De Baaij Thesis PDF

The research presented in this thesis was performed at the department of Physiology,
Radboud Institute for Molecular Life Sciences, Radboud university medical center,
The Netherlands and financially supported by the Netherlands Organization for Scientific
Research (NWO), ZonMW grant 9120.8026.
Financial support by the Dutch Kidney Foundation for the publication of this thesis is
gratefully acknowledged.
ISBN
978-94-6259-412-8
Print
Ipskamp Drukkers BV, Enschede, the Netherlands

Cover design
Susan Rolffs, Stevensbeek, the Netherlands

Lay-out
Promotie In Zicht, Arnhem, the Netherlands
2014, J.H.F de Baaij, Nijmegen, the Netherlands

All rights reserved. No part of this thesis may be reproduced or transmitted in any form or by any means
without permission in writing of the authors, or, when appropriate, from the publishers of the publications.
The Distal Convoluted Tubule:

The Art of Magnesium Transport
Proefschrift
ter verkrijging van de graad van doctor

aan de Radboud Universiteit Nijmegen
op gezag van de rector magnificus prof. dr. Th.L.M. Engelen,
volgens besluit van het college van decanen
in het openbaar te verdedigen op woensdag 21 januari 2015
om 12.30 uur precies
door
Jeroen Herman Frans de Baaij

geboren op 16 mei 1987
te Nijmegen, Nederland
Promotoren
Prof. dr. J.G.J. Hoenderop
Prof. dr. R.J.M. Bindels
Manuscriptcommissie
Prof. dr. J.M.J. Kremer (voorzitter)
Prof. dr. J.H.J.M van Krieken
Prof. dr. H. van Goor (UMCG)
Realists do not fear the results of their study

Fjodor Dostojevski (1821-1881)
Happy is he who gets to know the reason for things

Virgil (70-19 B.C.)
Table of contents
Chapter 1
Art History: An Introduction to Magnesium in Health

and Disease
Chapter 2
Elucidation of the Distal Convoluted Tubule Transcriptome

Identifies New Candidate Genes Involved in Renal Magnesium
Handling
41
Chapter 3
Mutations in PCBD1 Cause Hypomagnesemia and

Renal Magnesium Wasting
71
Chapter 4
Recurrent FXYD2 p.Gly41Arg Mutation in Patients

with Isolated Dominant Hypomagnesemia
99
Chapter 5
Identification of SLC41A3 as a Novel Player in

Magnesium Homeostasis
111
Chapter 6
Membrane Topology and Intracellular Processing of

Cyclin M2 (CNNM2)
135
Chapter 7
CNNM2 Mutations Cause Impaired Brain Development

and Seizures in Patients with Hypomagnesemia
161
Chapter 8
P2X4 Receptor Regulation of Transient Receptor Potential

Melastatin Type 6 (TRPM6) Mg2+ Channels
195
Chapter 9
Flavaglines Stimulate Transient Receptor Potential

Melastatin Type 6 (TRPM6) Channel Activity
215
Chapter 10
Contemporary Art of Magnesium Transport: A Discussion

on the Distal Convoluted Tubule
235
Chapter 11
Summary: The Art of Magnesium Transport
269
Chapter 12
Samenvatting: De Kunst van het Magnesiumtransport
277
Chapter 13
List of Abbreviations
289
List of Publications
295
Curriculum Vitae
297
RIMLS Portfolio
299
Dankwoord Acknowledgments Remerciements
301
Chapter 14
Magnesium in Health and Disease | 11
Magnesium Basics
Magnesium (Mg2+) is an essential ion for health. Within the periodic table of elements,
Mg has atom number 12 and is classified as an alkaline earth element (group 2). Mg occurs
in nature in three stable isotopes, 24Mg, 25Mg, and 26Mg. 24Mg is the most common
isotope (78,99 %) and has a relative atomic mass of 24.305 Da, a melting point of 648.8 C
and a boiling point of 1090 C (97). In the dissolved state, Mg2+ has two hydration shells,
making its radius 400 times larger than its dehydrated radius. Consequently, before
passing through channels and transporters, Mg2+ needs to be dehydrated, which is a
highly energy consuming process. The radius of hydrated Mg2+ is much bigger than other
cations like Na+, K+ and even Ca2+ (28). As a result, Mg2+ is a powerful Ca2+-antagonist,
despite their same charge and similar chemical properties.
Mg2+ is a co-factor of over 600 enzymes (http://www.metacyc.org, (24)). Among the
enzymes that require Mg2+ as co-activator, many enzymes are essential for life. For
instance, Mg2+ is necessary for proper structure and activity of DNA and RNA polymerases
(15, 139). Knowing that other enzymes using Mg2+ are topisomerases, helicases and
exonucleases, Mg2+ is an essential component of DNA replication, RNA transcription,
amino acid synthesis and protein formation. Since kinases, ATP-ases, guanylyl cyclases and
adenylyl cyclases all depend on Mg-ATP for proper function, Mg2+ plays a role in virtually
every process within the human cell.
Magnesium in Health and Disease

The first use of Mg2+ in human medicine can be traced back to 1697 when Dr. Nehemiah
Grew identified magnesium sulfate (MgSO4) as the major ingredient of Epsom salt (51).
Epsom Salt was extracted from a well in Epsom, England and was used over the years to
treat abdominal pain, constipation, sprains, muscle strains, hyaline membrane disease,
and cerebral edema. Subsequently, Mg2+ was recognized as an element (Mg) by Joseph
Black in 1755 and first isolated by Sir Humphrey Davy from magnesia (Mg3SO4O10(OH)2)
and mercury (Hg) in 1808 (30). The role of Mg2+ in the human body emerged once Mg2+
was described in blood plasma by Willey Glover Denis in 1920 (31). Subsequently, Jehan
Leroy demonstrated that Mg2+ is essential for life in mice (85). These findings were
translated to humans, and the first reports of Mg2+ deficiency in man were by Arthur
Hirschfelder & Victor Haury in 1934 (61). Since then, Mg2+ has been implicated in and used
for treatment of a variety of diseases, including migraines, cardiovascular diseases and
diabetes (Figure 1). Although the importance of Mg2+ is widely acknowledged, serum
Mg2+ values are not generally determined in clinical medicine. Therefore, Mg2+ is often
referred to as the forgotten cation in human health.
Brain
In brain, intracellular Mg2+ regulates the activity of the N-Methyl-D-aspartic acid (NMDA)
receptor. During Mg2+ deficiency, NMDA receptors become hyperexcitable, resulting in
12 | Chapter 1
- Migraine
- Depression
- Epilepsy
- Stroke
- Traumatic Brain Injury
- Myocardial infarction
- Arrythmias
- Preeclampsia
- Hypertension
- Muscle Cramps
- Asthma
- COPD
- Cystic Fibrosis
- Osteoporosis
Figure 1 Magnesium in health and disease

Overview of the major diseases in which Mg2+ disturbances have been reported or in which Mg2+
supplementation has been considered as potential treatment.
severe brain pathologies (92, 103). Patients with migraines, depression, epilepsy and
traumatic brain injury have lower blood Mg2+ values (6, 32, 115, 137). Therefore, Mg2+
supplementation has been proposed as potential treatment for these disorders. In a
recent large-scale trial Mg2+ was shown to decrease death and disability after stroke when
applied within three hours of the onset of the stroke (99). In contrast, Mg2+ was unsuccessful to
improve outcome after traumatic brain injury (140). Despite the absence of large-scale
clinical trials, Mg2+ is considered second-line treatment for migraine and epilepsy (62, 131).
Heart and Vasculature

Mg2+ regulates the activity of ion channels in the cardiac cells, thereby affecting the
electrical properties of the myocardium (98). Moreover, it determines myocardial contractility
by influencing the intracellular Ca2+ mobility and Mg2+ has an anti-inflammatory and
vasodilatory effect. Patients with severe hypomagnesemia may, therefore, suffer from
arrhythmias and hypertension. Mg2+ is the most important treatment for patients with
preeclampsia and has been widely advocated by the world health organization (WHO) in
third world countries to reduce child mortality (59). Additionally, Mg2+ is the first treatment
option for patients with torsades des pointes type of cardiac arrhythmias (158).
Lung
Given the bronchodilatory and anti-inflammatory effects of Mg2+, the use of Mg2+ has also
been advocated in lung disease (104). Specifically, Mg2+ is considered second-line
treatment for acute asthma patients (2). Recently, a large randomized controlled study In
children with asthma showed the improvement of the asthma severity after inhalation of
MgSO4 (111). Large-scale studies are necessary to examine the efficacy of Mg2+ in the
treatment of chronic obstructive pulmonary disorder (COPD) and cystic fibrosis.
Muscle
In muscle, the main effect of Mg2+ is as a Ca2+ antagonist on Ca2+-permeable channels
and Ca2+-binding proteins (63, 110). Muscle contraction is a highly Ca2+-dependent
process, since Ca2+ will bind to troponin C and myosin to induce contraction (50). Mg2+
competes for the Ca2+-binding sites on these proteins. Consequently, more Ca2+ will bind
troponin C and myosin in Mg2+ deficiency, resulting in hypercontractibility, which presents
as muscle cramps and spasms in the clinic. Therefore, Mg2+ supplementation is considered
second line treatment for muscle cramps (74).
Magnesium Deficiency
The US Food and Nutrition Board recommends a daily intake of 420 mg for men and 320
mg for women (1). However, recent reports estimate that at least 60 % of the population
does not meet daily-required Mg2+ intake (76). Part of the problem stems from the soil
used for agriculture, which is becoming increasingly deficient in essential minerals. Over
14 | Chapter 1
the last 60 years the Mg2+ content in fruit and vegetables decreased by 20-30 % (151).
Moreover, the Western diet is containing more refined grains and processed food.
Estimates are that 80-90 % of Mg2+ is lost during food processing. As a result, a significant
number of people are Mg2+ deficient, which may comprise up to 60 % of critically ill
patients (26, 35). Mg2+ deficiency is commonly determined by measuring the total serum
Mg2+ concentration, which ranges between 0.7 and 1.1 mmol/L in healthy persons (90).

Hypomagnesemia is generally defined as serum Mg2+ levels below 0.7 mmol/L (Table 1).
Patients suffer from non-specific symptoms such as depression, tiredness, muscle spasms
and muscle weakness and diagnosis therefore may take years (44, 143). Only severe Mg2+
depletion (< 0.4 mmol/L) may lead to cardiac arrhythmias, tetany and seizures. Secondary to
hypomagnesemia, disturbances in K+ and Ca2+ handling are often detected. Hypokalemia
Table 1 S ymptoms of Mg2+ Disturbances
Hypomagnesemia
Concentration
Clinical manifestation
< 0.7 mmol/L
Neuromuscular irritability
Hypocalcemia
Hypokalemia
< 0.4 mmol/L
Tetany
Seizures
Arrhythmias
Hypermagnesemia
Concentration
Clinical manifestation
> 1.1 mmol/L
Lethargy
> 2 mmol/L
Drowsiness
Flushing
Nausea and vomiting
Diminished deep tendon reflex
> 3 mmol/L
Somnolence
Loss of deep tendon reflexes
Hypotension
ECG changes
> 5 mmol/L
Complete heart block

Cardiac arrest
Apnea
Paralysis
Coma
Death
Clinical symptoms of disturbed Mg2+ homeostasis.
can be attributed to increased renal K+ secretion via ROMK in the connecting tubule (CNT)
and collecting duct (CD) (67). Low intracellular Mg2+ levels release the Mg2+-dependent
inhibition of renal outer medullary potassium channel (ROMK) channels, resulting in increased
renal K+ secretion. Hypocalcemia can be explained by low parathyroid hormone (PTH)
levels due to altered activation of the calcium-sensing receptor (CaSR) (154).

Hypomagnesemia is generally treated by oral Mg2+ supplementation ( 360 mg/day),
although oral Mg2+ intake may cause diarrhea at high doses. Intravenous Mg2+ supplementation may be more effective, but this treatment has the disadvantage that it requires
regular hospital visits (143). When serum Mg2+ levels are extremely low or are associated
with hypokalemia, Mg2+ supplementation may not be sufficient to restore normal Mg2+
levels. In that case, patients are often co-supplemented with K+ or receive amiloride to
prevent K+ secretion.

The human body contains approximately 24 g of Mg2+ of which 99 % is stored in
bone, muscle and other soft tissues (Figure 2). Since serum Mg2+ values reflect only 1 % of
the body Mg2+ content, serum values may be within the normal range whereas the body
may be in a severely Mg2+-depleted state. As a result, the clinical impact of Mg2+ deficiency
may be largely underestimated.
Magnesium Uptake in Intestine

Given a daily Mg2+ intake of 370 mg, approximately 30-50 % of Mg2+ is absorbed in the
intestine, resulting in a net uptake of 100 mg (Figure 2). However, if Mg2+ intake is low, up
to 80 % of dietary Mg2+ can be absorbed (48). Mg2+ absorption in the gut depends on two
separate pathways; paracellular transport is responsible for bulk Mg2+ absorption and
takes place mostly in the small intestine, whereas fine-tuning occurs in the cecum and
colon via transcellular transport. In spite of this, the intestine seems to have a limited role
in regulation of the Mg2+ balance. In contrast to other minerals, intestinal Mg2+ absorption
is poorly regulated and depends mainly on Mg2+ intake (58, 126). Thus, the kidneys
presumably primarily regulate the maintenance of Mg2+ homeostasis.
Small Intestine
Mg2+ absorption in the small intestine is hypothesized to be exclusively of a paracellular
nature (Figure 3), since Mg2+ absorption in this region of the intestine correlates linearly to
luminal Mg2+ concentrations (73, 112). Moreover, epithelial Mg2+ channel Transient
receptor potential melastatin type 6 (TRPM6) is not expressed in the small intestine (52).
Mg2+ is poorly absorbed in the duodenum, where unfavorable electrochemical gradients
may even result in a limited amount of paracellular Mg2+ excretion (107). In later parts of
the small intestine, such as late jejunum and ileum, the driving force for passive Mg2+
transport is established by the high luminal Mg2+ concentration and the lumen-positive
transepithelial voltage of 15 mV (38). The Km for Mg2+ transport in the late small intestine
has been reported to be in the range of 4-12 mmol/L (95, 126). These results suggest that
16 | Chapter 1
0.7-1.1 mmol/L
Figure 2 Magnesium Homeostasis

Panels represent the daily amount of Mg2+ intake and excretion. Daily the intestines absorption
approximately 120 mg and secrete 20 mg of Mg2+, resulting in a net absorption of 100 mg. In the
kidney daily about 2,400 mg Mg2+ is filtered by the glomerulus, of which 2,300 mg is reabsorbed
along the kidney tubule. This results in a net excretion of 100 mg, which matches the intestinal
absorption. Bone and muscle provide the most important Mg2+ stores.
NaCl and water absorption are prerequisites for Mg2+ uptake, since water absorption
concentrates luminal Mg2+. Tight junction permeability underlying paracellular Mg2+
transport is still poorly understood. The small intestine has been described to be the most
permeable for ions because of the relatively low expression of tightening claudins 1, 3, 4,
5 and 8 (7, 83). Claudins 16 and 19, which are linked to Mg2+ transport, are not expressed in
the intestine (7, 65). The exact composition of the tight junction complex facilitating
intestinal Mg2+ absorption remains to be elucidated.
Figure 3 Magnesium Absorption in the Intestine

Bulk Mg2+ is absorbed paracellular by the late part of the small intestine. Fine-tuning of Mg2+
absorption takes place transcellular by the colon, where TRPM6 and TRPM7 Mg2+ channels facilitate
luminal Mg2+ uptake in the enterocyte. CNNM4 provides the basolateral Mg2+ extrusion mechanism.
TRPM6: Transient receptor potential melastatin type 6, TRPM7: Transient receptor potential melastatin type
7, ENaC: Epithelial Sodium Channel, CNNM4: Cyclin M4.
Large Intestine
Mg2+ absorption in cecum and colon is thought to be transcellular of nature and is on the
luminal side of the enterocyte mediated by TRPM6 and TRPM7 Mg2+ channels (Figure 3).
Specifically, the intestinal expression of TRPM6 is located in caecum and colon (52, 82). In
a study with rat colon epithelium, 37 % of Mg2+ was transported transcellularly (72). This
suggests the existence of significant paracellular transport of Mg2+ in the colon, which
would be unlikely given the expression of tight claudins 3, 4 and 8 in this segment (83). In
contrary to Ca2+, Mg2+ transport in colon is independent of 1,25-dihydroxyvitamin D3
(1,25(OH)2D3) signaling, nor is TRPM6 expression dependent on 1,25(OH)2D3 (52, 72). It has
18 | Chapter 1
been suggested that the basolateral Mg2+ extrusion mechanism of the enterocyte is
coupled to the Na+ gradient (117). Indeed, a recent study using Cyclin M4 (CNNM4) KO
mice, suggests that CNNM4 may act as a Na+/Mg2+ exchanger at the basolateral
membrane of enterocytes (155). CNNM4 knockout mice suffer from hypomagnesemia,
and functional analysis using Magnesium Green showed that CNNM4 overexpression
increased Mg2+ efflux in HEK293 cells. However, patients with CNNM4 mutations do not
suffer from hypomagnesemia (106, 109).
Magnesium Storage in Bone

Approximately 50-60 % of the total body Mg2+ content is stored in bone (Figure 2). Serum
Mg2+ concentrations are closely related to bone metabolism; bone surface Mg2+ is
continuously exchangeable with blood Mg2+ (5). Bone hydroxy-apatite structures mainly
consist of Pi and Ca2+ and are bound by Mg2+ ions at the surface of the hydroxy-apatite
crystals. Mg2+ increases the solubility of the minerals and thereby acts on the crystal size
and formation (120). Crystals in Mg2+-deficient bone are larger and the bones may
therefore be brittle and more susceptible to fractures (27). Moreover, Mg2+ stimulates
osteoblast proliferation, suggesting that Mg2+ deficiency results in decreased bone
formation (88). Mg2+-deficient rats have reduced osteoblast numbers and decreased
bone mass (118). Moreover, Mg2+ deficiency increases the secretion of pro-inflammatory
cytokines such as TNF, IL1 and substance P (118, 148), all of which have been implicated
in increased osteoclastic bone resorption (75). These effects may be further enhanced by
reduced PTH and 1,25(OH)2D3 levels, which are often associated with hypomagnesemia (119).
Magnesium Reabsorption in Kidney

Approximately 2,400 mg of Mg2+ is filtered by the glomeruli on a daily basis. The nephron
recovers 95-99 % of this; the remaining 100 mg leaves the body via the urine (Figure 2).
Proximal Tubule
The mechanisms of proximal tubule (PT) Mg2+ reabsorption are poorly understood, but
early micropuncture studies show that approximately 10-25 % of Mg2+ is reabsorbed by
the proximal convoluted tubule segment of the nephron (Figure 4) (84, 114). In the
glomeruli, 70 % of the serum Mg2+ is freely filterable, suggesting that the concentration in
the glomerular filtrates and thus the start of the PT ranges between 0.5-0.7 mmol/L. The
transepithelial potential difference ranges from slightly lumen negative (-6 mV) at the
early parts of the PT to positive (3 mV) in later parts (78). Micropuncture studies have
shown that a 1.9 ratio between the concentration of Mg2+ in the tubular fluid and the
interstitial fluid is necessary to initiate Mg2+ transport (84). This finding could be explained
by the poor tight junction permeability for Mg2+ in PT. As a result, water uptake via
aquaporin1 (AQP1) precedes Mg2+ reabsorption (113). Consequently, Mg2+ reabsorption
mainly occurs in the late parts of the PT, where the transepithelial chemical Mg2+ gradient
is sufficient to favor Mg2+ transport. Generally, PT Mg2+ reabsorption is considered to be a

passive paracellular process, but there might be some transcellular Mg2+ transport via a
poorly characterized amiloride-sensitive mechanism (69). In both cases, sufficient Na+
transport is required to drive water transport that is prerequisite for Mg2+ reabsorption.
Therefore, hormonal effects on Na+ reabsorption in the PT will also affect Mg2+
reabsorption in this segment. However, disturbances of proximal tubular Mg2+
reabsorption generally do not result in clinical symptoms, since more distal segments will
compensate for reduced Mg2+ uptake in PT.
Thick Ascending Limb of Henles Loop

Whereas most electrolytes are majorly transported in the PT, the Thick Ascending Limb of
Henles Loop (TAL) is the main location for Mg2+ reabsorption. Due to the unique
properties of this segment, approximately 50-70 % of filtered Mg2+ is reabsorbed here.
Most of the Mg2+ is reabsorbed by the cortical part of the TAL, since medullary Mg2+
reabsorption is negligible (130). Paracellular bulk Mg2+ transport is dependent on the
lumen-positive transepithelial voltage (+10 mV) that is determined by the activity of the
Na+-K+-2Cl- co-transporter (NKCC2) and the subsequent secretion of K+ at the apical
membrane (49). Inhibition of the NKCC2 by furosemide diuretics therefore results in
decreased TAL Mg2+ reabsorption. Further contributors to the transepithelial membrane
voltage are K+ secretion via ROMK and paracellular back flux of Na+ ions as a result of
decreasing luminal Na+ concentrations.

The reabsorption of Mg2+ in the TAL follow the paracellular pathway and therefore
depends on the tight junction permeability (Figure 4). Tight junctions form a physical and
chemical barrier between the epithelial cells. The major components of tight junctions are
proteins of the claudin family. Currently, 26 claudins have been described in humans (57).
Tight junction permeability is determined by the individual claudins in each tight junction
complex. TAL tubules are known to express claudins 3, 10, 11, 14, 16 and 19. Claudin 16 and
19 are considered to be the main claudins influencing Mg2+ permeability, since mutations
in these proteins results in renal Mg2+ wasting (80, 135).

However, the role of claudin 16 in Mg2+ reabsorption is controversial. Claudin 16 was
initially considered to act as a paracellular Mg2+ channel, but this hypothesis has not been
unequivocally confirmed (55, 64). Reports using the claudin 16 knockdown (KD) mouse
model and the LLC-PK1 cell model suggest that claudin 16 increases Na+ permeability (60,
64, 129). This would imply that claudin 16 is mainly involved in the regulation of the transepithelial voltage gradient by controlling the paracellular Na+ back leak. However, in
MDCK-C7 cells overexpressing claudin 16, Na+ permeability remained stable, whereas
Mg2+ permeability increased significantly (55). Claudin 16 KD mice demonstrate 2-fold
lower permeability ratio for Na+ over Cl without a change in paracellular conductance.
Consequently, the transepithelial voltage collapsed, reducing the driving force for Mg2+
reabsorption in TAL (128).
20 | Chapter 1
Figure 4 Magnesium Reabsorption in the Kidney

Along the nephron 95 % is reabsorbed. 10-25 % of Mg2+ is reabsorbed in the late proximal tubule
(PT), where Na+ and H2O reabsorption via NHE3 and AQP1 are prerequisites for paracellular Mg2+
transport. Bulk Mg2+ reabsorption (50-70 %) takes place in the thick ascending limb of Henles Loop
(TAL). In TAL, Mg2+ reabsorption take place paracellular and depends on the uptake of Na+ and K+ via
NKCC2. Fine-tuning (10 %) of Mg2+ transport takes place transcellular in the distal convoluted tubule
(DCT). In DCT, TRPM6 facilitates Mg2+ uptake from the pro-urine, which depends on the voltage-gradient set by back leak of K+ via ROMK and Kv1.1 potassium channels. At the basolateral membrane,
Mg2+ is extruded via an unknown mechanism, which may be regulated by CNNM2 acting as
Mg2+-sensor. Mg2+ extrusion depends on the Na+ gradient, set by the Na+-K+-ATPase. The activity of
the Na+-K+-ATPase is in turn dependent on K+ recycling via Kir4.1. FXYD2 transcription encoding the
-subunit of the Na+-K+-ATPase, is regulated by HNF1. Upon activation of the EGFR and IR an
intracellular signaling cascade (PI3K, Akt and Rac1) results in an increased TRPM6 membrane
expression and channel activity. Additionally, estrogens stimulate TRPM6 mRNA expression.
PT: Proximal Tubule, TAL: Thick Ascending Limb of Henles Loop, DCT: Distal Convoluted Tubule, CNT:
Connecting Tubule, CD: Collecting Duct, NHE3: Na+-H+-exchanger type 3, AQP1: Aquaporin 1, NKCC2: Na+K+-2Cl--cotransporter, ROMK: Renal Outer Medulla K+ channel, ClC-Kb: Chloride channel Kb, Kv1.1: Voltage
gated K+ channel 1.1,TRPM6: Transient receptor potential melastatin type 6, NCC: Na+-Cl- co-transporter,
CNNM2: Cyclin M2, FXYD2: FXYD-domain containing 2, HNF1: Hepatocyte Nuclear Factor 1, EGF:
Epidermal Growth Factor, EGFR: Epidermal Growth Factor Receptor, IR: Insulin Receptor, PI3K: Phosphoinositide 3-kinase, Rac1: Ras-related C3 botulinum toxin substrate 1, Cdk5: Cyclin-dependent kinase 5.

Claudin 19 has been studied less extensively, but claudin 19 has been suggested to
increase the tight junction barrier function (8). The claudin 19 KD mouse exhibits highly
increased urinary excretion of K+, Mg2+ and Ca2+, but Mg2+ is the only electrolyte changed
at serum level (65). The discrepancy between studies with claudin 16 and claudin 19
isoforms might be explained by their interdependence in forming functional tight
junction barriers (65, 66). Both in vitro and in vivo studies demonstrated that claudin 16 and
19 need to interact for proper insertion in the tight junction to be become functionally
active. Further differences in experimental results may depend on the endogenous
expression of other claudin isoforms in the specific cell types used in these experiments.
Claudin 14 reduces the cation specificity of tight junction barriers, when co-expressed
with claudin 16, or with claudin 16 - claudin 19 complexes (46). Consequently, claudin 14
KO mice exhibit increased serum Mg2+ values and decreased urinary Mg2+ excretion. This
agrees with previous findings in Madin-Darby canine kidney (MDCK) cells showing that
claudin 14 acts as a non-specific cation blocker (12, 149). Studies on claudin 14 KO mice
have mainly focused on Ca2+ homeostasis, since claudin 14 expression is highly Ca2+
sensitive (33, 46). The CaSR regulates claudin 14 expression and Ca2+ reabsorption in the
TAL by downregulation of two microRNAs, miR-9 and miR-374. Since CaSR is also activated
by Mg2+, although to a lesser extent than Ca2+, it would be interesting to address the
effect of elevated serum Mg2+ levels on claudin 14 expression in future studies.

Recently, claudin 10 has been identified as an important factor in cation selectivity in
TAL, as demonstrated in a mouse model where claudin 10 was deleted specifically in this
segment (16). Claudin 10 TAL-KO mice show hypermagnesemia, nephrocalcinosis and
impaired paracellular Na+ permeability. In the absence of claudin 10, TAL tight junctions
become more permeable for Ca2+ and Mg2+ and the transepithelial voltage increases.
These results are in line with in vitro studies overexpressing claudin 10b, suggesting that
this splice variant is mainly expressed in TAL (16, 56).
Over the last decades several mutations have been found that result in disturbed
Mg2+ reabsorption in the TAL. An overview of TAL-caused genetic Mg2+ disorders is
presented in Box 1.
22 | Chapter 1
Box 1 Genetic Disorders of TAL Mg2+ Reabsorption

CLDN16
Familial hypomagnesemia with hypercalciuria and nephrocalcinosis Type 1

(FHHNC Type 1; OMIM: 248250) is caused by mutations in claudin 16 previously
known as Paracellin-1 (135). Patients suffer from renal Mg2+ wasting, hypo
magnesemia, renal Ca2+ wasting, renal parenchymal calcification (nephro
calcinosis) and renal failure. Serum and urinary Na+, K+, Cl- and HCO3- are
initially normal, but may get indirectly affected after progression of renal
failure. Sometimes these symptoms are extended to urinary tract infections,
kidney stones and hyperuricemia. Mg2+ supplementation is not capable in
restoring normal serum Mg2+ levels or slow down disease progression (150).
A few dozen different mutations have been reported, all characterized by a
recessive mode of inheritance (44). All symptoms can be traced to the TAL, the
main site for paracellular Ca2+ and Mg2+ reabsorption. Claudin 16 is part of the
tight junction barrier between the cells. The TAL is the main site for paracellular
Ca2+ and Mg2+ reabsorption, and disruption of these tight junctions result in
a lack of Ca2+ and Mg2+ absorption in TAL, which can only be partially be
compensated for in the downstream DCT and CNT segments.
CLDN19
Similar to FHHNC Type 1, patients with FHHNC type 2 (OMIM: 248190) suffer
from severe hypomagnesemia accompanied with hypercalciuria and nephrocalcinosis. Additionally, patients have ocular defects consisting of macular
colobomata, significant myopia, and horizontal nystagmus. FHHNC type 2 is
caused by mutations in Claudin 19, which is expressed in the TAL segment of
the kidney. In the initial publication from Konrad and colleagues 12 patients
from 10 families were genotyped and characterized (80). Remarkably, 9 out
of 12 patients developed chronic kidney disease or underwent kidney
transplantation. Indeed, other studies confirmed that FHHNC type 2 patients
are more prone to developing CKD and develop the disease at an earlier age
compared to Type 1 patients (44), Over the years, several treatment regimens
have been proposed including oral magnesium supplementation, thiazide
diuretics and indomethacin. However, none of these treatments significantly
increased serum Mg2+ values (44).
SLC12A1 BSND
CLCNKB KCNJ1
Bartters syndrome was originally described by Dr. Bartter in 1962 and is

characterized by salt wasting, hypokalemic alkalosis, elevated renin and
aldosterone levels and low blood pressure (10). Mutations in SLC12A1,
encoding NKCC2, Barttin, ClC-Kb, KCNJ1, encoding ROMK and the CaSR form
the genetic basis of Bartters syndrome (13, 132-134). Mild hypomagnesemia is
sometimes observed in Bartters patients, which could be explained by a
reduced driving force for paracellular Mg2+ reabsorption in the TAL.
Compensation for reduced TAL Mg2+ reabsorption may take place in the DCT,
which explains why Bartters patients often have normal Mg2+ levels. ClC-Kb
and Barttin are also expressed in DCT, which justifies why patients with
mutations in these genes more often show hypomagnesemia (70).
Distal Convoluted Tubule

The distal convoluted tubule (DCT) determines the final urinary Mg2+ excretion, since no
reabsorption of Mg2+ take place beyond this segment. Approximately 10 % of the total
Mg2+ is reabsorbed by tightly regulated transcellular transport mechanisms (Figure 2) (18).
DCT cells form a high-resistance epithelium with a lumen negative voltage of approximately 5
mV (49, 152). In DCT, TRPM6 divalent cation channels mediate luminal Mg2+ uptake (Figure 4).
Within the kidney, TRPM6 is specifically expressed in DCT and its activity is regulated by
intracellular Mg2+ (144). TRPM6 contains six transmembrane spanning domains with a
pore region between the fifth and sixth segment and a large kinase domain fused to the
channels intracellular C-terminus. TRPM6 may function in homo- and heteromeric
tetramers with TRPM7, although there is some controversy about the necessity of TRPM7
for TRPM6 function (87, 157).
TRPM6 is regulated by numerous factors at the level of transcription, plasma membrane
availability and activity (21). Epidermal growth factor (EGF) and insulin act on TRPM6 by a
PI3K-Akt-Rac1 dependent mechanism, increasing the insertion of TRPM6 in the membrane
(100, 141). Insulin may directly affect TRPM6 activity through cyclin-dependent kinase 5
(cdk5)-dependent phosphorylation of the channel. Patients with reduced EGF receptor or
insulin receptor activity are therefore more susceptible to hypomagnesemia (100, 124).
Additionally, estrogens increase TRPM6 mRNA expression (52). Over the last decade,
several important interactors of TRPM6, including guanine nucleotide-binding protein
subunit beta-2-like 1 (GNB2L1/RACK1) and prohibitin2 (PHB2/REA), have been identified
(22, 23). Interestingly, GNB2L1 interacts with the -kinase domain of TRPM6 in the autophosphorylated state thereby reducing channel activity (22). Other modulators of TRPM6
activity include dietary Mg2+, pH and ATP (142). Interestingly, acidification-induced current
potentiation is dependent on residues p.Glu1024 and p.Glu1029, which also determine
the pore selectivity for Mg2+ (86, 101). Moreover, recent findings indicate that TRPM6 is
inhibited by low concentrations of intracellular ATP (IC50: 29 mol/L), questioning the
physiological activity of monomeric TRPM6 channels (157).

A chemical gradient for Mg2+ entry in DCT cells is almost absent. The luminal Mg2+
concentrations vary between 0.2-0.7 mmol/L and the intracellular Mg2+ levels are typically
in the range of 0.5-1.0 mmol/L. Therefore, luminal Mg2+ entry is purely dependent on the
negative membrane potential in the DCT cell. Luminal K+ channels are indispensable for
maintaining the necessary driving force for Mg2+ uptake. The voltage-gated K+ channel
Kv1.1 has been suggested to provide efflux K+ currents resulting in hyperpolarization of
the luminal membrane, although expression levels in the DCT are limited (43). To prevent
Mg2+ overload and hyperpolarization of the luminal membrane, intracellular Mg2+ blocks
Kv1.1 (45). Interestingly, recent studies suggest that other K+ channels in the luminal
membrane of DCT cells may have similar roles. ROMK is prominently expressed in DCT and
its expression in this segment is regulated by dietary Mg2+ (153). Similar to Kv1.1, intracellular
Mg2+ blocks ROMK currents, suggesting a regulatory function on Mg2+ homeostasis (156).
24 | Chapter 1
Moreover, indirect inhibition of ROMK by aldosterone or Epithelial Na+ Channel (ENaC)

blockers represent the only effective approach to prevent renal Mg2+ wasting in most
clinical situations (34).

Several proteins have been suggested to mediate Mg2+ extrusion to the bloodstream,
but general consensus of the extrusion mechanism has not been reached. Due to the
absence of a representative DCT cell model, the properties of Mg2+ extrusion have not
been elucidated. Nevertheless, over the last decade several groups have claimed to
identify Mg2+ extrusion proteins. Originally described in 2002, Cyclin M2 (CNNM2
previously known as ACDP2) is exclusively expressed at the basolateral membrane of DCT
and CNT cells within the kidney (138, 147). Moreover, expression of CNNM2 is sensitive to
dietary Mg2+ availability (138). CNNM2 was initially depicted as Mg2+ transporter, since
overexpression in Xenopus laevis oocytes allows uptake of a variety of divalent cations,
with highest affinity for Mg2+ (47). However, these results could not be confirmed in
mammalian cell lines (138). Thus, it remains unclear whether CNNM2 mediates Mg2+
uptake directly or activates other Mg2+ carriers.

Recently, mutations in the SLC41A1 Mg2+ transporter were described to be causative
for a nephronophthisis-like phenotype (68). Localization studies showed expression in
DCT, however the immunostainings were not conclusive about the subcellular localization
(apical or basolateral) of SLC41A1 proteins (68). Using Mag-Fura, SLC41A1 was demonstrated
to increase both Mg2+ absorption and Mg2+ extrusion (68, 79). These results suggest that
SLC41A1 plays a role in DCT Mg2+ reabsorption, although further studies are necessary to
elucidate the mechanisms by which SLC41A1 mediates Mg2+ transport.
Since parvalbumin is within the kidney exclusively expressed in DCT, it has been
suggested that this cytosolic protein acts as a Ca2+/Mg2+ buffer in DCT (122). Although
parvalbumin has much higher affinity for Ca2+ than for Mg2+ (dissociation constants are
510 nmol/L for Ca2+ and 30 mol/L for Mg2+), the cation binding sites of parvalbumin
will be mainly occupied by Mg2+ (105). This can be explained by the fact that the
intracellular concentration of Mg2+ (0.51.0 mmol/L) exceeds largely that of Ca2+ (50100
nmol/L). In mouse and human kidney, parvalbumin is exclusively expressed in the early
DCT (11). In late DCT and CNT, calbindin-D28K is the main Ca2+-binding protein. The exact
role of parvalbumin in DCT remains to be elucidated. Parvalbumin KO mice do not have
altered serum or urine Mg2+ levels under basal conditions (11). The mice have reduced
NCC expression, but display normal tubule morphology. DCT parvalbumin expression is
highly sensitive to dietary Mg2+ availability, suggesting that parvalbumin plays an
important role in DCT Mg2+ reabsorption.

Disturbed Mg2+ reabsorption in the DCT inevitably results in renal Mg2+ wasting,
since no Mg2+ is reabsorbed beyond this segment. An overview of genetic Mg2+
disorders due to DCT defects is presented in Box 2.
Box 2 Genetic Disorders of DCT Mg2+ Reabsorption

TRPM6
Hypomagnesemia with secondary hypocalcemia (HSH, OMIM: 602014) is

characterized by extremely low serum Mg2+ levels (0.1-0.3 mmol/L)
accompanied by low serum Ca2+ levels, which result in severe muscular and
neurological complications including seizures and mental retardation (121,
145). The disorder was first characterized by Paunier and colleagues and 1968
and later mapped to a region at chromosome 9q in 1997 (108, 146). In 2002,
two independent groups identified mutations in TRPM6 to be causative for
HSH (121, 145). TRPM6 forms the epithelial Mg2+ channel responsible for
transcellular Mg2+ transport in the colon and DCT segment of the kidney
(144). Therefore, mutations result in reduced intestinal absorption and renal
Mg2+ wasting. HSH has an autosomal-recessive mode of inheritance and until
now a few dozen mutations have been identified. Patients are generally
treated with Mg2+ supplements and anti-epileptic drugs against seizures.
Serum Mg2+ levels improve after supplementation, but normally do not
recover to normal levels (81).
EGF
Isolated autosomal recessive hypomagnesemia (IRH, OMIM: 611718) is caused

by mutations in the EGF gene (53). In a consanguine family from Dutch origin,
two sisters presented with serum Mg2+ levels of 0.53 mmol/L and 0.56 mmol/L
and urinary Mg2+ values of 3.9 mmol/24 h and 3.7 mmol/24 h, respectively (41).
Serum Ca2+, Na+, K+, Cl, HCO3, and blood pH values were normal. The
patients presented with epileptic seizures during their first year of life, which
could be controlled by anti-epileptic drugs. Moreover, psychomotor
retardation was observed in these patients. Plasma renin activity, plasma
aldosterone, and parathyroid hormone concentrations were in the normal
range. Homozygosity mapping and subsequent Sanger sequencing of gene
candidates resulted in the identification of a homozygous c.3209C>T mutation
in exon 22 resulting a p.P1070L missense mutation at protein level (53). This
residue is particularly important for membrane targeting of the EGF molecule
and the mutation results in impaired basolateral sorting of EGF. Therefore,
TRPM6 is not stimulated, resulting in renal Mg2+ wasting (53, 141). Until now,
only a single family has been described with EGF mutations, but studies with
EGFR antagonists further underline the clinical importance of EGF for renal
Mg2+ handling.
KCNA1
In a Brazilian family mutations in KCNA1 encoding voltage-gated K+ channel

Kv1.1 were shown to cause autosomal dominant hypomagnesemia (OMIM:
176260) (43). The patient presented in the clinic with muscle cramps, muscle,
weakness, tetanic episodes and tremor. Serum Mg2+ values were low (0.37
mmol/L), whereas other electrolytes and metabolites including Na+, K+, Ca2+,
Pi, uric acid, bicarbonate, urea, creatinine, glucose, bilirubin, aminotransferases,
alkaline phosphate, and lactate dehydrogenase were all normal. Urinary
creatinine clearance, Mg2+ and Ca2+ excretion were within the normal range.
KCNA1 mutations were previously linked to ataxia and myokymia (17, 36).
26 | Chapter 1
Box 2 Continued
KCNA1
Therefore, a cerebral MRI was performed in this patient, showing slight

atrophia of the cerebral vermis. Family members suffer from myokymic
discharge in electromyograph analysis, which is in line with the previously
observed mixed phenotype. Intravenous Mg2+ infusion improved the clinical
symptoms. Kv1.1 has been proposed to cause apical hyperpolarization, which
allows the uptake of Mg2+ via TRPM6. The p.N255D (c.763A>G) mutation
identified in the Brazilian family disrupts Kv1.1 activity and therefore may
reduce the driving force for Mg2+ transport. Although many KCNA1 mutations
have been reported, even in residues very close to the p.N255, none of these
have been associated with hypomagnesemia (4, 71). Identification of
additional hypomagnesemic families with Kv1.1 mutations may aid our
understanding of Kv1.1 function in DCT. It has been suggested that other
factors contribute to the apical membrane potential and may compensate for
a loss of Kv1.1 function; ROMK may be one of them (34).
SLC12A3
Hypomagnesemia with hypokalemia are the cardinal symptoms of a

hereditary electrolyte disorder characterized by Dr. Gitelman in 1966, that has
been known since as Gitelmans syndrome (42). Patients present with tetany,
paresthesias, and chondrocalcinosis (77). The severity of the symptoms often
depends on the degree of the hypokalemia. Except hypokalemia and
hypomagnesemia, laboratory investigations often show metabolic alkalosis
and hypocalciuria, sometimes associated with a mild hypotension and
prolonged QT interval. Mutations in SLC12A3 encoding the thiazide-sensitive
Na+-Cl--co-transporter (NCC) cause Gitelmans syndrome (39, 136). Patients
with Gitelmans syndrome are often treated with oral Mg2+ supplements (77).
Interestingly, in some patients Mg2+ supplementation results in restoration
of normal K+ levels, suggesting that hypokalemia is secondary to hypo
magnesemia (54). This hypothesis is further substantiated by the NCC KO
mouse, which is hypomagnesemic but does not display K+ disturbances
under basal conditions (125). NCC KO mice have markedly reduced TRPM6
expression levels, which may explain the renal Mg2+ wasting observed in
Gitelmans syndrome (102). However, the mechanisms explaining why a loss of
NCC function results in reduced TRPM6 expression remains unresolved. It has
been suggested that atrophy of the DCT segment observed in KO mice, may
partially explain this phenomenon (89).
CNNM2
Mutations in CNNM2 have been shown to be causative for hypomagnesemia

with seizures and mental retardation (HSMR, OMIM: 613882). Originally, two
unrelated families with seizures and dominant hypomagnesemia were
reported to carry CNNM2 mutations (138). In these patients, serum Mg2+ levels
range between 0.3-0.5 mmol/L, but no other electrolyte disturbances were
detected. The patients symptoms include seizures, loss of consciousness, loss
of muscle tone, headaches and staring (94). HSMR patients are treated with
anti-epileptic drugs and Mg2+ supplements. Mg2+ levels improve after supplementation but didnt reach to normal levels.
KCNJ10
Mutations in KCNJ10 encoding the Kir4.1 K+ channel are causative for Seizures,
sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance /
epilepsy, ataxia, sensorineural deafness, and renal tubulopathy syndrome
(SeSAME/EAST, OMIM: 612780) (14, 116, 123). Patients have marked electrolyte
abnormalities, including hypokalemic metabolic alkalosis without hypertension,
severe hypomagnesemia and renal Na+, K+ and Mg2+ wasting. In some patients,
high renin and aldosterone levels, salt craving and polyuria were observed.
Kir4.1 is hypothesized to be involved in K+ recycling at the basolateral membrane
of DCT cells. When Kir4.1 is mutated, K+ availability becomes rate limiting for
Na+-K+-ATPase activity. Thus, the Na+-K+-ATPase will be inhibited resulting in a
reduced potential across the basolateral membrane. Consequently, Na+ and
Mg2+ transport will be reduced in DCT. To compensate for this, ENaC activity in
CNT will be increased at the expense of K+ excretion via ROMK. Therefore,
SeSAME/EAST patients suffer from severe hypomagnesemia and hypokalemia.
To treat the hypomagnesemia, patients are often treated with Mg2+ and K+
supplements in combination with aldosterone antagonists or ENaC inhibitors
(9). SeSAME/EAST patients suffer from a severe neurological phenotype
consisting of tonic-clonic seizures in infancy, cerebellar ataxia and hearing loss.
Moreover, magnetic resonance imaging evidenced subtle symmetrical signal
changes in the cerebellar dentate nuclei (29).
FXYD2
Gene linkage studies identified FXYD domain containing ion transport

regulator 2 (FXYD2) mutations in a family with dominant isolated renal Mg2+
wasting (IDH, OMIM: 154020) (93). The patients in this family suffered from low
serum Mg2+ values (0.4 mmol/L), without other plasma electrolyte
abnormalities including Na+, K+, Ca2+, Cl-, HCO3-. Urinary Mg2+ excretion was
increased, whereas Ca2+ excretion was slightly low (40). The c.121G>A mutation
results in a p.G41R missense mutation at protein level which causes misrouting
of FXYD2 to the membrane (19). FXYD2 encodes for the -subunit of the
Na+-K+-ATPase. Although the exact role of FXYD2 in the DCT it is unknown. It
has been hypothesized to stabilize the Na+-K+-ATPase, influencing the
membrane potential necessary for Mg2+ transport (96). However, other
reports suggest that it may function as inward rectifier channel on its own
(127). Functional analysis of patients proximal tubular cells showed no
differences in Na+, K+ or ATP-affinity of the Na+-K+-ATPase, but demonstrated
a lower FXYD2 protein expression (20).
HNF1B
Renal cysts and diabetes syndrome (RCAD, OMIM: 137920) is caused by

mutations in Hepatocyte nuclear factor 1B (HNF1B) and consists of a
heterogenous group of symptoms including renal cysts ( 70 % of patients),
maturity onset diabetes of the young subtype 5 (MODY5, 50 %) and
hypomagnesemia ( 45 %) (3, 25). HNF1 is a transcription factor regulating
gene expression in kidney development (91). Amongst others, FXYD2b
expression has been shown to be regulated by HNF1 (37), which may explain
its role in renal Mg2+ handling. However, it cannot be excluded that HNF1
additionally regulates other DCT genes involved in renal Mg2+ transport.
28 | Chapter 1
Outline of this Thesis

The aim of this thesis was to understand the physiological mechanism of Mg2+
reabsorption in the DCT. Dissecting the biochemical and molecular basis of Mg2+ transport
pathways and their regulatory mechanisms may aid to provide clinical tools for patients
with genetic or acquired Mg2+ deficiencies. In particular, this thesis aims to identify and to
characterize new genes involved in DCT Mg2+ transport. Chapter 2 provides a large-scale
screening of Mg2+ sensitive gene expression in the DCT by microarray analysis on isolated
DCT cells form mice fed Mg2+-enriched and Mg2+-deficient diets. This study resulted in
the identification of several new genes regulating Mg2+ reabsorption in the DCT, including
PCBD1 and SLC41A3. In Chapter 3, the role of PCBD1 as transcriptional co-activator of
HNF1B has been further characterized using luciferase assays to determine its effect on
FXYD2 transcription. It was acknowledged that patients with mutations in PCBD1 develop
hypomagnesemia and MODY5-like diabetes, which may partially be the result of reduced
FXYD2 transcription in the kidney. Within the DCT cell the extrusion mechanism for Mg2+
remains to be identified. In Chapter 4, two new patient families with hypomagnesemia
caused by FXYD2 mutation were described. Extensive clinical examinations aimed to
further describe the clinical presentation of patients with FXYD2 mutations. Moreover,
haplotype and genealogical analysis was performed to identify the genetic origin of
FXYD2 mutations. Several transporters have been proposed to mediate Mg2+ transport at
the basolateral membrane of the DCT cell. Chapter 5 aimed to examine whether SLC41A3
may be one of these extrusion mechanisms. Using Slc41a3 knockout mice, the effect on
Mg2+ homeostasis and renal function was investigated.
Although patients with CNNM2 mutations develop severe hypomagnesemia and
renal Mg2+ wasting, CNNM2 was excluded as Mg2+ extrusion protein. In Chapter 6,
biochemical and molecular characterization of the CNNM2 protein aimed to elucidate the
structure and regulation of CNNM2. Using epitope-stainings the membrane topology was
determined and by homology modeling the ability of CNNM2 to bind Mg-ATP was
studied. In Chapter 7, it was shown that patients with CNNM2 mutations develop severe
seizures and mental retardation. By introducing 25Mg2+ uptakes studies to measure Mg2+
transport, the goal was test which patient mutations could alter CNNM2 function.
Moreover, we used the zebrafish knockdown system to test the effect of CNNM2 on brain
development and activity.
The last part of this thesis is dedicated to new regulatory mechanisms of TRPM6
activity. In Chapter 8, expression profiling of P2X purinoreceptors aimed to identify the
purinoreceptors involved in ATP-mediated regulation of Mg2+ transport. By patch clamp
analysis the effect of ATP was studied on TRPM6 activity via P2X4 purinoreceptors.
Chapter 9 examines the effect of the small molecules belonging to the flavagline class of
compounds, on TRPM6 activity using patch clamp analysis. Studying new activators of
TRPM6-mediated Mg2+ transport may provide new potential treatment for patients with
hypomagnesemia. In chapter 10 the findings of this thesis are summarized and discussed
by placing them in the context of the current knowledge of renal Mg2+ transport in the
DCT.
30 | Chapter 1
References
1. In: Dietary Reference Intakes for Calcium, Phosphorus, Magnesium, Vitamin D, and Fluoride. Washington (DC): 1997.
2. Expert Panel Report 3 (EPR-3): Guidelines for the Diagnosis and Management of Asthma-Summary Report
2007. The Journal of allergy and clinical immunology 120: S94-138, 2007.
3. Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE,
Rees L, vant Hoff W, Marks SD, Trompeter RS, Tullus K, Winyard PJ, Cansick J, Mushtaq I, Dhillon HK,
Bingham C, Edghill EL, Shroff R, Stanescu H, Ryffel GU, Ellard S, and Bockenhauer D. HNF1B mutations
associate with hypomagnesemia and renal magnesium wasting. Journal of the American Society of Nephrology
: JASN 20: 1123-1131, 2009.
4. Adelman JP, Bond CT, Pessia M, and Maylie J. Episodic ataxia results from voltage-dependent potassium
channels with altered functions. Neuron 15: 1449-1454, 1995.
5. Alfrey AC, Miller NL, and Trow R. Effect of age and magnesium depletion on bone magnesium pools in rats.
The Journal of clinical investigation 54: 1074-1081, 1974.
6. Altura BT, Memon ZI, Zhang A, Cheng TP, Silverman R, Cracco RQ, and Altura BM. Low levels of serum
ionized magnesium are found in patients early after stroke which result in rapid elevation in cytosolic free
calcium and spasm in cerebral vascular muscle cells. Neuroscience letters 230: 37-40, 1997.
7. Amasheh S, Fromm M, and Gunzel D. Claudins of intestine and nephron - a correlation of molecular tight
junction structure and barrier function. Acta Physiol (Oxf) 201: 133-140, 2011.
8. Angelow S, El-Husseini R, Kanzawa SA, and Yu AS. Renal localization and function of the tight junction
protein, claudin-19. American journal of physiology Renal physiology 293: F166-177, 2007.
9. Bandulik S, Schmidt K, Bockenhauer D, Zdebik AA, Humberg E, Kleta R, Warth R, and Reichold M. The
salt-wasting phenotype of EAST syndrome, a disease with multifaceted symptoms linked to the KCNJ10 K+
channel. Pflugers Archiv : European journal of physiology 461: 423-435, 2011.
10. Bartter FC, Pronove P, Gill JR, Jr., and Maccardle RC. Hyperplasia of the juxtaglomerular complex with hyperaldosteronism and hypokalemic alkalosis. A new syndrome. The American journal of medicine 33: 811-828, 1962.
11. Belge H, Gailly P, Schwaller B, Loffing J, Debaix H, Riveira-Munoz E, Beauwens R, Devogelaer JP,
Hoenderop JG, Bindels RJ, and Devuyst O. Renal expression of parvalbumin is critical for NaCl handling
and response to diuretics. Proceedings of the National Academy of Sciences of the United States of America 104:
14849-14854, 2007.
12. Ben-Yosef T, Belyantseva IA, Saunders TL, Hughes ED, Kawamoto K, Van Itallie CM, Beyer LA, Halsey
K, Gardner DJ, Wilcox ER, Rasmussen J, Anderson JM, Dolan DF, Forge A, Raphael Y, Camper SA, and
Friedman TB. Claudin 14 knockout mice, a model for autosomal recessive deafness DFNB29, are deaf due to
cochlear hair cell degeneration. Human molecular genetics 12: 2049-2061, 2003.
13. Birkenhager R, Otto E, Schurmann MJ, Vollmer M, Ruf EM, Maier-Lutz I, Beekmann F, Fekete A, Omran
H, Feldmann D, Milford DV, Jeck N, Konrad M, Landau D, Knoers NV, Antignac C, Sudbrak R, Kispert A,
and Hildebrandt F. Mutation of BSND causes Bartter syndrome with sensorineural deafness and kidney
failure. Nature genetics 29: 310-314, 2001.
14. Bockenhauer D, Feather S, Stanescu HC, Bandulik S, Zdebik AA, Reichold M, Tobin J, Lieberer E,
Sterner C, Landoure G, Arora R, Sirimanna T, Thompson D, Cross JH, vant Hoff W, Al Masri O, Tullus K,
Yeung S, Anikster Y, Klootwijk E, Hubank M, Dillon MJ, Heitzmann D, Arcos-Burgos M, Knepper MA,
Dobbie A, Gahl WA, Warth R, Sheridan E, and Kleta R. Epilepsy, ataxia, sensorineural deafness, tubulopathy,
and KCNJ10 mutations. The New England journal of medicine 360: 1960-1970, 2009.
15. Brautigam CA, and Steitz TA. Structural and functional insights provided by crystal structures of DNA
polymerases and their substrate complexes. Current opinion in structural biology 8: 54-63, 1998.
16. Breiderhoff T, Himmerkus N, Stuiver M, Mutig K, Will C, Meij IC, Bachmann S, Bleich M, Willnow TE,
and Muller D. Deletion of claudin-10 (Cldn10) in the thick ascending limb impairs paracellular sodium
permeability and leads to hypermagnesemia and nephrocalcinosis. Proceedings of the National Academy of
Sciences of the United States of America 109: 14241-14246, 2012.
17. Browne DL, Gancher ST, Nutt JG, Brunt ER, Smith EA, Kramer P, and Litt M. Episodic ataxia/myokymia
syndrome is associated with point mutations in the human potassium channel gene, KCNA1. Nature genetics
8: 136-140, 1994.
18. Brunette MG, Vigneault N, and Carriere S. Micropuncture study of magnesium transport along the
nephron in the young rat. The American journal of physiology 227: 891-896, 1974.
19. Cairo ER, Friedrich T, Swarts HG, Knoers NV, Bindels RJ, Monnens LA, Willems PH, De Pont JJ, and
Koenderink JB. Impaired routing of wild type FXYD2 after oligomerisation with FXYD2-G41R might explain
the dominant nature of renal hypomagnesemia. Biochimica et biophysica acta 1778: 398-404, 2008.
20. Cairo ER, Swarts HG, Wilmer MJ, Willems PH, Levtchenko EN, De Pont JJ, and Koenderink JB. FXYD2
and Na,K-ATPase expression in isolated human proximal tubular cells: disturbed upregulation on renal
hypomagnesemia? The Journal of membrane biology 231: 117-124, 2009.
21. Cao G, Hoenderop JG, and Bindels RJ. Insight into the molecular regulation of the epithelial magnesium
channel TRPM6. Current opinion in nephrology and hypertension 17: 373-378, 2008.
22. Cao G, Thebault S, van der Wijst J, van der Kemp A, Lasonder E, Bindels RJ, and Hoenderop JG. RACK1
inhibits TRPM6 activity via phosphorylation of the fused alpha-kinase domain. Current biology : CB 18: 168-176,
2008.
23. Cao G, van der Wijst J, van der Kemp A, van Zeeland F, Bindels RJ, and Hoenderop JG. Regulation of the
epithelial Mg2+ channel TRPM6 by estrogen and the associated repressor protein of estrogen receptor
activity (REA). The Journal of biological chemistry 284: 14788-14795, 2009.
24. Caspi R, Altman T, Dreher K, Fulcher CA, Subhraveti P, Keseler IM, Kothari A, Krummenacker M,
Latendresse M, Mueller LA, Ong Q, Paley S, Pujar A, Shearer AG, Travers M, Weerasinghe D, Zhang P,
and Karp PD. The MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of
pathway/genome databases. Nucleic acids research 40: D742-753, 2012.
25. Chen YZ, Gao Q, Zhao XZ, Chen YZ, Bennett CL, Xiong XS, Mei CL, Shi YQ, and Chen XM. Systematic
review of TCF2 anomalies in renal cysts and diabetes syndrome/maturity onset diabetes of the young type 5.
Chinese medical journal 123: 3326-3333, 2010.
26. Chernow B, Bamberger S, Stoiko M, Vadnais M, Mills S, Hoellerich V, and Warshaw AL. Hypomagnesemia
in patients in postoperative intensive care. Chest 95: 391-397, 1989.
27. Cohen L, and Kitzes R. Infrared spectroscopy and magnesium content of bone mineral in osteoporotic
women. Israel journal of medical sciences 17: 1123-1125, 1981.
28. Cowan JA. The biological chemistry of magnesium. VCH Publishers, 1995.
29. Cross JH, Arora R, Heckemann RA, Gunny R, Chong K, Carr L, Baldeweg T, Differ AM, Lench N, Varadkar
S, Sirimanna T, Wassmer E, Hulton SA, Ognjanovic M, Ramesh V, Feather S, Kleta R, Hammers A, and
Bockenhauer D. Neurological features of epilepsy, ataxia, sensorineural deafness, tubulopathy syndrome.
Developmental medicine and child neurology 55: 846-856, 2013.
30. Davy H. Electro-Chemical Researches, on the Decomposition of the Earths; With Observations on the Metals
Obtained from the Alkaline Earths, and on the Amalgam Procured from Ammonia. Philosophical Transactions
of the Royal Society of London 98: 333-370, 1808.
31. Denis W. Determination of magnesium in blood. Journal of Biological Chemistry 41: 363-365, 1920.
32. Derom ML, Sayon-Orea C, Martinez-Ortega JM, and Martinez-Gonzalez MA. Magnesium and
depression: a systematic review. Nutritional neuroscience 2012.
33. Dimke H, Desai P, Borovac J, Lau A, Pan W, and Alexander RT. Activation of the Ca(2+)-sensing receptor
increases renal claudin-14 expression and urinary Ca(2+) excretion. American journal of physiology Renal
physiology 304: F761-769, 2013.
34. Ellison DH. The voltage-gated K+ channel subunit Kv1.1 links kidney and brain. The Journal of clinical
investigation 119: 763-766, 2009.
35. Escuela MP, Guerra M, Anon JM, Martinez-Vizcaino V, Zapatero MD, Garcia-Jalon A, and Celaya S. Total
and ionized serum magnesium in critically ill patients. Intensive care medicine 31: 151-156, 2005.
36. Eunson LH, Rea R, Zuberi SM, Youroukos S, Panayiotopoulos CP, Liguori R, Avoni P, McWilliam RC,
Stephenson JB, Hanna MG, Kullmann DM, and Spauschus A. Clinical, genetic, and expression studies of
mutations in the potassium channel gene KCNA1 reveal new phenotypic variability. Annals of neurology 48:
647-656, 2000.
37. Ferre S, Veenstra GJ, Bouwmeester R, Hoenderop JG, and Bindels RJ. HNF-1B specifically regulates the
transcription of the gammaa-subunit of the Na+/K+-ATPase. Biochemical and biophysical research
communications 404: 284-290, 2011.
32 | Chapter 1
38. Fordtran JS, Rector FC, Jr., and Carter NW. The mechanisms of sodium absorption in the human small
intestine. The Journal of clinical investigation 47: 884-900, 1968.
39. Gamba G, Saltzberg SN, Lombardi M, Miyanoshita A, Lytton J, Hediger MA, Brenner BM, and Hebert
SC. Primary structure and functional expression of a cDNA encoding the thiazide-sensitive, electroneutral
sodium-chloride cotransporter. Proceedings of the National Academy of Sciences of the United States of America
90: 2749-2753, 1993.
40. Geven WB, Monnens LA, Willems HL, Buijs WC, and ter Haar BG. Renal magnesium wasting in two
families with autosomal dominant inheritance. Kidney international 31: 1140-1144, 1987.
41. Geven WB, Monnens LA, Willems JL, Buijs W, and Hamel CJ. Isolated autosomal recessive renal
magnesium loss in two sisters. Clinical genetics 32: 398-402, 1987.
42. Gitelman HJ, Graham JB, and Welt LG. A new familial disorder characterized by hypokalemia and
hypomagnesemia. Transactions of the Association of American Physicians 79: 221-235, 1966.
43. Glaudemans B, van der Wijst J, Scola RH, Lorenzoni PJ, Heister A, van der Kemp AW, Knoers NV,
Hoenderop JG, and Bindels RJ. A missense mutation in the Kv1.1 voltage-gated potassium channel-encoding gene KCNA1 is linked to human autosomal dominant hypomagnesemia. The Journal of clinical investigation
119: 936-942, 2009.
44. Godron A, Harambat J, Boccio V, Mensire A, May A, Rigothier C, Couzi L, Barrou B, Godin M, Chauveau
D, Faguer S, Vallet M, Cochat P, Eckart P, Guest G, Guigonis V, Houillier P, Blanchard A, Jeunemaitre X,
and Vargas-Poussou R. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis: phenotype-genotype correlation and outcome in 32 patients with CLDN16 or CLDN19 mutations. Clinical journal of
the American Society of Nephrology : CJASN 7: 801-809, 2012.
45. Gomez-Hernandez JM, Lorra C, Pardo LA, Stuhmer W, Pongs O, Heinemann SH, and Elliott AA.
Molecular basis for different pore properties of potassium channels from the rat brain Kv1 gene family. Pflugers
Archiv : European journal of physiology 434: 661-668, 1997.
46. Gong Y, Renigunta V, Himmerkus N, Zhang J, Renigunta A, Bleich M, and Hou J. Claudin-14 regulates
renal Ca(+)(+) transport in response to CaSR signalling via a novel microRNA pathway. The EMBO journal 31:
1999-2012, 2012.
47. Goytain A, and Quamme GA. Functional characterization of ACDP2 (ancient conserved domain protein), a
divalent metal transporter. Physiological genomics 22: 382-389, 2005.
48. Graham LA, Caesar JJ, and Burgen AS. Gastrointestinal absorption and excretion of Mg 28 in man.
Metabolism: clinical and experimental 9: 646-659, 1960.
49. Greger R, and Velazquez H. The cortical thick ascending limb and early distal convoluted tubule in the
urinary concentrating mechanism. Kidney international 31: 590-596, 1987.
50. Greising SM, Gransee HM, Mantilla CB, and Sieck GC. Systems biology of skeletal muscle: fiber type as an
organizing principle. Wiley interdisciplinary reviews Systems biology and medicine 4: 457-473, 2012.
51. Grew N. A Treatise of the Nature and Use of the Bitter Purging Salt Containd in Epsom, and Such Other Waters.
printed in the year, 1697.
52. Groenestege WM, Hoenderop JG, van den Heuvel L, Knoers N, and Bindels RJ. The epithelial Mg2+
channel transient receptor potential melastatin 6 is regulated by dietary Mg2+ content and estrogens. Journal
of the American Society of Nephrology : JASN 17: 1035-1043, 2006.
53. Groenestege WM, Thebault S, van der Wijst J, van den Berg D, Janssen R, Tejpar S, van den Heuvel LP,
van Cutsem E, Hoenderop JG, Knoers NV, and Bindels RJ. Impaired basolateral sorting of pro-EGF causes
isolated recessive renal hypomagnesemia. The Journal of clinical investigation 117: 2260-2267, 2007.
54. Gullner HG, Gill JR, Jr., and Bartter FC. Correction of hypokalemia by magnesium repletion in familial
hypokalemic alkalosis with tubulopathy. The American journal of medicine 71: 578-582, 1981.
55. Gunzel D, Amasheh S, Pfaffenbach S, Richter JF, Kausalya PJ, Hunziker W, and Fromm M. Claudin-16
affects transcellular Cl- secretion in MDCK cells. The Journal of physiology 587: 3777-3793, 2009.
56. Gunzel D, Stuiver M, Kausalya PJ, Haisch L, Krug SM, Rosenthal R, Meij IC, Hunziker W, Fromm M, and
Muller D. Claudin-10 exists in six alternatively spliced isoforms that exhibit distinct localization and function.
Journal of cell science 122: 1507-1517, 2009.
57. Gunzel D, and Yu AS. Claudins and the modulation of tight junction permeability. Physiological reviews 93:
525-569, 2013.
58. Hardwick LL, Jones MR, Buddington RK, Clemens RA, and Lee DB. Comparison of calcium and
magnesium absorption: in vivo and in vitro studies. The American journal of physiology 259: G720-726, 1990.
59. Health WHOR. Managing complications in pregnancy and childbirth: a guide for midwives and doctors. World
Health Organization, 2003.
60. Himmerkus N, Shan Q, Goerke B, Hou J, Goodenough DA, and Bleich M. Salt and acid-base metabolism
in claudin-16 knockdown mice: impact for the pathophysiology of FHHNC patients. American journal of
physiology Renal physiology 295: F1641-1647, 2008.
61. HIRSCHFELDER AD, and Haury VG. CLINICAL MANIFESTATIONS OF HIGH AND LOW PLASMA MAGNESIUM
DANGERS OF EPSOM SALT PURGATION IN NEPHRITIS. Journal of the American Medical Association 102: 1138-1141,
1934.
62. Holland S, Silberstein SD, Freitag F, Dodick DW, Argoff C, and Ashman E. Evidence-based guideline
update: NSAIDs and other complementary treatments for episodic migraine prevention in adults: report of
the Quality Standards Subcommittee of the American Academy of Neurology and the American Headache
Society. Neurology 78: 1346-1353, 2012.
63. Holroyde MJ, Potter JD, and Solaro RJ. The calcium binding properties of phosphorylated and unphosphorylated cardiac and skeletal myosins. The Journal of biological chemistry 254: 6478-6482, 1979.
64. Hou J, Paul DL, and Goodenough DA. Paracellin-1 and the modulation of ion selectivity of tight junctions.
Journal of cell science 118: 5109-5118, 2005.
65. Hou J, Renigunta A, Gomes AS, Hou M, Paul DL, Waldegger S, and Goodenough DA. Claudin-16 and
claudin-19 interaction is required for their assembly into tight junctions and for renal reabsorption of magnesium.
Proceedings of the National Academy of Sciences of the United States of America 106: 15350-15355, 2009.
66. Hou J, Renigunta A, Konrad M, Gomes AS, Schneeberger EE, Paul DL, Waldegger S, and Goodenough
DA. Claudin-16 and claudin-19 interact and form a cation-selective tight junction complex. The Journal of
clinical investigation 118: 619-628, 2008.
67. Huang CL, and Kuo E. Mechanism of hypokalemia in magnesium deficiency. Journal of the American Society
of Nephrology : JASN 18: 2649-2652, 2007.
68. Hurd TW, Otto EA, Mishima E, Gee HY, Inoue H, Inazu M, Yamada H, Halbritter J, Seki G, Konishi M,
Zhou W, Yamane T, Murakami S, Caridi G, Ghiggeri G, Abe T, and Hildebrandt F. Mutation of the Mg2+
transporter SLC41A1 results in a nephronophthisis-like phenotype. Journal of the American Society of Nephrology:
JASN 24: 967-977, 2013.
69. Ikari A, Kano T, and Suketa Y. Magnesium influx enhanced by nitric oxide in hypertensive rat proximal
tubule cells. Biochemical and biophysical research communications 294: 710-713, 2002.
70. Jeck N, Konrad M, Peters M, Weber S, Bonzel KE, and Seyberth HW. Mutations in the Chloride Channel
Gene, CLCNKB, Leading to a Mixed Bartter-Gitelman Phenotype. Pediatr Res 48: 754-758, 2000.
71. Jen JC, Graves TD, Hess EJ, Hanna MG, Griggs RC, and Baloh RW. Primary episodic ataxias: diagnosis,
pathogenesis and treatment. Brain : a journal of neurology 130: 2484-2493, 2007.
72. Karbach U. Cellular-mediated and diffusive magnesium transport across the descending colon of the rat.
Gastroenterology 96: 1282-1289, 1989.
73. Karbach U, and Rummel W. Cellular and paracellular magnesium transport across the terminal ileum of the
rat and its interaction with the calcium transport. Gastroenterology 98: 985-992, 1990.
74. Katzberg HD, Khan AH, and So YT. Assessment: symptomatic treatment for muscle cramps (an
evidence-based review): report of the therapeutics and technology assessment subcommittee of the
American academy of neurology. Neurology 74: 691-696, 2010.
75. Kimble RB, Srivastava S, Ross FP, Matayoshi A, and Pacifici R. Estrogen deficiency increases the ability of
stromal cells to support murine osteoclastogenesis via an interleukin-1and tumor necrosis factor-mediated
stimulation of macrophage colony-stimulating factor production. The Journal of biological chemistry 271:
28890-28897, 1996.
76. King DE, Mainous AG, 3rd, Geesey ME, and Woolson RF. Dietary magnesium and C-reactive protein levels.
Journal of the American College of Nutrition 24: 166-171, 2005.
77. Knoers NV, and Levtchenko EN. Gitelman syndrome. Orphanet journal of rare diseases 3: 22, 2008.
78. Kokko JP. Proximal tubule potential difference. Dependence on glucose on glucose, HCO 3 , and amino acids.
The Journal of clinical investigation 52: 1362-1367, 1973.
34 | Chapter 1
79. Kolisek M, Nestler A, Vormann J, and Schweigel-Rontgen M. Human gene SLC41A1 encodes for the Na+/
Mg(2)+ exchanger. American journal of physiology Cell physiology 302: C318-326, 2012.
80. Konrad M, Schaller A, Seelow D, Pandey AV, Waldegger S, Lesslauer A, Vitzthum H, Suzuki Y, Luk JM,
Becker C, Schlingmann KP, Schmid M, Rodriguez-Soriano J, Ariceta G, Cano F, Enriquez R, Juppner H,
Bakkaloglu SA, Hediger MA, Gallati S, Neuhauss SC, Nurnberg P, and Weber S. Mutations in the
tight-junction gene claudin 19 (CLDN19) are associated with renal magnesium wasting, renal failure, and
severe ocular involvement. American journal of human genetics 79: 949-957, 2006.
81. Lainez S, Schlingmann KP, van der Wijst J, Dworniczak B, van Zeeland F, Konrad M, Bindels RJ, and
Hoenderop JG. New TRPM6 missense mutations linked to hypomagnesemia with secondary hypocalcemia.
European journal of human genetics : EJHG 2013.
82. Lameris AL, Hess MW, van Kruijsbergen I, Hoenderop JG, and Bindels RJ. Omeprazole enhances the
colonic expression of the Mg(2+) transporter TRPM6. Pflugers Archiv : European journal of physiology 465:
1613-1620, 2013.
83. Lameris AL, Huybers S, Kaukinen K, Makela TH, Bindels RJ, Hoenderop JG, and Nevalainen PI.
Expression profiling of claudins in the human gastrointestinal tract in health and during inflammatory bowel
disease. Scandinavian journal of gastroenterology 48: 58-69, 2013.
84. Le Grimellec C. Micropuncture study along the proximal convoluted tubule. Electrolyte reabsorption in first
convolutions. Pflugers Archiv : European journal of physiology 354: 133-150, 1975.
85. LERoY J. Necessite du magnesium pour la croissance de la souris. CR Soc Biol(Paris) 94: 431, 1926.
86. Li M, Du J, Jiang J, Ratzan W, Su LT, Runnels LW, and Yue L. Molecular determinants of Mg2+ and Ca2+
permeability and pH sensitivity in TRPM6 and TRPM7. The Journal of biological chemistry 282: 25817-25830, 2007.
87. Li M, Jiang J, and Yue L. Functional characterization of homo- and heteromeric channel kinases TRPM6 and
TRPM7. The Journal of general physiology 127: 525-537, 2006.
88. Liu C, Yeh J, and Aloia J. Magnesium directly stimulates osteoblast proliferation. Journal of Bone and Mineral
Research 3: S104, 1988.
89. Loffing J, Vallon V, Loffing-Cueni D, Aregger F, Richter K, Pietri L, Bloch-Faure M, Hoenderop JGJ,
Shull GE, Meneton P, and Kaissling B. Altered Renal Distal Tubule Structure and Renal Na+ and Ca2+
Handling in a Mouse Model for Gitelmans Syndrome. Journal of the American Society of Nephrology 15:
2276-2288, 2004.
90. Lowenstein FW, and Stanton MF. Serum magnesium levels in the United States, 1971-1974. Journal of the
American College of Nutrition 5: 399-414, 1986.
91. Massa F, Garbay S, Bouvier R, Sugitani Y, Noda T, Gubler MC, Heidet L, Pontoglio M, and Fischer E.
Hepatocyte nuclear factor 1beta controls nephron tubular development. Development 140: 886-896, 2013.
92. Mayer ML, Westbrook GL, and Guthrie PB. Voltage-dependent block by Mg2+ of NMDA responses in
spinal cord neurones. Nature 309: 261-263, 1984.
93. Meij IC, Koenderink JB, van Bokhoven H, Assink KF, Groenestege WT, de Pont JJ, Bindels RJ, Monnens
LA, van den Heuvel LP, and Knoers NV. Dominant isolated renal magnesium loss is caused by misrouting of
the Na(+),K(+)-ATPase gamma-subunit. Nature genetics 26: 265-266, 2000.
94. Meij IC, van den Heuvel LP, Hemmes S, van der Vliet WA, Willems JL, Monnens LA, and Knoers NV.
Exclusion of mutations in FXYD2, CLDN16 and SLC12A3 in two families with primary renal Mg2+ loss.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association European Renal Association 18: 512-516, 2003.
95. Milla PJ, Aggett PJ, Wolff OH, and Harries JT. Studies in primary hypomagnesaemia: evidence for defective
carrier-mediated small intestinal transport of magnesium. Gut 20: 1028-1033, 1979.
96. Mishra NK, Peleg Y, Cirri E, Belogus T, Lifshitz Y, Voelker DR, Apell HJ, Garty H, and Karlish SJ. FXYD
proteins stabilize Na,K-ATPase: amplification of specific phosphatidylserine-protein interactions. The Journal of
biological chemistry 286: 9699-9712, 2011.
97. Mordike BL, and Ebert T. Magnesium: Properties applications potential. Materials Science and
Engineering: A 302: 37-45, 2001.
98. Mubagwa K, Gwanyanya A, Zakharov S, and Macianskiene R. Regulation of cation channels in cardiac
and smooth muscle cells by intracellular magnesium. Archives of biochemistry and biophysics 458: 73-89, 2007.
99. Muir KW, Lees KR, Ford I, and Davis S. Magnesium for acute stroke (Intravenous Magnesium Efficacy in
Stroke trial): randomised controlled trial. Lancet 363: 439-445, 2004.
100. Nair AV, Hocher B, Verkaart S, van Zeeland F, Pfab T, Slowinski T, Chen YP, Schlingmann KP, Schaller
A, Gallati S, Bindels RJ, Konrad M, and Hoenderop JG. Loss of insulin-induced activation of TRPM6
magnesium channels results in impaired glucose tolerance during pregnancy. Proceedings of the National
Academy of Sciences of the United States of America 109: 11324-11329, 2012.
101. Nijenhuis T, Renkema KY, Hoenderop JG, and Bindels RJ. Acid-base status determines the renal
expression of Ca2+ and Mg2+ transport proteins. Journal of the American Society of Nephrology : JASN 17:
617-626, 2006.
102. Nijenhuis T, Vallon V, van der Kemp AW, Loffing J, Hoenderop JG, and Bindels RJ. Enhanced passive
Ca2+ reabsorption and reduced Mg2+ channel abundance explains thiazide-induced hypocalciuria and
hypomagnesemia. The Journal of clinical investigation 115: 1651-1658, 2005.
103. Nowak L, Bregestovski P, Ascher P, Herbet A, and Prochiantz A. Magnesium gates glutamate-activated
channels in mouse central neurones. Nature 307: 462-465, 1984.
104. Okayama H, Aikawa T, Okayama M, Sasaki H, Mue S, and Takishima T. Bronchodilating effect of
intravenous magnesium sulfate in bronchial asthma. JAMA : the journal of the American Medical Association 257:
1076-1078, 1987.
105. Olinger E, Schwaller B, Loffing J, Gailly P, and Devuyst O. Parvalbumin: calcium and magnesium buffering
in the distal nephron. Nephrology, dialysis, transplantation : official publication of the European Dialysis and
Transplant Association - European Renal Association 27: 3988-3994, 2012.
106. Parry DA, Mighell AJ, El-Sayed W, Shore RC, Jalili IK, Dollfus H, Bloch-Zupan A, Carlos R, Carr IM,
Downey LM, Blain KM, Mansfield DC, Shahrabi M, Heidari M, Aref P, Abbasi M, Michaelides M, Moore
AT, Kirkham J, and Inglehearn CF. Mutations in CNNM4 cause Jalili syndrome, consisting of autosomal-recessive
cone-rod dystrophy and amelogenesis imperfecta. American journal of human genetics 84: 266-273, 2009.
107. Partridge IG. Studies on digestion and absorption in the intestines of growing pigs. 3. Net movements of
mineral nutrients in the digestive tract. The British journal of nutrition 39: 527-537, 1978.
108. Paunier L, Radde IC, Kooh SW, Conen PE, and Fraser D. Primary hypomagnesemia with secondary
hypocalcemia in an infant. Pediatrics 41: 385-402, 1968.
109. Polok B, Escher P, Ambresin A, Chouery E, Bolay S, Meunier I, Nan F, Hamel C, Munier FL, Thilo B,
Megarbane A, and Schorderet DF. Mutations in CNNM4 cause recessive cone-rod dystrophy with
amelogenesis imperfecta. American journal of human genetics 84: 259-265, 2009.
110. Potter JD, and Gergely J. The calcium and magnesium binding sites on troponin and their role in the
regulation of myofibrillar adenosine triphosphatase. The Journal of biological chemistry 250: 4628-4633, 1975.
111. Powell C, Kolamunnage-Dona R, Lowe J, Boland A, Petrou S, Doull I, Hood K, and Williamson P.
MAGNEsium Trial In Children (MAGNETIC): a randomised, placebo-controlled trial and economic evaluation of
nebulised magnesium sulphate in acute severe asthma in children. Health Technol Assess 17: 1-216, 2013.
112. Quamme GA. Recent developments in intestinal magnesium absorption. Current opinion in gastroenterology
24: 230-235, 2008.
113. Quamme GA, and Smith CM. Magnesium transport in the proximal straight tubule of the rabbit. The
American journal of physiology 246: F544-550, 1984.
114. Quamme GA, Wong NL, Dirks JH, Roinel N, De Rouffignac C, and Morel F. Magnesium handling in the
dog kidney: a micropuncture study. Pflugers Archiv : European journal of physiology 377: 95-99, 1978.
115. Ramadan NM, Halvorson H, Vande-Linde A, Levine SR, Helpern JA, and Welch KM. Low brain
magnesium in migraine. Headache 29: 590-593, 1989.
116. Reichold M, Zdebik AA, Lieberer E, Rapedius M, Schmidt K, Bandulik S, Sterner C, Tegtmeier I, Penton
D, Baukrowitz T, Hulton SA, Witzgall R, Ben-Zeev B, Howie AJ, Kleta R, Bockenhauer D, and Warth R.
KCNJ10 gene mutations causing EAST syndrome (epilepsy, ataxia, sensorineural deafness, and tubulopathy)
disrupt channel function. Proceedings of the National Academy of Sciences of the United States of America 107:
14490-14495, 2010.
117. Romani A. Regulation of magnesium homeostasis and transport in mammalian cells. Archives of biochemistry
and biophysics 458: 90-102, 2007.
36 | Chapter 1
118. Rude RK, Gruber HE, Norton HJ, Wei LY, Frausto A, and Mills BG. Bone loss induced by dietary magnesium
reduction to 10% of the nutrient requirement in rats is associated with increased release of substance P and
tumor necrosis factor-alpha. The Journal of nutrition 134: 79-85, 2004.
119. Rude RK, Oldham SB, Sharp CF, Jr., and Singer FR. Parathyroid hormone secretion in magnesium
deficiency. The Journal of clinical endocrinology and metabolism 47: 800-806, 1978.
120. Salimi MH, Heughebaert JC, and Nancollas GH. Crystal growth of calcium phosphates in the presence of
magnesium ions. Langmuir 1: 119-122, 1985.
121. Schlingmann KP, Weber S, Peters M, Niemann Nejsum L, Vitzthum H, Klingel K, Kratz M, Haddad E,
Ristoff E, Dinour D, Syrrou M, Nielsen S, Sassen M, Waldegger S, Seyberth HW, and Konrad M.
Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the
TRPM gene family. Nature genetics 31: 166-170, 2002.
122. Schneeberger PR, and Heizmann CW. Parvalbumin in rat kidney. Purification and localization. FEBS letters
201: 51-56, 1986.
123. Scholl UI, Choi M, Liu T, Ramaekers VT, Hausler MG, Grimmer J, Tobe SW, Farhi A, Nelson-Williams C,
and Lifton RP. Seizures, sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance
(SeSAME syndrome) caused by mutations in KCNJ10. Proceedings of the National Academy of Sciences of the
United States of America 106: 5842-5847, 2009.
124. Schrag D, Chung KY, Flombaum C, and Saltz L. Cetuximab therapy and symptomatic hypomagnesemia.
Journal of the National Cancer Institute 97: 1221-1224, 2005.
125. Schultheis PJ, Lorenz JN, Meneton P, Nieman ML, Riddle TM, Flagella M, Duffy JJ, Doetschman T,
Miller ML, and Shull GE. Phenotype Resembling Gitelmans Syndrome in Mice Lacking the Apical Na+-Cl
Cotransporter of the Distal Convoluted Tubule. Journal of Biological Chemistry 273: 29150-29155, 1998.
126. Schweigel M, and Martens H. Magnesium transport in the gastrointestinal tract. Frontiers in bioscience : a
journal and virtual library 5: D666-677, 2000.
127. Sha Q, Pearson W, Burcea LC, Wigfall DA, Schlesinger PH, Nichols CG, and Mercer RW. Human FXYD2
G41R mutation responsible for renal hypomagnesemia behaves as an inward-rectifying cation channel.
American journal of physiology Renal physiology 295: F91-99, 2008.
128. Shan Q, Himmerkus N, Hou J, Goodenough DA, and Bleich M. Insights into Driving Forces and Paracellular
Permeability from Claudin-16 Knockdown Mouse. Annals of the New York Academy of Sciences 1165: 148-151, 2009.
129. Shan Q, Himmerkus N, Hou J, Goodenough DA, and Bleich M. Insights into driving forces and paracellular
permeability from claudin-16 knockdown mouse. Annals of the New York Academy of Sciences 1165: 148-151, 2009.
130. Shareghi GR, and Agus ZS. Magnesium transport in the cortical thick ascending limb of Henles loop of the
rabbit. The Journal of clinical investigation 69: 759-769, 1982.
131. Shorvon S, and Ferlisi M. The treatment of super-refractory status epilepticus: a critical review of available
therapies and a clinical treatment protocol. Brain : a journal of neurology 134: 2802-2818, 2011.
132. Simon DB, Bindra RS, Mansfield TA, Nelson-Williams C, Mendonca E, Stone R, Schurman S, Nayir A,
Alpay H, Bakkaloglu A, Rodriguez-Soriano J, Morales JM, Sanjad SA, Taylor CM, Pilz D, Brem A,
Trachtman H, Griswold W, Richard GA, John E, and Lifton RP. Mutations in the chloride channel gene,
CLCNKB, cause Bartters syndrome type III. Nature genetics 17: 171-178, 1997.
133. Simon DB, Karet FE, Hamdan JM, DiPietro A, Sanjad SA, and Lifton RP. Bartters syndrome, hypokalaemic
alkalosis with hypercalciuria, is caused by mutations in the Na-K-2Cl cotransporter NKCC2. Nature genetics 13:
183-188, 1996.
134. Simon DB, Karet FE, Rodriguez-Soriano J, Hamdan JH, DiPietro A, Trachtman H, Sanjad SA, and Lifton
RP. Genetic heterogeneity of Bartters syndrome revealed by mutations in the K+ channel, ROMK. Nature
genetics 14: 152-156, 1996.
135. Simon DB, Lu Y, Choate KA, Velazquez H, Al-Sabban E, Praga M, Casari G, Bettinelli A, Colussi G, Rodriguez-Soriano J, McCredie D, Milford D, Sanjad S, and Lifton RP. Paracellin-1, a renal tight junction
protein required for paracellular Mg2+ resorption. Science 285: 103-106, 1999.
136. Simon DB, Nelson-Williams C, Bia MJ, Ellison D, Karet FE, Molina AM, Vaara I, Iwata F, Cushner HM,
Koolen M, Gainza FJ, Gitleman HJ, and Lifton RP. Gitelmans variant of Bartters syndrome, inherited
hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive Na-Cl cotransporter. Nature genetics
12: 24-30, 1996.
137. Sood AK, Handa R, Malhotra RC, and Gupta BS. Serum, CSF, RBC & urinary levels of magnesium & calcium
in idiopathic generalised tonic clonic seizures. The Indian journal of medical research 98: 152-154, 1993.
138. Stuiver M, Lainez S, Will C, Terryn S, Gunzel D, Debaix H, Sommer K, Kopplin K, Thumfart J, Kampik
NB, Querfeld U, Willnow TE, Nemec V, Wagner CA, Hoenderop JG, Devuyst O, Knoers NV, Bindels RJ,
Meij IC, and Muller D. CNNM2, encoding a basolateral protein required for renal Mg2+ handling, is mutated
in dominant hypomagnesemia. American journal of human genetics 88: 333-343, 2011.
139. Suh WC, Leirmo S, and Record MT, Jr. Roles of Mg2+ in the mechanism of formation and dissociation of
open complexes between Escherichia coli RNA polymerase and the lambda PR promoter: kinetic evidence for
a second open complex requiring Mg2+. Biochemistry 31: 7815-7825, 1992.
140. Temkin NR, Anderson GD, Winn HR, Ellenbogen RG, Britz GW, Schuster J, Lucas T, Newell DW,
Mansfield PN, Machamer JE, Barber J, and Dikmen SS. Magnesium sulfate for neuroprotection after
traumatic brain injury: a randomised controlled trial. Lancet neurology 6: 29-38, 2007.
141. Thebault S, Alexander RT, Tiel Groenestege WM, Hoenderop JG, and Bindels RJ. EGF increases TRPM6
activity and surface expression. Journal of the American Society of Nephrology : JASN 20: 78-85, 2009.
142. Thebault S, Cao G, Venselaar H, Xi Q, Bindels RJ, and Hoenderop JG. Role of the alpha-kinase domain in
transient receptor potential melastatin 6 channel and regulation by intracellular ATP. The Journal of biological
chemistry 283: 19999-20007, 2008.
143. Topf JM, and Murray PT. Hypomagnesemia and hypermagnesemia. Reviews in endocrine & metabolic
disorders 4: 195-206, 2003.
144. Voets T, Nilius B, Hoefs S, van der Kemp AW, Droogmans G, Bindels RJ, and Hoenderop JG. TRPM6
forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. The Journal of biological
chemistry 279: 19-25, 2004.
145. Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck GE, Englehardt
RK, Carmi R, and Sheffield VC. Mutation of TRPM6 causes familial hypomagnesemia with secondary
hypocalcemia. Nature genetics 31: 171-174, 2002.
146. Walder RY, Shalev H, Brennan TM, Carmi R, Elbedour K, Scott DA, Hanauer A, Mark AL, Patil S, Stone EM,
and Sheffield VC. Familial hypomagnesemia maps to chromosome 9q, not to the X chromosome: genetic
linkage mapping and analysis of a balanced translocation breakpoint. Human molecular genetics 6: 1491-1497, 1997.
147. Wang CY, Shi JD, Yang P, Kumar PG, Li QZ, Run QG, Su YC, Scott HS, Kao KJ, and She JX. Molecular cloning and
characterization of a novel gene family of four ancient conserved domain proteins (ACDP). Gene 306: 37-44, 2003.
148. Weglicki WB, Dickens BF, Wagner TL, Chmielinska JJ, and Phillips TM. Immunoregulation by
neuropeptides in magnesium deficiency: ex vivo effect of enhanced substance P production on circulating T
lymphocytes from magnesium-deficient mice. Magnesium research : official organ of the International Society
for the Development of Research on Magnesium 9: 3-11, 1996.
149. Wilcox ER, Burton QL, Naz S, Riazuddin S, Smith TN, Ploplis B, Belyantseva I, Ben-Yosef T, Liburd NA,
Morell RJ, Kachar B, Wu DK, Griffith AJ, Riazuddin S, and Friedman TB. Mutations in the gene encoding
tight junction claudin-14 cause autosomal recessive deafness DFNB29. Cell 104: 165-172, 2001.
150. Wolf MT, Dotsch J, Konrad M, Boswald M, and Rascher W. Follow-up of five patients with FHHNC due to
mutations in the Paracellin-1 gene. Pediatr Nephrol 17: 602-608, 2002.
151. Worthington V. Nutritional quality of organic versus conventional fruits, vegetables, and grains. J Altern
Complement Med 7: 161-173, 2001.
152. Wright FS. Increasing magnitude of electrical potential along the renal distal tubule. The American journal of
physiology 220: 624-638, 1971.
153. Xu JZ, Hall AE, Peterson LN, Bienkowski MJ, Eessalu TE, and Hebert SC. Localization of the ROMK protein
on apical membranes of rat kidney nephron segments. The American journal of physiology 273: F739-748, 1997.
154. Yamamoto M, Yamaguchi T, Yamauchi M, Yano S, and Sugimoto T. Acute-onset hypomagnesemia-induced hypocalcemia caused by the refractoriness of bones and renal tubules to parathyroid hormone.
Journal of bone and mineral metabolism 29: 752-755, 2011.
155. Yamazaki D, Funato Y, Miura J, Sato S, Toyosawa S, Furutani K, Kurachi Y, Omori Y, Furukawa T, Tsuda
T, Kuwabata S, Mizukami S, Kikuchi K, and Miki H. Basolateral Mg<sup>2+</sup> Extrusion via CNNM4
Mediates Transcellular Mg<sup>2+</sup> Transport across Epithelia: A Mouse Model. PLoS genetics 9:
e1003983, 2013.
38 | Chapter 1
156. Yang L, Frindt G, and Palmer LG. Magnesium modulates ROMK channel-mediated potassium secretion.
Journal of the American Society of Nephrology : JASN 21: 2109-2116, 2010.
157. Zhang Z, Yu H, Huang J, Faouzi M, Schmitz C, Penner R, and Fleig A. The TRPM6 Kinase Domain
Determines the Mg.ATP Sensitivity of TRPM7/M6 Heteromeric Ion Channels. The Journal of biological chemistry
289: 5217-5227, 2014.
158. Zipes DP, Camm AJ, Borggrefe M, Buxton AE, Chaitman B, Fromer M, Gregoratos G, Klein G, Moss AJ,
Myerburg RJ, Priori SG, Quinones MA, Roden DM, Silka MJ, Tracy C, Smith SC, Jr., Jacobs AK, Adams
CD, Antman EM, Anderson JL, Hunt SA, Halperin JL, Nishimura R, Ornato JP, Page RL, Riegel B, Blanc
JJ, Budaj A, Dean V, Deckers JW, Despres C, Dickstein K, Lekakis J, McGregor K, Metra M, Morais J,
Osterspey A, Tamargo JL, and Zamorano JL. ACC/AHA/ESC 2006 Guidelines for Management of Patients
With Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death: a report of the American College
of Cardiology/American Heart Association Task Force and the European Society of Cardiology Committee for
Practice Guidelines (writing committee to develop Guidelines for Management of Patients With Ventricular
Arrhythmias and the Prevention of Sudden Cardiac Death): developed in collaboration with the European
Heart Rhythm Association and the Heart Rhythm Society. Circulation 114: e385-484, 2006.
42 | Chapter 2
Abstract
The kidney plays a key role in the maintenance of the magnesium (Mg2+) homeostasis.
Specifically, the distal convoluted tubule (DCT) is instrumental in fine-tuning of the renal
Mg2+ handling. In recent years hereditary Mg2+ transport disorders have helped to identify
important players in DCT Mg2+ homeostasis. Nevertheless, several proteins involved in
DCT-mediated Mg2+ reabsorption remains to be discovered and a full expression profile of
this complex nephron segment may facilitate the discovery of new Mg2+-related genes.
Here, we report the Mg2+-sensitive expression of the DCT transcriptome. To this end,
transgenic mice expressing eGFP under a DCT-specific parvalbumin promoter were
subjected to Mg2+-deficient or Mg2+-enriched diets. Subsequently, the Complex Object
Parametric Analyzer and Sorter (COPAS) allowed for the first time isolation of eGFP-positive
DCT cells. RNA extracts thereof were analyzed by DNA microarrays comparing high vs.
low Mg2+ to identify Mg2+ regulatory genes. Based on statistical significance and a
fold-change of at least two, 46 genes showed differential expression. Several known
magnesiotropic genes, such as Trpm6 and Parvalbumin, were upregulated under low
dietary Mg2+. Moreover, new genes were identified that are potentially involved in renal
Mg2+ handling. To confirm that the selected candidate genes were regulated by dietary
Mg2+ availability, the expression levels of Slc41a3, Pcbd1, Tbc1d4 and Umod were determined
by RT-PCR analysis. Indeed, all four genes show significant upregulation in the DCT of mice
fed the Mg2+-deficient diet.
By elucidating the Mg2+-sensitive DCT transcriptome new candidate genes in renal Mg2+
handling have been identified.
Keywords: Magnesium Homeostasis, Hypomagnesemia, Gene Expression Microarray, COPAS,
Elucidation of the Mg2+ -sensitive DCT Transcriptome | 43
Introduction
Hypomagnesemia is a common clinical manifestation associated with type 2 diabetes,
hypertension, osteoporosis, tetany, seizures, depression and the use of a variety of drugs
(6, 21). Clinical studies addressing the Mg2+ status of critically ill patients showed that a
substantial number of patients is hypomagnesemic. Moreover, low blood Mg2+ levels are
associated with a poor clinical outcome (23, 40). Regulation of blood Mg2+ levels is an
equilibrium between intestinal Mg2+ absorption and renal Mg2+ reabsorption. In kidney,
Mg2+ reabsorption in the proximal tubule (PT) and the thick ascending limb of Henle (TAL)
is a passive paracellular process, whereas in the distal convoluted tubule (DCT) Mg2+
reabsorption is a highly regulated and transcellular mechanism. This latter segment
facilitates the fine-tuning of renal Mg2+ uptake, since no reabsorption takes places beyond
DCT.
Over the last decade, the elucidation of the molecular origin of human genetic
diseases has helped to identify new proteins involved in Mg2+ transport in DCT (6).
In patients with hypomagnesemia and secondary hypocalcemia (HSH), mutations were
identified in the transient receptor potential melastatin 6 (TRPM6), the gatekeeper of Mg2+
entry in the DCT cell (39, 47). The abundance of TRPM6 at the plasma membrane is
regulated by the epidermal growth factor (EGF) and as a result mutations in the pro-EGF
gene are causative for hypomagnesemia (16). Mg2+ transport via TRPM6 is a passive
process that depends on the membrane potential across the luminal membrane (14).
Therefore, several players involved in the maintenance of this membrane potential have
been identified by gene-linkage analyses in patients with hereditary hypomagnesemia.
For instance, a mutation in KCNA1 encoding the voltage-gated K+ channel Kv1.1 impairs
the luminal extrusion of K+ ions necessary to maintain a substantial luminal membrane
potential (14). At the basolateral membrane, the K+ channel Kir4.1 acts an important player
in the K+ recycling which seems necessary to maintain a high Na+-K+-ATPase activity (1).
Indeed, mutations in KCNJ10 coding for Kir4.1 and mutations in the -subunit of the
Na+-K+-ATPase, FYXD2, are linked to hypomagnesemia (1, 4). Moreover, mutations in
transcription factor HNF1, that regulates the transcription of FXYD2, cause a similar
phenotype (27). Recently, mutations in the DCT-expressed CNNM2 gene were linked to
hypomagnesemia (43). It was postulated that CNNM2 may act as an intracellular Mg2+
sensor regulating Mg2+ transport (7). Although gene-linkage studies have gained insight
in Mg2+ reabsorption in DCT over the last years, several factors remain unidentified. For
instance, the Mg2+ extrusion mechanism of DCT cells is still unknown.

