ORIGINAL ARTICLE

Pancreatic Enzyme Extract Improves Survival in Murine

Pancreatic Cancer
Murat Saruc, MD,* Silke Standop,* Jens Standop, MD,* Fumiaki Nozawa, MD, PhD,*
Atsushi Itami, MD, PhD,* Krishan K. Pandey, PhD,* Surinder K. Batra, PhD,*
Nicholas J. Gonzalez, MD, Pierre Guesry, MD, and Parviz M. Pour, MD*
Objectives: The disappointing current therapeutic approaches for
pancreatic cancer (PC) represent an urgent need for the development
of novel methods to control the disease. Based on a recent report on
the effectiveness of pancreatic enzyme therapy, we examined the effect of porcine pancreatic enzyme extracts (PPE) on human PC xenografts in nude mice.

Methods: The malignant human PC cell line AsPC1 was transplanted into the pancreas of male beige XID nude mice that were
treated or not with PPE in drinking water. The survival, size, and
volume of tumors, plasma pancreatic enzyme levels, fecal fat, and
urine were examined as were the expression of transforming growth
factor , insulinlike growth factor-I, epidermal growth factor, epidermal growth factor receptor, apoptosis, and proliferation rate of tumor
cells.
Results: PPE-treated mice survived significantly longer than the
control group (P < 0.002). Tumors in the PPE-treated group were
significantly smaller than in the control group. All mice in the control
group showed steatorrhea, hyperglucosuria, hyperbilirubinuria, and
ketonuria at early stages of tumor growth, whereas only a few in the
treated group showed some of these abnormalities at the final stage.
There were no differences in the expression of growth factors, epidermal growth factor receptor, or the apoptotic rate between the tumors
of treated and control mice.
Conclusions: The treatment with PPE significantly prolongs the
survival of mice with human PC xenografts and slows the tumor
growth. The data indicate that the beneficial effect of PPE on survival
is primarily related to the nutritional advantage of the treated mice.

Received for publication August 6, 2003; accepted October 3, 2003.

From the *Eppley Institute for Research in Cancer and Allied Diseases, Departments of Biochemistry and Molecular Biology and Pathology and
Microbiology, University of Nebraska Medical Center, Omaha, Nebraska;
private practice, New York, New York, Nestle Research Center,
Lausanne, Switzerland.
This work was supported by the Nestle Company and, in part, by an American
Cancer Society Special Institutional grant. Dr. Saruc is the recipient of a
scholarship from the Turkish Gastroenterology Foundation.
Reprints: Parviz M. Pour, MD, The Eppley Institute for Research in Cancer
and Allied Diseases, 986805 Nebraska Medical Center, Omaha, NE
68198-6805 (e-mail: ppour@unmc.edu).
Copyright 2004 by Lippincott Williams & Wilkins

Pancreas Volume 28, Number 4, May 2004

Key Words: pancreatic cancer, xenograft, nude mice, pancreatic enzyme, survival, therapy
(Pancreas 2004;28:401412)

espite advances in the clinical and biologic areas of pancreatic cancer (PC), the disease has maintained its deadly
course. It is still the fifth leading cause of cancer death in both
men and women, accounting for more than 27,000 deaths annually in the United States.1 The most common symptoms of
the disease, jaundice, abdominal pain, and weight loss together
with other presenting factors, are nonspecific for this disease.
Thus, the diagnosis of PC at an early stage is difficult at best
and requires an extensive diagnostic workup, including exploratory surgery.2 In the majority of patients who are referred
to the hospital, the tumor is generally in an advanced stage, has
invaded the surrounding tissues, or has metastasized.
The only effective therapy, surgery, is still limited to
about 25% of the patients, and even in these patients, cancer
recurrence has remained inescapable.3 Although the operative
mortality over the years has decreased, the postoperative survival has remained below 20% at 5 years.47 These features
highlight the urgent need for the establishment of effective
therapeutic modalities because the current conventional
therapy has proven ineffective.
Among the new chemotherapeutic drugs, gemcitabine
has been shown to provide a clinical benefit in the treatment of
PC compared with 5-fluorouracil (5-FU).2 This benefit has
been limited mainly to the palliation of disease symptoms including pain intensity, analgesic consumption, Karnofsky performance status, and weight gain.8,9 In a study, the only benefit
for gemcitabine-treated patients was an approximate 1-month
increase in median survival time compared with the survival of
patients treated with 5-FU.9 The probability of surviving 1
year for those receiving gemcitabine was 18% compared with
2% for those receiving 5-FU.9 These survival numbers are,
however, not significantly different. Also, the combination of
chemotherapy and radiation therapy for PC has remained a major toxicity problem.10
Because of the limited scientific design and the lack of
particularly efficacious therapy, the role of adjuvant therapy in

401

Pancreas Volume 28, Number 4, May 2004

Saruc et al

PC remains largely unestablished.1113 Although neoadjuvant

therapy has been advocated to improve curative resection rates
and survival, it carries its own morbidity. As a result, the prognosis of patients with PC has remained extremely poor.3 The
pitfalls of therapy in experimental models also highlight the
inherent resistance of PC cells to any conventional therapy.
Alternative medicine has been employed in hard-tocontrol cancers with some success. Recently, a significant increase in survival rates has been reported in PC patients who
were given high doses of porcine lyophilized pancreas, containing 3080 USP units of proteolytic activity per milligram
and 1540 U of lipolytic activity per milligram.14 In this study,
81% of the patients survived 1 year, 45% survived 2 years, and
36% survived 3 years.14 These results are significantly above
the 25% survival rate at 1 year and 10% survival rate at 2 years
for all stages of pancreatic adenocarcinoma reported in the National Cancer Database.15 The data were generated from 11
patients in a private clinic and no controls were used. In the
present studies, we examined the therapeutic efficacy of the
same enzyme used in the clinical study in the nude mouse
model with human PC cell xenografts.

MATERIALS AND METHODS

Animals
Thirty 5- to 6-week-old, male beige XID nude mice from
the National Cancer Institute were used. They were housed in
plastic cages on autoclaved corncob bedding (Anderson 1/8in. bed corncob autoclavable bedding) in groups of 5 and were
maintained in a controlled, germ-free environment (temperature, 2226C; humidity, 44%64%; 12-hour light/dark
cycles) in sterilized plastic containers covered with polyester
bacterial air filters. All mice had free access to commercial
food (Teklad 8064 Sterilizable Rodent Chow; Harland Teklad,
Madison, WI) and autoclaved water.

