour sample. Neg
denotes negative control (water); Bone denotes positive
control (bone 2). Ethidium bromide-stained gel
electrophoresis.

Normal dog tissues real-time qPCR findings

The two samples of bone were positive for FGF23
expression. Samples of skin, skeletal muscle, tendons, cardiac muscle, fat, fascia, vessels, nerves,
ovary, pylorus, small intestine, liver and spleen
did not express FGF23. Mesenteric lymph node
and thymus were tested in dog C and showed
positive FGF23 expression. Both lung and kidney expression of FGF23 was variable; dogs A
and B both had FGF23 expression in the kidney,
but dog C did not. Dog B had positive FGF23
expression in the lung, whereas dogs A and C
did not.
All samples negative for FGF23 expression tested
positive with HMBS and/or RPL13A.
Relative expression of FGF23 in the control tissues was compared to bone 2 (Table 3). Expression
of FGF23 in all of the positive tissues and bone 1 was
lower than in bone 2.

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

6 M. R. Hardcastle and K. E. Dittmer

Table 3. Characteristics of FGF23 expressing samples

Sample

Diagnosis

Site

Spindle cell tumour/

haemangiopericy
toma

Right caudal
antebrachium
SQ

Soft tissue sarcoma

Right thigh muscle

Spindle cell tumour/

soft tissue
sarcoma/haemangio
pericytoma

Left thorax SQ

14

Soft tissue sarcoma

Left ank/leg
skin/SQ

15

Spindle cell tumour/

haemangioperi
cytoma

Lateral elbow
skin/SQ

17

Spindle cell tumour/

haemangioperic
ytoma

Right thigh SQ

24

Spindle cell tumour/

haemangiopericy
toma

Left shoulder SQ

27

Haemangiopericytoma

Sciatic nerve
sheath

30

Fibrosarcoma

Left scapula SQ

32

Metastatic mixed
sarcoma with
elements of
myoepithelial
sarcoma,
myxosarcoma and
chondrosarcoma
Sarcoma

Abdominal wall SQ
(masses also in
lung, brain,
heart and kidney) possibly
of mammary
origin
Middle of left
gastrocnemius
muscle,
metastasis to
lungs
Right axilla SQ

34

43

Sarcoma (Possible
Myxosarcoma)

Histological features
Densely to loosely packed cells, interweaving
bundles and frequent whorls around vessels or
collagen bres, scant stroma, occasional
multinucleated cells, large numbers of
inltrating inammatory cells and 1 MF/10 HPF
Densely to loosely packed, interwoven bundles
with some areas of whorling, vascular clefts,
myxoid stroma, large areas of
thrombosis/necrosis and 4 MF/10 HPF
Mostly densely packed cells, interweaving
bundles and fascicles, occasional whorls around
vessels, some pseudocysts, small amount
collagenous to myxomatous stroma, some
multinucleated cells with peripheralized nuclei
and 2 MF/10 HPF
Densely packed cells with haphazard
arrangement, occasional large peripheral
whorls, sparse collagenous stroma and 3 MF/10
HPF
Mostly densely packed cells, storiform and
whorling arrangement, small amount of
collagenous stroma, multinucleated cells and
megakaryotic cells seen, pseudocysts, 3 MF/10
HPF and some necrosis
Dense to loosely packed cells, storiform and
whorling arrangement, small amount of
collagenous/myxomatous stroma and 12
MF/10 HPF
Dense to loosely packed cells, interweaving
bundles and whorling cells, occasional
palisading around vessels, small/moderate
amount of collagenous stroma, occasional
multinucleated cells and pseudocysts and 12
MF/10 HPF
Densely packed interweaving bundles and whorls
arranged around blood vessels, well-developed
brovascular stroma, multifocal eosinophilic
crystalline deposits and 4 MF/10 HPF
Densely packed cells, interweaving bundles,
occasional whorls around vessels, ne stroma,
small area of necrosis and 12 MF/10 HPF
Loosely packed cells, streaming to whorling
within myxomatous to chondroid stroma (in
some areas cells arranged in a reticular pattern
with sparse stroma), large areas of necrosis and
15 MF/10 HPF