The aim of the present study was, therefore, to elucidate the Mg2+-sensitive transcriptome
of the DCT cell. To this end, primary DCT cells were isolated from mice kidneys and a
comprehensive expression profile specific for DCT cells was established using gene
expression microarrays. Furthermore, by comparing DCT expression profiles of mice fed
high and low Mg2+-containing diets, the Mg2+-sensitivity of the DCT transcriptome has
44 | Chapter 2
been determined. Here, we describe the identification of new candidate genes potentially
involved in Mg2+ reabsorption in DCT.
Results
Experimental Design
In our study, transgenic mice, that express enhanced Green Fluorescent Protein (eGFP)
downstream a parvalbumin (Pv) promoter, were subjected to Mg2+ diets. Within the
kidney, PV is exclusively expressed in DCT (3). Combining Pv-eGFP mice with the COPAS
tissue sorting system allowed the specific isolation of DCT cells (26). Here, Pv-eGFP mice
were subdivided into 2 groups consisting of 12 mice each. Each group was subjected to a
high (0.48 % (w/w)) Mg2+ or a low (0.02 % (w/w)) Mg2+-containing diet for 15 days.
Subsequently, DCT tubules were isolated using COPAS and total RNA was extracted
(Figure 1A). 4 out of 12 pairs of RNA extracts were processed for and subjected to pair-wise
(high vs. low) microarray analysis. The 8 remaining RNA extracts per group were used to
validate the results of the microarray experiments by RT-PCR.

As a control for purity, transcriptional expression levels of DCT marker genes, Trpm6
and Ncc were determined by RT-PCR (Figure 1B-1C). Indeed, the expression of the thiazide-
sensitive sodium-chloride cotransporter (Ncc) and Trpm6 are enriched 200-fold and 8-fold,
respectively, compared to total kidney material of the same mice. Moreover, expression of
protein markers for proximal tubules (Aqp1) and the collecting duct (Aqp2) was reduced.
Slight overlap was detected with thick ascending limb and connecting tubules, when
testing for marker genes, Nkcc2 and Trpv5, respectively (Figure 1B). These results indicate
that the COPAS-sorted tubules contain primarily DCT transcripts.
Effects of Mg2+ Diets

Before subjecting mRNA transcripts to microarray hybridization, the effect of the Mg2+
diets on plasma and urinary Mg2+ levels were assessed (Figure 2A-2C). In line with our
previous experiments, the serum Mg2+ concentration dropped significantly in the mice
fed with the Mg2+-deficient diet (Figure 2A)(15). The Mg2+-enriched diet resulted in a
slight, albeit significant, hypermagnesemia (Figure 2A). The urinary Mg2+ excretion
showed the same pattern: high excretion in the Mg2+-enriched diets and low excretion in
the Mg2+-deficient mice (Figure 2B). Serum Ca2+ concentrations did not change
significantly (Figure 2C). In contrast, the urinary Ca2+ concentration was significantly
increased in mice fed a high Mg2+ diet (Figure 2D). Urinary and serum Na+ and K+ values
were not significantly altered by the dietary Mg2+ availability (Figure 2E-H).
Day
Day
Day
13
Blood Sampling
15
Metabolic Cages
Mg2+ diets
Blood Sampling
Pairwise Microarray
Low Mg 2+
C
10
*
8
6
4
2
*
p2
280
260
240
220
200
180
160
140
2
1
0
Kidney DCT
Aq
Tr
p
v5
6
m
Tr
p
p1
Nk
cc
2
Aq
mRNA expression
(Relative to total kidney, fold change)
NCC mRNA expression

RT-PCR
High Mg 2+
Figure 1 Isolation of Distal Convoluted Tubule Cells

A, Timeline of animal experiment. Mice were placed on Mg2+ diets for 15 days (gray bar). Blood samplings
are indicated by black arrows, metabolic cages are represented by the black bar. B-C, mRNA expression
levels of Aqp1, Nkcc2, Trpm6, Trpv5, Aqp2 (B) and Ncc (C) in COPAS-selected mouse DCT (black bar)
and control (none-selected, white bar) kidney tubules were measured by quantitative RT-PCR and
normalized for Gapdh expression. Data represent means (n=8) SEM and are expressed as fold
difference when compared with the expression in none-selected tubules. *P < 0.05 indicates significant
difference from none-selected tubules.
DCT Transcriptome Analysis

The DCT transcriptome was first analyzed for abundance of individual mRNAs. This was
achieved by analyzing the average log2 intensity of the two channel microarray data (the
so-called A value, A=log2(RG)) after normalization between the two channels. Although the
A value is influenced by the amplification of the transcripts and the position of microarray
feature sequences, it gives a qualitative view of the gene expression levels in the DCT
46 | Chapter 2
Day 15
Day 0
Serum
[Na ] (mM)
S erum
S odium
(mM)
150
100
50
2+
High Mg 2+ diet
gh
Lo
w
2+
Low Mg 2+ diet
150
100
50
Low Mg 2+ diet
2g+
Urinary K+ excretion
200
2g+
Hi
Serum [K+]
(mM)
High Mg 2+ diet
250
Hi
Lo
w
10
S erum P ota s s ium (mM)
High Mg 2+ diet
gh
2g+
Low Mg 2+ diet
Low Mg 2+ diet
Day 15
200
2
0
High Mg 2+ diet
gh
Hi
8
6
2g+
0.5
10
1.0
14
12
600
400
200
Low Mg 2+ diet
High Mg 2+ diet
2+
1.5
2.0
High Mg 2+ diet
Urinary Ca2+ excretion

(mol/24hr urine)
Serum [Ca2+]
(mM)
2.5
Low Mg 2+ diet
18
16
2+
3.0
20
10
Lo
w
Day 0
30
40
gh
0.5
50
Hi
1.0
60
Urinary Mg2+ excretion
(mol/24hr urine)
1.5
70
Urinary
Na+E xcretion
excretion( mol)
24hrs
S odium
(mol/24hr urine)
Serum [Mg2+]
(mM)
2.0
Lo
w
2.5
24hrs P (mol/24hr
ota s s ium E xcretion
)
urine) ( mol
Figure 2 Effect of Dietary Mg2+ Availability on Serum and Urinary Mg2+ and
Ca2+ Concentrations.
A-H, Serum Mg2+ (A) and Ca2+ (C) concentrations at day 0 (black bars) and day 15 (white bars) of mice
fed with a low or high Mg2+-containing diet for 15 days. 24hrs urinary Mg2+ (B) and Ca2+ (D) excretion
at day 15 of mice fed with a low or high Mg2+-containing diet for 15 days. Serum Na+ (E) and K+ (G)
concentrations at day 15 of mice fed with a low or high Mg2+-containing diet for 15 days. 24hr urinary
Na+ (F) and K+ (H) excretion at day 15 of mice fed with a low or high Mg2+-containing diet for 15 days.
Values are presented as means SEM (n=12). *P < 0.05 is considered statistically significant compared
to day 0. #P < 0.05 is considered statistically significant to the low Mg2+ group.
tubules. Of the most abundant transcripts more then a third are directly linked to
mitochondrial function (Table 1). DCT cells are the cells with the highest mitochondrial
density in the mammalian kidney (9). Moreover, DCT marker genes have moderate to high
A values. Ncc gave an average expression signal of 11.9 and Trpm6 had a value of 11.7.
Several genes implicated in DCT-mediated Mg2+ transport were highly expressed. Egf and
Fxyd2 were with expression values of 16.7 and 16.5 among the 50 most expressed DCT
genes. Interestingly, marker proteins of the TAL showed low expression levels. For instance,
Slc12a1 had a value of 8.6 and Claudin16 had an expression level of 6.9. Taken together
these results confirm the purity of the COPAS-selected DCT cells.
Mg2+-sensitive Gene Expression

To identify DCT genes involved in Mg2+ homeostasis, the Mg2+-sensitive differential
expression of the transcriptome was determined by pair-wise comparison of high versus
low Mg2+ samples. As a first approach, we examined the expression of the genes that are
associated with hypomagnesemia in genetic disease (6). Interestingly, only Trpm6 and Egf
were shown significantly upregulated in the low Mg2+ diet compared to mice fed with
high Mg2+ diets (Table 2). To assess the reproducibility of our microarray data, the
microarray results were validated by RT-PCR on a separate set of DCT mRNA transcripts
(Figure 3A-3H). Indeed, this analysis confirmed that dietary Mg2+ regulates Trpm6
expression. The Trpm6 expression in the low Mg2+-fed diet mice was 2.3 fold enriched in
comparison to mice fed with high Mg2+ diets (Figure 3A). Additionally, only Egf and Cnnm2
were differentially regulated (Figure 3B and 3F). RT-PCR analyses showed enrichment in
the low Mg2+ diet-fed mice of 1.5 and 2.1 fold, respectively, relatively to high Mg2+ diet-fed
mice. The enrichment of Cnnm2 was not significant in the microarray data (P=0.68), but
was highly significant in the RT-PCR analysis (P<0.002). Kcna1 transcripts, encoding Kv1.1,
were not detectable in the pure DCT material (Figure 3C), confirming the low signal in the
microarray (A value: 5.7). No major differences between microarray and RT-PCR data were
observed, indicating high reproducibility between the RT-PCR and microarray analyses.

Next, we analyzed the microarray Mg2+ sensitivity of all potential mammalian Mg2+
transporters that have been described in literature (34). In comparison with mice fed an
Mg2+-enriched diet, only Trpm6 and Slc41a3 mRNA transcripts show a significant
enrichment in mice fed a Mg2+-deficient diet (Table 3). Slc41a3 has been previously linked
to Mg2+ transport, although the exact function of this gene was never examined (34).
Cnnm1, Cnnm3, Cnnm4, Slc41a1, Slc41a2 and all other transporters of the Nipa, MagT, MMgT,
Mrs and Zdhhc families are not Mg2+ sensitive and present a relatively low A value,
suggesting low DCT abundance.
48 | Chapter 2
Table 1 M
ost Abundantly Expressed Genes in the Distal Convoluted Tubule
Gene
Name
Gene
Description
Average
Signal
(A value)
Fjx1
four jointed box 1
17.2
Olfr215
olfactory receptor 215
17.1
Klk1b5
kallikrein 1-related peptidase b5
17.1
Neurog3
neurogenin 3
17.1
mt-Co2
mitochondrially encoded cytochrome c oxidase II
17.1
Fth1
ferritin heavy chain 1
17.1
Ccdc78
coiled-coil domain containing 78
17.1
Ccl4
chemokine (C-C motif ) ligand 4
17.1
Klk1b26
kallikrein 1-related petidase b26
17.1
Aspscr1
alveolar soft part sarcoma chromosome region, candidate 1 (human)
17.1
Slc45a3
solute carrier family 45, member 3
17.0
Atp5a1
ATP synthase, H+ transporting, alpha subunit 1
17.0
Olfr214
17.0
Lrsam1
leucine rich repeat and sterile alpha motif containing 1
17.0
mt-Nd4
mitochondrially encoded NADH dehydrogenase 4
17.0
mt-Nd2
16.9
Atp5g3
ATP synthase, H+ transporting, subunit C3 (subunit 9)
16.9
Dnajc19
DnaJ (Hsp40) homolog, subfamily C, member 19
16.9
Ddx51
DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
16.9
Porcn
porcupine homolog
16.9
Fgf17
fibroblast growth factor 17
16.9
Gabarapl1
gamma-aminobutyric acid A receptor-associated protein-like 1
16.9
Atp5b
ATP synthase, H+ transporting beta subunit
16.9
mt-Atp8
mitochondrially encoded ATP synthase 8
16.9
Mdh1
malate dehydrogenase 1, NAD (soluble)
16.9
mt-Nd3
16.8
Nudt4
nudix (nucleoside diphosphate linked moiety X)-type motif 4
16.8
Olfr15
16.8
mt-Cytb
mitochondrially encoded cytochrome b
16.8
Ulk1
Unc-51 like kinase 1
16.8
mt-Co3
mitochondrially encoded cytochrome c oxidase III
16.8
Avpr2
arginine vasopressin receptor 2
16.8
Entpd4
ectonucleoside triphosphate diphosphohydrolase 4
16.8
Plekho2
pleckstrin homology domain containing, family O member 2
16.8
Table 1 C
ontinued
Gene
Name
Gene
Description
Average
Signal
(A value)
Vsig10l
ZV-set and immunoglobulin domain containing 10 like
16.7
Chchd2
coiled-coil-helix-coiled-coil-helix domain containing 2
16.7
Egf
epidermal growth factor
16.7
Atp1a1
ATPase, Na+/K+ transporting, alpha 1 polypeptide
16.7
Eef1a1
eukaryotic translation elongation factor 1 alpha 1
16.7
mt-Atp6
mitochondrially encoded ATP synthase 6
16.7
Uqcrh
ubiquinol-cytochrome c reductase hinge protein
16.7
Oxct1
3-oxoacid CoA transferase 1
16.6
Uqcrfs1
ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
16.6
Slc25a3
solute carrier family 25 member 3
16.5
SNORA17
Small nucleolar RNA SNORA17
16.5
Cox6c
cytochrome c oxidase, subunit VIc
16.5
Ldhb
lactate dehydrogenase B
16.5
Mtx1
metaxin 1
16.5
Fxyd2
FXYD domain-containing ion transport regulator 2
16.5
Id3
inhibitor of DNA binding 3
16.4
Hspa12b
heat shock protein 12B
16.4
Wfdc15b
WAP four-disulfide core domain 15B
16.4
Umod
uromodulin
16.3
Atp5l
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g
16.3
Mal
myelin and lymphocyte protein, T-cell differentiation protein
16.3
Cox8a
cytochrome c oxidase, subunit VIIIa
16.2
Igfbp7
insulin-like growth factor binding protein 7
16.2
Ndufa4
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4
16.2
Stat5b
signal transducer and activator of transcription 5B
16.2
Kcnj1
potassium inwardly-rectifying channel, subfamily J, member 1
16.2
Krt16
keratin 16
16.1
Cox6a1
cytochrome c oxidase, subunit VI a, polypeptide 1
16.1
Dlx3
distal-less homeobox 3
16.1
Rpl7
ribosomal protein L7
16.1
Rpl10
ribosomal protein 10
16.1
Slc48a1
solute carrier family 48 (heme transporter), member 1
16.0
Cox7c
cytochrome c oxidase, subunit VIIc
16.0
Cox7a2
cytochrome c oxidase, subunit VIIa 2
16.0
50 | Chapter 2
Table 1 C
ontinued
Gene
Name
Gene
Description
Average
Signal
(A value)
Efhd1
EF hand domain containing 1
16.0
Atp5h
ATP synthase, H+ transporting, subunit d
16.0
Rpl23
ribosomal protein L23
16.0
Ndufa1
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1
16.0
Fryl
furry homolog-like
16.0
This table summarizes the genes that are most abundantly expressed (A value >16) in the distal
convoluted tubule (DCT) of mice, as determined by microarray expression analysis on mRNA specifically
isolated from DCT material. The total signal is expressed as the 2log of the sum of the red and green
signal divided by 2, A=log2 (RG).
Table 2 M
g2+-sensitivity in the Distal Convoluted Tubule of Genes Associated with
Hypomagnesemia.
Name
Average Signal
(A value)
Fold Change in the

Low Mg2+ group
P value
Trpm6
11.8
2.05
0.03
Egf
16.7
1.74
0.05
Kcna1
5.7
0.97
Kcnj10
14.9
1.08
Fxyd2
16.5
0.88
Hnf1b
8.7
0.84
Cnnm2
10.4
1.69
0.68
Slc12a3
11.9
1.11
Shown is a summary of Mg2+-sensitive expression of all distal convoluted tubule (DCT) genes
previously linked with human genetic forms of hypomagnesemia by microarray expression analysis
on mRNA specifically isolated from DCT material. The average signal is expressed as the log2 of the
sum of the red and green signal. The fold change is the differential expression between high- and
low-Mg2+ diet-fed mice and is expressed as enrichment in the low-Mg2+ diet compared with the
high-Mg2+ diet. Numbers above 1 indicate enrichment in mice fed a low-Mg2+ diet. Numbers below
1 designate enrichment in mice fed with high-Mg2+ diet. The P value shows the statistical significance
of the differential expression.
Trpm6, transient receptor potential cation channel, subfamily M, member 6; Egf, Epidermal growth
factor; Kcna1, K+ voltage-gated channel, shaker-related subfamily, member 1; Kcnj10, K+ inwardly
rectifying channel, subfamily J, member 10; Fxyd2, FXYD domain containing ion transport regulator
2; Hnf1b, hepatocyte nuclear factor-1; Cnnm2, cyclin M2; Slc12a3, solute carrier family 12, member 3.
1.0
0.5
Kcna1 mRNA expression

(fold change)
Fxyd2 mRNA expression
(fold change)
Low Mg 2+
1.5
1.0
0.5
ND
Low Mg 2+
ND
High Mg 2+
2.0
1.5
1.0
0.5
0
Low Mg 2+
High Mg 2+
2.0
1.5
1.0
0.5
0
Low Mg 2+
High Mg 2+
2.0
1.5
1.0
0.5
0
High Mg 2+
2.0
2.5
Cnnm2 mRNA expression
(fold change)
Egf mRNA expression

(fold change)
1.5
3.0
2.5
2.0
Kcnj10 mRNA expression

(fold change)
2.5
Hnf1b mRNA expression

(fold change)
Trpm6 mRNA expression

(fold change)
3.0
Low Mg 2+
High Mg 2+
Low Mg 2+
High Mg 2+
Low Mg 2+
High Mg 2+
Low Mg 2+
High Mg 2+
2.0
1.5
1.0
0.5
0
2.0
1.5
1.0
0.5
0
2.5
Slc12a3 mRNA expression
(fold change)
2.0
1.5
1.0
0.5
0
Figure 3 Effects of Dietary Mg2+ Availability on mRNA Transcript Expression of

Hypomagnesemia-linked Genes
AH, the mRNA expression levels of Trpm6 (A), Egf (B), Kcna1 (C), Kcnj10 (D), Fxyd2 (E), Hnf1b (F), Cnnm2
(G) and Ncc (H) in COPAS-selected DCT tubules of mice fed with a low or high Mg2+-containing
diet for 15 days were measured by quantitative RT-PCR and normalized for Gapdh expression. Data
represent means (n=8) SEM and are expressed fold difference when compared to the expression
in the high Mg2+ group. ND = Not detectable. *P < 0.05 indicates significant difference from the
high Mg2+ group.
52 | Chapter 2
Table 3 Distal Convoluted Tubule Mg2+-sensitivity of Mg2+ Channels and Transporters

Name
Average Signal
(A value)
Fold Change in the Low

Mg2+ group
P-value
Trpm6
11.8
2.05
0.03
Trpm7
14.3
1.37
0.49
Cnnm1
8.4
0.86
Cnnm2
13.5
1.69
0.68
Cnnm3
11.5
1.21
Cnnm4
7.1
0.95
Slc41a1
6.8
1.03
Slc41a2
5.6
0.99
Slc41a3
7.8
0.49
0.02
Nipa1
8.6
0.98
Nipa2
9.9
1.15
Nipal1
5.9
1.01
Nipal2
5.8
0.94
Nipal3
11.8
1.09
Nipal4
5.1
1.00
Mrs2
8.3
0.75
MagT1
7.8
0.98
MMgT1
7.8
1.06
MMgT2
8.3
1.29
Tusc3
8.7
0.98
Zdhhc17
7.9
1.20
Zdhhc13
8.5
1.05
Shown is Mg2+ sensitive expression of all putative mammalian Mg2+ transporters by microarray
expression analysis on mRNA specifically isolated from DCT material. The average signal is expressed
as the log2 of the sum of the red and green signal. The fold change gives the differential expression
between high and low Mg2+-fed mice and is expressed as enrichment in the low diet compared to
the high Mg2+ diet. Numbers above 1 indicate enrichment in mice fed with a low Mg2+-diet.
Numbers smaller than 1 designate enrichment in mice fed with a high Mg2+-diet. The P value shows
the statistical significance of the differential expression.
Nipa, NaCl-inducible protein; MMgT, membrane Mg2+ transporter; Tusc3, tumor suppressor candidate
3; Zdhhc, putative ZDHHC-type palmitoyltransferase 6-like.
New Candidate Genes

The main objective of this study was to identify new players in renal Mg2+ handling.
Therefore, we subsequently selected differentially expressed genes with statistical
significance (P < 0.05) and a minimal fold-change in expression of two. As a result of this
stringent analysis, 46 gene candidates were identified (Table 4). Among the genes that
were enriched in Mg2+-deficient mice, the previously mentioned Trpm6 and Slc41a3 were
detected. Additionally, 33 genes were identified that were enriched in the low Mg2+ group
(compared to the high Mg2+ group). The gene with the highest fold change was Sox9
encoding a transcription factor involved in renal development. Other high ranking genes
are the DCT marker Pv, glycoprotein Umod and complement factor Cd55. Furthermore, we
identified direct and indirect regulators of the Na+-K+-ATPase, Tbc1d4 and Pcbd1. Notable
is the presence of several genes that are mainly known for their role in Ca2+ homeostasis,
such as calbindin28K and the vitamin D receptor. Only 11 genes were significantly enriched
with a minimal fold change of 2 in the high Mg2+ group, compared to low Mg2+-fed mice.
None of these genes were earlier linked to Mg2+ homeostasis. The most profound
differential expression was measured with the Ptger3 gene, a prostaglandin receptor.

To confirm the results of the microarray analysis, mRNA transcript levels of all major
candidate genes were determined using RT-PCR (Figure 4A-D). Indeed, Slc41a3 mRNA
expression was 1.8 fold enriched in the Mg2+-deficient mice, similar to the values observed
Table 4 Mg2+-regulated Genes in the Distal Convoluted Tubule

Name
Average Signal
(A value)

Mg2+ group
P value
Sox9
9.6
4.83
0.01
Cd55
7.1
4.16
0.00
Dnaja4
11.8
3.28
0.00
Gulo
8.4
3.27
0.02
Pck1
9.0
3.27
0.03
Prkd1
9.7
3.17
0.0004
Calb1
13.5
3.01
0.02
Umod
16.3
2.91
0.01
Pvalb
13.4
2.71
0.01
Ptgs1
10.0
2.52
0.0008
Tppp
6.4
2.52
0.01
Unc5b
10.6
2.37
0.00
Rd3
9.5
2.36
0.01
Acss1
15.7
2.30
0.03
Wdr72
11.8
2.27
0.02
Pdlim1
7.8
2.20
0.03
Pcbd1
14.8
2.20
0.01
Tbc1d4
11.6
2.18
0.01
Gsn
12.8
2.17
0.02
54 | Chapter 2
Table 4 Continued
Name
Average Signal
(A value)

Mg2+ group
P value
Ilvbl
8.2
2.12
0.01
Spag5
6.5
2.12
0.03
Etv5
10.3
2.11
0.01
Vdr
10.7
2.10
0.01
Hmgcll1
8.1
2.09
0.0012
Iyd
7.4
2.08
0.03
Zscan4c
9.4
2.08
0.02
Plekha1
12.0
2.08
0.0018
Trpm6
11.8
2.05
0.03
Tspan33
10.8
2.04
0.01
Abcg1
8.1
2.04
0.02
Dusp6
10.6
2.03
0.02
Gpm6b
8.7
2.02
0.01
Slc41a3
7.8
2.02
0.02
Cwh43
13.3
2.01
0.03
Tdrd3
12.9
2.00
0.0008
Pdpn
9.0
0.49
0.002
Gpc3
7.0
0.49
0.02
Lrtm2
8.3
0.48
0.05
Nqo1
8.3
0.46
0.03
Tmed6
8.7
0.45
0.0004
Grin3a
6.8
0.44
0.01
Ell3
8.3
0.42
0.00
Kap
9.2
0.40
0.01
Mreg
9.6
0.38
0.00
Ndrg4
9.1
0.37
0.01
Ptger3
9.5
0.23
0.01
Shown is a summary of all genes that are significantly (P < 0.05) differentially expressed with a
minimal fold change of 2 in the distal convoluted tubule (DCT) of mice fed with a high or low Mg2+
diet for 15 days, as determined by microarray expression analysis on mRNA specifically isolated from
DCT material. The average signal is expressed as the log2 of the sum of the red and green signal.
The fold change gives the differential expression between high and low Mg2+-fed mice and is
expressed as enrichment in the low diet compared to the high Mg2+ diet. Numbers above 1 indicate
enrichment in mice fed with a low Mg2+-diet. Numbers smaller than 1 designate enrichment in mice
fed with a high Mg2+-diet. The P-value shows the statistical significance of the differential expression.
The full lists of 35,000 genes can be accessed at GEO database Ac: GSE40208.
on the microarray (Figure 4A). Likewise, mRNA expression levels were determined for
Pcbd1, Tbc1d4 and Umod, since all three genes are potentially involved in Mg2+ handling
(Figure 4B-D). Pcbd1 is a regulator of HNF1 function, Tbc1d4 has been shown to modulate
Na+-K+-ATPase activity and uromodulin effects transcellular Na+ transport (2, 28, 31). The
fold enrichment values for these three genes estimated by RT-PCR correspond to the
values obtained by the microarray analysis. Since Umod is mainly described as TAL gene,
we further examined uromodulin DCT expression with immunohistological staining and
RT-PCR. Interestingly, Umod was 3.5 times more expressed in DCT cells compared to total
kidney material (Figure 5A). Uromodulin co-localized with NCC in early DCT cells (Figure 5C).
Moreover, only the DCT fraction of Umod expression, but not the total kidney sample
mainly containing TAL Umod expression, was shown to be Mg2+-sensitive (Figure 5B).

To determine whether the differentially regulated genes belong to the same functional
pathways or cellular processes, GO-term enrichment analysis was performed by gene set
enrichment analysis (GSEA, Table 5). In the DCT samples from Mg2+-deficient mice EGF
2.0
1.5
1.0
0.5
0
Low Mg 2+
High Mg 2+
2.0
1.5
1.0
0.5
0
Low Mg 2+
High Mg 2+
2.0
1.5
1.0
0.5
0
Low Mg 2+
High Mg 2+
3.0
Uromodulin mRNA expression
(fold change)
Tbc1d4 mRNA expression

(fold change)
3.0
2.5
2.5
Pcbd1 mRNA expression
(fold change)

(fold change)
2.5
2.5
2.0
1.5
1.0
0.5
0
Low Mg 2+
High Mg 2+
Figure 4 Effects of Dietary Mg2+ Availability on mRNA Transcript Expression of

Newly Identified Candidate Genes
AD, the mRNA expression levels of Slc41a3 (A), Pcbd1 (B), Tbc1d4 (C) and Umod (D) in COPAS-selected DCT tubules of mice fed with a low or high Mg2+-containing diet were measured by quantitative
RT-PCR and normalized for Gapdh expression. Data represent means (n=8) SEM and are expressed
fold difference when compared to the expression in the high Mg2+ group. *P < 0.05 indicates significant
difference from the high Mg2+ group.
56 | Chapter 2
UMOD mRNA expression

(Relative to high Mg2+ diet, fold change)
B
UMOD mRNA expression
A
5
4
3
2
1
0
Kidney
DCT
NCC
2.5
2.0
1.5
1.0
0.5
0.0
Kidney
DCT
DCT
UMOD
TAL
Merge
Figure 5 Expression of Uromodulin in Distal Convoluted Tubules

A, the mRNA expression levels of Umod, in COPAS-selected mouse DCT and control (none-selected)
kidney tubules were measured by quantitative RT-PCR and normalized for Gapdh expression. Data
represent means (n=8) SEM and are expressed as fold difference when compared with the expression in none-selected tubules. *P < 0.05 indicates significant difference from none-selected tubules.
B, the mRNA expression levels of Umod in COPAS-selected DCT tubules and control (none-selected)
kidney tubules of mice fed with a low or high Mg2+-containing diet were measured by quantitative
RT-PCR and normalized for Gapdh expression. Data represent means (n=8) SEM and are expressed
fold difference when compared to the expression in the high Mg2+ group. *P < 0.05 indicates significant difference from the high Mg2+ group. C. Double immunofluorescence staining of mouse
kidney sections for NCC (in green) and UMOD (in red). Bars represent 20 m.
TAL: Thick ascending limb of Henles loop. DCT: Distal Convoluted Tubule.
Table 5 GO-term Enrichment Analysis of Mg2+-sensitive Expression in the

GO-Term
Description
P value
Mean
Difference
GO:0060009
Sertoli cell development
0.0004
-0.26
GO:0061036
positive regulation of cartilage development
0.0002
-0.26
GO:0030238
male sex determination
0.0018
-0.25
GO:0060170
cilium membrane
2.4E-05
-0.25
GO:0002237
response to molecule of bacterial origin
0.0043
-0.23
GO:0001158
enhancer sequence-specific DNA binding
0.0015
-0.22
GO:0030502
negative regulation of bone mineralization
0.0056
-0.21
GO:0016585
chromatin remodeling complex
0.0001
-0.20
GO:0043536
positive regulation of blood vessel endothelial

cell migration
0.0065
-0.20
GO:0030903
notochord development
0.0053
-0.20
GO:0007173
epidermal growth factor receptor signaling pathway
0.0011
-0.18
GO:0032331
negative regulation of chondrocyte differentiation
4.2E-07
-0.17
GO:0006107
oxaloacetate metabolic process
0.0059
-0.17
GO:0030279
negative regulation of ossification
0.0001
-0.16
GO:0010634
positive regulation of epithelial cell migration
9.5E-06
-0.15
GO:0045732
positive regulation of protein catabolic process
0.0090
-0.14
GO:0071347
cellular response to interleukin-1
0.0010
-0.13
GO:0016614
oxidoreductase activity, acting on CH-OH group

of donors
0.0054
-0.13
GO:0035924
cellular response to vascular endothelial growth factor

stimulus
0.0075
-0.11
GO:0005840
ribosome
2.3E-20
0.10
GO:0003735
structural constituent of ribosome
9.4E-20
0.10
GO:0006694
steroid biosynthetic process
0.0001
0.11
GO:0022627
cytosolic small ribosomal subunit
0.0007
0.12
GO:0022900
electron transport chain
7.7E-14
0.14
GO:0005903
brush border
0.0010
0.14
GO:0006637
acyl-CoA metabolic process
0.0032
0.16
GO:0005762
mitochondrial large ribosomal subunit
1.1E-05
0.18
GO:0005747
mitochondrial respiratory chain complex I
2.4E-12
0.20
GO:0070469
respiratory chain
3.7E-19
0.21
GO:0008137
NADH dehydrogenase (ubiquinone) activity
5.3E-10
0.23
GO:0015238
drug transmembrane transporter activity
0.0003
0.23
GO:0015893
drug transport
0.0035
0.24
58 | Chapter 2
Table 5 Continued
GO-Term
Description
P-value
Mean
Difference
GO:0003954
NADH dehydrogenase activity
0.0004
0.24
GO:0035634
response to stilbenoid
0.0002
0.26
GO:0016651
oxidoreductase activity, acting on NADH or NADPH
6.7E-06
0.28
Shown is a summary of the significantly differentially expressed GO-terms in the Distal Convoluted
Tubule of mice fed with a high or low Mg2+ diets with a minimal difference of 0.1. GO-term
enrichment was determined by gene set enrichment analysis (GSEA) analysis of the microarray
expression data from mRNA specifically isolated from DCT material.
signaling was upregulated, as evidenced by the differentially regulated GO-term EGF

pathway. EGF activates a signaling pathway leading to increased TRPM6 plasma membrane
expression, hence more Mg2+ reabsorption (44). Interestingly, bone mineralization was
also among the enriched GO-terms in the mice fed with low Mg2+-diets. Mg2+ plays an
important role in this latter process (38). The most evidently enriched functional pathways
were observed in the high Mg2+ fed mice. Among the upregulated functions many
GO-terms indicating mitochondrial activity were evidenced.
Discussion
In this study, the Mg2+-sensitive transcriptome of the DCT was elucidated. By taking
advantage of the COPAS sorting system, we are the first to isolate primary DCT material with
high purity for gene expression analysis. As a result of our approach new promising candidate
players in renal Mg2+ homeostasis were identified. Among the candidates: i) SLC41A3 has
been proposed as a potential Na+/Mg2+ exchanging mechanism; ii) PCBD1 might influence
HNF1 activity; iii) TBC1D4 is a possible regulator of ion channel membrane availability;
iv) Uromodulin could regulate Mg2+ transport by decreasing the urinary flow rate.

We isolated DCT cells from mice kidneys combining the COPAS sorting system with
Pv-eGFP mice. Until now, it was difficult to obtain high quality expression profiles of the
isolated DCT fraction because of the quantitative limits of the microdissection technique.
Therefore, previously reported expression analyses resulted in a gene expression profile of
the combined DCT and CNT fraction (33). The COPAS system provides the only high
efficiency and high quality alternative for microdissection. The purity of the COPAS-sorted
DCT cells was significantly higher then previous reports, as was demonstrated by the
impressive fold-enrichments of 200 and 8 for Ncc and Trpm6 (26). The high abundance of
mitochondrial genes in our microarray data set further showed sample purity. In kidney,
DCT cells contain the highest amount of mitochondria (9). Inevitably, COPAS-sorted DCT
cells can contain adjacent TAL and CNT cells. Although the TAL marker Slc12a1, encoding
NKCC2, was not significantly enriched compared to total kidney samples, transcripts
isolated from COPAS-sorted cells may contain genes expressed in TAL. More importantly,
Trpv5 expression was upregulated in COPAS-sorted DCT cells, which can be explained by
the gradual transition of DCT1, via DCT2 to CNT region, causing a partial overlap of Pv and
Trpv5 expression. Since the aim of our study was to identify Mg2+-sensitive gene
transcription, the potential limit of sample purity will not affect the results of the microarray
analysis. Altogether, this approach allowed the identification of magnesiotropic DCT genes.
Slc41a3 is probably the most interesting candidate among the newly identified
Mg2+-sensitive DCT genes. SLC41A3 is part of a family of three putative Mg2+ transporters
that were first described by Quamme et al. (34) Using the Xenopus laevis oocyte
voltage-clamp model it was shown that all three SLC41 proteins transport Mg2+ within its
physiological range, although these findings have never been repeated in mammalian
cell models (19, 34). SLC41A3 has never been investigated in detail, but lessons from the
other SLC41 family members have learned that it consists of 11 transmembrane domains
(24). Recent reports claim that SLC41A1 could act as a Na+/Mg2+ exchanger (20). Likewise,
the highly homologous SLC41A3 protein could have a similar function. Since SLC41A1 and
SLC41A2 are not differentially regulated in DCT, it seems possible that SLC41A3 is the
DCT-specific Mg2+ extrusion mechanism. Further research characterizing the function of
SLC41A3 is needed to confirm this hypothesis.

Interestingly, the expression of Hnf1b and Fxyd2 were not differentially regulated in
this study. Nevertheless, we identified in Pcbd1 a potential modulator of HNF1/FXYD2
activity. First described in 1991, PCBD1 is a protein with a dual activity (28). PCBD1 can
stimulate the HNF1 and HNF1 transcription and has a role in tetrahydrobiopterin
regeneration (42). HNF1 transcriptional activation by PCBD1 does not depend on its
enzymatic activity (17). Its role in HNF1 activation seems of special interest with respect
to the Mg2+ homeostasis. HNF1 is a transcription factor that stimulates FXYD2 expression,
encoding the -subunit of the Na+-K+-ATPase (11). PCBD1, also known as Dimerization
Cofactor of HNF1 (DCOH), stabilizes HNF1 dimer formation necessary for Fxyd2 transcription.
Although PCBD1 activation has never been linked to FXYD2 directly, PCBD1 could
indirectly stimulate Fxyd2 transcription by enhancing HNF1 function. Given that Pcbd1 is
transcriptionally upregulated in Mg2+-deficient conditions and that such regulation is
absent for Fxyd2 and Hnf1b, PCBD1 might be the trigger in FXYD2-mediated fine-tuning of
Mg2+ reabsorption in DCT.

During analyses of the microarray data, another modulator of Na+-K+-ATPase activity
caught attention. Tbc1d4, previously known as AS160, was significantly upregulated in the
low Mg2+-fed mice. TBC1D4 has been described as Rab-GTPase activating kinase involved in
the regulation of Na+-K+-ATPase plasma membrane availability (2). In this ability, it might
directly influence the transmembrane potential that is necessary for Mg2+ reabsorption.
60 | Chapter 2
Interestingly, the function of TBC1D4 is not limited to regulation of the Na+-K+-ATPase.

Originally described as regulator of GLUT4 glucose transporters, TBC1D4 has recently been
linked to the regulation of channels including AQP2 and ENaC (18, 22, 30). Thus, it might be
relevant to consider TBC1D4 as a modulator of TRPM6 plasma membrane trafficking. This
notion is further supported by the fact that a PI3K/Akt/RAC1-mediated pathway activated
upon EGF stimulation regulates TRPM6 plasma membrane abundance and that TBC1D4 is an
Akt-substrate that can also be stimulated by EGF (12, 44). GO-term enrichment analysis of our
microarray results taught that the EGF pathway was upregulated in the low Mg2+ diet-fed mice.
Although previously implicated in renal ion homeostasis, our finding that Umod
expression is highly Mg2+-sensitive is unprecedented (31). Uromodulin, also described as
Tamm-Horshfall glycoprotein, is the most abundant protein in urine, but its exact function
remains to be determined (8). It has been proposed that after excretion in the pro-urine
uromodulin forms an anionic gel-like structure that retards the flow of positively charged
ions (46). Then, increasing Umod expression would decrease the urinary flow rate and
thereby enhance the uptake of cations, such as Mg2+. Although often used as a marker for
the TAL, Umod expression has been described to be not exclusively restricted to TAL, but
also to be profound in the early DCT (33, 41). Studies using gene expression microarrays of
microdissected DCT tubules are inconclusive. Whereas Pradervand and colleagues
showed clear enrichment of Umod mRNA expression, other studies detected barely Umod
mRNA transcripts in DCT (5, 33). Immunohistological stainings confirmed co-localization
of uromodulin with the DCT-marker NCC, although it cannot be excluded that TAL-cleaved
uromodulin reached DCT by urinary flow and sticked to the luminal membranes.
Interestingly, RT-PCR analysis showed that only DCT expression of Umod was shown to be
Mg2+ sensitive, in contrary to Umod expression in total kidney samples. This suggests
different functional roles of UMOD in DCT and TAL segments of the kidney.

Of all genes that have been linked to hypomagnesemia in human genetic diseases,
only a few are transcriptionally regulated (6). Trpm6, Egf and Cnnm2 were modulated,
indicating that Mg2+ transport is partially regulated on the transcriptional level. Major
regulatory pathways are executed on protein level. The EGF signaling pathway is one of
the best-described regulatory mechanisms of TRPM6-mediated Mg2+ transport in DCT
(16, 44). Although its mean effectors, such as PI3K, Akt and RAC1, are not transcriptionally
affected by alterations in dietary Mg2+ availability, EGF is among the enriched GO-terms.
Futhermore, Kcna1 coding for K+ channel Kv1.1 could not be detected in the mouse DCT
material by RT-PCR. Kcna1 is part of a larger family of voltage-gated K+ channels that are
known to form heteromeric complexes. Although Kv1.1 has been implicated in Mg2+
handling in patients, its function might be compensated for by other K+-channels in the
Pv-eGFP mouse model (14). In this context, it is interesting to note that ROMK is 1.7-fold
upregulated in the low Mg2+ mice. Although this result does not reach statistical
significance (P=0.06), it suggests that ROMK might play a role in the maintenance of the
luminal membrane potential necessary for Mg2+ reabsorption in DCT.

Inevitably, although changing only the dietary Mg2+ availability, our approach also
led to the detection of many Ca2+ homeostasis-related genes, such as vitamin D receptor,
klotho and calbindin-D28K (35). Activation of the calcium-sensing receptor (CaSR) is
hypothesized to explain this phenomenon (10). The CaSR is not only sensitive to Ca2+ ions,
but is also activated upon Mg2+ binding. As a result, changes in Mg2+ availability activate
the Ca2+-regulatory pathways at the local and whole-body level. Hypomagnesemia is,
therefore, often associated with a disturbed Ca2+ balance in patients (39, 47). In a similar
fashion the dietary Mg2+ availability influenced the Ca2+ homeostasis in our mice, as
evidenced by the altered serum and urinary Ca2+ levels in the present and previous studies
(15). Therefore, differential gene expression induced by dietary Mg2+ should be analyzed
with care. Although serum Ca2+ and Mg2+ measurements showed that the alterations in
Mg2+ balance are more profound, it has to be taken into account that differential gene
expression might be the effect of Ca2+ alterations. Interlink between Ca2+ and Mg2+
homeostasis was further evidenced in the GO-term analysis of the microarray data.
Although analyzing renal samples, bone mineralization was among the enriched
GO-terms. This might be explained by the fact that many genes involved in renal mineral
homeostasis play similar roles in bone formation (6, 38, 44). In addition, GO-term analysis
identified upregulation of mitochondrial genes in mice fed the Mg2+-rich diet. This could
be a response to an increased intracellular Mg2+ concentration in these mice. Intracellular
Mg2+ is an important ATP-binding factor. Therefore, high Mg2+ concentrations in the cell
could result in a low unbound ATP availability. Mitochondrial activation will lead to
increased ATP production and thereby compensate for the Mg2+ binding.

In conclusion, gene expression microarray analysis on primary DCT cells allowed the
identification of ample Mg2+-sensitive genes of the mouse genome. Particularly, Slc41a3,
Pcbd1, Tbc1d4 and Umod are candidates that require further investigation. We suggest that
patients suffering from hereditary hypomagnesemia of unknown cause are screened for
mutations in these candidate genes. The COPAS sorting system provides an excellent
mechanism to obtain primary DCT cells. Establishing COPAS-sorted DCT monolayers have
been proven to be an accurate method to study thiazide-sensitive Na+ transport (26, 36).
By the use of stable Mg2+ isotopes such as 25Mg2+ and 26Mg2+, this primary DCT culture
could provide a unique model to examine DCT-specific Mg2+ transport. Furthermore,
crossbreeding of Pv-eGFP mice with the available knock out mouse models including
TRPM6 and NCC knock out mice, further expands the possibilities of the established
procedure. It will in particular further substantiate the physiological importance of the
studied target molecule (6, 48).
Acknowledgements
The authors thank AnneMiete van der Kemp, Judy Lin, Maikel School, Anke Lameris, Ellen
van Loon and Fariza Bouallala for their technical support. Furthermore, Dr. Hannah Monyer,
University of Heidelberg kindly donated the PV-eGFP mice. The authors are grateful to Drs
62 | Chapter 2
Nicolas Markadieu and Titia Woudenberg-Vrenken for optimizing the COPAS sorting
system for PV-eGFP tubule sorting and to Dr. Sjoerd Verkaart for critical reading of the
manuscript. This work was supported by grants from the Netherlands Organization for
Scientific Research (ZonMw 9120.8026, NWO ALW 818.02.001), a Vici Grant for J. Hoenderop
(NWO-ZonMw 016.130.668) and EURenOmicsfunding from the European Union seventh
Framework Programme (FP7/2007-2013, agreement n 305608).
Methods
Animal Studies
All the experimental procedures are in compliance with the animal ethics board of the
Radboud University Nijmegen. Transgenic C57Bl/6 mice expressing eGFP under the
parvalbumin (Pv) promotor were kindly provided by Dr. Hannah Monyer (University of
Heidelberg, Germany)(29). Genotype was determined under UV light by checking
fluorescent emission of muscular PV expression in the mouse legs. Littermates were
housed in a temperature- and light-controlled room with the standard pellet chow
(SSNIFF spezialditen GmbH, Soest, Germany) and deionized drinking water available ad
libitum until the start of the experiment. Pv-eGFP positive mice were selected for
experiments at the age of 4-6 weeks. During the experiments the mice were fed low (0.02
% (w/w)) or high (0.48 % (w/w)) Mg2+-containing diets for 15 days (SSNIFF spezialditen
GmbH, Soest, Germany). During the last 48 hrs of the experiment the mice were housed
in metabolic cages for urine and faeces collection (24 hrs adaptation, 24 hrs sampling).
Blood samples were taken at the start of the experiment and just before sacrifice.
Isolation of DCT using COPAS Sorting

Pv-eGFP positive tubules were isolated as described previously (26). In short, mice aged
from 4 to 6 weeks were anesthetized and perfused transcardially with ice-cold KREBS
buffer (in mmol/L: 145 NaCl, 5 KCl, 1 NaH2PO4, 2.5 CaCl2, 1.8 MgSO4, 10 glucose, 10 HEPES/
NaOH pH: 7.4). Directly after perfusion of the mice, the whole kidneys were harvested and
GFP-positive kidney material was manually selected under a microscope. This part of the
procedure may take up 30-45 min. Subsequently, the kidney fragments were digested in
KREBS buffer containing 1 mg/mL collagenase (Worthington, Lakewood, NJ, USA) and
2,000 units/mL hyaluronidase (Sigma, Houten, the Netherlands) for 15 min at 37 C.
Subsequently, the kidney tubules sized between 100 m and 40 m were collected by
filtration. Oversized material was digested again in two additional cycles of 10 min
digestion and filtration. Tubules collected from the three digestions were ice-cooled and
sorted by the Complex Object Parametric Analyzer and Sorter (COPAS, Union Biometrica,
Holliston, MA, USA) at a rate of 2,000-4,000 tubules / hr. Sorted tubules were directly
collected in 1 % (v/v) -mercaptoethanol containing RLT buffer that was supplied by the
RNeasy RNA extraction kit (Qiagen, Venlo, the Netherlands). In total the sorting procedure
of tubules from one mouse takes several hours. Per mouse, 4,000 eGFP-fluorescent tubules
were collected and as control an additional 4,000 tubules were sorted from the same
kidney sample without selection for eGFP positive cells. This control sample contained
both eGFP-positive and eGFP-negative cells of the same size as the selected sample.
4,000 tubules were pooled on a Qiagen Rneasy micro column for RNA extraction according
to the manufacturers protocol.
Microarray Analysis
For microarray experiments RNA from two male and two female mice per group was
taken. RNA from the low Mg2+ and the high Mg2+ group was matched in pairs based on
gender of the mice. Double round RNA amplifications and labeling were performed as
described before (37) on an automated system (Caliper Life Sciences NV/SA, Belgium) with
10-50 ng total RNA from each sample. Briefly, total RNA was amplified twice from ~50,000
cells by cDNA synthesis with oligo(dT) double-anchored primers, followed by in vitro
transcription using a T7 RNA polymerase kit (Ambion, Bleiswijk, the Netherlands). During
second round of transcription, 5-(3-aminoallyl)-UTP was incorporated into the single
stranded cRNA. Cy3 and Cy5 NHS-esters (Amersham Biosciences, Roosendaal, the
Netherlands) were coupled to 2 g cRNA. RNA quality was monitored after each successive
step using the equipment described above. Mouse Whole Genome Gene Expression
Microarrays V2 (Agilent Technologies, Belgium) representing 39,429 mus musculus 60-mer
probes in a 4x44K layout were used for hybridizations with 1 g of each alternatively
labeled cRNA on a HS4800PRO system supplemented with QuadChambers (Tecan
Benelux B.V.B.A.) according to van de Peppel et al. (45). Two independent dye-swap
hybridizations (4 arrays) were performed for each experimental group. After hybridization
the slides were washed extensively and scanned using the Agilent G2565AA DNA
Microarray Scanner.

After automated data extraction using Imagene 8.0 Software (BioDiscovery), Lowess
normalization was performed on mean spot-intensities, followed by dye bias correction
based on a within-set estimate as described before (25, 50). Data was analysed using
MAANOVA (49). In a fixed effect analysis, sample, array and dye effects were modeled.
P-values were determined by a permutation F2-test, in which residuals were shuffled
5,000 times globally. Genes with P < 0.05 after family wise error correction (FWER) were
considered significantly changed. Additionally a 2-fold change cutoff was applied. The
complete microarray dataset is deposited in Gene expression omnibus (GEO) database
(http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE40208. The 8,000 mos t
expressed DCT genes are also available via http://helixweb.nih.gov/ESBL/Database/Non_
ESBL_datasets/Nijmegen-Webpage/index1.html.
64 | Chapter 2
Mg2+ and Ca2+ Analysis

Serum and urine total Mg2+ and Ca2+ concentrations were determined using a colorimetric
assay kit according to the manufacturers protocol (Roche Diagnostics, Woerden, the
Netherlands). Urine volume was measured to calculate 24 hrs Mg2+ excretion.
Quantitative Real Time PCR

The obtained mRNA from 4,000 tubules was reverse transribed using M-MLV reverse
transcriptase (Invitrogen, Bleiswijk, the Netherlands) for 1 hr at 37 C. The cDNA was
subsequently used to measure Pv, Ncc, Trpm6, Kcna1, Kcnj10, Egf, Fxyd2, Hnf1b, Cnnm2,
Slc41a3, Pcbd1, Tbc1d4 and Umod mRNA levels. Gene expression levels were determined by
quantitative real-time PCR on a Bio-Rad analyzer and normalized for Gapdh expression.
Primer sequences are provided in Table 6.
Table 6 P
rimer Sequenced Used for RT-PCR Analysis.
Gene
Forward Primer
Reverse Primer
Parvalbumin
5-CGCTGAGGACATCAAGAAGG-3
5-AGCTTTCAGCCACCAGAGTG-3
Ncc
5-CTTCGGCCACTGGCATTCTG-3
5-GATGGCAAGGTAGGAGATGG-3
Trpm6
5-AAAGCCATGCGAGTTATCAGC-3
5-CTTCACAATGAAAACCTGCCC-3
Egf
5-GAGTTGCCCTGACTCTACCG-3
5-CCACCATTGAGGCAGTATCC-3
Kcna1
5-CTGTGACAATTGGAGGCAAGATC-3
5-GAGCAACTGAGCCTGCTCTTC-3
Kcnj10
5-CCGCGATTTATCAGAGC-3
5-AGATCCTTGAGGTAGAGGAA-3
Fxyd2
5-TCAGCCTTTCTTGTGACTGG-3
5-GGTCTTCCTGTGGCCTCTACT-3
Hnf1b
5-CATTGCACAGAGCCTCAACACC-3
5-GTTGAGAGAACTGGACGGGCTG-3
Cnnm2
5-GGAGGATACGAACGACGTG-3
5-TTGATGTTCTGCCCGTACAC-3
Slc41a3
5-TGAAGGGAAACCTGGAAATG-3
5-GGTTGCTGCTGATGATTTTG-3
Pcbd1
5-TGGACATGGCCGGCAAGGC-3
5-CCCACAGCCCTCAGGTTTG-3
Tbc1d4
5-CTCGAGCCAAGCTGGTAATC-3
5-ACCCGTTCAAAGATGTCAGC-3
Umod
5-TGCAGGGTAGATGAAGATTGC-3
5-GGCACTTTCTGAGGGACATC-3
Gapdh
5-TAACATCAAATGGGGTGAGG-3
5-GGTTCACACCCATCACAAAC-3
Immunohistochemistry
Immunohistochemistry was performed as described previously (13). In short, co-staining
for Uromodulin with thiazide-sensitive Na+-Cl- cotransporter (NCC) was performed on 5
m sections of fixed frozen mouse kidney samples. The sections were incubated for 16 hrs
at 4 C with the following primary antibodies: guinea pig anti-UMOD (1:750, BioTrend, Kln,
Germany) and rabbit anti-NCC (1:100 (32)). For detection, kidney sections were incubated
with Alexa Fluor-conjugated secondary antibodies. Images were taken with an AxioCam
camera and AxioVision software (Zeiss, Sliedrecht, the Netherlands).
Statistical Analysis
For RT-PCR experiments statistical significance was determined using an unpaired Students
t test. In all experiments, data is expressed as mean SEM. Differences with P < 0.05 were
regarded as statistically significant.
66 | Chapter 2
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE,
associate with hypomagnesemia and renal magnesium wasting. Journal of the American Society of Nephrology:
JASN 20: 1123-1131, 2009.
Alves DS, Farr GA, Seo-Mayer P, and Caplan MJ. AS160 associates with the Na+,K+-ATPase and mediates
the adenosine monophosphate-stimulated protein kinase-dependent regulation of sodium pump surface
expression. Molecular biology of the cell 21: 4400-4408, 2010.
Belge H, Gailly P, Schwaller B, Loffing J, Debaix H, Riveira-Munoz E, Beauwens R, Devogelaer JP,
Hoenderop JG, Bindels RJ, and Devuyst O. Renal expression of parvalbumin is critical for NaCl handling
and response to diuretics. Proceedings of the National Academy of Sciences of the United States of America 104:
14849-14854, 2007.
Bockenhauer D, Feather S, Stanescu HC, Bandulik S, Zdebik AA, Reichold M, Tobin J, Lieberer E,
Sterner C, Landoure G, Arora R, Sirimanna T, Thompson D, Cross JH, vant Hoff W, Al Masri O, Tullus K,
Yeung S, Anikster Y, Klootwijk E, Hubank M, Dillon MJ, Heitzmann D, Arcos-Burgos M, Knepper MA,
Dobbie A, Gahl WA, Warth R, Sheridan E, and Kleta R. Epilepsy, ataxia, sensorineural deafness, tubulopathy,
and KCNJ10 mutations. The New England journal of medicine 360: 1960-1970, 2009.
Cheval L, Pierrat F, Dossat C, Genete M, Imbert-Teboul M, Duong Van Huyen JP, Poulain J, Wincker P,
Weissenbach J, Piquemal D, and Doucet A. Atlas of gene expression in the mouse kidney: new features of
glomerular parietal cells. Physiological genomics 43: 161-173, 2011.
de Baaij JH, Hoenderop JG, and Bindels RJ. Regulation of magnesium balance: lessons learned from
human genetic disease. Clin Kidney J 5: i14-i24, 2012.
de Baaij JH, Stuiver M, Meij IC, Lainez S, Kopplin K, Venselaar H, Muller D, Bindels RJ, and Hoenderop
JG. Membrane topology and intracellular processing of cyclin M2 (CNNM2). The Journal of biological chemistry
287: 13644-13655, 2012.
Devuyst O, Dahan K, and Pirson Y. Tamm-Horsfall protein or uromodulin: new ideas about an old molecule.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association European Renal Association 20: 1290-1294, 2005.
Dorup J. Ultrastructure of distal nephron cells in rat renal cortex. Journal of ultrastructure research 92: 101-118, 1985.
Ferre S, Hoenderop JG, and Bindels RJ. Sensing mechanisms involved in Ca2+ and Mg2+ homeostasis.
Kidney international 82: 1157-1166, 2012.
Ferre S, Veenstra GJ, Bouwmeester R, Hoenderop JG, and Bindels RJ. HNF-1B specifically regulates the
transcription of the gammaa-subunit of the Na+/K+-ATPase. Biochemical and biophysical research communications
404: 284-290, 2011.
Geraghty KM, Chen S, Harthill JE, Ibrahim AF, Toth R, Morrice NA, Vandermoere F, Moorhead GB,
Hardie DG, and MacKintosh C. Regulation of multisite phosphorylation and 14-3-3 binding of AS160 in
response to IGF-1, EGF, PMA and AICAR. The Biochemical journal 407: 231-241, 2007.
Gkika D, Mahieu F, Nilius B, Hoenderop JG, and Bindels RJ. 80K-H as a new Ca2+ sensor regulating the
activity of the epithelial Ca2+ channel transient receptor potential cation channel V5 (TRPV5). The Journal of
biological chemistry 279: 26351-26357, 2004.
Glaudemans B, van der Wijst J, Scola RH, Lorenzoni PJ, Heister A, van der Kemp AW, Knoers NV,
Hoenderop JG, and Bindels RJ. A missense mutation in the Kv1.1 voltage-gated potassium channel-encoding gene KCNA1 is linked to human autosomal dominant hypomagnesemia. The Journal of clinical investigation
119: 936-942, 2009.
Groenestege WM, Hoenderop JG, van den Heuvel L, Knoers N, and Bindels RJ. The epithelial Mg2+
Groenestege WM, Thebault S, van der Wijst J, van den Berg D, Janssen R, Tejpar S, van den Heuvel LP,
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Johnen G, and Kaufman S. Studies on the enzymatic and transcriptional activity of the dimerization cofactor
for hepatocyte nuclear factor 1. Proceedings of the National Academy of Sciences of the United States of America
94: 13469-13474, 1997.
Kim HY, Choi HJ, Lim JS, Park EJ, Jung HJ, Lee YJ, Kim SY, and Kwon TH. Emerging role of Akt substrate
protein AS160 in the regulation of AQP2 translocation. American journal of physiology Renal physiology 301:
F151-161, 2011.
Kolisek M, Launay P, Beck A, Sponder G, Serafini N, Brenkus M, Froschauer EM, Martens H, Fleig A,
and Schweigel M. SLC41A1 is a novel mammalian Mg2+ carrier. The Journal of biological chemistry 283:
16235-16247, 2008.
Kolisek M, Nestler A, Vormann J, and Schweigel-Rontgen M. Human gene SLC41A1 encodes for the Na+/
Mg(2)+ exchanger. American journal of physiology Cell physiology 302: C318-326, 2012.
Lameris AL, Monnens LA, Bindels RJ, and Hoenderop JG. Drug-induced alterations in Mg2+ homoeostasis.
Clin Sci (Lond) 123: 1-14, 2012.
Liang X, Butterworth MB, Peters KW, and Frizzell RA. AS160 modulates aldosterone-stimulated epithelial
sodium channel forward trafficking. Molecular biology of the cell 21: 2024-2033, 2010.
Limaye CS, Londhey VA, Nadkart MY, and Borges NE. Hypomagnesemia in critically ill medical patients.
The Journal of the Association of Physicians of India 59: 19-22, 2011.
Mandt T, Song Y, Scharenberg AM, and Sahni J. SLC41A1 Mg(2+) transport is regulated via Mg(2+)-
dependent endosomal recycling through its N-terminal cytoplasmic domain. The Biochemical journal 439:
129-139, 2011.
Margaritis T, Lijnzaad P, van Leenen D, Bouwmeester D, Kemmeren P, van Hooff SR, and Holstege FC.
Adaptable gene-specific dye bias correction for two-channel DNA microarrays. Molecular systems biology 5:
266, 2009.
Markadieu N, San-Cristobal P, Nair AV, Verkaart S, Lenssen E, Tudpor K, van Zeeland F, Loffing J,
Bindels RJ, and Hoenderop JG. A primary culture of distal convoluted tubules expressing functional thiazide-sensitive NaCl transport. American journal of physiology Renal physiology 303: F886-892, 2012.
Meij IC, Koenderink JB, van Bokhoven H, Assink KF, Groenestege WT, de Pont JJ, Bindels RJ, Monnens
the Na(+),K(+)-ATPase gamma-subunit. Nature genetics 26: 265-266, 2000.
Mendel DB, Khavari PA, Conley PB, Graves MK, Hansen LP, Admon A, and Crabtree GR. Characterization of
a cofactor that regulates dimerization of a mammalian homeodomain protein. Science 254: 1762-1767, 1991.
Meyer AH, Katona I, Blatow M, Rozov A, and Monyer H. In vivo labeling of parvalbumin-positive
interneurons and analysis of electrical coupling in identified neurons. The Journal of neuroscience : the official
journal of the Society for Neuroscience 22: 7055-7064, 2002.
Miinea CP, Sano H, Kane S, Sano E, Fukuda M, Peranen J, Lane WS, and Lienhard GE. AS160, the Akt
substrate regulating GLUT4 translocation, has a functional Rab GTPase-activating protein domain. The
Biochemical journal 391: 87-93, 2005.
Mutig K, Kahl T, Saritas T, Godes M, Persson P, Bates J, Raffi H, Rampoldi L, Uchida S, Hille C, Dosche C,
Kumar S, Castaneda-Bueno M, Gamba G, and Bachmann S. Activation of the bumetanide-sensitive
Na+,K+,2Cl- cotransporter (NKCC2) is facilitated by Tamm-Horsfall protein in a chloride-sensitive manner. The
Journal of biological chemistry 286: 30200-30210, 2011.
Nijenhuis T, Hoenderop JG, Loffing J, van der Kemp AW, van Os CH, and Bindels RJ. Thiazide-induced
hypocalciuria is accompanied by a decreased expression of Ca2+ transport proteins in kidney. Kidney
international 64: 555-564, 2003.
Pradervand S, Zuber Mercier A, Centeno G, Bonny O, and Firsov D. A comprehensive analysis of gene
expression profiles in distal parts of the mouse renal tubule. Pflugers Archiv : European journal of physiology 460:
925-952, 2010.
Quamme GA. Molecular identification of ancient and modern mammalian magnesium transporters.
American journal of physiology Cell physiology 298: C407-429, 2010.
Renkema KY, Nijenhuis T, van der Eerden BC, van der Kemp AW, Weinans H, van Leeuwen JP, Bindels
RJ, and Hoenderop JG. Hypervitaminosis D mediates compensatory Ca2+ hyperabsorption in TRPV5
knockout mice. Journal of the American Society of Nephrology : JASN 16: 3188-3195, 2005.
68 | Chapter 2
36. Riveira-Munoz E, Chang Q, Godefroid N, Hoenderop JG, Bindels RJ, Dahan K, and Devuyst O. Transcriptional and functional analyses of SLC12A3 mutations: new clues for the pathogenesis of Gitelman
syndrome. Journal of the American Society of Nephrology : JASN 18: 1271-1283, 2007.
37. Roepman P, de Koning E, van Leenen D, de Weger RA, Kummer JA, Slootweg PJ, and Holstege FC.
Dissection of a metastatic gene expression signature into distinct components. Genome biology 7: R117, 2006.
38. Rude RK, and Gruber HE. Magnesium deficiency and osteoporosis: animal and human observations. The
Journal of nutritional biochemistry 15: 710-716, 2004.
40. Sedlacek M, Schoolwerth AC, and Remillard BD. Electrolyte disturbances in the intensive care unit.
Seminars in dialysis 19: 496-501, 2006.
41. Sikri KL, Foster CL, MacHugh N, and Marshall RD. Localization of Tamm-Horsfall glycoprotein in the
human kidney using immuno-fluorescence and immuno-electron microscopical techniques. Journal of
anatomy 132: 597-605, 1981.
42. Sourdive DJ, Transy C, Garbay S, and Yaniv M. The bifunctional DCOH protein binds to HNF1 independently
of its 4-alpha-carbinolamine dehydratase activity. Nucleic acids research 25: 1476-1484, 1997.
in dominant hypomagnesemia. American journal of human genetics 88: 333-343, 2011.
45. van de Peppel J, Kemmeren P, van Bakel H, Radonjic M, van Leenen D, and Holstege FC. Monitoring
global messenger RNA changes in externally controlled microarray experiments. EMBO reports 4: 387-393,
2003.
46. Vyletal P, Bleyer AJ, and Kmoch S. Uromodulin biology and pathophysiology--an update. Kidney & blood
pressure research 33: 456-475, 2010.
48. Woudenberg-Vrenken TE, Sukinta A, van der Kemp AW, Bindels RJ, and Hoenderop JG. Transient
receptor potential melastatin 6 knockout mice are lethal whereas heterozygous deletion results in mild
hypomagnesemia. Nephron Physiology 117: p11-19, 2011.
49. Wu H, Kerr MK, Cui X, and Churchill GA. MAANOVA: a software package for the analysis of spotted cDNA
microarray experiments. In: The analysis of gene expression data: methods and softwareSpringer, 2012, p. 313-342.
50. Yang YH, Dudoit S, Luu P, Lin DM, Peng V, Ngai J, and Speed TP. Normalization for cDNA microarray data:
a robust composite method addressing single and multiple slide systematic variation. Nucleic acids research
30: e15, 2002.
72 | Chapter 3
Abstract
Mutations in PCBD1 are causative for transient neonatal hyperphenylalaninemia and primapterinuria (HPABH4D). Until now HPABH4D has been regarded as a transient and
benign neonatal syndrome without complications in adulthood.

In our study, two adult patients out of three individuals with homozygous mutations
in the PCBD1 gene were diagnosed with hypomagnesemia and renal Mg2+ loss. Two
patients also developed diabetes with characteristics of maturity onset diabetes of the
young (MODY) regardless of the serum Mg2+ levels. Our results suggest that these clinical
findings are related to the function of PCBD1 as dimerization cofactor for the transcription
factor HNF1B. Mutations in the HNF1B gene have previously been shown to cause renal
malformations, hypomagnesemia and MODY. Gene expression studies in combination
with immunohistochemical analysis in the kidney showed that PCBD1 is expressed in the
distal convoluted tubule (DCT) where Pcbd1 transcript levels are upregulated by a low
Mg2+-containing diet. Overexpression in a human kidney cell line demonstrated that
wild-type PCBD1 binds HNF1B to co-stimulate the FXYD2-promoter, whose activity is
instrumental in Mg2+ reabsorption in DCT. Five out of seven PCBD1 mutations previously
reported in HPABH4D patients caused proteolytic instability leading to a reduced FXYD2-
promoter activity. Furthermore, HNF1B mutations may disturb the nuclear localisation of
PCBD1, since PCBD1 showed an increased cytosolic localization when co-expressed with
HNF1B mutants.
Overall, our findings establish PCBD1 as an important co-activator of the HNF1B-
mediated transcription necessary for fine-tuning of FXYD2 transcription in DCT. Thus,
patients with HPABH4D should be monitored for previously unrecognised late complications,
such as hypomagnesemia and MODY diabetes.
Keywords: HNF1B, PCBD1/DCOH, HPABH4D, MODY, Diabetes, Tetrahydrobiopterin
PCBD1 and Hypomagnesemia | 73
Introduction
Hypomagnesemia is a common clinical manifestation in patients with mutations in the
transcription factor hepatocyte nuclear factor 1 homeobox B (HNF1B, OMIM #189907)(1).
Mutations in HNF1B are associated with an autosomal dominant syndrome characterized
by renal malformations with or without cysts, liver and genital tract abnormalities, gout,
and maturity-onset diabetes of the young type 5 (MODY5; renal cysts and diabetes
syndrome, OMIM #137920)(1, 13). Hypomagnesemia (plasma Mg2+ levels <0.7 mmol/L)
with hypermagnesuria affects up to 50 % of the HNF1B patients (1, 15).
In adult kidney HNF1B is expressed in epithelial cells along all segments of the
nephron. The role of HNF1B in renal Mg2+ handling was, however, pinpointed to the distal
convoluted tubule (DCT), where the final urinary Mg2+ excretion is determined (1, 18). In
DCT, the Na+/K+-ATPase provides the necessary driving force for active Mg2+ reabsorption
from the pro-urine into the blood (18). Heterozygous mutations in the FXYD2 gene,
encoding the -subunit of the Na+/K+-ATPase, result in an autosomal dominant renal
hypomagnesemia with hypocalciuria (IDH, OMIM #154020)(29). More recently, functional
HNF1B binding sites were identified in the promoter region of FXYD2 suggesting that
impaired transcription of FXYD2 by HNF1B results in renal Mg2+ wasting (1, 16). Additional
HNF1B target genes in kidney include renal cystic genes (19-21) as well as genes involved
in tubular electrolyte transport (23, 24).

HNF1B forms heterotetrameric complexes with the protein pterin-4 alpha-carbinolamine
dehydratase / dimerization cofactor of hepatocyte nuclear factor 1 alpha (PCBD1 / DCOH,
OMIM #126090)(30). PCBD1 is a protein of 12 kDa with two distinct biological functions:
transcriptional co-activator of HNF1A-mediated transcription within the nucleus, and pterin-
4-carbinolamine dehydratase (EC 4.2.1.96) in the cell cytosol (10, 30). The enzymatic activity of
PCBD1, together with dihydropteridine reductase, regenerates tetrahydrobiopterin (BH4), which
is the cofactor for phenylalanine hydroxylase (PAH) and other aromatic amino acid hydrolases
(42). The crystal structure of PCBD1 revealed that the protein forms a tetramer of identical
subunits comprising two saddle-like shaped dimers (14, 17). HNF1 binding sites are located
at the same surface that mediates interaction of the PCBD1 homodimers, on the opposite
side of the catalytic domain (34). PCBD1 knockout mice display hyperphenylalaninemia,
predisposition to cataracts and mild glucose-intolerance (4). Homozygous or compound
heterozygous PCBD1 mutations in humans are associated with transient neonatal hyperphenyalaninemia and high urinary levels of primapterin (HPABH4D, or primapterinuria,
OMIM #264070)(11, 38, 39). To date there have been no reports of late complications, or
possible phenotypic consequences of impaired stimulation of the HNF1 transcription factors.