Methods
Two separate experiments were performed. The first
study was planned as a survival study followed by a comparative study on the cancer growth rate and some laboratory data.

Orthotopic PC Cell Inoculation

Under Nembutal anesthesia, PC cells (AsPC1), which
were originally derived from the ascites of the patient with PC
and exhibit an extremely malignant behavior in vitro (we have
shown that it is resistant to the apoptotic effect of TRAIL),16
were injected into the splenic lobe of the pancreas by a method
developed in our laboratories.17 Briefly, the abdomen was
opened at the right upper quadrant at the projection of the duodenum instead of the left upper quadrant. This technique
avoids the adherence of the growing tumor in the splenic lobe
to the laparotomy wound at the projection of that lobe. Then,
the pancreas was pulled out and 1 106 tumor cells were in-

402

jected into the splenic lobe with a 12-gauge syringe. The injection was carefully performed to avoid spillage of cells into
the peritoneal cavity or the liver. The pancreas and attached
spleen were replaced to the original positions, and the wound
was closed.

Study 1 (Survival Study)

Thirty male mice were divided into 2 equal groups. Both
groups received human PC cells, AsPC1, injected into their
pancreas as described above. One week after the injection of
tumor cells, when tumor growth was evident by palpation of
the abdomen at the projection of the transplantation area, the
treatment group received PPE in water at a dose of 400 mg/kg
body weight. The dose of PPE corresponded to that used in
patients.14 The control group was given only autoclaved tap
water. Water intake was measured daily and body weight
weekly. The concentration of PPE solution was adjusted
weekly according to their water intake and body weight
changes. PPE intake per day was calculated for each mouse.
Mice were closely observed during the study and examined
periodically for tumor growth by palpating the abdomen at the
projection of the tumor inoculation site.
Animals were allowed to die spontaneously, except for
the last 2 animals from the treatment group, which were killed
on day 62, when no control mice were alive. A complete necropsy was performed in each mouse, and all abdominal and
thoracic tissues were examined carefully for abnormalities and
metastases. The pancreas was removed, and the dimensions,
volume, and weight of tumors (isolated and freed from the surrounding tissues) were measured by previously reported methods.18 The liver, kidneys, and lungs were sliced in 2-mm thick
slices for the detection of possible metastases. All tissues were
fixed in buffered formalin, and the pancreas, duodenum, liver,
kidneys, lungs, and any tissues with abnormalities were processed for histology by conventional methods. The histologic
evaluation of the tissues was performed by 2 pathologists in a
blinded fashion.

Study 2 (Tumor Growth Study)

The same study, using the same number of mice and procedures, was carried out 2 months after the termination of the
first experiment. Tumors were carefully isolated from the surrounding pancreatic tissue, if recognizable, as well as from
connective tissue as much as possible. The tumor size and
weight were determined in 2 mice from each group on day 52
as well as 2 mice from the control group and 5 mice from the
treatment group on day 60. In these mice, plasma amylase and
lipase levels were also examined. The fecal fat content and the
urinary ketone, glucose, and bilirubin of all mice were examined weekly.
In all mice, a complete necropsy was performed and tissues were examined as in the first study. All tumors from mice
that were euthanized at intervals were examined by immuno 2004 Lippincott Williams & Wilkins

Pancreas Volume 28, Number 4, May 2004

histochemistry and polymerase chain reaction (PCR) for the

expression of transforming growth factor (TGF)-, insulinlike
growth factor (IGF)-I, epidermal growth factor receptor
(EGFR), apoptotic rate, and cell proliferation markers.

Cell Culture
AsPC1 cells were grown in RPMI 1640 supplemented
with 10% heat-inactivated fetal bovine serum (FBS), 100
U/mL penicillin and 100 g/mL streptomycin. Cells were
maintained at 37C in a humid chamber with 5% CO2 conditions. At the time of their use, the viability of these cells, as
determined by the trypan blue staining method, was over 98%.
RPMI 1640, FBS and penicillin-streptomycin were purchased
from Gibco BRL (Grand Island, NY).

Porcine Pancreatic Enzyme

The PPE preparation (Nutritional Services, Inc., CA)
was used clinically in patients.14 Specifically, porcine lyophilized pancreas containing 3080 USP units of proteolytic activity per milligram and 1540 U of lipolytic activity per milligram was used. PPE differs from the conventional commercial enzyme preparation in that it is not alcohol extracted and
vacuum distilled, a procedure that produces a very purified
protein extract, removing some yet unknown active factors,
cofactors, protective factors, enhancers, and so on. PPE in the
less activated form is far more stable in the gut, and with the
component of unknown as well as known cofactors, the
product is more efficient in controlling the digestion. According to the supplier, each lot of the enzyme preparation had been
assayed qualitatively and bacteriologically. Comparison of the
activity of PPE with the commercial preparation Pancreatin is
summarized in Table 1. The comparative assay performed at
the Laboratories of Nestle in Lausanne, Switzerland, have
shown that Pancreastatin has more proteolytic activities (trypsin, -chymotrypsin, and elastase) than PPE. On the contrary,
PPE has a higher -amylase, aminopeptidase (leucyl-, valylAP), acid phosphatase, and phosphoamidase activity than Pancreatin. It is assumed that the differences are due to the conditions of tissue extraction and drying. The rapid freeze-drying
associated with PPE would favor release, activation, and preservation of lysosomal enzymes (eg, acid phosphatase and glycosidases) and could better preserve the activities of pancreatic
antiprotease inhibitors.
The fresh batch, which was kept at 4C immediately after delivery, was replaced every 3 months.
Because feeding of the PPE via serial gavage procedures
several times daily (consistent with the clinical therapy)14 resulted in morbidity and mortality, the enzyme was supplemented in drinking water. We determined the activity of PPE
in water in various conditions to optimally preserve the enzyme activity over 24 hours in water. PPE, which was delivered in flake form and not soluble in water, was ground by a
tissue tearer at low speed. One gram of the ground PPE could
2004 Lippincott Williams & Wilkins