Loosely packed cells forming interweaving

bundles in a herring bone pattern, peripheral
whorling, well-developed brovascular stroma,
small areas of necrosis and mild lymphocyte
inltration and 18 MF/10 HPF
Streaming cells loosely packed in myxoid stroma,
occasional interweaving, areas of thrombosis
and necrosis and 59 MF/10 HPF

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

Expression/
bone 2
0.2407

1.3742

0.0271

0.0277

0.0004

0.0467

0.0301

0.0015

0.0494

2.5052

0.0428

1.0299

Expression of FGF23 by canine soft tissue sarcomas 7

Table 3. Continued

Sample

Diagnosis

Site

44

Poorly dierentiated
sarcoma

Left stie muscle

48

Fibrosarcoma

Retropharynx

50

Spindle cell tumour

Mass right axilla,

SQ

Dog A
Dog B
Dog B
Dog C
Dog C

Kidney
Lung
Kidney
Thymus
Mesenteric lymph
node
Bone 1
Bone 2

Dog
Dog C

Histological features

Expression/
bone 2

Solid sheets of cells, occasional megakaryotic

cells, rare multinucleated cells, ne stroma and
42 MF/10 HPF
Densely packed cells, interweaving bundles and
sheets, occasional pseudocysts, small amount
of collagenous stroma and 15 MF/10 HPF
Loose to densely packed spindle cells forming
whorls around blood vessels and interleaving
bundles, large area central necrosis, abundant
collagenous stroma, focal lymphocyte inltrate
and 20 MF/10 HPF

0.0447

0.0548
0.5653
0.0968
0.5813
0.2438

0.0128
1.0

0.0200

0.0194

SQ, subcutaneous site; MF, mitotic gures; HPF, high power eld (400).

Discussion
In this study, we have demonstrated through RNA
extraction followed by end point and qRT-PCR that
canine soft tissue sarcomas may express FGF23.
Importantly, FGF23 expression was not detected
in control tissues sampled from sites typically giving rise to canine soft tissue sarcomas (e.g. skin,
skeletal muscle, tendon, fat, fascia, arteries, veins
and nerves). This is significant as it indicates that
any FGF23 expression in these tissues is normally
either very low/undetectable within the protocols
described, or absent; therefore the discovery of
FGF23 mRNA in canine soft tissue sarcomas could
suggest an abnormal level of FGF23 expression by
these tumours.
TIO has never been diagnosed in dogs; however, given our findings it is tempting to speculate
that it could occur, particularly given the high frequency with which dogs are diagnosed with soft
tissue sarcomas. Proof of principle lies in the article published by Aschinberg et al.13 These investigators intravenously injected a 6-week-old puppy
with a homogenated extract from tumour causing
TIO in a human patient, and documented a marked
phosphaturia following this injection. Although the
causative factors were not identified at that time, it

Figure 2. A tumour sample with high relative expression of

FGF23 (No. 32). Note the prominent myxoid stroma and

loosely packed streams of spindloid cells. H&E.

seems likely that a phosphatonin caused this effect.

This suggests that canine kidneys participate in a
phosphatonin axis homologous to that found in
humans, although further work would be required
to establish this.
TIO could be overlooked in some canine soft
tissue sarcoma patients. In humans, osteomalacia
causes proximal muscle weakness, gait abnormalities and bone pain, which may be confused with
arthritic pain.41 This confusion seems likely to

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

8 M. R. Hardcastle and K. E. Dittmer

Figure 3. A graphical representation of the tumour FGF23

expression data from Table 3, where the x axis represents
the tumour sample number and the y axis indicates
expression of FGF23 relative to bone 2 in real-time qPCR.