In our study, the occurrence of hypomagnesemia and MODY diabetes was investigated
in three patients carrying PCBD1 mutations. We evaluated whether PCBD1 plays a role in
renal Mg2+ reabsorption by directly affecting HNF1B-regulated FXYD2 transcription, in
order to gain new insight into the molecular basis of the PCBD1-HNF1B interaction.
74 | Chapter 3
Results
Homozygous PCBD1 Mutations Cause Hypomagnesemia and
Renal Mg2+ Wasting
We diagnosed hypomagnesemia and hypermagnesuria in two patients carrying
mutations on both alleles in the PCBD1 gene (Table 1). In patient 1, hypomagnesemia was
partially corrected with oral Mg2+ supplements at a dose of 500 mg/day (0.64 mmol/L to
0.76 mmol/L at first measurement, 0.66 mmol/L to 0.69 mmol/L at second measurement,
N 0.7-1.1 mmol/L), though at the expense of increased magnesuria (FEMg 4.6 % to 7.8 %,
N <4 %). He had non-specific symptoms that might be related to hypomagnesemia
including fatigue, muscular pain, weakness and cramps in arms, numbness, difficulty
with memory, chest pains, and blurred vision, with some improvement after Mg2+
supplementation. An abdominal ultrasound showed slightly increased echogenicity of
both liver and kidney of uncertain cause; renal size was normal, with no cysts present
(Figure 1A-B). Renal function was normal (GFR 128 mL/min per 1.73 m2). Laboratory
investigations of patient 2 revealed a relatively high 24h urinary Mg2+ excretion (5.25
mmol/24 hrs, N 2-8; Table 1) in the presence of hypomagnesemia (0.65 mmol/L), with no
secondary symptoms. Serum and 24h urinary Ca2+ excretion were within the normal
range as well as creatinine clearance (126 mL/min, N 89-143). Ultrasound examinations
excluded the presence of renal hypoplasia or cysts (Figure 1C). Patient 3 showed borderline
serum Mg2+ levels (0.74 mmol/L), but displayed normal urinary Mg2+ excretion (FEMg 2.5 %).
Maturity Onset Diabetes of the Young (MODY) in Two Patients

with PCBD1 Mutations
In addition to hypomagnesemia, patient 1 was diagnosed with diabetes. Type 1 autoimmune
diabetes was unlikely, since the patient lacked islet-cell antibodies and showed normal
serum C-peptide levels (0.69 nmol/L, N 0.3-1.32 nmol/L). Since MODY patients are generally
highly sensitive to sulphonylureas (37), he was treated with Gliclazide 80 mg/bid to which he
responded well, allowing his previous insulin treatment of 20-30 units/day to be discontinued.
Additional extrarenal manifestations in HNF1B disease include liver test abnormalities (6, 7).
Liver function tests in patient 1 revealed that the plasma levels of high sensitivity C-reactive
protein (hs-CRP) were significantly low at <0.1 mg/L (N <8 mg/L) (Table 2). IgG was slightly low
at 5.66 g/L (N 6.94-16.18 g/L), whereas the remaining liver function tests were all within the
normal range. Based on his glycosylated haemoglobin levels, we concluded that patient 2 did
not develop diabetes (HbA1c 4.95 %, N 4.3-6.1 %; Table 1). Abdominal ultrasound analysis
showed that pancreas and liver were normal (Figure 1D-E). Patient 3 was also diagnosed
with diabetes of no autoimmune origin due to the absence of islet-cell antibodies. HbA1c
levels were 6.5 % (N 4.3-6.1 %) and glucose was 6.4 mmol/L (N 4.4-6.1 mmol/L). MODY type
1, 2 and 3 due to mutations in HNF4A, GCK, and HNF1A, respectively, were excluded by DNA
analysis. Presently the patient is not receiving medications nor insulin treatment.
Patient 1 (BIODEF 272)
Patient 2 (BIODEF 329)
Figure 1 Abdominal Ultrasound Examination of Patient 1 and 2

In patient 1, size of the right (A) and left (B) kidney with normal with no cysts. Ultrasound analysis of
kidney (C), pancreas (D) and liver (E) in patient 2 showed normal organ morphology.
Pcbd1 Expression in DCT is Modulated by Dietary Mg2+ Content

We examined Pcbd1 mRNA expression levels in a mouse tissue panel using real-time
RT-PCR. Highest expression was measured in kidney and liver (Figure 2A). Furthermore,
immunohistochemical analysis of mouse pancreas sections revealed that PCBD1 is
expressed in pancreatic cells (Figure 2B). Mouse kidney sections were stained for PCBD1 to
evaluate whether PCBD1 locates to the sites of renal Mg2+ reabsorption (Figure 2C-G).
PCBD1 staining co-localized with NCC in DCT, and in part with Tamm Horsfall and
calbindin-D28K expression in the cortical thick ascending limb of Henles loop (TAL) and
connecting tubule (CNT), respectively. No co-localization of PCBD1 was detected with
markers of the proximal tubule (PT) or collecting duct (CD), BCRP and AQP2, respectively.
The expression of Pcbd1 in DCT was confirmed in isolated DCT fragments. Pcbd1 expression
was significantly higher in DCT in comparison with whole kidney (Figure 2H). Hnf1b
transcript was not enriched in the DCT fraction. Interestingly, Pcbd1 expression in the DCT
was significantly upregulated when mice were fed a low Mg2+-containing diet compared
to a high Mg2+-containing diet (Figure 2I). Mice on a Mg2+-deficient diet displayed a
significantly lower 24hrs Mg2+ excretion (Figure 3B) in response to the hypomagnesemia
(1.1 mmol/L versus 2.2 mmol/L, N 1.2-1.5 mmol/L (9), Figure 3A). Differences were not
observed in the serum and urinary levels of phenylalanine between the experimental
groups (Figure 3C-D).
76 | Chapter 3
Table 1 Pertinent Laboratory Investigations for Three Patients with PCBD1 Mutations
Parameter
Patient 1
(BIODEF 272)
Patient 2
Patient 3
Reference
(BIODEF 329) (BIODEF 319)
range
Baseline
On 500 mg /
day Mg2+
Baseline
Baseline
Na+ (mmol/L)
141
138
139
135-145
K+ (mmol/L)
4.0
4.5
4.0
3.5-5.0
Mg2+ (mmol/L)
0.64*
0.76
0.65*
0.74
0.7-1.1
Ca2+ (mmol/L)
2.41
2.55
2.25
2.43
2.20-2.65
Pi (mmol/L)
1.13
1.16
1.15
0.8-1.4
Creatinine (mmol/L)
0.069
0.066
0.062
0.056
0.045-0.110
HbA1c (%)
7.2*
4.95
6.5*
4.3-6.1
Uric acid ((mol/L)
310
135-510
Serum indices
Urinary indices
Mg2+ (mmol/L)
6.16
3.96
2.6
Mg2+ (mmol/24h)
5.25
2-8
FeMg (%)
6.6*
11.1*
3.5
<4
Ca2+ (mmol/L)
4.47
3.04
2.99
5.61
<7.5
>1
Ca2+ (mmol/24h)
FeCa (%)
Pi (mmol/L)
FePi (%)
Creatinine (mmol/L)
0.9
1.8
0.86
40.29
13.61
18.2
17
17.6
5-20
14.29
4.40
8.0
Creatinine (mmol/24h)
14
9-18
GFR (mL/min per 1.73 m2)
128
135
124
90
CCr (mL/min)
126
89-143
HbA1c: glycosylated haemoglobin; FEMg: fractional excretion of Mg2+. The FEMg was calculated
using the following formula: FEMg = (UMg x PCr) / [(0.7 x PMg) x UCr x 100]; FeCa: fractional excretion
of Ca2+; FEPi: fractional excretion of phosphate (Pi); GFR: glomerular filtration rate by Modification of
Diet in Renal Disease (MDRD) formula; CCr: creatinine clearance.
Table 2 L iver Function Tests in Patient 1 (BIODEF 272)

Parameter
Patient 1
(BIODEF 272)
Reference
range
41
38-50
Prealbumin (g/L)
0.381
0.1-0.4
hs-CRP (mg/L)
<0.1*
<8
-1 antitrypsin (g/L)
1.4
0.9-2.6
C3 (g/L)
1.17
0.8-2.1
C4 (g/L)
0.18
0.15-0.5
IgG (g/L)
5.66*
6.94-16.18
IgM (g/L)
0.75
0.6-3.0
IgA (g/L)
1.99
0.7-4.0
ALT (U/L)
20*
21-72
AST (U/L)
26
15-46
ALP (U/L)
108
30-130
Albumin (g/L)
hs-CRP: high-sensitivity C reactive protein; C3: complement component 3; C4: complement component 4;
IgG: immunoglobulin G; IgM: immunoglobulin M; IgA: immunoglobulin A; ALT: alanine transaminase;
AST: aspartate transaminase; ALP: alkaline phosphatase.
* indicates value outside of reference range
PCBD1 Enhances FXYD2 and PKHD1 Promoter Activation by HNF1B

In order to investigate whether the PCBD1 p.Glu26*, p.Arg87Gln, p.Glu96Lys and p.Gln97*
mutations can lead to an impairment of the interaction with HNF1B, we generated a
structural homology model of the PCBD1HNF1B dimerization domain (HNF1B-D)
complex using the structure of the PCBD1HNF1A dimerization domain tetramer (Figure
4A and B). The p.Glu26* mutation leads to a major protein truncation and complete loss of
the interaction domain with HNF1B (Figure 4B). Although p.Gln97* does not directly affect
the HNF1-binding domain of PCBD1, the mutation results in a truncation of the central
-helix of the protein. Consequently, the interaction domain might be destabilized
explaining the PCBD1 dysfunction. Similarly, the negatively charged p.Glu96 residue could
be important for the stabilization of the interaction domain, which may be hampered by
the p.Glu96Lys mutation.
To test the effects of the mutations on PCBD1 function, we studied all previously
described patient mutations in their ability to co-activate FXYD2 transcription in a luciferase
assay (Figure 4C)(11, 38, 39). Expression of wild-type PCBD1 did not change the luciferase
activity compared to mock-transfected cells, while HNF1B significantly enhanced the
FXYD2 promoter activity (Figure 4D). Interestingly, co-expression of PCBD1 with HNF1B
78 | Chapter 3
Pcbd1 mRNA
expression (% of total)
40
35
Pcbd1
30
25
20
15
10
5
0
y
s e
t g r
m m
n
ne um num nu Ileu olon olonecum Brai ear Lun Live leen esti uscl
H
C C C
K i d d e n o d e J eju
Sp T M
o u
r l y L a te
u
a
D
E
yD e
a r l L at
Pcbd1
Bcrp
Merge
Pcbd1
TH
Merge
Figure 2 Pcbd1 is Expressed in the DCT of the Kidney

A, Tissue expression pattern of the Pcbd1 transcript. Pcbd1 mRNA expression level was measured in a
panel of mouse tissues by quantitative RT-PCR and normalized for Gapdh expression. Data represent
the mean of three individual experiments SEM and are expressed as the percentage of the total
tissue expression. B, Immunohistochemical
analysis of PCBD1 in mouse
pancreas tissue. Scale bar,
NCC
Merge
Pcbd1
20 m. CG, Mouse kidney sections were costained for PCBD1 (green) and (C) BCRP (red), (D) TH (red),
(E) NCC (red), (F) 28K (red), or (G) AQP2 (red). Nuclei are shown by 4,6-diamidino-2-phenylindole
staining (DAPI, blue). Scale bar, 20 mm. H, Kidney expression pattern of Pcbd1 shows the highest
expression in DCT. The mRNA expression levels of Pcbd1 and Hnf1b in (black bars) COPAS-selected
mouse DCT and (white bars) control (nonselected) kidneys were measured by quantitative RT-PCR
and normalized for Gapdh expression. Data represent the mean of three individual experiments
Merge in nonselected tubules.
28K compared with the expression
Pcbd1
SEM and
are expressed as fold difference
*P < 0.05 versus total kidney. I, DCT expression of Pcbd1 is regulated by dietary Mg2+ intake. The mRNA
expression levels of Pcbd1 and Hnf1b in COPAS-selected mouse DCT kidney tubules from mice fed
with (white bars) low and (black bars) high Mg2+-containing diets were measured by realtime RTPCR and normalized for Gapdh expression. Data represent the mean of four individual experiments
SEM and are expressed as fold difference compared with the expression in high Mg2+-containing
diets. *P < 0.05 versus high Mg2+.
Merge
Aqp2
Pcbd1
PCBD1: pterin-4 alpha-carbinolamine dehydratase; AQP2, aquaporin 2; BCRP, breast cancer resistance
protein; TH, Tamm Horsfall; NCC, Na+-Cl--cotransporter; 28K, calbindin-D28K.
1.5
1.0
Non-selected tubules
DCT
2.5
mRNA expression
d of high Mg2+)
mRNA expression
of whole kidney)
2.0
2.0
1.5
1.0
Low Mg2+
High Mg2+
Pcbd1
Bcrp
Merge
Pcbd1
TH
Merge
Pcbd1
NCC
Merge
Pcbd1
28K
Merge
Pcbd1
Aqp2
Merge
I
Relative mRNA expression
(Fold of whole kidney)
2.0
Non-selected tubules
DCT
1.5
1.0
0.5
Pcbd1
Figure 2 Continued
Hnf1b
2.5
Relative mRNA expression

(Fold of high Mg2+)
2.0
Low Mg2+
High Mg2+
1.5
1.0
0.5
0
Pcbd1
Hnf1b
80 | Chapter 3
B
60
Magnesium excretion
(mol/24h)
Serum Magnesium (mM)
2.5
2.0
1.5
1.0
0.5
0
40
30
20
10
0
Low Mg 2+
H igh Mg 2+
Low Mg 2+
H igh Mg 2+
Low Mg 2 +
H igh M g 2 +
D
40
Phenylalanine excretion
(nmol/24h)
80
Serum Phenylalanine (M)
50
60
40
20
Low Mg 2 +
H igh Mg 2 +
30
20
10
Figure 3 Effect of Dietary Mg2+ on Serum and Urinary Mg2+ and Phenylalanine Levels
C57Bl/6 mice were fed low or high Mg2+-containing diets for 15 days. Before sacrifice, serum and
24 hrs urine samples were collected for Mg2+ (A-B) and phenylalanine (C-D) levels determination.
Results are depicted as mean SEM, * P < 0.05 versus low Mg2+ (n=10).
further increased FXYD2 promoter activation by 1.5 fold (Figure 4D). Of all PCBD1 mutants,
only PCBD1 p.Arg87Gln and p.Cys81Arg maintained their co-activator properties (Figure 4D).
The transcription of PKHD1, another established target gene of HNF1B in the kidney (21),
was assessed in the presence of PCBD1. PKHD1 promoter activity showed a ~1.5 fold
increase expression levels when HNF1B and PCBD1 were co-expressed (Figure 4E). PCBD1
p.Arg87Gln, but not p.Cys81Arg, was the only PCBD1 mutant that retained its co-activator
activity (Figure 4E).
Mutations Detected in HPABH4D Patients Cause Protein Degradation

of PCBD1
To explain why the PCBD1 mutants are not capable of enhancing HNF1B-induced
transcription, we examined their subcellular localization and their capacity to bind HNF1B.
Immunostaining for PCBD1 in transiently transfected HEK293 cells revealed that wild-type
PCBD1 translocates to the nucleus upon co-expression with HNF1B compared to mock
B
Ser14
C
N
HNF1B-D
Leu5
p.Gln97*
p.Glu96Lys
Ser18
Val21
Gln10
Ser7
HNF1B-D
p.Glu86*
p.Arg87Gln
PCBD1
N
Asn44
Glu58
PCBD1
p.Thr78Ile
p.Cys81Arg
p.Glu26*
C
1
p.Glu26*
30
40
2
50
60
2
HNF1B
binding site
70
3
80
90
100
3
COOH
p.Glu96Lys
p.Gln97*
NH2
20
p.Thr78Ile
p.Cys81Arg
p.Glu86*
p.Arg87Gln
10
200
Fold induction compared to

HNF1B/Mock (%)
Figure 4 PCBD1 Coactivates HNF1B-induced

FXYD2
and
*
* PKHD1 Promoter Activity
*
150

HNF1/Mock (%)
A, Homology model of100the PCBD1HNF1B dimerization domain (HNF1BD) tetramer modeled using
50
the structure of the PCBD1HNF1A
dimerization domain (HNF1AD) complex (Protein Data Bank ID
5
code 1F93). (Light blue and
4 grey) The PCBD1 dimer binds the (orange and grey) HNF1B dimer through
3
helix sequences. The HNF1AD
monomer is shown in yellow. Residues in the PCBD1 protein that were
2
1
found mutates in patients
affected by hyperphenylalaninemia are depicted in red. B, Homology
0
model of the interaction Mock
site within
theWTPCBD1HNF1B
domain
PCBD1(HNF1AD) complex.
26
78
81 dimerization
86
87
96
97
WT Mock
Mock + forms
HNF1B
Mockmonomer
+
+ a helix
+
+
+ with
+
+
+
(Orange) The bound HNF1B
bundle
the (light
blue) PCBD1 monomer.
The HNF1AD monomer is shown in yellow. The residues that differ between HNF1BD and HNF1AD
are visualized in grey. 200
C, Linear representation of the secondary structure elements of the human
PCBD1 protein. Red arrowheads
indicate* the positions of the* patient mutations described in the
150
literature. Green balls indicate
the histidine residues involved in the dehydratase active site (p.His61,
100
p.His62, and p.His79). D-E,
50 A luciferase assay was performed in HEK293 cells transiently cotransfected
20
with a (D) firefly luciferase
FXYD2 and (E) PKHD1 promoter construct and HNF1B or mock DNA in the
15
presence of wild-type or
10 mutant PCBD1. A Renilla luciferase construct was cotransfected to correct
5
for transfection efficiency.
Firefly/renilla luciferase ratios were determined as a measure of promoter
0
activity. Results are depicted
percentage
cells. *P < 0.05
PCBD1
Mock asWT
Mock WT compared
26
78
81 with
86 HNF1B-Mock
87
96
97 transfected
versus HNF1B/Mock (n=0).Mock Mock + + + + + + + + + HNF1B
Mock, mock DNA; WT, wild type; 26, p.Glu26*; 78, p.Thr78lle; 81, p.Cys81Arg; 86, p.Glu86*; 87, Arg87Gln; 96,
p.Glu96Lys; 97, p.Gln97*
50
60
150
80
90
HNF1B
binding site
100
3
COOH
100
50
5
4
3
2
1
0
Mock WT Mock WT
Mock Mock +
+
70
3
200

HNF1B/Mock (%)
40
2
p.Glu26*
82 | Chapter 3
30
1
p.Glu96Lys
p.Gln97*
20
1
p.Thr78Ile
p.Cys81Arg
p.Glu86*
p.Arg87Gln
10
NH2
26
78
81
86
87
96
97
PCBD1
HNF1B

HNF1/Mock (%)
200
150
100
50
20
15
10
5
0
Mock WT Mock WT
Mock Mock +
+
26
78
81
86
87
96
97
PCBD1
HNF1B
Figure 4 Continued
DNA (Figure 5A). Furthermore, PCBD1 p.Glu26*, p.Glu86*, p.Glu96Lys and p.Gln97* were
not expressed, whereas p.Thr78Ile and p.Cys81Arg were detected significantly less than
the wild-type protein. PCBD1 p.Arg87Gln was the only mutant showing a comparable
expression level to wild-type PCBD1 (Figure 5A). Co-immunoprecipitation studies
confirmed that only PCBD1 p.Arg87Gln, p.Thr78Ile and p.Cys81Arg were expressed and
able to bind HNF1B (Figure 5B, upper and lower panel). Importantly HNF1B was equally
expressed in all conditions (Figure 5B, middle panel). To examine whether mutated PCBD1
proteins are degraded by the proteasomal pathway for misfolded proteins, PCBD1-
expressing HEK293 cells were treated for 24hrs with 10 nM of the proteasome inhibitor
MG-132. Protein expression was restored for all of the PCBD1 mutants, with the only
exception of p.Glu26* (Figure 5C).
HNF1B Mutations Affect the Subcellular Localization of PCBD1

We evaluated five HNF1B mutations (p.Lys156Glu, p.Gln253Pro, p.Arg276Gly, p.His324
Ser325fsdelCA, p.Tyr352fsinsA) for their ability to bind and functionally respond to PCBD1
(Figure 6A)(1, 15). All HNF1B mutants, except HNF1B 2-30, bound PCBD1 in co-immunoprecipitation studies in transiently transfected HEK293 cells (Figure 6B, upper panel).
PCBD1 and HNF1B were expressed in all conditions tested (Figure 6B, middle and lower
WT + Mock
WT + HNF1B
26 + HNF1B
78 + HNF1B
81 + HNF1B
86 + HNF1B
87 + HNF1B
96 + HNF1B
97 + HNF1B
26
78
81
86
87
96
97
T
W
kDa
oc
HA-PCBD1
Flag-HNF1B
12
IP: Flag-tag
WB: HA-tag
64
IP: Flag-tag
WB: Flag-tag
12
Input
WB: HA-tag
26
kDa
12
+ -
78
+ -
81
+ -
86
+ -
87
+ -
96
+ -
97
PCBD1
MG-132
HA-PCBD1
Figure 5 Several PCBD1 Mutations Lead to Protein Degradation HEK293 Cells

A, Immunocytochemistry analysis of the subcellular localization of HA-tagged PCDB1 wild type or
HA-tagged PCDB1 mutants when coexpressed in a 1:1 ratio with FLAG-tagged HNF1B or mock DNA in
HEK293 cells. Red signal represents immunodetected HA epitopes. Nuclei stained with 4,6-diamidino-2phenylindole (DAPI) are shown in blue. Scale bar: 10 m. Representation immunocytochemical images
are shown. B, HA-tagged PCDB1 wild-type, PCDB1 mutant, or mock DNA were transiently expressed
in HEK293 cells with or without FLAG-tagged HNF1B. Immunoprecipitations on nuclear extracts using
an anti-FLAG antibody were separated by SDS-PAGE, and Western blots were probed with (top) anti-HA
and (middle) anti-FLAG antibodies. (Bottom) HAPCDB1 input (25 %) expression was also included in the
analysis. The immunoblots shown are representative of three independent experiments. C, Western
blot analysis of HA-tagged PCDB1 mutants expressed in HEK293 cells treated with (+) or without (2)
10 nM MG-132 for 24 hrs. A representative immunoblot is shown.
IP, immunoprecipitation; Mock, mock DNA; WB, Western blot;W T, wild-type; 26, p.Glu26*; 78, p.Thr78lle; 81,
p.Cys81Arg; 86, p.Glu86*; 87, Arg87Gln; 96, p.Glu96Lys; 97, p.Gln97*.
88
NLS
POU
D
1 32
POU
kDa
557
35
2
32
4_
27
6
25
3
15
6
IP: Flag-tag
WB: Flag-tag
12
Input
WB: HA-tag
64
36
PCBD1 (-)
PCBD1 (+)
324_325
352
276
253
156
1-32
PCBD1 + Mock
PCBD1 + 1-32
PCBD1 + WT
PCBD1 + 156
PCBD1 + 253
PCBD1 + 276
PCBD1 + 324_325
PCBD1 + 352
*
*
352
324_325
276
253
WT
156
0
1-32
50
20
15
10
5
0
WT
100
Mock
PCBD1 localization
(nuclear/cytosolic ratio)

HNF1B WT/ Mock (%)
C
150
Flag-PCBD1
Transactivation
DNA Binding
200
HA-HNF1B
IP: Flag-tag
WB: HA-tag
36
C
313
- + + + + + + + + + + + + +
64
178 229-235
WT
1-32
p.
G
p . l n2
Ar 5
g2 3P
76 ro
Gl
y
p.
Hi
s3
p.T 24
yr Se
35 r3
2 f 25
si n f s
sA d e
lC
u
Gl
Ly
s1
56
p.
N
32
5
84 | Chapter 3
Figure 6 HNF1B Mutations Result in Cytosolic Localization of PCBD1

A, Linear representation of the human HNF1B protein. Red arrowheads indicate patient mutations
that were tested in this study. B, HA-tagged HNF1B wild-type (WT), HNF1B mutants, or HNF1B lacking
the extracts using an anti-FLAG antibody were separated by SDS-PAGE, and Western blots (WBs)
were probed with (top) anti-HA or (middle) anti-FLAG antibodies. (Lower) HA-HNF1B input (25 %)
expression was also included in the analysis. The immunoblots shown are representative for three
independent experiments. C, A luciferase assay was performed in HEK293 cells expressing a firefly
luciferase FXYD2 promoter construct and each of the HNF1B variants (black bars) with and (white
bars) without PCDB1. Results are depicted as percentage compared with HNF1B/Mock transfected
cells (SEM). *P < 0.05 compared with the HNF1B/Mock condition (n=9). D, Immunocytochemistry
analysis of FLAG-tagged PCDB1 when coexpressed HNF1B WTs, HNF1B mutants, or mock DNA. Red
signal represents immunodetected FLAG epitopes. Scale bar: 20 m. The immunocytochemical
images shown are representative for three independent experiments. E, Quantification of the nuclear
versus cytosolic localization of PCDB1 when co-expressed with mock DNA (n=24), HNF1B D132
(n=33), WT (n=41), 156 (n=38), 253 (n=35), 276 (n=33), 324_325 (n=37), or 352 (n=36) (mean SEM).
*P < 0.05 compared with Mock. #P < 0.05 compared with WT.
D, dimerization domain; NLS, nuclear localization signal; POUH, atypical POU homeodomain; POUS,
POU-specific domain; IP, immunoprecipitation; Mock, mock DNA; D132, HNF1B lacking the dimerization
domain; 156, p.Lys156Glu; 253, p.Gln253Pro; 276, p.Arg276Gly; 324_325, p.His324Ser325fsdelCA; 352,
p.Tyr352fsinsA.
panel). FXYD2 promoter-luciferase assays showed that only HNF1B p.His324Ser325fsdelCA and
p.Tyr352fsinsA, that retained partial transcriptional activity, respond to the co-activation by
PCBD1 to the same extent as HNF1B wild-type (1.5 fold, Figure 6C). Importantly, immuno
cytochemical analysis revealed that co-expression of PCBD1 with the HNF1B mutants
p.Gln253Pro and p.His324Ser325fsdelCA causes a predominant cytosolic localization of
PCBD1 compared to the nuclear translocation observed upon co-expression with HNF1B
wild-type (Figure 6D-E).
Discussion
Mutations in PCBD1 have been shown to cause a transient and benign form of neonatal
hyperphenylalaninemia (HPABH4D)(11, 38, 39). Here, we present the first follow-up study
of HPABH4D patients reporting the onset of late complications linked to the deficient
activity of PCBD1 as transcriptional co-activator of HNF1B. Our results suggest that PCBD1
acts as an important transcriptional regulator of FXYD2 contributing to renal Mg2+
reabsorption in DCT. Our observations are based on the following results: i) hypo
magnesemia with renal Mg2+ wasting was reported in two out of three patients carrying
mutations in the PCBD1 gene; ii) two patients were diagnosed with MODY; iii) PCBD1 is
present in pancreas and kidney, predominantly in DCT, where its expression is sensitive to
dietary Mg2+ content; iv) in vitro data demonstrated that PCBD1 binds HNF1B to
co-stimulate the FXYD2-promoter, whose activity contributes to Mg2+ reabsorption in
DCT; v) PCBD1 mutations reported in HPABH4D patients caused proteolytic instability
leading to degradation via the proteasomal pathway.
To our knowledge, we are the first to report that PCBD1 mutations associate with
hypomagnesemia due to renal Mg2+ wasting as well as MODY. In kidney, the key sites for
Mg2+ reabsorption are TAL and DCT. While defects in the molecular pathway for Mg2+
handling in TAL lead to a concomitant waste of Ca2+, shortcomings in DCT cause hypermagnesuria associated with hypo- or normocalciuria. Based on the serum Ca2+ levels and
urinary Ca2+ excretion values, it is likely that in our patients the DCT is primarily affected.
Fluorescence-based sorting of DCT-eGFP tubules using a COPAS apparatus coupled to
real-time PCR analysis confirmed an enrichment of Pcbd1 expression in DCT tubules
compared to other nephron segments. Pcbd1 expression in DCT was increased in mice fed
with a low Mg2+ diet, suggesting that PCBD1 is important for renal Mg2+ reabsorption in
86 | Chapter 3
DCT. Serum and urinary phenylalanine levels were stable in the mice, thus did not
modulate PCBD1 expression. Immunohistochemical analysis showed that PCBD1
expression is not limited to DCT, but partially extended to cortical TAL and CNT. Overall,
these findings confirm previous immunohistochemical studies showing PCBD1 expression
in the cortex of the kidney (33). Since PCBD1 was present in the cytosol of renal cells, we
hypothesized that the relative abundance of PCBD1 and HNF1B in the kidney may favor
the cytosolic localization. Nevertheless, a nuclear localization of PCBD1 in the kidney
could occur according to tissue-specific dynamics of the PCBD1-HNF1B complex.

Our results demonstrated that PCBD1 enhances the FXYD2 promoter activation by
HNF1B in vitro. The relevance of FXYD2 activity in Mg2+ handling in DCT has been suggested
previously, since both patients with FXYD2 mutations and patients carrying HNF1B
mutations may present with hypomagnesemia (1, 29). It was demonstrated that HNF1B
binds the FXYD2 promoter to specifically regulate the transcription of the -subunit of the
Na+/K+-ATPase isoform (1, 16). -subunit is mainly expressed in PT and medullary TAL,
but also in DCT (Figure 7)(2, 16), where PCBD1 is expressed. To date, the exact molecular
mechanism by which the -subunit regulates Mg2+ handling in DCT remains elusive (18).
In kidney, HNF1B is ubiquitously expressed where it regulates the transcription of
several cystic genes, like PKHD1 (20). Mutations in PKHD1 are causative for autosomal
recessive polycystic kidney disease (ARPKD, OMIM #263200)(21). Similar to the FXYD2
promoter, a PKHD1 reporter construct showed increased expression levels when HNF1B
and PCBD1 were co-transfected in HEK293 cells. However, the renal expression of PKHD1
in vivo is restricted to TAL and CD, where PCBD1 expression is negligible (41). Thus, under
physiological conditions, renal PKHD1 gene transcription seems not affected by PCBD1.
This finding is supported by the absence of kidney abnormalities in patients with PCBD1
mutations.

Further evidence for an impaired HNF1-mediated transcription in HPABH4D patients
was provided by the diagnosis of MODY in patients 1 and 3. MODY is a monogenic form
of autosomal dominant type II diabetes characterized by age of onset often below 25
years and negative pancreatic autoantibodies. Heterozygous mutations in HNF1B or its
homolog HNF1A associate with MODY type 5 and type 3, respectively (26). We
demonstrated that PCBD1 is localized in the nuclei of pancreatic cells. Knowing that
PCBD1 acts as transcriptional co-activator of both HNF1B and HNF1A, a dysregulation of
HNF1B and/or HNF1A is potentially responsible for the MODY diagnosed in patients 1 and
3. Interestingly, the low plasma hs-CRP levels in patient 1 are in line with two recent studies
showing lower hs-CRP levels in MODY3 patients than individuals with other forms of
diabetes or nondiabetic controls (28, 32). This evidence favors the diagnosis of MODY3-like
diabetes in patient 1. Patient 2 was not diagnosed with diabetes, but he will be monitored
for later onset.

In this study, we showed that the HPABH4D patient mutations reported in literature
lead to protein degradation of PCBD1 via the proteasome pathway. Our data together
PT
TAL
DCT
CNT
CD
BCRP
TH
NCC
28K
AQP2
Markers
PCBD1
HNF1B
FXYD2
PKHD1
HNF1B
target genes
Figure 7 Schematic Diagram of Gene Expression in the Kidney
with previous studies on proteolytic instability for the same mutants in both mammalian
and bacterial expression systems support the hypothesis that this degradation process
may also occur in HPABH4D patients (22, 38, 39). Considering the inheritance of the
disease, HNF1-mediated transcription seems to be sensitive to changes in PCBD1 quantity
only when both PCBD1 alleles are affected, suggesting that PCBD1 probably belongs to an
ancillary regulatory mechanism to which other HNF1B partners may participate (12).
In vitro data in HEK293 cells revealed that PCBD1 p.Arg87Gln was the only mutant showing
an expression level comparable to the wild-type protein. Nevertheless, in patient 2 p.
Arg87Gln is homozygously present on both alleles with a p.Glu26* mutation that leads to
a significant decrease in the cellular content of PCBD1 (39). PCBD1 p.Glu26* degradation
could not be rescued by proteasome inhibition, suggesting that its transcript is degraded
by mRNA surveillance mechanisms (3, 5). PCBD1 p.Thr78Ile and p.Cys81Arg were
significantly less expressed than the wild-type protein. Both mutants showed binding to
HNF1B, but only PCBD1 p.Cys81Arg co-activated the FXYD2 promoter. PCBD1 p.Cys81Arg
did not co-activate the PKHD1 promoter suggesting insufficient expression to enhance
the transcription of PKHD1. In the near future, it would be of interest to screen patients
with PCBD1 p.Thr78Ile and p.Cys81Arg mutations for complications related to the HNF1B
disease.

PCBD1 monomers are small molecules that can passively diffuse from the cytosol into
the nucleus (36). It was suggested that, by assembling via the same interface, PCBD1
homotetramer and PCBD1HNF1 complexes are mutually exclusive (34). In our immunocytochemical analysis, the HNF1B mutants p.Gln253Pro and p.His324Ser325fsdelCA
significantly stimulated a cytosolic localization of PCBD1 compared to the nuclear PCBD1
localization observed in the presence of wild-type HNF1B. This suggests that HNF1B
mutations may disturb the stability of the PCBD1HNF1 complexes in the nucleus and
therefore favour the formation of PCBD1 homotetramers in the cytosol of the cell (1, 15).
The reduced nuclear localization of PCBD1 will indirectly result in a decreased co-activation
of HNF1B and could contribute to the hypomagnesemia observed in some HNF1B
patients. Since the presentation and development of HNF1B disease is diverse, variations
88 | Chapter 3
in HNF1B interacting proteins may be responsible for the phenotypic heterogeneity.

Screening of HNF1B patients for polymorphisms in PCBD1 should, therefore, be considered.

In conclusion, we identified PCBD1 as a new molecular player in renal Mg2+ handling.
Our results suggest that PCBD1 regulates the HNF1B-mediated FXYD2 transcription, influencing
active renal Mg2+ reabsorption in DCT. So far, HPABH4D due to PCBD1 mutations has been
considered a transient, benign condition, primarily related to impaired BH4 regeneration.
To date, 23 patients with PCBD1 mutations linked to HPABH4D are listed in the International
Database of Tetrahydrobiopterin Deficiencies (BIODEF database, Opladen T, Blau N., http://
www.biopku.org/biodef/)(8). Here, we suggest that patients affected by HPABH4D should
be monitored for late complications related to the interactions with HNF1 transcription
factors, including hypomagnesemia and MODY.
Acknowledgements
The authors are grateful to the patients for their participation in this study. We appreciate
the kind help of N. Blau and B. Thny in the recruitment of the patients and for providing
the PCBD1 antibody. We also thank Lonneke Duijkers and Annelies van Angelen for their
excellent technical support. This work was supported by grants from the Netherlands
Organization for Scientific Research (ZonMw 9120.8026, NWO ALW 818.02.001), a European
Young Investigator award (EURYI) 2006 and Vici Grant (NWO- ZonMw 016.130.668) for J.G.J.
Hoenderop and EURenOmicsfunding from the European Union seventh Framework
Programme (FP7/2007-2013, agreement n 305608).
Patients and Methods

Patients
The three patients reported in this study were ascertained by contacting authors of
papers related to hyperphenylalaninemia, tetrahydrobiopterin-deficient, due to pterin-4-alpha-carbinolamine dehydratase deficiency (HPABH4D, OMIM #264070)(11, 38, 39).
Out of the 23 patients listed in the International Database of Tetrahydrobiopterin
Deficiencies (BIODEF database, Opladen T, Blau N., http://www.biopku.org/biodef/)(8),
BIODEF 272, BIODEF 329 and BIODEF 319 were assessed by Dr. Ferreira (Canada), Dr.
Germann (Germany) and Dr. de Klerk (The Netherlands), respectively. The results are
included in this study. Informed consent to participate in this study was obtained and the
procedures followed were in accordance with the standards of the medical ethics
committee of each participating institution. Patients were not treated with any medication
that could affect serum levels of Mg2+ (e.g. diuretics, calcineurin inhibitors, corticosteroids).
Patient 1 (BIODEF 272) was reported in detail previously (38). In summary, he was found to
have borderline hyperphenylalaninemia on newborn screening, but this markedly
increased to a peak of 2589 mol/L at 3.5 weeks. The diagnosis of HPABH4D was suspected
because of primapterinuria (7-biopterin), as well as a marked response to BH4. There was
no parental consanguinity; molecular analysis confirmed the diagnosis showing that he
was homozygous for a c.312C>T (p.Gln97*) mutation in the PCBD1 gene. He was treated
with phenylalanine restriction and BH4 until 4 months of age, at which time his
phenylalanine levels normalised without further treatment, on a normal diet. Intermittent
follow-up into adolescence revealed normal health, growth and cognitive development.
He was re-contacted for this study at age of 19 years; at that time it was noticed that he
had become an insulin-dependent diabetic about 6 months previously.
Patient 2 (BIODEF 329) Initial neonatal screening had shown hyperphenylalaninemia with
high urinary levels of primapterin (7-biopterin)(38, 39). This resolved after daily treatment
with BH4. There was parental consanguinity, and molecular studies showed that he was
homozygote for two separate mutations in the PCBD1 gene: c.99G>T (p.Glu26*), and
283G>A (p.Arg87Gln). He was followed by paediatricians at the Klinik fr Kinder- und
Jugendmedizin (Karlsruhe, Germany).

Patient 3 (BIODEF 319) is the first child of non-consanguineous parents. A previous sibling
of the patient died neonatally, while a younger brother was born healthy. The patient was
diagnosed with hyperphenylalaninemia and primapterinuria at the age of one month (39).
Molecular analysis revealed compound heterozygous c.309G>A/c.312C>T (p.Glu96Lys/p.
Gln97*) mutations in the PCBD1 gene. She needed cofactor BH4 replacement therapy, on
a normal diet, to maintain phenylalanine levels within the reference range. At the moment
of recruitment for this study, she was 17 years old. At that time she had stopped taking BH4
around a year earlier and had slightly elevated phenylalanine levels 120 mol/L (N <60
mol/L). It was also noticed that, just before turning 16 years old, she was diagnosed with
diabetes. MODY diabetes type 1, 2 and 3 were excluded by DNA analysis. The patient is
presently healthy and developing normally.
Calculation of FEMg
The FEMg was calculated using the following formula: FEMg = (UMg x PCr) / [(0.7 x PMg) x UCr
x 100]. U and P refer to the urine and serum concentrations of Mg2+(Mg) and creatinine
(Cr). Serum Mg2+ concentration was multiplied by 0.7 since only approximately 70 % of the
circulating Mg2+ was unbound by albumin and therefore able to be filtered across the
glomerulus.
Animal Study
All the experimental procedures are in compliance with the animal ethics board of the
Radboud University Nijmegen. The transgenic parvalbumin-eGFP mice were a kind gift
from Dr. Monyer (University of Heidelberg, Germany)(31). In the Mg2+ diet experiment, the
90 | Chapter 3
mice were fed low (0.02 % (w/w)) or high (0.48 % (w/w)) Mg2+-containing diets for 15 days
(SSNIFF spezialditen GmbH, Soest, Germany). During the last 48hrs of the experiment the
mice were housed in metabolic cages for urine collection (24hrs adaptation, 24hrs
sampling). Blood samples were taken at the start of the experiment and just before the
sacrifice. Pv-eGFP positive tubules were isolated as described previously (27). In short,
mice aged from 4 to 6 weeks were anesthetized and perfused transcardially with ice-cold
KREBS buffer (in mmol/L: 145 NaCl, 5 KCl, 1 NaH2PO4, 2.5 CaCl2, 1.8 MgSO4, 10 glucose, 10
HEPES/NaOH pH: 7.4). Kidneys were harvested and digested in KREBS buffer containing 1
mg/mL collagenase (Worthington, Lakewood, NJ, USA) and 2,000 units/mL hyaluronidase
(Sigma, Houten, the Netherlands) for three cycles of maximal 15 min each at 37 C.
Subsequently, the kidney tubules sized between 40-100 m were collected by filtration.
Tubules collected from the three digestions were ice-cooled and sorted by the Complex
Object Parameric Analyzer and Sorter (COPAS, Union Biometrica, Holliston, MA, USA).
Sorted tubules were directly collected in 1 % (v/v) -mercaptoethanol containing RLT
buffer that was supplied by the RNeasy RNA extraction kit (Qiagen, Venlo, the Netherlands).
Per mouse, 4,000 eGFP-fluorescent tubules were collected. 4,000 tubules were pooled on
a micro column for RNA extraction according to the manufacturers protocol. Subsequently,
reverse transcription of the RNA by M-MLV reverse transcriptase (Invitrogen) was
performed 1 hr at 37 C. Gene expression levels were determined by quantitative real-time
PCR on a BioRad Analyzer and normalized for Gapdh expression levels. Real-time PCR
primers (Table 3) were designed using the online computer program NCBI/Primer-BLAST
software.
Phenylalanine Measurements
Phenylalanine in plasma and urine samples was measured by LC-MS/MS by a standardized
method, in which the MS was operated in positive mode. For these MS measurements, a
Waters Premier triple quadrupole mass spectrometer (tandem MS) interfaced with an
electrospray ionization (ESI) source and equipped with an Alliance UPLC (Waters,
Etten-Leur, the Netherlands) was used. Briefly, to 10 L plasma or urine sample, 13C6-labeled
phenylalanine was added as an internal control to correct for possible ion-suppression.
Samples were deproteinized with methanol, diluted with water and injected on a RP C18
column (Waters Atlantis T3, 3 m, 2,1 x 100 mm). Samples were eluted in 17.5 % methanol
/ 0.1 mol/L formic acid. Positively charged [M-H]+ phenylalanine (m/z 166) and
13C -phenylalanine (m/z172) were selected as parent ions. After collision induced
6
dissociation (CID), the loss of NH3 and COOH groups were chosen as quantifier ion (m/z
120 and 126, respectively) and the loss of NH3 , COOH and OH2 groups (m/z 103 and
109, respectively) as qualifier ions. In Multiple Reaction Monitoring (MRM) mode, the
transitions m/z 166 120and m/z 166 103 (for phenylalanine) and m/z 172 126 and
m/z 172 109 (for 13C6-phenylalanine) were measured. Phenylalanine concentrations
were calculated using a calibration curve.
Table 3 Primer sequences used for real-time PCR analysis

Gene
product
Forward
Reverse
Pcbd1
5-TGGACATGGCCGGCAAGGC-3
5-CCCACAGCCCTCAGGTTTG-3
Hnf1b
5-CAAGATGTCAGGAGTGCGCTAC-3
5-CTGGTCACCATGGCACTGTTAC-3
Gapdh
Pcbd1: pterin-4-alpha-carbinolamine dehydratase; Hnf1b: hepatocyte nuclear factor 1b; Gapdh:

glyceraldehyde 3-phospgate dehydrogenase
DNA Constructs
Human HNF1B wild-type and mutants were cloned into the pCINeo HA IRES GFP vector as
described previously (16). HNF1B was Flag-tagged at the NH2-terminal by Phusion PCR
using NheI and AgeI restriction sites. To obtain a HNF1B lacking the dimerization domain
spanning residues 2-30 (2-30), HNF1B was amplified using a Phusion polymerase
(Finnzymes, Vantaa, Finland) with specific primers covering from residue p.Glu31. The
HNF1B-2-30 was ligated into pCINeo IRES GFP using AscI/AgeI restriction sites. The open
reading frame of human PCBD1 was amplified using Phusion polymerase from PCBD1
pCMV-SPORT6 (Genbank BC006324, ImaGenes) and subcloned into the pCINeo HA IRES
GFP vector using AgeI/EcoRI restriction sites. Wild-type PCBD1 was Flag-tagged at the
NH2-terminal by PCR using NheI/XhoI restriction sites. PCBD1 mutations were inserted in
the construct using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla,
CA) according to the manufacturers protocol. The luciferase reporter plasmid containing
the FXYD2 promoter linked to the coding region of firefly luciferase was produced as
previously described (16). Briefly, the human FXYD2 promoter region that controls
transcription of the -subunit isoform alpha (-3229/+91 bp from the transcription start site)
was amplified from genomic DNA using Phusion polymerase (Finnzymes, Vantaa, Finland),
and cloned into pGL3-Basic (Promega) using KpnI/BglII restriction sites. The human PKHD1
promoter region extending from exon 1 to 1.5 kb upstream to the transcription start site
was amplified from genomic DNA and cloned into pGL3-Basic using KpnI/HindIII sites.
The pRL-CMV vector encoding Renilla luciferase under control of a CMV promoter was
commercially available (Promega, Fitchburg, USA). All constructs were verified by sequence
analysis.
Cell Culture
Human Embryonic Kidney cells (HEK293) were grown in DMEM (Bio Whittaker-Europe,
Verviers, Belgium) containing 10 % (v/v) FCS (Thermo Fisher HyClone), 10 L/mL nonessential amino acids and 2 mmol/L L-glutamine at 37 C in a humidity-controlled
incubator with 5 % (v/v) CO2. The cells were transiently transfected with the respective
92 | Chapter 3
constructs using polyethylenimine cationic polymer (PEI, Polysciences Inc.) at 1:6 DNA:PEI
ratio for 48 hrs unless otherwise stated.
Western Blotting
HEK293 cells were transfected for 24 hrs with HA-PCBD1 mutants and treated at the same
time with 10 mmol/L MG-132 (Company). Protein lysates were denatured in Laemmli
containing 100 mmol/L DTT for 30 min at 37 C and subsequently subjected to SDS-PAGE.
Then, immunoblots were incubated with a mouse anti-HA (Roche, high affinity 3F10,
1:5,000) primary antibody and peroxidase conjugated sheep anti-mouse secondary
antibodies (Jackson Immunoresearch, 1:10,000).
Immunocytochemistry
HEK293 cells were seeded in 12-well plates on glass cover slips and co-transfected with
400 ng PCBD1 constructs and 400 ng HNF1B constructs or empty pCINeo IRES GFP vector
(mock DNA). After 48 hrs, HEK293 cells were fixed with 4 % (w/v) paraformaldehyde (PFA)
for 30 min at 4 C, followed by the subsequent steps at room temperature: permeabilization
for 15 min with 0.3 % (v/v) Triton X-100 in PBS, incubation for 15 min with 50 mmol/L NH4Cl,
and finally incubation in blocking buffer (16 % (v/v) goat serum, 0.3 % (v/v) Triton X-100
and 0.3 mol/L NaCl in PBS). After incubation overnight at 4 C with a rabbit anti-Flag M2
(Sigma F7425, 1:100) or a mouse anti-HA (Cell signaling technology, 6E2, 1:100), cells were
washed three times with Tris-buffered NaCl Tween-20 (TNT; 150 mmol/L NaCl, 0.1 mol/L
Tris/HCl, pH 7.5, 0.05 % (v/v) Tween-20) and subsequently incubated with a secondary goat
anti-rabbit antibody (Sigma A4914, 1:300) or a sheep anti-mouse (Jackson Immunoresearch,
1:300), coupled to AlexaFluor 594, for 45 min at room temperature. After incubation with
4,6-diamidino-2-phenylindole (DAPI) for 30 min at room temperature, cells were washed
three times with TNT and finally mount with Fluoromount-G (SouthernBiotech). Photographs
were taken using a Zeiss Axio Imager 1 microscope (Oberkochen, Germany) equipped
with a HXP120 Kubler Codix fluorescence lamp and a Zeiss Axiocam MRm digital camera.
Images were analysed by use of the software ImageJ (35).
Staining was performed on 5 m sections of periodate-lysine-paraformaldehyde (PLP)
fixed frozen mouse kidney or pancreas samples. Subsequently, sections were washed
three times with TN buffer (0.15 mol/L NaCl, 0.1 mol/L Tris/HCl, pH 7.6). Antigen retrieval
was done with 10 mmol/L sodium citrate pH 6.0 and non-specific binding was blocked
by incubation in blocking buffer for 1 hr. Sections were stained overnight at 4 C with
a polyclonal rabbit anti-PCBD1 antibody (F3862, 1:5000, kind gift by Prof. Thny)(33). The
following day, sections were washed and incubated with a goat anti-rabbit secondary
antibody coupled to Alexa Fluor 488 (1:300; Invitrogen, A11008) for 1 hr at room temperature.
Kidney sections were costained for the breast cancer resistance protein (BCRP), Tamm
Horsfall (TH), Na+/Cl- cotransporter (NCC), calbindin-D28k (D28K) or aquaporin-2 (AQP2).

Briefly, sections were washed and incubated for 2 hrs at room temperature with rat
anti-BCRP (Clone BXP-9, Kamya Biomedical Company MC-980, 1:200), sheep anti-TH (AbD
serotec 8595-0054, 1:1500), guinea-pig anti-NCC (1:50, kind gift by Prof. Jan Loffing), mouse
anti-28K (1:1500, Sigma C-9848) or guinea-pig anti-AQP2 (1:1000, kind gift by Prof. Peter
Deen). Secondary antibodies were coupled with Alexa Fluor 495 (1:300; Invitrogen) and
incubated for 45 min at room temperature. Subsequently, sections were washed,
incubated for 10 min with DAPI and mounted with Mowiol. Photographs were taken using
a Zeiss Axio Imager 1 microscope (Oberkochen, Germany) equipped with a HXP120 Kubler
Codix fluorescence lamp and a Zeiss Axiocam MRm digital camera.
Co-Immunoprecipitation
HEK293 cells were seeded on 55 mm petri dishes and co-transfected with 5 g PCBD1
constructs and 5 g of HNF1B constructs or a empty pCINeo IRES GFP vector (mock DNA).
48hrs after transfection, nuclear and cytosolic fractions were prepared using the NE-PER
Nuclear Protein Extraction Kit (Pierce). The next incubation steps were all done under
rotary agitation at 4 C. 35 L of protein A-agarose beads (Santa Cruz Biotechnology) were
previously incubated overnight at 4 C with 2.5 g rabbit anti-Flag antibody (Sigma F7425)
and washed with IPP500 (500 mmol/L NaCl, 10 mmol/L Tris/HCl pH 8.0, 0.1 % (v/v) NP-40,
0.1 % (v/v) Tween-20, 0.1 % (w/v) BSA and protein inhibitors) four times. After sampling 60
L as input control, the remaining 180 L of the lysate samples was added to the
antibody-beads mixture overnight at 4 C. Then, the beads were collected by centrifugation
at 2000 rpm for 2 min at 4 C and washed four times with lysis buffer. The proteins were
separated from the beads by incubation for 30 min at 37 C in 1x Laemmli sample buffer
supplemented with 100 mmol/L DTT and detected by immunoblotting using a mouse
anti-HA (Roche, high affinity 3F10, 1:5,000) or a mouse anti-Flag M2 (Sigma F3165, 1:5,000)
primary antibodies, and peroxidase conjugated sheep anti-mouse secondary antibodies
(Jackson Immunoresearch, 1:10,000).
Luciferase Reporter Assay

HEK293 cells were seeded on 12-well plates and transfected with the following DNA
amounts: 700 ng of the FXYD2 promoter-luciferase construct, 50 ng PCBD1 constructs, 50
ng HNF1B constructs or empty pCINeo IRES GFP vector (mock DNA). To correct for
transfection efficiency, 10 ng of pRL-CMV was used as a reference. Firefly and Renilla
luciferase activities were measured by use of a Dual-Luciferase Reporter Assay (Promega)
48hrs after transfection.
Homology Modelling
A homology model was built using the modelling script in the WHAT IF & YASARA Twinset
with standard parameters (25, 40). The structure of the PCBD1 dimer in complex with the
94 | Chapter 3
HNF1A dimerization domain dimer was used as a template for modelling of HNF1B (PDB
file: 1f93). Our model contains only the dimerization domain (31 amino acids) of HNF1B
and this has 68 % sequence identity with the dimerization domain of HNF1A.
All results are depicted as mean standard error of the mean (SEM). Statistical analyses
were conducted by unpaired students t-test when comparing two experimental
conditions, and one-way ANOVA with Bonferroni test when comparing more conditions,
P values less than 0.05 were considered significant.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE,
associate with hypomagnesemia and renal magnesium wasting. J Am Soc Nephrol 20: 1123-1131, 2009.
Arystarkhova E, Wetzel RK, and Sweadner KJ. Distribution and oligomeric association of splice forms of
Na(+)-K(+)-ATPase regulatory gamma-subunit in rat kidney. Am J Physiol Renal Physiol 282: F393-407, 2002.
Baker KE, and Parker R. Nonsense-mediated mRNA decay: terminating erroneous gene expression. Curr
Opin Cell Biol 16: 293-299, 2004.
Bayle JH, Randazzo F, Johnen G, Kaufman S, Nagy A, Rossant J, and Crabtree GR. Hyperphenylalaninemia
and impaired glucose tolerance in mice lacking the bifunctional DCoH gene. J Biol Chem 277: 28884-28891, 2002.
Behm-Ansmant I, and Izaurralde E. Quality control of gene expression: a stepwise assembly pathway for
the surveillance complex that triggers nonsense-mediated mRNA decay. Genes Dev 20: 391-398, 2006.
Bellanne-Chantelot C, Chauveau D, Gautier JF, Dubois-Laforgue D, Clauin S, Beaufils S, Wilhelm JM,
Boitard C, Noel LH, Velho G, and Timsit J. Clinical spectrum associated with hepatocyte nuclear factor-1beta
mutations. Ann Intern Med 140: 510-517, 2004.
Bingham C, and Hattersley AT. Renal cysts and diabetes syndrome resulting from mutations in hepatocyte
nuclear factor-1beta. Nephrol Dial Transplant 19: 2703-2708, 2004.
Blau N, Barnes I, and Dhondt JL. International database of tetrahydrobiopterin deficiencies. J Inherit Metab
Dis 19: 8-14, 1996.
Chollet D, Franken P, Raffin Y, Malafosse A, Widmer J, and Tafti M. Blood and brain magnesium in inbred
mice and their correlation with sleep quality. American journal of physiology Regulatory, integrative and
comparative physiology 279: R2173-2178, 2000.
Citron BA, Davis MD, Milstien S, Gutierrez J, Mendel DB, Crabtree GR, and Kaufman S. Identity of
4a-carbinolamine dehydratase, a component of the phenylalanine hydroxylation system, and DCoH, a
transregulator of homeodomain proteins. Proc Natl Acad Sci USA 89: 11891-11894, 1992.
Citron BA, Kaufman S, Milstien S, Naylor EW, Greene CL, and Davis MD. Mutation in the 4a-carbinolamine dehydratase gene leads to mild hyperphenylalaninemia with defective cofactor metabolism. Am J
Hum Genet 53: 768-774, 1993.
Dudziak K, Mottalebi N, Senkel S, Edghill EL, Rosengarten S, Roose M, Bingham C, Ellard S, and Ryffel
GU. Transcription factor HNF1beta and novel partners affect nephrogenesis. Kidney Int 74: 210-217, 2008.
Edghill EL, Bingham C, Ellard S, and Hattersley AT. Mutations in hepatocyte nuclear factor-1beta and their
related phenotypes. J Med Genet 43: 84-90, 2006.
Endrizzi JA, Cronk JD, Wang W, Crabtree GR, and Alber T. Crystal structure of DCoH, a bifunctional, protein-binding transcriptional coactivator. Science 268: 556-559, 1995.
Faguer S, Decramer S, Chassaing N, Bellanne-Chantelot C, Calvas P, Beaufils S, Bessenay L, Lengele
JP, Dahan K, Ronco P, Devuyst O, and Chauveau D. Diagnosis, management, and prognosis of HNF1B
nephropathy in adulthood. Kidney Int 80: 768-776, 2011.
Ferre S, Veenstra GJ, Bouwmeester R, Hoenderop JG, and Bindels RJ. HNF-1B specifically regulates the
transcription of the gammaa-subunit of the Na+/K+-ATPase. Biochem Biophys Res Commun 404: 284-290, 2011.
Ficner R, Sauer UH, Stier G, and Suck D. Three-dimensional structure of the bifunctional protein PCD/
DCoH, a cytoplasmic enzyme interacting with transcription factor HNF1. EMBO J 14: 2034-2042, 1995.
Glaudemans B, Knoers NV, Hoenderop JG, and Bindels RJ. New molecular players facilitating Mg(2+)
reabsorption in the distal convoluted tubule. Kidney Int 77: 17-22, 2010.
Gong Y, Ma Z, Patel V, Fischer E, Hiesberger T, Pontoglio M, and Igarashi P. HNF-1beta regulates
transcription of the PKD modifier gene Kif12. J Am Soc Nephrol 20: 41-47, 2009.
Gresh L, Fischer E, Reimann A, Tanguy M, Garbay S, Shao X, Hiesberger T, Fiette L, Igarashi P, Yaniv M,
and Pontoglio M. A transcriptional network in polycystic kidney disease. EMBO J 23: 1657-1668, 2004.
Hiesberger T, Bai Y, Shao X, McNally BT, Sinclair AM, Tian X, Somlo S, and Igarashi P. Mutation of
hepatocyte nuclear factor-1beta inhibits Pkhd1 gene expression and produces renal cysts in mice. J Clin Invest
113: 814-825, 2004.
96 | Chapter 3
22. Johnen G, Kowlessur D, Citron BA, and Kaufman S. Characterization of the wild-type form of 4a-carbinolamine dehydratase and two naturally occurring mutants associated with hyperphenylalaninemia. Proc Natl
Acad Sci USA 92: 12384-12388, 1995.
23. Kikuchi R, Kusuhara H, Hattori N, Kim I, Shiota K, Gonzalez FJ, and Sugiyama Y. Regulation of tissue-specific expression of the human and mouse urate transporter 1 gene by hepatocyte nuclear factor 1 alpha/beta
and DNA methylation. Mol Pharmacol 72: 1619-1625, 2007.
24. Kikuchi R, Kusuhara H, Hattori N, Shiota K, Kim I, Gonzalez FJ, and Sugiyama Y. Regulation of the
expression of human organic anion transporter 3 by hepatocyte nuclear factor 1alpha/beta and DNA
methylation. Mol Pharmacol 70: 887-896, 2006.
25. Krieger E, Koraimann G, and Vriend G. Increasing the precision of comparative models with YASARA
NOVA--a self-parameterizing force field. Proteins 47: 393-402, 2002.
26. Maestro MA, Cardalda C, Boj SF, Luco RF, Servitja JM, and Ferrer J. Distinct roles of HNF1beta, HNF1alpha,
and HNF4alpha in regulating pancreas development, beta-cell function and growth. Endocr Dev 12: 33-45, 2007.
27. Markadieu N, San-Cristobal P, Nair AV, Verkaart S, Lenssen E, Tudpor K, van Zeeland F, Loffing J,
Bindels RJ, and Hoenderop JG. A primary culture of distal convoluted tubules expressing functional thiazide-sensitive NaCl transport. Am J Physiol Renal Physiol 303: F886-892, 2012.
28. McDonald TJ, Shields BM, Lawry J, Owen KR, Gloyn AL, Ellard S, and Hattersley AT. High-sensitivity CRP
discriminates HNF1A-MODY from other subtypes of diabetes. Diabetes Care 34: 1860-1862, 2011.
29. Meij IC, Koenderink JB, van Bokhoven H, Assink KF, Groenestege WT, de Pont JJ, Bindels RJ, Monnens
the Na(+),K(+)-ATPase gamma-subunit. Nat Genet 26: 265-266, 2000.
30. Mendel DB, Khavari PA, Conley PB, Graves MK, Hansen LP, Admon A, and Crabtree GR. Characterization
of a cofactor that regulates dimerization of a mammalian homeodomain protein. Science 254: 1762-1767, 1991.
31. Meyer AH, Katona I, Blatow M, Rozov A, and Monyer H. In vivo labeling of parvalbumin-positive
interneurons and analysis of electrical coupling in identified neurons. J Neurosci 22: 7055-7064, 2002.
32. Owen KR, Thanabalasingham G, James TJ, Karpe F, Farmer AJ, McCarthy MI, and Gloyn AL. Assessment
of high-sensitivity C-reactive protein levels as diagnostic discriminator of maturity-onset diabetes of the
young due to HNF1A mutations. Diabetes Care 33: 1919-1924, 2010.
33. Resibois A, Cuvelier L, Svoboda M, Heizmann CW, and Thony B. Immunohistochemical localisation of
pterin-4alpha-carbinolamine dehydratase in rat peripheral organs. Histochem Cell Biol 111: 381-390, 1999.
34. Rose RB, Bayle JH, Endrizzi JA, Cronk JD, Crabtree GR, and Alber T. Structural basis of dimerization,
coactivator recognition and MODY3 mutations in HNF-1alpha. Nat Struct Biol 7: 744-748, 2000.
35. Schneider CA, Rasband WS, and Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods
9: 671-675, 2012.
36. Sourdive DJ, Transy C, Garbay S, and Yaniv M. The bifunctional DCOH protein binds to HNF1 independently
of its 4-alpha-carbinolamine dehydratase activity. Nucleic Acids Res 25: 1476-1484, 1997.
37. Thanabalasingham G, and Owen KR. Diagnosis and management of maturity onset diabetes of the young
(MODY). BMJ 343: d6044, 2011.
38. Thny B, Neuheiser F, Kierat L, Blaskovics M, Arn PH, Ferreira P, Rebrin I, Ayling J, and Blau N. Hyperphenylalaninemia with high levels of 7-biopterin is associated with mutations in the PCBD gene encoding the
bifunctional protein pterin-4a-carbinolamine dehydratase and transcriptional coactivator (DCoH). The
American Journal of Human Genetics 62: 1302-1311, 1998.
39. Thony B, Neuheiser F, Kierat L, Rolland MO, Guibaud P, Schluter T, Germann R, Heidenreich RA, Duran
M, de Klerk JB, Ayling JE, and Blau N. Mutations in the pterin-4alpha-carbinolamine dehydratase (PCBD)
gene cause a benign form of hyperphenylalaninemia. Hum Genet 103: 162-167, 1998.
40. Vriend G. WHAT IF: a molecular modeling and drug design program. Journal of molecular graphics 8: 52-56, 29,
1990.
41. Ward CJ, Yuan D, Masyuk TV, Wang X, Punyashthiti R, Whelan S, Bacallao R, Torra R, LaRusso NF,
Torres VE, and Harris PC. Cellular and subcellular localization of the ARPKD protein; fibrocystin is expressed
on primary cilia. Hum Mol Genet 12: 2703-2710, 2003.
42. Werner ER, Blau N, and Thony B. Tetrahydrobiopterin: biochemistry and pathophysiology. Biochem J 438:
397-414, 2011.
100 | Chapter 4
Abstract
Magnesium (Mg2+) is an essential ion for cell growth, neuroplasticity and muscle
contraction. Blood Mg2+ levels below 0.7 mmol/L may cause a heterogenous clinical
phenotype, including muscle cramps and epilepsy and disturbances in K+ and Ca2+
homeostasis. Over the last decade, the genetic origin of several familial forms of
hypomagnesemia has been found. In 2000, mutations in FXYD2, encoding the -subunit
of the Na+-K+-ATPase, were identified to cause isolated dominant hypomagnesemia (IDH) in
a large Dutch family suffering from hypomagnesemia, hypocalcuria and chondrocalcinosis.
However, no additional patients were identified since then.

Here, we report a p.Gly41Arg FXYD2 mutation in two families with hypomagnesemia
and hypocalciuria. Interestingly, this is the same mutation as was described in the original
study. Therefore, the patients were clinically and genetically characterized. As in the initial
family, several patients suffered from muscle cramps, chondrocalcinosis and epilepsy.
Haplotype analysis revealed an overlapping haplotype in all families, suggesting a founder
effect.

In conclusion, the recurrent p.Gly41Arg FXYD2 mutation in two new families with isolated
dominant hypomagnesemia confirms that FXYD2 mutation causes hypomagnesemia. Until
now, no other FXYD2 mutations have been reported which could indicate that other
FXYD2 mutations will not cause hypomagnesemia.
Keywords: Na+-K+-ATPase, Magnesium, Kidney, Distal Convoluted Tubule
FXYD2 Mutation Causes Hypomagnesemia | 101
Introduction
Hypomagnesemia is a common electrolyte imbalance resulting in muscle cramps, muscle
weakness and cardiac arrhytmias (11). The use of certain types of drugs including
calcineurin inhibitors, proton-pump inhibitors and diuretics may cause low serum
magnesium (Mg2+) levels (10). In a small percentage of patients the Mg2+ disturbance is of
genetic origin (5). Hypomagnesemia-causing mutations often affect Mg2+ transport
processes operating in the renal distal convoluted tubule (DCT). The final urinary Mg2+
excretion is determined in the DCT, since Mg2+ reabsorption does not take place beyond
that nephron segment (5). As a consequence, patients with reduced Mg2+ uptake in DCT
have renal Mg2+ wasting.

In 2000, we identified a c.115G>A (p.Gly41Arg) mutation in the FXYD domain containing
ion transport regulator 2 gene (FXYD2) causative for isolated dominant hypomagnesemia
(IDH, OMIM #154020) in a large Dutch family (12-14). Although originally described as two
families, haplotype analysis revealed a 10.5 cM overlapping region suggesting a founder
effect (14). Patients in this family had normal urinary Mg2+ values, but showed lowered
urinary Ca2+ excretion and suffered from episodes of convulsions (8). Some patients
developed symptoms of chondrocalcinosis, related to chronic hypomagnesemia (16).
FXYD2 encodes the subunit of the Na+-K+-ATPase and is involved in stabilization of
the -subunit of that complex (15). Moreover, the subunit decreases the affinity of the
Na+-K+-ATPase for Na+ and K+ and increases the affinity for ATP (2). The p.Gly41Arg
mutation causes a trafficking defect preventing the subunit to reach the basolateral
membrane (4, 13). In the kidney, three splice variants of FXYD2 are expressed. FXYD2a is
expressed strongly in the thick ascending limb (TAL) and proximal tubule and only
discretely in DCT (3). In contrast, FXYD2b expression is restricted to the basolateral
membrane of the DCT and connecting tubule (CNT). Additionally, HNF1 can activate
FXYD2a transcription and mutations in the HNF1 transcription factor gene (HNF1B) cause
hypomagnesemia (1, 6, 7). Given that each FXYD2 splice variant differentially modifies
Na+-K+-ATPase activity, it has been hypothesized that the ratio between FXYD2a and
FXYD2b expression may determine Na+-K+-ATPase activity. However, the mechanism by
which changes in basolateral FXYD2 expression affects renal Mg2+ reabsorption remains
to be elucidated.

Since the report of the original family in 2000, new families with FXYD2 mutations
have not been described. As a result the relevance of FXYD2 mutations for hypomagnesemia
has been questioned over the years. For the first time since the initial report, we now
present two new families harboring the same p.Glu41Arg mutation in FXYD2. To provide
further insight into the role of this mutation in hypomagnesemia, full molecular and
genealogical analyses were performed. Furthermore, we aimed to increase the current
phenotypic knowledge and describe the clinical presentations and treatment of patients
with FXYD2 mutations.
102 | Chapter 4
Results
Recurrent FXYD2 Mutation in Patients with Hypomagnesemia
In two families with hypomagnesemia a c.115G>A mutation in the FXYD2 gene was
identified by mutation analysis. The mutation results in a p.Gly41Arg change at amino acid
level. Interestingly, the c.115G>A mutation has previously been reported in a large Dutch
family in 2000 and no other FXYD2 mutations have been found since (13).
FXYD2 Mutation in a Dutch Family

The first family is a Dutch family with 3 affected family members (Figure 1). The proband
(Figure 1, NL II.1) was discovered suffering from hypokalemia and hypomagnesemia
during admission for lung embolism at the age of 34 years (Table 1). He had a chronic
history of muscle cramps and fatigue and reported a spacious fluid intake. He is an only
child and his parents are deceased. He reported no relevant symptoms of his father (Figure 1,
NL I.1) besides a spacious fluid intake and recurrent miscarriages of his mother (Figure 1, NL I.2).
The proband was suspected of having Gitelman syndrome and he was treated with Mg2+
and K+ supplements.
A
NL
B
I.
II.
2
A T C G T G N G G C T C C T C
III.
1
G/R
39
40
41
42
43
Figure 1 Family with Isolated Hypomagnesemia from the Netherlands

A, Pedigree of the Dutch family with hypomagnesemia. Black-filled symbols denote affected and
genetically confirmed family members, grey symbols denote potentially affected family members.
B, Mutation analysis chromatogram of the proband (NL II.1). The mutation is indicated by an arrow.
Nucleotide changes and resulting effect at the amino acid level are shown.
Hereafter, his two children were admitted to the outpatient clinic for evaluation
because of muscle cramps. They both showed hypomagnesemia. The daughter (Figure 1,
NL III.1), 9 years old, reported muscle cramps and uncertainty about keeping balance,
without falling. His son (Figure 1, NL III.2), 7 years old, reported an increased fluid intake
Table 1 Laboratory Investigations of Affected Individuals

NL II.1
NL III.1
NL III.2
B II.1
B III.2
B IV.1
0.38
0.45
0.45
0.56
0.35
0.50
Serum K+
(mmol/L, N 3.5-5.1
3.3
4.2
3.8
4.0
3.0
3.6
Serum HCO3(mmol/L, N 21-27)
29.6
24
22
26
27
31
eGFR
(mL/1.73 mL/min, N > 90)
123
133
124
43
125
85
Urinary Mg2+ excretion / 24 hrs

(mmoL/day, N 3.0-5.0)
8.9
8.1
10.6
8.4
0.8
1.5
0.3
Serum Mg2+
(mmol/L, N 0.7-0.95)
Fractional Mg2+ excretion

(%, nl < 4 %)
Urinary Ca2+ excretion / 24 hrs
(mmoL/day, N 1.5-7.5)
11.9
1.3
Urinary Ca2+/creat
(mmol/mmol, N <0.7)
0.04
0.05
1 mEq Mg2+ = 0.5 mmol Mg2+ = 12.3 mg Mg2+.

1 mEq Ca2+ = 0.5 mmol Ca2+ = 20.5 mg Ca2+.
and nightly muscle cramps and is known with an attention deficit disorder. Both children
had a normal growth pattern, normal blood pressure, no dysmorphic features and
unremarkable renal ultrasound and X-ray of the hand. Laboratory evaluation revealed
isolated hypomagnesemia with hypermagnesuria and hypocalciuria (with normal serum
creatinine) (Table 1). Because the dominant inheritance of hypomagnesemia in this family was
not compatible with Gitelman syndrome, genetic analysis was performed for diagnostic
purposes. No mutations were found in the HNF1B and SLC12A3 genes. A heterozygous
missense mutation in the FXYD2 gene (c.121G>A (p.(Gly41Arg)) was found in all 3 affected
individuals. The children are free of symptoms with Mg2+ supplementation 3 times a day,
achieving serum Mg2+ concentrations in the low normal range.
FXYD2 Mutation in a Belgian Family

The second family originates from Belgium. The proband is a 67-year old man admitted for
a work-up of hypokalemia and hypomagnesemia (Figure 2, B II.1). Hypomagnesemia was
first discovered at age 44, during a blood electrolyte analysis following an episode of
tetanic cramps. Magnesium supplements were then initiated, with variable compliance.
The patient reported chronic fatigue, with general weakness, dysesthesia of the face and
hands, and frequent cramps of the lower limbs, which generated difficulties in walking. He
complained about continuous thirst and nocturia. Blood pressure was 180/85 mmHg
104 | Chapter 4
B
B I.
II.
1
A T C G T G N G G C T C C T C
III.
1
IV.
G/R
39
40
41
42
43
Figure 2 Family with Isolated Hypomagnesemia from Belgium

A, Pedigree of the Belgian family with hypomagnesemia. Blackened symbols denote affected and
genetically confirmed family members, grey symbols denote potentially affected family members.
B, Mutation analysis chromatogram of the proband (B II.1). The mutation is indicated by an arrow and
the nucleotide changes and resulting effect at the amino acid level are shown.
(supine) and 150/90 mmHg (standing). The clinical examination was otherwise unremarkable.
The patient had chondrocalcinosis evidenced by X-ray of the knees.

Blood and urine analyses revealed renal failure (plasma creatinine 1.62 mg/dL, eGFR
43 mL/min/m2), with hypomagnesemia (all serum electrolytes within normal range) hypermagnesuria and hypocalciuria (Table 1). Facing the chronic history of hypomagnesemia
with inappropriate urinary Mg2+ loss and hypocalciuria, Gitelman syndrome was suspected.
Genetic testing of SLC12A3, CLCNKB and HNF1B (sequencing of all exons, exon-intron
boundaries plus MLPA) was negative.

The patient reported that his mother (Figure 2, B I.2, deceased at age 62) was known for
Mg2+ problems. She suffered from chronic fatigue and articulation problems. Additionally, she
also took Mg2+ supplements, as well as the probands daughter (B III.2) and granddaughter (B IV.1).

The daughter of the proband (Figure 2, B III.2), aged 41 years, complained of fatigue
since childhood, with limited physical activity. She had cramps and dysesthesia of the face
and hands. She was diagnosed with hypomagnesemia as a young adult and has taking
Mg2+ supplements since then. Plasma analyses revealed persistent hypomagnesemia and
hypokalemia, with normal HCO3- and normal renal function. The urinary Mg2+ loss was
inappropriately high (Table 1).

The granddaughter of the proband (B IV.1), age 16 years, experienced two epileptic
crises at 5 and 15 years of age and complained of chronic fatigue. The neurological work-up
was negative but hypomagnesemia and hypokalemia were noticed, with inappropriate
urinary Mg2+ loss and hypocalciuria (Table 1). Renal function was normal. Over the years,
plasma Mg2+ remained low despite supplementation.
Common Haplotype Bearing the FXYD2 Mutation

To examine whether the newly identified families share the same haplotype as the original
family, marker analysis was initiated. Five markers encompassing the FXYD2 gene were
selected: D11S4092, D11S4127, D11S939, D11S1356, D11S4195 (Figure 3). For this analysis,
relatives from the original family were included. Indeed, patients from all three families
share the same haplotype, suggesting that the families are related through a common
ancestor. Genealogical analysis did not result in the identification of this common ancestor.
Although the Belgian family was shown to originate from the same geographical region
(surroundings of Lige, Belgium) as the family described in the original paper from 2000,
no common ancestor was found in 9-12 generations back.
chr11 (cM)
117.25
117.5
D11S4092
117.75
D11S4127
118
D11S939
D11S1356
D11S4195
FXYD2
D11S4092
D11S4127
FXYD2
D11S939
D11S1356
D11S4195
202
204
190
204
190
204
204
204
196
204
202
93
85
93
85
93
85
87
85
96
85
93
xx
Gly41Arg
xx
Gly41Arg
xx
Gly41Arg
xx
Gly41Arg
xx
Gly41Arg
xx
204
85
Gly41Arg
243
245
238
245
238
245
242
245
242
245
240
245
202
202
200
202
192
202
200
202
200
202
202
202
272
272
272
272
272
272
279
272
272
272
272
272
NL III.1
NL III.2
NL II.1
B III.2
B IV.1
Meij et al. 2000
Figure 3 Haplotype Analysis of Patients with FXYD2 Mutations

STS marker analysis of patients with FXYD2 mutations with markers from the chromosome 11q23
(Chr11:117,250,000-118,000,000, hg38). All families share the same haplotype.
Discussion
In this study, a c.115G>A (p.Gly41Arg) mutation in FXYD2 was identified in two families with
hereditary hypomagnesemia. Importantly, these are the first new patients reported since
2000 confirming that FXYD2 mutations cause hypomagnesemia. In both patient families
the same c.115G>A mutation was detected that was previously described in a large Dutch
family. All three families shared the same haplotype, suggesting a founder effect.
Although the genetic cause was only found in 2000 (14), the first patients with
mutations in the FXYD2 gene were clinically evaluated in 1987 (9, 17). Twenty-two individuals
harboring FXYD2 mutations showed isolated dominant hypomagnesemia, hypocalciuria
and occasionally also hypomagnesemia-associated chondrocalcinosis was detected.
Since the first identification of the FXYD2 p.Gly41Arg mutation in 2000 (6), no other FXYD2
mutations have been reported in literature or detected in our diagnostic testing facility.
106 | Chapter 4
Therefore, the role of FXYD2 in hypomagnesemia has been questioned. The identification
of the new Dutch and Belgian families with FXYD2 mutations confirms its importance in
renal Mg2+ handling. Moreover, several regulatory factors of FXYD2 have additionally
been implicated in Mg2+ homeostasis. The transcription of FXYD2 is induced by HNF1 (7)
and patients with HNF1B mutations also develop hypomagnesemia (1). Recently, pterin-
4-alpha-carbinolamine dehydratase (encoded by PCBD1) was identified as additional
transcriptional regulator of FXYD2 and again patients with PCBD1 mutations showed
hypomagnesemia (6). Although the exact molecular mechanism by which the PCBD1HNF1B-FXYD2 axis regulates renal Mg2+ reabsorption is still unclear, the effects of
FXYD2-encoded subunit on Na+-K+-ATPase activity have been well established.
The subunit increases the affinity of the Na+-K+-ATPase for ATP and decreases the
affinity for Na+ and K+ (2). The p.Gly41 residue is located central in the alpha-helix that
forms the subunit (PDB: 2mkv). Mutation of the small glycine residue in the larger
arginine residue may disrupt the structure of the subunit. To date other FXYD2 mutations
have not been identified, suggesting that other FXYD2 mutations may not cause
hypomagnesemia. Alternativity, the importance of subunit for Na+-K+-ATPase activity
could suggest that more severe mutations in FXYD2 render a dysfunctional Na+-K+-ATPase
and therefore may be embryonic lethal.

In the new families from the Netherlands and Belgium, both hypomagnesemia and
hypocalciuria could be confirmed in all patients. Of note, hypomagnesemia was associated
with moderate hypokalemia in the two patients with lowest serum Mg2+ values.
Hypokalemia is often secondary to hypomagnesemia (13). Hypomagnesemia results in
decreased intracellular Mg2+ levels in the distal part of the nephron, possibly due to the
fact the Mg2+ normally inhibits the renal ROMK K+ channel minimizing renal K+ secretion.
Other clinical manifestations of the patients harboring FXYD2 mutations include renal
failure (CKD stage 3)(B II.1), but additional factors in the development of renal failure
cannot be excluded (e.g. analgesics and NSAID for chronic pain due to chondrocalcinosis).
All affected family members reported muscle cramps. Additionally, one patient suffered
from episodes of epilepsy (B IV.1). Moreover, chrondrocalcinosis was detected in the
proband of the Belgian family (B II.1). Both epilepsy and chondrocalcinosis were observed
in the other patients from the original family (1, 7), and are classical complications of
hypomagnesemia. In the Dutch family, daily supplementation using Mg(OH)2 achieved
plasma Mg2+ levels in the low normal range.

Genealogical analysis, going back to 1700 of all three patients families with the similar
FXYD2 mutation did not result in the identification of a common ancestor. Interestingly,
the ancestry of two families could be traced back to the same geographical area near
Lige in Belgium. If indeed the common ancestor lived before 1700, the dominant
inheritance of IDH suggests that more, still unidentified, descendants of this common
ancestor could live in the Netherlands and Belgium. However, given the variety of this
phenotype and the aspecificity of the symptoms these patients often remain undetected.
Increasing the awareness of this syndrome may help identifying more patients with FXYD2
mutations and allow proper treatment by Mg2+ supplementation.
In conclusion, this study reports two new families with isolated dominant hypo
magnesemia caused by FXYD2 mutations. Further insight in the clinical spectrum associated
with genetic Mg2+ disorders can provide useful information for clinicians to make an early
differential diagnosis. FXYD2 mutations should be considered in patients with hypo
magnesemia and hypocalciuria, especially when chondrocalcinosis or epilepsy are observed.
Acknowledgements
This work was supported by grants from the Netherlands Organization for Scientific
Research (ZonMw 9120.8026, NWO ALW 818.02.001) and the EURenOmics project from the
European Union seventh Framework Programme (FP7/20072013, agreement nu 305608).
Action de Recherche Concerte (ARC10/15-029, Communaut Franaise de Belgique); the
FNRS and FRSM; Inter-University Attraction Pole (IUAP, Belgium Federal Government); the
NCCR Kidney.CH program (Swiss National Science Foundation); the Gebert Rf Stiftung
(Project GRS-038/12); and the Swiss National Science Foundation 310030-146490.

Patients
All patients in this study were diagnosed with hypomagnesemia and were screened by
the DNA diagnostics department of the Radboudumc Nijmegen for hypomagnesemia
causing mutations. Informed consent for participation in research was obtained in
accordance with Institutional Review Board guidelines. Serum and urine electrolytes were
determined by general laboratory screenings. Laboratory findings of all patients are
presented in Table 1.
Mutation Analysis
Extraction of DNA from whole blood was performed using standard protocols. FXYD2
mutation screening was performed using polymerase chain reaction (PCR) primers
designed on the coding sequence of the human FXYD2 gene (NM_001680.4, NM_021603.3)
including exon/intron boundaries (13). Amplified sequences were separated on agarose
gel by electrophoresis and directly Sanger sequenced according to standard methods on
a 3730 Sequence Analyzer (Applied Biosystems). Mutation nomenclature is according to
HGVS using NM_001680.4 as a reference sequence.
Haplotype Analysis
Microsatellite markers D11S4092, D11S4127, D11S939, D11S1356 and D11S4195 encompassing
the FXYD2 gene on chromosome 11q23 were amplified by PCR using fluorescently labelled
108 | Chapter 4
primers. PCR products are denatured and analyzed on a 3730 Sequence Analyzer (Applied
Biosystems).
Genealogy Study
In-depth genealogical analysis was performed to identify common ancestors of FXYD2
patients. Lists of descendants from index patients were compiled and pedigrees were
generated using Dutch and Belgian civil registers and church books.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE, Rees
L, vant Hoff W, Marks SD, Trompeter RS, Tullus K, Winyard PJ, Cansick J, Mushtaq I, Dhillon HK,
Bingham C, Edghill EL, Shroff R, Stanescu H, Ryffel GU, Ellard S, Bockenhauer D. HNF1B mutations
associate with hypomagnesemia and renal magnesium wasting. J. Am. Soc. Nephrol. 20: 11231131, 2009.
Arystarkhova E, Sweadner KJ. Splice variants of the gamma subunit (FXYD2) and their significance in
regulation of the Na, K-ATPase in kidney. J. Bioenerg. Biomembr. 37: 381386, 2005.
Arystarkhova E, Wetzel RK, Sweadner KJ. Distribution and oligomeric association of splice forms of Na(+)K(+)-ATPase regulatory gamma-subunit in rat kidney. Am. J. Physiol. Renal Physiol. 282: F393407, 2002.
Cairo ER, Friedrich T, Swarts HGP, Knoers NV, Bindels RJM, Monnens LA, Willems PHGM, De Pont
JJHHM, Koenderink JB. Impaired routing of wild type FXYD2 after oligomerisation with FXYD2-G41R might
explain the dominant nature of renal hypomagnesemia. Biochim. Biophys. Acta 1778: 398404, 2008.
de Baaij JHF, Hoenderop JGJ, Bindels RJM. Regulation of magnesium balance: lessons learned from human
genetic disease. Clin kidney j 5: i15i24, 2012.
Ferr S, de Baaij JHF, Ferreira P, Germann R, de Klerk JBC, Lavrijsen M, van Zeeland F, Venselaar H,
Kluijtmans LAJ, Hoenderop JGJ, Bindels RJM. Mutations in PCBD1 cause hypomagnesemia and renal
magnesium wasting. J. Am. Soc. Nephrol. 25: 574586, 2014.
Ferr S, Veenstra GJC, Bouwmeester R, Hoenderop JGJ, Bindels RJM. HNF-1B specifically regulates the
transcription of the a-subunit of the Na+/K+-ATPase. Biochem. Biophys. Res. Commun. 404: 284290, 2011.
Geven WB, Monnens LA, Willems HL, Buijs WC. Renal magnesium wasting in two families with autosomal
dominant inheritance. Kidney international, 1987.
Huang C-L, Kuo E. Mechanism of hypokalemia in magnesium deficiency. J. Am. Soc. Nephrol. 18: 26492652,
2007.
Lameris AL, Monnens LA, Bindels RJ, Hoenderop JGJ. Drug-induced alterations in Mg2+ homoeostasis.
Clin. Sci. 123: 114, 2012.
Martin KJ, Gonzlez EA, Slatopolsky E. Clinical consequences and management of hypomagnesemia. J.
Am. Soc. Nephrol. 20: 22912295, 2009.
Meij IC, Koenderink JB, De Jong JC, De Pont JJHHM, Monnens LAH, Van Den Heuvel LPWJ, Knoers
NVAM. Dominant isolated renal magnesium loss is caused by misrouting of the Na+,K+-ATPase
gamma-subunit. Ann. N. Y. Acad. Sci. 986: 437443, 2003.
LA, van den Heuvel LP, Knoers NV. Dominant isolated renal magnesium loss is caused by misrouting of the
Na(+),K(+)-ATPase gamma-subunit. Nat. Genet. 26: 265266, 2000.
Meij IC, Saar K, van den Heuvel L. Hereditary isolated renal magnesium loss maps to chromosome 11q23.
The American Journal of (1999). doi: 10.1086/302199.
Mishra NK, Peleg Y, Cirri E, Belogus T, Lifshitz Y, Voelker DR, Apell H-J, Garty H, Karlish SJD. FXYD
proteins stabilize Na,K-ATPase: amplification of specific phosphatidylserine-protein interactions. J. Biol. Chem.
286: 96999712, 2011.
Richette P, Ayoub G, Lahalle S, Vicaut E, Badran A-M, Joly F, Messing B, Bardin T. Hypomagnesemia
associated with chondrocalcinosis: a cross-sectional study. Arthritis Rheum. 57: 14961501, 2007.
Yang L, Frindt G, Palmer LG. Magnesium modulates ROMK channel-mediated potassium secretion. J. Am.
Soc. Nephrol. 21: 21092116, 2010.
112 | Chapter 5
Abstract
Hypomagnesemia is a common clinical cause of muscle cramps, epilepsy and cardiac
arrhythmias. Regulation of the body magnesium (Mg2+) balance is of critical importance
and is largely regulated by the kidney and the intestine. In the distal convoluted tubule
(DCT) of the kidney, a transcellular reabsorption process determines the final urinary Mg2+
excretion. The basolateral Mg2+ extrusion mechanism in DCT is still unknown, but recent
findings suggest that proteins of the SLC41 family may contribute to cellular Mg2+
extrusion. The aim of this study was, therefore, to characterize the role of SLC41A3 in Mg2+
homeostasis using the Slc41a3 knockout mouse.

