Pandey at Alii Ethanol re-precipitation removes PCR inhibitors

Physical Anthropology

167 172

Ethanol re-precipitation removes PCR

inhibitors from Ancient DNA extract
Rajeev Kumar Pandey 1 2, Deepankar Pratap Singh 3 5,
Godi Sudhakar 2, Vadlamudi Raghavendra Rao 1 4 *

Abstract
One of the major problems in ancient DNA work is the presence of inhibitory substances, which hampers Taq
polymerase activity. Therefore analysis of ancient DNA sample is very challenging. Here we describe a simple and
competent ethanol re-precipitation based protocol for the purification of DNA from ancient bones and tissues. The
efficiency of this procedure has been demonstrated on 600 years old biological samples provided by Anthropological
Survey of India (Himalaya region). This suggests that re-precipitation of ancient DNA extracts removes PCR
inhibitors and increases the success rate of amplification.
Key words: PCR inhibitors, Ancient DNA, Re-precipitation, PCR

INTRODUCTION
Analysis of contemporary organisms can provide indirect evidence of the evolutionary history, and the
reconstructions remain tentative if they cannot be checked against fossil records. Although working
with ancient samples could unravel the molecular evolution, there are several technical limitations that
make the study extremely difficult. Very small amount of DNA, the decay of molecules over time,
post-mortem modifications and contamination with DNA from other organisms has proven to be
considerable hurdles for these studies (Hansen et al. 2006; Zhang and Wu 2005; Paabo 1989; Paabo.
et al. 2004; Binladen et al. 2005; Hanni et al. 1995; Tbor Kalmar et al. 2000; Willerslev and Cooper
2005; Hebsgaard et al.2005; Kaestle. and Horsburgh. 2002). A major factor, which affects PCR
amplification, is the presence of inhibitors, which vary between state of preservation. These inhibitors
are result of contaminants from the surrounding environment of samples in the form of humic acid,
1 Anthropological survey of India, Mysore, India
2 Department of Human Genetics, Andhra University, Visakhapatnam 530003, India
3 S2 Functionnel Genomics,IBENS, UMR8197,Ecole Normale Superieure 46, rue d'Ulm, 75005 Paris, France
4 Department of Anthropology, University of Delhi, Delhi 110007, India
5 Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad-500007,India
* Correspondence author: Dr. V.R.Rao, Department of Anthropology, University of Delhi; email: drraovr2@gmail.com
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN 1973-2870