Pancreatic Cancer Treatment by Pancreatic Enzymes

TABLE 1. Comparative Activity of Enzymes Between

Commercial Preparation (Pancreatin) and PPE
Enzyme

Pancreatin

PPE

Control
Alkaline phosphatase
Esterase (C4)
Esterase Lipase (C8)
Lipase (C14)
Leucin arylamidase
Valine arylamidase
Cystine arylamidase
Trypsin
-Chymotrypsin
Acid phosphatase
Phosphoamidase
-Galactosidase
-Galactosidase
-Glucuronidase
-Glucosidase
-Glucosidase
N-acetyl--glucosaminidase
-Mannosidase
-Fucosidase

0.00
1.25
1.75
2.25
1.00
0.50
0.50
1.00
5.00
5.00
0.50
0.75
0.00
4.00
1.75
1.00
0.50
0.00
0.50
0.00

0.00
1.00
2.00
3.00
1.50
5.00
2.50
1.00
3.00
2.50
4.50
4.50
0.00
4.50
1.00
2.00
1.25
1.00
1.50
0.75

Activities were assayed by the Api Zym system (Bio Merieux SA, France),
which is a semiquantitive microassay system.

then be dissolved in water at 1:10 mL in 4C water and kept at

room temperature. Samples were taken for the determination
of amylase, lipase, and trypsin at 0, 4, 12, and 24 hours. The
procedure was repeated in every batch to check enzyme activity. Cold water was used for the enzyme solution to avoid possible enzyme degradation at room temperature. For comparison, samples were also taken from a solution where PPE was
dissolved in water at room temperature. The PPE solution was
prepared freshly every day by dissolving the extract in autoclaved water.

Histology and Immunohistochemistry

Tumor tissues derived from nude mice were embedded
in paraffin and cut into 4-m serial sections. One set of sections
was stained with hematoxylin and eosin for the determination
of morphologic type, invasion, extent of necrosis, and metastases. For adequate screening, in the immunohistochemically
processed slides, depending on the size of the tumors, the same
areas of tumors (as many as possible) were marked with a red
circle on the back of each of the serial sections. In each section,
prepared by different staining methods, the identical areas
were subjected to evaluation. In each area, the cells positive for
the staining were counted (at least 1000 cells per slide). Two
pathologists independently counted the cells, and the average

403

Pancreas Volume 28, Number 4, May 2004

Saruc et al

number of cells counted was regarded as the representative

number. When differences in the results of these pathologists
exceeded 20%, the slides were reevaluated.
All immunohistochemical examinations were carried
out using an avidin-biotin-peroxidase complex (ABC)
method.19 Antibodies used in this study are summarized in
Table 2.

Apoptosis Assay
Apoptosis was measured on paraffin-embedded tissue
sections using the TUNEL staining. TUNEL staining was performed using the DeadEnd TUNEL System (Promega, Madison, WI), according to the manufacturers instructions. From
formalin-fixed and paraffin-embedded specimens, 4-m thick
sections were prepared on glass slides. The specimens were
deparaffinized in xylene for 5 minutes 2 times and were then
hydrated in 100, 95, 85, 70, and 50% ethanol, washed with
0.85% NaCl, and finally in phosphate-buffered saline (PBS)
(Gibco BRL). These specimens were fixed in 4% paraformaldehyde solution and washed with PBS. These were treated
with 20 g/mL proteinase K (Promega) for 20 minutes and
refixed by 4% paraformaldehyde solution. After washing with
PBS, equilibration buffer was added. These specimens were
treated with 100 L of labeling reagent at 37C for 60 minutes.
This reaction was terminated by 2 SSC. After washing by
PBS, we blocked the endogenous peroxidases by 0.3% hydrogen peroxidase for 5 minutes at room temperature. These
specimens were incubated with streptavidinhorseradish peroxidase solution at room temperature for 30 minutes. After
washing in PBS at room temperature, specimens were visualized with DAB substrate, DAB chromogen, and hydrogen peroxidase solutions. After rinsing in deionized water, these
specimens were counterstained with hematoxylin and then
mounted. The results were observed with an optical microscope. For the evaluation of the positive cell ratios, a total of at
least 300 cells in 1 optical field was counted 3 times, and the
mean value was taken as the apoptotic ratio.

Reverse Transcriptase PCR (RT-PCR)

Total RNA was isolated from 2 AsPC1 xenografts in
treated mice, from 4 untreated mice (control), and from the

native cultured AsPC1 cells. Thin sections of tumor tissue

were cut out and lysed in guanidinium isothiocyanate (GITC)
for 5 hours with shaking at room temperature. The lysate was
overlaid on cesium chloride and centrifuged for 20 hours at
32,000 rpm at room temperature. The RNA pellet was resuspended in DEPC water, and the RNA was precipitated with
ethanol and sodium acetate.
Two micrograms of RNA were reverse transcribed using
Superscript II RNase H-reverse transcriptase (Invitrogen,
Carlsbad, CA). The cDNA was used in PCR to check the
expression of EGF, EGFR, and TGF- using a gene specific
primer (Table 3). The integrity of the RNA was confirmed by amplifying a constitutively expressed ribosomal gene, RPL13A. PCR cycling parameters included an
initial denaturation at 94C for 4 minutes followed by 3540
cycles of denaturation at 94C for 45 seconds, annealing
at 60C for 45 seconds, polymerization at 72C for 1 minute,
and a final extension of 20 minutes at 72C. The PCR
products were separated by 1% agarose gel electrophoresis
analysis.

Enzyme Assays
Lipase
The Ortho-Clinical Diagnostics, Inc. Vitros Clinical
Chemistry Slide (LIPA) is a dry, multilayered, analytical element coated on a polyester support. A 10-L drop of patient
sample is deposited on the slide and evenly distributed by the
spreading layer to the underlying layers. The method incorporates colipase, which facilitates the adsorption of lipase to the
substrate micelles in the presence of bile salts. Lipase then
catalyzes the hydrolysis of water-insoluble triacetylglycerol
esters. The method uses the enzyme diacetinase to convert the
substrate 2,3-diacylglycerol to glycerol. Glycerol kinase converts the glycerol to L-glycerophosphate to generate hydrogen
peroxide. Peroxidase oxidizes a leuco dye to produce a colored
dye. The resulting change in reflection density is measured after 3.85 and 5 minutes at a wavelength of 540 nm. The rate of
change in reflection density is proportional to the activity of
lipase present in the sample.