To this end, a tissue expression screening was performed by RT-PCR, showing that
Slc41a3 is the only SLC41 isoform with enriched expression in DCT compared to other
segments in the kidney. Interestingly, serum and urinary electrolyte determinations
demonstrated that Slc41a3 knockout mice suffer from hypomagnesemia with renal Mg2+
wasting. Serum and urinary sodium, potassium and calcium levels were not affected. To
determine the effect of SLC41A3 on intestinal Mg2+ absorption, the Mg2+ absorption
capacity was measured using the stable 25Mg2+ isotope. 25Mg2+ uptake was similar in wild
type and knockout mouse, although Slc41a3 knockout animals exhibited increased
intestinal expression of Mg2+ transporters Trpm6 and Slc41a1. Remarkably, 10% of the
Slc41a3 knockout mice developed severe unilateral hydronephrosis, as demonstrated by
the presence of transitional epithelium lining the fluid cavity. Feeding the Slc41a3 knockout
mice a low Mg2+ diet may have instigated the formation of hydronephrosis.
In conclusion, SLC41A3 was established as a new important factor for renal Mg2+
handling. In the future, SLC41A3 mutations should be considered in patients with unilateral
hydronephrosis and/or hypomagnesemia.
Keywords: Hypomagnesemia, Kidney, Hydronephrosis, Distal Convoluted Tubule
Hypomagnesemia in SLC41A3 KO Mice | 113
Introduction
The distal convoluted tubule (DCT) is essential for magnesium (Mg2+) homeostasis (4).
Although only 10 % of the filtered Mg2+ is reabsorbed in this segment of the kidney, it
determines the final urinary Mg2+ excretion since no reabsorption takes place beyond this
segment. In the DCT, Mg2+ enters the cell via the Transient Receptor Potential Melastatin
type 6 (TRPM6) divalent cation channel (31), while the basolateral Mg2+ extrusion
mechanism remains to be identified. Disturbances in this latter process result in
hypomagnesemia, which is characterized by a variety of clinical symptoms including
cardiac arrhythmias, muscle cramps and fatigue (4). Additionally, drugs affecting the DCT
such as epidermal growth factor receptor inhibitors, calcineurin inhibitors and diuretics
may reduce blood Mg2+ levels (15). Therefore, understanding the molecular mechanism
underlying Mg2+ reabsorption in the DCT is of major importance for the treatment of
patients with hypomagnesemia.

In a recent transcriptome screening study, Solute carrier family 41 member 3 (Slc41a3)
was identified as highly regulated by dietary Mg2+ intake (3). In this study, mice were fed
with various Mg2+-containing diets after which DCT segments were isolated. Using a
quantitative gene expression microarray, the Mg2+-sensitive genes in the DCT were
identified. Slc41a3 was among the genes with increased expression in response to a
Mg2+-deficient diet.

SLC41A3 was originally described by Quamme and colleagues as part of the solute
carrier family 41 of putative Mg2+ transporters (22). Although SLC41A3 has never been
studied in detail, few studies have addressed the structure, regulation and function of its
close homologue SLC41A1 (52 % identity at amino acid level)(12, 13, 17). There is controversy
about the structure of SLC41A1; some groups support a 10 transmembrane domain
structure, while others suggest 11 transmembrane domains with an extracellular
C-terminus (17, 28). On the functional level, initial experiments in Xenopus laevis oocytes
demonstrated Mg2+ currents for SLC41A1 and SLC41A3 using physiological Mg2+
concentrations, proposing a channel-like function (5, 22). Indeed, SLC41 proteins posses
conserved pore regions with the MgtE bacterial Mg2+ channel (9, 17, 32). In contrast, recent
experiments using Mg2+-sensitive fluorescent probes showed Na+-dependent Mg2+
transport, suggesting that SLC41A1 may be the long-sought Na+/Mg2+-exchanger (13, 14).
Interestingly, an exon-skipping mutation in SLC41A1 resulted in a nephronophthisis-like
phenotype in a patient eventually requiring renal transplantation (10). Whether SLC41A3
may have a similar function as SLC41A1 has never been examined. However, in contrast to
Slc41a3, Mg2+-sensitive regulation of Slc41a1 expression was not observed in the DCT
transcriptome study (3).

The aim of the present study was to characterize the role of SLC41A3 in renal and
intestinal Mg2+ (re)absorption. Slc41a3 knockout mice (Slc41a3-/-) were analyzed for ion
homeostasis and kidney development. Furthermore, by challenging the mice with low
114 | Chapter 5
Mg2+ diets the compensatory mechanisms in intestine, kidney and brain were examined
in detail. Using the 25Mg isotope, intestinal Mg2+ uptake studies were performed to
determine the role of SLC41A3 in the intestine.
Results
Expression Profile of Slc41 Isoforms
To examine the role of the SLC41 protein family in DCT Mg2+ transport, a tissue expression
screening for Slc41a1, Slc41a2 and Slc41a3 was performed using RT-PCR (Figure 1). All three
isoforms showed a ubiquitous expression pattern. High Slc41a1 expression was detected
in brain, heart and lung, Slc41a2 was mostly expressed in the early intestine and Slc41a3
expression was highest in heart, lung and small intestine. However, in RT-PCR analysis of
isolated DCT tubules Slc41a3 transcript levels showed an impressive 10-fold enrichment
compared to total kidney mRNA. Slc41a1 and Slc41a2 expression was not enriched in DCT
compared to other segments; the latter was even significantly decreased, suggesting that
SLC41A3 is the most relevant SLC41 family member for Mg2+ transport in DCT.
Slc41a3 Mouse Breeding

To examine the function of SLC41A3 in Mg2+ homeostasis, Slc41a3-/- mice were generated.
Breeding of Slc41a3+/- mice resulted in a normal Mendelian inheritance pattern in the
offspring. Of a total of 181 mice 32 % was genotyped Slc41a3+/+, 46 % Slc41a3+/- and 22 %
Slc41a3-/-. Since Shirpa screening by the Mouse Genetics Project reported abnormal
locomotor coordination of Slc41a3-/- mice fed with a high fat diet (MGI: 1918949)(35),
special attention to behavioral observations was given during the breeding procedure.
However, no abnormalities in behavior of the mice including ataxia and locomotor
behavior were observed. By visual inspection, it was not possible to distinguish between
Slc41a3+/+, Slc41a3+/- and Slc41a3-/- mice based on behavior or phenotype. All offspring was
genotyped for the insertion of the KO cassette and presence of the wild type Slc41a3 allele
(Figure 2B). To confirm KO of Slc41a3 -galactose stainings were performed, taking
advantage of the insertion of the LacZ cassette in the Slc41a3 gene in the Slc41a3-/- mice.
Indeed, LacZ staining was only observed in Slc41a3-/- mice (Figure 2C).
Hypomagnesemia in Slc41a3-/- Mice

To investigate the role of SLC41A3 in Mg2+ homeostasis, mice were subjected to normal or
low Mg2+-containing diets for 14 days. Blood, urine and feces were collected at day 0 and
day 14 of the experiment using metabolic cages (Figure 3A). At the end of the experiment
the mice were sacrificed and tissues were collected for further analysis. No significant
differences were observed between the body weights of Slc41a3+/+ mice and Slc41a3+/and Slc41a3-/- littermates (Table 1). Food and water intake, urinary volume and fecal excretion
T
DC
ey
Ki
To
t
*
DC
10
T
DC
dn
ey
Ki
To
t
al
Ki
dn
Ea
rly
L a du K i d
te o d n
du en e y
o d um
en
um
J Il e
E a eju u m
r l y nu
La co m
te l o n
co
Ce l o n
cu
m
Br
a
H e in
a
Lu r t
n
Liv g
Sp e r
le
M en
us
cl e
10
al
Ea
rly
L a du K i d
te o d n
du en e y
o d um
en
um
J Il e
E a eju u m
r l y nu
La co m
te l o n
co
Ce l o n
cu
m
Br
a
H e in
a
Lu r t
n
Liv g
Sp e r
le
M en
us
cl e
al
10
10
15
ey
20
20
15
10
To
t
Ea
30
30
15
dn

10
40

(% of Total)
20
40

(% of Total)
30
rly
L a du K i d
te o d n
du en e y
o d um
en
um
J Il e
E a eju u m
r l y nu
La co m
te l o n
co
Ce l o n
cu
m
Br
a
H e in
a
Lu r t
n
Liv g
Sp e r
le
M en
us
cl e

(% of Total)
40


Figure 1 S lc41a3 Expression is Enriched in the Distal Convoluted Tubule (DCT)

A-F, mRNA expression levels of Slc41a1 (A-B), Slc41a2 (C-D) and Slc41a3 (E-F) in a panel of mouse
tissues (A,C,E) and in COPAS-sorted DCT cells (B,D.F) were measured by quantitative RT-PCR and
normalized for Gapdh expression. Data represent the mean of three individual experiments SEM
and are expressed as the percentage of the total tissue expression (A,C,E) or enriched compared to
total kidney expression (B,D,F). *P < 0.05 indicates a significant difference from total kidney expression.
were comparable among all mice on the same diet (Table 1). On the normal diet, Slc41a3-/mice serum Mg2+ concentrations were significantly decreased by 29 %(2 %) compared
to Slc41a3+/+ mice (Figure 3B). 24hrs urinary Mg2+ excretion was not significantly different,
suggesting a renal Mg2+ leak in Slc41a3-/- mice (Figure 3C). Interestingly, both serum and
urine Ca2+ levels were not significantly altered compared to Slc41a3+/+ mice, underlining
116 | Chapter 5
A
5arm
bp
Slc41a3
SA
+/+
IRES
Slc41a3
+/-
lacZ pA
Slc41a3
-/-
hBactP neo pA
6 7
exon 5
3arm
805
524
Figure 2 C
haracteristics of the Slc41a3-/- Mouse
A, Targeted insertion of the knockout (KO) cassette. Top: Slc41a3 locus on chromosome 6. Bottom:
targeted allele in which the KO cassette is inserted before exon 5. Grey boxes indicate exons; black
triangles depict LoxP sites; white triangles depict Flp sites; arrows depict genotype primers (AC).
SA: splice acceptor, IRES: interinal ribosome entry site, lacZ: -galactosidase, pA: polyA, hBactP:
promoter, neo: neomycin resistance gene. B, Identification of the mouse genotype by PCR analysis
of ear-derived DNA. The PCR product size 530 bp shows the presence of the wild-type allele (+/+)
using primers A and C; the PCR product sized 800 bp shows the KO allele (/) using primers B and C.
Both alleles are detected in heterozygous animals (+/). C, -galactosidase staining of Slc41a3-/- mice.
the specificity of the hypomagnesemia in these Slc41a3-/- mice (Figure 3D-E). Slc41a3+/+
mice fed a Mg2+-deficient diet for two weeks, displayed hypomagnesemia (serum Mg2+
levels of 0.43 0.04 mmol/L, Figure 3B). Although the serum Mg2+ levels of Slc41a3-/- mice
on a low Mg2+ diet were even lower (0.32 0.02 mmol/L), they did not reach a significant
difference compared to Slc41a3+/+ mice (p=0.14). On the low Mg2+ diet, no differences in
urinary Mg2+ and Ca2+ excretion or serum Ca2+ concentrations were measured among
the groups (Figure 3C-E).
Hydronephrosis in a Subset of Slc41a3-/- Mice

Interestingly, in several male Slc41a3-/- mice on the low Mg2+ diet a severely increased
kidney size was observed in the left kidney caused by a hydronephrosis (Figure 4A). The
kidney volume was 6-8 fold higher than the other kidney of the same animal and caused
a serious organ rearrangement in the peritoneal cavity. The hydronephrotic kidney was
unilateral and was observed in 10 % of the Slc41a3-/- mice in the low Mg2+ group and
was never detected in Slc41a3-/- mice fed the normal Mg2+ diet. To further assess the
morphology of the hydronephrosis, the kidney tissue was stained using standard
hematoxylin and eosin (H&E) stainings (Figure 4B, left image). The presence of transitional
epithelium around the dilated tissue and the absence of dilated ureters suggest that the
origin of the hydronephrosis is located in the renal calyx or renal pelvis. Indeed, umbrella
-2
Diets : Normal vs. Low Mg
2+
10
12
-containing diets
MC
MC
Blood
0. 5
w
Lo
M
al
g 2+
g 2+
g 2+
w
Lo
al
g 2+
0. 0
0. 5
1. 0
Lo
1. 5
rm
g 2+
al
rm
No
2. 0
No
g 2+
M
2. 5
Serum Ca2+ (mM)
No
20
Lo
rm
al
g 2+
0. 0
40
rm
1. 0
60
No
Serum Mg2+ (mM)
g 2+
1. 5
Mg2+ excretion (mol/24hrs)
Blood
Ca2+ excretion (mol/24hrs)
14
Figure 3 S lc41a3-/- Mice Suffer from Isolated Hypomagnesemia

A, Slc41a3+/+, Slc41a3+/-, Slc41a3-/- mice were randomly assigned to the low or normal Mg2+ group
(n=10). Subsequently, mice were fed with the Mg2+ diets for 14 days of which the animals were
housed in metabolic cages during the last 48 hrs for urine and feces sampling (24 hrs adaptation,
24 hrs sampling). At the end of the experiments, the animals were sacrificed and blood and organs were taken for further analysis. B-E, Serum Mg2+ (B) and Ca2+ (D) concentrations at day 14
of Slc41a3+/+ (black bars), Slc41a3+/- (grey bars) and Slc41a3-/- (white bars) mice fed with a low or
normal Mg2+-containing diet for 14 days. 24 hrs urinary Mg2+ (C) and Ca2+ (E) excretion at day 14 of
Slc41a3+/+ (black bars), Slc41a3+/- (grey bars) and Slc41a3-/- (white bars) mice fed with a low or normal
Mg2+-containing diet for 14 days. Values are presented as means SEM (n=10). *P < 0.05 is considered statistically significant compared to Slc41a3+/+ mice fed the same diet.
cells were detected to further confirm the urothelial origin of the tissue (Figure 4B, middle
image). However, major parts of the tissue lining the fluid-filled cavity were not covered
with transitional epithelium, but existed of fibrous connective tissue. The ureter was filled
with large cells that possibly obstructed the flow (Figure 4B, right image). Subsequently,
the presence of Ca2+ deposits was examined to exclude urolithiasis as cause for the
hydronephrosis. By alizarin red stainings, Ca2+ deposits were not detected in the ureter or
18.0 2.1
20.5 2.1
3.97 0.50
4.95 1.23
1.86 0.38
1.25 0.31
152 1
4.45 0.08
185 13
539 26
Weight day 0 (g)
Weight day 14 (g)
Food intake (g)
Water intake (mL)
Feces weight (g)
Urine volume (mL)
Serum [Na+] (mmol/L)
Serum [K+] (mmol/L)
Urine Na+ (mol/24hrs)
Urine K+ (mol/24hrs)
538 39
184 20
4.59 0.08
150 1
1.12 0.37
1.94 0.39
4.98 1.13
4.26 0.23
20.5 1.9
18.4 1.6
562 25
214 11
4.54 0.10
153 1
1.22 0.29
2.09 0.22
4.77 0.88
4.43 0.28
20.2 2.5
17.5 2.2
559 39
204 13
4.15 0.15
152 0
1.53 0.66
0.34 0.12
4.00 0.82
3.46 0.52
19.8 2.6
18.4 2.1
Slc41a3+/+
Slc41a3-/-
Slc41a3+/+
Slc41a3+/-
Low Mg2+ diet
Normal Mg2+ diet
460 46
169 17
4.43 0.08
152 0
1.61 0.54
0.38 0.08
4.65 1.12
3.56 0.42
20.3 2.4
18.7 2.0
Slc41a3+/-
502 69
176 26
4.76 0.09
153 0
1.46 0.48
0.34 0.13
4.03 0.61
3.76 0.56
19.1 3.3
17.7 3.2
Slc41a3-/-
Slc41a3+/+, Slc41a3+/- and Slc41a3-/- mice were kept at normal diets or Mg2+-deficient (<0.02 % (w/w)) diets for 14 days. During the last 48 hrs the mice were kept
in metabolic cages to collect urine and feces. Values represent the measurements of the last 24 hrs.
Table 1 M
etabolic Parameters of Slc41a3-/- mice
118 | Chapter 5
Surface of cavities (mm2)
5
4
3
2
1
0
Slc41a 3+/+
Slc41a 3/
Figure 4 S lc41a3-/- Mice Develop Hydronephrosis on Low Mg2+ Diets

A, Images of hydronephrotic kidneys found in 2 out of 20 of Slc41a3-/- mice fed with low Mg2+ diets.
B, Hematoxylin and eosin stain of the hydronephrosis kidney detected in Slc41a3-/- mice showing
transitional epithelium lining the hydronephrosis. The left image gives an overview of the total
kidney (bar: 1 mm). The middle image shows the transitional epithelium with a black arrow indicating the umbrella cells (bar: 20 m). The right image indicates that the ureter is filled with large
cells, which potentially cause obstruction (bar: 20 m). C, Alizarin red staining of the hydronephrosis
kidney did not show Ca2+ deposits in ureter, only minor Ca2+ stains in the connective tissue surrounding the hydronephrosis (bar: 200 m). D, Hematoxylin and eosin stain of normal kidney tissue
from Slc41a3-/- mice fed with normal Mg2+ demonstrating venal en tubular dilations (left image bar:
100m, right image bar: 20 m). E, Quantification of dilated surface in Slc41a3+/+ and Slc41a3-/- mice.
Values are presented as means SEM (n=10).
120 | Chapter 5
remnant kidney of the Slc41a3-/- mouse with hydronephrosis, only small deposits were
present in the connective tissue lining the cavity (Figure 4C). To assess whether more
initial stages of the development of the hydronephrosis could be detected, kidneys from
Slc41a3-/- mice fed with the normal Mg2+ diet without apparent abnormalities at the
exterior of the kidney were stained using a standard hematoxylin and eosin stain (Figure
4D). Small tubular and venal dilations were observed in the cortex and medulla of
Slc41a3+/+ and Slc41A3-/- mice. Quantification of the surface size of these dilations did not
show differences between kidneys from Slc41a3+/+ and Slc41A3-/- mice, suggesting that
these dilations are non-pathogenic (Figure 4E).
Increased Colonic Expression of Mg2+ Transporters in Slc41a3-/- Animals

To examine the compensatory mechanisms for the renal Mg2+ wasting in Slc41a3-/- mice,
the expression of renal Mg2+ transporters was analyzed using RT-PCR (Figure 5).
Interestingly, the renal transcript levels of Trpm6, Slc41a1, Cnnm2 and parvalbumin were not
significantly different between Slc41a3+/+ and Slc41a3-/- mice (Figure 5A-D). Renal Slc41a1
expression was significantly increased in the low Mg2+ diet fed mice compared to mice in
the normal Mg2+ fed group for all genotypes (Figure 5B). Furthermore, the renal mRNA
levels of Egf, Ncc, Cldn16 and Cldn19 were not significantly altered in Slc41a3-/- mice in
comparison with their wild type littermates (Figure 5E-H).
Subsequently, the expression of Mg2+ transporters in the colon was examined by
RT-PCR. In particular in the low Mg2+ groups, gene expression levels of Slc41a1, Cnnm4 and
Trpm7 were significantly increased in the colon of Slc41a3-/- animals compared to colon of
their wild-type littermates (Figure 6). In contrast, no difference in colonic Trpm6 expression
was detected between Slc41a3+/+ and Slc41a3-/- mice.
Since Slc41a3 was also expressed in brain (Figure 1) and SLC41A1 is associated with
Parkinsons disease (14, 25, 34), expression levels of Trpm7 and Slc41a1 in the brain were
measured by RT-PCR. No significant changes in brain mRNA expression levels of Trpm7
and Slc41a1 were observed among the genotypes (Figure 7). However, brain Trpm7 and
Slc41a1 transcript levels were significantly increased in the low Mg2+ diet groups compared
to mice on the normal Mg2+ diet.
Intestinal Absorption is the Similar in Slc41a3+/+ and Slc41a3-/- Mice

To further establish the intestinal function in Slc41a3-/- mice, the intestinal Mg2+ absorption
capacity was determined using the stable 25Mg2+ isotope. The mice were subjected to 10
days of low Mg2+ diets prior to the Mg2+ absorption analysis. At the day of the experiment,
the mice were administrated 25Mg2+ by oral gavage and subsequently blood was taken
from the tail up to 60 min after the administration. The natural abundance of 25Mg2+ in
blood is 10 %, which is enriched by more than 100 % during 60 min of 25Mg2+ uptake to
more than 20 % (Figure 8A). However, no significant differences in Mg2+ absorption were
detected between Slc41a3+/+ and Slc41a3-/- mice (Figure 8A). Determination of the mRNA
al
g 2+
M
M
M
0. 5
0. 0
g 2+
M
w
Lo
al
rm
No
w
Lo
Lo
rm
No
1. 0
g 2+
1. 5
g 2+
0. 0
2. 0
0. 5
M
al
1. 0
g 2+
g 2+
0. 0
g 2+
1. 5
g 2+
Lo
rm
No
0. 5
2. 0
2. 5
1. 0
w
Lo
rm
al
g 2+
0. 0
Kidney Egf mRNA expression

(fold change compared to +/+)
0. 5
Kidney Cldn19 mRNA expression

1. 0
1. 5
g 2+
g 2+
1. 5
al
Lo
0. 5
g 2+
1. 0
2. 0
rm
1. 5
Lo
rm
al
g 2+
M
al
rm
No
0. 5
Kidney Parv mRNA expression

1. 0
No
1. 5
No
Kidney Cldn16 mRNA expression

Lo
2. 0
No
Kidney Ncc mRNA expression
al
rm
No
Kidney Cnnm2 mRNA expression
g 2+
g 2+
0. 5
g 2+
1. 0
Kidney Slc41a1 mRNA expression

(fold change compated to +/+)
1. 5
Kidney Trpm6 mRNA expression

Figure 5 C
ompensatory Mechanisms for the Loss of Slc41a3 Function in the Kidney
A-H, The mRNA expression levels of Trpm6 (A), Slc41a1 (B), Cnnm2 (C), Parvalbumin (D), Egf (E), Ncc
(F), Cldn16 (G) and Cldn19 (H) in kidney of Slc41a3+/+ (black bars), Slc41a3+/- (striped bars) and Slc41a3-/(white bars) mice fed with a low or normal Mg2+-containing diet for 14 days were measured by
quantitative RT-PCR and normalized for Gapdh expression. Data represent means (n=10) SEM and
are expressed fold difference when compared to the expression in normal diet fed Slc41a3+/+ mice.
*P < 0.05 indicates a statistically significance compared to Slc41a3+/+ mice fed the same diet.
1
0
3
2
1
w
Lo
w
No
Lo
rm
al
g 2+
g 2+
M
al
rm
g 2+
g 2+
* *
2
Lo
No
M
al
Lo
rm
al
rm
No
g 2+
g 2+
0. 0
g 2+
0. 5
g 2+
1. 0
No
Colon Slc41a1 mRNA expression

1. 5
Colon Trpm7 mRNA expression


Colon Cnnm4 mRNA expression

122 | Chapter 5
Figure 6 C
ompensatory Mechanisms for the Loss of Slc41a3 Function in the Intestine
A-D, The mRNA expression levels of Trpm6 (A), Slc41a1 (B), Cnnm4 (C) and Trpm7 (D) in colon of
Slc41a3+/+ (black bars), Slc41a3+/- (striped bars) and Slc41a3-/- (white bars) mice fed with a low or
normal Mg2+-containing diet for 14 days were measured by quantitative RT-PCR and normalized
for Gapdh expression. Data represent means (n=10) SEM and are expressed fold difference when
compared to the expression in normal diet fed Slc41a3+/+ mice. *P < 0.05 indicates a statistically
significance compared to Slc41a3+/+ mice fed the same diet.
al
rm
g 2+
M
g 2+
M
w
Lo
No
rm
al
g 2+
Lo
g 2+
p=0.06
Trpm7 mRNA expression
No
Figure 7 B
rain Expression of Mg2+ Transporters
A-B, The mRNA expression levels of Trpm7 (A) and Slc41a1 (B) in brain of Slc41a3+/+ (black bars),
Slc41a3+/- (striped bars) and Slc41a3-/- (white bars) mice fed with a low or normal Mg2+-containing
diet for 14 days were measured by quantitative RT-PCR and normalized for Gapdh expression. Data
represent means (n=10) SEM and are expressed fold difference when compared to the expression in normal diet fed Slc41a3+/+ mice. *P < 0.05 indicates a statistically significance compared to
Slc41a3+/+ mice fed the same diet.
22
20
18
16
14
12
10
8
25
Mg2+ uptake (% of Total Mg2+)
24
10
20
30
40
50
60
3
2
1
Sl c
41
a3
/+
Sl c
41
a3
4
3
2
1
0
Sl c
41
a3
Sl c
41
a3
Sl c
41
a3 +
/+
/+
/+
Sl c
41
a3 +
Sl c
41
a3 +
Colon Slc41a1 mRNA expression

(fold change compared to SLC41A3+/+)
Duodenum Slc41a1 mRNA expression

C
5
Sl c
41
a3 +

Duodenum Trpm6 mRNA expression

Time (min)
Figure 8 Increased Expression of Intestinal Mg2+ Transporters Compensate for Slc41a3 KO

A, 60 min intestinal 25Mg2+ absorption in Slc41a3+/+ (solid line) and Slc41a3-/- (dashed line) mice after
10 days on low Mg2+ diets, B-E, The mRNA expression levels of Trpm6 (B,D) and Slc41a1 (C,E) in duodenum (B-C) or colon (D-E) of Slc41a3+/+ and Slc41a3-/- mice fed with a low Mg2+-containing diet
for 10 days were measured by quantitative RT-PCR and normalized for Gapdh expression. Values
are presented as means SEM (n=10). *P < 0.05 is considered statistically significant compared to
Slc41a3+/+ mice.
124 | Chapter 5
expression levels of Trpm6 and Slc41a1 to examine the role of other Mg2+ transporters in
intestinal Mg2+ uptake showed that the expression of these genes was significantly
increased in both colon and duodenum of Slc41a3-/- mice (Figure 8B-E).
Discussion
This study identified SLC41A3 as a novel and essential player in Mg2+ homeostasis in
general and in particular in renal Mg2+ transport. This conclusion is based on the following
results: i) Slc41a3 is expressed in the kidney and intestine where Mg2+ is (re)absorbed;
ii) Slc41a3-/- mice suffer from hypomagnesemia and normomagnesiuria indicating a renal
Mg2+ leak; iii) Intestinal Mg2+ absorption is not altered in Slc41a3-/- mice; iv) Upregulation
of Mg2+ transporters including Trpm6 and Slc41a1 in the intestine of Slc41a3-/- mice
compensates for loss of SLC41A3 function.

The urine electrolyte levels in Slc41a3-/- mice point to a specific renal Mg2+ leak and
copies the phenotype of patients with renal Mg2+ wasting (7, 26, 33), namely low serum
Mg2+ levels accompanied by normal urinary Mg2+ excretion. Under normal physiological
circumstances, renal Mg2+ excretion is diminished to compensate reduced blood Mg2+
levels. However, the Slc41a3-/- mice failed to counteract their urinary Mg2+ excretion.
Additionally, the intestinal 25Mg2+ absorption after dietary Mg2+ deficiency was normal in
Slc41a3-/- mice, suggesting that the hypomagnesemia in Slc41a3-/- mice is indeed due to
renal Mg2+ wasting. The renal Mg2+ wasting in Slc41a3-/- mice can presumably be explained
by impaired DCT function. In kidney, Slc41a3 was, in contrast to its close homologue
Slc41a1, highly enriched in DCT. Likewise, the expression of Slc41a3, but not Slc41a1, in DCT
is highly dependent on dietary Mg2+ intake (3). These results are comparable to the
established findings concerning the Mg2+ channels TRPM6 and TRPM7. TRPM6 provides
the specific apical Mg2+ uptake mechanism in intestine and kidney (6, 30, 31). Hence, the
expression of TRPM6 is localized to the colon and the DCT and highly regulated by dietary
Mg2+ availability (6). In contrast, TRPM7 is ubiquitously expressed and is involved in basic
cellular Mg2+ handling (23, 27). Its expression is therefore insensitive to dietary Mg2+
changes (6). A comparable mechanism could apply to SLC41 proteins, in which SLC41A3
would be specific for epithelial Mg2+ uptake in colon and DCT and SLC41A1 would serve
as ubiquitously expressed general Mg2+ transporter.

The molecular function of SLC41A3 in DCT remains elusive. SLC41A3 activity has only
been examined in Xenopus laevis oocytes by voltage-clamp, showing Mg2+-evoked
currents with a Km within the physiological range (22). However, when overexpressed in
HEK293 cells Mg2+ currents could not be detected (unpublished data from our lab). The
function of the close homologue SLC41A1 has been examined in more detail. As SLC41A3,
SLC41A1 mediates Mg2+-evoked currents in Xenopus laevis oocytes (5). Moreover, its Mg2+
transport capacity was further established in the TRPM7-deficient DT40 cell line, where
SLC41A1 can restore cell growth (24). Importantly, recent data suggest that SLC41A1 acts
as a Na+/Mg2+-exchanger (13). If SLC41 proteins indeed function as basolateral Mg2+
exchangers, knockout of Slc41a3 in the DCT region would seriously reduce the extrusion of
Mg2+ across the basolateral membrane. As a consequence, intracellular Mg2+ concentrations
will increase, preventing transcriptional activation of magnesiotropic genes. This could
explain why the expression of DCT transcripts such as Trpm6, Egf and Parvalbumin were
not altered in Slc41a3-/- mice. Moreover, these genes are mainly involved in apical uptake
of Mg2+ and will, therefore, not be able to rescue the basolateral extrusion of Mg2+.
Although Slc41a3 is expressed in the small intestine, Slc41a3-/- mice exhibited normal
intestinal Mg2+ absorption compared to their wild type littermates. However, the expression
of Mg2+ transporters Slc41a1 and Trpm6 was increased in duodenum of Slc41a3-/- mice,
suggesting that loss of SLC41A3 function induces a compensatory mechanism to facilitate
normal Mg2+ uptake. Specifically, the upregulation of Slc41a1 is of interest because the
structure of SLC41A1 is largely similar to SLC41A3 (17). Importantly, the pore region of
SLC41A1 and SLC41A3 proteins is conserved from MgtE bacterial Mg2+ channels and
essential for their function (9, 17, 32). If the increased expression of Slc41a1 indeed
compensates for defects in intestinal Mg2+ absorption Slc41a3-/- mice, this would suggest
that SLC41A1 and SLC41A3 are functionally redundant. Future in vitro studies should
substantiate this hypothesis.

The development of hydronephrosis in Slc41a3-/- mice is one of the striking findings
of our study. H&E stainings showed transitional epithelia including umbrella cells lining
the hydronephrotic region, excluding a cystic origin of the kidney malformation (1).
However important parts of the lining tissue of the hydronephrosis were not covered
with transitional epithelium, but with a layer of fibrous connective tissue that normally
originates from the renal capsule. A similar phenotype of perinephric pseudocysts, in
which fluid accumulates in a fibrous sac surrounding the kidney, has been observed
previously in humans, mice and cats (2, 20, 21). In a previously described C57BL/6J mouse,
extensive histological analysis showed that unilateral perinephric pseudocyst can be
formed from an initial hydronephrosis that at some point ruptures when the integrity of
the lining wall is compromised (20). The urine may then leak into the subcapsular space
between the renal capsule and the remnant kidney. In concordance with these findings,
histological analysis of the Slc41a3-/- mice demonstrated both transitional epithelium and
connective tissue lining the cavity, suggesting that an initial hydronephrosis may have
ruptured resulting in a perinephric pseudocyst. However, the absence of transitional
epithelium may also be explained by atrophy due to the pressure of the hydronephrosis.
Future extensive histological studies should further address this issue.

Hydronephrosis is normally the consequence of obstruction of the ureter resulting in
fluid retention in the renal calyx and pelvis (19). The cause of the obstruction in Slc41a3-/mice could not be identified. Importantly, only a subset of the Slc41a3-/- mice developed
hydronephrosis, suggesting that Slc41a3-/- mice are more sensitive to the development of
126 | Chapter 5
hydronephrosis, but that knockout of SLC41A3 is not causative of hydronephrosis per se.
Speculatively, the dietary Mg2+ availability could have contributed to the development of
the hydronephrosis, since hydronephrosis was only detected in mice fed a Mg2+-deficient
diet. It is widely acknowledged that Mg2+ can prevent urolithiasis by reducing the
formation of calcium oxalate (CaC2O4) and calcium phosphate (Ca(H2PO4)2) stones and
deposits (8, 11, 29). Urolithiasis can cause obstruction of the ureter and, therefore, result in
hydronephrosis (16). However, alizarin red stainings did not show Ca2+ deposits in the
ureter of Slc41a3-/- mice on the low Mg2+ diet despite their extremely low urinary Mg2+
excretion. H&E stainings demonstrate the presence of large cells in the ureter that might
obstruct the flow of urine. Future studies should address the origin of these cells and
whether these cells are causing hydronephrosis in Slc41a3-/- mice.

Interestingly, a mutation of SLC41A1 was recently shown to be causative for a nephronophthisis-like (NPHP-like) phenotype in an Italian family (10). The kidneys of the patients
showed irregular echogenicity when examined by kidney ultrasonography (10), suggesting
kidney abnormalities such as renal cysts or hydronephrosis. However, hydronephrosis
could be excluded by subsequent histological analysis, which showed periglomerular
fibrosis, tubular ectasia, tubular basement membrane disruption and tubulointerstitial
infiltrations (10). The aforementioned signs of inflammation and fibrosis were absent in the
remnant kidney tissue of Slc41a3-/- mice. Moreover, in contrast to the NPHP-like phenotype
in SLC41A1 patients, the kidney size was markedly increased in the Slc41a3-/- mice that
suffered from hydronephrosis. More SLC41A1 patients should be identified and closely
examined for hydronephrosis to allow final conclusions on the kidney phenotype of these
patients.

In conclusion, SLC41A3 is novel player in renal and intestinal Mg2+ (re)absorption and
a new factor in the formation of hydronephrosis. Consequently, SLC41A3 should be
included in genetic screenings for hypomagnesemic patients. Future studies should
further investigate the interaction between Mg2+ homeostasis and the formation of
hydronephrosis.
Acknowledgements
The authors acknowledge the technical contributions of Karin de Haas-Cremers, Maikel
School, Hans Meijer, Caro Bos, Anke Hoefnagels, Stijn Elbers, Cas van der Made and Julia
van Tuijl. We thank Dr. Francisco Arjona-Madueo for stimulating discussions. This work
was supported by grants from the Netherlands Organization for Scientific Research
(ZonMw 9120.8026, NWO ALW 818.02.001, VICI 016.130.668), the EURenOmics project from
the European Union seventh Framework Programme (FP7/20072013, agreement nu
305608).
Methods
Expression Analysis
Three C57BL/6 mice were sacrificed; kidney, duodenum, ileum, jejunum, cecum, colon,
brain, lung, liver, spleen, muscle, and heart tissues were collected. For the collection of DCT
material, transgenic parvalbumin-eGFP mice were used as described previously (kind gift
from Dr. Monyer, University of Heidelberg, Germany)(18). In short, mice were anesthetized
by a mixture injection of domitor (0.01 mg/g of body weight) and ketamine (0.1 mg/g of
body weight). Subsequently, the mice were perfused with 10 mL of Krebs buffer (in
mmol/L: 145 NaCl, 5 KCl, 10 HEPES/NaOH pH 7.4, 1 NaH2PO4, 2.5 CaCl2, 1.8 MgSO4, 5 glucose)
through the heart. The kidneys were removed, minced, and digested in collagenase (1 mg/mL
collagenase A (Worthington, Lakewood, NJ, USA), 0.6 mg/mL hyaluronidase) in Krebs
buffer. The digested tubules sized between 40 and 100 m were sorted based on GFP
fluorescence by COPAS (Complex Object Parametric Analysis and Sorting, Union
Biometrica, Holliston, MA, USA). Per mouse, 4,000 eGFP-positive fluorescent DCT tubules
were collected, and an additional 4,000 control tubules were sorted from the same kidney
sample without selection for eGFP-positive cells.
RNA Isolation
Total RNA was isolated using TRIzol total RNA isolation agent (Invitrogen, Bleiswijk, the
Netherlands) according to the manufacturers protocol. Obtained RNA was treated with
DNase (Promega, Fitchburg, WI, USA) to remove genomic DNA. Subsequently, reverse
transcription of the mRNA by M-MLV reverse transcriptase (Invitrogen, Bleiswijk, the
Netherlands) was performed for 1 hr at 37 C.
Real Time PCR

Gene expression levels were determined by quantitative real-time PCR on a BioRad
(Hercules, CA, USA) analyzer using sybrgreen and normalized for Gapdh expression levels.
Primer sequences are provided in Table 2.
Animals
All experiments were performed in compliance with the animal ethics board of the
Radboud University Nijmegen. Heterozygous male and female (Slc41a3+/) mice of the Slc41a3tm1a(KOMP)Wtsi strain were purchased from Knock Out Mouse Project repository (KOMP,
Davis, CA, USA MGI: 1918949) and crossbred to C57Bl/6N wild-type mice. The heterozygous
offspring was used to generate Slc41a3/ mice. Littermates were housed in a temperatureand light-controlled room with standard pellet chow and deionized drinking water
available ad libitum.
128 | Chapter 5
Table 2 P
rimer Sequences for RT-PCR Analysis
Forward primer
Reverse primer
Gapdh
Slc41a1
5-CATCCCACACGCCTTCCTGC-3
5-CGGCTGGCCTGCACAGCCAC-3
Slc41a2
5-TGGCATGGTTTTGGACATAG-3
5-AGCGTCATTTCCAAGTTTCC-3
Slc41a3
5-TGAAGGGAAACCTGGAAATG-3
5-GGTTGCTGCTGATGATTTTG-3
Trpm6
Trpm7
5-GGTTCCTCCTGTGGTGCCTT-3
5-CCCCATGTCGTCTCTGTCGT-3
Cnnm2
5-GGAGGATACGAACGACGTG-3
5-TTGATGTTCTGCCCGTACAC-3
Cnnm4
5-TCTGGGCCAGTATGTCTCTG-3
5-CACAGCCATCGAAGGTAGG-3
Parvalbumin
5-CGCTGAGGACATCAAGAAGG-3
5-AGCTTTCAGCCACCAGAGTG-3
Egf
5-GAGTTGCCCTGACTCTACCG-3
5-CCACCATTGAGGCAGTATCC-3
Ncc
Cldn16
5-GTTGCAGGGACCACATTAC-3
5-GAGGAGCGTTCGACGTAAAC-3
Cldn19
5-GGTTCCTTTCTCTGCTGCAC-3
5-CGGGCAACTTAACAACAGG-3
Diet study
20 Slc41a3+/+, 20 Slc41a3+/- and 20 Slc41a3-/- mice aged between 8-12 weeks were randomly
selected for this experiment (50 % male, 50 % female). The animals were housed in
metabolic cages for 48 hrs (24 hrs adaptation, 24 hrs sampling) prior to collect urine and
feces. Subsequently, the mice were randomly divided to a group and fed with normal (0.19
% (wt/wt) Mg2+, SSNIFF Spezialitten GmbH, Soest, Germany) and low Mg2+ diets (0.02 %
(wt/wt) Mg2+, SSNIFF) (n=10 per group per genotype) for 14 days. Blood samples were
taken before and after the diets via submandibular facial vein puncture. The last 48 hrs of
the experiment the animals were housed in the metabolic cages again to collect urine
and feces. Then, animals were sacrificed, blood was collected and kidney, brain and colon
tissues were sampled and frozen immediately in liquid nitrogen for further analysis.
25Mg2+ Absorption Study
Intestinal absorption of Mg2+ was measured by analyzing serum 25Mg2+ as percentage of

total Mg2+. In short, 20 male animals aged 8-10 weeks (10 Slc41a3+/+, 10 Slc41a3-/-) were
fasted (food, not water) overnight on wire-mesh raised floors to prevent coprophagia. At
time-point 0, mice were administered a solution containing 44 mmol/L 25Mg2+ (MgO,
isotopic enrichment of > 98 %, CortectNet, Voisins-Le-Bretonneux, France), 125 mmol/L
NaCl, 17 mmol/L Tris/HCl pH 7.5, 1.8 g/L fructose. Animals were administered a volume of
15 uL/g bodyweight via oral gavage. Subsequently, blood was taken at serial time-points
via a small tail-cut and collected in Microvette serum tubes (Sarstedt, Etten-Leur, The
Netherlands). After serum collection from the coagulated blood samples, sera were
digested in nitric acid (65 % concentrated, Sigma, Zwijndrecht, The Netherlands) for 1 hr at
70 C followed by an overnight incubation at room temperature. Subsequently, samples
were diluted in milliQ and subjected to ICP-MS analysis (X1 series, Thermo Fisher Scientific,
Breda, The Netherlands).
Histology
After the sampling, the tissues specimens were immediately fixed in 4 % PFA (w/v) and
embedded in paraffin or frozen in liquid nitrogen. 5 mm sections were cut in embedding
media (Tissue-Tek, OCT medium, Sakura, Alphen aan den Rijn, The Netherlands), mounted
onto Superfrost Plus slides (Thermo Scientific, Menzel-Glaser, Braunschweig, Germany)
and stored at -20 C. Paraffin sections were deparaffinized and rehydrated and stained
with a hematoxylin and eosin (H&E) staining. Slides were put in hematoxillin and
differentiated in tapwater. Thereafter the slides were counterstained with eosin Y,
dehydrated and mounted. Pictures were made with a Zeiss (Oberkochen, Germany)
microscope.
-galactosidase Staining
Slides were pretreated for immunohistochemistry with 10 mmol/L sodium citrate.
Endogen peroxidase was blocked with 0.3 % (v/v) H2O2 and endogen biotin was blocked
with avidin-biotin (Vector Laboratories, SP-2001, Burlingame, CA, USA). Rabbit anti-NCC
antibody (1:2000;, Millipore, Darmstadt, Germany) was incubated ON in 1 % (w/v) BSA in
PBS and labeled with goat anti-rabbit-biotin-SP secondary antibody and coupled to
horseradish peroxidase (HRP). NCC was visualized with 3,3-Diaminobenzidine (DAB). To
visualize the LacZ insert in the Slc41a3-/- animals, tissue was rinsed in PBS containing 2
mmol/L MgCl2, thereafter the slides were incubated overnight with staining solution
containing 10 mg/mL 5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-gal, in dimethylformamide), 35 mmol/L potassium ferrocyanide, 35 mmol/L potassium ferricyanide,
2 mmol/L MgCl2, 0.01 % (w/v) deoxycholate and 0.02 % (v/v) NP40 in PBS. After incubation
slides were rinsed in PBS containing 2 mmol/L MgCl2, and mounted for analysis.
Alizarin Red Staining

Slides were pretreated for alizarin red staining with 50 % ethanol. Subsequently, cells were
stained with alizarin red (2 % (v/v)) for 5 min. After staining, the slides were rinced with
acetone and xylene and mounted for analysis.
Mg2+ and Ca2+ Measurements

Serum and urine total Mg2+ and Ca2+ concentrations were determined using a colorimetric
assay kit according to the manufacturers protocol (Roche Diagnostics, Woerden, The
Netherlands). Urine volume was measured to calculate 24 hrs excretion.
130 | Chapter 5
Data are expressed as mean SEM. Statistical comparisons were analyzed by two-way
ANOVA with a Tukeys multiple comparison test or by unpaired students t-test. P < 0.05
was considered statistically significant.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Bisceglia M, Galliani CA, Senger C, Stallone C, Sessa A. Renal Cystic Diseases: A REVIEW. Advances in
Anatomic Pathology 13: 2656, 2006.
Chew DJ, DiBartola SP, Schenck P. Canine and Feline Nephrology and Urology. Elsevier Health Sciences, 2010.
de Baaij JHF, Groot Koerkamp MJ, Lavrijsen M, van Zeeland F, Meijer H, Holstege FCP, Bindels RJM,
Hoenderop JGJ. Elucidation of the distal convoluted tubule transcriptome identifies new candidate genes
involved in renal Mg(2+) handling. Am. J. Physiol. Renal Physiol. 305: F156373, 2013.
Goytain A, Quamme GA. Functional characterization of human SLC41A1, a Mg2+ transporter with similarity
to prokaryotic MgtE Mg2+ transporters. Physiol. Genomics 21: 337342, 2005.
Groenestege WMT, Hoenderop JG, van den Heuvel L, Knoers N, Bindels RJ. The epithelial Mg2+ channel
transient receptor potential melastatin 6 is regulated by dietary Mg2+ content and estrogens. J. Am. Soc.
Nephrol. 17: 10351043, 2006.
Groenestege WMT, Thbault S, van der Wijst J, van den Berg D, Janssen R, Tejpar S, van den Heuvel LP,
van Cutsem E, Hoenderop JG, Knoers NV, Bindels RJ. Impaired basolateral sorting of pro-EGF causes
isolated recessive renal hypomagnesemia. J Clin Invest 117: 22602267, 2007.
Gyawali PR, Joshi BR, Gurung CK. Correlation of calcium, phosphorus, uric acid and magnesium level in
serum and 24 hours urine of patients with urolithiasis. Kathmandu Univ Med J (KUMJ) 9: 5456, 2011.
Hattori M, Tanaka Y, Fukai S, Ishitani R, Nureki O. Crystal structure of the MgtE Mg2+ transporter. Nature
448: 10721075, 2007.
Hurd TW, Otto EA, Mishima E, Gee HY, Inoue H, Inazu M, Yamada H, Halbritter J, Seki G, Konishi M, Zhou
W, Yamane T, Murakami S, Caridi G, Ghiggeri G, Abe T, Hildebrandt F. Mutation of the Mg2+ Transporter
SLC41A1 Results in a Nephronophthisis-Like Phenotype. J. Am. Soc. Nephrol. 24: 967977, 2013.
Kato Y, Yamaguchi S, Yachiku S, Nakazono S, Hori J-I, Wada N, Hou K. Changes in urinary parameters after
oral administration of potassium-sodium citrate and magnesium oxide to prevent urolithiasis. Urology 63:
711 discussion 112, 2004.
Schweigel M. SLC41A1 is a novel mammalian Mg2+ carrier. J. Biol. Chem. 283: 1623516247, 2008.
Kolisek M, Nestler A, Vormann J, Schweigel-Rntgen M. Human gene SLC41A1 encodes for the Na+/Mg2+
exchanger. American Journal of Physiology - Cell Physiology 302: C318C326, 2012.
Kolisek M, Sponder G, Mastrototaro L, Smorodchenko A, Launay P, Vormann J, Schweigel-Rntgen M.
Substitution p.A350V in Na+/Mg2+ Exchanger SLC41A1, Potentially Associated with Parkinsons Disease, Is a
Gain-of-Function Mutation. 8: e71096, 2013.
Lameris AL, Monnens LA, Bindels RJ, Hoenderop JGJ. Drug-induced alterations in Mg2+ homoeostasis.
Clin. Sci. 123: 114, 2012.
Lin EP, Bhatt S, Dogra VS, Rubens DJ. Sonography of Urolithiasis and Hydronephrosis. Ultrasound Clinics 2:
116, 2007.
Mandt T, Song Y, Scharenberg AM, Sahni J. SLC41A1 Mg 2+transport is regulated via Mg 2+-dependent
endosomal recycling through its N-terminal cytoplasmic domain. Biochem. J. 439: 129139, 2011.
Bindels RJM, Hoenderop JGJ. A primary culture of distal convoluted tubules expressing functional thiazide-sensitive NaCl transport. Am. J. Physiol. Renal Physiol. 303: F88692, 2012.
McDougal WS, Wein AJ, Kavoussi LR, Novick AC, Partin AW, Peters CA, Ramchandani P. Campbell-Walsh
Urology 10th Edition Review. Elsevier Health Sciences, 2011.
Meyerholz DK, Hostetter SJ. Unilateral perinephric pseudocyst secondary to hydronephrosis in a C57BL/6J
mouse. Vet. Pathol. 42: 496498, 2005.
Meyers MA. Uriniferous perirenal pseudocyst: new observations. Radiology 117: 539545, 1975.
Quamme GA. Molecular identification of ancient and modern mammalian magnesium transporters.
American Journal of Physiology - Cell Physiology 298: C407C429, 2010.
132 | Chapter 5
23. Runnels LW, Yue L, Clapham DE. TRP-PLIK, a bifunctional protein with kinase and ion channel activities.
Science 291: 10431047, 2001.
24. Sahni J, Scharenberg AM. The SLC41 family of MgtE-like magnesium transporters. Mol. Aspects Med. 34:
620628, 2013.
25. Satake W, Nakabayashi Y, Mizuta I, Hirota Y, Ito C, Kubo M, Kawaguchi T, Tsunoda T, Watanabe M,
Takeda A, Tomiyama H, Nakashima K, Hasegawa K, Obata F, Yoshikawa T, Kawakami H, Sakoda S,
Yamamoto M, Hattori N, Murata M, Nakamura Y, Toda T. Genome-wide association study identifies
common variants at four loci as genetic risk factors for Parkinsons disease. Nat. Genet. 41: 13031307, 2009.
Ristoff E, Dinour D, Syrrou M, Nielsen S, Sassen M, Waldegger S, Seyberth HW, Konrad M.
TRPM gene family. Nat. Genet. 31: 166170, 2002.
27. Schmitz C, Perraud A-L, Johnson CO, Inabe K, Smith MK, Penner R, Kurosaki T, Fleig A, Scharenberg
AM. Regulation of vertebrate cellular Mg2+ homeostasis by TRPM7. Cell 114: 191200, 2003.
28. Sponder G, Rutschmann K, Kolisek M. Inside-in or inside-out? The membrane topology of SLC41A1.
Magnesium Research 26: 176181, 2013.
29. Su CJ, Shevock PN, Khan SR, Hackett RL. Effect of magnesium on calcium oxalate urolithiasis. J. Urol. 145:
10921095, 1991.
30. van der Wijst J, Hoenderop JGJ, Bindels RJM. Epithelial Mg2+ channel TRPM6: insight into the molecular
regulation. Magnesium Research 22: 127132, 2009.
31. Voets T, Nilius B, Hoefs S, van der Kemp AWCM, Droogmans G, Bindels RJM, Hoenderop JGJ. TRPM6
forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J. Biol. Chem. 279: 1925,
2004.
32. Wabakken T, Rian E, Kveine M, Aasheim H-C. The human solute carrier SLC41A1 belongs to a novel
eukaryotic subfamily with homology to prokaryotic MgtE Mg2+ transporters. Biochem. Biophys. Res. Commun.
306: 718724, 2003.
RK, Carmi R, Sheffield VC. Mutation of TRPM6 causes familial hypomagnesemia with secondary
hypocalcemia. Nat. Genet. 31: 171174, 2002.
34. Yan Y, Tian J, Mo X, Zhao G, Yin X, Pu J, Zhang B. Genetic Variants in the RAB7L1 and SLC41A1 Genes of the
PARK16 Locus in Chinese Parkinsons Disease Patients. Int J Neurosci 121: 632636, 2011.
35. The Mouse Genome Database: integration of and access to knowledge about the laboratory mouse. Nucl.
Acids Res. 42: D8107, 2014.
136 | Chapter 6
Abstract
Recently, mutations in the Cyclin M2 (CNNM2) gene were identified to be causative for
severe hypomagnesemia. In kidney, CNNM2 is a basolaterally expressed protein with
predominant expression in the distal convoluted tubule (DCT). Transcellular magnesium
(Mg2+) reabsorption in DCT represents the final step before Mg2+ is excreted into the
urine, thus fine-tuning its final excretion via a tightly regulated mechanism.

The present study aims to get insight in the structure of CNNM2 and to characterize
its post-translational modifications. Here, membrane topology studies using intramolecular
epitopes and immunocytochemistry showed that CNNM2 has an extracellular amino
(N)-terminus and an intracellular carboxy (C)-terminus. This suggests that one of the
predicted transmembrane regions might be reentrant. By homology modeling we
demonstrated that the loss-of-function mutation as found in patients disturbs the
potential ATP binding by the intracellular cysthationine -synthase domains. In addition,
the cellular processing pathway of CNNM2 was exposed in detail. In the endoplasmic
reticulum, the signal peptidase complex cleaves off a large N-terminal signal peptide of
about 64 amino acids. Mutagenesis screening showed that CNNM2 is glycosylated at
residue p.Asn112 stabilizing CNNM2 on the plasma membrane. Interestingly, co-immunoprecipitation studies evidenced that CNNM2a forms heterodimers with the smaller
isoform CNNM2b.

These new findings on CNNM2 structure and processing may aid to elucidate the
physiological role of CNNM2 in Mg2+ reabsorption in the kidney.
Keywords: CNNM2, Magnesium, Distal Convoluted Tubule, Hypomagnesemia, Kidney
Molecular Characterization of CNNM2 Structure | 137
Introduction
As the second most abundant intracellular cation in humans, magnesium (Mg2+) constitutes
an essential co-factor in vital processes such as energy metabolism, DNA transcription
and protein synthesis. Balance between intestinal absorption and renal excretion is tightly
regulated to keep the plasma Mg2+ concentration in its physiological range (0.7-1.1
mmol/L) (7). Specifically, bulk Mg2+ reabsorption in kidney from the pro-urine is dependent
on passive, paracellular transport in the proximal tubule (PT) and the thick ascending limb
of Henles loop (TAL), whereas fine-tuning is achieved by active, transcellular transport in
the distal convoluted tubule (DCT) (7). In the latter segment, tight regulation of Mg2+
transport will determine the final urinary Mg2+ excretion, since no Mg2+ reabsorption
takes places beyond the DCT. The TRPM6 ion channel, expressed at the apical side of the
DCT, constitutes the gatekeeper in active Mg2+ uptake (37), whereas a basolateral Mg2+
extrusion mechanism remains to be identified.

Recently, mutations in the Cyclin M2 (CNNM2) gene were described leading to a
dominant form of hypomagnesemia caused by renal Mg2+ wasting (32). Patients suffer from
muscle weakness, tremor and headaches accompanied by low Mg2+ serum concentrations
(0.3-0.5 mmol/L) (21, 32). Interestingly, no other electrolyte disturbance was detected (32).
CNNM2, formerly known as Ancient Conserved Domain Protein 2 (ACDP2), belongs to the
CNNM family consisting of four proteins (CNNM1-4) which share homology to cyclins,
although no cyclin-related function has been described (40). Two predicted CNNM2 protein
isoforms are conserved between man and mouse. Whereas the 875 amino acid CNNM2a is
encoded by splice variant 1 (CNNM2v1, NM_017649), the 22 residues shorter isoform b is
translated from splice variant 2 (CNNM2v2, NM_199076), which lacks exon 6. CNNM2
expressed in Xenopus laevis oocytes and in the Mg2+-deficient Salmonella enterica strain
MM281, has been suggested to be involved in Mg2+ transport (8, 31). However, electro
physiological analysis using mammalian cells expressing CNNM2 showed Mg2+-sensitive
Na+ currents instead of Mg2+ currents (32). This last finding could indicate that instead of
transporting Mg2+ itself, CNNM2 might be involved in a Mg2+-sensing mechanism which, in
turn, could regulate renal Mg2+ uptake. At present, no studies have been reported showing
the structure of CNNM2, or any of the other CNNM family members.

The aim of this study was to elucidate the membrane topology of CNNM2 and to
provide a molecular characterization of the intracellular processing mechanisms.
Results
Expression Profile of the CNNM Family
To examine the transcript expression levels for Cnnm1-4 in various tissues, a mouse tissue
cDNA panel was constructed and Cnnm mRNA expressions were quantified by real-time
138 | Chapter 6
PCR analysis. Gapdh expression was used to normalize values. Cnnm3v1 and Cnnm3v2
(containing an alternative last exon) show a ubiquitous expression pattern with highest
expression in kidney, brain, lung, spleen and heart (Figure 1D-E). Cnnm1 expression is
predominantly found in brain and testis (Figure 1A), whereas Cnnm4 shows highest
expression along the gastrointestinal tract (Figure 1F). Interestingly, Cnnm2 shows a
ubiquitous expression pattern with highest expression in kidney, lung, spleen and testis
(Figure 1B-C). CNNM2A and CNNM2B (encoded by Cnnm2v1 and Cnnm2v2, lacking exon 6)
share a similar pattern; only minor differences between the tissue expression levels were
measured.
Since CNNM2 has been described to be causative for hypomagnesemia due to
excessive renal Mg2+ wasting (32), its kidney localization was investigated in detail. Using
immunohistochemistry, co-expression of CNNM2 with markers of different distal nephron
segments was examined: The Na+-K+-Cl--cotransporter (NKCC2, TAL), the thiazide-sensitive Na+-Cl--cotransporter (NCC, DCT), Calbindin-D28k (CaBP28K, CNT and cortical collecting
duct (CCD)) and Aquaporin-2 (AQP2, collecting duct, CD). CNNM2 was expressed on the
basolateral side of the cells (Figure 2A-D, green), opposed to the luminal expression of the
marker proteins (Figure 2A-D, red). CNNM2 immunopositive tubules were negative for
AQP2 staining, but did co-stain with NCC positive tubules. Only a part of the tubules
positive for CaBP28k showed CNNM2 staining. Whereas most of NKCC2 positive tubules are
negative for CNNM2, only a few NKCC2 positive tubules show faint CNNM2 staining. These
results indicate that CNNM2 is predominantly expressed in DCT. mRNA expression levels
measured by real-time PCR on GFP-sorted DCT and CNT tubules showed an equivalent
pattern; expression of Cnnm2v1 and Cnnm2v2 was high in DCT and to a lesser extent also
in the CNT (Figure 2E). As a control for DCT and CNT specificity of the mRNA, we examined
the expression of the transcripts for the marker proteins TRPM6 and TRPV5 respectively
(Figure 2E). These and previous results (32) indicate that CNNM2 is predominantly
expressed basolaterally in DCT and also, but minorly, present in TAL and CNT (Figure 2F).
CNNM2 Has an Intracellular C-terminus Containing CBS Domains

The consensus topology prediction for the plasma membrane protein CNNM2 indicates 5
potential transmembrane domains (TM) and an extracellular C-terminus (32), which would
locate the cystathionine -synthase (CBS) domains in an unprecedented, extracellular
position. We decided to investigate the topology in detail using an intramolecular epitope
strategy by expression of various epitope-tagged CNNM2 proteins (Figure 3A) in COS-7
cells with subsequent immunocytochemistry. A similar approach was used successfully to
aid in the topology determination of other plasma membrane transporters like multidrug
resistance proteins (17) and an iron transporter (6). Immunocytochemistry of cells
overexpressing CNNM2a proteins with HA-epitopes at positions 211 (HA211), 745 (HA745)
or at the extreme C-terminus revealed these proteins to be targeted to the plasma
membrane of the cells (Figure 3B, upper panels), similar to the results obtained in MDCK-C7
10
0
20
10
0
40
30
20
10
0
30
Du Kid
od ne
en y
um
I
Je leum
ju
nu
Co m
Ce lon
cu
m
Br
ain
Lu
ng
L
Sp iver
lee
Te n
s
M tis
us
cl
He e
ar
t
Cnnm3v2 mRNA Expression

(% of Total)
Du Kid
od ne
en y
um
I
Je leum
ju
nu
Co m
Ce lon
cu
m
Br
ain
Lu
ng
L
Sp iver
lee
Te n
s
M tis
us
cl
He e
ar
t

(% of Total)
30

(% of Total)
10
Du Kid
od ne
en y
um
I
Je leum
ju
nu
Co m
Ce lon
cu
m
Br
ai
Lu n
ng
L
Sp iver
lee
Te n
s
M tis
us
cl
He e
ar
t
20
20
10
0
Du Kid
od ne
en y
um
I
Je leum
ju
nu
Co m
Ce lon
cu
m
Br
ai
Lu n
ng
L
Sp iver
lee
Te n
s
M tis
us
cl
He e
ar
t
30
20
30
20
10
0
Du Kid
od ne
en y
um
I
Je leum
ju
nu
Co m
Ce lon
cu
m
Br
ai
Lu n
ng
L
Sp iver
lee
Te n
s
M tis
us
cl
He e
ar
t
40
30
(% of Total)
50
Du Kid
od ne
en y
um
I
Je leum
ju
nu
Co m
Ce lon
cu
m
Br
ain
Lu
ng
L
Sp iver
lee
Te n
s
M tis
us
cl
He e
ar
t
Cnnm1 mRNA Expression

(% of Total)
60
Cnnm4 mRNA Expression

(% of Total)
Figure 1 T issue Expression Pattern of the CNNM Isoform-encoding Transcripts

A-F, The mRNA expression levels of Cnnm1 (A), Cnnm2 splice variant 1 (B), Cnnm2 splice variant 2
(C), Cnnm3 splice variant 1 (D), Cnnm3 splice variant 2 (E) and Cnnm4 (F) in a panel of mouse tissues
were measured by quantitative RT-PCR and normalized for Gapdh expression. Data represent the mean
of 3 individual experiments SEM and are expressed as the percentage of the total tissue expression.
cells (32). Importantly, C-terminally HA-tagged CNNM2b showed a localization that is undistinguishable from that of CNNM2a, indicating that the absence of the amino acids
translated from exon 6 does not influence sorting to the plasma membrane.

To determine whether the epitopes are located on the inside or the outside of the
cells, formaldehyde fixed cells, both intact and permeabilized, were immunostained for
the HA-epitope. The HA-tag at position 211 could be detected on intact cells (Figure 3B,
lower panels), indicating extracellular localization. On the contrary, detection of HA745 or
140 | Chapter 6
CNNM2
NKCC2
merge
CNNM2
NCC
merge
CNNM2
CaBP
C
D
merge
28K
20 m
CNNM2
20 m
AQP2
merge
20 m
20 m
20 m
14
PT
12
mRNA Expression
(Fold over total)
20 m
10
DTL ATL TAL DCT CNT CD

NKCC2
NCC
TRPM6
TRPV5
CaBP
2
0
28K
AQP2
Total Kidney
DCT
CNT
CNNM2
Figure 2 K idney Expression Pattern of CNNM2 Shows Highest Expression in DCT

A-D, Double immunofluorescence staining of mouse kidney cortex sections for CNNM2 (in green)
and NKCC2 (A, red), NCC (B, red), Calbindin-D28k (C, red) or Aquaporin-2 (D, red). Bars represent
20 m. E, The mRNA expression levels of Cnnm2v1 (black bars), Cnnm2v2 (white bars), Trpm6 (red
bars) and Trpv5 (green bars) in COPAS selected mouse DCT, CNT and control (none-selected) k idney
tubules were measured by quantitative RT-PCR and normalized for Gapdh expression. Data represent
the mean of 3 individual experiments SEM and are expressed as fold difference compared to the
expression in none-selected tubules. F, A schematic overview of marker protein kidney expression.
PT: Proximal Tubule, DTL: descending thin limb of Henles loop, ATL: ascending thin limb of Henles loop,
TAL: Thick Ascending Limb, DCT: Distal Convoluted Tubule, CNT: Connecting Tubule, CD: Collecting Duct.
Figure 3 C
NNM2 Topology Determination
A, Linear representation of the CNNM2 protein with domain structures based on Uniprot Q3TWN3.
Predicted TM domains are indicated in dark blue, CBS domains in purple and the exon 6 coding region,
which is absent in CNNM2b, in gray. The position of the epitope tags and the epitope recognized by the
Abcam 111351 antibody are indicated by narrow and wide arrow heads, respectively. B-E, Immunofluorescence images of transiently transfected COS-7 cells. Bars represent 50 m in each panel. Red signal
represents immunodetected HA-epitopes. Nuclei stained with DAPI are shown in blue. B, Permeabilized
(upper panels) and intact (lower panels) cells expressing, from left to right: CNNM2a with an HA-tag at
positions 211, 745 or at the C-terminus and CNNM2b with a C-terminal HA-tag. C, Cells, expressing CNNM2a
with an HA-tag at position 211, were additionally stained with Ab111351 (in green) under permeabilized
and non-permeabilized conditions (upper and lower panels, respectively). D, Permeabilized (top)
and intact (bottom) cells transfected with C-terminally HA-tagged CNNM4. E, Cells transfected with
C-terminally FLAG-tagged CNNM2a with an intramolecular HA-epitope at position 25. Immuno
detection of permeabilized cells for the HA-tag (left), FLAG-tag (middle, in green) and the merged
image on the right are indicated.
142 | Chapter 6
Figure 3 C
ontinued
the epitope at the C-terminus required cell permeabilization, suggesting that these latter
two are located intracellularly. Similar results were obtained when living cells were
incubated with anti-HA antibodies prior to fixation (Figure 4).

As an alternative approach to confirm that the C-terminus is located intracellularly,
cells that expressed HA211 were immunostained with Abcam antibody 111351, raised
against amino acids 590-640, located just after the pair of CBS domains. Also here, the
epitope could only be detected after permeabilization (Figure 3C), indicative for an
intracellular position of the C-terminus that importantly includes the two CBS domains.

To investigate whether the intracellular localization of the C-terminus is shared with
other members of the CNNM family, the same permeabilization assay was performed on
cells transfected with C-terminally HA-tagged CNNM4 (Figure 3D). Again, the plasma
membrane staining was only observed after permeabilization, indicating that also for
CNNM4, the C-terminus resides inside the cell. In conclusion, the CNNM2 protein has a
membrane topology with its C-terminus inside of the cell.
The CNNM2 N-terminus Contains a Large Signal Peptide and

a Glycosylation Site
We observed that the HA-epitope at the extreme N-terminus or at position 25 of CNNM2a
was not detected at the plasma membrane, but rather in distinct perinuclear structures
(Figure 5), which suggested that the N-terminus might contain a signal peptide and,
therefore, ultimately results in cleavage of the HA-epitope. To exclude incorrect processing
of the recombinant protein, a construct was expressed with the HA-epitope at position 25
of CNNM2a and a FLAG-epitope at the C-terminus. We observed that the FLAG-epitope
was correctly targeted at the plasma membrane, but the HA-epitope was retained in
perinuclear structures (Figure 3E). Colocalization studies with an antibody against Calnexin
(Figure 5B) showed that these perinuclear structures are part of the endoplasmic reticulum
(ER), which is in line with the presence of a signal peptide.
Signal peptide prediction software (SignalP, (3)) predicts a long N-terminal signal
peptide of 64 amino acids. Examination of the N-terminally HA-tagged CNNM2 construct
by immunoblotting confirmed that the CNNM2 N-terminus is cleaved (Figure 6A, upper
panel), since the HA-tag was undetectable. Mutation of the predicted cleavage region
permeabilized
intact (labeling of living cells)
Figure 4 E pitope Labelling of Living Cells Confirms Results on Fixed Cells

COS7 cells transfected with CNNM2a expression constructs with a HA-tag at positions 211 (HA211),
745 (HA745) or at the C-terminus (C-HA) showed correct targeting to the plasma membrane as
demonstrated by immunostaining (in red) after formaldehyde fixation and permeabilization (upper
panels). Immunostaining of living COS7 cells for the HA-epitope before fixation resulted in detection
of HA211 only (lower panels). Nuclei stained with DAPI are shown in blue, size bar represents 50 m
in each panel.
(p.Gly62/p.Cys63/p.Thr64/p.Ala65) to hydrophobic residues (p.Leu62/p.Leu63/p.Leu64/

p.Val65) marred this cleavage event, evidenced by detection of a HA-positive band in the
mutant (Figure 6A, upper panel, right). To identify the exact cleavage site, constructs were
generated in which the p.Cys63/p.Ala65 and the p.Gly62/p.Thr64 positions were mutated
to hydrophobic amino acids. However, none of these two mutations were able to impair
the cleavage of CNNM2 (Figure 6A, upper panel).

To confirm that the signal peptidase complex (SPC, a protein complex expressed on
the ER-membrane known to be involved in signal peptide cleavage) facilitates cleavage,
an in vitro protein translation assay in presence of SPC inhibitor AAPV-CMK was performed.
SPC inhibition by AAPV-CMK prevented signal peptide cleavage, as shown by a higher
molecular weight on gel (MW, Figure 6B). Together, we conclude that SPC is responsible
for CNNM2 signal peptide cleavage.
In eukaryotic cells, trafficking of membrane proteins to the cell surface is often
regulated by glycosylation of asparagine residues present in extracellular domains. To
determine the CNNM2 glycosylation profile, four potential candidate asparagine residues
were mutated to alanine; namely p.Asn112, p.Asn327, p.Asn527 and p.Asn591 (based on
prediction software NetNGlyc 1.0, http://www.cbs.dtu.dk/services/NetNGlyc/). Subsequently,
the presence of N-linked glycans in the mutants was discerned by immunoblotting the
proteins after treatment with PNGase F, an enzyme causing N-glycan cleavage. The glyco-
144 | Chapter 6
Figure 5 T he CNNM2 N-terminus is Retained in the Endoplasmic Reticulum

A, COS7 cells transfected with CNNM2a expression constructs with an HA-tag at the N-terminus
(N-HA) or at position 25 without (HA25) or with (HA25-FLAG) an additional C-terminal FLAG-tag
were permeabilized and co-immunostained with anti-HA (in red) and anti-Calnexin (CNX, in green).
Merged images on the right show colocalization (in yellow) of the HA-tag with perinuclear parts
of the ER. B, The identical experiment as shown in the lower panel of (A), except for the omission of the
primary antibody anti-CNX, excluding cross-staining of the anti-HA antibody. Nuclei stained with
DAPI are shown in blue. Size bars represent 25 m in each panel.
sylated wild type CNNM2 runs at approximately 105 kDa, but PNGase F treatment reduced
its MW to 96 kDa (Figure 7A). Of all the candidates, only residue p.Asn112 was identified
as a glycosylation target in CNNM2, since the p.Asn112A mutation resulted in a MW of 96 kDa
(Figure 7A). PNGase F treatment did not cause a further reduction of the MW indicating
that no N-glycan is present in this mutant. To determine the effect of the N-glycan at
position 112 on membrane expression of the CNNM2 protein, cell surface biotinylation
studies of the p.Asn112Ala mutant were performed (Figure 7B, left panel). A reduction of
B
Mock
Residues 62-65:
Cleavage
kDa
116
WT
GCTA
MU
LCLA
MU
GLTV
MU
LLLV
CNNM2
AAPV-CMK
kDa
135
97
100
Expression
kDa
116
72
97
Figure 6 T he Signal Peptidase Complex Cleaves the CNNM2 Signal Peptide

A, Cleavage analysis of the CNNM2 protein by immunoblotting of double tagged CNNM2 transfected
HEK293 cells against the N-terminal HA-tag (upper blot). As a control for CNNM2 expression, the
CNNM2 C-terminus was targeted by immunoblotting against the VSV-tag (lower blot). Blot shown is
representative for 5 independent experiments. B, Coupled in vitro transcription/translation protein
synthesis of the CNNM2-HA protein in the presence (+) and absence (-) of SPC-inhibitor MeoSuc-
Ala-Ala-Pro-Val-Chloromethylketone (AAPV-CMK). Gel shown is representative for 3 independent
experiments.
90 % in plasma membrane expression of the CNNM2-N112A mutant was observed when

compared to the wild type CNNM2 protein (Figure 7B, right panel), suggesting that
p.Asn112 glycosylation is necessary for CNNM2 membrane stability. Taken together,
the CNNM2 extracellular N-terminus provides important sites for post-translational
modifications necessary for proper plasma membrane expression.
The C-terminal CBS Domains are Disrupted by the p.Thr568Ile Mutation

One of the mutations recently described to be causative for hypomagnesemia is located
in the CBS domains within the C-terminus (32). Therefore, emphasis was placed on
determining the structure of the intracellular CBS domains (Figure 3A) that have been
associated amongst others, with ATP binding (2). Here, we provide a homology model of
the CNNM2 CBS domains based on the Bordetella Parapertussis CorC Mg2+/Co2+ efflux
protein (Figure 8A). Analysis of this model showed conservation of the potential ATP
binding site in the CBS dimer of CNNM2 (Figure 8A, ATP in yellow). Interestingly, the
p.Thr568Ile mutation, identified in a Czech family to be causative for hypomagnesemia (32),
is lining the ATP binding site in the CBS domain (Figure 8B). In our model, mutation of the
threonine into the bigger isoleucine residue causes steric bumps with the ATP molecule.
Besides that, T568 also forms a hydrogen bond that stabilizes the position of the p.Glu570
and p.Asp571 residues (Figure 8B, hydrogen bonds in yellow). These two residues form
146 | Chapter 6
A
PNGase F
kDa
Mock
+
N112A
+
WT
+
N327A
+
N527A
+
N591A
+
97
CNNM2 N112A
97
Total Protein kDa

Expression
100
50
0
*
N112A
116
150
WT
tin
CNNM2 WT
kDa
Biotinylated fraction
(% of CNNM2 WT)
Cell Surface
Expression
Bio
oc
co
nt
ro
116
97
Figure 7 G
lycosylation on Residue N112 Regulates CNNM2 Membrane Trafficking
A, Immunoblot of C-terminally HA-tagged wild type CNNM2 (WT) and CNNM2 glycosylation m
utants
treated with (+) or without (-) PNGase F. B, Cell surface biotinylation of HEK293 cells expressing
HA-tagged wild type CNNM2 or glycosylation mutant p.Asn112Ala. A representative immunoblot
showing that glycosylation at position p.Asn112 is necessary for CNNM2 membrane expression
(upper blot), and a CNNM2 expression control (lower blot). On the right, a quantification by blot
intensities is shown of cell surface expression of CNNM2-WT (n=6) and CNNM2-p.Asn112Ala (n=6)
corrected for total protein expression. Error bars represent SEM; *P < 0.05 versus CNNM2-WT.
important hydrogen bonds and ionic interactions to the ATP molecule and residues lining
the ATP-binding pocket, respectively. According to the model, the patients p.Thr568Ile
mutation will also affect the position of the p.Glu570 and p.Asp571 residues and could,
therefore, severely affect ATP binding. In conclusion, this model might explain why the
patients p.Thr568Ile mutation is causative for non-functional CNNM2.
CNNM2a and CNNM2b Form Multimers

In GenBank, two splice variants exist that are conserved between man and mouse,
the first being full length, the second lacking exon 6. Interestingly, splice variant 2
was consistently found in conjunction with that of splice variant 1 in all tissues examined,
including kidney (Figure 1). Further examination of potential interactions between CNNM2a
Figure 8 T he CBS Domains are Potentially Involved in ATP Binding
CNNM2b
Mock
CNNM2a
A, Homology model of the CBS domain pair of CNNM2, modeled using the structure of the CorC
Mg2+ and Co2+ efflux protein from Bordetella Parapertussis (PDB file 3jtf). The two CBS domain
monomers are shown in dark and light blue with the p.Thr568 highlighted in red. ATP is shown
in yellow. B, Detail of the ATP binding region in the CBS domain. ATP is shown in light blue in this
model. The wild type p.Thr568 residue is highlighted in green, the extra side-chain of the mutant
p.Ile568 is shown in red. Hydrogen bonds with the surrounding p.Glu570 and p.Asp571 residues are
demonstrated in yellow.
kDa
200
kDa
116
100
97
100
100
Figure 9 C
NNM2a and CNNM2b Form Homo- and Heterotypic Interactions
A, Western blot analysis of CNNM2 protein showing CNNM2a and CNNM2b monomers at approximately
100 kDa and potential CNNM2 dimers at approximately 200 kDa. B, Co-immunoprecipitation studies
of CNNM proteins in COS-7 cells. C-terminal FLAG-tagged CNNM2a or CNNM2b were co-expressed
with C-terminal HA-tagged CNNM2a, CNNM2b or CNNM4 as indicated in the two top rows. The upper
blot shows the detection of the FLAG-tagged proteins in anti-HA precipitated cell lysates. The lower
two blots show input controls (10 %) of HA-tagged and FLAG-tagged proteins respectively. The results
shown are representative of three individual experiments.
148 | Chapter 6
and CNNM2b was performed by studying the dimerization of CNNM2 isoforms. Interestingly,
besides the CNNM2 monomer (with an expected MW of 105 kDa) (40), additional
complexes were visualized in the immunoblot at approximately 200 kDa (Figure 9A). This
molecular weight matches the mass of a hypothetical CNNM2 dimer. To confirm CNNM2
oligomerization events, co-immunoprecipitation assays of CNNM2 isoforms were
performed. CNNM2a-HA and CNNM2b-HA were each able to co-immunoprecipitate both
C-terminally FLAG-tagged CNNM2a and CNNM2b. CNNM4-HA only weakly co-immunoprecipitated, even though it was highly expressed, indicating the specificity of these
interactions (Figure 9B). These data show that CNNM2a and CNNM2b are able to form
specific homo- and hetero multimeric complexes.
Discussion
Mutations in CNNM2 have, recently, been described to be causative for a severe form of
hypomagnesemia (32). Initially described as nuclear proteins involved in cell cycle
regulation (40), the family of CNNM proteins has now been shown to reside at the plasma
membrane (8, 32). Although their physiological role is still poorly understood, all members
are likely involved in electrolyte homeostasis. CNNM1 has been identified as a cytosolic
copper chaperone, CNNM2 was shown to mediate Mg2+-sensitive Na+ currents in HEK293
cells and CNNM2, CNNM3 and CNNM4 have been linked with serum Mg2+ levels (1, 23, 32).
Furthermore, CNNM2 has been associated with coronary artery disease and hypertension
(24, 30, 33). Finally, mutations in CNNM4 were shown to be causative for recessive cone-rod
dystrophy with amelogenesis imperfecta (28, 29). In the present study, we aimed to
elucidate the CNNM2 protein topology and characterize its post-translational modifications.
Although Gmez Garca and colleagues have been working on structural elucidation
of the CBS domains of CNNM4 (9), complete structural information for any of the CNNM
proteins is presently unknown. Using immunocytochemical methods we examined the
membrane topology of CNNM2. Based on our results showing an extracellular N-terminus
and an intracellular C-terminus (Figure 3), we propose a structure comparable to that of
the glutamate receptor (GluR) ion channels (34), containing 3 full membrane-spanning
regions and an additional reentrant loop. In silico analysis of the CNNM2 protein sequence
showed that of the 4 hydrophobic regions, the second one is the shortest and the least
hydrophobic, indicating that the second hydrophobic region might not be completely
membrane-spanning, but instead forms a reentrant loop (Figure 10).
Similar to the GluR family, CNNM2 contains an N-terminal signal peptide that is
cleaved in the ER. Here, the SPC seems to be the protease complex responsible for CNNM2
cleavage (Figure 6B). The human SPC is a complex of five proteins expressed on the ER
membrane and recruited post-translationally to the signal recognition particle (SRP) to
perform signal peptide cleavage (27). Our results do not identify the exact position of the
Extracellular
N112
SP
TM2
TM1
TM3
I40SfsX15
ER membrane
TM2
TM3
Intracellular
CBS1
CBS1
CBS2
CBS2
T568I
Plasma membrane
Figure 10 S chematical Model of CNNM2 Structure

Model representing the structure of the CNNM2 protein at the plasma membrane and showing
the signal peptide cleavage in the endoplasmic reticulum. Crosses represent the locations of
the mutations. The glycosylation site at position p.Asn112 is shown in the extracellular N-terminus.
The CBS domains are represented in purple binding ATP in red.
ER: endoplasmic reticulum SP: signal peptide TM: transmembrane helix CBS: cysthationine -synthase domain.
cleavage site. Signal peptide recognition is known to be dependent on the residues at

positions -1 and -3 of the actual cleavage site (25). Nevertheless, conversion of the -1 and -3
position of the predicted site (p.Gly62/p.Thr64) to hydrophobic residues did not prevent
cleavage. Likewise, the cleavage was also not impaired when the alternative cleavage site
(p.Cys63/p.Ala65) was mutated. Only mutation of both sites prevented CNNM2 cleavage,
suggesting that the SPC can cleave CNNM2 at the preferential site between p.Thr64 and
p.Ala65, but also at an alternate site between p.Ala65 and p.Ala66. Thus, CNNM2 contains
a remarkable lengthy signal peptide of approximately 64 amino acids. Long signal
peptides have been associated with multiple functions, but might serve as a mechanism
to achieve proper membrane insertion of the protein (12). This also suggests that the first
predicted transmembrane domain (Figure 3A), actually represents the hydrophobic core
of the signal peptide that, after cleavage, will remain at the ER membrane (Figure 10). After
cleavage in the ER, CNNM2 is further processed by glycosylation in the Golgi apparatus.
N-glycosylation is known to facilitate plasma membrane trafficking for several membrane
proteins (35). Here, p.Asn112 was identified as the residue that is glycosylated and
implicated in CNNM2 membrane stability (Figure 7A-B). This can be interpreted as an
additional argument showing that the N-terminus is located on the extracellular side of
150 | Chapter 6
the membrane. Interestingly, our immunoblotting data showed a shift of the MW of the
CNNM2 protein when the alternative residue N327 was mutated. However, PNGase F
treatment still lowers the MW of the p.Asn327Ala mutant, indicating that the protein is not
deglycosylated (Figure 7A). Since p.Asn327 is predicted to be located in the second TM
domain, we suspect that mutation of this residue instigates an altered protein folding that
runs different on gel, explaining the observed shift.

Once at the plasma membrane, the functional CNNM2 unit likely represents a multimer.
Interestingly, we showed that both CNNM2a and CNNM2b can form homomultimers
as well as heteromultimers (Figure 9B). This interaction is specific, as evidenced by the
fact that CNNM2a and CNNM2b hardly dimerize with CNNM4, which shares the highest
sequence homology with CNNM2 (96.7 % similarity and 81.4 % identity at the protein
level) (40).