be even more common in dogs, who cannot be

interrogated regarding the source of their pain,
and in whom the source of locomotive abnormalities or pain is often hard to define on clinical
examination.42,43 If radiographic examination of
painful sites was performed in a case of canine
TIO, the subtle signs of osteomalacia could be
overlooked given the difficulty that human radiologists have in diagnosing this disease on survey
radiographs,44 and the low index of suspicion
most practitioners would have for osteomalacia in
canines.1 Hypophosphatemia in veterinary patients
is not commonly recognized,45 and is generally
assigned significance only in animals with dramatic
clinical syndromes such as diabetic ketoacidosis,
re-feeding syndrome or hyperparathyroidism.46 It
can therefore be speculated that hypophosphatemia
would rarely be considered further in the biochemical assessment of a dog with osteoarthritis and/or
a soft tissue sarcoma. While none of the dogs in
this study were diagnosed with osteomalacia, most
of the FGF23 positive tumours were located in
easily palpable subcutaneous sites; their location
would have facilitated rapid surgical resection,
perhaps allowing insufficient time for osteomalacia
to become clinically apparent.
The RT-PCR positive tumours varied considerably in their original diagnosis, location, histological description and expression of FGF23 relative
to bone on real-time qPCR analysis. This contrasts
with the typical features of PMT-MCT in humans,
which as discussed earlier tend to have similar clinical features (e.g. obscure location),3 presumptive

diagnosis (e.g. haemangiopericytoma)15 and

histological features (e.g. grungy, myxoid to chondroid stroma).15 It is interesting to note that the
three tumours with the highest relative expression
of FGF23 (tumours 5, 32 and 43) had a more myxoid
to chondroid stroma than the other tumours tested;
also, tumour 5 was located in an obscure location
(muscle). A recent paper using real-time qPCR
found that FGF23 expression in human PMT-MCT
was on an average 10 000 times higher than in
non-TIO-associated mesenchymal tumours.47 The
expression difference between tumours 5, 32, 43
and the other FGF23-positive tumours in this
study varied up to 5590-fold, suggesting that these
tumours could have been responsible for TIO.
However, because TIO has never been diagnosed in dogs, it is necessary to consider alternative
explanations for our experimental findings. Even
if adequately expressed, it is well documented that
many proteins are never produced or exported by
cells. Their mRNA may be degraded or interfered
with preventing translation, and post-translational
degradation of proteins is also reported. White
et al.48 speculated that in normal humans, secreted
full-length FGF23 is rapidly cleaved by a serine
protease (one of the subtilisin-like proprotein convertases) resulting in its inactivation; they suggested that TIO was only seen when a tumour
secreted enough FGF23 to overcome this natural post-translational processing. It is notable that
another study comparing real-time qPCR expression of FGF23 in TIO and a range of normal
human tissues found that expression of FGF23 in
TIO-associated tumours was between 62 and 54 087
times greater than FGF23 expression in bone.17
Tumours 5, 32 and 43 enter the low end of this range
if compared to bone 1, while all the canine tumours
in this study fall well outside this range if compared
to bone 2. It is therefore difficult to determine if
the FGF23 expression in canine soft tissue sarcomas
would exert a clinical effect.
In humans, increased concentrations of FGF23
do not always lead to osteomalacia. Increases
in serum FGF23 have been detected in cancer
patients without hypophosphatemia or evidence of
osteomalacia49 ; in addition, Bahrami et al.50 identified a number of PMT-MCT and non-PMT-MCT
that were positive for FGF23 expression, but were