TABLE 2. Antibodies Used for Immunohistochemistry

Antibody

Pretreatment

Dilution

Supplier

PCNA
TGF-
IGF-I
IGF-IR
Cyclin D1

Microwave heat
0.05% Saponin
Microwave heat
Microwave heat
Microwave heat

1:100
1:20
1:2000
1:200
Ready to use

Novocastra Laboratories (Newcastle, UK)

Oncogene Research Products (Cambridge, MA)
Cymbus Bioscience (Chandlers Ford, UK)
Santa Cruz Biotechnology, Inc. (Santa Cruz, CA)
Novocastra Laboratories

PCNA, proliferating cell nuclear antibody; TGF-, transforming growth factor , IGF-1, insulinlike growth factor-I; IGF-IR, IGF-I receptor.

404

2004 Lippincott Williams & Wilkins

Pancreas Volume 28, Number 4, May 2004

Pancreatic Cancer Treatment by Pancreatic Enzymes

319

Urine Analysis
Reagent strips of Bayer Multistix 10 SG (Bayer Corporation, Elkhart, IN) were used to determine the urine levels of
glucose, bilirubin, and ketone (acetoacetic acid), which was
collected weekly from all mice. The urine of 3 untreated mice
was used as control.

594

Statistical Evaluation

TABLE 3. Gene-Specific Primers Used in PCR to Check the

Expression of EGF, EGFR, and TGF-
Gene
Name
RPLA13A
EGF
EGFR-F
TGF--F

Primer Sequences
ATCGTGGCTAAACAGGTACTG
GCACGACCTTGAGGGCAGC
ACAGCCCTGAAGTGGATAGAG
GGGCTTCAGCATGCTGCCTTG
AACACCCTGGTCTGGAAGTAC
ACACCAGTTGAGCAGGTACTG
CGCCCTGTTCGCTCTGGGTAT
AGGAGGTCCGCATGCTCACAG

Product
Size (bp)

645
240

The survival rates of the 2 groups were evaluated by using the Kaplan-Meier survival curves and compared by the
log-rank test. The Mann-Whitney and Wilcoxon tests were
used to evaluate the statistical significance of tumor size, volume, weight, and body weight.

RPL13A, the ribosomal highly basic 23-kd protein; TGF-, transforming

growth factor ; EGF, epidermal growth factor I; EGFR, EGF receptor.

RESULTS
Stability Testing of the PPE

Amylase
Using the Ortho-Clinical Diagnostics, Inc. Vitros Clinical Chemistry Slide (AMYL), a 10-L drop of patient sample
is deposited on the slide and is evenly distributed by the
spreading layer to the underlying layers. The spreading layer
contains the dyed starch substrate (dye covalently linked to
amylopectin) for the reaction. The amylase in the sample catalyzes the hydrolysis of this dyed starch into smaller dyed saccharides and then diffuses into an underlying reagent layer that
contains a cationic hydrophobic polymeric mordant, which
binds the released anionic dye fragments and removes them
from solution. The reflection density of the dyed saccharides in
the reagent layer is measured by reflectance spectrophotometry at 2.3 and 5 minutes. The change in the slide reflection
density between the 2 readings is proportional to sample amylase activity.
Trypsin
Trypsin was assayed by a radioimmunoassay method at
Associated Regional and University Pathologists, Inc. (Salt
Lake City, UT).
Fecal Fat
Feces were collected and stained for fat according to the
methods of Drummey et al20 and Fine and Ogunji21 with minor
modifications. Briefly, a small amount of stool was placed on
a glass slide and 2 drops of 36% acetic acid were added. Another glass slide was placed on top immediately, and the content was homogenized by grinding between the 2 glass slides,
after which 2 drops of 1% Sudan III (Rowley Biochemical Inc.,
Danvers, MA) was added. The slides were held, by hand, over
a hot plate until bubbles appeared, then they were quickly removed and reheated 2 more times. Microscopy was performed
immediately. The assay was performed weekly in all mice. The
feces of 3 untreated mice were used as control.
2004 Lippincott Williams & Wilkins

Samples taken from the PPE solution at 0, 4, 12, and 24

hours were assayed for amylase, lipase, and trypsinogen. The
results are given in Table 4. Although the level of amylase and
trypsin was not different in the samples, the level of the lipase
was higher at 12 and 24 hours. Similar results were obtained
when PPE was dissolved in water at room temperature. Hence,
all enzyme activities were found to be stable in the solution at
room temperature for at least 24 hours (Table 4).

Study 1 (Survival Study)

During the tumor cell injection procedure, 1 mouse from
the treatment group and 2 from the control group died. As a
result, treatment and control groups consisted of 14 and 13
mice, respectively.
All mice in the treatment group showed normal physical
activities and no signs of the disease, whereas all mice in the
control group showed reduced activity. No differences were
found in the eating and drinking habits between the groups
except that from day 21 on, treated mice consumed more water
than those in the control group (P < 0.0001, Fig. 1), although
initially, from days 0 to 7, treated mice drank less water (possibly due to the taste of the PPE) than did the control mice (P <
0.0001). There was no difference, however, in the total amount
of enzyme taken by each mouse, the average PPE intake being
10.6 0.3 mg/d.

TABLE 4. Enzyme Activities of the PPE Solution at

Room Temperature
Enzyme
Amylase (U/L)
Lipase (U/L)
Trypsinogen
(ng/mL)

0h
1083528
749016
78.3

4h
1090800
779720
70.7

12 h
1067772
1152824
76.2

24 h
837492
1109384
83.5

405

Pancreas Volume 28, Number 4, May 2004

Saruc et al

The survival rates at day 35 were 79% in the treatment group

and 38% in the control group.

Tumor Size and Weight

Because mice in the control and treated groups died at
different times and the mice in the treated group survived
longer, an adequate comparison of the tumor growth could not
be made. The greater tumor weight in the treated group (P =
0.04) could well be related to the significantly longer survival
of mice in this group (Fig. 3).