In magnesium research, CNNM2 function is heavily debated. CNNM2 was first reported
as a Mg2+ transporter (8, 31), but recent findings questioned the ability of CNNM2 to
transport Mg2+ and proposed a Mg2+-sensing function (32). We, therefore, examined
whether our topological findings could further elucidate the function of CNNM2. We
reasoned that, although CNNM2 might contain a re-entrant region, it is unlikely that this
region forms a pore for Mg2+ transport. The re-entrant loop does not include negatively
charged residues that could provide Mg2+ specificity. Furthermore, the protein topology
of only 3 transmembrane segments would be small in comparison with known eukaryotic
Mg2+ transporters such as TRPM6/7 (tetramers of 6 TM proteins) and SLC41A1 (10/11 TM
domains) (37, 39). Thus, our topological findings strengthen the previously reported patch
clamp data (32), suggesting that CNNM2 might be a Mg2+ sensor indirectly regulating
Mg2+ transport.
To further substantiate this hypothesis, we focused on the CBS domains during
analysis of the CNNM2 structure. CBS domains are found in 100-200 mammalian proteins
and play a role in a variety of functions such as adenosine phosphate binding and ionic
strength sensing (4, 15). The CBS domains in CNNM2 are highly homologous to those
found in the Bordetella Parapertussis Co2+/Mg2+ efflux protein CorC of which the structure
has been crystallized recently (PDB 3jtf). As shown by homology modelling based on the
CorC structure, the CBS domains in the CNNM2 C-terminus contain a potential ATP-binding
domain (Figure 4B). ATP binding in CBS domains has been reported to activate or further
inhibit protein function in eukaryotic CBS domain-containing proteins (2).

Our model does not allow discrimination between ATP and Mg-ATP binding, but we
expect that the CBS domains of CNNM2 are also able to bind Mg-ATP. This theory is
strengthened by the recently elucidated crystal structure of the bacterial Mg2+ transporter
MgtE in which its CBS domains are involved in Mg2+ binding (PDB 2yvy, (11, 16)). As the
majority of intracellular Mg2+ is ATP bound, the intracellular Mg-ATP concentrations are
representative for the cellular Mg2+ content. The suggestion that CNNM2 binds Mg-ATP
implies that rather than ATP being an energy source for active transport, the Mg-ATP
binding would provide a Mg2+-sensing mechanism. Given that the CNNM2 p.Thr568Ile
loss-of-function mutation found in patients (32) is located at the region predicted to form
the ATP binding pocket (Figure 8B), the (Mg-)ATP binding is likely of major importance for
CNNM2 function. Since the p.Thr568Ile mutation is specifically disturbing the ATP binding
pocket, Mg2+ alone will possibly not be able to activate CNNM2.
In conclusion, we propose a protein topology of CNNM2 consisting of three
membrane-spanning domains and a re-entrant loop (Figure 8). CNNM2 is extensively
post-translationally modified by signal peptide cleavage and glycosylation, before being
functional in multimers at the plasma membrane. Rather than transporting Mg2+ itself,
we hypothesize CNNM2 would sense intracellular Mg2+ concentrations and regulate
other Mg2+ transporters. Future research should focus on the identification of CNNM2
protein partners to further elucidate its role in Mg2+ homeostasis.
Acknowledgements
We thank Femke van Zeeland, AnneMiete van der Kemp, Michelle Damen, Kelly Menting,
Evelien Oerlemans and Kerstin Sommer for their technical support. In particular, we would
like to thank Eric Jansen for supplying us the materials and his excellent technical
suggestions for the in vitro translation experiments. This study was supported by the
Netherlands organization for Scientific Research (ZonMw 9120.8026 and EURYI 2006) to
J.H. and by grants from the European Community, FP7 (EUNEFRON 201590) to I.C.M. and D.M.
Methods
Expression Profiling
Three C57BL/6 mice were sacrificed; kidney, duodenum, ileum, jejunum, colon, cecum,
brain, lung, liver, spleen, testis, muscle and heart tissues were collected. The transgenic
parvalbumin-EGFP mice were a gift kind from Dr. Monyer (University of Heidelberg,
Germany, (22)) and TRPV5-GFP mice were kindly provided by Dr. Praetorius from the
University of Aarhus (14). They were used to isolate the DCT and CNT respectively. Mice
were anesthetized by a cocktail injection of ketamine (0.1 mg/g body weight) and xylazine
(0.01 mg/g body weight) and perfused with 20 mL PBS (in mmol/L: 137 NaCl, 2.7 KCl, 10
Na2HPO4, 1.76 KH2PO4) through the heart. The kidneys were removed, minced and
digested in collagenase (1 mg/mL collagenase A Worthington, Lakewood, NJ, USA, 1 mg/
mL hyaluronidase) in KREBS buffer (in mmol/L: 145 NaCl, 5 KCl, 10 HEPES/NaOH pH:7.4, 1
NaH2PO4, 2.5 CaCl2, 1.8 MgSO4, 5 glucose) at 37 C for 18 min. The collagenase-digested
tubules sized between 40 m and 100 m were sorted based on GFP fluorescence by
COPAS (Complex Object Parametric Analysis and Sorting, Union Biometrica, USA).
152 | Chapter 6

Total RNA was isolated using TRIzol Total RNA Isolation Agent (Invitrogen). Obtained
RNA was DNase (Promega) treated to remove genomic DNA. Subsequently, reverse
transcription of the RNA by M-MLV reverse transcriptase (Invitrogen) was performed 1 hr at
37 C. Gene expression levels were determined by quantitative real-time PCR on a BioRad
Analyzer and normalized for Gapdh expression levels. Primer sequences are provided in
Table 1.
Table 1 Primer Sequences Used for RT-PCR Analysis
Forward
Reverse
Cnnm1
5-ACAGGTCACAGCAAGTCTCG-3
5-CCCATGTTTTCCTCAGAGTC-3
Cnnm2v1
5-GTCTCGCACCTTTGTTGTCA-3
5-GTCGCTCCGACTGAGAGAAT-3
Cnnm2v2
5-CTCACAGCCTCTCCAGGG-3
5-AGGAAGAGCTGAGCTGGTTG-3
Cnnm3v1
5-CCTTAATGCACTCCTGGCTAC-3
5-CTGGGTCTGCTGTTGGTG-3
Cnnm3v2
5-CCTTAATGCACTCCTGGCTAC-3
5-AAAGAGGGAAAGGTGGACTG-3
Cnnm4
5-TCTGGGCCAGTATGTCTCTG-3
5-CACAGCCATCGAAGGTAGG-3
Trpm6
5-GTCTCGCACCTTTGTTGTCA-3
5-GTCGCTCCGACTGAGAGAAT-3
Trpv5
5-CCATGACTTCCGCTAGTTGAG-3
5-TGGATGTCACGTGTCCAGTT-3
Gapdh
Immunohistochemistry was performed as previously described (13). In short, costaining
for CNNM2 with Na+-K+-Cl- cotransporter (NKCC2), thiazide-sensitive Na+-Cl- cotransporter
(NCC), Calbindin-D28k and Aquaporin-2 (AQP2), was performed on 7 m sections of fixed
frozen mouse kidney samples. The sections were incubated for 16 hrs at 4 C with the
following primary antibodies: guinea pig anti-CNNM2 (1:100, (32)), rabbit anti-NKCC2 (1:100,
(20)), rabbit anti-NCC (1:100, (26)), rabbit anti-Calbindin-D28k (1:500, (5)) and rabbit anti-AQP2
(1:300, kindly provided by Dr. Deen, Nijmegen, the Netherlands). For detection, kidney
sections were incubated with Alexa-conjugated secondary antibodies. Images were taken
with an AxioCam camera (Zeiss) and AxioVision software (Zeiss).
DNA Constructs
Mouse Cnnm2 was cloned into the pCINeo HA IRES GFP vector as described previously
(32). To obtain a C-terminal VSV-epitope, an XbaI restriction site was introduced before
the stop codon using the QuikChange site-directed mutagenesis kit (Agilent, Amstelveen,
the Netherlands) according to the manufacturers protocol. Subsequently, oligos
(F: 5- GAATCGCTTGGGGAAGTAGCTCGAGAATTCCGCCCC-3 R: 5- GGGGCGGAATTCTCGAG
CTACTTCCCCAAGCGATTC-3) encoding the VSV-epitope were hybridized and ligated into
the pCINEO HA-CNNM2 IRES GFP vector using the XbaI and XhoI restriction sites. CNNM2
mutations were inserted in the construct using the QuikChange site-directed mutagenesis
kit according to the manufacturers protocol. Human CNNM4 full-length cDNA clone
(GenBank accession BC063295) was amplified using Phusion polymerase (Finnzymes,
Vantaa, Finland) and primers (Forward: 5-CGGCTAGCGCCACCATGGCGCCGGTGG-3, Reverse:
5-CGACCGGTCTATGCGTAGTCTGGCACGTCGTATGGGTAGATGGCATTCTCGTGGGAG-3) to introduce
an in frame HA-tag before the stop codon and AgeI and NheI restriction sites. The
amplicons were cloned into the pCINeo IRES GFP expression vector using the AgeI and
NheI restriction sites. All constructs were verified by sequence analysis.
Mouse Cnnm2 was cloned into pcDNA3 (Invitrogen) as described previously (32). To
obtain splice variant 2 with a 66 nucleotide deletion corresponding to exon 6, site-directed
mutagenesis (QuikChange, Agilent) was used, according to the two stage PCR mutagenesis
protocol described by Wang and Malcolm (41). The same protocol was used to delete the
C-terminal tag and to insert internal HA-tags with an additional serine residue (NH2-YPYDVPDYAS-COOH) (18) after residues p.Thr24, p.Gly210 or p.Pro744 or to replace the C-terminal
HA-tag with a FLAG sequence. Mutagenesis primer sequences are available upon request.
To obtain an N-terminal HA-tagged expression clone, the ORF in pFLCI-mCnnm2WT (32)
was amplified using Expand polymerase (Roche) using forward primer 5- ATGGGGTACCATGGCTTACCCATATGATGTTCCAGATTACGCTATTGGCTGTGGCGCTTGTG-3 containing an
in frame HA-tag after the Kozak sequence and reverse primer 5- ATCTTCTAGAGGTCAGACCAAGTCCAGGAG-3 and subsequently cloned in pcDNA3 as described previously (10). The
complete ORFs of all expression constructs were sequence verified.
Cell Culture and Transfection

HEK293 cells were grown at 37 C in DMEM (Bio Whittaker Europe, Vervier, Belgium)
supplemented with 10 % (v/v) FCS (PAA, Linz, Austria), non-essential amino acids and 2
mmol/L L-glutamine in a humidified 5 % (v/v) CO2 atmosphere. Few hours before
transfection with Lipofectamine 2000 (Invitrogen), cells were seeded in 12-well plates and
subsequently transiently transfected with 0.5 g pCINeo-IRES-GFP constructs encoding
HA-tagged wild type or mutated CNNM2 proteins at a 1:2 DNA to lipofectamine ratio.

COS-7 cells (ATCC CRL-1651) were grown in DMEM supplemented with 10 % FBS, 100 U/mL
penicillin and 100 g/mL streptomycin (Biochrom, Berlin) in a humidified environment of
5 % (v/v) CO2 at 37 C.
Immunocytochemistry
COS-7 cells were seeded on glass cover slips and transfected using Lipofectamine 2000
according to the manufacturers protocol with constructs expressing epitope-tagged
CNNM2 or CNNM4. After 2 days of growth in medium supplemented with 20 mmol/L
MgCl2, the cells were rinsed with PBS and fixed for 10 min with 4 % (w/v) methanol-free
formaldehyde solution (Thermo Scientific) in PBS. In a control experiment (Figure 4,
lower panels), living cells were incubated with primary antibody rat anti-HA (Roche,
154 | Chapter 6
high affinity 3F10, 1:250) for 60 min at 4 C before formaldehyde fixation. After rinses in
PBS, some of the cells were incubated for 10 min with 0.2 % (v/v) Triton X-100 in PBS for
permeabilization. After PBS rinses, the cells were incubated with blocking buffer (5 % (v/v)
donkey serum (Sigma) in PBS) for 1 hr and immuno-labeled with the primary antibodies
rat anti-HA (1:250), mouse anti-FLAG M2 (Sigma, 1:250), rabbit anti-Calnexin (C5C9, Cell
Signaling Technology, 1:50) or rabbit anti-CNNM2 (Abcam, Ab111351, 1:50) in blocking
buffer for 90 min. After rinses in PBS, cells were incubated with Alexa Fluor 488 conjugated
donkey anti-rabbit or anti-mouse IgG or Alexa Fluor 594 conjugated donkey anti-rat IgG
secondary antibodies (Invitrogen, 1:500) and DAPI (2 g/mL) for 45 min. After PBS and
ethanol rinses, the cells were mounted on slides using ProLong Gold antifade reagent
(Invitrogen). Fluorescence microscopy was performed with a Leica DMIRE2 inverted
microscope, and images taken with Openlab software.
Homology Modeling
A homology model was built using the modeling script in the WHATIF & YASARA Twinset
with standard parameters (19, 38). We used the structure of a cysthationine B-synthase
(CBS) domain pair structure of the Mg2+ and Co2+ efflux protein CorC from Bordetella
Parapertussis (PDB file 3jtf) as a template for modeling.
Cell Surface Biotinylation, PNGase Treatment and Immunoblotting

Biotinylation experiments were performed as previously described (36). In short, HEK293
cells were transfected for 48 hrs and cell surfaces were biotinylated at 4 C for 1 hr by
adding sulfo-NHS-LC-LC-biotin. Subsequently protein lysates were incubated overnight
with Neutravidin-agarose beads (Pierce).

Protein lysates were denatured in Laemmli containing 100 mmol/L DTT for 30 min at
37 C and subsequently subjected to SDS-PAGE. Then, immunoblots were incubated with
mouse anti-HA (Cell Signaling Technology, Danvers, MA, USA) primary antibodies and
peroxidase conjugated sheep anti-mouse secondary antibodies (Sigma). PNGase F (New
England Biolabs) was added to the protein lysates in Laemmli-DTT buffer and incubated
at 37 C for 1 hr before loading the protein samples on gel.
Co-Immunoprecipitation
COS-7 cells were cultured and transfected as described above with expression vectors for
HA and FLAG-tagged wild type CNNM2 or CNNM4 isoforms. 48 hrs after transfection, cells
were scraped from dishes in ice-cold 50 mmol/L Tris/HCl pH 8.0, followed by centrifugation
at 5,000 g. The pellets were lysed in lysis buffer (150 mmol/L NaCl; 0,1 % (v/v) Nonidet P-40;
50 mmol/L Tris/HCl pH 7.5 and Complete protease inhibitor cocktail (Roche)) by repeated
passage through a 26-gauge needle. Protein concentration measurement was performed
using a BCA assay (Pierce). The next incubation steps were all done under rotary agitation
at 4 C. Protein aliquots of 100 g in lysis buffer were pre-cleared by incubation with
protein G-Sepharose (Sigma-Aldrich) for 2 hrs after which the pre-cleared lysate was
incubated for 18 hrs with 2.5 g anti-HA antibody (Roche, high affinity 3F10). The antibody-lysate mixture was added to 50 L fresh protein G-Sepharose beads and incubated
for 1 hr. The beads were collected by centrifugation at 1,000 g for 1 min at 4 C and washed
four times with lysis buffer. The proteins were separated from the beads by boiling for 5
min in 1x Laemmli sample buffer and detected by immunoblotting using a mouse
monoclonal antibody against FLAG M2 (Sigma-Aldrich, 1:1000).
In Vitro Transcriptiona and Translation

The cDNA template for in vitro transcription contained the CNNM2-HA sequence
downstream of a T7 promoter sequence in a pT7Ts vector. The coupled in vitro
transcription/translation reaction was incubated at 30 C for 90 min. The reaction mixture
contained 2 g of cDNA template, 2 L reaction buffer, 1 L T7 RNA polymerase, 1 L of
amino acid mix without methionine, 3 L of 35S-Met (1 Ci/l), RNasin and 25 L of rabbit
reticulocyte lysate (Promega). The reaction was performed with or without signal
peptidase inhibitor MeoSuc-Ala-Ala-Pro-Val-Chloromethylketone (AAPV-CMK, Sigma).
The protein mixture was separated on an 8 % (w/v) SDS-PAGE gel. The gel was fixed in
a mixture of acetic acid, methanol and H2O (20:10:70) and incubated in 20 % (w/v)
2,5-diphenyloxazole in DMSO to intensify the radioactive signal. The proteins were
visualized using CL-X Posure films (Pierce, Etten-Leur, the Netherlands).
In all experiments, data are expressed as mean standard error of the mean (SEM).
Statistical significance was determined using an unpaired Students t-test, differences with
P < 0.05 were regarded as statistically significant.
156 | Chapter 6
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Alderton A, Davies P, Illman K, Brown DR. Ancient conserved domain protein-1 binds copper and modifies
its retention in cells. J. Neurochem. 103: 312321, 2007.
Baykov AA, Tuominen HK, Lahti R. The CBS domain: a protein module with an emerging prominent role in
regulation. ACS Chem. Biol. 6: 11561163, 2011.
Bendtsen JD, Nielsen H, Heijne von G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J. Mol.
Biol. 340: 783795, 2004.
Biemans-Oldehinkel E, Mahmood NABN, Poolman B. A sensor for intracellular ionic strength. Proc. Natl.
Acad. Sci. U.S.A. 103: 1062410629, 2006.
Bindels RJ, Hartog A, Timmermans J, Van Os CH. Active Ca2+ transport in primary cultures of rabbit kidney
CCD: stimulation by 1,25-dihydroxyvitamin D3 and PTH. Am. J. Physiol. 261: F799807, 1991.
Czachorowski M, Lam-Yuk-Tseung S, Cellier M, Gros P. Transmembrane topology of the mammalian
Slc11a2 iron transporter. Biochemistry 48: 84228434, 2009.
Glaudemans B, Knoers NVAM, Hoenderop JGJ, Bindels RJM. New molecular players facilitating Mg(2+)
reabsorption in the distal convoluted tubule. Kidney Int. 77: 1722, 2010.
Goytain A, Quamme GA. Functional characterization of ACDP2 (ancient conserved domain protein), a
divalent metal transporter. Physiol. Genomics 22: 382389, 2005.
Gmez Garca I, Oyenarte I, Martnez-Cruz LA. Purification, crystallization and preliminary crystallographic
analysis of the CBS pair of the human metal transporter CNNM4. Acta Crystallogr. Sect. F Struct. Biol. Cryst.
Commun. 67: 349353, 2011.
Gnzel D, Stuiver M, Kausalya PJ, Haisch L, Krug SM, Rosenthal R, Meij IC, Hunziker W, Fromm M, Mller
D. Claudin-10 exists in six alternatively spliced isoforms that exhibit distinct localization and function. J. Cell. Sci.
122: 15071517, 2009.
448: 10721075, 2007.
Hiss JA, Schneider G. Architecture, function and prediction of long signal peptides. Brief. Bioinformatics 10:
569578, 2009.
Hoenderop JGJ, Dardenne O, Van Abel M, van der Kemp AWCM, Van Os CH, St Arnaud R, Bindels RJM.
Modulation of renal Ca2+ transport protein genes by dietary Ca2+ and 1,25-dihydroxyvitamin D3 in 25hydroxyvitamin D3-1alpha-hydroxylase knockout mice. FASEB J. 16: 13981406, 2002.
Hofmeister MV, Fenton RA, Praetorius J. Fluorescence isolation of mouse late distal convoluted tubules
and connecting tubules: effects of vasopressin and vitamin D3 on Ca2+ signaling. Am. J. Physiol. Renal Physiol.
296: F194203, 2009.
Ignoul S, Eggermont J. CBS domains: structure, function, and pathology in human proteins. American
Journal of Physiology - Cell Physiology 289: C136978, 2005.
Ishitani R, Sugita Y, Dohmae N, Furuya N, Hattori M, Nureki O. Mg2+-sensing mechanism of Mg2+
transporter MgtE probed by molecular dynamics study. Proc. Natl. Acad. Sci. U.S.A. 105: 1539315398, 2008.
Kast C, Canfield V, Levenson R, Gros P. Membrane topology of P-glycoprotein as determined by epitope
insertion: transmembrane organization of the N-terminal domain of mdr3. Biochemistry 34: 44024411, 1995.
Kast C, Gros P. Topology mapping of the amino-terminal half of multidrug resistance-associated protein by
epitope insertion and immunofluorescence. J. Biol. Chem. 272: 2647926487, 1997.
Krieger E, Joo K, Lee J, Lee J, Raman S, Thompson J, Tyka M, Baker D, Karplus K. Improving physical
realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed
well in CASP8. Proteins 77 Suppl 9: 114122, 2009.
Loffing J, Vallon V, Loffing-Cueni D, Aregger F, Richter K, Pietri L, Bloch-Faure M, Hoenderop JGJ, Shull
GE, Meneton P, Kaissling B. Altered renal distal tubule structure and renal Na(+) and Ca(2+) handling in a
mouse model for Gitelmans syndrome. J. Am. Soc. Nephrol. 15: 22762288, 2004.
Meij IC, Van Den Heuvel LPWJ, Hemmes S, van der Vliet WA, Willems JL, Monnens LAH, Knoers NVAM.
Exclusion of mutations in FXYD2, CLDN16 and SLC12A3 in two families with primary renal Mg2+ loss. Nephrol.
Dial. Transplant. 18: 512516, 2003.
22. Meyer AH, Katona I, Blatow M, Rozov A, Monyer H. In vivo labeling of parvalbumin-positive interneurons
and analysis of electrical coupling in identified neurons. J. Neurosci. 22: 70557064, 2002.
23. Meyer TE, Verwoert GC, Hwang S-J, Glazer NL, Smith AV, van Rooij FJA, Ehret GB, Boerwinkle E, Felix JF,
Leak TS, Harris TB, Yang Q, Dehghan A, Aspelund T, Katz R, Homuth G, Kocher T, Rettig R, Ried JS,
Gieger C, Prucha H, Pfeufer A, Meitinger T, Coresh J, Hofman A, Sarnak MJ, Chen Y-DI, Uitterlinden AG,
Chakravarti A, Psaty BM, van Duijn CM, Kao WHL, Witteman JCM, Gudnason V, Siscovick DS, Fox CS,
Kttgen A, Genetic Factors for Osteoporosis Consortium, Meta Analysis of Glucose and Insulin
Related Traits Consortium. Genome-wide association studies of serum magnesium, potassium, and sodium
concentrations identify six Loci influencing serum magnesium levels. PLoS Genet 6: e1001045, 2010.
24. Newton-Cheh C, Johnson T, Gateva V, Tobin MD, Bochud M, Coin L, Najjar SS, Zhao JH, Heath SC,
Eyheramendy S, Papadakis K, Voight BF, Scott LJ, Zhang F, Farrall M, Tanaka T, Wallace C, Chambers JC,
Khaw K-T, Nilsson P, van der Harst P, Polidoro S, Grobbee DE, Onland-Moret NC, Bots ML, Wain LV,
Elliott KS, Teumer A, Luan J, Lucas G, Kuusisto J, Burton PR, Hadley D, McArdle WL, Wellcome Trust
Case Control Consortium, Brown M, Dominiczak A, Newhouse SJ, Samani NJ, Webster J, Zeggini E,
Beckmann JS, Bergmann S, Lim N, Song K, Vollenweider P, Waeber G, Waterworth DM, Yuan X, Groop
L, Orho-Melander M, Allione A, Di Gregorio A, Guarrera S, Panico S, Ricceri F, Romanazzi V, Sacerdote
C, Vineis P, Barroso I, Sandhu MS, Luben RN, Crawford GJ, Jousilahti P, Perola M, Boehnke M,
Bonnycastle LL, Collins FS, Jackson AU, Mohlke KL, Stringham HM, Valle TT, Willer CJ, Bergman RN,
Morken MA, Dring A, Gieger C, Illig T, Meitinger T, Org E, Pfeufer A, Wichmann H-E, Kathiresan S,
Marrugat J, ODonnell CJ, Schwartz SM, Siscovick DS, Subirana I, Freimer NB, Hartikainen A-L,
McCarthy MI, OReilly PF, Peltonen L, Pouta A, de Jong PE, Snieder H, van Gilst WH, Clarke R, Goel A,
Hamsten A, Peden JF, Seedorf U, Syvnen A-C, Tognoni G, Lakatta EG, Sanna S, Scheet P, Schlessinger
D, Scuteri A, Drr M, Ernst F, Felix SB, Homuth G, Lorbeer R, Reffelmann T, Rettig R, Vlker U, Galan P,
Gut IG, Hercberg S, Lathrop GM, Zelenika D, Deloukas P, Soranzo N, Williams FM, Zhai G, Salomaa V,
Laakso M, Elosua R, Forouhi NG, Vlzke H, Uiterwaal CS, van der Schouw YT, Numans ME, Matullo G,
Navis G, Berglund G, Bingham SA, Kooner JS, Connell JM, Bandinelli S, Ferrucci L, Watkins H, Spector
TD, Tuomilehto J, Altshuler D, Strachan DP, Laan M, Meneton P, Wareham NJ, Uda M, Jarvelin M-R,
Mooser V, Melander O, Loos RJF, Elliott P, Abecasis GR, Caulfield M, Munroe PB. Genome-wide
association study identifies eight loci associated with blood pressure. Nat. Genet. 41: 666676, 2009.
25. Nielsen H, Engelbrecht J, Brunak S, Heijne von G. Identification of prokaryotic and eukaryotic signal
peptides and prediction of their cleavage sites. Protein Eng. 10: 16, 1997.
26. Nijenhuis T, Hoenderop JGJ, Loffing J, van der Kemp AWCM, Van Os CH, Bindels RJM. Thiazide-induced
hypocalciuria is accompanied by a decreased expression of Ca2+ transport proteins in kidney. Kidney Int. 64:
555564, 2003.
27. Paetzel M, Karla A, Strynadka NCJ, Dalbey RE. Signal peptidases. Chem. Rev. 102: 45494580, 2002.
28. Parry DA, Mighell AJ, El-Sayed W, Shore RC, Jalili IK, Dollfus H, Bloch-Zupan A, Carlos R, Carr IM,
Downey LM, Blain KM, Mansfield DC, Shahrabi M, Heidari M, Aref P, Abbasi M, Michaelides M, Moore
AT, Kirkham J, Inglehearn CF. Mutations in CNNM4 cause Jalili syndrome, consisting of autosomal-recessive
cone-rod dystrophy and amelogenesis imperfecta. Am. J. Hum. Genet. 84: 266273, 2009.
29. Polok B, Escher P, Ambresin A, Chouery E, Bolay S, Meunier I, Nan F, Hamel C, Munier FL, Thilo B,
Mgarban A, Schorderet DF. Mutations in CNNM4 cause recessive cone-rod dystrophy with amelogenesis
imperfecta. Am. J. Hum. Genet. 84: 259265, 2009.
30. Schunkert H, Knig IR, Kathiresan S, Reilly MP, Assimes TL, Holm H, Preuss M, Stewart AFR, Barbalic M,
Gieger C, Absher D, Aherrahrou Z, Allayee H, Altshuler D, Anand SS, Andersen K, Anderson JL,
Ardissino D, Ball SG, Balmforth AJ, Barnes TA, Becker DM, Becker LC, Berger K, Bis JC, Boekholdt SM,
Boerwinkle E, Braund PS, Brown MJ, Burnett MS, Buysschaert I, Cardiogenics, Carlquist JF, Chen L,
Cichon S, Codd V, Davies RW, Dedoussis G, Dehghan A, Demissie S, Devaney JM, Diemert P, Do R,
Doering A, Eifert S, Mokhtari NEE, Ellis SG, Elosua R, Engert JC, Epstein SE, de Faire U, Fischer M, Folsom
AR, Freyer J, Gigante B, Girelli D, Gretarsdottir S, Gudnason V, Gulcher JR, Halperin E, Hammond N,
Hazen SL, Hofman A, Horne BD, Illig T, Iribarren C, Jones GT, Jukema JW, Kaiser MA, Kaplan LM,
Kastelein JJP, Khaw K-T, Knowles JW, Kolovou G, Kong A, Laaksonen R, Lambrechts D, Leander K,
Lettre G, Li M, Lieb W, Loley C, Lotery AJ, Mannucci PM, Maouche S, Martinelli N, McKeown PP,
158 | Chapter 6
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
Meisinger C, Meitinger T, Melander O, Merlini PA, Mooser V, Morgan T, Mhleisen TW, Muhlestein JB,
Mnzel T, Musunuru K, Nahrstaedt J, Nelson CP, Nthen MM, Olivieri O, Patel RS, Patterson CC, Peters
A, Peyvandi F, Qu L, Quyyumi AA, Rader DJ, Rallidis LS, Rice C, Rosendaal FR, Rubin D, Salomaa V,
Sampietro ML, Sandhu MS, Schadt E, Schfer A, Schillert A, Schreiber S, Schrezenmeir J, Schwartz SM,
Siscovick DS, Sivananthan M, Sivapalaratnam S, Smith A, Smith TB, Snoep JD, Soranzo N, Spertus JA,
Stark K, Stirrups K, Stoll M, Tang WHW, Tennstedt S, Thorgeirsson G, Thorleifsson G, Tomaszewski M,
Uitterlinden AG, van Rij AM, Voight BF, Wareham NJ, Wells GA, Wichmann H-E, Wild PS, Willenborg C,
Witteman JCM, Wright BJ, Ye S, Zeller T, Ziegler A, Cambien F, Goodall AH, Cupples LA, Quertermous T,
Mrz W, Hengstenberg C, Blankenberg S, Ouwehand WH, Hall AS, Deloukas P, Thompson JR,
Stefansson K, Roberts R, Thorsteinsdottir U, ODonnell CJ, McPherson R, Erdmann J, CARDIoGRAM
Consortium, Samani NJ. Large-scale association analysis identifies 13 new susceptibility loci for coronary
artery disease. Nat. Genet. 43: 333338, 2011.
Sponder G, Svidova S, Schweigel M, Vormann J, Kolisek M. Splice-variant 1 of the ancient domain protein
2 (ACDP2) complements the magnesium-deficient growth phenotype of Salmonella enterica sv. typhimurium
strain MM281. Magnes Res 23: 105114, 2010.
Stuiver M, Lainez S, Will C, Terryn S, Gnzel D, Debaix H, Sommer K, Kopplin K, Thumfart J, Kampik NB,
Querfeld U, Willnow TE, Nmec V, Wagner CA, Hoenderop JG, Devuyst O, Knoers NVAM, Bindels RJ,
Meij IC, Mller D. CNNM2, encoding a basolateral protein required for renal Mg2+ handling, is mutated in
dominant hypomagnesemia. Am. J. Hum. Genet. 88: 333343, 2011.
Takeuchi F, Isono M, Katsuya T, Yamamoto K, Yokota M, Sugiyama T, Nabika T, Fujioka A, Ohnaka K,
Asano H, Yamori Y, Yamaguchi S, Kobayashi S, Takayanagi R, Ogihara T, Kato N. Blood pressure and
hypertension are associated with 7 loci in the Japanese population. Circulation 121: 23022309, 2010.
Traynelis SF, Wollmuth LP, McBain CJ, Menniti FS, Vance KM, Ogden KK, Hansen KB, Yuan H, Myers SJ,
Dingledine R. Glutamate receptor ion channels: structure, regulation, and function. Pharmacol. Rev. 62:
405496, 2010.
Vagin O, Kraut JA, Sachs G. Role of N-glycosylation in trafficking of apical membrane proteins in epithelia.
Am. J. Physiol. Renal Physiol. 296: F45969, 2009.
van de Graaf SFJ, Hoenderop JGJ, Gkika D, Lamers D, Prenen J, Rescher U, Gerke V, Staub O, Nilius B,
Bindels RJM. Functional expression of the epithelial Ca(2+) channels (TRPV5 and TRPV6) requires association
of the S100A10-annexin 2 complex. EMBO J. 22: 14781487, 2003.
Voets T, Nilius B, Hoefs S, van der Kemp AWCM, Droogmans G, Bindels RJM, Hoenderop JGJ. TRPM6
forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J. Biol. Chem. 279: 1925,
2004.
Vriend G. WHAT IF: a molecular modeling and drug design program. J Mol Graph 8: 526 29, 1990.
Wabakken T, Rian E, Kveine M, Aasheim H-C. The human solute carrier SLC41A1 belongs to a novel
306: 718724, 2003.
Wang C-Y, Shi J-D, Yang P, Kumar PG, Li Q-Z, Run Q-G, Su Y-C, Scott HS, Kao K-J, She J-X. Molecular
cloning and characterization of a novel gene family of four ancient conserved domain proteins (ACDP). Gene
306: 3744, 2003.
Wang W, Malcolm BA. Two-stage PCR protocol allowing introduction of multiple mutations, deletions and
insertions using QuikChange Site-Directed Mutagenesis. BioTechniques 26: 680682, 1999.
162 | Chapter 7
Abstract
Intellectual disability and seizures are frequently associated with hypomagnesemia and
have an important genetic component. However, to find the genetic origin of intellectual
disability and seizures often remains challenging because of considerable genetic
heterogeneity and clinical variability.

In this study, we have identified new mutations in the gene CNNM2 in five families
suffering from mental retardation, seizures, and hypomagnesemia. For the first time, a
recessive mode of inheritance of CNNM2 mutations was observed. Importantly, patients
with recessive CNNM2 mutations suffer from severe brain malformations and severe
intellectual disability. Additionally, three patients with moderate mental disability were
shown to carry de novo heterozygous missense mutations in the CNNM2 gene. To elucidate
the physiological role of CNNM2 and explain the pathomechanisms of disease, we studied
CNNM2 function combining in vitro activity assays and the zebrafish knockdown model
system. Using stable Mg2+ isotopes, we demonstrated that CNNM2 increases cellular Mg2+
uptake in HEK293 cells and that this process occurs through regulation of the
Mg2+-permeable cation channel TRPM7. In contrast, cells expressing mutated CNNM2
proteins did not show increased Mg2+ uptake. Knockdown of cnnm2 isoforms in zebrafish
resulted in disturbed brain development including neurodevelopmental impairments
such as increased embryonic spontaneous contractions and weak touch-evoked escape
behaviour, and reduced body Mg content, indicative of impaired renal Mg2+ absorption.
These phenotypes were rescued by injection of mammalian wild-type Cnnm2 cRNA,
whereas mammalian mutant Cnnm2 cRNA did not improve the zebrafish knockdown
phenotypes.

We therefore concluded that CNNM2 is fundamental for brain development, neurological
functioning and Mg2+ homeostasis. By establishing the loss-of-function zebrafish model
for CNNM2 genetic disease, we provide a unique system for testing therapeutic drugs
targeting CNNM2 and for monitoring their effects on the brain and kidney phenotype.
Keywords: Cyclin M2, Mental Retardation, Magnesium, Distal Convoluted Tubule
CNNM2 Mutations Impair Brain and Kidney Function | 163
Introduction
Brain defects including seizures, migraine, depression and intellectual disability are
frequently associated with hypomagnesemia (7). Indeed, low Mg2+ concentrations may
cause epileptiform activity during development (25). Specifically, the Mg2+ channel
transient receptor potential melastatin 7 (TRPM7) is essential for brain function and
development (18). Interestingly, patients with genetic defects in TRPM6, a close homologue
of TRPM7, may have neurological complications (34). Although TRPM6 and TRPM7 share
similar Mg2+ transporting properties, they are differentially expressed and regulated (27).
TRPM7 is a ubiquitously expressed protein regulating intracellular Mg2+ levels in a broad
range of cells, whereas TRPM6 is localized in the luminal membrane of renal and intestinal
epithelia involved in Mg2+ absorption (7, 16, 32, 36). Recently, we have identified mutations
in the gene encoding cyclin M2 (CNNM2) in two unrelated families with dominant isolated
hypomagnesemia (CNNM2, OMIM #607803) (31). Patients suffered from symptoms
associated with low serum Mg2+ levels (0.3-0.5 mmol/L) such as tremors, headaches and
muscle weakness. The role of CNNM2 in the kidney for the maintenance of serum Mg2+
levels can be traced to the distal convoluted tubule (DCT), where also TRPM6 is expressed.
Here, CNNM2 is present in the basolateral membrane of DCT cells and its expression is
regulated by dietary Mg2+ availability (5, 31).

Although CNNM2 has been proposed as a Mg2+ transporter in overexpression studies
in Xenopus laevis oocytes (12), Mg2+ transport could not be directly measured in
mammalian cells using patch clamp analysis (31). On the other hand, modelling of the
CNNM2 cystathionine -synthase (CBS) domains resulted in the identification of an
Mg2+-ATP binding site, suggesting a role in Mg2+ sensing within the cell (6). Consequently,
the molecular mechanism explaining the role of CNNM2 in DCT-mediated Mg2+ transport
remains to be elucidated.
The CNNM2 gene is ubiquitously expressed in mammalian tissues, most prominently
in kidney, brain and lung (6, 38). Although the role of CNNM2 beyond the kidney has never
been studied, genome wide association studies have related the CNNM2 locus to blood
pressure, coronary artery disease and schizophrenia, suggesting an important role of
CNNM2 in the cardiovascular system and brain (4, 26). CNNM2 is widely conserved among
species. In Danio rerio, a frequently used model for ion homeostasis and human genetic
diseases in general (17, 22), the cnnm2 gene is duplicated and two paralogues, cnnm2a and
cnnm2b, are described (1). Both paralogues share a high conservation with human CNNM2
(79 % amino acid identity). In detail, transcripts are abundantly expressed in zebrafish brain
and in ionregulatory organs such as kidney and gills, which act as a pseudokidney in fish
(1). Consistent with the regulation of CNNM2 transcripts in mammals (12), the expression of
cnnm2a and cnnm2b is regulated by Mg2+ in vivo (1).

In the present study, we aim to elucidate the function of CNNM2 in brain and kidney.
Hence, we can demonstrate the genetic origin of symptoms in five unrelated families
164 | Chapter 7
suffering from a distinct phenotype of mental retardation, seizures and hypomagnesemia,

where we have identified novel mutations in the CNNM2 gene. By combining functional
analyses and a loss-of-function approach in the zebrafish model, we provide evidence for
a key role of CNNM2 in brain development, neurological activity and renal Mg2+ handling.
Results
Patients
Patients F1.1 and F1.2 presented in the neonatal period with cerebral convulsions. Serum
Mg2+ levels at manifestation were found to be 0.5 mmol/L in both patients (Table 1).
Convulsions were refractory to conventional antiepileptic medications. Intravenous Mg2+
supplementation with 1 mmol/kg body weight/day was initiated after oral Mg2+ failed to
correct serum Mg2+ levels. However, seizure activity continued even in face of normomagnesemia. An extensive analysis for infectious causes or inborn errors of metabolism
did not yield any positive results. Ultrasound examination of the kidneys did not reveal
nephrocalcinosis, whereas basal ganglia calcifications were noted in early central nervous
system (CNS) sonographies. During follow-up, severe developmental delay was noted
accompanied by microcephaly (head circumference below third percentile for age and
sex in both patients). A magnetic resonance imaging (MRI) at 5.5 years of age in patient
F1.1 showed wide supratentorial outer cerebrospinal liquor spaces with failure of oper
cularization together with a significantly reduced myelinization of the white matter tract
(Figure 1C-D). The severe degree of intellectual disability, which became apparent with
increasing age comprised major deficits in cognitive function, the inability to verbally
communicate, and severely limited motor skills. Both children are not able to perform
main activities of daily living and require full-time care by an attendant. Seizure activity is
sufficiently controlled in the brother by valproate and lamotrigine, electroencephalo
graphy (EEGs) merely shows generalized slowing, but no epileptic activity. In contrast,
the younger sister suffers from ongoing generalized, myoclonic seizures despite
antiepileptic treatment with valproate and levetiracetame. Laboratory investigations
during follow-up demonstrated persistent hypomagnesemia of 0.6 mmol/L despite
oral Mg2+ supplementation.

Patients F2.1, F3.1, and F4.1 presented with seizures during infancy (between 4 and 12
months of age). Laboratory evaluation yielded isolated hypomagnesemia of 0.5 mmol/L
(Table 1). Urine analyses demonstrated inappropriate fractional excretion for Mg2+ in face
of persistent hypomagnesemia. In addition, the renal Mg2+ leak was verified by Mg2+
loading tests in patients F2.1 and F4.1 as described before (37). Urinary calcium excretion rates
were normal, renal ultrasound excluded the presence of nephrocalcinosis. After acute therapy
with intravenous Mg2+, the patients received a continuous oral Mg2+ supplementation of 0.5
to 1 mmol/kg body weight/day of elemental Mg2+. This oral therapy however failed to
correct the hypomagnesemia, serum Mg2+ remained in the subnormal range in all three
children. Because of recurrent cerebral seizures, patients F2.1 to F4.1 received diverse
antiepileptic medications. Currently only patient F4.1 is still treated with clobazam.
In all three patients (F2.1 to F4.1), a significant degree of intellectual disability was
already noted in early childhood with delayed speech development, but also impaired
motor as well as cognitive skills. In addition, patient F4.1 was noted to exhibit disturbed
social interaction, abnormal verbal and non-verbal communication, as well as stereotyped
behaviour and finally received the formal diagnosis of early onset autism. All three patients
F2.1 to F4.1 were not able to attend regular schools. Standardized intelligence testing in
patients F2.1 and F3.1 revealed a significant degree of mental retardation (Table 1). While
patients F2.1 and F3.1 are currently living with their parents, patient F4.1 is placed in a
home for children with mental illness because of episodes of violence and destructive
behaviour. The parents of all three children (F2.1-F4.1) had normal serum Mg2+ levels and
no signs of intellectual disability.

Finally, patient F5.1 presented with muscle spasms and dysesthesia in adolescence.
Serum Mg2+ levels were found to be low (0.6 mmol/L). Because of concomitant
borderline hypokalemia, she was suspected to have Gitelman syndrome (OMIM #263800)
and received oral Mg2+ and K+ supplements. Also this patient exhibited a mild degree of
intellectual disability. Unfortunately, she was not available for further examination.
CNNM2 Mutations in Patients with Mental Retardation

Common genetic causes of mental retardation were excluded in patients F1.1 and F2.1 by
array CGH (comparative genomic hybridization). The presence of two affected siblings
together with the suspected parental consanguinity in family F1 suggested an autosomalrecessive pattern of inheritance. Therefore, we subjected patients F1.1 and F1.2 to
homozygosity mapping which, at a cut-off size of >1.7 megabases (Mb), yielded eleven
critical intervals on autosomes with a cumulative size of 62 Mb. The gene list generated
from these loci included 322 RefSeq genes and putative transcripts. CNNM2 in a critical
interval of 7.1 Mb on chromosome 10 emerged as the most promising candidate gene
because of its known role in Mg2+ metabolism (6, 12, 30, 31). Conventional Sanger
sequencing of the complete coding region of the CNNM2 gene revealed a homozygous
mutation, c.364G>A, leading to a non-conservative amino acid substitution of glutamate
to lysine at position 122 of the CNNM2 protein (p.Glu122Lys, Figure 1A-B). The mutation
was present in heterozygous state in both parents. After discovery of this homozygous
mutation in patients F1.1 and F1.2, a larger cohort (n=34) of patients with Mg2+ deficiency
of unknown origin was screened for mutations in the CNNM2 gene. Mutations in
heterozygous state were discovered in patients F2.1 to F5.1 (Table 1). However, sequencing
of the complete coding region and adjacent exon-intron boundaries did not reveal a
second pathogenic allele. Next, we examined the CNNM2 gene in parents and unaffected
siblings of families F2 to F4. The mutations previously identified in our patients were not
detected in either of the parents pointing to de novo mutational events. Interestingly,
166 | Chapter 7
Table 1 C
linical and Biochemical Data of the Patients
Patient
F1.1
F1.2
Gender
Male
Female
Ethnicity
Serbian
Serbian
Age at manifestation
1 day
6 days
Follow-up
12 years
8 years
Symptoms at manifestation
Seizures
Seizures
Treatment
Valproate
Lamotrigine
Valproate
Levetiracetame
Neuroimaging
Myelinization defects
Opercularization defect
Widened outer cerebrospinal liquor spaces
Mental retardation
Severe
Severe
Speech/ Communication
No verbal speech
Limited communication skills
No verbal speech
Limited communication skills
Additional symptoms
Very limited motor skills
Very limited motor skills
Initial serum
Mg2+ (mmol/L)
0.5
0.5
Follow-up serum Mg2+ (mmol/L)
0.66
0.54
Mutation
(DNA level)
c.364G>A
c.364G>A
Mutation
(Protein level)
p.Glu122Lys
p.Glu122Lys
Zygosity
Homozygous
Homozygous
Cognitive function
patients F2.1 and F4.1 exhibited the same mutation, p.Glu357Lys (c.1069G>A), affecting a
highly conserved amino acid residue in the 2nd membrane-spanning domain of the
CNNM2 protein. Also the p.Ser269Trp (c.806C>G) mutation detected in patient F3.1 affects
a highly conserved residue located in the 1st transmembrane domain. All three mutations
were ranked probably damaging by Polyphen-2 when tested for functional consequences
of the mutations (p.Glu122Lys, p.Ser269Trp and p.Glu357Lys with scores of 0.981, 1.000 and
1.000, respectively). Finally, in patient F5.1 with a late manifestation and putatively milder
phenotype, the variant p.Leu330Phe (c.988C>T) was identified in heterozygous state. This
variant affects an amino acid residue conserved among mammals, however a
phenylalanine appears at this position in certain fish species. The variant is predicted to be
possibly damaging by Polyphen-2 with a score of 0.711. None of the identified variants was
detected in 204 controls or present in publically available exome data.
F2.1
F3.1
F4.1
F5.1
Female
Female
Male
Female
German
German
German
Polish
7 months
1 years
4 months
16 years
12 years
20 years
12 years
None
Seizures
Seizures
Paresthesia
Seizures
Myoclonus
Paresthesia
Phenobarbital
Valproate
Clobazam
Unknown
Normal
Normal
Normal
Unknown
Moderate
Moderate
Moderate
Mild
IQ 55-57
IQ 55-59
Autism
Unknown
Expressive language
disorder
Expressive language
disorder
Limited speech and

vocabulary
Unknown
Impaired motor skills,

severe obesity
Impaired motor skills,

severe obesity
Impaired motor skills
Unknown
0.56
0.44
0.5
0.66
0.56
0.53
0.68
c.1069G>A
c.806C>G
c.1069G>A
c.988C>T
p.Glu357Lys
p.Ser269Trp
p.Glu357Lys
p.Leu330Phe
Heterozygous
Heterozygous
Heterozygous
Heterozygous
CNNM2 Increases Mg2+ Transport

To clarify the function of CNNM2, Human Embryonic Kidney (HEK293) cells were transiently
transfected with mouse Cnnm2 or mock constructs and examined for Mg2+ transport
capacity using the stable 25Mg2+ isotope. At baseline, approximately 10 % of the total
intracellular Mg2+ content consists of 25Mg2+, which is the natural abundance of 25Mg2+
(39). By incubating the cells in a physiological buffer containing pure 25Mg2+, the
intracellular 25Mg2+ concentration increases over time. Interestingly, Cnnm2 expressing
cells displayed a higher 25Mg2+ uptake compared to mock cells (Figure 2A). After 5 min,
Cnnm2-expressing cells had approximately 2 times more 25Mg2+ uptake than mock-transfected cells (Figure 2B). All further experiments were performed at the 5 min time point to
cover the exponential phase of the uptake. To reduce the background in 25Mg2+ uptake,
inhibitors of known Mg2+ channels and transporters were added during the uptake
168 | Chapter 7
F1
F2
p.Glu122Lys
+/-
+/+
+/-
-/-
+/+
+/-
F4
-/-
-/-
-/-
+/-
-/-
-/F3.1
F5
p.Glu357Lys
-/-
p.Ser269Trp
F2.1
F1.2
F1.1
F3
p.Glu357Lys
p.Leu330Phe
-/-
+/-
-/-
+/-
F4.1
F5.1
p.Glu122Lys
p.Glu357Lys
Plasma Membrane
ER Membrane
p.Ser269Trp
p.Leu330Phe
Figure 1 Pedigrees and Magnetic Resonance Imaging (MRI) Studies of Families with
Primary Hypomagnesemia
A, Pedigrees of families F1-F5. Filled symbols represent affected individuals, mutant alleles are
indicated by a minus (-) and plus (+) sign, respectively. B, Localization of the mutations in the CNNM2
protein structure (Uniprot Q9H8M5). CNNM2 contains a long signal peptide (64 amino acids) that is
cleaved at the membrane of the endoplasmic reticulum. The remaining part of the CNNM2 protein
is trafficked to the plasma membrane, where it becomes functionally active. White dots show the
locations of the mutations. C-D, MRI of the brain of patient F1.1 (C, T2 weighed images) and patient
F2.1 (D, T2 weighed images). Left: Coronal images demonstrating a defect in myelinization of
U-fibers (arrows) in patient F1.1 in contrast to a normal myelin pattern in patient F2.1. Center: Coronal
T2 weighted images showing widened outer cerebrospinal liquor spaces (dashed arrows) and lack
of opercularization (solid arrows) in patient F1.1, whereas a regular brain volume and insular lobe is
observed in patient F2.1. Right: Absence of cerebellar structural abnormalities in patients F1.1 and
F2.1 on axial T2 weighted images at the level of the trigeminal nerve.
Figure 1 Continued
process; 2-Aminoethoxydiphenyl borate (2-APB) to inhibit TRPM7 (3), Ouabain to block the
Na+-K+-ATPase (40), Quinidin for SLC41A1 (20) and Nitrendipin (13) for silencing MagT1
activity (Figure 2C). Only 2-APB was capable of significantly inhibiting 25Mg2+ uptake in
HEK293 cells. Moreover, 2-APB inhibition also abolished the CNNM2-dependent increase
in 25Mg2+ uptake. Dose-response experiments confirmed that the IC50 of 2-APB inhibition
is 22 mol/L (Figure 2D). CNNM2-dependent 25Mg2+ uptake was found to be independent
of Na+ and Cl- availability, when uptakes were performed in N-methyl-d-glucamine
(NMDG) or Gluconate buffers (Figure 2E). Interestingly, the highest CNNM2-dependent
25Mg2+ uptake was measured between 1-2 mmol/L, suggesting a K in the physiological
m
range of approximately 0.5 mmol/L (Figure 2F). At high Mg2+ concentrations (5 mmol/L),
25Mg2+ uptake was inhibited. When subjected to 24 hours 25Mg2+ loading, Cnnm2-
expressing cells showed a significantly higher 25Mg2+ content baseline. Subsequently,
15 min extrusion of Cnnm2-expressing cells demonstrated no difference in Mg2+ extrusion
rate compared to mock-transfected cells (Figure 2G).
Mutations Impair CNNM2-dependent Mg2+ Uptake

To characterize the effect of the CNNM2 mutations identified in our hypomagnesemic
patients, 25Mg2+ uptake was determined in HEK293 cells expressing mutant CNNM2
proteins. Of all missense mutations that are identified to date, only p.Leu330Phe was
capable of increasing 25Mg2+ uptake to a similar extent as wild-type CNNM2 (Figure 3A).
All other CNNM2 mutants exhibited severely decreased 25Mg2+ uptake or had lost their
ability to increase 25Mg2+ uptake completely. To examine whether CNNM2 dysfunction
can be explained by a reduced plasma membrane expression, all mutants were subjected
to cell surface biotinylation analysis. Indeed, p.Glu122Lys CNNM2 membrane expression
was significantly reduced compared with wild-type CNNM2 (66 % decrease, P < 0.05) and
p.Ser269Trp CNNM2 showed a trend towards reduction (46 % decrease, Figure 3B).
170 | Chapter 7
20
15
100
50
8 10 12 14 16
0
k
150
oc
200
25
10
250
M
*
100
50
200
100
*
50
0
in
10 -7
ip
10 -6
nd
in
10 -5
10 -4
10 -3
[2-APB] (M)
150
100
50
200
100
uc
Cl
Gl
DG
50
0
[25 Mg 2+ ] (mM)
Na
NM
150
25
0
Na
Mg 2+ uptake (% of mock)
200
Cl
25
Ni
Qu
t re
id
in
ain
PB
ab
Ou
NT
150
25
150
2A
25
Time (min)
25
NM
Intracellular 25 Mg 2+
(% of total Mg 2+ )
30
CN
Intracellular 25 Mg 2+
(% of total Mg 2+ )
95
90
85
80
75
70
0
Time (min)
Figure 2 C
NNM2 Increases Mg2+ Uptake in HEK293 Cells
A, Time curve of 25Mg2+ uptake in mock (circles) and CNNM2 (squares) transfected cells. B, Representation
of the normalized Mg2+ uptake after 5 min. C, 25Mg2+ uptake in the presence of inhibitors of ion
transporters, black bars represent mock cells and white bars represent CNNM2-transfected cells.
D, Dose-response curve of 25Mg2+ transport inhibition by 2-APB in mock (circles) and CNNM2 (squares)
transfected cells. E, The effect of Na+ and Cl- availability on 25Mg2+ uptake in mock (black bars)
and CNNM2 (white bars) transfected cells. F, 25Mg2+ uptake as a function of extracellular 25Mg2+
availability in mock (circles) and CNNM2 (squares) transfected cells. G, 25Mg2+ extrusion in mock
(circles) and CNNM2 (squares) transfected cells. Each data point represent the mean of 3 independent
experiments SEM. * indicates significant differences compared to mock (P < 0.05).
mock
*
*
200
150
CNNM2
CNNM2-p.Glu122Lys
CNNM2-p.Ser269Trp
CNNM2-p.Leu330Phe
100
CNNM2-p.Glu357Lys
CNNM2-p.Thr568Ile
50
25
Mg uptake (% of mock)
250
10
15
Time (min)
B
mock
CNNM2
CNNM2
Cell surface
fraction
CNNM2
p.Glu122Lys
WT
Biotin
CNNM2
p.Ser269Trp
CNNM2
p.Leu330Phe p.Glu357Lys
CNNM2
p.Thr568Ile
kDa
116
97
Total protein
fraction
116
150
100
50
le
8I
56
hr
p.T
p.
Gl
Ph
Tr
p
r2
69
u3
30
Le
p.
Se
p.
Gl
p.
u3
57
Ly
s
W
T
u1
22
Ly
s
Biotinylated Fraction (% of WT)
97
Figure 3 C
NNM2 Mutations Impair Mg2+ Uptake in HEK293 Cells
A, Time curve of 25Mg2+ uptake in mock, wild-type CNNM2 and mutant CNNM2 transfected
cells. Symbols indicate cells transfected with the vector empty ( mock) or containing CNNM2
sequences encoding for wild-type or mutant CNNM2 proteins ( CNNM2, CNNM2-p.Glu122Lys,
CNNM2-p.Ser269Trp, CNNM2-p.Leu330Phe, CNNM2-p.Glu357Lys, CNNM2-p.Thr568Ile).
Each data point represent the mean of 3 independent experiments SEM. * indicates significant
differences compared to mock (P < 0.05). B, Representative immunoblots showing that p.Glu122Lys
and p.Ser269Trp mutations reduce CNNM2 membrane expression (upper blot) and a CNNM2
expression control (lower blot). Quantification of cell surface expression of wild-type (WT) and
mutant CNNM2 proteins corrected for total protein expression. Results are the mean SEM of 3
independent experiments. * indicate significant differences compared to WT CNNM2 transfected
cells (P < 0.05).
172 | Chapter 7
Disturbed Mg2+ Homeostasis and Brain Abnormalities in cnnm2

Morphant Zebrafish Larvae
Patients with mutations in CNNM2 suffer from hypomagnesemia. Therefore, zebrafish
cnnm2 morphants were tested for disruptions of their Mg2+ homeostasis. Extraction of
serum from zebrafish embryos is technically not feasible. Thus, total body Mg contents of
controls and morphant larvae were examined at 5 days post-fertilization (dpf). During
these 5 days of zebrafish development, intestinal absorption of Mg2+ does not take place
since larvae do not eat and drink. For that reason, Mg2+ homeostasis is the result of the
balance between Mg2+ excretion, passive Mg2+ uptake from the yolk, Mg2+ reabsorption
in the kidney, and Mg2+ uptake in the integument, where ionocytes are analogous to renal
tubular cells in terms of function and transporter and channel expression (17). Therefore,
when knocking down a gene involved in active epithelial Mg2+ uptake, disturbances in
total body Mg content reliably represent disturbances in active Mg2+ reabsorption and/or
uptake, through pronephric (renal) tubular cells and/or their analogous in the skin,
respectively.
The cnnm2a gene, one of the two zebrafish cnnm2 paralogues, is expressed during
early development (Figure 4A). Injection in embryos of higher doses than 2 ng of
morpholino (MO) blocking cnnm2a translation resulted in a significantly reduced survival
compared to controls at 5 dpf (Figure 4B). At non-lethal doses of MO (when mortality
caused by the cnnm2a-MO does not differ significantly from mortality in controls),
knockdown of cnnm2a resulted in morphological phenotypes characterized by enlarged
pericardial cavities and notochord defects (Figure 4C-D). The biochemical equivalency
between mammalian CNNM2 and its zebrafish orthologue Cnnm2a was demonstrated
by the fact that co-injection of cnnm2a-MO with mouse wild-type Cnnm2 cRNA induced
a rescue of all phenotypes observed (Fig. 4E). Conversely, co-injection with mouse mutant
Cnnm2 cRNA did not result in any rescue. In line with the symptom of hypomagnesemia
in patients with mutated CNNM2, cnnm2a morphants exhibited significantly reduced
levels of Mg compared to controls when increasing doses of MO were injected (Figure 4F).
Total Mg content in cnnm2a morphants was restored to control levels when cnnm2a-MO
was co-injected with cRNA encoding for mouse wild-type CNNM2 and not with mutant
Cnnm2 (Figure 4G). This demonstrated that the defects observed in morphants were
indeed caused by dysfunctional cnnm2a and not by toxic off-target effects.
Zebrafish cnnm2b is also expressed during early development (Figure 5A). Survival in
cnnm2b morphants was not affected by the knockdown (Figure 5B). The cnnm2b morphants
were characterized by enlarged pericardial cavities, kidney cysts and, in agreement with
the morphological brain abnormalities observed in the F1.1 patient, by accumulation of
cerebrospinal fluid in the cerebrum (Figure 5C-D). Interestingly, most cnnm2b morphants
were morphologically normal at the dose of 2 ng MO/embryo (Figure 5D). All morphological
phenotypes were rescued by co-injection of cnnm2b-MO with mouse wild-type Cnnm2
(Figure 5E). As for cnnm2a, cnnm2b was demonstrated to reduce Mg levels when knocked
Passive diffusion of Mg2+ from the yolk
1.4
B
120
Epithelial (integument) absorption of Mg2+

Pronephric (re)absorption of Mg2+
1.2
1.0
0.8
0.6
0.4
0.2
100
Survival at 5 dpf (%)
80
60
40
20
0.0
0
0
2
4
6
cnnm2a -MO (ng/embryo)
97
Class I
Class II
Class III
Class IV
Class V
Dead
yo
yo
110
100
Class I
Class II
Class III
Class IV
Class V
Dead
M
O
W
TC
NN
M
O
M
2
+
M
TC
NN
M
2
tro
Co
n
br
br
em
O/
M
g
119
117
Class V
4n
g
2n
94
em
tro
ty
Co
n
W
ild
-
Class IV
94
O/
120
100
80
60
40
20
0
100
Class III
93
pe
Class II
120
100
80
60
40
20
0
Class I
Phenotype (%)
Phenotype (%)
Time (hours post-fertilization)
100 120
8n
80
yo
60
br
40
em
20
O/
cnnm2a mRNA expression

in wild-type zebrafish (fold change)
10
10
Mg ( g Mg/mg protein)
Figure 4 K nockdown of cnnm2a Results in Mg Wasting in aZebrafish Larvae

a
8
TC
NN
NN
TC
Co
nt
ro
b
A, mRNA expression
ofbcnnm2a in developing zebrafish.6 Expression patterns
were banalysed by
6
b
RT-qPCR (n=6). B, Survival curve bat 5 dpf (n=3). The dose of zero represents injection with control-MO.
4
4
C, Morphological phenotypes in zebrafish larvae (5 dpf) in cnnm2a knockdown experiments.
2
D, Distribution of morphological phenotypes in zebrafish2 larvae (5 dpf) untreated (wild-type) or
injected with0different doses of cnnm2a-MO or control-MO.0 Numbers on top of the bars indicate the
0
2
4
6
8
number of animals
in each
experimental
condition.
E, Distribution of morphological phenotypes
in zebrafish larvae at 5 dpf in rescue experiments. The wild-type phenotype (class I) was restored
in morphants by co-injection of cnnm2a-MO (2 ng MO/embryo) with wild-type CNNM2 cRNA
(50 pg cRNA/embryo), but not with mutant (p.Glu357Lys) CNNM2 cRNA (50 pg cRNA/embryo).
F, Magnesium content in zebrafish injected with different doses of cnnm2a-MO, the dose of zero
represents injection with control-MO (n=10 except in 8 ng MO-injected zebrafish where n=5).
G, Rescue of Mg wasting in morphant zebrafish by co-injection of cnnm2a-MO (2 ng MO/embryo)
with cRNA encoding for wild-type (WT) CNNM2 (50 pg cRNA/embryo). Co-injection with cRNA
encoding for mutant (MT, p.Glu357Lys) CNNM2 (50 pg cRNA/embryo) did not restore Mg levels
(n = 10 per experimental condition). Data are presented as mean SEM. Different letters indicate
significant differences between mean values in experimental groups (P < 0.05).
110
100
Class I
Class II
Class III
Class IV
Class V
Dead
M
O
M
O
Co
n
tro
M
O
W
TC
NN
M
2
+
M
TC
NN
M
2
Phenotype (%)
Class V
174 | Chapter 7
119
117
100
80
60
40
20
0
G
a
4
2
a
b
4
2
0
2
NN
M
+
W
O
+
M
O
M
120
Epithelial (integument) absorption of Mg2+

Pronephric (re)absorption of Mg
Passive diffusion of Mg2+ from the yolk
45
40
35
30
25
20
15
10
5
0
2+
100
Survival at 5 dpf (%)
cnnm2b mRNA expression

in wild-type zebrafish (fold change)
Figure 4 C
ontinued
2
NN
TC
TC
2
4
6
Co
nt
ro
l
10
10
80
60
40
20
0
20
40
60
80
100 120
2
4
6
cnnm2b -MO (ng/embryo)
120
100
105
101
102
104
104
Phenotype (%)
Figure 5 K nockdown of cnnm2b Results in Mg Wasting

and Brain MalformationsClass
inIII
Class
80
Class I
Class III
60
Zebrafish Larvae
Class IV
40
20
Dead
2
0
TC
TC
NN
NN
M
2
M
2
O
M
W
M
+
M
O
nt
ro
2
4
6
Co
Co
n
tro
M
O
W
TC
NN
O
M
2
+
M
TC
NN
M
2
Phenotype (%)
2n
W
ild
-ty
pe
Co
nt
ro
O/
l
em
4n
br
g
M
yo
O/
em
8n
br
g
M
yo
O/
em
br
yo
A, mRNA expression of cnnm2b in developing zebrafish. Expression

patterns were analysed by RT0
Class IIpoint). B, SurvivalClass
III
qPCR (n=6 per time
curve
at 5 dpf (n=3). The dose of zero represents injection
with control-MO. C, Morphological phenotypes in zebrafish larvae (5 dpf) in cnnm2b knockdown
experiments. D, Distribution of morphological phenotypes in zebrafish larvae (5 dpf) untreated
E 120 107
(wild-type) or injected with different doses of cnnm2b-MO
or control-MO.
malformations
106
100 Brain
116
100
Class I
Classspaces,
IV
Class
II
80 are prominent in morphants
(widened cerebrospinal fluid
class IV phenotype)
injected
Class III
60
with 4-8 ng MO/embryo. Numbers on top of the bars 40
indicate the number of animals
ClassinIV each
Dead
experimental condition. E, Distribution of morphological 20
phenotypes in zebrafish larvae at 5 dpf in
0
rescue experiments. The wild-type phenotype (class I) was restored in morphants by co-injection
of cnnm2b-MO (8 ng MO/embryo) with wild-type CNNM2 cRNA (50 pg cRNA/embryo), but not
with mutant (p.Glu357Lys) CNNM2 cRNA (50 pg cRNA/embryo). F, Magnesium content in zebrafish
injected
F with10different doses of cnnm2b-MO. The dose
G of10zero represents injection with control-MO
(n=10). G, Rescuea of Mg wasting in morphant zebrafish by co-injection
of cnnm2b-MO (8 ng MO/
a
a
b
embryo) with8 cRNA encoding
for wild-type (WT) CNNM28(50 pg cRNA/embryo). Co-injection with
6 for mutant (MT, p.Glu357Lys) CNNM2 (50 pg
6 cRNA/embryo)
cRNA encoding
b did not restore Mg levels
c
c
c
(n=10). Data are
presented
as
mean
SEM.
Different
letters
indicate
significant
differences between
4
4
mean values in experimental groups (P < 0.05).
Survival at 5 dpf (
cnnm2b mRNA expr

in wild-type zebrafish (fol
30
25
20
15
10
5
0
80
60
40
20
CNNM2 Mutations Impair
Brain and Kidney Function | 175
0
20
40
60
80
100 120
2
4
6
D
Class I
120
100
80
60
40
20
0
120
100
80
60
40
20
0
Class III
105
101
102
104
104
Class I
Class II
Class III
Class IV
Dead
W
ild
-ty
pe
2n
Co
g
n
tro
M
O/
l
em
4n
br
g
M
yo
O/
em
8n
br
g
M
yo
O/
em
br
yo
107
106
100
116
Class I
Class II
Class III
Class IV
Dead
Co
nt
ro
Class IV
M
O
W
TC
NN
O
M
2
+
M
TC
NN
M
2
Class II
Phenotype (%)
Phenotype (%)
G
a
4
2
0
10
a
4
2
2
NN
TC
NN
TC
W
M
+
O
M
nt
ro
2
4
6
Co
10
Figure 5 Continued
down (Figure 5F) and to be functionally equivalent to mammalian CNNM2 in cRNA rescue
experiments (Figure 5G). Phenotype rescue with mouse wild-type Cnnm2 demonstrated
the absence of toxic off-target effects and the specificity of the cnnm2b-MO to produce
defects attributable to impaired CNNM2 function.
Brain Abnormalities and Increased Spontaneous Contractions in cnnm2

Morphant Zebrafish Embryos
Patients with CNNM2 mutations suffer from mental retardation and seizures. As the severe
neurological phenotype in patients F1.1 and F1.2 was diagnosed early after birth (Table 1),
we hypothesized that the deleterious effects of mutant CNNM2 could result from early
developmental defects in brain primordia. In zebrafish, the segmental organization of the
brain rudiment, and morphologically visible boundaries and primordia are established at
25 hours post-fertilization (hpf). At this stage, maldevelopment of the midbrain hindbrain
boundary (MHB) is observed in cnnm2a morphant embryos (Figure 6A-B). Interestingly,
176 | Chapter 7
H
FV
Phenotype (%)
Class I
0.33 mM Mg2+
99
111 111
120
100
80
60
40
20
0
Class I
Class II
Dead
15
10
5
109
116
l
tro
O
M
108
106
Class I
Class II
Dead
c
b
a
M
W
O
TC
NN
O
M
+
2
M
TC
NN
M
2
O
M
M
O
W
ild
-ty
pe
Co
nt
ro
l
12
10
8
6
4
2
0
tro
W
ild
-
25 mM Mg2+
Co
n
0.33 mM Mg2+
Seizures
(contractions/30 sec)
12
10
8
6
4
2
0
ty
pe
Co
nt
ro
l
Seizures
Co
n
W
ild
-
M
O
W
ild
-ty
pe
Co
nt
ro
l
120
100
80
60
40
20
0
M
O
W
TC
NN
M
M
2
O
+
M
TC
NN
M
2
25 mM Mg2+
Phenotype (%)
0.33 mM Mg2+
20
ty
pe
Co
nt
ro
l
W
ild
-
ty
pe
Co
nt
ro
l
Class II
25 mM Mg2+
104 109
106
MHB
M
O
W
ild
-ty
pe
Co
nt
ro
l
Figure 6 D
ysfunctional cnnm2a Causes Brain Abnormalities and Increased Spontaneous
Contractions in Zebrafish Embryos
A, Phenotypes in zebrafish embryos untreated (wild-type, WT) or following treatment with (2 ng MO/
embryo) cnnm2a-MO or control-MO. M, midbrain; T, tectum; MHB, midbrain-hindbrain boundary;
FV, fourth ventricle; and H, hindbrain. B-C, Distribution of (B) phenotypes and (C) Mg content in
zebrafish embryos WT or injected with cnnm2a-MO or control-MO and exposed to a medium with
a concentration of Mg2+ of 0.33 or 25 mmol/L. Numbers on top of the bars indicate the number
of animals. D, Restoration of normal brain development by co-injection of cnnm2a-MO with cRNA
encoding for WT CNNM2, and not by co-injection with cRNA encoding for mutant (MT, p.Glu357Lys)
CNNM2. E, Spontaneous contractions in zebrafish embryos WT or injected with cnnm2a-MO
or control-MO and exposed to a medium with a concentration of Mg2+ of 0.33 or 25 mmol/L.
F, Restoration of normal spontaneous contraction activity by co-injection of cnnm2a-MO with cRNA
encoding for WT CNNM2, and not by co-injection with cRNA encoding for MT CNNM2. Data are
presented as mean SEM. *P < 0.05 versus WT and control. #P < 0.05 versus Mg2+-normal (0.33 mmol/L
Mg2+) medium. Data are presented as mean SEM. Letters indicate significant differences between
experimental groups (P < 0.05).
these phenotypes could not be rescued by exposure to media with high Mg2+ concentrations
(Figure 6B), even though these media significantly increased the Mg content of morphant
embryos (Figure 6C). More importantly, phenotypes were rescued by co-injection with
the mouse orthologue cRNA and not by co-injection with the mutant transcript (Figure
6D). In addition to brain developmental defects, the frequency of spontaneous embryonic
contractions was increased in cnnm2a morphants compared to controls (Figure 6E), which
could indicate that (motor) neurons are hyperexcitable (24). This phenotype was not
rescued by exposure to high Mg2+ concentrations in the medium (Figure 6E). In contrast,
co-injection of the cnnm2a-MO with mouse wild-type Cnnm2 cRNA did result in a rescue
of the neurological functioning (Figure 6F). Conspicuously, co-injection with the mutant
Cnnm2 cRNA even worsened this motor neuronal phenotype by increasing the number of
spontaneous contractions significantly compared to embryos injected only with cnnm2a-MO
(Figure 6F).

In the case of cnnm2b morphants, enlarged tectums were also present in a 30 % of
morphants in addition to the defects in the MHB, phenotypes that were not rescued by
exposure to high Mg2+ concentrations (Figure 7A-C) but by co-injection of cnnm2b-MO
with mouse wild-type Cnnm2 cRNA (Figure 7D). Spontaneous contraction frequency was
increased in cnnm2b morphants (Figure 7E), restored to control levels with overexpression
of mouse wild-type Cnnm2 (Figure 7F), and 4-fold increased with overexpression of mouse
mutant Cnnm2 compared to cnnm2b morphants injected solely with cnnm2b-MO (Figure 7F).
Weaker Touch-evoked Escape Behaviour in cnnm2 Morphant Zebrafish

Larvae
As our in vitro data pointed to a putative interaction between CNNM2 and TRPM7 and
zebrafish morphants presented brain developmental defects, the touch-evoked escape
behaviour in zebrafish was evaluated, a parameter largely dependent on TRPM7 activity in
sensory neurons and/or brain development (10, 23, 28). Indeed, in cnnm2a and cnnm2b
morphants (at 5 dpf), touch-evoked escape behaviour was significantly weaker than that
in controls (Figures 8-9). Additionally, this phenotype was rescued by co-injection of the
MO with wild-type Cnnm2 cRNA and not by mutant Cnnm2 cRNA. As for the other
phenotypes, cRNA rescues proved the causality between the weak touch-evoked escape
behaviour in morphants and dysfunctional cnnm2 paralogues.
178 | Chapter 7
25 mM Mg2+
#
15
10
5
Phenotype (%)
0.33 mM Mg2+
20
107
112
125
120
100
80
60
40
20
0
124
115
101
106
124
112
Class I
Class II
Class III
Dead
l
tro
O
M
25 mM Mg2+
100
Class I
Class II
Class III
Dead
*
O
M
10
5
O
M
W
ild
-
M
O
W
ild
-ty
pe
Co
nt
ro
l
15
M
W
O
TC
NN
M
+
2
M
TC
NN
M
2
10
20
15
tro
25 mM Mg2+
Co
n
0.33 mM Mg2+
Seizures
20
ty
pe
Co
nt
ro
l
Seizures
Co
n
W
ild
-
M
O
W
ild
-ty
pe
Co
nt
ro
l
ty
pe
Co
nt
ro
l
Class III
0.33 mM Mg2+
120
100
80
60
40
20
0
W
ild
-ty
pe
Co
nt
ro
l
Class II
Phenotype (%)
Class I
FV
M
O
W
ild
-ty
pe
Co
nt
ro
l
M MHB
M
O
W
TC
NN
M
M
2
O
+
M
TC
NN
M
2
Figure 7 D
ysfunctional cnnm2b Causes Brain Abnormalities and Increased Spontaneous
Contractions in Zebrafish Embryos
A, Phenotypes in zebrafish embryos untreated (wild-type, WT) or following treatment with cnnm2bMO (8 ng MO/embryo) or control-MO. See Figure 6 for an explanation of the abbreviations shown.
B-C, Distribution of (B) phenotypes and (C) Mg content in zebrafish embryos WT or injected with
cnnm2b-MO or control-MO and exposed to a medium with a concentration of Mg2+ of 0.33 or 25
mmol/L. Numbers on top of the bars indicate the number of animals in each experimental condition.
D, Restoration of normal brain development by co-injection of cnnm2b-MO with cRNA encoding for
WT CNNM2 and not by co-injection with cRNA encoding for mutant (MT, p.Glu357Lys) CNNM2. E,
Spontaneous contractions in zebrafish embryos WT or injected with cnnm2b-MO or control-MO
and exposed to a medium with a concentration of Mg2+ of 0.33 or 25 mmol/L. F, Restoration of
normal spontaneous contraction activity by co-injection of cnnm2b-MO with cRNA encoding for
WT CNNM2 and not by co-injection with cRNA encoding for MT CNNM2. Data are presented as
mean SEM. *P < 0.05 versus wild-type and control. #P < 0.05 versus Mg2+-normal (0.33 mmol/L
Mg2+) medium. Data are presented as mean SEM. Different letters indicate significant differences
between mean values in experimental groups (P < 0.05).
Control
0 cs
110 cs
119 cs
121 cs
126 cs
110 cs
164 cs
173 cs
191 cs
Morphant
0 cs
Touch-evoked
escape behaviour score
a
b
2
NN
TC
NN
TC
W
M
+
O
M
O
M
Co
nt
ro
Figure 8 T ouch-evoked Escape Behaviour in cnnm2a Morphant Zebrafish

Touch-evoked escape behaviour score in zebrafish cnnm2a morphants at 5 dpf after injection
of 2 ng control-MO/embryo, 2 ng cnnm2a-MO/embryo, 2 ng cnnm2a-MO/embryo + 50 pg wildtype (WT) CNNM2 cRNA/embryo, or 2 ng cnnm2a-MO/embryo + 50 pg mutant (MT, p.Glu357Lys)
CNNM2 cRNA/embryo. Three categories were distinguished, responders, late responders and nonresponders, to which the following scores were given: 3 points for responders: fish quickly react
(swimming or flicking the tail) to the stimuli after 1 or 2 twitches; 2 points for late responders:
fish react (swimming or flicking the tail) to the stimuli after 3, 4 or 5 twitches; and 1 point for nonresponders: fish do not react to the stimuli after more than 5 twitches. The upper part of the
figure shows frames of videos showing touch-evoked escape contractions at 5 dpf of control
and morphant zebrafish larvae. Time of each video frame is indicated in centiseconds (cs). Data
are shown as mean SEM (n = 30). Different letters indicate significant differences between mean
values in experimental groups (P < 0.05).
180 | Chapter 7
Control
0 cs
169 cs
271 cs
275 cs
278 cs
262 cs
292 cs
312 cs
324 cs
Morphant
0 cs
Touch-evoked
escape behaviour score
a
a
M
TC
NN
M
2
+
M
O
M
O
TC
NN
M
2
M
O
Co
nt
ro
l
Figure 9 T ouch-evoked Escape Behaviour in cnnm2b Morphant Zebrafish

Touch-evoked escape behaviour score in zebrafish cnnm2b morphants at 5 dpf after injection
of 8 ng control-MO/embryo, 8 ng cnnm2b-MO/embryo, 8 ng cnnm2b-MO/embryo + 50 pg wildtype (WT) CNNM2 cRNA/embryo, or 2 ng cnnm2b-MO/embryo + 50 pg mutant (MT, p.Glu357Lys)
CNNM2 cRNA/embryo. Three categories were distinguished, responders, late responders and nonresponders, to which the following scores were given: 3 points for responders: fish quickly react
(swimming or flicking the tail) to the stimuli after 1 or 2 twitches; 2 points for late responders: fish
react (swimming or flicking the tail) to the stimuli after 3, 4 or 5 twitches; and 1 point for nonresponders: fish do not react to the stimuli after more than 5 twitches. The upper part of the
figure shows frames of videos showing touch-evoked escape contractions at 5 dpf of control
and morphant zebrafish larvae. Time of each video frame is indicated in centiseconds (cs). Data
are shown as mean SEM (n = 30). Different letters indicate significant differences between mean
values in experimental groups (P < 0.05).
Discussion
In the present study, a severe brain phenotype consisting of cerebral seizures, mental
retardation and brain malformations in patients with hypomagnesemia was shown to be
caused by mutations in CNNM2. Our experiments established CNNM2 as a new essential
gene in brain development, neurological functioning and Mg2+ homeostasis. This notion
is supported by the following observations; i) hypomagnesemic patients with CNNM2

mutations suffer from seizures, mental disability, and if mutations are present in recessive
state, brain malformations are observed in addition; ii) Mg2+ supplementation does not
improve the neurological phenotype of the patients; iii) CNNM2 increases Mg2+ uptake in
HEK293 cells, whereas mutant CNNM2 does not; iv) knockdown of CNNM2 orthologues in
zebrafish results in impaired development of the brain, abnormal neurodevelopmental
phenotypes manifested as altered locomotor and touch-evoke escape behaviours, and
Mg wasting; v) the zebrafish phenotype can be rescued by injection of mouse Cnnm2
cRNA.
In addition to the previously reported dominant mode of inheritance (31), the genetic
findings in our patients support heterogenous patterns of inheritance. In family F1, a recessive
mode of CNNM2 inheritance was observed. The homozygous CNNM2 p.Glu122Lys
mutation in this family resulted in the manifestation of a neonatal onset and a considerably
more severe cerebral involvement than in the remaining patients. Yet, a CNS phenotype
with seizures and intellectual disability, which was not reported previously, represented
the cardinal clinical symptom in all of our patients. Seizures constituted the major
symptom at manifestation coinciding with hypomagnesemia, but were also seen during
follow-up despite Mg2+ supplementation. Pronounced Mg2+ deficiency reflected by
severely low serum Mg2+ levels clearly represents a promotive element in the development
of seizures. However, the persistence of seizure activity despite Mg2+ supplementation
might point to a genuine disturbance in brain function caused by defective CNNM2.
Accordingly, the extent of hypomagnesemia found in the two siblings with the recessive
mutation, F1.1 and F1.2, was identical to other patients (F2.1-F5.1) with heterozygous CNNM2
mutations and a milder neurological phenotype. Continuous oral Mg2+ supplementation
stabilized serum Mg2+ levels in the subnormal range, however a complete normalization
of Mg2+ metabolism could not be achieved in any of the patients.

In three out of five families (F2, F3 and F4), the mutation of the patient was not present
in the parents. This finding supports the recent advancements evidencing that de novo
mutations provide an important mechanism in the development of mental disability
disorders (35). Remarkably, the same de novo p.Glu357Lys mutation was identified in two
unrelated individuals. Although the mutation rate along the human genome varies
significantly (15), the chance to observe an identical de novo base pair change in two
individuals is extremely small, supporting causality of this mutation. The clinical and
genetic findings observed in patient F5.1 should be interpreted with caution. Though the
p.Leu330Phe variant was not present in controls or exome variant databases, the presence
of an innocuous polymorphism cannot be completely excluded. The clinical phenotype
with a milder degree of intellectual disability and a later manifestation with
hypomagnesemic symptoms during adolescence support a partial loss of CNNM2
function caused by the p.Leu330Phe variant. Unfortunately, the patient was not available
for clinical re-evaluation.
182 | Chapter 7

Over the recent years, the function of CNNM2 in the context of Mg2+ handling has
been heavily debated (6, 12, 30, 31, 38). Therefore, an important question is how CNNM2
mutations cause impaired Mg2+ metabolism and lead to CNS dysfunction. Functional
studies in HEK293 cells demonstrated a putative role in cellular Mg2+ transport.
Overexpression of CNNM2 increased cellular Mg2+ uptake, which was abrogated by
introduction of the CNNM2 mutants identified in our patients. The p.Ser269Trp and
p.Glu357Lys mutants as well as the previously published p.Thr568Ile mutant (31), all
identified in heterozygous state, failed to enhance the cellular Mg2+ uptake, indicating a
loss-of-function in mutated CNNM2. The recessively inherited p.Glu122Lys mutant
identified in patients F1.1 and F1.2 displayed a small but significant residual function, while
Mg2+ uptake was almost completely retained for mutant p.Leu330Phe. Biotinylation
experiments demonstrated a trafficking defect of p.Glu122Lys and p.Ser269Trp mutants
supporting a loss-of-function nature of CNNM2 mutations. Together, these findings argue
for distinct degrees of severity of the disease depending on the number of affected alleles.
Furthermore, a small residual function of p.Glu122Lys is in line with the lack of a clinical
phenotype in the parents of family F1. The parents, however, declined a thorough
evaluation of their Mg2+ status.

To further analyze the relevance of CNNM2 for brain and Mg2+ metabolism deduced
from the human disease model, the translation of orthologues of CNNM2 (cnnm2a and
cnnm2b) was knocked down in zebrafish. In line with the human disease, the concentration
of total body Mg was decreased in zebrafish cnnm2a and cnnm2b morphants when
compared to controls. The decrease in total body Mg content is interpreted as a decrease
in the renal absorption and/or skin uptake (through ionocytes analogous to renal tubular
cells) of the ionic fraction, Mg2+, since only Mg2+ is transported transcellularly and no
intestinal Mg2+ uptake takes place in zebrafish larvae. Additionally, Mg losses observed in
morphant larvae were rescued by expression of wild-type Cnnm2, but not by expression
of mutant Cnnm2. This demonstrates the specificity of our MO antisense oligos, as well as
the functional equivalence between mammalian CNNM2 and its zebrafish orthologues.

Consistent with the human pathology, knockdown of cnnm2a or cnnm2b induced
brain malformations. Specifically, the brain phenotype observed in cnnm2b morphants
resembles that found in patient F1.1 showing enlarged outer cerebrospinal liquor spaces.
This provides further consistency to link CNNM2 dysfunction with the brain morphological
defects found in this homozygous patient. The absence of outer cerebrospinal liquor
spaces in the cerebrum of cnnm2a morphants shows that cnnm2 paralogues in zebrafish
are a case of subfunctionalization at the level of the cerebrum. CNS malformations were
rescued in morphants by co-injection with mouse wild-type Cnnm2.