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

Expression of FGF23 by canine soft tissue sarcomas 9

not associated with TIO. The reasons for these findings are unclear, but it may be that inconsequential
FGF23 over-expression is also seen in dogs.
Whatever the explanation, it remains that FGF23
expression has been detected in nearly a third of the
canine soft tissue sarcomas included in this study.
To delineate which of the hypotheses discussed
earlier is correct, further work is required. Immunohistochemistry of FGF23 positive tumours would
confirm the production of FGF23 to protein level,
and determine tumour homology to reported case
series of human PMT-MCTs.15 Confirmation that
FGF23 protein is excessively produced by canine
soft tissue sarcomas could lead to prospective analysis of living patients diagnosed with soft tissue sarcoma on cytology or biopsy.
Canine FGF23 RNA was consistently amplified
from normal dog bone and was also amplified
from the lung, kidney, mesenteric lymph node
and thymus of normal dogs. FGF23 expression
in these organs has been documented in other
species17,21,51,52 ; expression in the one sample of
lung might also be explained by the presence of
inflammation, given recent studies suggesting
FGF23 expression in tissues by, or induced by
macrophages.53 . In this study, only intact female
dog soft tissue samples were used, so it would be
desirable to test a range of normal tissues from
male and desexed dogs, as there is currently uncertainty over the relationship between oestrogen and
FGF23.54 Further investigation will be required to
allow direct comparison of canine FGF23 tissue
expression to that documented in other species.
In summary, a range of canine soft tissue sarcomas were tested for expression of canine fibroblast
growth factor 23. Fifteen of forty-nine were positive
for FGF23, and three of these tumours had high
relative quantitative expression of fibroblast growth
factor 23 with some features similar to human
PMT-MCT, suggesting that TIO could be a heretofore unrecognized paraneoplastic complication in
some dogs with soft tissue sarcomas.

Acknowledgements
The authors gratefully acknowledge the original
diagnosis and supply of tumour samples by Adrienne French of New Zealand Veterinary Pathology,

and the Pathobiology Section of the Institute of Veterinary, Animal and Biomedical Sciences, Massey
University. We also acknowledge the advice and
support provided by Dr Laryssa Howe, and technical assistance from Evelyn Lupton and Eugene
Ndeki.
This work was generously supported by the
IVABS Postgraduate Research Fund and the Lewis
Fitch Research Fund.

Conict of interest
The authors declare no conflicts of interest.

References
1. Dittmer KE and Thompson KG. Vitamin D
metabolism and rickets in domestic animals: a
review. Veterinary Pathology 2011; 48: 389407.
2. LeVine DN, Zhou Y, Ghiloni RJ, Fields EL,
Birkenheuer AJ, Gookin JL, Roberston ID, Malloy PJ
and Feldman D. Hereditary 1,25-dihydroxyvitamin
D-resistant rickets in a Pomeranian dog caused by a
novel mutation in the vitamin D receptor gene.
Journal of Veterinary Internal Medicine 2009; 23:
12781283.
3. Ryan EA and Reiss E. Oncogenous osteomalacia.
Review of the world literature of 42 cases and report
of two new cases. The American Journal of Medicine
1984; 77: 501512.
4. Weiss D, Bar RS, Weidner N, Wener M and Lee F.
Oncogenic osteomalacia: strange tumours in strange
places. Postgraduate Medical Journal 1985; 61:
349355.
5. Evans DJ and Azzopardi JG. Distinctive tumours of
bone and soft tissue causing acquired
vitamin-D-resistant osteomalacia. Lancet 1972; 1:
353354.
6. Fukumoto S, Takeuchi Y, Nagano A and Fujita T.
Diagnostic utility of magnetic resonance imaging
skeletal survey in a patient with oncogenic
osteomalacia. Bone 1999; 25: 375377.
7. Dewitt CA, Collins MT and Cowen EW. Diffuse
pain, hypophosphatemia, and a subcutaneous
nodule. Journal of the American Academy of
Dermatology 2007; 57: 509512.
8. Takeuchi Y, Suzuki H, Ogura S, Imai R, Yamazaki Y,
Yamashita T, Miyamoto Y, Okazaki H, Nakamura K,
Nakahara K, Fukumoto S and Fujita T. Venous
sampling for fibroblast growth factor-23 confirms
preoperative diagnosis of tumor-induced
osteomalacia. Journal of Clinical Endocrinology and
Metabolism 2004; 89: 39793982.