Histology

FIGURE 1. Daily water intake in the treated and control

groups. The small circle and square indicate the mean, the line
in the box indicates the median (50th percentile), and the
bottom and the top of the box indicate the 25th and 75th
percentiles of the distribution, respectively.

Also, the body weight of the mice did not show any statistically significant difference between the groups (P =
0.066).

Survival Rates
We estimated the survival of the 2 groups using KaplanMeier survival curves and compared them using the log-rank
test. The estimated survival functions are displayed in Figure 2
and Table 5. The median survival rates in the treatment and
control groups were 43.5 and 35 days, respectively (P = 0.009).

All animals in both groups developed poorly differentiated adenocarcinoma, which had destroyed most of the pancreatic tissues, especially in the treated mice with a longer survival. In general, the size of tumors and the rate of invasion
(liver, peritoneum) correlated with the survival time. No metastases were found in any mice.

Study 2 (Tumor Growth Study)

One mouse from each group died during the tumor inoculation. The general appearance of animals began to show a
difference after week 5 of the study. All animals in the control
group showed a remarkably greater distention of their abdomen and massive ascites (up to 5 mL), whereas only 1 of 9 in
the treatment group had ascites. Remarkable behavioral differences were also noticed between the animals of the 2 groups
after week 5 of the study. Treated mice were more active, and
their behavior was comparable with that of healthy mice,
whereas mice in the control group were less mobile and could
be caught more easily than treated mice. Also, control mice
exhibited pale skin.
No statistically significant differences were found in the
distribution of body weight. The considerably larger tumor
size and the presence of massive ascites in the control group,
however, made an adequate comparison of the actual body
weight (body weight minus tumor weight) impossible.
Food and water intake did not show any difference between the groups (P > 0.05). Weekly food intake per mouse
was 29.0 3.7 g in the treated group and 29.5 2.6 g in the
control group. There was no difference in the total amount of
enzyme taken by each mouse (Table 6). The average PPE intake was 11.2 0.01 mg/day.

Survival Rates

FIGURE 2. Survival curves of both groups in study 1. The estimated survival of the 2 groups of animals using Kaplan-Meier
survival curves and comparing them using the log-rank test.
The difference between the survival experience of the 2 groups
is statistically significant (P = 0.009).

406

Because of the experimental design, an adequate survival comparison could not be made. Nevertheless, based on a
few mice that were allowed to die spontaneously, treated mice
survived considerably longer (58 days) than the control mice
(44 days). At day 49, 9 of 14 control mice (64%) in the treatment group were alive compared with only 4 of 14 (29%) in the
control group (Table 7, Fig. 4).
2004 Lippincott Williams & Wilkins

Pancreas Volume 28, Number 4, May 2004

Pancreatic Cancer Treatment by Pancreatic Enzymes

TABLE 5. Estimated Survival Functions of the Groups in Study 1

Group

Survival
at
T = 35

95% Confidence
Interval for
Survival at T = 35

Median
Survival

95% Confidence
Interval for
Median Survival

Treated
Control

79%
38%

(57%, 99%)
(12%, 65%)

43.5
35

(36%, 55%)
(16%, 43%)

We estimated the survival of the 2 groups of animals using Kaplan-Meier survival curves and compared them
using the log-rank test. Some parameter estimates are shown. The difference between the survival experience of the
2 groups is statistically significant (P = 0.009).

Tumor Size and Weight

The treatment group had significantly smaller tumors
than the control group (Fig. 5). The mean tumor weight was 1.2
g in the control group and 0.75 g in the control group (P =
0.001). Tumor volumes were smaller in the treated mice (0.42
cm3) than in the control group (0.91 cm3; P = 0.02) (Fig. 6).
The difference in tumor size was more obvious when tumor
weight and size were compared between the animals that were
killed at the same time (P = 0.0001). Figure 7 shows the distribution of tumor volume between the 2 groups.

Histology and Immunohistochemistry

All animals in the treatment and control groups developed poorly differentiated adenocarcinoma. Most of the pan-

creatic tissues were destroyed by the carcinoma. Little or no

intact pancreatic tissue remained in most of the cases from both
groups. The pancreatic destruction was more significant, especially in the mice with a longer survival. The average tumor
size, taken from the largest diameter of the tumor, was 420
mm3 in the treatment group and 1060 mm3 in the control group
(P = 0.001). Invasion was found in 2 of 3 mice in the controls
(66.6%) and 2 of 4 in the treatment group (50%) (P > 0.05).
Necrosis was present in 50% of the tumor tissue of the treatment group and 40% in the control group (P > 0.05). No distant
metastasis was found in any mice from both groups.
Table 8 shows the results of immunohistochemical
staining of the tumor tissue from the mice in the treated and
control groups. Proliferating cell nuclear antigen (PCNA)

TABLE 6. Amount of PPE Consumed by Each Mouse

No. of Mice in a Cage

FIGURE 3. Tumor weights of the groups. This figure displays

boxplots indicating the distribution of tumor weight between
the 2 groups. The small circle indicates the mean, the line in
the box indicates the median (50th percentile), and the bottom and the top of the box indicate the 25th and 75th percentiles of the distribution, respectively. The distribution of
tumor weight at the time of death was higher for the treatment group, and this difference was statistically significant (P =
0.04, Wilcoxon test).
2004 Lippincott Williams & Wilkins

Study 1
Case 1*
Surv/PPE
Cage 2
Surv/PPE
Cage 3
Surv/PPE
Study 2
Cage 1
Surv/PPE
Cage 2
Surv/PPE
Cage 3
Surv/PPE

38/393

41/419

48/492

53/558

32/322

38/391

46/488

47/492

53/580

22/232

32/338

36/386

53/589

53/589

60/671

37/414

60/671

51/570

52/581

60/671

52/581

58/648

60/671

60/671

47/525

45/503

42/470

43/481

*In each cage, there were 4 or 5 mice.

Survival (in days)/PPE intake in milligrams (relationship between longevity and the amount of PPF consumed). For example, 1 mouse in 1 cage
survived 38 days and consumed a total of 393 mg PPE). On average, each
mouse from either group consumed about 1011 mg/day.