173

Pandey at Alii Ethanol re-precipitation removes PCR inhibitors

fulvic acid, hydroxi-apatite, tannin and contaminating DNA, or from degradation in the biological
sample itself. This could also be due to influence of terrestrial heat (Hansen et al. 2006; Zhang and Wu
2005; Paabo et al. 2004; Shinoda et al.2006). Various oxidative processes, which modify the ancient
DNA, are responsible for the low recovery rate of undamaged DNA from the archeological remains.
Collagen type-I and Maillard products are the inhibitory factors of PCR amplification in case of bone
(Paabo 1989; Paabo et al. 2004; Willerslev and Cooper 2005; Kemp . and Smith et al.2005; Kaestle.
and Horsburgh 2002).
In most of the published protocols almost the extraction procedures are same (Binladen et al. 2005;
Hanni et al. 1995; Ovchinnikov and Goodwin et al. 2001; Cappellini et al.2004). After extraction the
aqueous phase was concentrated with micro concentrators, precipitated by silica suspension/glass milk
(Gene Clean Spin Wash) (Shinoda et al.2006; Thomas et al. 2004). Some commercial kits are also
available which are dedicated for the extraction of ancient DNA such as Gene Clean Spin Kit for
Ancient DNA (BIO101). Another study shows that sodium-acetate-isopropanol extraction was possibly
better than phenol-chloroform method which gives three times more yield than glass milk method
(Hanni et al. 1995). One more protocol was published, in which Dextran blue is used, for removing
PCR inhibitors with selective ethanol precipitation (Kalmar et al. 2000).
Despite the availability of several methods for the analysis of ancient DNA samples, still the problems
of extraction and amplification remains obscure. The efficiency of every protocol has its own
limitations, depending upon the condition of the experimental specimen. We have observed that the
main problem dealing with ancient DNA is the unsuccessful/irreproducible amplification. Sometimes
we succeed to amplify some samples; however, these samples are not reproducible after some hours.
This may be due to generation of some sort of inhibitors in the DNA solution over the time. Even if
one gets the fair amount of DNA, no one can predict that it can be amplified owing to accumulation
of several PCR inhibitors. Every extract coming from these precious specimens is worthy and we
cannot thrust them aside.
Therefore, we have been trying to develop a simple protocol to overcome the PCR problem and
successfully developed a simple and efficient re-precipitation method for ancient DNA amplification. A
very simple and efficient re-precipitation method is described in this study for the purification of DNA
from ancient bone samples. In our adjudication this protocol is better in so many perspectives like; reuse of the extracts which were not giving amplification but DNA is there, loss of DNA in the process
is very less, no involvement of hazardous organic solvents, special devices, or enzymes which increases
the possibility of contamination and DNA degradation.
MATERIALS AND METHODS
Ancient specimens
Ancient Human bone samples were kindly provided by Anthropological Survey of India and all
experiment was performed in ancient DNA laboratory of the Centre for Cellular and Molecular
Biology (CCMB), Hyderabad. These samples are derived from Himalayan region of India and was
preserved at 4C for further work
Contamination Precautions
Standard contamination precautions strictly followed in ancient DNA studies were performed during
the experiments (Paabo et al. 2004; Kalmar et al. 2000; Willerslev and Cooper 2005; Kemp. and Smith
et al.2005; Kaestle and Horsburgh 2002; Cappellini et al.2004; Shinoda et al.2006; Thomas et al.2004;
Kemp and Smith 2005; Willerslev , Hansen . and Poinar 2004).
DNA Extraction
About 3 mm of cortical bone surface is removed with a sterile scalpel from all samples, followed by
immersion in 10% bleach solution for 10 min and washing with 70% alcohol. The cleaned bone
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN 1973-2870

174

Pandey at Alii Ethanol re-precipitation removes PCR inhibitors

fragments were mechanically pulverized into a fine meal in sterile pestle-mortar. The samples (500mg)
were then soaked in 5ml of 0.5M EDTA (pH 8.0) with 200l of 20mg/ml Proteinase K and 120l of
10% SLS (Sodium Lauryl Sulphate) at 55C for overnight.
Two different methods were employed for the extraction of DNA from the powdered samples. In the
first method decalcified samples were lysed in 2ml of Lysis buffer (10mM tris HCl ph 8.0, 1mM NaCl)
at 60C for 24 hrs, which later subjected to followed by phenol, phenol-chloroform, chloroformisoamyl alcohol extraction. At last, the aqueous phase was concentrated by centrifugation driven dialysis
using Centricon-30 micro concentrators from Amicon. The concentrate, which was about 0.7ml,
purified by Gene Clean Spin Kit and later eluted in 0.1m Tris-EDTA. In the second method extraction
was done with Gene Clean Kit for Ancient DNA (BIO 101). The pellet of decalcified bone samples
were used for DNA extraction with kit. Approximately 40l of DNA extract was obtained and
visualized on 1% agarose gel (Figure 1).

Fig. 1

Agarose DNA electrophoresis (1%): [Lane 1: phage DNA marker, lane 2: DNA sample extracted by Gene Clean Kit, lane 3: Blank, lane
4: DNA sample extracted by phenol- Chloroform method].

Re-precipitation of DNA extracts

As we found that the DNA samples extracted using the above methods failed with PCR amplification,
we have introduced a re-precipitation protocol for purification. For the handiness, volume of extract
was made up to 200l and equal volume of chloroform-iso-amyl alcohol was added to extract. The
aqueous phase, after centrifugation at 12,000 rpm for 15 min, was transferred to 1.5ml eppendorf s
tube and 1/23rd volume of 3M-sodium acetate, 2 volume of ethanol was added and kept at -20C for
overnight. To pellet, solution was centrifuged at 14,000 rpm for 15 min. supernatant discarded and
pellet washed with 85% ethanol and spin again at 14,000 rpm for 10 min. Supernatant discarded and
allowed to dry and dissolved in 40-50 l of 0.1M Tris-EDTA.
PCR and Sequencing
The PCR amplification was carried out in 20l reaction volume containing 1L of re-precipitated
template, 100M each of dNTPs, 4 pM of each primer, 1X PCR buffer [100mM Tris-HCL, pH 8.3 (at
250C), 500mM KCl, 15 mM MgCl2, 0.01%(w/v) gelatin, bovine serum albumin (BSA) (10 mg/ml)
(New England Bio Labs) and 0.5 units of AmpliTaq Gold (Applied Biosystems). Bovine serum
albumin was used as it can bind to various types of PCR inhibitors that might have carried during
extraction. Amplification of Hypervariable Region (HV region) of bone samples was carried out using
the primers listed (Table 1).
In order to sequence, the amplicons were treated with exonuclease-1 and Shrimp Alkaline Phosphatase
(USB, Cleveland, OH) and sequenced using an automated ABI 3730 DNA Analyzer (Applied
Biosystems).
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN 1973-2870