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

10

M. R. Hardcastle and K. E. Dittmer

9. de Beur SMJ, Streeten EA, Civelek AC, McCarthy

EF, Uribe L, Marx SJ, Onobrakpeya O, Raisz LG,
Watts NB, Sharon M and Levine MA. Localisation of
mesenchymal tumours by somatostatin receptor
imaging. Lancet 2002; 359: 761763.
10. Dupond JL, Mahammedi H, Pri D, Collin F, Gil H,
Blagosklonov O, Ricbourg B, Meaux-Ruault N and
Kantelip B. Oncogenic osteomalacia: diagnostic
importance of fibroblast growth factor 23 and F-18
fluorodeoxyglucose PET/CT scan for the diagnosis
and follow-up in one case. Bone 2005; 36: 375378.
11. Halperin F, Anderson RJ and Mulder JE.
Tumor-induced osteomalacia: the importance of
measuring serum phosphorus levels. Nature Clinical
Practice Endocrinology & Metabolism 2007; 3:
721725.
12. Imanishi Y, Nakatsuka K, Nakayama T, Okamura T,
Kobayashi K, Nakayama K, Ishimura E, Inaba M and
Nishizawa Y. False-positive magnetic resonance
imaging skeletal survey in a patient with sporadic
hypophosphatemic osteomalacia. Journal of Bone
and Mineral Metabolism 2003; 21: 5759.
13. Aschinberg LC, Solomon LM, Zeis PM, Justice P and
Rosenthal IM. Vitamin D-resistant rickets associated
with epidermal nevus syndrome: demonstration of a
phosphaturic substance in the dermal lesions.
Journal of Pediatrics 1977; 91: 5660.
14. Salassa RM, Jowsey J and Arnaud CD.
Hypophosphatemic osteomalacia associated with
"nonendocrine" tumors. The New England Journal of
Medicine 1970; 283: 6570.
15. Folpe AL, Fanburg-Smith JC, Billings SD, Bisceglia
M, Bertoni F, Cho JY, Econs MJ, Inwards CY, de
Beur SMJ, Mentzel T, Montgomery E, Michal M,
Miettinen M, Mills SE, Reith JD, OConnell JX,
Rosenberg AE, Rubin BP, Sweet DE, Vinh TN, Wold
LE, Wehrli BM, White KE, Zaino RJ and Weiss SW.
Most osteomalacia-associated mesenchymal tumors
are a single histopathologic entity: an analysis of 32
cases and a comprehensive review of the literature.
American Journal of Surgical Pathology 2004; 28:
130.
16. Larsson T, Marsell R, Schipani E, Ohlsson C,
Ljunggren , Tenenhouse HS, Jppner H and
Jonsson KB. Transgenic mice expressing fibroblast
growth factor 23 under the control of the alpha1(I)
collagen promoter exhibit growth retardation,
osteomalacia, and disturbed phosphate homeostasis.
Endocrinology 2004; 145: 30873094.
17. Mirams M, Robinson BG, Mason RS and Nelson AE.
Bone as a source of FGF23: regulation by phosphate?
Bone 2004; 35: 11921199.
18. Sitara D, Razzaque MS, St-Arnaud R, Huang W,
Taguchi T, Erben RG and Lanske B. Genetic ablation