407

Pancreas Volume 28, Number 4, May 2004

Saruc et al

TABLE 7. Estimated Survival Functions of the Groups in Study 2

Group

Survival at
T = 49

95% Confidence Interval

for Survival at T = 49

Median
Survival

95% Confidence Interval

for Median Survival

Treated
Control

64%
29%

(39%, 89%)
(5%, 52%)

58
44.5

(45%, )
(42%, )

We estimated the survival of the 2 groups of animals using Kaplan-Meier survival curves and compared them using the log-rank test. Some parameter estimates
are shown. The means that the upper limit of the confidence interval for the median is not defined. The difference between the survival experience of the 2 groups
is not statistically significant (P = 0.13).

staining was positive in 67.8% of the cells in the control group

and 42.4% in the treatment group; however, the difference was
not statistically significant (P > 0.05). Tumor tissue was not
stained for IGF-I and IGF-I receptor, whereas normal pancreatic
tissue was stained strongly positive. Tumor tissue was also not
stained for TGF-. The apoptotic rate and cyclin D1 staining did
not show any difference between the groups (P > 0.05).

Expression Analysis of Growth Factors

RT-PCR was used to detect specific mRNA for EGF,
EGFR, and TGF- in control and treated tumor samples. The
pancreatic tumor cell line HPAF was used as a positive control
for this expression analysis. Ribosomal protein RPL13A was
used as an internal control to show the quality of mRNA.22 No
expression could be detected in both control and treated samples
(Fig. 8). There was no expression of mRNA for EGF, EGFR,

or TGF- in the control or in the treated samples. In PC cell

line AsPC1 cells, however, a weak expression of these genes
was detected.

Plasma Amylase and Lipase Levels

Although the plasma amylase levels were higher in the
control mice (1545 793 U/L) than in the treated group (1286
604 U/L), the difference was not statistically significant.
Also, the level of lipase did not vary between the control group
(445.8 100 U/L) and the treatment group (475.6
86 U/L).

Fecal Fat and Urine Analysis

Fecal fat was examined in 14 mice in the treatment group
and in 14 mice in the control group. Thirteen of 14

FIGURE 4. Survival curves of both groups in study 2. We estimated the survival of the 2 groups of animals using Kaplan-Meier
survival curves and compared them using the log-rank test. The survival between the survival experience of the 2 groups is not
statistically significant (P = 0.13).

408

2004 Lippincott Williams & Wilkins

Pancreas Volume 28, Number 4, May 2004

Pancreatic Cancer Treatment by Pancreatic Enzymes

ment group (P = 0.057) (Fig. 9). Glucosuria developed in 6 of

14 in the control group and in 5 of 14 mice in the treatment
group. For hyperbilirubinuria, the figures were 5 of 14 and 4 of
14, respectively. All values for the untreated, age-matched
male beige XID nude mice were 0.

DISCUSSION
No effective therapy guidelines have been established
for PC patients.23 Although neoadjuvant and adjuvant therapy
have support, the respective studies have flaws in design and
have been generally ineffective. Therapy for measurable residual or unresectable PC is attractive in concept, although effective regimens have yet to be established.
PPE has been used in different countries for many years
in the therapy for a variety of cancers.14 The limited amount of
published data suggests that PPE causes tumor regressions or
even remission in terminally ill cancer patients.24,25
Recently, significantly improved survival rates have
been reported in inoperable PC patients who received PPE
orally.14 The article was the case reports of 11 PC patients with
stage IV disease. Nine of 11 treated patients (81%) survived
for 1 year, 5 of 11 patients (45%) survived for 2 years, and 4 of
11 (36%) survived for 3 years.14 Two were still alive and doing

FIGURE 5. Xenografts of human PC cells, AsPC1 in nude

mice. a: At day 52, tumor size was significantly larger in the
control group (left) than in the treatment group (right). b:
The same differences were found at day 60. c: At the late
stage, tumors in the control group appeared as multiple nodules invading the surrounding tissues and peritoneal and pelvic cavities.

mice in the control group and 2 of 14 mice in the treatment

group (P < 0.001) had fecal fat (Fig. 9). In the control group,
fecal fat appeared as early as week 5. In the treatment group,
1 animal had fecal fat at week 6 and the other at week 8. Six
of 9 mice in the control group had fecal fat at week 6, 3 of 4
mice at week 7, and both mice at week 8 had fecal fat.
Urinalysis showed that 10 of 14 mice in the control
group had ketonuria compared with 4 of 14 mice in the treat 2004 Lippincott Williams & Wilkins

FIGURE 6. Distribution of tumor weights (gram) of the groups

in study 2. Boxplots indicate the distribution of tumor weight
between the 2 groups. The small circle indicates the mean, the
line in the box indicates the median (50th percentile), and the
bottom and the top of the box indicate the 25th and 75th
percentiles of the distribution, respectively. The values of tumor weight were smaller for the animals in the treatment
group, and this difference was statistically significant (P =
0.001, Wilcoxon test). Control group mean, 1.20; treatment
group mean, 0.75.

409

Pancreas Volume 28, Number 4, May 2004

Saruc et al

TABLE 8. Results of Immunohistochemical Staining in

Both Groups

Tumor size (cm3)

Necrosis
Invasion
PCNA
TGF
IGF-I
IGF-IR
Apoptosis
Cyclin D1

Treated

Control

P Value

0.42
50%
50%
42.4%
No staining
No staining
No staining
15.5%
50.2%

1.06
40%
66.6%
67.8%
No staining
No staining
No staining
18.1%
56%

0.001
>0.05
>0.05
>0.05
>0.05
>0.05
>0.05
>0.05
>0.05

PCNA, proliferating cell nuclear antibody; TGF-, transforming growth

factor ; IGF-I, insulin-like growth factor I; IGF-IR, IGF-I receptor.