In homozygous patients, the neurological defects became evident early after birth. In
line with a developmental role for CNNM2 within the CNS, gene expression of zebrafish
cnnm2a and cnnm2b peaked within the first 24 hpf. In addition, in situ hybridization located
cnnm2a expression specifically in the MHB (33), an organizing center in the neural tube
that determines neural fate and differentiation in the CNS during development (8, 29).
Indeed, the most striking brain developmental defect in our study is maldevelopment of
the MHB. These defects were rescued with Cnnm2 cRNA. Interestingly, the brain
phenotypes observed in both zebrafish and patients were independent of Mg2+, as Mg2+
supplementation was unsuccessful to rescue the phenotypes. Thus, our findings suggest
that a brain-specific CNNM2 function is crucial for the development of constitutive regions
of the CNS, which in the zebrafish model is illustrated by defects in the MHB.

At 25 hpf, a time point in which the locomotor behaviour is unaffected by the brain
and only depends on signals from the spinal cord (28), zebrafish morphant embryos
displayed an increased frequency of spontaneous contractions, especially when the MOs
were co-injected with mutant Cnnm2. This hyperexcitability of motor neurons suggests a
function of zebrafish Cnnm2 proteins in the regulation of the activity of the neurological
network in the spinal cord or in the synaptic junctions with muscle fibbers. Consistent
with these findings, patients with mutations in CNNM2 presented impaired motor skills,
which were severe in the case of homozygous patients.

In the CNS, TRPM7 is essential during early development (19), as it modulates neuro
transmitter release in sensory neurons (2, 21). Specifically, when using 2-APB, an inhibitor
of TRPM7 (3), CNNM2-dependent Mg2+ transport was abolished in HEK293 cells.
Remarkably, in a similar fashion to knockdown of trpm7 in zebrafish (10, 23), cnnm2a or
cnnm2b morphants showed weaker touch-evoked escape behaviour compared to
controls. In 5 dpf larvae, and unlike in 25 hpf embryos, locomotor behaviours elicited by
touch require the involvement of high brain structures (28). Therefore, it is reasoned that
CNNM2 conditions locomotor behaviour with an etiology that can be related to lack of
excitation of sensory neurons via TRPM7 and/or to the defects in early brain development
observed in zebrafish morphant embryos. In kidney, where CNNM2 is expressed at the
basolateral membrane in DCT, specific regulation of TRPM7 Mg2+ reabsorption is unlikely,
since TRPM6 is the main Mg2+ transporter in this segment. TRPM7 is a ubiquitously
expressed gene regulating cellular Mg2+ metabolism, which is for instance involved in
regulation of brain Mg2+ levels (16). Therefore, one could hypothesize that CNNM2 may
regulate other proteins in addition to TRPM7 in kidney for the control of Mg2+ reabsorption,
which remain to be identified.

In conclusion, our findings of CNNM2 mutations in patients with hypomagnesemia
and severe neurological impairment widen the clinical spectrum of CNNM2-related
disease. By establishing a zebrafish CNNM2 loss-of-function model of the genetic disease,
we provide a unique model for the testing of novel therapeutic drugs targeting CNNM2.
Acknowledgements
The authors are grateful to the patients for their participation in this study. We thank
Lonneke Duijkers, Jelle Eygensteyn, Margo Dona, Sami Mohammed and Andreas
Kompatscher for excellent technical support. We thank W. Schwindt, Department of
184 | Chapter 7
Clinical Radiology, and Heymut Omran, Department of General Pediatrics, University

Hospital Mnster for help with the interpretation of neuroimaging studies. This work was
supported by grants from the Netherlands Organization for Scientific Research (ZonMw
9120.8026, NWO ALW 818.02.001), a Dutch Kidney Foundation Innovation Grant (IP11.46),
the EURenOmics project from the European Union seventh Framework Programme
(FP7/20072013, agreement n 305608) and NWO Vici Grant to JGJH (016.130.668). This
work was further supported by the Hans-Joachim-Bodlee-Stifung and by the PeterStiftung.

Ethics Statement
All genetic studies were approved by the local ethics committee. Patients or their parents
provided written informed consent in accordance to the Declaration of Helsinki. All animal
experiments were performed in agreement with European, National and Institutional regulations.
Patients
We studied a cohort of six patients from five families with hypomagnesemia and mental
retardation. Patients F1.1 to F4.1 are followed in secondary or tertiary care neuropediatric
centres. Neuroimaging was performed in F1.1, F2.1, F3.1, and F4.1 by cranial MRI (magnetic
resonance imaging). Psychological diagnostic evaluation in patients F2.1 and F3.1 was
performed using Snijders Oomen Non-Verbal (SON) Intelligence Test (revised) 5.5-17 years.
Copy number variations (CNVs) associated with neurodevelopmental delay and intellectual
disability were excluded in patients F1.1 and F2.1 by array CGH (comparative genomic
hybridization) using the Sureprint G3 Human CGH Microarray kit (Agilent Technologies,
Boeblingen, Germany) in patient F1.1 and using the Affymetrix Cytogenetics Whole-
Genome 2.7 Array in patient F2.1.
Homozygosity Mapping and CNNM2 Mutational Analysis

Genomic DNA of affected individuals and available family members was extracted from
whole blood using standard methods. A genome scan for shared homozygous regions
was performed in the two affected children F1.1 and F1.2 with suspected parental
consanguinity. Samples were genotyped on an Illumina human 660W Quad beadchip
SNP array (Illumina, Eindhoven, The Netherlands). Merlin 1.1.2 (University of Michigan, Ann
Arbor, MI, USA) was used to determine homozygous regions by linkage analysis. As exact
information on pedigree structure was missing, we used a 1.7 Mb threshold for regions
identical by descent that is very rarely crossed by non-consanguineous samples, but
allows to identify most of the true homozygosity regions if parental consanguinity is
present (14). A list of candidate genes within the identified homozygous intervals was
generated including known Refseq genes as well as novel transcripts using Ensembl
Genome assembly GRCh37 via biomart (www.ensembl.org). At a cut-off size of >1.7 Mb,
eleven critical intervals were yielded on autosomes with a cumulative size of 62 Mb. The
gene list generated from these loci included 322 RefSeq genes and putative transcripts,
including CNNM2 in a critical interval of 7.1 Mb on chromosome 10. The entire coding
region and splice-sites of the most promising candidate gene CNNM2 were sequenced
from both strands (Genbank: NM_017649.4, Uniprot: Q9H8M5). After discovery of a
homozygous mutation in the index family F1, the mutational screening was extended to
patients with hypomagnesemia without mutations in known genes involved in hereditary
magnesium wasting. The presence of newly identified CNNM2 sequence variations was
tested in at least 204 ethnically matched control alleles and compared to publically
available exome data (www.1000genomes.org; evs.gs.washington.edu). Additionally, all
identified mutations were ranked for potential damage on protein function using
Polyphen-2 (genetics.bwh.harvard.edu/cgi-bin/ggi/ggi2.cgi).
DNA Constructs
Mouse wild-type Cnnm2 construct was cloned into the pCINeo HA IRES GFP vector as
described previously (6). Cnnm2 mutations were inserted in the construct using the
QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the
manufacturers protocol. All constructs were verified by sequence analysis. Primer
sequences used for cloning or mutagenesis PCR are reported in Table 2.
Table 2 P
rimer Sequences for Mutagenesis PCR
Mutation
Sequence
E122K
GGTCCCGCATCGCCTTCACTAAGCACGAGCGGCGCCGGCAC
GTGCCGGCGCCGCTCGTGCTTAGTGAAGGCGATGCGGGACC
CATCTCGCTGCTGCTGTGCCTGTGGGGCATGTTCAGCGGCCTCAAC
GTTGAGGCCGCTGAACATGCCCCACAGGCACAGCAGCAGCGAGATG
GTACTGGTCAACACCACGTTCACCATCCTGCTGGACGAC
GTCGTCCAGCAGGATGGTGAACGTGGTGTTGACCAGTAC
GGCATCGTCATCTTCGGAAAAATCGTGCCCCAAGCCATC
GATGGCTTGGGGCACGATTTTTCCGAAGATGACGATGCC
S269W
L330F
E357K
Cell Culture
HEK293 cells were grown in Dulbeccos modified eagles medium (DMEM, Bio Whittaker-
Europe, Verviers, Belgium) containing 10 % (v/v) fetal calf serum (PAA, Liz, Austria),
2 mmol/L L-glutamine and 10 g/mL non-essential amino acids, at 37 C in a humiditycontrolled incubator with 5 % (v/v) CO2. The cells were transiently transfected with the
186 | Chapter 7
respective DNA constructs using Lipofectamin 2000 (Invitrogen, Breda, The Netherlands)
at 1:2 DNA:Lipofectamin ratio for 48 hrs unless otherwise stated.
Cell Surface Biotinylation

HEK293 cells were transfected with wild-type and mutant CNNM2 constructs for 48 hrs.
Subsequently, cell surface proteins were biotinylated as described previously (11). Briefly,
cell surface proteins were biotinylated for 30 min at 4 C in 0.5 mg/mL sulfo-NHS-LC-LCbiotin (Pierce, Rockford, IL, USA). Cells were washed and lysed in lysis buffer (150 mmol/L
NaCl, 5 mmol/L EGTA, Triton 1 % (v/v), 1 g/mL pepstatin, 1 mmol/L PMSF, 5 g/mL
leupeptin, 5 g/mL aproptin, 50 mmol/L Tris/HCl pH 7.5). 10 % (v/v) of the sample was
taken as input control and the rest of the protein lysates were incubated overnight with
NeutrAvidin-agarose beads (Pierce, Rockford, IL, USA) at 4 C. The next day, unbound
protein was discarded by washing the beads 5 times with lysis buffer. The remaining
protein lysates were denatured in Laemmli containing 100 mmol/L DTT for 30 min at 37 C
and subsequently subjected to SDS-PAGE. Then, immunoblots were incubated with
mouse anti-HA 1:5,000 primary antibodies (Cell Signaling Technology, Danvers, MA, USA)
and peroxidase conjugated sheep anti-mouse secondary antibodies 1:10,000 (Jackson
Immunoresearch, Suffolk, UK).
Magnesium Transport Assays

HEK293 cells were transfected with wild-type and mutant CNNM2 constructs for 48 hrs
and seeded on poly-L-lysine (Sigma, St Louis, MO, USA) coated 12-well plates. Mg2+ uptake
was determined using a stable 25Mg2+ isotope (Cortecnet, Voisins Le Bretonneux, France),
which has a natural abundance of 10 %. Cells were washed with basic uptake buffer (in
mmol/L: 125 NaCl, 5 KCl, 0.5 CaCl2, 0.5 Na2HPO4 0.5 Na2SO4, 15 HEPES/NaOH pH 7.5) and
subsequently placed in basic uptake buffer containing 1 mmol/L 25Mg2+ (purity 98 %) for
5 min unless stated differently. After washing three times with ice-cold PBS, the cells were
lysed in HNO3 (65 %, Sigma) and subjected to ICP-MS (inductively coupled plasma mass
spectrometry) analysis. For extrusion experiments, cells were transfected with wild-type
or mutant CNNM2 constructs for 24 hrs. After 24 hrs, cells were placed in culture medium
containing 1 mmol/L 25Mg2+ (purity 98 %) for an additional 48 hrs. Before the start of the
experiment, the cells were briefly washed in basic uptake buffer and subsequently placed
in basic uptake buffer containing 0.5 mmol/L Mg2+ (containing 10 % 25Mg2+) for 5 min.
After washing three times with ice-cold PBS, the cells were lysed in nitric acid and
subjected to ICP-MS analysis.
Morpholino Knockdown and Rescue Experiments

Wild-type Tupfel long-fin zebrafish were bred and raised under standard conditions (28.5
C and 14 hrs of light: 10 hrs of dark cycle) in accordance with international and institutional
guidelines. Zebrafish eggs were obtained from natural spawning. The following antisense
oligonucleotides (MOs) were raised against the translational start site of cnnm2a and
cnnm2b, along with the standard mismatch control MO (Gene Tools, Philomath, OR, USA):
cnnm2a, 5-GCGGTCCATTGCTCTGCCATGTTGA-3; cnnm2b, 5-ACCGACGGTTCTGCCATGTTGATAA-3; and the negative control (standard mismatch MO), directed against a human
-globin intron mutation, 5-CCTCTTACCTCAGTTACAATTTATA. The underlined areas
indicate the complementary sequences to the initial methionines of cnnm2a and cnnm2b.
MOs were diluted in deionized, sterile water supplemented with 0.5 % (w/v) phenol red
and injected in a volume of 1 nL into the yolk of one- to two-cell stage embryos using a
Pneumatic PicoPump pv280 (World Precision Instruments, Sarasota, FL, USA). Wild-type
(uninjected) embryos were also included in the experiments to control for the effects of
the injection procedure per se. To determine the most effective dose of the cnnm2a- and
cnnm2b-MO, 2, 4 and 8 ng were injected. In these experiments, control embryos were
injected with 8 ng of the standard mismatch control MO (the highest dose). After injection,
embryos from the same experimental condition were placed in 3 Petri dishes (at a
maximum density of 45 embryos/dish, allowing statistical comparisons between survivals
in the different experimental conditions) and cultured at 28.5 C in E3 embryo medium (in
mmol/L: 5 NaCl, 0.17 KCl, 0.33 CaCl2, 0.33 MgSO4), which was refreshed daily. As criteria for
subsequent experiments, the dose of MO that caused major effects and induced a
percentage of mortality non-significantly different from controls was injected (2 ng for
cnnm2a-MO and 8 ng for cnnm2b-MO). In experiments that implied exposure to high
Mg2+ concentrations, the high Mg2+ medium had a composition of 5 mmol/L NaCl, 0.17
mmol/L KCl, 0.33 mmol/L CaCl2 and 25 mmol/L MgSO4. In order to control for the
specificity of the MOs blocking the translation of cnnm2a and cnnm2b, as well as for toxic
off-target effects, in vivo cRNA rescue experiments were performed (9). For these
experiments, mouse wild-type CNNM2 and mutant (p.Glu357Lys) CNNM2 cRNAs were
prepared using the mMESSAGE mMACHINE Kit (Ambion, Austin, TX, USA) according to the
manufacturers instructions. The cRNAs, in an amount of 50 pg, as based on other studies
(24), were (co)injected together with MOs or alone as described above. Zebrafish embryos
and larvae were phenotyped at 25 hpf or 5 dpf, respectively.
Analysis of Phenotypes in Zebrafish Embryos and Larvae

For the analyses of brain phenotypes, the brain rudiment of zebrafish embryos at 25 hpf
was observed for morphological changes under a Leica MZFLIII microscope (Leica
Microsystems Ltd, Heerburgg, Germany). Morphological phenotypes, which also included
the brain, were also analysed in larvae at 5 dpf. Embryos or larvae were classified into
different classes of phenotypes on the basis of comparisons with stage-matched control
embryos of the same clutch. In cnnm2a morphant embryos (25 hpf), two phenotype
classes were distinguished: class I, normal; and class II, embryos with underdeveloped
MHB. In cnnm2a morphant larvae (5 dpf), the following classes were distinguished: class I,
normal; class II, normal with non-inflated swim bladder; class III, larvae with enlarged
188 | Chapter 7
pericardial cavity (edema) and non-inflated swim bladder; class IV, larvae with notochord
defects, enlarged pericardial cavity and non-inflated swim bladder; and class V, larvae with
severely enlarged pericardial cavity, notochord defects and non-inflated swim bladder. In
cnnm2b morphant embryos (25 hpf), three different phenotypes were distinguished: class
I, normal; class II, embryos with underdeveloped MHB; and class III, embryos with
underdeveloped MHB and enlarged tectum. In cnnm2b morphant larvae (5 dpf), the
number of different phenotypes distinguished were four: class I, normal; class II, normal
with non-inflated swim bladder; class III, larvae with enlarged pericardial cavity (edema)
and non-inflated swim bladder; and class IV, larvae with widened outer cerebrospinal fluid
spaces, kidney cysts, severely enlarged pericardial cavity and non-inflated swim bladder.
Representative images were obtained with a DFC450C camera (Leica Microsystems Ltd)
after anaesthetising embryos or larvae with tricaine/Tris pH 7.0 solution. Prior to
anaesthesia and image acquisition, zebrafish embryos were manually dechorionated.
Mg2+ Determinations in Embryos and Larvae

Zebrafish embryos or larvae were anesthetized with tricaine/Tris pH 7.0 solution and 5-7
individuals were pooled as one sample. Samples were then snap frozen in liquid nitrogen
and stored at -80C in order to ensure euthanasia of animals and remained at these storage
conditions until the beginning of the analytical procedures.
Analytical procedures started by quickly washing the samples with nanopure water in
order to avoid contamination of remaining waterborne Mg2+. The washing procedure was
repeated twice. Fish were then dried at 65 C for 1.5 hrs, at which time 2.5 L of HNO3 (65
%, Sigma) was added to each tube. Samples were digested at 65 C during 1.5 hrs. After,
digested samples were diluted 1:10 with 22.5 L nanopure water. The total Mg content in
each sample was determined with a commercial colorimetric assay (Roche Diagnostics,
Woerden, The Netherlands) following the manufacturers protocol. Blanks (HNO3 diluted
1:10 with nanopure water) were added during assays and values were equal to zero.
Within-run precision and accuracy was controlled by means of an internal control
Precinorm (Roche Diagnostics). Samples from embryos exposed to 25 mmol/L Mg2+ were
further diluted (1:20). Furthermore, samples were normalized by protein content, which
was determined in 1:20 (embryos at 25 hpf) or 1:50 (larvae at 5 dpf) diluted samples using
the PierceTM BCA protein assay kit (Pierce Biotechnology, Rockford, IL, USA).
Total RNA Isolation, cDNA Synthesis and Real Time PCR Analysis
Zebrafish embryos or larvae at specific developmental times (6, 12, 24, 48, 72, 96 and 120
hpf) were anaesthetised with tricaine/Tris pH 7 solution and 10 individuals were pooled as
one sample. RNA isolation, cDNA synthesis and quantitative real-time PCR (RT-qPCR)
measurements were carried out as previously described using validated cnnm2a and
cnnm2b primers (1). Samples were normalized to the expression level of the housekeeping
gene elongation factor-1 (elf1) (1). Relative mRNA expression was analysed using the
Livak method (2Ct), where results are expressed relative to the gene expression at 6 hpf
(time point chosen as calibrator).
Spontaneous Contraction Analysis and Touch-evoked Escape Behaviour

At 25 hpf, 10 zebrafish embryos per Petri dish (n=30 per experimental condition) were
randomly selected. The number of complete body contractions each zebrafish made in
30 s period was counted and was used as indicative of motor neuron activity (28).
Representative videos of each experimental condition were taken using Leica Application
Suite (Leica Microsystems Ltd) and a Leica MZFLIII microscope (Leica Microsystems Ltd)
equipped with a DFC450C camera (Leica Microsystems Ltd).

For the analysis of the touch-evoked escape behaviour, 10 zebrafish larvae per Petri
dish (n=30 per experimental condition) were randomly selected. Touch-evoked escape
behaviours were elicited by touching a larva in the tail up to 6 times with a pair of forceps
at 5 dpf. Three categories were distinguished, responders, late responders and nonresponders, to which the following scores were given: 3 points for responders: fish quickly
react (swimming or flicking the tail) to the stimuli after 1 or 2 twitches; 2 points for late
responders: fish react (swimming or flicking the tail) to the stimuli after 3, 4 or 5 twitches;
and 1 point for non-responders: fish do not react to the stimuli after more than 5 twitches.
Representative videos were recorded with the system described above.
All results are depicted as mean standard error of the mean (SEM). Statistical analyses
were conducted by one- or two-way (for experiments where zebrafish embryos were
exposed to different Mg2+ concentrations, then two factors of variance appear: Mg2+
concentration and treatment) ANOVA. Where appropriate, data were logarithmically
transformed to fulfil the requirements for ANOVA, but all data are shown in their decimal
values for clarity. When data did not comply with the premises of the parametric ANOVA,
data were analyzed using a Kruskal-Wallis ANOVA on ranks. Tukeys post-test was used to
identify significantly different groups. Statistical significance was accepted at P < 0.05.
190 | Chapter 7
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Arjona FJ, Chen YX, Flik G, Bindels RJ, and Hoenderop JG. Tissue-specific expression and in vivo regulation
of zebrafish orthologues of mammalian genes related to symptomatic hypomagnesemia. Pflugers Arch 2013.
Brauchi S, Krapivinsky G, Krapivinsky L, and Clapham DE. TRPM7 facilitates cholinergic vesicle fusion
with the plasma membrane. Proc Natl Acad Sci U S A 105: 8304-8308, 2008.
Chokshi R, Fruasaha P, and Kozak JA. 2-aminoethyl diphenyl borinate (2-APB) inhibits TRPM7 channels
through an intracellular acidification mechanism. Channels (Austin) 6: 362-369, 2012.
Consortium SPG-WASG. Genome-wide association study identifies five new schizophrenia loci. Nat Genet
43: 969-976, 2011.
de Baaij JH, Groot Koerkamp MJ, Lavrijsen M, van Zeeland F, Meijer H, Holstege FC, Bindels RJ, and
Hoenderop JG. Elucidation of the distal convoluted tubule transcriptome identifies new candidate genes
involved in renal magnesium handling. Am J Physiol Renal Physiol doi:10.1152/ajprenal.00322.2013: 2013.
de Baaij JH, Stuiver M, Meij IC, Lainez S, Kopplin K, Venselaar H, Muller D, Bindels RJ, and Hoenderop
JG. Membrane topology and intracellular processing of cyclin M2 (CNNM2). J Biol Chem 287: 13644-13655, 2012.
Dimke H, Monnens L, Hoenderop JG, and Bindels RJ. Evaluation of Hypomagnesemia: Lessons From
Disorders of Tubular Transport. Am J Kidney Dis 2012.
Dworkin S, and Jane SM. Novel mechanisms that pattern and shape the midbrain-hindbrain boundary. Cell
Mol Life Sci 2013.
Eisen JS, and Smith JC. Controlling morpholino experiments: dont stop making antisense. Development 135:
1735-1743, 2008.
Elizondo MR, Arduini BL, Paulsen J, MacDonald EL, Sabel JL, Henion PD, Cornell RA, and Parichy DM.
Defective skeletogenesis with kidney stone formation in dwarf zebrafish mutant for trpm7. Curr Biol 15:
667-671, 2005.
Gkika D, Mahieu F, Nilius B, Hoenderop JG, and Bindels RJ. 80K-H as a new Ca2+ sensor regulating the
activity of the epithelial Ca2+ channel transient receptor potential cation channel V5 (TRPV5). J Biol Chem 279:
26351-26357, 2004.
Goytain A, and Quamme GA. Functional characterization of ACDP2 (ancient conserved domain protein), a
divalent metal transporter. Physiol Genomics 22: 382-389, 2005.
Goytain A, and Quamme GA. Identification and characterization of a novel mammalian Mg2+ transporter
with channel-like properties. BMC Genomics 6: 48, 2005.
Hildebrandt F, Heeringa SF, Rschendorf F, Attanasio M, Nrnberg G, Becker C, Seelow D, Huebner N,
Chernin G, Vlangos CN, Zhou W, OToole JF, Hoskins BE, Wolf MT, Hinkes BG, Chaib H, Ashraf S,
Schoeb DS, Ovunc B, Allen SJ, Vega-Warner V, Wise E, Harville HM, Lyons RH, Washburn J, Macdonald
J, Nrnberg P, and Otto EA. A systematic approach to mapping recessive disease genes in individuals from
outbred populations. PLOS Genet 5: e10000353, 2009.
Hodgkinson A, and Eyre-Walker A. Variation in the mutation rate across mammalian genomes. Nat Rev
Genet 12: 756-766, 2011.
Hoenderop JG, and Bindels RJ. Calciotropic and magnesiotropic TRP channels. Physiology (Bethesda) 23:
32-40, 2008.
Hwang P-P, and Chou M-Y. Zebrafish as an animal model to study ion homeostasis. Pflgers Arch 465:
1233-1247, 2013.
Jin J, Wu LJ, Jun J, Cheng X, Xu H, Andrews NC, and Clapham DE. The channel kinase, TRPM7, is required
for early embryonic development. Proc Natl Acad Sci USA 109: E225-E233, 2012.
Jin J, Wu LJ, Jun J, Cheng X, Xu H, Andrews NC, and Clapham DE. The channel kinase, TRPM7, is required
for early embryonic development. Proc Natl Acad Sci U S A 109: E225-233, 2012.
Kolisek M, Nestler A, Vormann J, and Schweigel-Rontgen M. Human gene SLC41A1 encodes for the Na+/
Mg(2)+ exchanger. Am J Physiol Cell Physiol 302: C318-326, 2012.
Krapivinsky G, Mochida S, Krapivinsky L, Cibulsky SM, and Clapham DE. The TRPM7 ion channel
functions in cholinergic synaptic vesicles and affects transmitter release. Neuron 52: 485-496, 2006.
Lieschke GJ, and Currie PD. Animal models of human disease: zebrafish swim into view. Nature Reviews
Genetics 8: 353-367, 2007.
23. Low SE, Amburgey K, Horstick E, Linsley J, Sprague SM, Cui WW, Zhou W, Hirata H, Saint-Amant L,
Hume RI, and Kuwada JY. TRPM7 is required within zebrafish sensory neurons for the activation of
touch-evoked escape behaviors. J Neurosci 31: 11633-11644, 2011.
24. Mahmood F, Mozere M, Zdebik AA, Stanescu HC, Tobin J, Beales PL, Kleta R, Bockenhauer D, and
Russell C. Generation and validation of a zebrafish model of EAST (epilepsy, ataxia, sensorineural deafness
and tubulopathy) syndrome. Dis Model Mech 6: 652-660, 2013.
25. Moser J, Kilb W, Werhahn KJ, and Luhmann HJ. Early developmental alterations of low-Mg2+ -induced
epileptiform activity in the intact corticohippocampal formation of the newborn mouse in vitro. Brain Res
1077: 170-177, 2006.
26. Newton-Cheh C, Johnson T, Gateva V, Tobin MD, Bochud M, Coin L, Najjar SS, Zhao JH, Heath SC,
Eyheramendy S, Papadakis K, Voight BF, Scott LJ, Zhang F, Farrall M, Tanaka T, Wallace C, Chambers
JC, Khaw KT, Nilsson P, van der Harst P, Polidoro S, Grobbee DE, Onland-Moret NC, Bots ML, Wain LV,
Elliott KS, Teumer A, Luan J, Lucas G, Kuusisto J, Burton PR, Hadley D, McArdle WL, Brown M,
Dominiczak A, Newhouse SJ, Samani NJ, Webster J, Zeggini E, Beckmann JS, Bergmann S, Lim N,
Song K, Vollenweider P, Waeber G, Waterworth DM, Yuan X, Groop L, Orho-Melander M, Allione A, Di
Gregorio A, Guarrera S, Panico S, Ricceri F, Romanazzi V, Sacerdote C, Vineis P, Barroso I, Sandhu MS,
Luben RN, Crawford GJ, Jousilahti P, Perola M, Boehnke M, Bonnycastle LL, Collins FS, Jackson AU,
Mohlke KL, Stringham HM, Valle TT, Willer CJ, Bergman RN, Morken MA, Doring A, Gieger C, Illig T,
Meitinger T, Org E, Pfeufer A, Wichmann HE, Kathiresan S, Marrugat J, ODonnell CJ, Schwartz SM,
Siscovick DS, Subirana I, Freimer NB, Hartikainen AL, McCarthy MI, OReilly PF, Peltonen L, Pouta A,
de Jong PE, Snieder H, van Gilst WH, Clarke R, Goel A, Hamsten A, Peden JF, Seedorf U, Syvanen AC,
Tognoni G, Lakatta EG, Sanna S, Scheet P, Schlessinger D, Scuteri A, Dorr M, Ernst F, Felix SB, Homuth
G, Lorbeer R, Reffelmann T, Rettig R, Volker U, Galan P, Gut IG, Hercberg S, Lathrop GM, Zelenika D,
Deloukas P, Soranzo N, Williams FM, Zhai G, Salomaa V, Laakso M, Elosua R, Forouhi NG, Volzke H,
Uiterwaal CS, van der Schouw YT, Numans ME, Matullo G, Navis G, Berglund G, Bingham SA, Kooner
JS, Connell JM, Bandinelli S, Ferrucci L, Watkins H, Spector TD, Tuomilehto J, Altshuler D, Strachan DP,
Laan M, Meneton P, Wareham NJ, Uda M, Jarvelin MR, Mooser V, Melander O, Loos RJ, Elliott P,
Abecasis GR, Caulfield M, and Munroe PB. Genome-wide association study identifies eight loci associated
with blood pressure. Nat Genet 41: 666-676, 2009.
27. Runnels LW. TRPM6 and TRPM7: A Mul-TRP-PLIK-cation of channel functions. Curr Pharm Biotechnol 12: 42-53,
2011.
28. Saint-Amant L, and Drapeau P. Time course of the development of motor behaviors in the zebrafish
embryo. Journal of Neurobiology 37: 622-632, 1998.
29. Scholpp S, and Brand M. Neural Patterning: MidbrainHindbrain Boundary. In: Encyclopedia of Neuroscience,
edited by Editor-in-Chief:Larry RS. Oxford: Academic Press, 2009, p. 205-211.
30. Sponder G, Svidova S, Schweigel M, Vormann J, and Kolisek M. Splice-variant 1 of the ancient domain
protein 2 (ACDP2) complements the magnesium-deficient growth phenotype of Salmonella enterica sv.
typhimurium strain MM281. Magnes Res 23: 105-114, 2010.
in dominant hypomagnesemia. Am J Hum Genet 88: 333-343, 2011.
activity and surface expression. J Am Soc Nephrol 20: 78-85, 2009.
33. Thisse B, and Thisse C. Fast Release Clones: A High Throughput Expression Analysis. ZFIN Direct Dat
Submission (http://zfin.org), 2004.
34. van de Graaf SF, Bindels RJ, and Hoenderop JG. Physiology of epithelial Ca2+ and Mg2+ transport. Rev
Physiol Biochem Pharmacol 158: 77-160, 2007.
35. Veltman JA, and Brunner HG. De novo mutations in human genetic disease. Nat Rev Genet 13: 565-575, 2012.
forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J Biol Chem 279: 19-25,
2004.
192 | Chapter 7
Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck GE, Englehardt
hypocalcemia. Nat Genet 31: 171-174, 2002.
38. Wang CY, Shi JD, Yang P, Kumar PG, Li QZ, Run QG, Su YC, Scott HS, Kao KJ, and She JX. Molecular
cloning and characterization of a novel gene family of four ancient conserved domain proteins (ACDP). Gene
306: 37-44, 2003.
39. White JR, and Cameron AE. The Natural Abundance of Isotopes of Stable Elements. Physical Review 74:
991-1000, 1948.
40. Whittam R, and Wheeler KP. The sensitivity of a kidney ATPase to ouabain and to sodium and potassium.
Biochim Biophys Acta 51: 622-624, 1961.
37.
196 | Chapter 8
Abstract
The transient receptor potential melastatin type 6 (TRPM6) ion channel regulates the body
Mg2+ homeostasis by mediating transcellular Mg2+ absorption in kidney and intestine.

Here, the P2X4 receptor was established as a novel regulator of TRPM6 activity. Using
RT-qPCR on a mouse tissue panel, P2x4 and P2x6 were shown to be expressed in the
epithelium of the colon and of the kidney, two major sites of Mg2+ reabsorption. While
P2x4 was highly expressed in the colon, both P2x4 and P2x6 mRNA were prominently
expressed in the distal convoluted tubule (DCT) segment of the kidney, a segment with
high Trpm6 expression. Using whole-cell patch clamp, an inhibitory role of P2X4 on TRPM6
activity was determined. Expression of P2X6, which does not form functional channels in
mammalian cells, did not affect the function of TRPM6. The inhibition was dependent on
the activity of P2X4, since a P2X4 mutant with altered ATP sensitivity was not able to inhibit
TRPM6. Additionally, P2X4 was unable to inhibit TRPM7, a close homologue of TRPM6,
suggesting that the inhibition is specific for TRPM6. To identify the intracellular signaling
molecules that mediate the P2X4-dependent inhibition of TRPM6, the cells were treated
with inhibitors of PKC, PKA and PI3K. However, none of these inhibitors prevented the
inhibition of TRPM6 by P2X4.

In conclusion, we propose that P2X4 receptor mediated purinergic signaling is a new
regulatory mechanism of TRPM6 Mg2+ channels.
Keywords: Magnesium, Colon, Purinergic Receptor, P2X4, TRPM6
P2X4 Regulates the Activity of TRPM6 | 197
Introduction
Magnesium (Mg2+) plays a key role in bone formation, neuronal excitability and muscular
function, which can be explained by its numerous cellular functions such as Ca2+-channel
antagonist, inhibitor of Ca2+ signaling, NMDA receptor blocker and cofactor in over
300 enzymatic reactions. Among patients in the intensive care unit more than 50 %
present disturbed Mg2+ balance (25). To keep serum Mg2+ levels within a constant range
(0.7-1.1 mmol/L), the intestine facilitates uptake of Mg2+, bone serves as the body Mg2+
store and the kidney regulates the excretion of Mg2+ (9).
Two separate absorption mechanisms facilitate Mg2+ uptake in the gut and the
kidney. First, paracellular uptake allows the passive transport of Mg2+ from the lumen of
the small intestine to the blood through the tight junctions between the cells (34). The
fine-tuning of Mg2+ absorption is achieved in the colon and in the distal convoluted
tubule (DCT) segment of the nephron, where the transient receptor potential melastatin
type 6 (TRPM6) channels function as the gatekeepers of transcellular Mg2+ transport (34,
45). Mutations causing loss of function of TRPM6 are the predominant cause for familial
hypomagnesaemia where blood Mg2+ falls below the normal range (9, 35, 46). Knockout
(KO) of Trpm6 is lethal in mice, whereas the heterozygous animals display a mild hypomagnesaemia due to reduced intestinal and renal Mg2+ (re)absorption (52). In the DCT, TRPM6
has been shown to be regulated by a variety of factors, including: epidermal growth
factor (EGF)(14, 40), insulin (29), estrogens (13) and acid-base status (30). In addition, various
transporters and channels are necessary to maintain a favorable electrochemical gradient
for transcellular Mg2+ uptake (reviewed in (9)). In contrast, factors regulating intestinal
Mg2+ absorption are largely unknown although it was demonstrated that dietary Mg2+
intake modulates the expression of TRPM6 (13).

ATP acts as an autocrine and paracrine modulator of ion transport processes in the
kidney and intestine (24, 32). In the intestine, high amounts of ATP (25-500 mol/L) are
released in response to different stimuli, such as flow and neuronal activation (5). Two
types of P2 purinergic receptors are expressed at the cell surface of epithelial cells. Whereas
P2Y receptors act as G-protein coupled receptors, P2X receptors form ATP-activated ion
channels (3, 31). The P2X receptor family consists of seven subtypes (P2X1-7) with distinct
expression profiles and biophysical properties (3, 31). P2X receptors assemble in homo- or
heterotrimers with large extracellular loops forming one or multiple ATP binding sites (3,
18). Activation of P2X receptors by extracellular ATP leads to the non-selective influx of
cations into the cell. P2X receptors are commonly described as inhibitors of ion transport
processes (24). In the kidney, P2X receptors negatively modulate water, Mg2+ and Na+
reabsorption (7, 26, 48, 51). Interestingly, a previous study described the P2X-dependent
inhibition of Mg2+ influx in mouse DCT cells (7). Although the number of studies on the
effects of P2X receptors on transport activity beyond the kidney is limited, recent
publications support an inhibitory role in bone and intestine (1, 33).
198 | Chapter 8

In the present study, we aim to clarify the expression and the role of P2X receptors in
the regulation of transcellular epithelial Mg2+ transport in the intestine and the kidney.
After providing a transcriptional profile of P2X subunits in a mouse tissue panel, the renal
expression of P2X4 and P2X6 was examined in detail using immunohistochemistry. With a
combination of biochemistry and electrophysiology, a previously unknown inhibitory role
of P2X4 on TRPM6 activity was demonstrated, suggesting that purinergic signaling is an
important modulator of Mg2+ homeostasis.
Results
Expression Profile of P2X1-7 Subunits
In order to determine the expression of P2X channels in Mg2+-transporting epithelia, the
distribution of P2x1-7 subunits was assessed in a mouse cDNA tissue panel using RT-PCR.
A broad range of intestinal tissues were chosen with the aim of pinpointing the expression
of the different P2x to the distinct segments of the gut. Notably, P2x4 is the most expressed
P2x subunit in the distal intestine, including colon and cecum, which are known for high
capacity in transcellular Mg2+ reabsorption via TRPM6 (13). The expression of P2x4 is
generally high in tissues with strong ion transporting capacities such as intestines, kidney
and lung (Figure 1D). P2x6 mRNA levels are most prominent in the kidney, although it is
present in all additionally examined tissues including intestine, lung and heart (Figure 1F).
All other P2X receptors showed a distinct expression pattern that is less specific for ion
transporting epithelia. Although present in duodenum, P2x1 mRNA levels are highest in
spleen and lung (Figure 1A). P2x2 is exclusively expressed in testes (Figure 1B). P2x3 shows
a broad expression pattern with presence in all parts of the intestines (Figure 1C). P2x5 is
prominently expressed in heart, lung and testes (Figure 1E). P2x7 is present in lung, spleen
and testes (Figure 1G).
Transcellular Mg2+ reabsorption occurs in the DCT segment of the kidney. The
expression of the different P2x isoforms in the DCT was further examined using RT-PCR on
COPAS sorted kidney material and immunohistochemistry on kidney slices. Interestingly,
the DCT almost exclusively expresses transcripts for P2x4 and P2x6 (Figure 2A).

Total kidney samples from the same mice revealed that all P2x subunits are present in
kidney tissue, although P2x3 and P2x7 mRNA transcript levels were low (Figure 2B). The
localization of P2X4 and P2X6 proteins was further examined using immunohistochemistry on mouse kidney tissue. Remarkably, a conspicuous co-localization of P2X6 and NCC
was found, of which the latter serves as a marker for DCT (Figure 3A). Conversely, immunohistochemical stainings on mouse kidney did not show co-localization of P2X4 and NCC
(Figure 3B).
n
y m m
in rt g er n s le
ne nu leu num olo cumBra Hea Lun Li v lee este usc
Kidode I eju C Ce
Sp T M
J
Du
n
y m m
in rt g er n s le
ne nu leu num olo cumBra Hea Lun Liv lee este usc
Kidode I eju C Ce
Sp T M
J
Du
10
20
30
40
10
20
30
40
n
y m m
in rt g er n s le
Kidode I eju C Ce
Sp T M
J
Du
20
40
60
80
100
n
y m m
in rt g er n es le
ne nu leu num olo cumBra Hea Lun Liv lee e st usc
Kidode I eju C Ce
Sp T M
J
Du
10
20
30
r
n
y m m
in rt g e n s le
p T M
Kidode I eju C Ce
S
J
Du
20
40
60
P2x2 mRNA expression
(% of total expression)
10
20
30
40
50
n
y m m
in rt g er n s l e
ne nu leu num olo cumBra Hea Lun Li v lee este usc
Kidode I eju C Ce
Sp T M
J
Du
n
y m m
in rt g er n s le
Kidode I eju C Ce
Sp T M
J
Du
10
20
30
40
A-G, The mRNA expression levels of P2x1 (A), P2x2 (B), P2x3 (C), P2x4 (D), P2x5 (E), P2x6 (F) and P2x7 (G) in a panel of mouse tissues were measured by quantitative
RT-PCR and normalized for Gapdh expression. Data are expressed as percentage of total tissue expression and represent the mean of 3 individual experiments SEM.
Figure 1 T issue Distribution of P2x1-7 Subunits




1.0
0.5
0
1.0
0.8
0.6
0.4
0.2
0
P2
X1
P2
X2
P2
X3
P2
X4
P2
X5
P2
X6
P2
X7
1.5
Cortex mRNA expression

(copy number / GAPDH X10-2)
B
2.0
P2
X1
P2
X2
P2
X3
P2
X4
P2
X5
P2
X6
P2
X7
DCT mRNA expression

(copy number / GAPDH X10-2)
200 | Chapter 8
Figure 2 P2x4 and P2x6 are Expressed in the DCT Segment of the Kidney
A-B, The mRNA expression levels of P2x1, P2x2, P2x3, P2x4, P2x5, P2x6, and P2x7 were measured from
COPAS-sorted DCT cells (A) or from COPAS-sorted cells from same kidney sample without selection
for EGFP (B). mRNA levels were measured by quantitative RT-PCR and normalized for Gapdh expression.
Data represent the mean of 4 experiments SEM.
Figure 3 P2X6 Co-localizes with NCC in the DCT

A, Mouse kidney sections were co-stained for NCC (in green) and P2X6 (in red). B, Mouse kidney
sections were co-stained for P2X4 (in green) and NCC (in red). Bars represent 100 m (upper panel),
50 m (middle panel) or 10 m (bottom panel).
P2X4 Inhibits the Activity of TRPM6

Given the co-expression of TRPM6 with P2X4 in the colon, protein expression of P2X4 in
the rat colonic crypts (38) and previous reports demonstrating P2X4-dependent inhibition
of Mg2+ transport in the kidney (7), we investigated whether there is a functional
interaction between P2X4 and TRPM6. Constructs of TRPM6 and P2X4 were either
expressed alone or together in HEK293 cells and their function was investigated using
whole-cell patch clamp.

Cells were perfused with a Mg2+-free pipette solution as described previously (45).
Voltage ramps evoked slowly-developing outwardly rectifying currents, a signature
feature of TRPM6 under our recording conditions (Figure 4A-B, (45)). Measurement of the
voltage-evoked current density at +80 mV revealed that co-transfection of P2X4 and
TRPM6 led to the constitutive inhibition of TRPM6 activity near endogenous levels (Figure
4A-C), while ATP-evoked current increased from undetectable levels to -304 54 pA/pF at
-60 mV (n42, data not shown). Non-transfected cells showed an average voltage-evoked
current density of 35 5 pA/pF at +80 mV (Figure 4C). Co-transfection of P2X6 subunit
together with TRPM6 yielded a current density not significantly different from TRPM6
alone (Figure 4C). In agreement with previous reports (4, 43), ATP-evoked current were
absent from cells expressing P2X6 alone (n=9, data not shown). The expression of P2X6 at
the membrane was confirmed by cell surface biotinylation (data not shown). In addition,
the co-expression of TRPM6 and a P2X4 mutant (p.Tyr315Cys, P2X4mut (37)) with a reduced
ATP sensitivity did not lead to the inhibition of TRPM6 (Figure 4C). A plot of TRPM6 current
density versus the ATP-evoked current density revealed a dose-dependent inhibition of
TRPM6 by P2X4 (Figure 4D). TRPM6 is made of a channel domain and a C-terminal
intracellular kinase domain (35, 46). Co-transfection of P2X4 and the kinase-inactive TRPM6
mutant (p.Lys1804Arg, (41)) resulted in a similar inhibition (n9, data not shown), therefore
excluding a role of the kinase domain of TRPM6. Interestingly, co-expression of P2X4 with
TRPM7, a close homolog of TRPM6, did not inhibit TRPM7 (Figure 4E). The average
ATP-evoked current in the presence of P2X4 and TRPM7 was 85 16 pA/pF (n=10, data not
shown). Cell surface biotinylation showed that TRPM6 membrane availability is not
abolished when co-expressed with P2X4 (Figure 4F). These data demonstrates that P2X4
specifically inhibits TRPM6 in a way that requires the ion channel activity of P2X4.
TRPM6 Inhibition Does not Depend on PKC, PKA or PI3K

Given the Ca2+-permeability of P2X4 and the requirement of functional P2X4 channels for
the inhibition of TRPM6, we hypothesized that the constitutive activity of P2X4 would lead
to an increase in the cytosolic free Ca2+ concentration. Rising intracellular Ca2+ levels will
activate Ca2+-dependent kinases such as protein kinase C (PKC). Cells were incubated with
the PKC inhibitor Chelerythrine Chloride ( 2 hrs, 1 mmol/L). This protocol did not
significantly affect basal TRPM6 currents or TRPM6 currents in the presence of P2X4 (Figure
5A, left panel). ATP-evoked currents were also unaffected by this treatment (Figure 5A,
202 | Chapter 8
A +100 mV
ATP
+80 mV
300
-100 mV
TRPM6+Mock
TRPM6+Mock
TRPM6+P2X4
TRPM6+P2X4
500 pA
TRPM6
200
100
TRPM6+P2X4
TRPM6
1 nA
20
40
50 ms
D
200
150
100
50
0
NT
Mock P2X6 P2X4 P2X4mut
250
200
150
100
50
0
Mock
TRPM6
+ P2X4
TRPM6
Mock
Biotin
kDa
200
750
500
250
0
Mock P2X4
TRPM7
200
TRPM6
TRPM6
Total protein
fraction
Cell surface
fraction
anti-HA
100
1000
10
100
1000
P2X4 current density (pA/pF)
TRPM6
300
80
TRPM6
+ P2X4
250
**
TRPM6
***
TRPM6 current density (pA/pF)
60
Time (s)
Current density (pA/pF)
0 mV
anti-HA
96
96
P2X4
Figure 4 P2X4 Inhibits the Activity of TRPM6 Channels

A, TRPM6 currents were evoked by a 500 ms voltage ramp from -100 to +100 mV applied every 2 s
(top left inset). The activity of P2X4 channels was assessed by perfusion of 100 mmol/L ATP on cells
held at -60 mV. Typical voltage-evoked traces (left) and ATP-evoked traces (right) obtained with or
without P2X4 co-expression. B, Time course of TRPM6 current development at +80 mV ( , ) and
-80 mV ( , ). Co-expression of P2X4 strongly reduces the current amplitude of TRPM6 currents
(n=7). C, Co-expression of TRPM6 with P2X4 (n39), but not P2X6 (n13), reduces the average voltage-evoked current density. Non-transfected cells are shown for comparison (NT, n=10). A mutant
with altered sensitivity to ATP (p.Tyr315Cys) does not inhibit TRPM6 currents (n10). D, The TRPM6
current density is plotted against the logarithm of the peak ATP-evoked inward current density measured at -60 mV in the same cells. The star indicates the average current density obtained without
P2X4. A linear fit was performed to evidence a correlation between the activity of TRPM6 and P2X4.
P2X4
E, TRPM7 currents were compared with or without coexpression of P2X4. P2X4 does not inhibit the
function of TRPM7 channels (n11). F, Cell surface biotinylation of HEK293 cells co-expressing HAtagged TRPM6 and Mock or HA-tagged P2X4. Representative immunoblots showing that P2X4 expression does not impair TRPM6 membrane expression (left). Total protein expression was assessed
as control for expression of P2X4 (right).
P2X4 current density at -60 mV
300
200
100
0
C.C.
C.C.
P2X4
TRPM6 current density at +80 mV
400
300
200
100
0
Control
C.C.
TRPM6+P2X4
TRPM6
**
600
200
100
0
H-89
H-89
P2X4
300
400
200
0
Ctrl
H-89
TRPM6+P2X4
TRPM6
750
150
100
50
0
Wort.
Wort.
P2X4
200
500
250
0
Ctrl
Wortmannin
TRPM6+P2X4
TRPM6
Figure 5 PKA, PKC and PI3K are not Involved in the Inhibition of TRPM6 by P2X4
A, The PKC inhibitor chelerythrin chloride (CC, 2 hrs, 1 mmol/L) did not reverse the inhibition of
TRPM6 by P2X4 (n9, left panel). ATP evoked currents were unaffected by the treatment with CC
(n=8, right panel). B, The PKA inhibitor H-89 (1 mmol/L, 20 min) did not reverse the inhibition of
TRPM6 by P2X4 (n6, left panel). Inhibition of PKA with H-89 increased ATP-evoked currents in cells
co-expressing TRPM6 and P2X4 (n15, right panel). C, The PI3K inhibitor Wortmannin (100 nmol/L,
30 min) did not reverse the inhibition of TRPM6 by P2X4 (n6, left panel). Wortmannin did not affect
ATP-evoked currents in cells co-expressing TRPM6 and P2X4 (n9, right panel).
204 | Chapter 8
right panel). Next, to test whether the inhibition is dependent on protein kinase A (PKA),
cells were incubated with the PKA inhibitor H-89 (10 mmol/L, 20 min). The treatment with
H-89 did not affect the baseline TRPM6 current and current from cells expressing TRPM6
and P2X4 (Figure 5B, left panel). Under these conditions, the ATP-evoked currents were
significantly increased compared to the control treatment (Figure 5B, right panel). The
activation of PI3K was previously shown to modulate the epithelial Na+ channel function
(ENaC) in Xenopus laevis oocytes (50, 51). Cells were incubated with the PI3K inhibitor
Wortmannin (30 min, 10 nmol/L). This protocol did not induce any change in current
density for TRPM6 alone or TRPM6 together with P2X4 (Figure 5C, left panel). The
ATP-evoked currents were unaffected by the treatment with Wortmannin (Figure 5C, right
panel).
P2X4 KO Mice Show Normal Mg2+ Levels

To assess the involvement of P2X4 in the maintenance of Mg2+ levels under normal
conditions, the serum Mg2+ levels and urinary Mg2+ excretion of P2X4 KO mice were
determined. Average basal serum Mg2+ concentration (Figure 6A), nor the urinary Mg2+
excretion were significantly changed in P2X4 KO mice compared to wild type littermates
(Figure 6B).
B
24hrs Mg 2+ excretion (mol)
Serum [Mg 2+ ] (mM)
1.2
1.0
0.8
0.6
0.4
0.2
0
P2X4+/+
P2X4/
40
35
30
25
20
15
10
5
0
P2X4+/+
P2X4/
Figure 6 P2X4 Knockout Mice Exhibit Normal Serum and Urinary Mg2+ Concentrations
A, Serum Mg2+ concentrations of wild type and knockout P2X4 mice. B, 24hr urinary Mg2+ excretion
of wild type and knockout P2X4 mice. Values are presented as means SEM (n=6).
Discussion
Transcellular transport of Mg2+ via TRPM6 is the last step in Mg2+ (re)absorption in the
intestine and kidney and is, therefore, an important regulator of blood Mg2+ levels (9).
Here, we establish P2X4 as a novel player in the regulation of TRPM6 activity. Although
P2X4 was previously suggested to inhibit Mg2+ transport in kidney (7), we are the first to
establish its role in the regulation of TRPM6 activity.

TRPM6 forms constitutively active Mg2+-permeant ion channels inhibited by physiological
concentrations of intracellular Mg2+ (45). A functional TRPM6 channel comprises four
subunits, each containing seven transmembrane domains and intracellular COOH and
NH2 amino termini. In analogy with the well-described voltage-gated ion channels, a pore
and a selectivity filter are formed at the interface between the fifth and sixth
transmembrane domains of the four monomers (42). TRPM6 and its close homologue
TRPM7 exhibit a peculiar C-terminal kinase domain (35, 46), the function of which is not
completely understood. Due to their kinase moiety, TRPM6 and TRPM7 undergo autophosphorylation at multiple sites within their intracellular domains (2). P2X channels
comprise three subunits, each containing two transmembrane domains separated by a
large extracellular loop (18). P2X4 channels are characterized by a rapid activation upon
ATP binding, resulting in a slowly desensitizing non-selective influx of mono- and divalent
cations such as Ca2+ (3, 10, 31).

Here, it is demonstrated for the first time that the P2X4 purinergic receptors inhibit
the activity of TRPM6. Our data show that the inhibition of TRPM6 occurs at the membrane
since P2X4 did not disrupt the levels of TRPM6 membrane expression in a cell surface
biotinylation assay. The inhibition is dependent on the function of the P2X4 receptors
since the ATP-insensitive P2X4-p.Tyr315Cys mutant was not able to inhibit TRPM6. This
suggests that the inhibition of TRPM6 is dependent on activity-evoked P2X4 signaling.
Due to the strong intracellular divalent chelation needed to record TRPM6 currents in
whole-cell patch clamp, it is not possible to test the hypothesis that P2X4 receptor
activation directly inhibits TRPM6. The scenario in which TRPM6 and P2X4 participate in a
macromolecular complex and influence each others function via physical interaction
cannot be discarded. Such physical interactions between neuronal ligand-gated ion
channels, TRPV channels and P2X receptors have been previously demonstrated (19, 36).
Until now, P2X4 has been shown to interact with WNT4, MCM2 and CDH5 (12, 47). However,
there has been no large-scale P2X4 interaction studies published and there are no reports
of interactions with other ion channels. Therefore, it would be of interest to find P2X4
interacting partners to further examine this latter possibility.
P2X4 receptors have been previously described as inhibitors of ion transport
processes (7, 24, 49). Specifically, P2X4 receptors were shown to modulate the activity of
ENaC by promoting retrieval of the channel from the membrane (49, 50). Interestingly, the
authors found that among the tested functional P2X receptors, only the slowly-desensitizing
206 | Chapter 8
P2X2 and P2X4 were able to inhibit ENaC (50). Rapidly inactivating P2X channels (P2X1,
P2X3) failed to inhibit ENaC, suggesting that the intensity and duration of ion influx
dictates the extent of target channel inhibition. In agreement with previous reports, we
could not detect ATP-evoked currents from cells expressing P2X6 (16, 22, 43). In contrast to
P2X4, P2X6 failed to inhibit TRPM6. It is tempting to speculate that other functional and
slowly desensitizing homo- or heterotrimeric P2X receptors (P2X2, P2X5, P2X7, P2X2/X4,
P2X2/X5, etc) could alter the function of different ion channels in different tissues, thereby
forming a new general mechanism of ion channel regulation. This hypothesis is supported
by recent findings in the Thick Ascending Limb of Henles loop (TAL) (26), but further
investigations are necessary to confirm this proposition.

Although P2X receptors have been established as important regulators of ion
transport in a broad range of tissues, their exact mechanism of signaling is largely
unknown (1, 7, 23, 24, 26, 49). Indeed, our pharmacological screening could not identify
which kinases are involved in TRPM6 inhibition. A supporting role of PKA and PKC in the
P2X4-dependent TRPM6 inhibition could not be evidenced from our experiments. The
PI3K kinase has previously been implicated in P2X4-induced retrieval of ENaC from the
membrane (51). Using wortmannin, we demonstrate that PI3K was not involved in such
regulation of P2X4-mediated TRPM6 inhibition. Moreover, TRPM6 membrane expression
is largely preserved in the presence of P2X4, suggesting that ENaC and TRPM6 are
differentially regulated. TRPM6 has multiple predicted phosphorylation sites for numerous
protein kinases, with few of them characterized. Future large-scale pharmacological
screening and mutagenesis studies should identify the molecular mechanism responsible
for the P2X4-dependent TRPM6 inhibition.
The expression of P2X receptors was previously demonstrated in tissues and cells
from kidney and intestinal origin (1, 7, 15, 38, 39, 44). In our study, we found the protein
expression and colocalization of P2X6 with NCC, a marker of the DCT. Unfortunately,
despite high mRNA transcript levels in the DCT, we were not able to evidence the protein
expression of P2X4 in this segment of the kidney. This is in contradiction to a previous
report demonstrating basolateral expression of P2X4 and P2X6 throughout rat kidney,
including the DCT (44). The reasons for this discrepancy are not clear. However, given the
expression of P2X4 and P2X6 transcripts in the DCT and the tendency of P2X receptors to
form heteromultimers, one could speculate that P2X4 participates in protein complexes
with P2X6 in such a way that the P2X4 epitope is not accessible for antibody binding. In
addition, it is possible that certain metabolic conditions are required to trigger P2X4
protein expression in the DCT. However, future experiments will be needed to clarify this
issue.

In recent years, an increasing amount of reports from the clinic claim that the use of
certain types of drugs dramatically reduces intestinal Mg2+ absorption (17, 21). Nevertheless,
our knowledge of the regulation of intestinal Mg2+ absorption is limited. The colon is the
most important site of transcellular Mg2+ absorption via TRPM6 in the intestine (20, 45).
Although the regulation of TRPM6 has been widely studied in the kidney (13, 14, 29, 40),
this is the first identification of a regulatory mechanism of TRPM6 in the gut. Our results
provided evidence that P2X4 is expressed in colon and cecum, which is in line with
previous studies (6, 11, 38, 39). Interestingly, the intestines are among the tissues with the
highest ATP secreting capacities (5, 23). Physical force applied by the content of the colonic
lumen can activate mechanosensors resulting in luminal and basolateral ATP release (5).
Luminal ATP serves an autocrine and paracrine regulator of channel and transporter
activity at the luminal membrane (23, 27, 53). In addition, the role of P2X4 on TRPM6
activity may extend beyond the intestine, since TRPM6 and P2X4 are also highly expressed
in lung (13). In basal conditions, P2X4 KO mice have normal serum Mg2+ levels and urinary
Mg2+ excretion. These results suggest that other mechanisms may compensate for the
loss of P2X4 function in basal conditions. TRPM6 activity is regulated by growth factors
such as EGF and insulin, which may play a compensatory role (14, 29). Therefore, it would
be of interest to further challenge the P2X4 KO mouse with low Mg2+ diets.

In conclusion, a novel regulatory mechanism of intestinal TRPM6 activity has been
identified. ATP release in colon may activate the P2X4 purinergic receptor leading to the
inhibition of the activity of TRPM6. Our results are an important next step in understanding
the complex regulatory mechanism of intestinal Mg2+ absorption.
Acknowledgements
Research (ZonMw 9120.8026, NWO ALW 818.02.001), a NWO Vici Grant for J.G.J. Hoenderop
(016.130.668) and EURenOmics funding from the European Union seventh Framework
Program (FP7/2007-2013, agreement n 305608). The authors want to state their gratitude
to AnneMiete van der Kemp, Lonneke Duijkers, Fariza Bouallala and Pauline de Bruijn for
their excellent technical support. In particular, we would like to thank Dr. Sjoerd Verkaart
for valuable discussions.
Methods
Expression Profiling
Three male C57BL/6 mice were sacrificed; kidney, duodenum, ileum, jejunum, colon,
cecum, brain, lung, liver, spleen, testis, muscle, and heart tissues were collected. For the
analysis of segment-specific kidney expression we used parvalbumin-EGFP (PV-EGFP)
mice, which express the EGFP under the parvalbumin promoter and allow selection of
EGFP-positive DCT tubules (kind gift from Dr. Monyer, University of Heidelberg, Germany,
(28)). Selection of DCT tubules was performed as described previously (8). In short, mice
were perfused with 20 mL of PBS (in mmol/L: 137 NaCl, 2.7 KCl, 10 Na2HPO4, 1.76 KH2PO4)
through the heart. The kidneys were removed, minced, and digested in 1 mg/mL
208 | Chapter 8
collagenase A (Worthington, Lakewood, NJ, USA) and 1 mg/mL hyaluronidase (Sigma,

Houten, The Netherlands) in Krebs buffer (in mmol/L: 145 NaCl, 5 KCl, 10 HEPES, 1 NaH2PO4,
2.5 CaCl2, 1.8 MgSO4 and 5 glucose) at 37 C for three cycles of 5-15 min. The collagenase-
digested tubules were sorted by COPAS (Complex Object Parametric Analysis and Sorting,
Union Biometrica) based on EGFP-fluorescence intensity. Per mouse, 4,000 EGFP-positive
fluorescent tubules were collected. To use as a control, an additional 4,000 tubules were
sorted from the same kidney sample without selection for EGFP-positive cells.

Total RNA was isolated using TRIzol total RNA isolation agent (Invitrogen, Breda, the
Netherlands) and treated with DNase (1U/g RNA, Promega, Leiden, the Netherlands) to
remove genomic DNA. Subsequently, reverse transcription of the RNA by M-MLV reverse
transcriptase (Invitrogen) was performed for 1 hr at 37 C. Gene expression levels were
determined by quantitative real-time PCR on a Bio-Rad analyzer using iQ Sybr Green
(BioRad, Veenendaal, the Netherlands) and normalized for Gapdh expression levels. Primer
sequences are listed in Table 1.
Table 1 P
rimer Sequences
F
P2x1
5-CCGAAGCCTTGCTGAGAA-3
5-GGTTTGCAGTGCCGTACAT-3
P2x2
5-CACCACCACTCGAACTCTCA-3
5-GGTACGCACCTTGTCGAACT-3
P2x3
5-GGTGGCTGCCTTCACTTC-3
5-TCAGCCCCTTTGAGGAAA-3
P2x4
5-TTGGCTCTGGCTTGGCGCTC-3
5-TCTCCGGAAAGACCCTGCTCG-3
P2x5
5-GAGCGAGTTTTACCGAGACAAG-3
5-GATGAACCCTCTCCAGTGGC-3
P2x6
5-CTCCTGGAGGTGGTTCATGTG-3
5-GGCTTTGGCAAGCTTTACTTC-3
P2x7
5-GGGGGTTTACCCCTACTGTAA-3
5-GCTCGTCGACAAAGGACAC-3
Gapdh
Co-staining for P2X4 and P2X6 with the thiazide-sensitive Na+-Cl- cotransporter (NCC)
were performed on 5 m sections of frozen mouse kidney samples. Sections were heat
treated with sodium-citrate and endogenous peroxidase was blocked. Unspecific binding
sites were blocked with blocking buffer (TSA fluorescence System, Perkin Elmer). The sections
were incubated for 16 hrs at 4 C with the following primary antibodies: goat anti-P2X6
(1:100, A58sc-15197, Santa Cruz, Heidelberg, Germany), mouse anti-P2X4 (1:100, A58SC-28764,
Santa Cruz, Heidelberg, Germany), rabbit anti-NCC (1:100, (8)). P2X4 staining was enhanced
using TSA fluorescence System (Perkin Elmer, Groningen, The Netherlands). For detection,
kidney sections were incubated with Alexa Fluor-conjugated secondary antibodies.
Images were taken with an AxioCam camera and AxioVision software (Zeiss, Sliedrecht,
the Netherlands).
DNA Constructs
The pCINeo TRPM6 IRES GFP expression construct was described previously (45). To obtain
P2X4 and P2X6 expression constructs, we used the full-length human P2X4 and P2X6 cDNA
clones with Genbank accession numbers BC033826 and BC033488 respectively (Source
BioScience LifeSciences, Nottingham, United Kingdom). The coding sequences of P2X4
was amplified using Phusion polymerase (Finnzymes, Vantaa, Finland) and primers F:
5-ccgctagcgATGGCGGGCTGCTGCGC-3 and R: 5-CGCTCGAGTCACTGGTCCAGCTCAC-3) to
introduce NheI and XhoI restriction sites. For P2X6, we introduced NheI and XmaI with
primers F; 5-cggctagcATGGGCTCCCCAGGGGC-3 and R: 5-GCCCCGGGCGCAGGCTCCCGGAATGGG-3. The amplicons were cloned into the pCINeo-IRES-GFP expression vectors
containing an in frame N-terminal HA-tag using the NheI, XmaI and XhoI restriction sites.
The P2X4 p.Tyr315Cys mutation was introduced using the QuikChange site-directed
mutagenesis kit (Agilent, Amstelveen, The Netherlands). All constructs were verified by
sequence analysis. GFP-tagged P2X6 constructs were created by introducing BspEI and
EcoRI restriction by RT-PCR (F: 5-cgtccggaATGGGCTCCCCAGGGGC-3 and R: 5-GCGAATTCCTACAGGCTCCCGGAATG-3) and ligation in a pEGFP vector containing an in frame
N-terminal GFP. Flag-tag was inserted using Phusion polymerase and primers containing
AgeI and XhoI restrictions sites (F: 5-CAGaccggtcgccaccGACTACAAGGATGACGATGACAAGGCGGGCTGCTGCGCCGCG-3 and R: 5-CGCTCGAGTCACTGGTCCAGCTCAC-3). The
PCR product was digested and ligated into the pCINeo vector using AgeI and XhoI. The
pTracer mTRPM7 construct (kind gift from Dr. David E. Clapham) was transfected using an
identical protocol.
Cell Culture and Transfection

Human embryonic kidney cells (HEK293) were grown at 37 C in DMEM (Biowhittaker
Europe, Vervier, Belgium) supplemented with 10 % (v/v) FCS (PAA Laboratories, Linz,
Austria), nonessential amino acids, and 2 mmol/L L-glutamine in a humidified 5 % (v/v)
CO2 atmosphere. Cells were seeded in 12-well plates and subsequently transfected with
1-1.25 g of HA- of FLAG-tagged constructs in the pCINeo-IRES-GFP or pcINeo-IRES-mCherry
vectors using Lipofectamine 2000 (Invitrogen) at 1:3 DNA:Lipofectamine ratio.

For patch-clamp experiments, cells were seeded two days after transfection on glass
coverslips coated with 50 mg/mL of fibronectin (Roche, Mannheim, Germany). Two hrs
later, cells were placed in the recording chamber and selected based on the intensity of
the fluorescent reporter.
Immunoblotting
HEK293 cells were lysed for 1 hr at 4 C in TNE lysis buffer containing (in mmol/L): 50 Tris/
HCl pH 8.0, 150 NaCl, 5 EDTA, 1 % Triton X-100 (v/v) and pepstatin 1 g/mL, PMSF 1 mmol/L,
leupeptin 5 g/mL and aproptin 5 g/mL. Protein lysates were denatured in Laemmli
containing 100 mM DTT for 30 min at 37 C and subsequently subjected to SDS-PAGE.
210 | Chapter 8
Immunoblots were then incubated with a mouse anti-HA (Roche, high affinity 3F10,
1:5,000) primary antibody and peroxidase conjugated sheep anti-mouse secondary
antibodies (Jackson Immunoresearch, 1:10,000).
Electrophysiology
Whole-cell voltage-clamp experiments were carried out using an EPC-9 amplifier (HEKA
electronics, Lambrecht, Germany). Data acquisition and analysis were performed using
Pulse or Patchmaster software (HEKA). The sampling interval was set to 200 ms for all
experiments. Pipettes were pulled from thin-walled borosilicate glass (Harvard Apparatus)
and had resistance between 1 and 3 MW, when filled with the pipette solution. Series
resistance compensation was set to 50-95 % in all experiments. Measurements of TRPM6
and TRPM7 activity were performed by applying 500 ms voltage ramps from -100 to +100
mV every 2 s from a holding potential of 0 mV. TRPM6-expressing cells displayed a
time-dependent increase in outwardly-rectifying currents upon whole-cell break-in. This
is partly due to the chelation of intracellular Mg2+, which inhibits TRPM6. Consequently,
the reported current values were obtained at +80 mV 100 s after break-in. Consistent with
the endogenous expression of TRPM7 in HEK293 cells, non-transfected cells displayed
small voltage-evoked currents under these recording conditions (45). The activity of P2X
channels was assessed by perfusion of 100 mmol/L ATP on cells held at -60 mV using a fast
quartz micromanifold solution applicator (ALA scientific instruments, Farmingdale, NY).

The extracellular solution contained (in mmol/L): 150 NaCl, 1 CaCl2, 10 HEPES/NaOH
pH 7.4. The pipette solution was made of (in mmol/L): 150 NaCl, 10 Na2EDTA, 10 HEPES/
NaOH, pH 7.2.
P2X4 KO Mice
P2X4 KO mice were provided by GlaxoSmithKline UK and maintained in a C57BL/6 genetic
background. 24 hrs urine collection was performed in mouse metabolic cages for two
consecutive days. Blood samples were drawn by cardiac puncture in isoflurane-anesthetized mice. Urine measurements were performed on the sample of the second 24 hrs.
Mg2+ Analysis
Serum and urine total Mg2+ concentrations were determined using a colorimetric assay kit
according to the manufacturers protocol (Roche Diagnostics, Woerden, the Netherlands).
All results are depicted as mean standard error of the mean (SEM). All statistical analyses
were conducted by one-way ANOVA followed by Tukey post hoc test when comparing
two treatment groups or experimental conditions. Difference in means with P values
< 0.05 were considered statistically significant.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Bourzac JF, LEriger K, Larrivee JF, Arguin G, Bilodeau MS, Stankova J, and Gendron FP. Glucose
transporter 2 expression is down regulated following P2X7 activation in enterocytes. Journal of cellular
physiology 228: 120-129, 2013.
Clark K, Middelbeek J, Morrice NA, Figdor CG, Lasonder E, and van Leeuwen FN. Massive autophosphorylation of the Ser/Thr-rich domain controls protein kinase activity of TRPM6 and TRPM7. PloS one 3: e1876,
2008.
Coddou C, Yan Z, Obsil T, Huidobro-Toro JP, and Stojilkovic SS. Activation and regulation of purinergic
P2X receptor channels. Pharmacol Rev 63: 641-683, 2011.
Collo G, North RA, Kawashima E, Merlo-Pich E, Neidhart S, Surprenant A, and Buell G. Cloning OF P2X5
and P2X6 receptors and the distribution and properties of an extended family of ATP-gated ion channels. The
Journal of neuroscience : the official journal of the Society for Neuroscience 16: 2495-2507, 1996.
Cooke HJ, Wunderlich J, and Christofi FL. The force be with you: ATP in gut mechanosensory transduction.
News in physiological sciences : an international journal of physiology produced jointly by the International Union of
Physiological Sciences and the American Physiological Society 18: 43-49, 2003.
Coutinho-Silva R, Stahl L, Cheung KK, de Campos NE, de Oliveira Souza C, Ojcius DM, and Burnstock
G. P2X and P2Y purinergic receptors on human intestinal epithelial carcinoma cells: effects of extracellular
nucleotides on apoptosis and cell proliferation. Am J Physiol Gastrointest Liver Physiol 288: G1024-1035, 2005.
Dai LJ, Kang HS, Kerstan D, Ritchie G, and Quamme GA. ATP inhibits Mg(2+) uptake in MDCT cells via P2X
purinoceptors. American journal of physiology Renal physiology 281: F833-840, 2001.
involved in renal magnesium handling. American journal of physiology Renal physiology 2013.
de Baaij JHF, Hoenderop JGJ, and Bindels RJM. Regulation of magnesium balance: lessons learned from
human genetic disease. Clinical Kidney Journal 5 (supl 1): i15-i24, 2012.
Egan TM, and Khakh BS. Contribution of calcium ions to P2X channel responses. The Journal of neuroscience:
the official journal of the Society for Neuroscience 24: 3413-3420, 2004.
Garcia-Alcocer G, Padilla K, Rodriguez A, Miledi R, and Berumen LC. Distribution of the purinegic
receptors P2X(4) and P2X(6) during rat gut development. Neuroscience letters 509: 92-95, 2012.
Glass R, Loesch A, Bodin P, and Burnstock G. P2X4 and P2X6 receptors associate with VE-cadherin in
human endothelial cells. Cellular and molecular life sciences : CMLS 59: 870-881, 2002.
Groenestege WM, Thebault S, van der Wijst J, van den Berg D, Janssen R, Tejpar S, van den Heuvel LP,
Groschel-Stewart U, Bardini M, Robson T, and Burnstock G. P2X receptors in the rat duodenal villus. Cell
and tissue research 297: 111-117, 1999.
Hausmann R, Bodnar M, Woltersdorf R, Wang H, Fuchs M, Messemer N, Qin Y, Gunther J, Riedel T,
Grohmann M, Nieber K, Schmalzing G, Rubini P, and Illes P. ATP binding site mutagenesis reveals different
subunit stoichiometry of functional P2X2/3 and P2X2/6 receptors. J Biol Chem 287: 13930-13943, 2012.
Hess MW, Hoenderop JG, Bindels RJ, and Drenth JP. Systematic review: hypomagnesaemia induced by
proton pump inhibition. Alimentary pharmacology & therapeutics 36: 405-413, 2012.
Kawate T, Michel JC, Birdsong WT, and Gouaux E. Crystal structure of the ATP-gated P2X(4) ion channel in
the closed state. Nature 460: 592-598, 2009.
Khakh BS, Zhou X, Sydes J, Galligan JJ, and Lester HA. State-dependent cross-inhibition between transmitter-gated cation channels. Nature 406: 405-410, 2000.
Lameris AL, Hess MW, van Kruijsbergen I, Hoenderop JG, and Bindels RJ. Omeprazole enhances the
colonic expression of the Mg transporter TRPM6. Pflugers Archiv : European journal of physiology 2013.
212 | Chapter 8
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
Lameris AL, Monnens LA, Bindels RJ, and Hoenderop JG. Drug-induced alterations in Mg2+ homoeostasis.
Clin Sci (Lond) 123: 1-14, 2012.
Le KT, Babinski K, and Seguela P. Central P2X4 and P2X6 channel subunits coassemble into a novel
heteromeric ATP receptor. The Journal of neuroscience : the official journal of the Society for Neuroscience 18:
7152-7159, 1998.
Leipziger J. Control of epithelial transport via luminal P2 receptors. American journal of physiology Renal
physiology 284: F419-432, 2003.
Leipziger J. Luminal nucleotides are tonic inhibitors of renal tubular transport. Current opinion in nephrology
and hypertension 20: 518-522, 2011.
Limaye CS, Londhey VA, Nadkart MY, and Borges NE. Hypomagnesemia in critically ill medical patients. J
Assoc Physicians India 59: 19-22, 2011.
Marques RD, de Bruijn PI, Sorensen MV, Bleich M, Praetorius HA, and Leipziger J. Basolateral P2X
receptors mediate inhibition of NaCl transport in mouse medullary thick ascending limb (mTAL). American
journal of physiology Renal physiology 302: F487-494, 2012.
Matos JE, Sorensen MV, Geyti CS, Robaye B, Boeynaems JM, and Leipziger J. Distal colonic Na(+)
absorption inhibited by luminal P2Y(2) receptors. Pflugers Archiv : European journal of physiology 454: 977-987, 2007.
Meyer AH, Katona I, Blatow M, Rozov A, and Monyer H. In vivo labeling of parvalbumin-positive
interneurons and analysis of electrical coupling in identified neurons. The Journal of neuroscience : the official
journal of the Society for Neuroscience 22: 7055-7064, 2002.
Nair AV, Hocher B, Verkaart S, van Zeeland F, Pfab T, Slowinski T, Chen YP, Schlingmann KP, Schaller
Nijenhuis T, Renkema KY, Hoenderop JG, and Bindels RJ. Acid-base status determines the renal
expression of Ca2+ and Mg2+ transport proteins. J Am Soc Nephrol 17: 617-626, 2006.
North RA, and Surprenant A. Pharmacology of cloned P2X receptors. Annu Rev Pharmacol Toxicol 40:
563-580, 2000.
Novak I. Purinergic signalling in epithelial ion transport: regulation of secretion and absorption. Acta Physiol
(Oxf) 202: 501-522, 2011.
Orriss IR, Key ML, Brandao-Burch A, Patel JJ, Burnstock G, and Arnett TR. The regulation of osteoblast
function and bone mineralisation by extracellular nucleotides: The role of p2x receptors. Bone 51: 389-400, 2012.
Quamme GA. Recent developments in intestinal magnesium absorption. Current opinion in gastroenterology
24: 230-235, 2008.
Schlingmann KP, Weber S, Peters M, Niemann Nejsum L, Vitzthum H, Klingel K, Kratz M, Haddad E,
TRPM gene family. Nat Genet 31: 166-170, 2002.
Stanchev D, Blosa M, Milius D, Gerevich Z, Rubini P, Schmalzing G, Eschrich K, Schaefer M, Wirkner K,
and Illes P. Cross-inhibition between native and recombinant TRPV1 and P2X(3) receptors. Pain 143: 26-36,
2009.
Stokes L, Scurrah K, Ellis JA, Cromer BA, Skarratt KK, Gu BJ, Harrap SB, and Wiley JS. A Loss-of-Function
Polymorphism in the Human P2X4 Receptor Is Associated With Increased Pulse Pressure. Hypertension 58:
1086-1092, 2011.
Tanaka J, Murate M, Wang CZ, Seino S, and Iwanaga T. Cellular distribution of the P2X4 ATP receptor
mRNA in the brain and non-neuronal organs of rats. Archives of histology and cytology 59: 485-490, 1996.
Taylor AL, Schwiebert LM, Smith JJ, King C, Jones JR, Sorscher EJ, and Schwiebert EM. Epithelial P2X
purinergic receptor channel expression and function. The Journal of clinical investigation 104: 875-884, 1999.
Thebault S, Alexander RT, Tiel Groenestege WM, Hoenderop JG, and Bindels RJ. EGF increases TRPM6
activity and surface expression. J Am Soc Nephrol 20: 78-85, 2009.
Thebault S, Cao G, Venselaar H, Xi Q, Bindels RJ, and Hoenderop JG. Role of the alpha-kinase domain in
transient receptor potential melastatin 6 channel and regulation by intracellular ATP. J Biol Chem 283:
19999-20007, 2008.
42. Topala CN, Groenestege WT, Thebault S, van den Berg D, Nilius B, Hoenderop JG, and Bindels RJ.
Molecular determinants of permeation through the cation channel TRPM6. Cell calcium 41: 513-523, 2007.
43. Torres GE, Egan TM, and Voigt MM. Hetero-oligomeric assembly of P2X receptor subunits. Specificities exist
with regard to possible partners. J Biol Chem 274: 6653-6659, 1999.
44. Turner CM, Vonend O, Chan C, Burnstock G, and Unwin RJ. The pattern of distribution of selected
ATP-sensitive P2 receptor subtypes in normal rat kidney: an immunohistological study. Cells, tissues, organs 175:
105-117, 2003.
forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J Biol Chem 279: 19-25, 2004.
hypocalcemia. Nat Genet 31: 171-174, 2002.
47. Wang J, Huo K, Ma L, Tang L, Li D, Huang X, Yuan Y, Li C, Wang W, Guan W, Chen H, Jin C, Wei J, Zhang
W, Yang Y, Liu Q, Zhou Y, Zhang C, Wu Z, Xu W, Zhang Y, Liu T, Yu D, Zhang Y, Chen L, Zhu D, Zhong X,
Kang L, Gan X, Yu X, Ma Q, Yan J, Zhou L, Liu Z, Zhu Y, Zhou T, He F, and Yang X. Toward an understanding
of the protein interaction network of the human liver. Molecular systems biology 7: 536, 2011.
48. Wildman SS, Boone M, Peppiatt-Wildman CM, Contreras-Sanz A, King BF, Shirley DG, Deen PM, and
Unwin RJ. Nucleotides downregulate aquaporin 2 via activation of apical P2 receptors. J Am Soc Nephrol 20:
1480-1490, 2009.
49. Wildman SS, Kang ES, and King BF. ENaC, renal sodium excretion and extracellular ATP. Purinergic signalling
5: 481-489, 2009.
50. Wildman SS, Marks J, Churchill LJ, Peppiatt CM, Chraibi A, Shirley DG, Horisberger JD, King BF, and
Unwin RJ. Regulatory interdependence of cloned epithelial Na+ channels and P2X receptors. J Am Soc
Nephrol 16: 2586-2597, 2005.
51. Wildman SS, Marks J, Turner CM, Yew-Booth L, Peppiatt-Wildman CM, King BF, Shirley DG, Wang W,
and Unwin RJ. Sodium-dependent regulation of renal amiloride-sensitive currents by apical P2 receptors. J
Am Soc Nephrol 19: 731-742, 2008.
52. Woudenberg-Vrenken TE, Sukinta A, van der Kemp AW, Bindels RJ, and Hoenderop JG. Transient
receptor potential melastatin 6 knockout mice are lethal whereas heterozygous deletion results in mild
hypomagnesemia. Nephron Physiol 117: p11-19, 2011.
53. Yamamoto T, and Suzuki Y. Role of luminal ATP in regulating electrogenic Na(+) absorption in guinea pig
distal colon. Am J Physiol Gastrointest Liver Physiol 283: G300-308, 2002.
216 | Chapter 9
Abstract
Magnesium (Mg2+) is essential for enzymatic activity, brain function and muscle
contraction. Blood Mg2+ concentrations are tightly regulated between 0.7 and 1.1 mmol/L
by Mg2+ (re)absorption in kidney and intestine. The apical entry of Mg2+ in (re)absorbing
epithelial cells is mediated by the transient receptor potential melastatin type 6 (TRPM6) ion
channel.

Here, flavaglines are described as a novel class of stimulatory compounds for TRPM6
activity. Flavaglines are a group of natural and synthetic compounds that target the
ubiquitously expressed prohibitins and thereby affect cellular signaling. By whole-cell
patch clamp analyses, it was demonstrated that nanomolar concentrations of flavaglines
increases TRPM6 activity by 2 fold. The stimulatory effects were dependent on the
presence of the alpha-kinase domain of TRPM6, but did not require its phosphotransferase activity. Interestingly, it was observed that two natural occurring TRPM6 mutants with
impaired insulin-sensitivity, TRPM6-p.Val1393Ile and TRPM6-p.Lys1584Glu, are not sensitive
to flavagline stimulation. To examine the therapeutic potential of flavaglines, mice were
injected with a low dose of FL3 for 7 days. Serum concentration and 24 hrs urinary Mg2+
excretion were not changed after treatment.

In conclusion, we have identified flavaglines as potent activators of TRPM6 activity.
Our results suggest that flavaglines stimulate TRPM6 via the insulin receptor signaling
pathway.
Keywords: Magnesium, Kidney, Intestine, Homeostasis, Prohibitin, Flavagline
Flavaglines Stimulate TRPM6 Activity | 217
Introduction
Magnesium (Mg2+) is an essential electrolyte for cell growth, protein synthesis and
enzymatic activity. Therefore, physiological mechanisms maintain blood Mg2+
concentrations within a tightly regulated range (0.7-1.1 mmol/L, (11, 12)). The apically
expressed Transient Receptor Potential Melastatin type 6 (TRPM6) channels are the
gatekeepers of epithelial Mg2+ transport in colon and in the distal convoluted tubule
segment (DCT) of the kidney nephron (29). Loss-of-function mutations of TRPM6 cause
intestinal Mg2+ malabsorption and renal Mg2+ wasting, as evidenced in patients suffering
from hypomagnesemia with secondary hypocalcemia (HSH, OMIM #602014, (20, 30)).
TRPM6 channels are thought to form tetramers of subunits comprising six
transmembrane segments, with a central divalent-selective pore (Ba2+>Ni2+>Mg2+>Ca2+,
(29)). Functional channels are inhibited by intracellular Mg2+ (29, 33) and consequently
display a time-dependent increase in currents upon dialysis of cells with a pipette solution
containing a strong Mg2+ chelator such as ethylenediaminetetraacetic acid (EDTA). Like its
close homolog TRPM7, TRPM6 channels comprise an intrinsic intracellular Ser/Thr kinase
domain, which has similarities to proteins of the alpha-kinase family (19). TRPM6 channels
undergo autophosphorylation, but the role of the alpha-kinase on channel function and
cell physiology is still incompletely understood (5, 21, 24, 28, 33).