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

of vitamin D activation pathway reverses

biochemical and skeletal anomalies in Fgf-23-null
animals. The American Journal of Pathology 2006;
169: 21612170.
Bergwitz C and Jppner H. Regulation of phosphate
homeostasis by PTH, vitamin D, and FGF23. Annual
Review of Medicine 2010; 61: 91104.
Berndt T and Kumar R. Phosphatonins and the
regulation of phosphate homeostasis. Annual Review
of Physiology 2007; 69: 341359.
Shimada T, Mizutani S, Muto T, Yoneya T, Hino R,
Takeda S, Takeuchi Y, Fujita T, Fukumoto S and
Yamashita T. Cloning and characterization of FGF23
as a causative factor of tumor-induced osteomalacia.
Proceedings of the National Academy of Sciences of
the United States of America 2001; 98: 65006505.
Chong WH, Molinolo AA, Chen CC and Collins
MT. Tumor-induced osteomalacia.
Endocrine-Related Cancer 2011; 18: R53R77.
Larsson T, Zahradnik R, Lavigne J, Ljunggren ,
Jppner H and Jonsson KB. Immunohistochemical
detection of FGF-23 protein in tumors that cause
oncogenic osteomalacia. European Journal of
Endocrinology 2003; 148: 269276.
White KE, Jonsson KB, Carn G, Hampson G,
Spector TD, Mannstadt M, Lorenz-Depiereux B,
Miyauchi A, Yang IM, Ljunggren , Meitinger T,
Strom TM, Jppner H and Econs MJ. The autosomal
dominant hypophosphatemic rickets (ADHR) gene
is a secreted polypeptide overexpressed by tumors
that cause phosphate wasting. Journal of Clinical
Endocrinology and Metabolism 2001; 86: 497500.
Jonsson KB, Zahradnik R, Larsson T, White KE,
Sugimoto T, Imanishi Y, Yamamoto T, Hampson G,
Koshiyama H, Ljunggren , Oba K, Yang IM,
Miyauchi A, Econs MJ, Lavigne J and Jppner H.
Fibroblast growth factor 23 in oncogenic
osteomalacia and X-linked hypophosphatemia. The
New England Journal of Medicine 2003; 348:
16561663.
Lorenz-Depiereux B, Schnabel D, Tiosano D,
Husler G and Strom TM. Loss-of-function ENPP1
mutations cause both generalized arterial
calcification of infancy and autosomal-recessive
hypophosphatemic rickets. The American Journal of
Human Genetics 2010; 86: 267272.
Riminucci M, Collins MT, Fedarko NS, Cherman N,
Corsi A, White KE, Waguespack S, Gupta A,
Hannon T, Econs MJ, Bianco P and Gehron Robey
P. FGF-23 in fibrous dysplasia of bone and its
relationship to renal phosphate wasting. The Journal
of Clinical Investigation 2003; 112: 683692.
Rowe PS. Regulation of bone-renal mineral and
energy metabolism: the PHEX, FGF23, DMP1,

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

Expression of FGF23 by canine soft tissue sarcomas 11

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

MEPE ASARM pathway. Critical Reviews in

Eukaryotic Gene Expression 2012; 22: 6186.
Vogel P, Hansen GM, Read RW, Vance RB, Thiel M,
Liu J, Wronski TJ, Smith DD, Jeter-Jones S and
Brommage R. Amelogenesis imperfecta and other
biomineralization defects in Fam20a and Fam20c
null mice. Veterinary Pathology 2012; 49: 9981017.
Liu S and Quarles LD. How fibroblast growth factor
23 works. Journal of the American Society of
Nephrology 2007; 18: 16371647.
Crenshaw TD, Rortvedt LA and Hassen Z. Triennial
Growth Symposium: a novel pathway for vitamin
D-mediated phosphate homeostasis: implications for
skeleton growth and mineralization. Journal of
Animal Science 2011; 89: 19571964.
Bobeck EA, Burgess KS, Jarmes TR, Piccione ML
and Cook ME. Maternally-derived antibody to
fibroblast growth factor-23 reduced dietary
phosphate requirements in growing chicks.
Biochemical and Biophysical Research
Communications 2012; 420: 666670.
Finch NC, Geddes RF, Syme HM and Elliott J.
Fibroblast growth factor 23 (FGF-23) concentrations
in cats with early nonazotemic chronic kidney
disease (CKD) and in healthy geriatric cats. Journal
of Veterinary Internal Medicine 2013; 27: 227233.
Geddes RF, Finch NC, Syme HM and Elliott J. The
role of phosphorus in the pathophysiology of
chronic kidney disease. Journal of Veterinary
Emergency and Critical Care 2013; 23: 122133.
Geddes RF, Finch NC, Elliott J and Syme HM.
Fibroblast growth factor 23 in feline chronic kidney
disease. Journal of Veterinary Internal Medicine 2013;
27: 234241.
Williams TL, Elliott J and Syme HM. Calcium and
phosphate homeostasis in hyperthyroid cats associations with development of azotaemia and
survival time. Journal of Small Animal Practice 2012;
53: 561571.
Wood SH, Clements DN, McEwan NA, Nuttall T
and Carter SD. Reference genes for canine skin
when using quantitative real-time PCR. Veterinary
Immunology and Immunopathology 2008; 126:
392395.
Ayers D, Clements DN, Salway F and Day PJR.
Expression stability of commonly used reference
genes in canine articular connective tissues. BMC
Veterinary Research 2007; 3: 7.
Peters IR, Peeters D, Helps CR and Day MJ.
Development and application of multiple internal
reference (housekeeper) gene assays for accurate
normalisation of canine gene expression studies.
Veterinary Immunology and Immunopathology 2007;
117: 5566.