175

Pandey at Alii Ethanol re-precipitation removes PCR inhibitors

RESULTS AND DISCUSSION

Since the commencement of ancient DNA work several methods have been demonstrated to make
them easily extractable, amplifiable and inhibitors free (Hanni et al. 1995; Kalmar et al. 2000). However,
still there is no such protocol, which fulfills all these demands in one. One, which passes one hurdle,
fails in second. Hanni et al. 1995, published an isopropanol-based precipitation method (Hanni et al.
1995) that eliminates time-consuming dialysis and microconcentrator step. Kalmar et al. 2000
demonstrated that precipitation of sample with Dextran blue removes PCR inhibitors as well as save
the time of decalcification step (Kalmar et al. 2000). Hanni et al. 1995, noticed the presence of blurring
blue florescence (derived from Maillard products of reducing sugars), which migrates at the level of
500bp DNA molecule, and they correlated them with PCR inhibitors activity. In our case we didnt get
such type of florescence at 500bp (Figure 1) level in our samples, but still they were showing inhibitory
activity.
We have demonstrated that 1l of ancient DNA extract can inhibit the PCR reaction using modern
DNA as a template. If the ancient DNA extract is progressively diluted (1/10, 1/7, 1/5, 1/2) and
added to the reaction mixture containing contemporary DNA AmpliTaq Gold polymerase activity was
gradually restored. It means that inhibitors are present in fair amount and with gradual dilution
inhibition was decreased. The same sample was introduced for amplification with mitochondrial DNA
primers (Table n. 1)

Table 1
Primer Name

Primer Sequence

F15996

5CTCCACCATTAGCACCCAAAGC 3

R16410

5GCGGGATATTGATTTCACGG 3

Sequences of the primer designed for the ancient DNA study

Which was purified by the present method and good yield of PCR product (5l were loaded on 2%
agarose gel) was clearly seen that the re-precipitated extract gives amplified products of the expected
size after amplification (Figure 2). So, the method works for the samples, which were in much battered
condition and proves to be very effective method for ancient DNA.

Fig. 2

Agarose DNA electrophoresis (2%) of PCR reaction. [Lane 1: phage DNA marker (L), lanes 2-7: Positive control (P), lanes 8-16:
negative control samples (N), lane 17: ancient DNA sample (S13)].

Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN 1973-2870

176

Pandey at Alii Ethanol re-precipitation removes PCR inhibitors

There was no need of two consecutive PCR amplification i.e. re-amplification, as we were getting good
yield in first amplification (40 cycles). The original extract has not given any amplification but the reextracted samples has given proper amplification and interestingly we succeeded to amplify a long
stretch of 424 base pairs which is not usual case with ancient DNA samples (Kalmar et al. 2000). This
could be because of proper purification of DNA, which removed prominent PCR inhibitors efficiently.
This will reduce the time and labour in PCR and sequencing of two overlapping sets into a single
amplicon stretch of same size. All the amplified PCR products of varied lengths were successfully
sequenced and assembled with Cambridge reference sequence (r-CRS) using autoassembler (ABI),
which shows mitochondrial identity (Figure 3).
Fig. 3

B
Assembly of ancient Sample with r-CRS: Two Polymorphism were found in our ancient sample (A) g.16147: C>T; (B) g.16223: C>T

In this paper we have not demonstrated any full-length extraction protocol but a very simple and wellorganized re-precipitation method, which is capable of purifying ancient DNA extract with a little loss
during purification. We also proved efficiency of this method on the extracts, which have enough
amount of DNA but were not amplifiable; moreover we succeed to get an amplification of 424 base
pairs long stretch which proves the efficiency of this method. This could be very useful for the
purification of ancient DNA extracts and getting long stretch amplification from ancient DNA.

Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN 1973-2870

177

Pandey at Alii Ethanol re-precipitation removes PCR inhibitors

Acknowledgment
The authors thank Dr K.Thangaraj, Scientist, Centre for Cellular and Molecular Biology, Uppal Road,
Hyderabad, India for providing all the lab facilities. The financial assistance of Anthropological survey
of India is gratefully acknowledged.

References
Binladen J., Wiuf C., Thomas M., Gilbert P., Bunce M., Barnett R., Larson G., Greenwood A., Haile J.,
Simon Y. W. Ho, Hansen A. and Willerslev E. (2005): Assessing the fidelity of ancient DNA sequences
amplified from nuclear genes, Genetics, 172: 733741.
Cappellini E., Chiarelli B., Sineo L., Casoli A. (2004): Biomolecular study of the human remains from
tomb 5859 in the Etuscan necropolis of Monterozzi, Tarquinia (Viterbo, Italy), Journal of Archaeological
Science.31:603-612.
Hanni C., Brousseaul T., Laudet V. and Stehelin D. (1995): Isopropanol precipitation removes PCR
inhibitors from ancient bone extracts, Nucleic Acids Research. 23: 881-882.
Hansen A. J., Mitchell D. L., Wiuf C., Paniker L., Brand T. B., Binladen J., Gilichinsky D. A., Rnn R.,
and Willerslev E. (2006): Crosslinks rather than strand breaks determine access to ancient DNA
sequences from frozen sediments. Genetics 173:11751179.
Hebsgaard M. B., Phillips J. M. and Willerslev E. (2005): Geologically ancient DNA: fact or artefact?
Trends in Microbiology. 13: 212-220.
Kaestle. F.A. and Horsburgh K. A., (2002): Suppl, Ancient DNA in Anthropology: methods,
applications, and ethics, Am. J. Phys. Anthropology. 35: 92-130.
Kalmar T, Bachrati C. Z., Marcsik A. and Rasko I. (2000): A simple and efficient method for PCR
amplifiable DNA extraction from ancient bones, Nucleic Acids Research. 28: e67.
Kemp B. M. and Smith D. G., (2005): Use of bleach to eliminate contaminating DNA from the surface
of bones and teeth, Forensic Science international. 154: 53-61.
Ovchinnikov I. and Goodwin W. (2001): The Isolation and identification of Neanderthal Mitochondrial DNA
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN 1973-2870

178

Pandey at Alii Ethanol re-precipitation removes PCR inhibitors

Profiles in DNA, www.promega.com; 7-9.

Paabo S. (1989): Ancient DNA; extraction, characterization, molecular cloning and enzymatic
amplification, Proc. Natl. Acad. Sci. USA, 86: 1939-1943.
Paabo S., Poinar H., Serre D. ,Despres V., Juliane H., Rohland N. ,Kuch M., Krause J., Vigilant L.,
Hofreiter M. (2004:) Genetic analyses from ancient DNA. Annu. Rev. Genet. 38:645-79.
Shinoda Kaiser. I., Adachi N., Guillen S. and Shimada I. (2006): Mitochondrial DNA Analysis of
ancient Peruvian Highlanders, Am. J. Phys. Anthropology. 131:98-107.
Thomas M., Gilbert P., Cuccui J., White W., Lynnerup N., Titball R. W., Cooper A. and Prentice M. B.,
(2004): Absence of yersinia pestis-specific DNA in human teeth from five European excavations of
putative plague victims, Microbiology. 150:341-354.
Willerslev E., Andres H. J. and Poinar H. N. (2004:) Isolation of nucleic acids and cultures from fossil
ice and permafrost, Trends in Ecology and Evolution. 19:141-147.
Willerslev E. and Cooper A., Ancient DNA. (2005): Pro. R. Soc. B. 272: 3-16.
Zhang L. and Wu Q. (2005): Single gene retrieval from thermally degraded DNA, J. Bio. Sci, 30:599
604.

Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN 1973-2870

179