Over the last decade, the epidermal growth factor (EGF) and insulin were shown to
stimulate the activity and membrane expression of TRPM6 (16, 23). Two TRPM6 single
nucleotide polymorphisms (SNPs: p.Val1393Ile and p.Lys1584Glu) were recently associated
with an increased risk of diabetes development in humans (16, 22). Subsequently, it was
shown that these mutations prevent a rapid insulin-evoked increase in channel plasma
membrane expression (16).
By combined pull down and mass spectrometry studies of the TRPM6 alpha-kinase
domain, three interacting proteins have been identified: I) Methionine sulfoxide reductase
B1 (MSRB1) which reduces the sensitivity of TRPM6 to oxidative stress (6), II) Guanine nucleotide-
binding protein subunit beta-2-like 1 (GNB2L1/RACK1) which inhibits TRPM6 activity in a
alpha-kinase-dependent manner (7). III) Prohibitin 2 or Repressor protein of Estrogen
receptor Activity (PHB2/REA) which inhibits TRPM6, an effect that is relieved by estrogens (8).
Prohibitins (PHB1 and PHB2) are ubiquitously expressed members of the family of
stomatin/prohibitin/flotillin and HflK/C (SPFH) domain containing proteins (9). PHBs are
found in the nucleus, cytoplasm and plasma membrane, where they play an important
role in cellular differentiation, anti-proliferation and mitochondrial morphogenesis (9).
PHBs modulate the cell cycle progression, regulate transcription and facilitate cell surface
signaling (9). Recently, a family of natural compounds named flavaglines was established
as high affinity ligand of PHBs (18).
Flavaglines are a family of natural compounds characterized by a cyclopenta[b]
benzofuran structure (14). Natural flavaglines and synthetic analogs have been intensively
218 | Chapter 9
studied, owing to their pleiotropic favorable properties (anti-inflammatory, anticancer,

cardioprotective and neuroprotective, (2)). Flavaglines bind PHB1 and PHB2 (with nmol/L
affinity) and the CRaf-mediated activation of oncogenic MAPK signaling (18). In addition,
the PHB binding properties of flavaglines lead to the induction of apoptosis in apoptosis
inducing factor (AIF) and caspase-12-dependent manners (2). Additionally and independently
from PHBs, flavaglines inhibit eIF4A-dependent oncogenic protein synthesis (2). The
mechanism of flavaglines neuro- and cardioprotection are likely mediated by their PHB-
interacting properties, thereby reducing oxidative stress, deleterious growth factor
signaling and release of inflammatory mediators (2).

Given the previously described inhibitory interaction of PHB2 on TRPM6 and the high
affinity binding of flavaglines to PHB1 and PHB2, this study aims to identify and characterize
the effect of flavaglines on TRPM6 activity. The molecular effects of flavaglines are studied
using patch clamp, while their in vivo properties were assessed in mice injected with a
flavagline.
Results
Synthetic Flavaglines Stimulate TRPM6 Activity
HEK293 cells were transfected with the previously described pCINeo-TRPM6-HA-IRES-GFP
vector (29). This construct allows the visual identification of cells expressing TRPM6. Cells
were then subjected to whole-cell patch clamp analysis, as previously described (29).
Briefly, currents were elicited by a series of voltage ramps applied at 0.5 Hz from a holding
voltage of 0 mV. Due to the dialysis of the cytoplasm with a pipette solution containing
EDTA, time-dependent outwardly rectifying currents were observed in response to this
ramp protocol (Figure 1A). In order to assess the effect of flavaglines on TRPM6, cells were
first exposed to FL23 (50 nmol/L, (26)), a potent analog of the established PHB2 ligand FL3
(18). This protocol yielded a significant increase in the current density without affecting
the characteristic shape of the current-voltage (IV) curve (Figure 1B) or the current time-
development characteristics (Figure 1C). The average time-development curves were
fitted with a logistic equation (see Methods). This analysis revealed that the time of
half-maximal activation (t1/2) was not changed between control and FL23-treated cells
(control: 48 2 s, FL23: 43 3 s). The rate of current development (the slope h) was
increased with FL23 treatment (control: 1.8 0.1 pApF-1s-1, FL23: 3.0 0.2 pApF-1s-1).
Pre-incubation of the cells with concentrations of FL23 ranging from 0.01 to 50 nmol/L
revealed a concentration-dependent stimulation of TRPM6 activity with an EC50=1.4 0.2
nmol/L (see Methods, Figure 1D). A similar increase in TRPM6 activity was observed with
FL3 (50 nmol/L, Figure 2A-B). Next, cells were pre-incubated with FL2 (50 nmol/L), a
flavagline that does not display significant cytotoxicity in cancer cells (25). In contrast to
FL3 and FL23, this treatment did not significantly alter the current density of TRPM6-
250 ms
C ur r e nt ( nA )
f=0.5Hz
1
-100
-50
50
100
-50
vehicle
100
50
50
200
150
100
0.5 1.0 1.5 2.0
[FL23] (nM)
10 30 50
100
250
200
FL23
150
100
vehicle
50
0
Voltage (mV)
600
C ur r e nt de ns ity ( pA /pF )
150
-50
250
40
80
120
Time (s)
160
200
500
400
300
200
*
100
0
FL23
FL23
FL3
Mock
FL2
17 E
TRPM6
TR
oc
PM
E
17
cle
23
FL
hi
hi
cle
kDa
200
ve
FL23
200
0s
Voltage (mV)
250
ve
-100 mV
200 s
100 mV
0 mV
Figure 1 Flavaglines Stimulate TRPM6 at Nanomolar Concentration

A, TRPM6 currents were evoked by a series of 500 ms voltage ramp from -100 to +100 mV applied
every 2 s (0.5 Hz) from a holding potential of 0 mV (top left inset). A typical set of current-voltage
curves obtained from a single cell is shown. B, Typical current-voltage curves obtained 200 s after
break-in from cells pre-incubated 15 min with vehicle or FL23 (50 nmol/L). C, The average time-course
of TRPM6 current development with (n=19) or without (n=19) FL23 pre-treatment are shown for
current values measured at +80 mV. D, FL23 increases TRPM6 current density in a concentration-
dependent manner (n3 per data points). Line represents the fit of data points with a Hill equation
(see Methods). E, Incubation of TRPM6 expressing cells with FL3 (50 nmol/L, n10), FL23 (50 nmol/L,
n22) or estradiol (17E) (50 nmol/L, n9) significantly increased the average current densities
measured at +80 mV 200 s after break-in. Mock-transfected cells showed a similar increase in current
density (n8). TRPM6 currents were not sensitive to FL2 (n10). Stars indicate statistically significant
difference between vehicle- (white bar) and compound-treated cells (black bar). F, The chemical
structures of FL2, FL3 and FL23 are shown. A bromide atom at position 4 is necessary for the high
affinity stimulating effects of FL3 and FL23. G, Cells were pre-incubated with vehicle, FL23 (50
nmol/L) or 17E (50 nmol/L). Total lysate were subjected to Western blot analysis using an anti-HA
primary antibody. FL23 and 17E did not significantly affect the expression of TRPM6. Stars indicate
statistically significant difference (P < 0.05) between vehicle and compound-treated cells.
220 | Chapter 9
600
400
vehicle
200
-50
50
Voltage (mV)
100
500
400
FL3
300
vehicle
200
100
0
40
80
120
Time (s)
160
200
400
FL23
300
200
FL2
vehicle
100
0
0
600
50
100
Time (s)
150
200
-100
FL-3
800
400
300
200
100
0
vehicle
FL2
FL23
Figure 2 Analogs of FL23 Show Distinct Effects on TRPM6 Currents

A, Typical current-voltage curves obtained 200 s after break-in are shown for vehicle and FL23 (50
nmol/L) pre-incubated cells. B, The average time-course of TRPM6 current development with (n=8)
or without (n=11) FL23 (50 nmol/L) is shown for current values measured at +80 mV. C, The average
time-course of TRPM6 current development with FL2 (50 nmol/L, n=12), vehicle (n=10) or FL23 (50
nmol/L, n=10) pre-treatment is shown for current values measured at +80 mV. D, FL2 incubation
does not significantly stimulate TRPM6 activity (n10). Stars indicate statistically significant difference
(P < 0.05) between vehicle and compound-treated cells.
expressing cells (Figure 2C-D). As previously reported, estradiol (17E) significantly stimulated
TRPM6 currents (Figure 1E, (8)). On average, 17E, FL3 and FL23 stimulated TRPM6 activity by
1.5 to 2-fold (Figure 1E). Interestingly, mock-transfected cells demonstrated a similar
2-fold increase in current density upon FL23 treatment, indicating that TRPM7 is also a
likely target of flavaglines action (Figure 1E). As expected from the short pre-incubation
period, the expression of TRPM6 was not influenced by FL23 or 17E (Figure 1G).
The Stimulating Effects of Flavaglines Require the Intrinsic Kinase

Domain of TRPM6
To assess the involvement of the intrinsic alpha-kinase domain in the flavagline-mediated
potentiation of TRPM6 currents, cells were transfected with the previously described
kinase-truncated (p.Leu1749*, kinase) or kinase-inactive (p.Lys1804Arg, KI) TRPM6 constructs
(24). While the first construct produces mutant channels lacking the complete kinase
domain, the KI construct form channels without intrinsic alpha-kinase phosphotransferase activity. Both constructs produce functional proteins with apparently normal channel
function in the absence of intracellular Mg2+. Using an identical pre-incubation protocol,
cells expressing the KI mutant demonstrated a FL23-mediated increase in current densities
similar to wild type (Figure 3A and C). In contrast, the kinase mutant failed to respond to
this treatment (Figure 3B-C).
Flavaglines Act along a Shared Pathway with Insulin

The intracellular amino acid residues p.Val1393 and p.Lys1584 have been shown to
independently confer sensitivity of TRPM6 channels to insulin stimulation, probably by
altering the phosphorylation of the neighboring p.Thr1393 and p.Ser1583 residues,
respectively (16). Phosphomimicking mutations of either p.Thr1391Asp or p.Ser1583Asp
were shown to be permissive in the insulin-mediated potentiation of TRPM6 (16). To
address whether flavaglines act on TRPM6 in a similar way as insulin, cells expressing either
of two naturally occurring insulin-insensitive TRPM6 SNPs (p.Val1393Ile or p.Lys1584Glu)
were pre-incubated with FL23 (50 nmol/L). These mutants failed to respond to FL23
(Figure 4A-B,E).

Following the activation of the insulin receptor, a complex multi-branched signaling
cascade is activated. One of these branches involves the activation of Phosphoinositide
3-kinase (PI3K), Akt and Ras-related C3 botulinum toxin substrate 1 (Rac1)(4). Co-expression
of TRPM6 together with the constitutively active (p.Gly12Val) or dominant-negative
(p.Thr17Asn) mutants of Rac1 have been shown to respectively allow and prevent the
increase of TRPM6 membrane expression by insulin (16). Here, cells were co-transfected
with TRPM6 and either the p.Thr17Asn or p.Gly12Val Rac1 mutants. Both mutants prevented
the stimulation of TRPM6 by FL23 (Figure 4C-D,F).
Flavaglines Do not Affect Akt Phosphorylation

Given the previously described modulation of Akt by PHBs (1)4,5-triphosphate (PIP3, the
effects of flavaglines on Akt phosphorylation were examined using the same experimental
conditions as were used in the patch clamp experiments. Following 15 min of incubation,
phosphorylation of Akt was not induced by FL2 and FL3 (50 nmol/L, Figure 5). It has been
previously demonstrated that flavaglines prevent ERK1/2 phosphorylation in a manner
that depends on CRaf (18). Here, basal ERK1/2 phosphorylation was not apparent in control
condition and no additional phosphorylation was detected upon flavaglines stimulation
(Figure 5).
Flavaglines Do not Modulate In Vivo Mg2+ Homeostasis

To explore the therapeutic potential of flavaglines, twenty C57/Bl6 mice were injected
daily with 0.1 mg/kg FL3 or placebo for 7 days, a dose previously shown to provide cardioprotective benefits in mice (3). On days 1, 3 and 7 mice were transferred to metabolic
222 | Chapter 9
kinase
120
100
400
300
200
100
0
50
C
K1804R
500
150
100
Wild type
K1804R
60
40
20
2.5
200
80
200
400
300
100
Time (s)
N o r m a li z e d c u r r e n t
kinase
50
100
Time (s)
150
200
2.0
1.5
1.0
0.5
0
Wild type
K1804R
kinase
Figure 3 The Presence of the Intrinsic Alpha-Kinase Domain of the Channel but not its
Activity is Required for Flavagline-Mediated Stimulation of TRPM6
A, The average time-course of current development of the kinase-inactive (TRPM6K1804R) with (n=7,
full symbols) or without (n=9, empty symbols) FL23 (50 nmol/L) pre-incubation is shown for current
values measured at +80 mV. B, The average time-course of current development of TRPM6L1749X
(kinase) with (n=8, full symbols) or without (n=9, empty symbols) FL23 (50 nmol/L) pre-incubation
is shown for current values measured at +80 mV. C, Pre-incubation of cells with FL23 (50 nmol/L)
stimulated wild type (n22), K1804R (n9), but not kinase (n8) channel activity. Right panel shows
current values normalized to each control condition. Stars indicate statistically significant difference
(P < 0.05) between vehicle- (white bar) and compound-treated cells (black bar).
cages for 24 hrs to collect urine and feces; blood was collected by submandibular facial
vein puncture. No differences were detected in serum Mg2+ concentrations and 24 hrs
Mg2+ total excretion between FL3-treated mice and mice receiving placebo (Figure 6A-B).
Interestingly, minor, but significant, changes were detected in serum Na+ and Ca2+ values.
FL3-treated mice had decreased serum Ca2+ at day 1, but showed elevated serum Ca2+
levels at day 7 (Figure 6C). However, these changes were not reflected in urinary Ca2+
excretion (Figure 6D). Serum Na+ was slightly lower at day 7 in FL3-treated mice (Table 1).
Given that Trpm6 mRNA expression is sensitive to changes in Mg2+ homeostasis and
reduced Trpm6 expression may compensate for increased Tprm6 activity (11, 13), kidney
and colon mRNA was isolated and analyzed. Trpm6 expression in both colon and kidney
was not altered by FL3 treatment (Figure 7A-B). Since serum Na+ was slightly reduced in
FL3-treated mice, the expression of Na+ transporters was analyzed by RT-PCR. The expression
60
40
V1393I
20
0
50
100
Time (s)
150
200
150
Rac1-T17N
0
50
100
Time (s)
150
100
K1584E
50
0
50
150
200
150
100
Rac1-G12V
50
0
200
50
Rac1T17N Rac1G12V
Wild type
1.0
0.5
0
ty
pe
V1
39
3I
4E
K1
58
il d
ty
pe
200
1.5
il d
50
150
2.0
N o r m a li z e d c u r r e n t
100
100
Time (s)
2.5
150
V1
39
3I
C urre nt de ns ity ( pA /pF )
200
200
250
E
250
100
150
Time (s)
250
50
200
200
300
100
250
4E
80
300
K1
58
100
C
120
Rac1T17N Rac1G12V
Wild type
Figure 4 Flavaglines Act upon a Common Pathway with Insulin Receptor Signaling
A-D, The average time-course of current development of cells pre-incubated with (full symbols) or
without (empty symbols) FL23 (50 nmol/L) for: (A) TRPM6V1393I (n8), (B) TRPM6K1584E (n7), (C) wild
type TRPM6 together with Rac1T17N (n6) and (D) wild type TRPM6 together with Rac1G12V (n11).
E, FL23 pre-incubation failed to alter currents in cells expressing TRPM6V1391I (n=11), TRPM6K1584E
(n8) and cells co-expressing wild type TRPM6 together with Rac1T17N (n=8) and TRPM6 together
with Rac1G12V (n14). Right panel shows current values normalized to each control condition. Stars indicate
statistically significant difference (P < 0.05) between vehicle- (white bar) and compound-treated
cells (black bar).
of the thiazide-sensitive Na+-Cl--co-transporter (Ncc) and the epithelial Na+ channel (Enac)
were not affected (Figure 7C-D).
224 | Chapter 9
kDa
vehicle
Serum
PMA
FL3
FL2
Insulin
Insulin/FL3
45
ERK-pT202
45
ERK
66
Akt-pS473
66
Akt
Figure 5 Cell Akt and ERK Signaling is Unaffected by FL3
20
8
6
4
2
0
Da
y
Da
y
7
Da
y
3
Da
y
1
Da
y
Da
y
Da
y
10
12
Urinary Ca 2+ excretion (mol/24hr)
Da
y
Da
y
3
Serum Ca 2+ concentration (mM)
Da
y
Da
y
40
0. 5
60
Da
y
1. 0
80
1. 5
Urinary Mg 2+ excretion (mol/24hr)
2. 0
Serum Mg 2+ concentration (mM)
HEK293 cells were incubated with FL2 (50 nmol/L), FL3 (50 nmol/L), PMA (100 nmol/L) or insulin (10
nmol/L) for 15 min. Protein lysates were immediately obtained and immunoblots were performed
to detect pERK1/2 and pAkt.
Figure 6 Serum and Urine Mg2+ and Ca2+ in FL3-Treated Mice

A-D, Serum Mg2+ (A) and Ca2+ (C) concentrations of placebo-treated (white bars) and FL3-treated
(black bars) mice were measured after 1, 3 or 7 days. 24 hrs urinary Mg2+ (B) and Ca2+ (D) excretion of
placebo-treated (black bars) and FL3-treated (white bars) mice was determined after 1, 3 or 7 days (n=10).
Stars indicate statistically significant difference (P < 0.05) between placebo- and FL3-treated mice.
1. 0
0. 8
0. 6
0. 4
0. 2
0
Placebo
FL 3
1. 2
1. 0
0. 8
0. 6
0. 4
0. 2
0
Placebo
Colon T RPM6 mRNA expression

(fold change compared to placebo)
1. 2
FL 3
Kidney ENaC mRNA expression

Kidney NCC mRNA expression

Kidney T RPM6 mRNA expression

1. 5
1. 0
0. 5
Placebo
FL 3
Placebo
FL 3
1. 2
1. 0
0. 8
0. 6
0. 4
0. 2
0
Figure 7 mRNA Expression of Na+ and Mg2+ Transporters after FL3 Treatment
A-D, The mRNA expression levels of Trpm6 (A-B). Ncc (C) and Enac (D) in kidney (A, C-D) or colon (B)
of placebo- (black bars) or FL3-treated (white bars) mice for 7 days were measured by quantitative
RT-PCR and normalized for Gapdh expression (n=10). Stars indicate statistically significant difference
(P < 0.05) between placebo- and FL3-treated mice.
Discussion
The present study demonstrates that the activity of the Mg2+-permeant TRPM6 channel is
stimulated 2-fold by the flavaglines compounds FL3 and FL23. This is the first report of
an exogenous natural compound that stimulates TRPM6 activity.

The activity of TRPM6 and its plasma membrane expression have been shown to be
increased upon stimulation with insulin. This effect relied on the PI3K, Akt and Rac1
signaling cascade (Figure 8). Detailed electrophysiological and total internal reflection
fluorescence (TIRF) microscopy analyses have revealed a permissive role for TRPM6-p.
Val1391 and TRPM6-p.Lys1584 sites in insulin-evoked insertion of channels in the plasma
membrane (16). Here, it is proposed that flavaglines stimulate TRPM6 by acting along the
same pathway (Figure 8). This hypothesis is based on the following observations: (I)
flavaglines increased TRPM6 activity 1.5-2 fold, which is quantitatively similar to the
previously described action of insulin on TRPM6 activity (16); (II) the insulin-insensitive
5.3 0.2
1.1 0.1
2.1 0.1
223 29
588 69
Water consumption (ml)
Urinary excretion (ml)
Fecal excretion (g)
Serum Na+ (mmol/L)
Serum K+ (mmol/L)
Urinary Na+ excretion
Urinary K+ excretion
(mol/24 hrs)
FL3
540 46
220 21
1.9 0.1
1.1 0.1
5.3 0.2
3.8 0.1*
22.7 0.2
Placebo
670 46
264 23
2.1 0.1
1.1 0.1
4.6 0.3
4.6 0.2
23.1 0.3
Day 3
FL3
756 44
314 22
2.0 0.1
1.5 0.1*
4.2 0.3
4.2 0.2
23.2 0.2
Placebo
727 44
307 18
4.5 0.1
156 1
2.2 0.1
1.5 0.2
5.8 0.7
4.5 0.2
23.6 0.4
Day 7
FL3
654 37
283 14
4.4 0.1
152 1*
1.9 0.1
1.5 0.1
5.6 0.7
4.2 0.2
23.3 0.2
Mice (n=10) were injected daily with FL3 (0.1 mg/kg) or placebo for 7 days. During the experiment the animals were housed in metabolic cages for 24 hrs
on day 1, day 3 and day 7 to determine metabolic parameters. * indicates statistical significant differences compared to placebo-injected mice at the same
time point, P < 0.05.
(mol/24 hrs)
4.1 0.1
Food consumption (g)
Placebo
22.9 0.2
Weight (g)
Day 1
Table 1 M
etabolic Parameters of Placebo- and FL3-Treated Mice
226 | Chapter 9
insulin
lipid raft
PHB2
CDK5
PI3K
TRPM6
Akt
RAC1
?
?
PHB2
CDK5
Figure 8 Proposed Model of Flavaglines Action

Flavaglines stimulate TRPM6 activity by stimulating downstream effector(s) of the insulin receptor.
PHB2 and CDK5, proteins which are known to regulate TRPM6 are localized in lipid rafts.
(TRPM6-p.Val1391Ile and TRPM6-Lys1584Glu) TRPM6 mutants were not potentiated by

flavaglines; (III) flavaglines-induced TRPM6 stimulation was absent when overexpressing
TRPM6 together with Rac1 mutants; (IV) in concordance with the mechanism of insulin
action on TRPM6, flavaglines stimulated the kinase-inactive (TRPM6-p.Lys1804Arg)
mutant. Taken together, it is hypothesized that flavaglines act by triggering or relieving a
tonic inhibition on one (or more) of the molecular player(s) involved in insulin signaling,
effectively promoting the plasma membrane insertion of wild type TRPM6 channels but
not of TRPM6 channels containing insulin-insensitive SNP mutants. Our data suggest that
the effects of flavagline-stimulation take place downstream of Akt, since no additional Akt
phosphorylation was evident upon treatment with FL3. Further experiments investigating
the detailed molecular action of flavaglines on the localization and phosphorylation of
the known kinases involved in growth-factor stimulation of TRPM6 (PI3K/Akt/RAC1/CDK5)
will be necessary to elucidate the exact molecular targets.
Flavaglines have recently been identified as potent interactors of PHBs (9). Interestingly,
PHB1 and PHB2 are enriched in detergent resistant (lipid rafts) fractions of the plasma membrane
(9). Given the previously described action of PHBs as chaperone of Ras-dependent CRaf
228 | Chapter 9
activation in the plasma membrane (18), a general function of PHBs is to provide spatial
constraints necessary for the proper regulation of proteins in specialized regions (eg the
lipid rafts) of the plasma membrane. It can be hypothesized that TRPM6 channels
transiently or permanently localize together with PHB in the lipid raft fractions of the
plasma/vesicular membrane, where channels undergo regulatory phosphorylation. The
following facts support this hypothesis: (I) TRPM6 has been shown to establish a inhibitory
interaction with PHB2 (8); (II) TRPM6 requires CDK5 phosphorylation for proper insulin-
mediated regulation, CDK5 localizing and being activated in the lipid raft fraction of
plasma membrane (17); (III) the close homolog TRPM7 has been reported to localize in
lipid rafts (32), (IV) TRPM6 requires PIP2 for proper function (31), a lipid that is enriched in
lipid rafts. Therefore, it is tempting to speculate that PHBs binding to TRPM6 promotes the
formation of a macromolecular regulatory complex in the lipid rafts of the plasma
membrane. In this perspective, it is interesting to note that the insulin-induced signaling
pathway becomes more active when the insulin receptor is expressed in lipid rafts (10, 15,
27). Altogether, these findings point towards a compartmentalized insulin signaling
cascade on/near the lipid rafts in the vesicular/plasma membrane. In this model, expression
of TRPM6 and the insulin receptor in the lipid rafts allows for the rapid local regulation of
TRPM6 by insulin.
Comparison of structure-function activity between active (FL3, FL23) and inactive
(FL2) flavaglines analogs revealed a positive correlation between cytostatic/cytotoxic
properties of flavaglines in cancer cell lines and their action on TRPM6 (18, 25, 26). While
the effects of flavaglines on cellular proliferation and growth factor signaling were evident
starting from 2 hours after compound application, the stimulatory effect shown here
occurs within 15 minutes. These results suggest that the short-term effects of flavaglines
on TRPM6 take place independently from any translational effect (eg eIF4A-dependent).
However, the concurrent structure-function relationship of flavaglines in their TRPM6-
stimulatory effects and in their cytotoxic properties suggests that both mechanisms are
PHB-dependent. It has previously been shown that PHB2 interacts with TRPM6 and that
17E reduces this inhibitory interaction (8). However, the current results suggest that 17E
and FL23 only share a partly overlapping mechanism of action. Exogenous PHB2 inhibits
TRPM6 in an alpha-kinase phosphotransferase-dependent manner (8). In contrast,
flavaglines stimulated the kinase-inactive TRPM6-p.Lys1804Arg mutant. Moreover,
flavaglines induce an increase in endogenous TRPM7 currents, while TRPM7 currents were
insensitive to PHB2-mediated inhibition (8). Further work identifying the major players that
are part of the TRPM6-PHB macromolecular complex and its regulation by flavaglines and
17E are necessary to further understand the stimulatory but slightly distinct effects of
these compounds on the activity of TRPM6.

Reduced TRPM6 channel activity results in a clinically relevant hypomagnesemia due
to renal Mg2+ wasting. Because insulin and EGF stimulate TRPM6 function, patients with
diabetes mellitus type 2 or users of EGFR inhibitors are at risk to develop hypomagnesemia
(16, 23). Given that FL3 and FL23 stimulate TRPM6 activity, flavaglines may provide an
important therapeutic potential for these patient groups. However, at the dose of 0.1 mg/
kg used in this study, FL3 did not significantly alter serum and/or 24 hrs urinary Mg2+
excretion in mice treated over the course of one week. In a recent experiment with a
mouse model of cardiotoxicity, FL3 injection caused reduced mortality and demonstrated
several cardioprotective effects using the same dose of FL3 as in our experiments (3). Both
its cardioprotective role and its effects on TRPM6 are likely PHB-dependent, and therefore
a similar dose was used. However, the actual dose of FL3 reaching the DCT cells in the
kidney where TRPM6 is located may be much lower and challenging to assess. Future
experiments assessing the bioavailability of flavaglines should be performed to allow final
conclusions on its putative magnesiotropic effects in vivo. Additionally, given the
physiological mechanism of intestinal and/or renal compensation of Mg2+ transport, the
effects of flavaglines should be assessed in a murine model of hypomagnesemia.
In conclusion, the natural compounds flavaglines stimulate the activity of TRPM6
Mg2+ channels at nanomolar concentrations. The effect is rapid (within 15 min) and
probably relies on a near-plasma membrane mechanism that likely involves PHBs. Further
in vivo experiments will be needed to validate the putative magnesiotropic properties of
these compounds with a plethora of beneficial effects.
Acknowledgements
Research (ZonMw 9120.8026, NWO Vici 016.130.668) and the EURenOmics project from the
European Union seventh Framework Programme (FP7/20072013, agreement nu 305608).
We also thank ANRT and AAREC Filia Research for fellowships to C. Basmadjian and Q.
Zhao.
Methods
Cell Culture
Human embryonic kidney cells (HEK293) were grown at 37 C in DMEM (Biowhittaker
Europe, Vervier, Belgium) supplemented with 10 % (v/v) fetal calf serum (PAA Laboratories,
Linz, Austria), non-essential amino acids, and 2 mmol/L L-glutamine in a humidified 5 %
(v/v) CO2 atmosphere. Cells were seeded in 12-well plates and subsequently transfected
with 1 g of HA-tagged TRPM6 cDNA using Lipofectamine 2000 (Invitrogen) at 1:3 DNA:Lipofectamine ratio. For patch-clamp experiments, cells were seeded two days after
transfection on glass coverslips coated with 50 mL/cm2 of 50 g/mL fibronectin (Roche,
Mannheim, Germany). Two hours later, cells were placed in the recording chamber and
selected based on the intensity of the fluorescent reporter.
230 | Chapter 9
Electrophysiology
All experiments were undertaken and analyzed using an EPC-9 amplifier and the
Patchmaster software (HEKA electronics, Lambrecht, Germany). The sampling interval was
set to 200 ms and data was low-pass filtered at 2.9 kHz. Patch clamp pipettes were pulled
from thin-walled borosilicate glass (Harvard Apparatus, March-Hugstetten, Germany) and
had resistance between 1 and 3 MW when filled with the pipette solution. Series resistance
compensation was set to 75-95 % in all experiments. Current densities were obtained by
normalizing the current amplitude to the cell capacitance.
Solutions and Compound Application

The extracellular solution contained (in mmol/L): 150 NaCl, 1 CaCl2, 10 HEPES/NaOH pH 7.4.
The pipette solution was made of: 150 NaCl, 10 Na2EDTA, 10 HEPES/NaOH pH 7.2 (29). Cells
were pre-incubated 15 min at 37 C in bath solution containing the compound of interest
or vehicle (0.1 % (v/v) dimethyl sulfoxide (DMSO)).
Immunoblotting
HEK293 cells were lysed for 1 hr at 4 C in TNE lysis buffer containing (in mmol/L): 50 Tris/
HCl pH 8.0, 150 NaCl, 5 EDTA, 1 % (v/v) Triton X-100 and protease inhibitors (pepstatin 1 g/
mL, PMSF 1 mmol/L, leupeptin 5 g/mL and aproptin 5 g/mL). Protein lysates were
denatured in Laemmli containing 100 mmol/L dithiothreitol (DTT, 30 min, 37 C) and
subsequently subjected to SDS-PAGE. Immunoblots were incubated with mouse anti-HA
(Roche, high affinity 3F10, 1:5,000), rabbit anti-Akt (Cell signaling, 1:1,000) and rabbit
anti-ERK1/2 (Cell signaling, 1:1,000) primary antibodies and peroxidase conjugated sheep
anti-mouse secondary antibodies (Jackson Immunoresearch, 1:10,000).
Animal Experiment
Twenty male C57BL/6 mice aged between 8-12 weeks were housed in a light and
temperature controlled room with ad libitum access to food and water. The animals were
randomly divided in two groups and received daily intraperitoneal injections (0.1 mg/kg) of
FL3 or placebo (polyethylene glycol 400 (PEG400). FL3 was dissolved in absolute ethanol
(2 mg/mL) and diluted 100 fold (v/v) in PEG400 (4 g/10 ml). Blood was collected at day 1,
day 3 and day 7 by submandibular facial vein puncture. Mice were housed for 24 hrs in
metabolic cages at day 0-1, day 2-3 and day 6-7 to collect feces and urine. At day 7, the animals
were sacrificed and kidneys and intestine were taken and immediately frozen in liquid nitrogen.
Animal experiments were performed in concordance with national and institutional
guidelines and approved by the Radboud University Nijmegen animal ethics board.
Electrolytes Measurements
Serum concentrations and urinary total Ca2+ and Mg2+ excretions were determined using
colorimetric assay kits according to the manufacturers protocols (Lancer, St. Louis, MO,
USA and Roche Diagnostics, Woerden, the Netherlands, respectively). Serum and urinary
Na+ and K+ were analyzed using a Hitachi automatic analyzer (Hitachi, Laval, Quebec,
Canada).
Expression Analysis
Total RNA was isolated using TRIzol total RNA isolation agent (Invitrogen, Breda, the
Netherlands) and treated with DNase (1U/g RNA, Promega, Leiden, the Netherlands) to
remove genomic DNA. Subsequently, reverse transcription of the RNA by M-MLV reverse
transcriptase (Invitrogen) was performed for 1 hr at 37 C. Gene expression levels were
determined by quantitative real-time PCR on a Bio-Rad analyzer using iQ Sybr Green
(BioRad, Veenendaal, the Netherlands) and normalized for Gapdh expression levels. Primer
sequences are listed in Table 2.
Table 2 P
rimer Sequences
Forward primer
Reverse primer
Trpm6
Ncc
Enac
5-CATGCCTGGAGTCAACAATG-3
5-CCATAAAAGCAGGCTCATCC-3
Gapdh
Statistical and Data Analysis

All results are depicted as mean standard error of the mean (SEM). Statistical analysis was
conducted by one-way Students t-test when comparing two treatment groups or
experimental conditions. When comparing multiple groups statistical comparisons were
analyzed by two-way ANOVA with a Tukeys multiple comparison test. Difference in means
with P values <0.05 were considered statistically significant and indicated by a star (*).

Current time-development curves were fitted with a logistic equation: I=I0+((Imax-I0)/
(1+(t/t1/2)-h)s), with I the current density, I0 the baseline current density, t the time, t1/2 the
time of half-maximal current density, h the slope and s a parameter. Half-maximal
stimulatory concentration (EC50) was obtained by fitting a Hill equation to the data points:
I =I0+(Imax I0) *(([FL23]n)/(IC50n+[FL23]n)), with I the current density, I0 the baseline current
density obtained in control conditions, Imax the maximal current value and n the Hill
number.
232 | Chapter 9
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Ande SR, and Mishra S. Prohibitin interacts with phosphatidylinositol 3,4,5-triphosphate (PIP3) and
modulates insulin signaling. Biochemical and biophysical research communications 390: 1023-1028, 2009.
Basmadjian C, Thuaud F, Ribeiro N, and Desaubry L. Flavaglines: potent anticancer drugs that target
prohibitins and the helicase eIF4A. Future medicinal chemistry 5: 2185-2197, 2013.
Bernard Y, Ribeiro N, Thuaud F, Turkeri G, Dirr R, Boulberdaa M, Nebigil CG, and Desaubry L. Flavaglines
alleviate doxorubicin cardiotoxicity: implication of Hsp27. PloS one 6: e25302, 2011.
Bezzerides VJ, Ramsey IS, Kotecha S, Greka A, and Clapham DE. Rapid vesicular translocation and
insertion of TRP channels. Nature cell biology 6: 709-720, 2004.
Brandao K, Deason-Towne F, Zhao X, Perraud AL, and Schmitz C. TRPM6 kinase activity regulates TRPM7
trafficking and inhibits cellular growth under hypomagnesic conditions. Cellular and molecular life sciences :
CMLS 2014.
Cao G, Lee KP, van der Wijst J, de Graaf M, van der Kemp A, Bindels RJ, and Hoenderop JG. Methionine
sulfoxide reductase B1 (MsrB1) recovers TRPM6 channel activity during oxidative stress. The Journal of biological
chemistry 285: 26081-26087, 2010.
Cao G, Thebault S, van der Wijst J, van der Kemp A, Lasonder E, Bindels RJ, and Hoenderop JG. RACK1
inhibits TRPM6 activity via phosphorylation of the fused alpha-kinase domain. Current biology : CB 18: 168-176,
2008.
Cao G, van der Wijst J, van der Kemp A, van Zeeland F, Bindels RJ, and Hoenderop JG. Regulation of the
activity (REA). The Journal of biological chemistry 284: 14788-14795, 2009.
Chowdhury I, Thompson WE, and Thomas K. Prohibitins role in cellular survival through Ras-Raf-MEK-ERK
pathway. Journal of cellular physiology 229: 998-1004, 2014.
Cohen AW, Razani B, Wang XB, Combs TP, Williams TM, Scherer PE, and Lisanti MP. Caveolin-1-deficient
mice show insulin resistance and defective insulin receptor protein expression in adipose tissue. American
journal of physiology Cell physiology 285: C222-235, 2003.
involved in renal Mg(2+) handling. American journal of physiology Renal physiology 305: F1563-1573, 2013.
de Baaij JHF, Hoenderop JGJ, and Bindels RJM. Regulation of magnesium balance: lessons learned from
human genetic disease. Clinical kidney journal 5: i15-i24, 2012.
Kim S, Salim AA, Swanson SM, and Kinghorn AD. Potential of cyclopenta[b]benzofurans from Aglaia
species in cancer chemotherapy. Anti-cancer agents in medicinal chemistry 6: 319-345, 2006.
Morino-Koga S, Yano S, Kondo T, Shimauchi Y, Matsuyama S, Okamoto Y, Suico MA, Koga T, Sato T,
Shuto T, Arima H, Wada I, Araki E, and Kai H. Insulin receptor activation through its accumulation in lipid
rafts by mild electrical stress. Journal of cellular physiology 228: 439-446, 2013.
Nair AV, Hocher B, Verkaart S, van Zeeland F, Pfab T, Slowinski T, Chen YP, Schlingmann KP, Schaller
Okada S, Yamada E, Saito T, Ohshima K, Hashimoto K, Yamada M, Uehara Y, Tsuchiya T, Shimizu H,
Tatei K, Izumi T, Yamauchi K, Hisanaga S, Pessin JE, and Mori M. CDK5-dependent phosphorylation of the
Rho family GTPase TC10(alpha) regulates insulin-stimulated GLUT4 translocation. The Journal of biological
chemistry 283: 35455-35463, 2008.
Polier G, Neumann J, Thuaud F, Ribeiro N, Gelhaus C, Schmidt H, Giaisi M, Kohler R, Muller WW,
Proksch P, Leippe M, Janssen O, Desaubry L, Krammer PH, and Li-Weber M. The natural anticancer
compounds rocaglamides inhibit the Raf-MEK-ERK pathway by targeting prohibitin 1 and 2. Chemistry &
biology 19: 1093-1104, 2012.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
Ryazanova LV, Dorovkov MV, Ansari A, and Ryazanov AG. Characterization of the protein kinase activity
of TRPM7/ChaK1, a protein kinase fused to the transient receptor potential ion channel. The Journal of biological
chemistry 279: 3708-3716, 2004.
Schmitz C, Dorovkov MV, Zhao X, Davenport BJ, Ryazanov AG, and Perraud AL. The channel kinases
TRPM6 and TRPM7 are functionally nonredundant. The Journal of biological chemistry 280: 37763-37771, 2005.
Song Y, Hsu YH, Niu T, Manson JE, Buring JE, and Liu S. Common genetic variants of the ion channel
transient receptor potential membrane melastatin 6 and 7 (TRPM6 and TRPM7), magnesium intake, and risk of
type 2 diabetes in women. BMC medical genetics 10: 4, 2009.
Thebault S, Alexander RT, Tiel Groenestege WM, Hoenderop JG, and Bindels RJ. EGF increases TRPM6
Thebault S, Cao G, Venselaar H, Xi Q, Bindels RJ, and Hoenderop JG. Role of the alpha-kinase domain in
transient receptor potential melastatin 6 channel and regulation by intracellular ATP. The Journal of biological
chemistry 283: 19999-20007, 2008.
Thuaud F, Bernard Y, Trkeri G, Dirr R, Aubert G, Cresteil T, Baguet A, Tomasetto C, Svitkin Y,
Sonenberg N, Nebigil CG, and Dsaubry L. Synthetic analogue of rocaglaol displays a potent and selective
cytotoxicity in cancer cells: involvement of apoptosis inducing factor and caspase-12. Journal of medicinal
chemistry 52: 5176-5187, 2009.
Thuaud F, Ribeiro N, Gaiddon C, Cresteil T, and Desaubry L. Novel flavaglines displaying improved
cytotoxicity. J Med Chem 54: 411-415, 2011.
Vainio S, Heino S, Mansson JE, Fredman P, Kuismanen E, Vaarala O, and Ikonen E. Dynamic association
of human insulin receptor with lipid rafts in cells lacking caveolae. EMBO reports 3: 95-100, 2002.
van der Wijst J, Blanchard MG, Woodroof HI, Macartney TJ, Gourlay R, Hoenderop JG, Bindels RJ, and
Alessi DR. Kinase and channel activity of TRPM6 are co-ordinated by a dimerization motif and pocket
interaction. The Biochemical journal 460: 165-175, 2014.
Voets T, Nilius B, Hoefs S, van der Kemp AW, Droogmans G, Bindels RJ, and Hoenderop JG. TRPM6
forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. The Journal of biological
chemistry 279: 19-25, 2004.
Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck GE, Englehardt
Xie J, Sun B, Du J, Yang W, Chen HC, Overton JD, Runnels LW, and Yue L. Phosphatidylinositol 4,5bisphosphate (PIP(2)) controls magnesium gatekeeper TRPM6 activity. Scientific reports 1: 146, 2011.
Yogi A, Callera GE, Tostes R, and Touyz RM. Bradykinin regulates calpain and proinflammatory signaling
through TRPM7-sensitive pathways in vascular smooth muscle cells. American journal of physiology Regulatory,
integrative and comparative physiology 296: R201-207, 2009.
Zhang Z, Yu H, Huang J, Faouzi M, Schmitz C, Penner R, and Fleig A. The TRPM6 kinase domain
determines the Mg ATP-sensitivity of TRPM7/M6 heteromeric ion channels. The Journal of biological chemistry
2014.
Discussion on the Distal Convoluted Tubule | 237
Magnesium (Mg2+) homeostasis is the balance between intestinal uptake, storage in bone
and renal excretion. Animal studies with various Mg2+ diets have demonstrated that the
adaptability to differences in Mg2+ intake mainly takes place in the kidney (Chapter 2)(46,
133). Within the kidney, the distal convoluted tubule (DCT) is responsible for reabsorption
of about 10 % of the filtered Mg2+ (9). Although the amount of Mg2+ reabsorption in the
DCT is much lower than the reabsorption in the proximal tubule (PT, 10-25%) and the thick
ascending limb of Henles Loop (TAL, 50-70 %), it is the most tightly regulated part of Mg2+
reabsorption in the kidney (23). Mg2+ transport in the DCT determines the final urinary
Mg2+ excretion, since no reabsorption takes places beyond this segment. Animal studies
using loop diuretics, severely reducing the Mg2+ reabsorption in TAL, did not result in renal
Mg2+ wasting (60, 134). Indeed, increased Mg2+ reabsorption in DCT compensated for the
reduced TAL reabsorption, suggesting that the DCT is capable to double, triple or even
quadruple its reabsorption capacity (60). Several key players in Mg2+ reabsorption in DCT
have been described to date, mainly driven by the advances that were made over the last
decade elucidating monogenetic Mg2+-related tubulopathies (23). For instance, TRPM6
was identified as the apical cation channel mediating Mg2+ uptake in the DCT cell by
linkage-analysis of patients with hypomagnesemia and secondary hypocalcemia (HSH)
(111, 140). However, the basolateral extrusion mechanism for Mg2+ remains to be identified.
Additionally, the complex regulatory network of Mg2+ reabsorption in the DCT is only
partially deciphered. Therefore, this thesis aimed to identify new molecular players in DCT
Mg2+ transport.
The Distal Convoluted Tubule

The DCT is the segment of the nephron that is anatomically defined as the convoluted
tubule segment that starts from the macula densa and runs until the connecting tubule
(CNT)(13). The DCT can be subdivided in two segments: DCT1, which consists entirely of
DCT cells and DCT2, where DCT cells are present together with intercalated cells (30).
Functionally, DCT2 is responsive to the mineralocorticoid hormone aldosterone, whereas
DCT1 cells are not (100). DCT cells have a distinct morphology characterized by extensive
invaginations of the basolateral membrane (Figure 1)(61). In the cytoplasm between
the lamella-like structures formed by the basolateral membranes, a high amount of
mitochondria are located which provide the energy for Na+-K+-ATPase activity. Within the
kidney, the DCT cells contain the largest number of mitochondria compared to any other
segment. Because of the invaginations, the cell nucleus and endoplasmic reticulum are
located near the apical membrane of the cell. The cell nuclei may even have a flattened
appearance in histological analyses (100). At the molecular level, DCT cells can by identified
238 | Chapter 10
0 mV / -30 mV
Figure 1 Overview of Ion Transport in the Distal Convoluted Tubule Cell

Fine-tuning (10 %) of Mg2+ transport takes place transcellular in the distal convoluted tubule (DCT).
At the apical membrane, Na+ and Cl- enter the cell via NCC. TRPM6 mediates Mg2+ uptake from the
pro-urine, which depends on the voltage-gradient set by back leak of K+ via ROMK and Kv1.1 potassium
channels. Mg2+ transport via TRPM6 can be activated by EGF and insulin. Upon activation of the
EGFR and IR an intracellular signaling cascade including PI3K, Akt and Rac1 results in an increased
TRPM6 membrane expression and increased channel activity. Within the cell, Mg2+ is bound by
parvalbumin. At the basolateral membrane, Mg2+ extrusion may be facilitated by SLC41A3, which
may be regulated by CNNM2 acting as Mg2+-sensor. Mg2+ extrusion depends on the Na+ gradient,
set by the Na+-K+-ATPase. The activity of the Na+-K+-ATPase is in turn dependent on K+ recycling
via Kir4.1. FXYD2 transcription encoding the -subunit of the Na+-K+-ATPase, is regulated by HNF1.
ROMK: Renal Outer Medulla K+ channel, ClC-Kb: Chloride channel Kb, Kv1.1: Voltage gated K+ channel
1.1, TRPM6: Transient receptor potential melastatin type 6, NCC: Na+-Cl- co-transporter, CNNM2: Cyclin
M2, SLC41A3: Solute carrier family 41 member 3, FXYD2: FXYD-domain containing 2, HNF1: Hepatocyte
Nuclear Factor 1, PCBD1: Pterin-4 alpha-carbinolamine dehydratase, EGF: Epidermal Growth Factor, EGFR:
Epidermal Growth Factor Receptor, IR: Insulin Receptor, PI3K: Phosphoinositide 3-kinase, Rac1: Ras-related
C3 botulinum toxin substrate 1, Cdk5: Cyclin-dependent kinase 5.
by the expression of marker proteins such as the thiazide-sensitive Na+-Cl--cotransporter

(NCC) and parvalbumin (PV). DCT2 cells also express the Epithelial Na+ Channel (ENaC). As
a result, in DCT1 the NCC protein exclusively mediates Na+ transport. In DCT2, Na+ uptake
via ENaC results in simultaneous K+ secretion via Renal Outer Medullary K+ channels
(ROMK)(125). Na+ transport in DCT is important for the development of a voltage gradient
across the epithelium, which develops from 0 mV at the early DCT1 segment to -30 mV in
DCT2 (Figure 1)(4, 144).
DCT Cell Lines

Since the first attempts in the 1980s, the highly differentiated and polarized DCT cells have
proven to be extremely difficult to culture in vitro. Initially, intact distal tubules from dogs
and rats were, therefore, used to study electrolyte transport in DCT (22, 97). Given the
limitations of using intact tubules to examine the cellular and molecular mechanisms of
DCT electrolyte transport, several groups have pursued to establish a DCT cell line. In 1991,
the group of Friedman reported the isolation and immortalization of murine DCT cells
(mDCT) that were subsequently used frequently to study Na+, Ca2+ and Mg2+ influx (37,
94). These cells have been shown to express NCC and to allow thiazide-sensitive 22Na+
uptake, but other DCT genes such as the mineralocorticoid receptor and TRPM6 are
poorly expressed. Interestingly, the mDCT cells also express ENaC and can, therefore, be
used as a model for DCT2. Although Mg2+ influx in these cells has been measured, this has
been proven extremely difficult and sensitive to osmotic changes. Nevertheless, the
mDCT cells have been instrumental in the identification of new Mg2+ transporters,
including cyclin M2 (CNNM2), solute carrier family 41 member 1 (SLC41A1), nonimprinted
in Prader-Willi/Angelman syndrome (NIPA) and membrane Mg2+ transporter (MMgT)(41,
43, 98). Functional evidence for the Mg2+ transport capacity of some of the new genes,
such as NIPA and MMgT, is extremely scarce and their role in Mg2+ reabsorption should,
therefore, be reconsidered (40, 44). Alternatively, Vandewalle and colleagues have
established another DCT cell line from microdissected mouse DCT in 1999, named
mpkDCT cells (29). By culturing these cells on collagen-coated permeable membrane
filters, the mpkDCT cells will differentiate and form a confluent monolayer with a resistance
comparable to primary DCT cultures (26, 29). Generally, the mpkDCT cells are considered
to have higher thiazide-sensitive Na+ transport than mDCT cells, although a recent
subclone, mDCT15, may provide similar transport rates (64). Just like the mDCT cells, the
mpkDCT cells are of DCT2 origin, as shown by the expression of Transient receptor
potential vanilloid type 5 (TRPV5), calbindin-D28k and the parathyroid hormone (PTH)
receptor (26). Potentially due the DCT2 origin of both cell lines, they provide poor models
to study transepithelial Mg2+ transport. Although Mg2+ transport has been measured in
mDCT cells, many magnesiotropic DCT proteins are not expressed (unpublished data).
Thus, the need for a DCT1 cell line to study transepithelial Mg2+ transport is high.
Primary DCT Cells

Over the last 50 years, microdissection using forceps has been the leading technique to
obtain primary DCT cells (145). In contrast to the TAL and collecting duct (CD) cells that
240 | Chapter 10
each make up about 20 % of total nephron length, less than 5 % of the nephron consists
of DCT cells (147). Therefore, microdissection of DCT cells is highly labor-intensive and
results in very little material. In Chapter 2 automated-sorting of primary DCT cells was
established to study Mg2+-sensitive gene expression at the whole genome scale using
microarrays. Mice expressing the enhanced green fluorescent protein (eGFP) behind a Pv
promoter were sacrificed and the fluorescent DCT cells were isolated using the Complex
Object Parametric Analyzer and Sorter (COPAS) system (82). In comparison to microdissection,
COPAS significantly increases the yield and, therefore, allows large-scale expression studies
with pure DCT cells. Previous expression studies only reported mRNA transcript levels of
the combined DCT/CNT segments of the kidney (95). Recently, COPAS-sorted DCT cells
were shown to exhibit thiazide-sensitive Na+ transport, evidencing NCC activity (82). In
Chapter 2, the expression of all DCT-specific genes including Ncc, Trpm6 and Pv was
highly enriched compared to non-DCT tubules of the same kidney. The subsequent
expression profiling revealed that of all genes implicated in hypomagnesemia-related
genetic diseases, only Trpm6, Cnnm2 and Epidermal growth factor (Egf) were regulated by
the Mg2+ availability. These results demonstrate that COPAS-sorted DCT cells are the first
highly abundant alternative for microdissection and subsequent established DCT cell
lines.
Distal convoluted tubule cells are highly specialized cells characterized by
basolateral invaginations and high amounts of mitochondria
The distal convoluted tubule determines the final urinary Mg2+ excretion
COPAS sorting of distal convoluted tubule cells provides a high efficiency and
high quality alternative for microdissection and distal convoluted tubule cell
lines
Apical membrane: Regulation of TRPM6

Mg2+ reabsorption in DCT is mediated by the apical influx of Mg2+ via TRPM6 (Figure 1)
(138). TRPM6 is composed of 6 transmembrane domains with the predicted channel pore
between the fifth and sixth membrane-spanning domain (Figure 2). In this reentrant loop
two glutamate residues, p.Glu1024 and p.Glu1029, determine the pore selectivity for Mg2+
ions (74). Interestingly, the same two residues render the pH-sensitivity of TRPM6 channels.
Hence, acidification increases TRPM6 activity (74). TRPM6 forms homotetramers or heterotetramers with its closest homologue TRPM7 to become functionally active (75). A unique
characteristic of TRPM6 and TRPM7 proteins is that they have an atypical kinase domain
fused to their intracellular COOH-terminus (135). The kinase domain is involved in the
channels autophosphorylation, but its exact function remains to be identified. Recently,
0 mV / -30 mV
K K
1024 1029
V
T
1393
1831
1755
1584
Figure 2 Overview of Regulatory Pathways of TRPM6 Mediated Mg2+ Transport

TRPM6 consists of 6 membrane-spanning domains with its predicted channel pore between the
fifth and sixth transmembrane domain. Two lysine residues (p.Lys1024 and p.Lys1029) determine
the pH sensitivity and specificity of the pore for Mg2+ transport. TRPM6 has a kinase domain fused
to its C-terminus, which can be bound by interacting proteins including MSRB1, PHB2 and GNB2L1.
The p.Thr1831 residue is essential for autophosphorylation of the channel and p.Met1755 is sensitive
to oxidative stress. The activity of TRPM6 can be inhibited by extracellular ATP by binding the P2X4
receptor. Insulin and EGF stimulate TRPM6 activity by activation of an intracellular signaling pathway
including PI3K, Akt and Rac1. The p.Val1393 and p.Lys1584 are essential for insulin stimulation.
MSRB1: methionine sulfoxide reductase B1, GNB2L1: guanine nucleotide-binding protein subunit beta-2-like
1, PHB2: prohibitin 2, P2X4: Purinergic receptor X4, EGF: epidermal growth factor, IR: insulin receptor, EGFR:
epidermal growth factor receptor, PI3K: Phosphoinositide 3-kinase, Rac1: Ras-related C3 botulinum toxin
substrate 1, Cdk5: Cyclin-dependent kinase 5.
the kinase of TRPM7 was shown to be proteolytically cleaved from the channel (25). TRPM7
kinase fragments could translocate to the nucleus to activate chromatin remodeling (69).
It would be of major interest to examine whether the kinase of TRPM6 is also cleaved
and to identify which genes are regulated by the kinase fragments in the cell nucleus.
The necessity of TRPM7 for the functional activity of TRPM6 has been extensively discussed
over the last decade (14, 75, 112). Recent data on the regulation of TRPM6 activity by
242 | Chapter 10
intracellular Mg2+ provide new arguments for a significant role of TRPM7. Intracellular Mg2+
acts as a negative feedback mechanism for excessive Mg2+ uptake and, therefore, inhibits
TRPM6 and TRPM7. Although initial reports indicated that the IC50 of Mg2+ inhibition on
TRPM6 was in the range of 0.5 mmol/L (138), a recent study by Zhang and colleagues
reports much lower concentrations of intracellular Mg2+ (IC50: 29 mol/L)(149). Interestingly,
TRPM6-TRPM7 heterotetramers are inhibited at higher concentrations of intracellular Mg2+
(IC50: 466 mol/L). Since the intracellular Mg2+ concentrations are normally in the range of
0.2-1.0 mmol/L, these results question the physiological activity of homotetrameric TRPM6
channels. Thus, the exact composition of functional TRPM6 channels in the DCT should
be examined in future studies.

Mutations in TRPM6 lead to hypomagnesemia with secondary hypocalcemia (HSH),
caused by intestinal malabsorption and renal wasting of Mg2+ (111, 140). Since TRPM6 is
the gatekeeper of Mg2+ reabsorption in DCT, it is the main target of regulation of renal
Mg2+ reabsorption. Over the last decade, genetic and molecular studies have identified
several regulators of TRPM6 activity and plasma membrane availability, including
epidermal growth factor (EGF), insulin, pH and several interacting proteins (Table 1)(10-12,
74, 86, 126). In this thesis, two new regulatory pathways of TRPM6 activity are described,
underlining the central role of TRPM6 in Mg2+ homeostasis. In Chapter 8, the role of
purinergic receptors in ATP-mediated inhibition of TRPM6 was explained. Chapter 9
reports a new biological compound of the flavagline family that can activate TRPM6
activity.
Endocrine and Paracrine Regulation

After reports of hypomagnesemia in patients using EGF receptor (EGFR) inhibitors such as
cetuximab and in patients with diabetes mellitus type 2 (114, 141), research has focused
the last years on the effect of EGF and insulin on TRPM6 activity (86, 126). EGF activates
upon binding to the EGFR an intracellular signaling cascade including phosphoinositide
3-kinase (PI3K), Akt and Ras-related C3 botulinum toxin substrate 1 (RAC1) leading to an
increased insertion of TRPM6 in the plasma membrane (47, 126) (Figure 2). In patients using
cetuximab, EGFR cannot be activated, resulting in lower TRPM6 plasma membrane
expression and thus reduced Mg2+ reabsorption in DCT. In a similar fashion, insulin can
activate TRPM6 activity and plasma membrane expression (86). Interestingly, patients with
diabetes mellitus have an increased incidence of two single nucleotide polymorphisms
(SNPs), p.Ile1393Val and p.Lys1584Glu in TRPM6, which impair the insulin-sensitivity of the
Mg2+ channel. Although EGF has been shown to be produced locally and may have some
paracrine action, EGF and insulin are mainly endocrine factors reaching the DCT cells via
the blood.
In Chapter 8, a new autocrine and paracrine mode of TRPM6 regulation has been
identified. Initial studies to P2X receptors in DCT performed by Dai and colleagues in
mDCT cells demonstrate that Mg2+ transport is sensitive to ATP (21). P2X receptors form
Table 1 R
egulation of TRPM6 in the Kidney
Regulatory Hormones
Factor
Effects
on activity
Effect
on transcription
Residues
Ref.
EGF
Insulin
Estrogen
(12, 46)
ATP
Chapter 8
(55, 126)
p.Val1393, p.Lys1584
(71, 86)
Intracellular Factors
Factor
Effects
on activity
Effect
on transcription
Residues
Ref.
Mg2+
pH
H2O2
(10)
ATP
(127)
(138, 149)
p.Glu1024, p.Glu1029
(74)
Drugs and Compounds

Factor
Effects
on activity
Effect
on transcription
Residues
Ref.
2APB
(75)
FL3/FL23
Chapter 9
Thiazide
(87)
CNIs
(54)
PPIs
(70)
Rapamycin
(57)
EGFR blockers
(27)
Interacting proteins
Factor
Effects
on activity
Effect
on transcription
Residues
Ref.
MSRB1
p.Met1755
(10)
PHB2
GNB2L1
(12)
p.Thr1851
(11)
This table lists all regulating factors of TRPM6 activity and TRPM6 transcription. Activity is measured
by whole-cell patch clamp analysis and can therefore be defined as the total of open pore probability,
channel conductance and plasma membrane expression.
ATP-activated ion channels. Each channel consists of homo- or heterotrimers in which the
large extra cellular loops provide the ATP-binding sites (15, 89). Upon ATP binding the
channel opens, resulting in a non-selective cation entry into the cell. The expression
244 | Chapter 10
pattern of P2x1-7 in the DCT was determined using COPAS-sorted DCT cells. Within the
DCT, P2x4 and P2x6 were the only P2X isoforms with high expression levels in DCT cells.
However, co-localization of P2X4 and NCC was not detected when staining for P2X4 on
mouse kidney sections. In contrast, P2X6 is exclusively expressed in DCT. By patch clamp
analysis P2X4 was shown to inhibit TRPM6 activity when co-expressed in human
embryonic kidney cells (HEK293). Since both channels are expressed in the colon, a role of
P2X4 in the intestinal regulation of Mg2+ absorption was suggested. The secretion of ATP
in the lumen of intestine and the kidney tubule is regulated by flow (16). This suggests that
luminal ATP release could provide an important paracrine feedback mechanism to correct
for variations in flow in the tubule (72). Interestingly, ENaC has also been shown to be
inhibited by P2X4 receptors (142), suggesting that ATP-induced inhibition of ion channels
provides a general regulatory mechanism in response to flow changes.

Given that in patch clamp analysis P2X4 activation reduced TRPM6 currents and P2X6
had no effect on the channel activity, it would be interesting to further clarify the role of
P2X6 in the kidney. The unique expression pattern of P2X6, only being present in the DCT
suggests a role of P2X6 in the regulation of Na+ and Mg2+ transport mechanisms. However,
in our and previous studies it has been reported that P2X6 is not functional on its own but
requires P2X2 or P2X4 channels to reach the plasma membrane (73, 131). This kind of
mechanism is difficult to study in vitro, since it is challenging to influence and measure the
exact composition of heterotrimeric channels. Moreover, overexpression studies are not
conclusive since the endogenously expressed P2X receptors will also influence the
heteromeric complexes of the overexpressed proteins. Recently, a large consortium
developed a P2x6 knockout (KO) mouse (143) and it would be interesting to measure
blood and urinary Na+, K+ and Mg2+ values in this strain to determine the physiological
role of P2X6.
Interacting Proteins
By pull down experiments using the atypical kinase domain of TRPM6, several interacting
proteins have been identified (10-12). First, methionine sulfoxide reductase B1 (MSRB1)
binds the TRPM6 kinase to protect the channel from reactive oxygen species (10). DCT
cells are among the cell types with the highest mitochondria content in the body and are,
therefore, sensitive to oxidative stress. Notably, free methionine residues are prone to
oxidation, which inhibits TRPM6 channel activity (10). MSRB1 is a methionine reductase
(62), which by binding TRPM6 can reduce Met1755 after oxidative stress and thus rescue
TRPM6 inhibition (10). Second, guanine nucleotide-binding protein subunit beta-2-like 1
(GNB2L1) / receptor for activated C-kinase (RACK1) was identified to bind TRPM6 at
positions 1857-1885 and inhibit the channel activity (11). Autophosphorylation of TRPM6 at
p.Thr1851 is necessary for this inhibitory effect, although it does not affect GNB2L1 binding
(11). Interestingly, this autophosphorylation site is important for the regulation of TRPM6
activity by intracellular Mg2+, which provides a negative feedback mechanism. GNB2L1
binding may thus regulate the Mg2+ sensitivity of TRPM6. Third, prohibitin 2 (PHB2) /
repressor of estrogen receptor activity (REA) binds to the TRPM6 kinase domain at the
exact same location as RACK1 (12). PHB2 inhibits TRPM6 activity in kinase activity
dependent manner. Interestingly, estrogen prevents the binding of PHB2 to TRPM6 and,
thereby, stimulates channel activity.
In Chapter 9, a subgroup of flavaglines was shown to bind PHB2 and, therefore, their
functional effects on TRPM6 activity were tested. Flavaglines are cyclopental[b]benzofuran
structures that were originally used in traditional Chinese medicine and extracted from
the aglaia (Meliaceae) plant (103). Flavagline 23 (FL23) activated TRPM6 in the nanomolar
range, making FL23 a potent molecule to increase Mg2+ transport. Patch clamp analysis
demonstrated a similar effect of FL23 on mock currents, suggesting that TRPM7 was
activated in an analogous manner. If the mechanism of action of FL23 depends on PHB2
binding, this would suggest that PHB2 also binds TRPM7. PHB1 and PHB2 are central
players in cell cycle control (128). Several studies have demonstrated the role of TRPM7 in
cell growth and differentiation (91). PHB binding to TRPM7 could provide a new regulatory
mechanism for TRPM7 activity in cell growth. For future research, it would be interesting
to develop and test new flavagline compounds with higher specificity for TRPM6. TRP
channels are highly homologous and, therefore, compounds targeting TRP channels
show often relatively low specificity (88). For application of flavaglines in vivo or in clinic,
the specificity of flavagalines should be improved.
TRPM6 mediates apical Mg2+ entry in the distal convoluted tubule cell and is
regulated by EGF, insulin and pH

Extracellular ATP inhibits TRPM6 activity by binding P2X4 purinergic receptors
Flavagline compounds provide a new class of TRPM6 activating agents
Nucleus: Transcriptional regulation

In Chapter 2 and in previous studies comparing mice fed with Mg2+-deficient and
Mg2+-enriched diets, gene expression in the kidney was shown to be very sensitive to
alterations in Mg2+ homeostasis (46, 133). Notably, Trpm6, Cnnm2 and Egf were among the
genes that exhibit an increased expression in the low Mg2+ diet fed mice. However, the
molecular players involved in transcriptional regulation of these magnesiotropic genes
are largely unknown. Pioneering studies by Ikari and colleagues reported that the
expression of TRPM6 is increased by EGF stimulation (55, 56). Their findings propose a
mechanism in which the extracellular signal-regulated kinases (ERK) signaling pathway is
activated upon EGFR binding, eventually resulting in activation of cFos/cJun binding to an
Activator Protein-1 (AP-1) binding site in the TRPM6 promoter (56) (Figure 3). An additional
246 | Chapter 10
0 mV / -30 mV
J
TGACCAC
-741
GGTAAATATTACCG
FXYD2
AATGTTTAATGCC
+3257
AGAACAATGG
Figure 3 Overview of Transcriptional Regulation of Mg2+ transport in the DCT

In the DCT cell nucleus, TRPM6 expression is regulated via an EGF signaling pathway resulting in
activation of cFos/cJun proteins binding to an AP1 site in the TRPM6 promoter. FXYD2 transcription
can be activated by binding of HNF1B and its transcriptional coactivator PCBD1. Sox9 expression in
DCT has been shown to be extremely sensitive to dietary Mg2+ availability, but its molecular targets
remain to be identified.
TRPM6: Transient receptor potential melastatin type 6, FXYD2: FXYD-domain containing 2, HNF1: Hepatocyte Nuclear Factor 1, PCBD1: Pterin-4 alpha-carbinolamine dehydratase, EGF: Epidermal Growth Factor,
AP1: Activator Protein 1, SOX9: SRY (sex determining region Y)-box 9.
activators of TRPM6 transcription is estrogen, however the transcriptional mechanism of

estrogen is still unknown (46). In Chapter 2 the microarray screening of Mg2+-sensitive
mRNA transcription identified two new transcriptional regulators in DCT.
First, Sex determining region Y-box 9 (Sox9) was upregulated 5-fold in low Mg2+ diet fed
mice compared to littermates given the high Mg2+ diet. SOX9 is a key transcription factor
in tissue development. Kidney-specific Sox9 KO mice show impaired kidney development
en the formation of ectopic nephrons (99). Although the effect of SOX9 on nephron
segmentation is unknown, Sox9 expression is considered very low in adult nephron tissue.
Interestingly, in other epithelial cells such as colonic crypts and duodenal cells, SOX9 is
used as a marker for proliferation of progenitor cells that are involved in the renewal of the
epithelial cells (5, 137). Translating these findings to renal epithelia, this suggests that
increased SOX9 expression in DCT can be associated with cell regeneration (96). One
could speculate that high expression of SOX9 in response to stimuli like a low Mg2+ diet,
could result in activation of renal progenitor cells potentially with the purpose to extend
the DCT region to increase Mg2+ reabsorption capacity. SOX9 expression is regulated by
the magnesiotropic hormone EGF in urothelial cells (77). It would be interesting to identify
the gene targets of SOX9 in the kidney by ChIP-Seq analysis. This would allow distinguishing
whether SOX9 directly regulates magnesiotropic genes or may be involved in DCT cell
regeneration.
Second, Pterin-4-alpha-carbinolamine dehydratase (Pcbd1) transcription was identified
to be highly Mg2+-sensitive in Chapter 2. PCBD1 encodes the transcriptional co-activator
of hepatocyte nuclear factor 1 homeobox A and B (HNF1A/HNF1B) (Figure 3). In Chapter
3, the effect of PCBD1 on HNF1B-induced FXYD domain containing ion transport regulator 2
(FXYD2) transcription was examined with luciferase promoter assays, showing that PCBD1
increased FXYD2 transcription with 50 %. Interestingly, Hnf1B transcription was not altered
in response to a low Mg2+ diet, suggesting that PCBD1 is the regulating factor in the
transcription of FXYD2. Patients with mutations in PCBD1 suffered from hypomagnesemia,
renal Mg2+ wasting and maturity onset diabetes of the young (MODY). This phenotype
closely resembled the phenotype of renal cysts and diabetes syndrome (RCAD), which is
caused by HNF1B mutation. However, in contrast with RCAD patients, PCBD1 mutations do
not cause renal cysts (32). This can be explained by the absence of PCBD1 in the CD, where
HNF1B regulates PKHD1 transcription. In RCAD patients PKHD1 expression is disturbed,
resulting in renal malformation and cysts (51). The fact that PCBD1 mutations result in a
RCAD-like syndrome, suggests that mutations in other interaction partners may also cause
hypomagnesemia, MODY or renal malformations. Over the last decade, several interacting
proteins of HNF1B have been identified including E4F1 and ZFP36L1 (28). It would be
interesting to screen for mutations in the genes encoding for these interacting proteins in
patients with RCAD-like phenotypes, which test negative for HNF1B and PCBD1 mutations.
Low dietary Mg2+ intake regulates renal Mg2+ reabsorption by increasing
TRPM6, CNNM2 and EGF gene expression

PCBD1 was identified to cause hypomagnesemia and MODY-like diabetes in
patients with neonatal transient primapterinuria
248 | Chapter 10
Basolateral Membrane: A Quest for Extrusion

During the last years, the mechanisms of apical Mg2+ entry in the DCT have been relatively
well explained and many regulatory factors were characterized (23). In contrast, Mg2+
extrusion at the basolateral membrane from the DCT cell remains unexplained, despite
the identification of several basolateral magnesiotropic proteins (7, 84, 113, 124). Early
studies in the 80s by Gunther and Vormann already suggested that Na+ as a counter ion
can drive the Mg2+ extrusion from the cell (48). Since then, a large body of evidence was
gathered by several groups in many different cell types confirming these original findings
(106). This mechanism was shown to be electroneutral (2 Na+in : 1 Mg2+out), amiloride-
sensitive and activated by agents increasing intracellular cAMP levels including, prostaglandin
E2 (PGE2), forskolin and norepinephrine (106). The molecular identity of this alleged
epithelial Na+/Mg2+ exchanger remains to be identified, although several candidates have
been proposed (66, 124). In Chapter 5, 6 and 7, two of these candidates, Solute Carrier
Family 41 Member 3 (SLC41A3) and CNNM2 were examined in detail.
SLC41 Family of Mg2+ Carriers

SLC41A3 is part of the family of SLC41 carriers, which are related to the bacterial Mg2+
transporter MgtE (81, 108, 139). SLC41A1 is the most investigated isoform of this transporter
family and was initially studied in Xenopus laevis oocytes by voltage clamp analysis (41).
In these experiments, SLC41A1 mediated Mg2+ currents, but also transported Fe2+, Cu2+,
Zn2+ and Cd2+, suggesting a channel function or electrogenic exchanger (41). However, in
patch clamp experiments using mammalian HEK293 cells overexpressing SLC41A1 Mg2+
currents were not observed (unpublished results). Publications by Kolisek and colleagues
strongly advocate that SLC41A1 functions as a Na+/Mg2+ exchanger as they showed
Na+-dependent Mg2+ extrusion using the cytosolic Mg2+-indicator MagFura (66). This
finding was further substantiated in a recent study that identified mutations in SLC41A1 to
be causative for a nephronophthisis-like phenotype (53). However, given the affinity of
MagFura for other cations including Ca2+ and the sensitivity to osmotic changes due to
saturation of the probe (unpublished results), these results should be interpreted with
caution. Independent techniques such as 22Na+ uptake or 25Mg2+ extrusion assays should
confirm these findings. To study SLC41A1 and other Mg2+ transporters in the future, a
more specific and reliable Mg2+ probe to measure intracellular Mg2+ concentrations is
essential. Although over recent years many new Mg2+ probes have been described based
on RNA, protein or chemical structures, none of these have resulted in a specific and
dynamic Mg2+ probe sensitive within the physiological range (0.2-1.0 mmol/L) and low
affinity for Ca2+ (19, 35, 109). Future initiatives should be directed to develop such a probe,
for instance based on the Frster resonance energy transfer (FRET) technique (76).

In addition to SLC41A1, both SLC41A2 and SLC41A3 were tested in the Xenopus laevis
oocyte voltage-clamp system and mediated similar Mg2+ currents as SLC41A1 (41, 42, 98).
SLC41A2 is mainly located in the intracellular compartments such as the Golgi-system and
has been poorly characterized (107, 108). SLC41A3 has never been examined in detail. In mice
fed with Mg2+-deficient diets, Slc41a3 expression was significantly upregulated in the DCT
(Chapter 2). Therefore, SLC41A3 function was examined in vivo using Slc41a3 knockout
(KO) mice in Chapter 5. Interestingly, Slc41a3 KO mice displayed hypomagnesemia due to
renal Mg2+ wasting, further establishing the role of SLC41A3 in Mg2+ homeostasis. Slc41a3
KO mice exhibited the same intestinal Mg2+ absorption rate as wild type (WT) littermates.
The expression of Slc41a1 was increased in the duodenum of Slc41a3 KO mice, suggesting
that Slc41a1 can compensate for the loss of SLC41A3 function and that both proteins are
functionally redundant. In contrast, Slc41a1 expression was not increased in the kidney,
which may be explained by the fact that SLC41A1 and SLC41A3 are not expressed in the
same segments. RT-PCR analysis on COPAS-sorted DCT material showed that Slc41a3 is
10-fold enriched, whereas Slc41a1 is not enriched. Unexpectedly, hydronephrosis was
detected in 10% of Slc41a3 KO mice fed with Mg2+-deficient diets. Since a patient with
nephronophthisis was reported to carry a SLC41A1 splice site mutation (53), this suggests
that SLC41 proteins may play role in renal cyst formation and hydronephrosis. It would be
of interest to screen more cystic patients for mutations in SLC41 genes. Moreover, further
characterization of hydronephrosis formation in Slc41a3 KO mice is necessary to understand
the etiology of hydronephrosis in these mice and to examine the role of Mg2+ in this
process.
CNNM Family of Mg2+-binding Proteins

In 2011, CNNM2 mutations were identified to be causative for hypomagnesemia in two
patients suffering from epilepsy, tremor and muscle weakness (124). In Chapter 7, the
phenotypical spectrum was further extended by the identification of 5 additional families
with CNNM2 mutations. Interestingly, for the first time CNNM2 mutations were associated
with mental retardation. Moreover, in the family with the most severe mental disability
and brain malformations a recessive mode inheritance was observed. This is in contrast
with all other mutations, which were detected in heterozygous state. Importantly, the
parents of the patient with the homozygous (recessive) mutation were not affected;
suggesting that this mutation does not completely impairs CNNM2 function.

CNNM2 is within the kidney expressed in the cortical TAL, DCT and CNT region (124).
Given its basolateral localization at the plasma membrane, it has been proposed to be the
long-sought Mg2+ extrusion mechanism (124). In Xenopus laevis oocyte voltage clamp
experiments, CNNM2-mediated Mg2+ currents were within the physiological range of
intracellular Mg2+ concentrations (43). Moreover, CNNM2 expression rescues cell growth in
Mg2+-deficient Salmonella enterica (123). However, Mg2+ transport could not be measured
in mammalian cells (124). In Chapter 6, the protein structure of CNNM2 was further
examined to predict protein function. CNNM2 contains a N-terminal signal peptide, three
membrane-spanning domains and potential reentrant region between the second and
250 | Chapter 10
third domain. By homology modeling based on the bacterial CorC protein (148), a protein
3D structure of the cystathionine beta synthase (CBS) domains of CNNM2 was constructed.
Interestingly, this model suggested that the CBS domains harbor a Mg-ATP binding site
and that this site is disrupted by the p.Thr568Ile mutation identified in the first patient
family. Based on these findings, it was proposed that CNNM2 functions as a Mg2+-sensing
mechanism rather than as a Mg2+ transporter. In a recent study by Hirata and colleagues,
the homology model was confirmed and the binding of Mg-ATP was demonstrated by
filter binding assays (52). However, Mg-ATP binds the CNNM2 CBS domains with an
apparent affinity of 158 mol/L, which is far below the physiological range (52). Of note:
intracellular Mg-ATP concentrations are considered to range between 2-10 mmol/L. Based
on these findings an Mg2+-sensing mechanism should be excluded. However, it would be
interesting to repeat the Mg-ATP binding experiments within a more physiological cell
system, since other proteins and factors may influence the Mg-ATP binding.
In Chapter 7, the effect of CNNM2 on Mg2+ transport was examined using the stable
25Mg2+ isotope. CNNM2-expressing cells showed a higher 25Mg2+ uptake than mock-transfected cells. The CNNM2 mutants identified in the patients exhibited a lower 25Mg2+
uptake than wild type CNNM2. Importantly, the CNNM2-induced 25Mg2+ uptake was
inhibited by 2-Aminoethoxydiphenyl borate (2-APB), a non-selective inhibitor of TRPM7
Mg2+ channels (75), which are endogenously expressed in HEK293 cells. These findings
support the hypothesis that CNNM2 regulates other Mg2+ channels instead of transporting
Mg2+ itself. Brain development was impaired and Mg2+ homeostasis was disturbed after
knocking down cnnm2 expression in zebrafish using the morpholino approach. Cnnm2
morphants had impaired touch-response behavior, which has been reported before in
trpm7 mutant zebrafish (31, 79). Interestingly, in the same zebrafish model it was shown
that TRPM7 is essential for the development of dopaminergic neurons (24). CNNM2 has
been associated with Parkinsons disease and schizophrenia (104, 110, 122); both diseases
are known to exhibit an abnormal dopamine balance (8, 90). Although it cannot be
excluded that CNNM2 plays a role in neurodevelopment intrinsically, the combined in vitro
and in vivo findings may lead to the hypothesis that CNNM2 regulates TRPM7 in brain.
Therefore, it would be interesting to study the dopamine levels and development of
dopaminergic neurons in cnnm2 morphants and compare these to the results obtained in
trpm7 mutants.
TRPM7 may be expressed at low levels in the DCT, however, it is considered to
contribute only to basal cellular Mg2+ homeostasis, not to transcellular Mg2+ transport.
Thus, CNNM2-dependent activity of TRPM7 would not explain the renal Mg2+ wasting
observed in the patients. Future studies should therefore be directed towards the
identification of the interaction partners of CNNM2 in DCT. One could consider examining
the effects of CNNM2 on TRPM6 activity by patch clamp analysis. In addition, the SLC41
proteins are also interesting interaction candidates, given that both SLC41 and CNNM2
share homology to the bacterial Mg2+ transporter MgtE (43, 49, 108). The CBS domains of
CNNM2 are highly homologous to the MgtE CBS domains, but the plasma membrane
regions do not share any homology (Chapter 6). In contrast, the pore region including all
essential residues for Mg2+ transport of SLC41A1, SLC41A2 and SLC41A3 are highly
conserved from MgtE Mg2+ channels (81). In evolution, the functional domains of MgtE
may have been divided between the CNNM and SLC41 proteins. Given that both CNNM
and SLC41 proteins were evidenced to function in complexes (Chapter 6), it would be
interesting to examine whether these proteins interact (65). This hypothesis would also
explain the difficulties to measure the activity of the proteins individually.
Other Mg2+-related Proteins at the Basolateral Membrane

In 2000, linkage analysis identified a heterozygous p.Gly41Arg mutation in FXYD2 causing
dominant hypomagnesemia and renal Mg2+ wasting (83, 84). In Chapter 4, two new
families were identified with familial dominant hypomagnesemia. The patients suffer from
hypermagnesiuria, hypocalciuria, decline in renal function and epilepsy. Since these are
the first patients reported since 2000 and they all origin from the Netherlands and
Belgium, genealogy studies and marker analysis were performed. Indeed, marker analysis
revealed a common allele suggesting one founder mutation. However, genealogy analysis
until 1700 did not find a link between the families, although ancestors of two families
could be traced to the same area near Lige, Belgium. FXYD2 encodes for the -subunit of
the Na+-K+-ATPase that generates an electrochemical gradient across the basolateral
membrane driving electrolyte transport. In total seven FXYD proteins have been described
to date, each with its own expression pattern and effects on Na+-K+-ATPase function (36).
Thus, by changing the expression of FXYD proteins, the Na+-K+-ATPase activity can be
altered according to the needs of each tissue or cell. FXYD2 has been implicated in the
stabilization of the -subunit of the Na+-K+-ATPase, it decreases the affinity for Na+ and K+
and increases the affinity for ATP (3, 85). How the -subunit of the Na+-K+-ATPase influences
the plasma Mg2+ concentrations is not understood. Over the years several hypothesis
have been formed: i) the absence of -subunit binding to the - and -subunit of the
Na+-K+-ATPase may reduce its function and thus affects the driving force for Mg2+ uptake
via TRPM6 (33); ii) the -subunit of the Na+-K+-ATPase may form a functional channel on its
own mediating Mg2+ extrusion to the blood (115); iii) FXYD2 may act as a subunit for the
still unidentified Na+-Mg2+-exchanger, directly affecting Mg2+ extrusion to the blood. To
date, none of the given hypothesis has been convincingly substantiated and the role of
FXYD2 remains, therefore, to be determined. Interestingly, FXYD5 was recently shown to
increase the paracellular permeability and reduce plasma membrane resistance (80). It has
been shown previously that the -subunit of the Na+-K+-ATPase is important for cell-cell
adhesion (116). Therefore, it has been proposed that FXYD5 binding to the -subunit of
the Na+-K+-ATPase affects paracellular permeability (80). Knowing that FXYD2 expression
is not restricted to DCT but is also present in TAL, a similar mechanism could be proposed
(3). In this hypothesis, FXYD2 increases paracellular permeability in TAL. As a result,
252 | Chapter 10
mutations in FXYD2 would decrease Mg2+ reabsorption in TAL eventually resulting in renal
Mg2+ wasting.
Patients with mutations in KCNJ10, encoding Kir4.1, present with epilepsy, ataxia,
sensorial deafness and a tubulopathy phenotype (EAST/SeSAME syndrome) closely
resembling Gitelmans syndrome (7, 113). In these patients blood analysis showed
hypokalemia, hypomagnesemia and metabolic alkalosis. Often these patients have
polyuria and hypocalciuria. As in Gitelmans syndrome the origin of the hypomagnesemia
is not completely understood (38, 58). The most common explanation is that K+ efflux at
the basolateral membrane is necessary to maintain Na+-K+-ATPase serving as a K+-recycling
mechanism (Figure 4). Nonfunctional Kir4.1 would then result in decreased Na+-K+-ATPase
activity and thus, reduced driving force for Mg2+ reabsorption. However, an underappreciated symptom in patients with Gitelmans syndrome and EAST/SeSAME syndrome is the
presence of metabolic alkalosis (63). Given that Mg2+ reabsorption via TRPM6 is pH
dependent and this channel has decreased activity in basic conditions (74), it could be
hypothesized that the alkalosis results in reduced TRPM6-mediated Mg2+ transport. It is
unclear how the blood pH status is reflected in the local pH of the DCT lumen. Nevertheless,
it would be interesting to test whether treatment of the alkalosis can restore the Mg2+
balance in patients with EAST/SeSAME syndrome.
SLC41A3 is involved in Mg2+ homeostasis and may function as the basolateral
Na+/Mg2+-exchanger
CNNM2 binds Mg2+ in its CBS domains and may regulate other Mg2+ channels,
including TRPM7
The molecular mechanism of basolateral Mg2+ extrusion remains elusive
Clinical Perspectives: Mg2+ Disorders

Hypomagnesemia is a relatively common phenomenon that is sparsely diagnosed in the
clinic. Estimations of the incidence of hypomagnesemia range between 3 % and 10 % of
the normal population and may rise up to 65 % in patients at the intensive care unit (129).
The symptoms of hypomagnesemia are multifold; ranging from muscle cramps to epilepsy
and cardiac arrhythmias in severely hypomagnesemic patients. However, patients with only
minor deficiencies may experience only general signs of hypomagnesemia such as fatigue,
lethargy or depression. Based on these symptoms it is difficult to diagnose hypomagnesemia
in a clinical situation, especially because Mg2+ is not routinely determined in blood.