40. Deben C, Zwaenepoel K, Boeckx C, Wouters A,

Pauwels P, Peeters M, Lardon F, Baay M and
Deschoolmeester V. Expression analysis on archival
material revisited: isolation and quantification of
RNA extracted from FFPE samples. Diagnostic
Molecular Pathology: the American Journal of
Surgical Pathology, Part B 2013; 22: 5964.
41. Thacher TD and Clarke BL. Vitamin D insufficiency.
Mayo Clinic Proceedings 2011; 86: 5060.
42. McKee M. Lameness and weakness in dogs: is it
orthopaedic or neurological? In Practice 2007; 29:
434444.
43. Muir P. Physical examination of lame dogs.
Compendium on Continuing Education for the
Practicing Veterinarian 1997; 19: 11491161.
44. Krestan C and Hojreh A. Imaging of insufficiency
fractures. European Journal of Radiology 2009; 71:
398405.
45. Hooft KV, Drobatz KJ and Ward CR.
Hypophosphatemia. Compendium on Continuing
Education for the Practicing Veterinarian 2005; 27:
900911.
46. Schropp DM and Kovacic J. Phosphorus and
phosphate metabolism in veterinary patients.
Journal of Veterinary Emergency and Critical Care
2007; 17: 127134.
47. Imanishi Y, Hashimoto J, Ando W, Kobayashi K,
Ueda T, Nagata Y, Miyauchi A, Koyano HM, Kaji H,
Saito T, Oba K, Komatsu Y, Morioka T, Mori K,
Miki T and Inaba M. Matrix extracellular
phosphoglycoprotein is expressed in causative
tumors of oncogenic osteomalacia. Journal of Bone
and Mineral Metabolism 2012; 30: 9399.
48. White KE, Carn G, Lorenz-Depiereux B,
Benet-Pages A, Strom TM and Econs MJ.
Autosomal-dominant hypophosphatemic rickets
(ADHR) mutations stabilize FGF-23. Kidney
International 2001; 60: 20792086.
49. Tebben PJ, Kalli KR, Cliby WA, Hartmann LC,
Grande JP, Singh RJ and Kumar R. Elevated
fibroblast growth factor 23 in women with
malignant ovarian tumors. Mayo Clinic Proceedings
2005; 80: 745751.
50. Bahrami A, Weiss SW, Montgomery E, Horvai AE,
Jin L, Inwards CY and Folpe AL. RT-PCR analysis
for FGF23 using paraffin sections in the diagnosis of
phosphaturic mesenchymal tumors with and
without known tumor induced osteomalacia.
American Journal of Surgical Pathology 2009; 33:
13481354.
51. Yoshiko Y, Wang H, Minamizaki T, Ijuin C,
Yamamoto R, Suemune S, Kozai K, Tanne K, Aubin
JE and Maeda N. Mineralized tissue cells are a

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

12

M. R. Hardcastle and K. E. Dittmer

principal source of FGF23. Bone 2007; 40:

15651573.
52. Liu S, Guo R, Simpson LG, Xiao Z-S, Burnham CE
and Quarles LD. Regulation of fibroblastic growth
factor 23 expression but not degradation by PHEX.
Journal of Biological Chemistry 2003; 278:
3741937426.
53. van Venrooij NA, Pereira RC, Tintut Y, Fishbein
MC, Tumber N, Demer LL, Salusky IB and

Wesseling-Perry K. FGF23 protein expression in

coronary arteries is associated with impaired kidney
function. Nephrology, Dialysis, Transplantation 2014:
18. January 23. [Epub ahead of print].
54. Wetmore JB. The link between estrogen and
fibroblast growth factor 23. American Journal of
Kidney Diseases 2011; 58: 695696.

2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105