FIGURE 7. Distribution of tumor volume (cm3) of the groups in

study 2. Boxplots indicate the distribution of tumor volume
between the 2 groups. The small circle and indicates the
mean, the line in the box indicates the median (50th percentile), and the bottom and the top of the box indicate the 25th
and 75th percentiles of the distribution, respectively. The values of tumor volume were smaller for the animals in the treatment group, and this difference was statistically significant (P =
0.02, Wilcoxon test). Control group mean, 0.91; treatment
group mean, 0.42.

well when the article was published (1 at 3 years, the other at 4

years). Overall, the median survival was 17 months and the
mean survival was 25.2 months. These survival rates are in
sharp contrast to the data of the National Cancer Database Report on Pancreatic Cancer from 199515 showing 26% and 6%
survival rates for stage IV PC patients after 1 and 2 years, respectively. In the statistics from a trial of gemcitabine, the survival rate was 5.7 months; only 18% of patients lived 1 year,
and none of them survived beyond 19 months.9 These results
and the results of the study in which alternative treatment was
used were far from comparable. It must be noted that the diagnosis was confirmed by a core biopsy of the pancreas in only 4
of the 11 patients undergoing PPE therapy, whereas in the remaining patients, the diagnosis was based on histopathologic
examinations of metastatic foci strongly suggesting (but with
no proof) the pancreas as the primary site.
Our intensive search to develop a therapeutic modality
for PC in an animal model during the past 30 years has remained unsuccessful and indicated PCs exceptional resistance to therapy. The results of the clinical PPE studies
prompted us to confirm the efficacy of this treatment in an
experimental model. We used the mouse model, which has
gained popularity as a model to study human tumor biology2629

410

because tumor transplants in nude mice normally and generally maintain the phenotype and biology of the original tumor30,31 and respond to therapeutic agents.32 We used AsPC1
cells, derived from nude mouse xenografts initiated with cells
from the ascites of a patient with PC because this is one of the
most malignant human PC cell lines.16
The initial study, which was merely a survival study,
showed that the PPE treatment significantly prolonged survival. The larger tumor size in the treated mice surviving
longer indicated that the treatment apparently does not affect

FIGURE 8. Expression of EGF, EGFR, and TGF- in control and

enzyme-treated mice pancreas. RPLA13, a constituent of ribosomal protein, was used as an internal control. Lane M is a kb
ladder (Promega Corp). Lanes 14 contained control samples;
5 and 6 were PPE-treated samples. CD18-10% was used as a
positive control for all these genes. Since these tumors were
generated in mice by injecting the AsPC I cell line, the expression of these genes was also checked in this cell line.
2004 Lippincott Williams & Wilkins

Pancreas Volume 28, Number 4, May 2004

FIGURE 9. Urine ketone, glucose, and bilirubin and fecal fat.

Ketonuria, glucosuria, bilirubinuria, and fecal fat were examined in 14 mice in the treatment group and in 14 mice in the
control group. Data were shown as a positive ratio (percentage
of total at the end of the week).

tumor growth. Because treated mice with large tumors showed

physical activity and behavior comparable with those of the
healthy mice, it was thought that PPE has a beneficial effect on
nutrition. The earlier death and the poor health condition of the
control mice could well be due to the destruction of the exocrine pancreas by cancer cells leading to permanent pancreatic
enzyme deficiency and, hence, malnutrition. This nutritional
insufficiency was not reflected by the body weight, possibly
because of the presence of large tumors and ascites. Hence, the
longer survival of treated mice, whose cancer showed the same
invasive patterns as those in the control group, could be due to
the compensatory effect of PPE on pancreatic enzyme insufficiency. To clarify these issues, in the second experiment, we
compared some nutritional parameters during the tumor
growth. The results confirmed the role of PPE in the nutritional
status of the mice because control mice showed a significant
decrease of serum pancreatic enzyme levels, steatorrhea, ketonuria, hyperglucosuria, and hyperbilirubinuria, which occurred early and in a severe form. Only a few treated mice at
the late stage presented these abnormalities and in a less severe
degree. This comparative study also showed that tumors in the
treated mice grow significantly slower and are less invasive
than those in the matched control mice. The reduced cell proliferation index was consistent with this finding. Our hypothesis that the PPE treatment, directly or indirectly, affects the
tumor growth by altering the expression of the growth factors
2004 Lippincott Williams & Wilkins

Pancreatic Cancer Treatment by Pancreatic Enzymes

known to be overexpressed in human PC cells, however, was

not validated. There was also no correlation between the size
of tumors, cyclin D1 expression, and apoptosis rate. The
mechanism involved in the suppression of tumor growth is not
clear. Theoretically, the enzymes could alter the release of
CCK, a growth-promoting factor, which has receptors in both
endocrine and exocrine cells. Alteration of CCK may alter the
release of insulin, the potent growth hormone. It is also possible that some other ingredients of the PPE act as transcriptional factors in inhibiting the release of growth factors.
Mechanistic studies are required to understand the actual
event.
Confirming clinical studies, we did not observe any side
effect that may be associated with PPE treatment. Pancreatic
enzyme preparations have been used in several human diseases
with a wide range of safety. In the literature, the only side effect that may be related to the use of pancreatic enzyme preparation has been observed in children with cystic fibrosis. In
these patients, taking megadoses of pancreatic enzymes (the
equivalent of 10,000 U lipase per kilogram of body weight per
day), a distinctive form of fibrosing colonopathy has been reported.3335 We could not confirm this alteration in the mice
treated with PPE.
In summary, PPE is the first experimentally and clinically proven agent for the effective treatment of PC. The significant advantages of PPE over any other currently available
therapeutic modalities include its effects on physical condition, nutrition, and lack of toxicity.
ACKNOWLEDGMENT
The authors thank Dr. Linda Lee Isaacs for providing the
porcine pancreatic extract.
REFERENCES
1. Ahmedin J, Thomas A, Murray T, et al. Cancer statistics, 2002. CA Cancer J Clin. 2002;52:2342.
2. Cardillo TM, Blumenthal R, Ying Z, et al. Combined gemcitabine and
radioimmunotherapy for the treatment of PC. Int J Cancer. 2002;97:386
392.
3. Cooperman AM. Pancreatic cancer: the bigger picture. Surg Clin North
Am. 2001;81:557574.
4. Ahmad NA, Lewis JD, Ginsberg GG, et al. Long term survival after pancreatic resection for pancreatic adenocarcinoma. Am J Gastroenterol.
2001;96:26092615.
5. Benassai G, Mastrorilli M, Quarto G, et al. Factors influencing survival
after resection for ductal adenocarcinoma of the head of the pancreas. J
Surg Oncol. 2000;73:212218.
6. Huguier M. Survival after duodenopancreatectomy with mesenteroportal
resection for cancer of the head of the pancreas. Chirurgie. 1998;123:
421422.
7. Sperti C, Pasquali C, Piccoli A, et al. Survival after resection for ductal
adenocarcinoma of the pancreas. Br J Surg. 1996;83:625631.
8. Burris H, Storniolo AM. Assessing clinical benefit in the treatment of
pancreas cancer: gemcitabine compared to 5-fluorouracil. Eur J Cancer.
1997;33(Suppl 1):S18S22.
9. Burris HA 3rd, Moore MJ, Andersen J, et al. Improvements in survival
and clinical benefit with gemcitabine as first-line therapy for patients with
advanced pancreas cancer: a randomized trial. J Clin Oncol. 1997;15:
24032413.

411

Pancreas Volume 28, Number 4, May 2004

Saruc et al

10. Talamonti MS, Catalano PJ, Vaughn DJ, et al. Eastern Cooperative Oncology Group Phase I trial of protracted venous infusion fluorouracil plus
weekly gemcitabine with concurrent radiation therapy in patients with
locally advanced pancreas cancer: a regimen with unexpected early toxicity. J Clin Oncol. 2000;18:33843389.
11. Kalser MH, Ellenberg SS. Pancreatic cancer. Adjuvant combined radiation and chemotherapy following curative resection. Arch Surg. 1985;
120:899903.
12. Gastrointestinal Tumor Study Group. Further evidence of effective adjuvant combined radiation and chemotherapy following curative resection
of PC. Gastrointestinal Tumor Study Group. Cancer. 1987;59:2006
2010.
13. Klinkenbijl JH, Jeekel J, Sahmoud T, et al. Adjuvant radiotherapy and
5-fluorouracil after curative resection of cancer of the pancreas and periampullary region: phase III trial of the EORTC gastrointestinal tract cancer cooperative group. Ann Surg. 1999;230:776784.
14. Gonzalez NJ, Isaacs LL. Evaluation of pancreatic proteolytic enzyme
treatment of adenocarcinoma of the pancreas, with nutrition and detoxification support. Nutr Cancer. 1999;33:117124.
15. Niederhuber JE, Brennan MF, Menck HR. The National Cancer Data
Base report on PC. Cancer. 1995;76:16711677.
16. Matsuzaki H, Schmied BM, Ulrich A, et al. Combination of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and actinomycin D
induces apoptosis even in TRAIL-resistant human PC cells. Clin Cancer
Res. 2001;7:407414.
17. Egami H, Tomioka T, Tempero M, et al. Development of intrapancreatic
transplantable model of pancreatic duct adenocarcinoma in Syrian golden
hamsters. Am J Pathol. 1991;138:557561.
18. Corbert T, Valeriote F, LoRusso P, et al. In vivo methods for screening
and preclinical testing. Use of rodent solid tumors for drug discovery. In:
Teicher B, ed. Anticancer Drug Development Guide: Preclinical Screening, Clinical Trials, and Approval. Totowa, NJ: Humana Press; 1997:
7599.
19. Hsu SM, Raine L, Fanger H. Use of avidin-biotin-peroxidase complex
(ABC) in immunoperoxidase techniques: a comparison between ABC and
unlabeled antibody (PAP) procedures. J Histochem Cytochem. 1981;29:
577580.
20. Drummey GD, Benson JAJ. Microscopical examination of the stool for
steatorrhea. N Engl J Med. 1961;264:823835.
21. Fine KD, Ogunji F. A new method of quantitative fecal fat microscopy

412

22.
23.
24.
25.
26.
27.
28.
29.
30.
31.

32.
33.
34.
35.

and its correlation with chemically measured fecal fat output. Am J Clin
Pathol. 2000;113:528534.
Jesnowski R, Backhaus C, Ringel J, et al. Ribosomal highly basic 23-kDa
protein as a reliable standard for gene expression analysis. Pancreatology.
2002;2:421424.
Rosemurgy AS, Serafini FM. New directions in systemic therapy of PC.
Cancer Control. 2000;7:437451.
Shively FL. Multiple proteolytic enzyme therapy of cancer. Dayton:
Johnson-Watson; 1969.
Sakalova A, Bock PR, Dedik L, et al. Retrospective cohort study of an
additive therapy with an oral enzyme preparation in patients with multiple
myeloma. Cancer Chemother Pharmacol. 2001;47(Suppl):S38S44.
Flanagan SP. Nude, a new hairless gene with pleiotropic effects in the
mouse. Genet Res. 1966;8:295309.
Marincola FM, Drucker BJ, Siao DY, et al. The nude mouse as a model for
the study of human PC. J Surg Res. 1989;47:520529.
Dexter DL, Matook GM, Meitner PA, et al. Establishment and characterization of two human PC cell lines tumorigenic in athymic mice. Cancer
Res. 1982;42:27052714.
Kyriazis AP, McCombs WB 3rd, Sandberg AA, et al. Establishment and
characterization of human pancreatic adenocarcinoma cell line SW-1990
in tissue culture and the nude mouse. Cancer Res. 1983;43:43934401.
Bettan-Renaud L, Bayle C, Teyssier JR, et al. Stability of phenotypic and
genotypic traits during the establishment of a human neuroblastoma cell
line, IGR-N-835. Int J Cancer. 1989;44:460466.
Satyaswaroop PG, Zaino R, Clarke CL, et al. Nude mouse system in the
study of tumor biology, treatment strategies and progesterone receptor
physiology in human endometrial carcinoma. J Steroid Biochem. 1987;
27:431438.
Standop J, Schneider MB, Ulrich A, et al. Experimental animal models in
pancreatic carcinogenesis: lessons for human PC. Dig Dis. 2001;19:
2431.
Lowdon J, Goodchild MC, Ryley HC, et al. Maintenance of growth in
cystic fibrosis despite reduction in pancreatic enzyme supplementation.
Arch Dis Child. 1998;78:377378.
Smyth RL, Ashby D, OHea U, et al. Fibrosing colonopathy in cystic
fibrosis: results of a case-control study. Lancet. 1995;346:12471251.
FitzSimmons SC, Burkhart GA, Borowitz D, et al. High-dose pancreaticenzyme supplements and fibrosing colonopathy in children with cystic
fibrosis. N Engl J Med. 1997;336:12831289.

2004 Lippincott Williams & Wilkins