Given the impressive advancements that have been made in Mg2+ research during
the last decade, the importance of Mg2+ is more frequently appreciated. Firm evidence is
now available that the use of certain types of drugs, including proton pump inhibitors,
140 mM
15 mM
0.8 mM
5 mM
145 mM
0.8 mM
0 mV / -30 mV
Figure 4 Overview of the Regulation of Basolateral Mg2+ Extrusion in the DCT

At the basolateral membrane of the DCT, Mg2+ is extruded from the cell via a Na+-dependent
mechanism, which may be SLC41A3. Mg2+ extrusion relies, therefore, on Na+-K+-ATPase activity,
which is in turn dependent on K+ transport via Kir4.1. CNNM2 regulates Mg2+ transport via an unknown
mechanism.
ClC-Kb: Chloride channel Kb, Kir4.1: K+ channel Ki4.1, SLC41A3: Solute carrier family 41 member 3, CNNM2:
Cyclin M2.
EGFR antagonists and diuretics may cause hypomagnesemia (45, 50, 92). As a result,
clinicians prescribing these drugs are more aware of hypomagnesemia and test patients
using these types of drugs more often for Mg2+ disturbances. Still the role of Mg2+ in
health and disease needs more attention. Many patient groups, including diabetics or
patients with chronic kidney disease, show a worse disease outcome when they suffer
from low plasma Mg2+ levels (20). Recently, it was demonstrated in women with gestational
diabetes that single nucleotide polymorphisms in TRPM6 are associated with diabetes
and hypomagnesemia (86). Nevertheless, Mg2+ levels are still not routinely measured in
diabetes patients. A clear example of how patient care can be improved by early detection is
presented in Chapter 3 of this thesis. Three babies with neonatal transient primapterinuria
were diagnosed at birth after the Guthrie test and were treated with BH4 supplements.
254 | Chapter 10
However, at this time the fact that PCBD1 mutations cause renal Mg2+ wasting and MODY
diabetes was not known. Based on the findings presented in Chapter 3, patients with
PCBD1 mutations can now be supplemented with Mg2+ from birth and disease progression
may be decreased. Earlier detection of this kind of disorders by including Mg2+ measurements
in standard blood electrolyte screens, can significantly improve patient care.
Identification of Genetic Mg2+ Disorders

In a small group of hypomagnesemia patients, the disturbed blood Mg2+ levels could be
attributed to a genetic defect. In 1999, CLDN16 mutations were identified to cause Familial
Hypomagnesemia with Hypercalciuria and Nephrocalcinosis (FHHNC Type 1)(120) and
since then the molecular causes for 15 other hypomagnesemia-related diseases were
found. All genetic causes of hypomagnesemia are listed in Table 2. Next to FHHNC Type 1,
the most common ones include Familial Hypomagnesemia with Hypercalciuria and
Nephrocalcinosis with ocular involvement (FHHNC type 2, CLDN19 mutations)(68), Gitelman
syndrome (SLC12A3 mutations)(121), Hypomagnesemia with secondary hypocalcemia
(HSH, TRPM6 mutations)(111, 140) and Renal Cysts and Diabetes Syndrome (RCAD, HNF1B
mutations)(1).
To identify the genetic cause of hypomagnesemia careful phenotyping of the patient
is of major importance. A simple blood measurement including Na+, K+, Ca2+, Mg2+ and
glucose is already sufficient to distinguish between the most common genetic Mg2+
syndromes. Additional phenotyping is necessary to identify the more rare diseases. The
flow chart that is presented in Figure 5 may aid to find the causal gene in patients with a
suspected genetic origin of hypomagnesemia. However, it should be noted that patients
suffering form hereditary hypomagnesemia are heterogeneous and not every patient will
present with all characteristics of a particular syndrome. Therefore, the differential
diagnosis should always be confirmed by genetic testing.

Given the heterogeneity of hypomagnesemia patients, it is important to extend the
knowledge on the known Mg2+ syndromes by extensive phenotyping of newly identified
patients. An illustrative example is given in Chapter 6, where 5 new families with CNNM2
mutations are reported and characterized. All patients presented with mental retardation,
which was previously not described in CNNM2 patients. Moreover, for the first time a
recessive mode of inheritance of CNNM2 patients was observed. In the future, patients
with severe hypomagnesemia and mental retardation without Ca2+ and K+ disturbances
should be immediately screened for CNNM2 mutations. To improve patient care, it is
crucial to continue reporting new patients with mutations in known genes. The treatment
regimes of such patients should be further emphasized in these reports, since genetic
forms of hypomagnesemia are rare diseases that will never be suitable for clinical trials.
In this perspective, the recent widely executed N=1 trials should be initiated for
hypomagnesemia patients. An N=1 trial is a crossover study performed within a single
patient (59). This allows testing the optimal treatment regimen in an objective manner,
No neuronal
abnormalities
Gitelman
Syndrome
Epilepsy
SeSAME/EAST
Syndrome
Serum [K+]
< 3.5 mmol/L
Serum [Mg2+]
< 0.7 mmol/L
Serum [Ca+]
< 2.2 mmol/L
HSH
Normal
Vision
FHHNC type 1
Visual
Impairment
FHHNC type 2
Nephrocalcinosis
No other serum
electrolyte
disturbances
Ataxia
Myokimia
ADH
IDH
Epilepsy
Mental retardation
Dominant
Inheritance
HSMR
Recessive
Inheritance
IRH
Renal Cysts
RCAD
Transient
Primapterinuria
RCAD-like
Diabetes
Figure 5 S chematic Representation of Clinical Symptoms of Hypomagnesemia to

Phenotypically Distinguish Genetic Forms of Hypomagnesemia
Careful phenotyping of the patient is essential to determine the origin of hypomagnesemia in
patients. Simple blood Na+, K+, Ca2+, Mg2+ and glucose measurement allow to distinguish the main
genetic forms of hypomagnesemia. This flow chart may aid to find the causal gene in patients with
a suspected genetic origin of hypomagnesemia. However, it should be noted that patients suffering
form hereditary hypomagnesemia are heterogeneous and not every patient will present with all
characteristics of a particular syndrome. Therefore, the differential diagnosis should always be c onfirmed
by genetic testing.
but also provides a basis for the treatment of future patients. N=1 trials could, therefore, be
a tool in providing personalized health care for hypomagnesemia patients.

Although the cause of hypomagnesemia has been identified in many patients over
the last decade, there are still numerous hypomagnesemia patients without known cause,
but are suspected to have a genetic origin. Currently, next generation sequencing
FHHNC type 1
FHHNC type 2
Bartter type 1
Bartter type 2
Bartter type 3
Bartter type 4
Claudin 16
Claudin 19
NKCC2
ROMK
ClC-Kb
Barttin
CLDN16
CLDN19
SLC12A1
KCNJ1
CLCNKB
BSND
602522
607364
241200
601678
248190
248250
OMIM
Disease
HSH
IRH
HSMR
Protein
TRPM6
EGF
CNNM2
Gene
TRPM6
EGF
CNNM2
613882
611718
602014
OMIM
Human Genetic Mg2+ Disorders in the DCT
Disease
Protein
Gene
Human Genetic Mg2+ Disorders in the TAL
Table 2 G
enetic Causes of Hypomagnesemia
TAL
TAL
TAL
TAL
TAL
TAL
D/R
DCT
DCT
DCT
Inh. Segment Blood

Mg2+
Inh. Segment Blood

Mg2+
Urine
Mg2+
Urine
Mg2+
Blood
Ca2+
Blood
Ca2+
Urine
Ca2+
Urine
Ca2+
(119)
(117)
(6)
Na+ wasting
Hypokalemic alkalosis
High Renin/Aldosterone
Na+ wasting
Na+ wasting
Seizures
Mental retardation
Seizures
Mental retardation
Seizures
Muscle spasms
Mental retardation
(124)
Chapter 7
(47)
(111, 140)
Ref.
(118)
Na+ wasting
Other symptoms
(68)
(120)
Ref.
Nephrocalcinosis
Renal failure
Visual impairment
Nephrocalcinosis
Renal failure
Other symptoms
256 | Chapter 10
SeSAME / EAST
IDH
RCAD
RCAD-like
Gitelman syndrome
Kir4.1
FXYD2
HNF1
PCBD1
NCC
KCNJ10
FXYD2
HNF1B
PCBD1
SLC12A3
263800
264070
137920
154020
612780
176260
DCT
DCT
DCT
DCT
DCT
DCT
Hypokalemia
Metabolic alkalosis
Tetany
Chondrocalcinosis
Transient hyperphenylalaninemia
MODY5-like
Renal cysts
MODY5
Renal malformations
Convulsions
Muscle cramps
Chondrocalcinosis
Hypokalemia
Metabolic alkalosis
Sensorineural deafness
Seizures
Ataxia
Mental retardation
Muscle cramps
Tetany
Myokymia
(121)
Chapter 3
(1)
(84)
Chapter 4
(7, 113)
(39)
SLC: Solute carrier, NKCC2: Na+-K+-2Cl- cotransporter, TRPM6: Transient Receptor Potential Melastatin type 6, EGF: Epidermal Growth Factor, CNNM2: Cyclin
M2, FXYD2: FXYD domain containing ion transport regulator 2, HNF1B: Hepatocyte Nuclear Factor 1B, PCBD1: Pterin-4-alpha-carbinolamine dehydratase,
NCC: Na+-Cl- cotransporter, FHHNC: Familial Hypomagnesemia with Hypercalciuria and Nephrocalcinosis, HSH: Hypomagnesemia with Secondary Hypocalcemia, IRH: Isolated Recessive Hypomagnesemia, HSMR: Hypomagnesemia with Seizures and Mental Retardation, ADH: Autosomal Dominant Hypomagnsemia, SeSAME: Sensorineural Deafness, Seizures, Ataxia, Mental Retardation and Electrolyte imbalance, EAST: Epilepsy, Ataxia, Sensorineural Deafness
and Tubulopathy, IDH: Isolated Dominant Hypomagnesemia, RCAD: Renal Cysts and Diabetes, OMIM: Online Mendelian Inheritance in Man, D: Dominant, R:
Recessive, TAL: Thick Ascending Limb of Henles Loop, DCT: Distal Convoluted Tubule, MODY: Maturity Onset Diabetes of the Young.
ADH
Kv1.1
KCNA1
258 | Chapter 10
technology is applied to identify new genes that may be involved in Mg2+ homeostasis
(101). Identification of new genes will aid the understanding of the molecular mechanism
of Mg2+ reabsorption in the DCT. These insights are important to design new treatment
options for patients with renal Mg2+ wasting.
Treatment of Mg2+ Disorders

Hypomagnesemia is treated by oral Mg2+ supplementation ( 360 mg/day)(2). Generally,
organic Mg2+ salts are considered to be more soluble and bioavailable than inorganic
Mg2+ salts (18). Oral Mg2+ supplementation is not tolerated well in some patients because
it can cause diarrhea (34). Alternatively, intravenous Mg2+ administration may be more
effective, but is invasive and requires regular hospital visits. The treatment regimen of
intravenous Mg2+ supplementation normally consists of 10 g of MgSO4 in the first 24 hrs
followed by 5 g per day for several days (130). When serum Mg2+ levels are extremely low
or accompanied by hypokalemia, Mg2+ supplementation may not be sufficient to restore
normal plasma Mg2+ levels. In the latter case, patients are often co-supplemented with K+
or receive K+-sparing diuretics like amiloride.
In many patients, oral Mg2+ supplementation is not sufficient to restore normal
plasma Mg2+ levels. Therefore, alternative approaches to increase serum Mg2+ levels
should be developed. It has been proposed that dietary fibers may increase intestinal
Mg2+ absorption (17). Therefore, it would be interesting to treat patients with
hypomagnesemia with these oligo- or polysaccharides. In Chapter 9, flavaglines were
shown to stimulate TRPM6 activity. If these compounds would be suitable for clinical
applications, elevated TRPM6 activation may result in improved intestinal and renal (re)
absorption of Mg2+. Currently, flavaglines are subscribed for anticancer treatments in
clinical trials and their application is marked by toxic effects (102). In the future, it would be
interesting to develop more TRPM6-activating compounds to increase Mg2+ reabsorption
in hypomagnesemia patients.
Although the recent advances in Mg2+ research have been mainly achieved in the relative
small group of patients with genetic hypomagnesemia, the results can be often translated
to more general diseases. Hypomagnesemia has been associated with diabetes mellitus
type 2, chronic kidney disease and parkinsons disease (93, 136, 146), and these diseases
have been linked to activity of Mg2+ channels and transporters TRPM6, TRPM7 and
SLC41A1, respectively (67, 78, 86). The findings on TRPM6 and SLC41A3 in this thesis may
therefore be applicable to much larger population groups. Therefore, future research
should be dedicated to further understand the molecular mechanisms by which Mg2+
can contribute to the etiology and progression of aforementioned general diseases.
Especially because the first results with Mg2+ supplementation as treatment for diabetes
and chronic kidney disease confirm that Mg2+ is potentially a powerful treatment option
for these patients (105, 132).

The work presented in this thesis is the result of stimulating collaborations between
clinicians, geneticists, physiologists and molecular biologists that have increased our
understanding of Mg2+ reabsorption in the DCT. Nevertheless, many questions remain to
be answered and ample patients with hypomagnesemia are still awaiting diagnosis.
Aided by the many technological advances of recent years, integration of all different
research disciplines will provide the first step towards true personalized medicine for
hypomagnesemia patients. Combined efforts of clinicians, geneticists, and researchers are
continuously necessary to improve patient care of hypomagnesemia patients and increase
our understanding of Mg2+ homeostasis.
260 | Chapter 10
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE, Rees
L, vant Hoff W, Marks SD, Trompeter RS, Tullus K, Winyard PJ, Cansick J, Mushtaq I, Dhillon HK,
Bingham C, Edghill EL, Shroff R, Stanescu H, Ryffel GU, Ellard S, Bockenhauer D. HNF1B mutations
associate with hypomagnesemia and renal magnesium wasting. J. Am. Soc. Nephrol. 20: 11231131, 2009.
Agus ZS. Hypomagnesemia. J. Am. Soc. Nephrol. 10: 16161622, 1999.
Arystarkhova E, Sweadner KJ. Splice variants of the gamma subunit (FXYD2) and their significance in
regulation of the Na, K-ATPase in kidney. J. Bioenerg. Biomembr. 37: 381386, 2005.
Barratt LJ, Rector FC, Kokko JP, Tisher CC, Seldin DW. Transepithelial potential difference profile of the
distal tubule of the rat kidney. Kidney Int. 8: 368375, 1975.
Belo J, Krishnamurthy M, Oakie A, Wang R. The role of SOX9 transcription factor in pancreatic and duodenal
development. Stem Cells Dev. 22: 29352943, 2013.
Birkenhger R, Otto E, Schrmann MJ, Vollmer M, Ruf EM, Maier-Lutz I, Beekmann F, Fekete A, Omran
H, Feldmann D, Milford DV, Jeck N, Konrad M, Landau D, Knoers NV, Antignac C, Sudbrak R, Kispert A,
Hildebrandt F. Mutation of BSND causes Bartter syndrome with sensorineural deafness and kidney failure.
Nat. Genet. 29: 310314, 2001.
Bockenhauer D, Feather S, Stanescu HC, Bandulik S, Zdebik AA, Reichold M, Tobin J, Lieberer E, Sterner
C, Landoure G, Arora R, Sirimanna T, Thompson D, Cross JH, vant Hoff W, Masri Al O, Tullus K, Yeung S,
Anikster Y, Klootwijk E, Hubank M, Dillon MJ, Heitzmann D, Arcos-Burgos M, Knepper MA, Dobbie A,
Gahl WA, Warth R, Sheridan E, Kleta R. Epilepsy, ataxia, sensorineural deafness, tubulopathy, and KCNJ10
mutations. N. Engl. J. Med. 360: 19601970, 2009.
Brisch R, Saniotis A, Wolf R, Bielau H, Bernstein H-G, Steiner J, Bogerts B, Braun AK, Jankowski Z,
Kumaritlake J, Henneberg M, Gos T. The role of dopamine in schizophrenia from a neurobiological and
evolutionary perspective: old fashioned, but still in vogue. Front Psychiatry 5: 47, 2014.
Brunette MG, Vigneault N, Carriere S. Micropuncture study of magnesium transport along the nephron in
the young rat. Am. J. Physiol. 227: 891896, 1974.
Cao G, Lee KP, van der Wijst J, de Graaf M, van der Kemp A, Bindels RJM, Hoenderop JGJ. Methionine
sulfoxide reductase B1 (MsrB1) recovers TRPM6 channel activity during oxidative stress. J. Biol. Chem. 285:
2608126087, 2010.
Cao G, Thbault S, van der Wijst J, van der Kemp A, Lasonder E, Bindels RJM, Hoenderop JGJ. RACK1
inhibits TRPM6 activity via phosphorylation of the fused alpha-kinase domain. Curr. Biol. 18: 168176, 2008.
Cao G, van der Wijst J, van der Kemp A, van Zeeland F, Bindels RJ, Hoenderop JG. Regulation of the
activity (REA). J. Biol. Chem. 284: 1478814795, 2009.
Christensen EI, Wagner CA, Kaissling B. Uriniferous tubule: structural and functional organization. Compr
Physiol 2: 805861, 2012.
Chubanov V, Waldegger S, Mederos y Schnitzler M, Vitzthum H, Sassen MC, Seyberth HW, Konrad M,
Gudermann T. Disruption of TRPM6/TRPM7 complex formation by a mutation in the TRPM6 gene causes
hypomagnesemia with secondary hypocalcemia. Proc. Natl. Acad. Sci. U.S.A. 101: 28942899, 2004.
Coddou C, Yan Z, Obsil T, Huidobro-Toro JP, Stojilkovic SS. Activation and regulation of purinergic P2X
receptor channels. Pharmacol. Rev. 63: 641683, 2011.
Cooke HJ, Wunderlich J, Christofi FL. The force be with you: ATP in gut mechanosensory transduction.
News Physiol. Sci. 18: 4349, 2003.
Coudray C, Demign C, Rayssiguier Y. Effects of dietary fibers on magnesium absorption in animals and
humans. J. Nutr. 133: 14, 2003.
Coudray C, Rambeau M, Feillet-Coudray C, Gueux E, Tressol JC, Mazur A, Rayssiguier Y. Study of
magnesium bioavailability from ten organic and inorganic Mg salts in Mg-depleted rats using a stable isotope
approach. Magnesium Research 18: 215223, 2005.
Cromie MJ, Shi Y, Latifi T, Groisman EA. An RNA sensor for intracellular Mg(2+). Cell 125: 7184, 2006.
Curiel-Garca JA, Rodrguez-Morn M, Guerrero-Romero F. Hypomagnesemia and mortality in patients
with type 2 diabetes. Magnesium Research 21: 163166, 2008.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
Dai LJ, Kang HS, Kerstan D, Ritchie G, Quamme GA. ATP inhibits Mg(2+) uptake in MDCT cells via P2X
purinoceptors. Am. J. Physiol. Renal Physiol. 281: F83340, 2001.
Dai LJ, Ritchie G, Kerstan D, Kang HS, Cole DE, Quamme GA. Magnesium transport in the renal distal
convoluted tubule. Physiol. Rev. 81: 5184, 2001.
Decker AR, McNeill MS, Lambert AM, Overton JD, Chen Y-C, Lorca RA, Johnson NA, Brockerhoff SE,
Mohapatra DP, MacArthur H, Panula P, Masino MA, Runnels LW, Cornell RA. Abnormal differentiation of
dopaminergic neurons in zebrafish trpm7 mutant larvae impairs development of the motor pattern. Dev. Biol.
386: 428439, 2014.
Desai BN, Krapivinsky G, Navarro B, Krapivinsky L, Carter BC, Febvay S, Delling M, Penumaka A,
Ramsey IS, Manasian Y, Clapham DE. Cleavage of TRPM7 releases the kinase domain from the ion channel
and regulates its participation in Fas-induced apoptosis. Dev. Cell 22: 11491162, 2012.
Diepens RJW, Dekker den E, Bens M, Weidema AF, Vandewalle A, Bindels RJM, Hoenderop JGJ. Characterization of a murine renal distal convoluted tubule cell line for the study of transcellular calcium transport.
Am. J. Physiol. Renal Physiol. 286: F4839, 2004.
Dimke H, van der Wijst J, Alexander TR, Meijer IMJ, Mulder GM, van Goor H, Tejpar S, Hoenderop JG,
Bindels RJ. Effects of the EGFR Inhibitor Erlotinib on Magnesium Handling. J. Am. Soc. Nephrol. 21: 13091316,
2010.
Dudziak K, Mottalebi N, Senkel S, Edghill EL, Rosengarten S, Roose M, Bingham C, Ellard S, Ryffel GU.
Transcription factor HNF1beta and novel partners affect nephrogenesis. Kidney Int. 74: 210217, 2008.
Duong Van Huyen JP, Bens M, Teulon J, Vandewalle A. Vasopressin-stimulated chloride transport in transimmortalized mouse cell lines derived from the distal convoluted tubule and cortical and inner medullary
collecting ducts. Nephrol. Dial. Transplant. 16: 238245, 2001.
Drup J. Ultrastructure of three-dimensionally localized distal nephron segments in superficial cortex of the
rat kidney. J. Ultrastruct. Mol. Struct. Res. 99: 169187, 1988.
Elizondo MR, Arduini BL, Paulsen J, MacDonald EL, Sabel JL, Henion PD, Cornell RA, Parichy DM.
Defective skeletogenesis with kidney stone formation in dwarf zebrafish mutant for trpm7. Curr. Biol. 15:
667671, 2005.
Faguer S, Decramer S, Chassaing N, Bellanne-Chantelot C, Calvas P, Beaufils S, Bessenay L, Lengele J-P,
Dahan K, Ronco P, Devuyst O, Chauveau D. Diagnosis, management, and prognosis of HNF1B nephropathy
in adulthood. Kidney Int. 80: 768776, 2011.
Ferr S, Veenstra GJC, Bouwmeester R, Hoenderop JGJ, Bindels RJM. HNF-1B specifically regulates the
transcription of the a-subunit of the Na+/K+-ATPase. Biochem. Biophys. Res. Commun. 404: 284290, 2011.
Fine KD, ANA C, FORDTRAN JS. Diagnosis of Magnesium-Induced Diarrhea. N. Engl. J. Med. 324: 10121017,
1991.
Fujii T, Shindo Y, Hotta K, Citterio D, Nishiyama S, Suzuki K, Oka K. Design and synthesis of a FlAsH-type
Mg2+ fluorescent probe for specific protein labeling. J. Am. Chem. Soc. 136: 23742381, 2014.
Geering K. Functional roles of Na,K-ATPase subunits. Curr. Opin. Nephrol. Hypertens. 17: 526532, 2008.
Gesek FA, Friedman PA. Mechanism of calcium transport stimulated by chlorothiazide in mouse distal
convoluted tubule cells. J Clin Invest 90: 429438, 1992.
Gitelman HJ, Graham JB, Welt LG. A new familial disorder characterized by hypokalemia and
hypomagnesemia. Trans. Assoc. Am. Physicians 79: 221235, 1966.
Glaudemans B, van der Wijst J, Scola RH, Lorenzoni PJ, Heister A, van der Kemp AW, Knoers NV,
Hoenderop JG, Bindels RJ. A missense mutation in the Kv1.1 voltage-gated potassium channel-encoding
gene KCNA1 is linked to human autosomal dominant hypomagnesemia. J Clin Invest 119: 936942, 2009.
Goytain A, Hines RM, El-Husseini A, Quamme GA. NIPA1(SPG6), the basis for autosomal dominant form of
hereditary spastic paraplegia, encodes a functional Mg2+ transporter. J. Biol. Chem. 282: 80608068, 2007.
Goytain A, Quamme GA. Functional characterization of human SLC41A1, a Mg2+ transporter with similarity
to prokaryotic MgtE Mg2+ transporters. Physiol. Genomics 21: 337342, 2005.
Goytain A, Quamme GA. Functional characterization of the mouse solute carrier, SLC41A2. Biochem. Biophys.
Res. Commun. 330: 701705, 2005.
262 | Chapter 10
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
Goytain A, Quamme GA. Functional characterization of ACDP2 (ancient conserved domain protein), a
divalent metal transporter. Physiol. Genomics 22: 382389, 2005.
Goytain A, Quamme GA. Identification and characterization of a novel family of membrane magnesium
transporters, MMgT1 and MMgT2. American Journal of Physiology - Cell Physiology 294: C495C502, 2008.
Greenberg A. Diuretic complications. Am. J. Med. Sci. 319: 1024, 2000.
Groenestege WMT, Hoenderop JG, van den Heuvel L, Knoers N, Bindels RJ. The epithelial Mg2+ channel
transient receptor potential melastatin 6 is regulated by dietary Mg2+ content and estrogens. J. Am. Soc.
Nephrol. 17: 10351043, 2006.
Groenestege WMT, Thbault S, van der Wijst J, van den Berg D, Janssen R, Tejpar S, van den Heuvel LP,
van Cutsem E, Hoenderop JG, Knoers NV, Bindels RJ. Impaired basolateral sorting of pro-EGF causes
isolated recessive renal hypomagnesemia. J Clin Invest 117: 22602267, 2007.
Gnther T, Vormann J, Frster R. Regulation of intracellular magnesium by Mg2+ efflux. Biochem. Biophys.
Res. Commun. 119: 124131, 1984.
448: 10721075, 2007.
Hess MW, Hoenderop JGJ, Bindels RJM, Drenth JPH. Systematic review: hypomagnesaemia induced by
proton pump inhibition. Aliment. Pharmacol. Ther. 36: 405413, 2012.
Hiesberger T, Bai Y, Shao X, McNally BT, Sinclair AM, Tian X, Somlo S, Igarashi P. Mutation of hepatocyte
nuclear factor-1beta inhibits Pkhd1 gene expression and produces renal cysts in mice. J Clin Invest 113: 814825,
2004.
Hirata Y, Funato Y, Takano Y, Miki H. Mg2+-Dependent Interactions of ATP with the Cystathionine--Synthase (CBS) Domains of a Magnesium Transporter. J. Biol. Chem. 289: 1473114739, 2014.
Hurd TW, Otto EA, Mishima E, Gee HY, Inoue H, Inazu M, Yamada H, Halbritter J, Seki G, Konishi M, Zhou
W, Yamane T, Murakami S, Caridi G, Ghiggeri G, Abe T, Hildebrandt F. Mutation of the Mg2+ Transporter
SLC41A1 Results in a Nephronophthisis-Like Phenotype. J. Am. Soc. Nephrol. 24: 967977, 2013.
Ikari A, Okude C, Sawada H, Takahashi T, Sugatani J, Miwa M. Down-regulation of TRPM6-mediated
magnesium influx by cyclosporin A. Naunyn Schmiedebergs Arch. Pharmacol. 377: 333343, 2008.
Ikari A, Okude C, Sawada H, Yamazaki Y, Sugatani J, Miwa M. TRPM6 expression and cell proliferation are
up-regulated by phosphorylation of ERK1/2 in renal epithelial cells. Biochem. Biophys. Res. Commun. 369:
11291133, 2008.
Ikari A, Sanada A, Okude C, Sawada H, Yamazaki Y, Sugatani J, Miwa M. Up-regulation of TRPM6 transcriptional activity by AP-1 in renal epithelial cells. J. Cell. Physiol. 222: 481487, 2010.
Ikari A, Sanada A, Sawada H, Okude C, Tonegawa C, Sugatani J. Decrease in transient receptor potential
melastatin 6 mRNA stability caused by rapamycin in renal tubular epithelial cells. Biochim. Biophys. Acta 1808:
15021508, 2011.
Jiang L, Chen C, Yuan T, Qin Y, Hu M, Li X, Xing X, Lee X, Nie M, Chen L. Clinical severity of Gitelman
syndrome determined by serum magnesium. Am. J. Nephrol. 39: 357366, 2014.
Johnston BC, Mills E. n-of-1 randomized controlled trials: an opportunity for complementary and alternative
medicine evaluation. J Altern Complement Med 10: 979984, 2004.
Kaissling B, Bachmann S, Kriz W. Structural adaptation of the distal convoluted tubule to prolonged
furosemide treatment. Am. J. Physiol. 248: F37481, 1985.
Kaissling B, Kriz W. Structural analysis of the rabbit kidney. Adv Anat Embryol Cell Biol 56: 1123, 1979.
Kim H-Y, Gladyshev VN. Methionine sulfoxide reduction in mammals: characterization of methionine-R-sulfoxide reductases. Mol. Biol. Cell 15: 10551064, 2004.
Knoers NVAM, Levtchenko EN. Gitelman syndrome. Orphanet J Rare Dis 3: 22, 2008.
Ko B, Mistry AC, Hanson L, Mallick R, Cooke LL, Hack BK, Cunningham P, Hoover RS. A new model of the
distal convoluted tubule. Am. J. Physiol. Renal Physiol. 303: F70010, 2012.
Schweigel M. SLC41A1 is a novel mammalian Mg2+ carrier. J. Biol. Chem. 283: 1623516247, 2008.
Kolisek M, Nestler A, Vormann J, Schweigel-Rntgen M. Human gene SLC41A1 encodes for the Na+/Mg2+
exchanger. American Journal of Physiology - Cell Physiology 302: C318C326, 2012.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
Kolisek M, Sponder G, Mastrototaro L, Smorodchenko A, Launay P, Vormann J, Schweigel-Rntgen M.

Substitution p.A350V in Na+/Mg2+ Exchanger SLC41A1, Potentially Associated with Parkinsons Disease, Is a
Gain-of-Function Mutation. 8: e71096, 2013.
Konrad M, Schaller A, Seelow D, Pandey AV, Waldegger S, Lesslauer A, Vitzthum H, Suzuki Y, Luk JM,
Becker C, Schlingmann KP, Schmid M, Rodriguez-Soriano J, Ariceta G, Cano F, Enriquez R, Juppner H,
Bakkaloglu SA, Hediger MA, Gallati S, Neuhauss SCF, Nurnberg P, Weber S. Mutations in the tight-junction
gene claudin 19 (CLDN19) are associated with renal magnesium wasting, renal failure, and severe ocular
involvement. Am. J. Hum. Genet. 79: 949957, 2006.
Krapivinsky G, Krapivinsky L, Manasian Y, Clapham DE. The TRPM7 chanzyme is cleaved to release a chromatin-modifying kinase. Cell 157: 10611072, 2014.
Lameris ALL, Hess MW, van Kruijsbergen I, Hoenderop JGJ, Bindels RJM. Omeprazole enhances the
colonic expression of the Mg(2+) transporter TRPM6. Pflugers Arch - Eur J Physiol 465: 16131620, 2013.
Lee C-T, Lien Y-HH, Lai L-W, Chen J-B, Lin C-R, Chen H-C. Increased renal calcium and magnesium
transporter abundance in streptozotocin-induced diabetes mellitus. Kidney Int. 69: 17861791, 2006.
Leipziger J. Luminal nucleotides are tonic inhibitors of renal tubular transport. Curr. Opin. Nephrol. Hypertens.
20: 518522, 2011.
L KT, Babinski K, Sgula P. Central P2X4 and P2X6 channel subunits coassemble into a novel heteromeric
ATP receptor. J. Neurosci. 18: 71527159, 1998.
Li M, Du J, Jiang J, Ratzan W, Su L-T, Runnels LW, Yue L. Molecular determinants of Mg2+ and Ca2+
permeability and pH sensitivity in TRPM6 and TRPM7. J. Biol. Chem. 282: 2581725830, 2007.
Li M, Jiang J, Yue L. Functional characterization of homo- and heteromeric channel kinases TRPM6 and
TRPM7. J. Gen. Physiol. 127: 525537, 2006.
Lindenburg LH, Vinkenborg JL, Oortwijn J, Aper SJA, Merkx M. MagFRET: the first genetically encoded
fluorescent Mg2+ sensor. PLoS ONE 8: e82009, 2013.
Ling S, Chang X, Schultz L, Lee TK, Chaux A, Marchionni L, Netto GJ, Sidransky D, Berman DM. An
EGFR-ERK-SOX9 signaling cascade links urothelial development and regeneration to cancer. Cancer Res. 71:
38123821, 2011.
Louvet L, Bchel J, Steppan S, Passlick-Deetjen J, Massy ZA. Magnesium prevents phosphate-induced
calcification in human aortic vascular smooth muscle cells. Nephrol. Dial. Transplant. 28: 869878, 2013.
Low SE, Amburgey K, Horstick E, Linsley J, Sprague SM, Cui WW, Zhou W, Hirata H, Saint-Amant L,
Hume RI, Kuwada JY. TRPM7 is required within zebrafish sensory neurons for the activation of touch-evoked
escape behaviors. J. Neurosci. 31: 1163311644, 2011.
Lubarski I, Asher C, Garty H. FXYD5 (dysadherin) regulates the paracellular permeability in cultured kidney
collecting duct cells. Am. J. Physiol. Renal Physiol. 301: F127080, 2011.
Mandt T, Song Y, Scharenberg AM, Sahni J. SLC41A1 Mg 2+transport is regulated via Mg 2+-dependent
endosomal recycling through its N-terminal cytoplasmic domain. Biochem. J. 439: 129139, 2011.
Bindels RJM, Hoenderop JGJ. A primary culture of distal convoluted tubules expressing functional thiazide-sensitive NaCl transport. Am. J. Physiol. Renal Physiol. 303: F88692, 2012.
Meij IC, Koenderink JB, De Jong JC, De Pont JJHHM, Monnens LAH, Van Den Heuvel LPWJ, Knoers
NVAM. Dominant isolated renal magnesium loss is caused by misrouting of the Na+,K+-ATPase
gamma-subunit. Ann. N. Y. Acad. Sci. 986: 437443, 2003.
LA, van den Heuvel LP, Knoers NV. Dominant isolated renal magnesium loss is caused by misrouting of the
Na(+),K(+)-ATPase gamma-subunit. Nat. Genet. 26: 265266, 2000.
Mishra NK, Peleg Y, Cirri E, Belogus T, Lifshitz Y, Voelker DR, Apell H-J, Garty H, Karlish SJD. FXYD
proteins stabilize Na,K-ATPase: amplification of specific phosphatidylserine-protein interactions. J. Biol. Chem.
286: 96999712, 2011.
Nair AV, Hocher B, Verkaart S, van Zeeland F, Pfab T, Slowinski T, Chen Y-P, Schlingmann KP, Schaller A,
Gallati S, Bindels RJ, Konrad M, Hoenderop JG. Loss of insulin-induced activation of TRPM6 magnesium
channels results in impaired glucose tolerance during pregnancy. Proc. Natl. Acad. Sci. U.S.A. 109: 1132411329, 2012.
264 | Chapter 10
87. Nijenhuis T, Vallon V, van der Kemp AWCM, Loffing J, Hoenderop JGJ, Bindels RJM. Enhanced passive
Ca2+ reabsorption and reduced Mg2+ channel abundance explains thiazide-induced hypocalciuria and
hypomagnesemia. J Clin Invest 115: 16511658, 2005.
88. Nilius B, Szallasi A. Transient Receptor Potential Channels as Drug Targets: From the Science of Basic Research
to the Art of Medicine. Pharmacol. Rev. 66: 676814, 2014.
89. North RA, Surprenant A. Pharmacology of cloned P2X receptors. Annu. Rev. Pharmacol. Toxicol. 40: 563580,
2000.
90. Olanow CW, Tatton WG. Etiology and pathogenesis of Parkinsons disease. Annu. Rev. Neurosci. 22: 123144,
1999.
91. Paravicini TM, Chubanov V, Gudermann T. TRPM7: a unique channel involved in magnesium homeostasis.
Int. J. Biochem. Cell Biol. 44: 13811384, 2012.
92. Petrelli F, Borgonovo K, Cabiddu M, Ghilardi M, Barni S. Risk of anti-EGFR monoclonal antibody-related
hypomagnesemia: systematic review and pooled analysis of randomized studies. Expert Opin Drug Saf 11
Suppl 1: S919, 2012.
93. Pham P-CT, Pham P-MT, Pham SV, Miller JM, Pham P-TT. Hypomagnesemia in patients with type 2
diabetes. Clin J Am Soc Nephrol 2: 366373, 2007.
94. Pizzonia JH, Gesek FA, Kennedy SM, Coutermarsh BA, Bacskai BJ, Friedman PA. Immunomagnetic
separation, primary culture, and characterization of cortical thick ascending limb plus distal convoluted
tubule cells from mouse kidney. In Vitro Cell. Dev. Biol. 27A: 409416, 1991.
95. Pradervand S, Zuber Mercier A, Centeno G, Bonny O, Firsov D. A comprehensive analysis of gene
expression profiles in distal parts of the mouse renal tubule. Pflugers Arch - Eur J Physiol 460: 925952, 2010.
96. Pritchett J, Athwal V, Roberts N, Hanley NA, Hanley KP. Understanding the role of SOX9 in acquired
diseases: lessons from development. Trends Mol Med 17: 166174, 2011.
97. Quamme GA, Wong NL, Sutton RA, Dirks JH. Interrelationship of chlorothiazide and parathyroid hormone:
a micropuncture study. Am. J. Physiol. 229: 200205, 1975.
98. Quamme GA. Molecular identification of ancient and modern mammalian magnesium transporters.
American Journal of Physiology - Cell Physiology 298: C407C429, 2010.
99. Reginensi A, Clarkson M, Neirijnck Y, Lu B, Ohyama T, Groves AK, Sock E, Wegner M, Costantini F,
Chaboissier M-C, Schedl A. SOX9 controls epithelial branching by activating RET effector genes during
kidney development. Hum. Mol. Genet. 20: 11431153, 2011.
100. Reilly RF, Ellison DH. Mammalian distal tubule: physiology, pathophysiology, and molecular anatomy. Physiol.
Rev. 80: 277313, 2000.
101. Renkema KY, Stokman MF, Giles RH, Knoers NVAM. Next-generation sequencing for research and
diagnostics in kidney disease. Nat Rev Nephrol 10: 433444, 2014.
102. Ribeiro N, Thuaud F, Bernard Y, Gaiddon C, Cresteil T, Hild A, Hirsch EC, Michel PP, Nebigil CG, Dsaubry
L. Flavaglines as potent anticancer and cytoprotective agents. J. Med. Chem. 55: 1006410073, 2012.
103. Ribeiro N, Thuaud F, Nebigil C, Dsaubry L. Recent advances in the biology and chemistry of the flavaglines.
Bioorg. Med. Chem. 20: 18571864, 2012.
104. Ripke S, ODushlaine C, Chambert K, Moran JL, Khler AK, Akterin S, Bergen SE, Collins AL, Crowley JJ,
Fromer M, Kim Y, Lee SH, Magnusson PKE, Sanchez N, Stahl EA, Williams S, Wray NR, Xia K, Bettella F,
Borglum AD, Bulik-Sullivan BK, Cormican P, Craddock N, de Leeuw C, Durmishi N, Gill M, Golimbet V,
Hamshere ML, Holmans P, Hougaard DM, Kendler KS, Lin K, Morris DW, Mors O, Mortensen PB, Neale
BM, ONeill FA, Owen MJ, Milovancevic MP, Posthuma D, Powell J, Richards AL, Riley BP, Ruderfer D,
Rujescu D, Sigurdsson E, Silagadze T, Smit AB, Stefansson H, Steinberg S, Suvisaari J, Tosato S, Verhage
M, Walters JT, Multicenter Genetic Studies of Schizophrenia Consortium, Levinson DF, Gejman PV,
Laurent C, Mowry BJ, ODonovan MC, Pulver AE, Schwab SG, Wildenauer DB, Dudbridge F, Shi J, Albus
M, Alexander M, Campion D, Cohen D, Dikeos D, Duan J, Eichhammer P, Godard S, Hansen M, Lerer FB,
Liang K-Y, Maier W, Mallet J, Nertney DA, Nestadt G, Norton N, Papadimitriou GN, Ribble R, Sanders AR,
Silverman JM, Walsh D, Williams NM, Wormley B, Psychosis Endophenotypes International
Consortium, Arranz MJ, Bakker S, Bender S, Bramon E, Collier D, Crespo-Facorro B, Hall J, Iyegbe C,
Jablensky A, Kahn RS, Kalaydjieva L, Lawrie S, Lewis CM, Linszen DH, Mata I, McIntosh A, Murray RM,
Ophoff RA, Van Os J, Walshe M, Weisbrod M, Wiersma D, Wellcome Trust Case Control Consortium 2,
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
Donnelly P, Barroso I, Blackwell JM, Brown MA, Casas JP, Corvin AP, Deloukas P, Duncanson A,
Jankowski J, Markus HS, Mathew CG, Palmer CNA, Plomin R, Rautanen A, Sawcer SJ, Trembath RC,
Viswanathan AC, Wood NW, Spencer CCA, Band G, Bellenguez C, Freeman C, Hellenthal G,
Giannoulatou E, Pirinen M, Pearson RD, Strange A, Su Z, Vukcevic D, Langford C, Hunt SE, Edkins S,
Gwilliam R, Blackburn H, Bumpstead SJ, Dronov S, Gillman M, Gray E, Hammond N, Jayakumar A,
McCann OT, Liddle J, Potter SC, Ravindrarajah R, Ricketts M, Tashakkori-Ghanbaria A, Waller MJ,
Weston P, Widaa S, Whittaker P, McCarthy MI, Stefansson K, Scolnick E, Purcell S, McCarroll SA, Sklar P,
Hultman CM, Sullivan PF. Genome-wide association analysis identifies 13 new risk loci for schizophrenia. Nat.
Genet. 45: 11501159, 2013.
Rodrguez-Morn M, Guerrero-Romero F. Oral magnesium supplementation improves insulin sensitivity
and metabolic control in type 2 diabetic subjects: a randomized double-blind controlled trial. Diabetes Care
26: 11471152, 2003.
Romani AMP. Cellular magnesium homeostasis. Arch. Biochem. Biophys. 512: 123, 2011.
Sahni J, Nelson B, Scharenberg AM. SLC41A2 encodes a plasma-membrane Mg2+ transporter. Biochem. J.
401: 505513, 2007.
Sahni J, Scharenberg AM. The SLC41 family of MgtE-like magnesium transporters. Mol. Aspects Med. 34:
620628, 2013.
Sargenti A, Farruggia G, Malucelli E, Cappadone C, Merolle L, Marraccini C, Andreani G, Prodi L,
Zaccheroni N, Sgarzi M, Trombini C, Lombardo M, Iotti S. A novel fluorescent chemosensor allows the
assessment of intracellular total magnesium in small samples. Analyst 139: 12011207, 2014.
Schizophrenia Psychiatric Genome-Wide Association Study (GWAS) Consortium. Genome-wide
association study identifies five new schizophrenia loci. Nat. Genet. 43: 969976, 2011.
Ristoff E, Dinour D, Syrrou M, Nielsen S, Sassen M, Waldegger S, Seyberth HW, Konrad M.
TRPM gene family. Nat. Genet. 31: 166170, 2002.
Schmitz C, Dorovkov MV, Zhao X, Davenport BJ, Ryazanov AG, Perraud A-L. The channel kinases TRPM6
and TRPM7 are functionally nonredundant. J. Biol. Chem. 280: 3776337771, 2005.
Scholl UI, Choi M, Liu T, Ramaekers VT, Husler MG, Grimmer J, Tobe SW, Farhi A, Nelson-Williams C,
Lifton RP. Seizures, sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance (SeSAME
syndrome) caused by mutations in KCNJ10. Proc. Natl. Acad. Sci. U.S.A. 106: 58425847, 2009.
Schrag D, Chung KY, Flombaum C, Saltz L. Cetuximab therapy and symptomatic hypomagnesemia. J. Natl.
Cancer Inst. 97: 12211224, 2005.
Sha Q, Pearson W, Burcea LC, Wigfall DA, Schlesinger PH, Nichols CG, Mercer RW. Human FXYD2 G41R
mutation responsible for renal hypomagnesemia behaves as an inward-rectifying cation channel. Am. J.
Physiol. Renal Physiol. 295: F919, 2008.
Shoshani L, Contreras RG, Roldn ML, Moreno J, Lzaro A, Balda MS, Matter K, Cereijido M. The
polarized expression of Na+,K+-ATPase in epithelia depends on the association between beta-subunits
located in neighboring cells. Mol. Biol. Cell 16: 10711081, 2005.
Simon DB, Bindra RS, Mansfield TA, Nelson-Williams C, Mendonca E, Stone R, Schurman S, Nayir A,
Alpay H, Bakkaloglu A, Rodriguez-Soriano J, Morales JM, Sanjad SA, Taylor CM, Pilz D, Brem A,
Trachtman H, Griswold W, Richard GA, John E, Lifton RP. Mutations in the chloride channel gene, CLCNKB,
cause Bartters syndrome type III. Nat. Genet. 17: 171178, 1997.
Simon DB, Karet FE, Hamdan JM, DiPietro A, Sanjad SA, Lifton RP. Bartters syndrome, hypokalaemic
alkalosis with hypercalciuria, is caused by mutations in the Na-K-2Cl cotransporter NKCC2. Nat. Genet. 13:
183188, 1996.
Simon DB, Karet FE, Rodriguez-Soriano J, Hamdan JH, DiPietro A, Trachtman H, Sanjad SA, Lifton RP.
Genetic heterogeneity of Bartters syndrome revealed by mutations in the K+ channel, ROMK. Nat. Genet. 14:
152156, 1996.
Simon DB, Lu Y, Choate KA, Velazquez H, Al-Sabban E, Praga M, Casari G, Bettinelli A, Colussi G, Rodriguez-Soriano J, McCredie D, Milford D, Sanjad S, Lifton RP. Paracellin-1, a renal tight junction protein
required for paracellular Mg2+ resorption. Science 285: 103106, 1999.
266 | Chapter 10
121. Simon DB, Nelson-Williams C, Bia MJ, Ellison D, Karet FE, Molina AM, Vaara I, Iwata F, Cushner HM,
Koolen M, Gainza FJ, Gitelman HJ, Lifton RP. Gitelmans variant of Barters syndrome, inherited
hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive Na|[ndash]|Cl cotransporter. Nat.
Genet. 12: 2430, 1996.
122. Simn-Snchez J, Schulte C, Bras JM, Sharma M, Gibbs JR, Berg D, Paisan-Ruiz C, Lichtner P, Scholz SW,
Hernandez DG, Krger R, Federoff M, Klein C, Goate A, Perlmutter J, Bonin M, Nalls MA, Illig T, Gieger
C, Houlden H, Steffens M, Okun MS, Racette BA, Cookson MR, Foote KD, Fernandez HH, Traynor BJ,
Schreiber S, Arepalli S, Zonozi R, Gwinn K, van der Brug M, Lopez G, Chanock SJ, Schatzkin A, Park Y,
Hollenbeck A, Gao J, Huang X, Wood NW, Lorenz D, Deuschl G, Chen H, Riess O, Hardy JA, Singleton AB,
Gasser T. Genome-wide association study reveals genetic risk underlying Parkinsons disease. Nat. Genet. 41:
13081312, 2009.
123. Sponder G, Svidova S, Schweigel M, Vormann J, Kolisek M. Splice-variant 1 of the ancient domain protein
2 (ACDP2) complements the magnesium-deficient growth phenotype of Salmonella enterica sv. typhimurium
strain MM281. Magnes Res 23: 105114, 2010.
124. Stuiver M, Lainez S, Will C, Terryn S, Gnzel D, Debaix H, Sommer K, Kopplin K, Thumfart J, Kampik NB,
Querfeld U, Willnow TE, Nmec V, Wagner CA, Hoenderop JG, Devuyst O, Knoers NVAM, Bindels RJ,
Meij IC, Mller D. CNNM2, encoding a basolateral protein required for renal Mg2+ handling, is mutated in
dominant hypomagnesemia. Am. J. Hum. Genet. 88: 333343, 2011.
125. Subramanya AR, Ellison DH. Distal Convoluted Tubule. Clin J Am Soc Nephrol (May 22, 2014). doi: 10.2215/
CJN.05920613.
126. Thbault S, Alexander RT, Tiel Groenestege WM, Hoenderop JG, Bindels RJ. EGF increases TRPM6
activity and surface expression. J. Am. Soc. Nephrol. 20: 7885, 2009.
127. Thbault S, Cao G, Venselaar H, Xi Q, Bindels RJM, Hoenderop JGJ. Role of the alpha-kinase domain in
transient receptor potential melastatin 6 channel and regulation by intracellular ATP. J. Biol. Chem. 283:
1999920007, 2008.
128. Thuaud F, Ribeiro N, Nebigil CG, Dsaubry L. Prohibitin ligands in cell death and survival: mode of action
and therapeutic potential. Chem. Biol. 20: 316331, 2013.
129. Tong GM, Rude RK. Magnesium deficiency in critical illness. J Intensive Care Med 20: 317, 2005.
130. Topf JM, Murray PT. Hypomagnesemia and hypermagnesemia. Rev Endocr Metab Disord 4: 195206, 2003.
131. Torres GE, Egan TM, Voigt MM. Hetero-oligomeric assembly of P2X receptor subunits. Specificities exist with
regard to possible partners. J. Biol. Chem. 274: 66536659, 1999.
132. Turgut F, Kanbay M, Metin MR, Uz E, Akcay A, Covic A. Magnesium supplementation helps to improve
carotid intima media thickness in patients on hemodialysis. Int Urol Nephrol 40: 10751082, 2008.
133. van Angelen AA, San-Cristobal P, Pulskens WP, Hoenderop JG, Bindels RJ. The impact of dietary
magnesium restriction on magnesiotropic and calciotropic genes. Nephrol. Dial. Transplant. 28: 29832993, 2013.
134. van Angelen AA, van der Kemp AW, Hoenderop JG, Bindels RJ. Increased expression of renal TRPM6
compensates for Mg2+ wasting during furosemide treatment. Clin kidney j 5: 535544, 2012.
135. van der Wijst J, Hoenderop JGJ, Bindels RJM. Epithelial Mg2+ channel TRPM6: insight into the molecular
regulation. Magnesium Research 22: 127132, 2009.
136. Van Laecke S, Nagler EV, Verbeke F, Van Biesen W, Vanholder R. Hypomagnesemia and the risk of death
and GFR decline in chronic kidney disease. Am. J. Med. 126: 825831, 2013.
137. Van Landeghem L, Santoro MA, Krebs AE, Mah AT, Dehmer JJ, Gracz AD, Scull BP, McNaughton K,
Magness ST, Lund PK. Activation of two distinct Sox9-EGFP-expressing intestinal stem cell populations
during crypt regeneration after irradiation. American Journal of Physiology - Gastrointestinal and Liver Physiology
302: G1111G1132, 2012.
138. Voets T, Nilius B, Hoefs S, van der Kemp AWCM, Droogmans G, Bindels RJM, Hoenderop JGJ. TRPM6
forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J. Biol. Chem. 279: 1925, 2004.
139. Wabakken T, Rian E, Kveine M, Aasheim H-C. The human solute carrier SLC41A1 belongs to a novel
306: 718724, 2003.
RK, Carmi R, Sheffield VC. Mutation of TRPM6 causes familial hypomagnesemia with secondary
hypocalcemia. Nat. Genet. 31: 171174, 2002.
141. White JR, Campbell RK. Magnesium and diabetes: a review. American journal of pharmacotherapy 27:
775780, 1993.
142. Wildman SS, Marks J, Churchill LJ, Peppiatt CM, Chraibi A, Shirley DG, Horisberger J-D, King BF, Unwin
RJ. Regulatory interdependence of cloned epithelial Na+ channels and P2X receptors. J. Am. Soc. Nephrol. 16:
25862597, 2005.
143. Wilkinson P, Sengerova J, Matteoni R, Chen C-K, Soulat G, Ureta-Vidal A, Fessele S, Hagn M, Massimi M,
Pickford K, Butler RH, Marschall S, Mallon A-M, Pickard A, Raspa M, Scavizzi F, Fray M, Larrigaldie V,
Leyritz J, Birney E, Tocchini-Valentini GP, Brown S, Herault Y, Montoliu L, de Angelis MH, Smedley D.
EMMA--mouse mutant resources for the international scientific community. Nucl. Acids Res. 38: D5706, 2010.
144. Wright FS. Increasing magnitude of electrical potential along the renal distal tubule. Am. J. Physiol. 220:
624638, 1971.
145. Wright PA, Burg MB, Knepper MA. Microdissection of kidney tubule segments. Meth. Enzymol. 191: 226231,
1990.
146. Yasui M, Kihira T, Ota K. Calcium, magnesium and aluminum concentrations in Parkinsons disease. Neurotoxicology 13: 593600, 1992.
147. Zhai X-Y, Thomsen JS, Birn H, Kristoffersen IB, Andreasen A, Christensen EI. Three-dimensional
reconstruction of the mouse nephron. J. Am. Soc. Nephrol. 17: 7788, 2006.
148. Zhang N, Ren X, Zhu D, Li D, Wang D. Crystallization and preliminary crystallographic studies of CorC, a
magnesium-ion transporter. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 66: 681683, 2010.
149. Zhang Z, Yu H, Huang J, Faouzi M, Schmitz C, Penner R, Fleig A. The TRPM6 kinase domain determines the
MgATP sensitivity of TRPM7/M6 heteromeric ion channels. J. Biol. Chem. 289: 52175227, 2014.
Summary | 271
Magnesium (Mg2+) is an essential cofactor for more than 600 enzymes, a potent Ca2+
antagonist and anti-inflammatory agent. Therefore, Mg2+ plays an important role in virtually
every cell in the human body. In brain, Mg2+ regulates the activity of the NMDA receptor. As a
consequence, reduced serum Mg2+ levels cause hyperexcitability of the neurons and are
associated with epilepsy, migraine, depression and traumatic brain injury. In heart, Mg2+
determines cardiac contractibility by antagonizing Ca2+ and as a result Mg2+ disturbances
may result in cardiac arrhythmias. In muscle, low plasma Mg2+ levels result in hypercontractibility of the muscles and therefore cause muscle cramps or spasms. Blood Mg2+ levels are
maintained between 0.7 and 1.1 mmol/L by the tightly controlled balance between intestinal
uptake, storage in bone and renal excretion. In the intestine, Mg2+ is passively paracellularly
reabsorbed in the small intestine. Fine-tuning takes place by active transcellular reabsorption
in the colon, where Mg2+ is absorbed apically via TRPM6 and TRPM7 Mg2+ channels and
extruded via the CNNM4 Na+-Mg2+-exchanger. In the kidney, Mg2+ is filtered in the
glomerulus and reabsorbed along the kidney tubule in a similar fashion. First, bulk Mg2+ is
reabsorbed paracellularly in the proximal tubule and thick ascending limb of Henles loop.
Second, fine-tuning is achieved in the distal convoluted tubule (DCT) where Mg2+ is
reabsorbed transcellularly. Here, apical uptake from the pro-urine is facilitated by TRPM6
Mg2+ channels. The molecular identity of the basolateral extrusion mechanism is still
unknown. Over the last decade, genetic diseases have helped to identify the molecular
players in DCT Mg2+ transport. Disturbances in Mg2+ reabsorption in the DCT inevitably
result in renal Mg2+ wasting, since no reabsorption of Mg2+ takes place beyond the DCT.
However, several players in Mg2+ transport, including the basolateral extrusion mechanism,
remain to be identified. Therefore, this thesis aimed to identify and characterize new proteins
in epithelial Mg2+ transport to extend our understanding of Mg2+ reabsorption in the DCT.
Identification of New Magnesiotropic Genes in the DCT

To identify novel genes that are involved in DCT, mice expressing GFP only in DCT were
fed with low or high Mg2+ diets. The GFP expression allowed isolation of DCT cells by
COPAS sorting. The gene expression of low vs. high Mg2+ diet fed mice was compared
using microarrays. In chapter 2, four new candidate genes were identified to be involved
in DCT Mg2+ transport. SLC41A3, PCBD1, TBC1D4 and uromodulin expression were
increased in the low Mg2+ diet fed mice. Mutations in PCBD1 were previously linked
transient neonatal primapterinuria. In chapter 3, we describe that these patients also
suffer from hypomagnesemia due to renal Mg2+ wasting and MODY5-like diabetes. These
clinical findings could be explained at the molecular level by the role of PCBD1 as transcriptional co-activator of HNF1B. Interestingly, the symptoms of HNF1B patients also
include hypomagnesemia and MODY5. By luciferase assays, it was shown that PCBD1
increased HNF1B-induced FXYD2 transcription with 50 %. Indeed, mutant PCBD1 proteins
were not capable to increase FXYD2 transcription.
272 | Chapter 11

Although the exact role of FXYD2 in Mg2+ transport remains elusive, it is known that
FXYD2 regulates the Na+-K+-ATPase activity. The Na+-K+-ATPase is essential for Mg2+
transport in the DCT, since it sets the membrane potential that provides the driving force
for apical Mg2+ uptake. In chapter 4, two new families with mutations in the FXYD2 gene
were reported. This is the first account of FXYD2 mutations since the initial identification
of FXYD2 mutations more than 10 years ago, unequivocally confirming the importance of
FXYD2 in renal Mg2+ homeostasis. Interestingly, the new patients carry the same p.Gly41Arg
mutation that was described in the original study. Haplotype analysis revealed an
overlapping haplotype in all families, suggesting a founder effect. However, genealogy
studies did not identify a common ancestor until 1700. Given that no other FXYD2
mutations have been reported to date, this may suggest that other FXYD2 mutations are
embryonic lethal. The exact role of FXYD2 at the basolateral membrane of the DCT cell
needs further investigation.
In chapter 5, SLC41A3, which was also identified in the microarray study (chapter 2),
was further characterized. Recent studies with SLC41A1, a close homologue of SLC41A3,
showed that SLC41A1 functions as a Na+/Mg2+ exchanger. Therefore, SLC41A3 may
function as the Mg2+ extrusion mechanism at the basolateral membrane of the DCT cell.
To understand its role in Mg2+ homeostasis, SLC41A3 knockout mice were examined for
blood en urine electrolyte concentrations. Interestingly, SLC41A3 knockout mice had
lower serum Mg2+ levels than wild type littermates, but showed similar urinary Mg2+
excretion levels suggesting a renal Mg2+ leak. Using the stable 25Mg2+ isotope, it was
shown that intestinal Mg2+ absorption is not altered in SLC41A3 knockout mice. Strikingly,
hydronephrosis was detected in 10 % of the SLC41A3 knockout mice fed with a
Mg2+-deficient diet. Taken together, our data suggest that SLC41A3 is essential for DCT
Mg2+ reabsorption.
Characterization of the Structure and Function of CNNM2

Recently, mutations in CNNM2 were shown to cause hypomagnesemia and seizures in
two families with a dominant inheritance pattern. As SLC41A3 and FXYD2, CNNM2 is
expressed at the basolateral membrane of the DCT cells. However, the exact function of
CNNM2 remains to be identified. Although initial studies in Xenopus laevis oocytes
suggested that CNNM2 operates as a Mg2+ transporter, these results could not be
reproduced in mammalian cells. In chapter 6, the structure and regulation of CNNM2 was
examined in detail. By immunocytochemistry, CNNM2 was shown to contain three
membrane-spanning domains with an extracellular NH2-terminus and intracellular COOHterminus. The NH2-terminus is glycosylated at position p.Asn112. Cell surface biotinylation
studies showed that this residue is essential for normal plasma membrane expression of
the CNNM2 protein. A homology model of the CBS domains in the COOH-terminus of
CNNM2, identified a Mg-ATP binding site. Importantly, the model predicted that Mg-ATP
binding is lost by the p.Thr568Ile mutation that was identified in the patient families.
Summary | 273
These findings resulted in the hypothesis that CNNM2 may function as a Mg2+-sensing
mechanism rather than a Mg2+ transporter.
In chapter 7, this hypothesis was tested using the stable 25Mg2+ isotope. HEK293 cells
overexpressing CNNM2 exhibited higher 25Mg2+ uptake than mock-transfected cells.
Interestingly, cells expressing mutated CNNM2 proteins did not display this stimulatory
effect. The 25Mg2+ uptake was completely inhibited by the TRPM7 inhibitor 2APB,
suggesting that CNNM2 may regulate TRPM7 activity. These findings were further
examined in the zebrafish knockdown model. Using translation-blocking morpholinos,
cnnm2 knockdown larvae were generated showing a decreased total Mg2+ content.
Additionally, cnnm2 knockdown zebrafish suffered from a severely impaired brain
development, increased embryonic spontaneous contractions and weak touch-evoked
escape behaviour. Indeed, the weak touch-evoked escape behaviour is a characteristic of
the trpm7 mutant zebrafish, further establishing the link between CNNM2 and TRPM7
function. Importantly, five new families were identified with CNNM2 mutations. All the
affected family members reported hypomagnesemia, seizures, but for the first time also
mental retardation. Thus, CNNM2 is an essential gene for Mg2+ homeostasis and normal
brain development. Future studies should be aimed to elucidate the role of CNNM2 in the
regulation of TRPM7 and other Mg2+ transporters.
New Regulatory Pathways of TRPM6 Function

The last part of this thesis was dedicated to new pathways involved in the regulation of
TRPM6 activity. TRPM6 subunits form tetrameric structures comprising six transmembrane
segments, with a central divalent-selective pore and a Ser/Thr-kinase fused to its
COOH-terminus. The epithelial Mg2+ channels TRPM6 provide the apical uptake of Mg2+
from the pro-urine into the DCT cell. Mutations in TRPM6 cause hypomagnesemia with
secondary hypocalcemia and two SNPs in TRPM6 were associated with increased risk for
diabetes mellitus. Over the last decade, several important regulatory factors of TRPM6
were identified. EGF increases TRPM6 activity and plasma membrane expression and
therefore patients using EGFR inhibitors often suffer from hypomagnesemia. In a similar
fashion, TRPM6 can be activated by insulin. In chapter 8, extracellular ATP was shown to
inhibit TRPM6 activity via the action of P2X4 purinergic receptors. P2X receptors form
ATP-activated ion channels that transport cations into the cell. By RT-PCR, it was shown
that P2X4 and P2X6 were specifically expressed in DCT and colon. Using whole-cell patch
clamp, an inhibitory role of P2X4, but not of P2X6, on TRPM6 activity was demonstrated.
The inhibition was dependent on the activity of P2X4, since a P2X4 mutant with reduced
function did not inhibit TRPM6 activity. The inhibition was highly specific for TRPM6, since
P2X4 was unable to inhibit TRPM7. The mechanism by which increased Na+ or Ca2+ influx
via P2X4 can inhibit TRPM6 remains to be identified. The PKA, PKC and PI3K kinases were
not involved in this process.
274 | Chapter 11
In chapter 9, flavaglines were studied as a new class of compounds activating TRPM6.

Flavaglines belong to a family of natural compounds characterized by a cyclopenta[b]
benzofuran structure that binds to prohibitins. Previous studies have shown that
prohibitin2 is capable to bind TRPM6 and can inhibit its activity. By whole-cell patch
clamp, a stimulating role of FL3 and FL23, two flavaglines characterized by a bromine
group at position 4, on TRPM6 function was determined. Activation of TRPM6 is not
dependent on its kinase activity, but requires the presence of the kinase domain. Moreover,
HEK293 cells expressing the insulin-insensitive SNPs of TRPM6 do not respond to
flavaglines. Given that flavagline-induced stimulation of TRPM6 activity provides great
therapeutic potential for hypomagnesemia patients, in vivo effects were tested by the
injection of flavaglines in mice. However, low doses of FL3 did not lead to significant
changes in ion homeostasis over the time course of the 7 days trial. Further optimization
of the quantity and bioavailability of flavaglines in the DCT may be necessary to observe
significant effects in vivo.
The Art of Magnesium Transport: A Clinical Perspective

This thesis extended our knowledge on DCT Mg2+ transport. DCT cells are highly
specialized cells that are characterized by basolateral invaginations and high amounts of
mitochondria. They determine the final urinary Mg2+ excretion. By COPAS sorting of distal
convoluted tubule cells, a new high efficiency and high quality alternative for micro
dissection was established that can be used for future DCT studies. TRPM6 mediates
apical Mg2+ entry in the DCT and is regulated by EGF, insulin and pH. The identification of
P2X4 purinergic receptors and flavagline compounds as new regulators of TRPM6 activity,
provides novel pathways to target in the development of therapeutics to rescue Mg2+
disturbances. SOX9 and PCBD1 were identified as new transcriptional regulators of Mg2+
transport in the DCT. As a result, patients with PCBD1 can now be treated with Mg2+
supplements and sulfonylureas to improve their hypomagnesemia and MODY5-like
diabetes, respectively. The molecular mechanism of basolateral Mg2+ extrusion remains
elusive. The studies presented in this thesis, suggest that SLC41A3 may act as Mg2+
extrusion mechanism. CNNM2 may provide an Mg2+-sensing mechanism that regulates
DCT Mg2+ transport. However, further studies are necessary to understand and connect
all the molecular entities at the basolateral membrane.

In a small but well-studied group of hypomagnesemia patients the disturbed blood
2+
Mg levels could be attributed to a genetic defect. In the last years many causative genes
have been identified, but there are still patients awaiting a molecular diagnosis. Recent
technical advances in DNA sequencing techniques allow screening for mutations at a
genome-wide scale. Although this will provide important insight in genetic orders of
Mg2+ homeostasis, further development of bioinformatical techniques are necessary to
deal with the enormous amount of data that are currently generated.
Summary | 275
In addition to the role of Mg2+ in the small group of genetic patients, there is
increasing awareness for the important effects of Mg2+ in common diseases. Strong
evidence is now available that the use of certain types of drugs, including proton pump
inhibitors, EGFR antagonists and diuretics may cause hypomagnesemia. Nevertheless,
Mg2+ measurements are still not standard in the clinic. Future studies should be directed
to understand the function of Mg2+ in common diseases such as diabetes mellitus and
chronic kidney diseases. Previous studies have evidenced a worse outcome of patients
with these diseases when additionally suffering from hypomagnesemia. Only by further
establishing the importance of Mg2+ in health and disease, the clinical attention for Mg2+
deficits will rise. Combined efforts of clinicians, geneticists, and researchers are continuously
necessary to improve patient care of hypomagnesemia patients and increase our
understanding of Mg2+ homeostasis.
Samenvatting | 279
Magnesium in het Menselijke Lichaam

Magnesium (Mg2+) speelt een belangrijke rol in vrijwel iedere cel in het menselijk lichaam.
Op celniveau is Mg2+ essentieel voor de goede werking van enzymen en als ontstekingsremmer. Bovendien vervult Mg2+ vaak tegengestelde functies aan calcium (Ca2+), daarom
moet de balans tussen Ca2+ en Mg2+ in de cel goed moet worden geregeld. In de hersenen
benvloedt Mg2+ de werking van de NMDA receptor. Daardoor ontstaat bij een Mg2+ tekort
een overactiviteit van neuronen die kan leiden tot epilepsie, migraine, depressie en
hersentraumas. In het hart functioneert Mg2+ als Ca2+ antagonist en is daarmee erg
essentieel voor een goede samentrekking van de hartspier. Mg2+ tekorten leiden om deze
reden tot hartritmestoornissen. Lage Mg2+ waarden in de spieren kunnen zorgen voor
spierkrampen of spasmes.

De gebalanceerde samenwerking tussen de darmen, die Mg2+ opnemen, de botten,
die Mg2+ opslaan, en de nieren, die Mg2+ uitscheiden, zorgt ervoor dat de Mg2+
bloedwaarden constant blijven tussen 0.7 en 1.1 mmol/L. In de dunne darm wordt Mg2+
opgenomen tussen de cellen door (paracellulair). De optimale afstemming van Mg2+
opname vindt vervolgens plaats in de dikke darm door Mg2+ door de cellen heen te
transporteren (transcellulair). In de dikke darm wordt Mg2+ vanuit de darmholte (apicaal)
opgenomen in de cel via TRPM6 en TRPM7 Mg2+ kanalen, en aan de bloedzijde
(basolateraal) weer uitgescheiden via de CNNM4 Na+-Mg2+-uitwisselaar. In de nier wordt
het bloed gefiltreerd in de glomerulus en hierdoor komt Mg2+ terecht in de pro-urine in
de nierbuis. Op eenzelfde wijze als in de darm wordt Mg2+ vervolgens in twee stappen
weer opgenomen uit de pro-urine. Eerst wordt de overgrote meerderheid van het Mg2+
paracellulair geresorbeerd in de proximale tubulus en het stijgende deel van de lis van
Henle. Vervolgens vindt de afstemming van de definitieve Mg2+ uitscheiding plaats in het
distaal convoluut (DCT) waar Mg2+ transcellulair wordt opgenomen. In het DCT neemt
het TRPM6 Mg2+ kanaal Mg2+ apicaal op vanuit de pro-urine. De wijze waarop Mg2+
basolateraal wordt uitgescheiden naar het bloed moet nog gedentificeerd worden. Het
afgelopen decennium is door onderzoek naar patinten met genetische vormen van
Mg2+ tekorten (hypomagnesemie) de identiteit van de belangrijkste transporteiwitten in
het DCT bekend geworden. Verstoringen van Mg2+ opname in het DCT leiden
onvermijdelijk tot het verlies van Mg2+ via de urine, omdat er na dit segment geen Mg2+
meer kan worden geresorbeerd vanuit de nierbuis naar het bloed. Ondanks de recente
vooruitgang zijn nog steeds niet alle Mg2+ transporterende eiwitten in het DCT, zoals het
bovengenoemde basolaterale efflux mechanisme, bekend. Het doel van dit proefschrift
was derhalve het identificeren en karakteriseren van nieuwe moleculaire spelers die
deelnemen aan het Mg2+ transport in het DCT.
Identificatie van Nieuwe Genen die de Mg2+ Balans Benvloeden in het DCT
Allereerst was het zaak om nieuwe genen te identificeren die betrokken zijn bij het Mg2+
transport in het DCT. Hiertoe werden muizen die een groen fluorescent eiwit (GFP) tot
280 | Chapter 12
expressie brengen in het DCT op een Mg2+ dieet geplaatst. De GFP expressie maakte het
mogelijk om specifiek DCT cellen te isoleren en met behulp van microarrays konden
genen worden aangetoond die ten gevolge van het Mg2+ dieet werden gereguleerd. In
hoofdstuk 2 wordt aangetoond dat de mRNA expressie van Mg2+ transporter SLC41A3,
transcriptieregulator PCBD1, insuline-signaaleiwit TBC1D4, en urine eiwit uromoduline
was verhoogd in de DCT cellen van muizen die het laag Mg2+ dieet werd gevoerd.
Mutaties in PCBD1 veroorzaken transinte neonatale primapeterinurie. In hoofdstuk 3
wordt beschreven dat de patinten met PCBD1 mutaties ook lijden aan een
hypomagnesemie en MODY5-achtige diabetes. Deze symptomen leken erg op het
ziektebeeld van patinten met HNF1B mutaties, want ook zij presenteren zich met
hypomagnesemie en een MODY5-type diabetes. HNF1B reguleert de mRNA expressie van
FXYD2, een eiwit dat hypomagnesemie kan veroorzaken. Met behulp van bepalingen van
de promotoractiviteit werd aangetoond dat PCBD1 de FXYD2 transcriptie verhoogt met
50 %, als HNF1B ook aanwezig is. Gemuteerde PCBD1 eiwitten hadden geen stimulerend
effect op de FXYD2 transcriptie.

Hoewel de exacte rol van FXYD2 bij Mg2+ transport in het DCT nog niet is opgehelderd,
is het bekend dat FXYD2 de activiteit van het Na+-K+-ATPase reguleert. Het Na+-K+-ATPase
is essentieel voor het Mg2+ transport in het DCT, omdat het een gunstige membraanpotentiaal opbouwt die de drijvende kracht levert voor de apicale Mg2+ opname. In
hoofdstuk 4 worden twee nieuwe families met mutaties in het FXYD2 gen beschreven.
Deze personen lijden aan hypomagnesemie en de gevolgen hiervan, die bestaan uit
epilepsie en kraakbeenverkalking (chondrocalcinose). Dit is de eerste beschrijving van
patinten met FXYD2 mutaties sinds de identificatie van de hypomagnesemie patinten
met deze mutaties in 2000. Hierdoor wordt het belang van FXYD2 voor de Mg2+
huishouding ontegenzeggelijk vergroot en bevestigd. De nieuwe patinten hebben
dezelfde p.Gly41Arg mutatie als de patinten die werd beschreven in 2000. Erfelijkheidsonderzoek bevestigde hetzelfde haplotype in deze patinten, waardoor het mogelijk is
dat ze een gemeenschappelijke voorouder hebben. Genealogiestudies die teruggaan tot
het jaar 1700 konden deze gemeenschappelijke voorouder echter niet identificeren.
Omdat er buiten de p.Gly41Arg mutatie geen andere FXYD2 mutaties zijn gemeld, zou
gesuggereerd kunnen worden dat andere FXYD2 mutaties in een vroeg embryonaal
stadium lethaal zijn. Ondanks de nieuwe bevindingen zijn er aanvullende studies vereist
om de exacte functie van het FXYD2 eiwit op de basolaterale membraan te begrijpen.
In hoofdstuk 5 wordt het eerdergenoemde SLC41A3 gen, dat verhoogd tot expressie
kwam in muizen op een laag Mg2+ dieet, verder gekarakteriseerd. Recente studies gericht
op SLC41A1, een homoloog eiwit aan SLC41A3, tonen aan dat SLC41A1 functioneert als een
Na+-Mg2+-uitwisselaar. In tegenstelling tot SLC41A1 komt SLC41A3 sterk verhoogd tot
expressie in het DCT. Als het eiwit daar dezelfde functie heeft als SLC41A1, zou SLC41A3
een onderdeel kunnen zijn van het efflux mechanisme op de basolaterale membraan van
de DCT cel. Om de rol van SLC41A3 in de Mg2+ huishouding te onderzoeken, werden
Samenvatting | 281
SLC41A3 knock-outmuizen onderzocht op de Mg2+ concentraties in het bloed en in de

urine. Hieruit bleek dat de SLC41A3 knock-outmuizen een lagere bloed Mg2+ waarde
hadden dan controle muizen uit hetzelfde nest. De SLC41A3 controle en knock-outmuizen hadden wel een vergelijkbare Mg2+ uitscheiding in de urine. Dit duidt op een
verstoring van het Mg2+ transport in de nier. Door gebruik te maken van het stabiele
25Mg2+ isotoop werd vervolgens vastgesteld hoeveel 25Mg2+ in het bloed terecht kwam
na toediening in de maag. Hierdoor kon worden aangetoond dat de Mg2+ absorptie in de
darm niet verlaagd was in de SLC41A3 knock-outmuizen. Een interessante bevinding was
de aanwezigheid van een waternier (hydronefrose) in de linkernier van enkele SLC41A3
knock-outmuizen die een laag Mg2+ dieet werd gevoerd. Tezamen suggereren deze
resultaten dat SLC41A3 essentieel is voor Mg2+ reabsorptie in het DCT.
Bepaling van de Structuur en de Functie van CNNM2

Recent werd aangetoond dat mutaties in het CNNM2 gen hypomagnesemie en epilepsie
veroorzaken, zoals vastgesteld in twee families met een dominante overerving. Net als
FXYD2 en SLC41A3 komt CNNM2 tot expressie op de basolaterale membraan van de DCT
cel. De precieze functie van CNNM2 is nog niet bekend. Hoewel initile studies met
Xenopus laevis oocyten aantonen dat CNNM2 functioneert als een Mg2+ transporteur,
konden deze resultaten niet worden gereproduceerd in zoogdiercellen. In hoofdstuk 6
wordt de structuur en de regulatie van CNNM2 uitgebreid onderzocht. Door CNNM2 aan
te kleuren op de plasmamembraan konden we laten zien dat CNNM2 drie transmembraan
domeinen bezit met daarbij een extracellulaire NH2-terminus en een intracellulaire
COOH-terminus. De NH2-terminus bevat een suikergroep op de positie p.Asn112. Door de
CNNM2 van een label te voorzien op de plasmamembraan werd bewezen dat deze
suikergroep essentieel is voor een correct transport van CNNM2 naar de plasmamembraan.
Met behulp van een computer homologiemodel gebaseerd op de structuur van de
bacterile Mg2+ transporteur CorC, die veel verwantschap heeft met CNNM2, werd een
Mg-ATP bindingsplek in de CBS domeinen van de COOH-terminus aangetoond. Volgens
dit model zou de p.Thr568Ile mutatie, die werd gevonden in de patinten, de binding van
Mg-ATP op deze specifieke positie onmogelijk maken. Deze resultaten suggereren dat
CNNM2 waarschijnlijk fungeert als een Mg2+-sensing mechanisme in plaats van als een
Mg2+ transporteur.
In hoofdstuk 7 wordt deze hypothese verder getest met behulp van het stabiele
25Mg2+ isotoop. De HEK293 cellen waarin CNNM2 tot overexpressie werd gebracht,
hadden een verhoogde 25Mg2+ opname in vergelijking met controlecellen. De cellen die
gemuteerde CNNM2 eiwitten tot expressie brachten, lieten geen verhoging van de
25Mg2+ opname zien. De 25Mg2+ opname werd volledig geremd door de TRPM7-remmer
2APB te gebruiken. Hieruit zou men kunnen opmaken dat CNNM2 de activiteit van TRPM7
reguleert. Met behulp van morpholinos, die de eiwitproductie van CNNM2 blokkeerden,
konden CNNM2 knock-down zebravislarven worden gegenereerd. Zebravissen waarin de
282 | Chapter 12
CNNM2 expressie werd onderdrukt, toonden een verlaagd Mg2+ gehalte. Bovendien
leden de CNNM2 knock-down zebravissen aan een ernstig verstoorde hersenontwikkeling, een
verhoogd aantal embryonische spontane contracties en een verminderd vluchtgedrag
na aanraking. Juist dit verminderde vluchtgedrag werd eerder waargenomen in TRPM7
zebravismutanten. In hoofdstuk 7 werden vijf nieuwe families met CNNM2 mutaties
gedentificeerd. Opnieuw hadden de patinten last van hypomagnesemie en epilepsie,
maar nu werd ook een mentale retardatie aangetoond in alle patinten. Hieruit werd
opgemaakt dat CNNM2 essentieel is voor de Mg2+ huishouding en de hersenontwikkeling.
Toekomstige studies zijn noodzakelijk om de rol van CNNM2 in de regulatie van TRPM7 en
van andere Mg2+ transporteurs te begrijpen.
Nieuwe Regulatiemechanismen van TRPM6 Activiteit

Het laatste deel van dit proefschrift wordt gewijd aan de beschrijving van twee nieuwe
regulatiemechanismen voor de functie van het Mg2+ kanaal TRPM6. Mutaties in TRPM6
veroorzaken hypomagnesemie met secundaire hypocalcemie. Daarnaast zijn twee amino
zuurvariaties in TRPM6 geassocieerd met een verhoogd risico op diabetes mellitus. TRPM6
kanalen zijn opgebouwd uit vier subunits die elk bestaan uit zes transmembraan segmenten
en een Ser/Thr-kinase in de COOH-terminus. In de DCT cel zorgen TRPM6 Mg2+ kanalen
ervoor dat Mg2+ wordt opgenomen vanuit de pro-urine in de DCT cel. De afgelopen jaren
zijn enkele belangrijke regulatiefactoren voor de functie van TRPM6 gedentificeerd. Zo
verhoogt de epidermale groeifactor EGF de activiteit van TRPM6 en stimuleert het de
hoeveelheid van TRPM6 kanalen op de plasmamembraan. Dit is ook de reden dat veel
patinten die remmers gebruiken van de EGF receptor vaak last hebben van hypo
magnesemie. Op eenzelfde wijze kan TRPM6 geactiveerd worden door insuline. In
hoofdstuk 8 werd aangetoond dat ATP een remmende werking heeft op TRPM6 activiteit
via een activering van de P2X4 receptoren. P2X receptoren zijn ATP-geactiveerde ionkanalen
die positiefgeladen ionen de cel in transporteren. Met RT-PCR werd bewezen dat P2X4 en
P2X6 verhoogd tot expressie komen in het DCT en in de dikke darm waar Mg2+ resorptie
plaatsvindt. Activering van de P2X4 receptor leidde tot een verminderde activiteit van
TRPM6, zo bleek uit patch clamp analyse. P2X6 activering had geen remmende werking op
TRPM6 activiteit. Deze remming was afhankelijk van P2X4 activiteit, want een P2X4 eiwit
met een verminderde functie had geen effect op TRPM6 activiteit. De effecten waren
zeer specifiek voor TRPM6, want TRPM7 werd niet geremd door P2X4. Het mechanisme
waarmee een verhoogde Na+ of Ca2+ opname via P2X4 de activiteit van TRPM6 reduceert
is nog onbekend. De kinases PKA, PKC en PI3K waren niet betrokken bij dit proces.
In hoofdstuk 9 werden flavaglines beschreven als een nieuwe groep van stoffen die
de TRPM6 activiteit kan stimuleren. Flavaglines behoren tot een familie van natuurlijke
stoffen die zijn opgebouwd uit een chemische cyclopento[b]benzofuraan structuur die
bindt aan prohibitines. Eerdere studies hebben aangetoond dat prohibitine2 een interactie
aangaat met TRPM6 waardoor de activiteit is verminderd. Met behulp van patch clamp
Samenvatting | 283
analyse werd een stimulerende werking van FL3 en FL23, twee flavaglines met een bromide
groep op positie 4, gemeten op TRPM6 activiteit. De activering was niet afhankelijk van de
kinasefunctie van TRPM6, maar wel van de aanwezigheid van het kinase domein.
Bovendien reageerden HEK293 cellen die de insuline-ongevoelige TRPM6 varianten tot
expressie brachten, niet op de flavagline activatie. Aangezien de flavaglines de Mg2+
opname verhogen, zouden ze kunnen dienen als een manier om hypomagnesemie
patinten te behandelen. Daarom werden de effecten van de flavaglines vervolgens
getest in muizen. Injectie van een lage dosis FL3 zorgde echter niet voor significante
veranderingen in de Mg2+ huishouding binnen 7 dagen. Verdere optimalisatie van de
hoeveelheid en de beschikbaarheid van de flavaglines in het DCT zijn mogelijk nodig om
effecten te kunnen waarnemen in muizen.
De Kunst van het Magnesiumtransport: Een Klinisch Perspectief

Concluderend kan gesteld worden dat dit proefschrift een bijdrage levert aan onze kennis
over het Mg2+ transport in het DCT. DCT cellen zijn zeer gespecialiseerde cellen die grote
basolaterale inhammen hebben. De DCT cellen bepalen de uiteindelijke excretie van
Mg2+ in de urine, omdat er na het DCT geen Mg2+ meer wordt opgenomen. Door met
behulp van GFP expressie in DCT cellen te isoleren, wordt het mogelijk om met hoge
efficintie en kwaliteit DCT cellen te gebruiken voor onderzoek. In het DCT is TRPM6 het
eiwit dat Mg2+ opname verzorgt. Het is al jaren bekend dat TRPM6 wordt gereguleerd
door EGF, insuline en de pH waarde. In dit proefschrift werden ook flavaglines en ATP
gevonden als twee nieuwe regulatiemechanismen, die kunnen worden gebruikt voor de
ontwikkeling van gerichte medicijnen om verstoringen in de Mg2+ balans te verbeteren.
SOX9 en PCBD1 werden gedentificeerd als nieuwe transcriptieregulatoren in de celkernen
van het DCT. Hierdoor worden patinten met mutaties in het PCBD1 gen nu behandeld
met Mg2+ supplementen en sulfonylureumderivaten voor hun hypomagnesemie en
diabetes. Hoewel het moleculaire Mg2+ uitscheidingsmechanisme aan de basolaterale
membraan van het DCT nog altijd niet definitief is opgehelderd, suggereren de studies in
dit proefschrift dat SLC41A3 hierbij een rol speelt. CNNM2 lijkt zelf niet direct onderdeel
van het Mg2+ effluxmechanisme te zijn, maar kan mogelijk DCT Mg2+ transport reguleren
via zijn functie als Mg2+-sensor. Verdere studies zijn vereist om de functies en de interacties
van alle basolaterale eiwitten die betrokken zijn bij Mg2+ transport te begrijpen.

In een kleine, maar uitgebreid bestudeerde, groep patinten kunnen Mg2+ tekorten
in het bloed worden toegeschreven aan een genetisch defect. Ondanks dat er de
afgelopen jaren veel van deze defecten zijn opgehelderd, zijn er nog steeds patinten die
wachten op een diagnose. De recente technische vooruitgang in genetische onderzoeks
technieken maakt het mogelijk te screenen voor mutaties op genoomschaal. Hoewel dit
verder inzicht zal verschaffen in de genetische Mg2+ afwijkingen, zijn verdere bioinformatische
ontwikkelingen nodig om te kunnen omgaan met de significante hoeveelheid data die
deze technieken genereren.
284 | Chapter 12

Naast de rol van Mg2+ in de kleine groep patinten met een genetisch defect, komt
er steeds meer aandacht voor de belangrijke effecten van Mg2+ in algemene en veelvoorkomende ziektebeelden. Er is sterk bewijs beschikbaar dat het gebruik van bepaalde
medicijnen zoals protonpompremmers (PPIs), EGFR antagonisten en diuretica hypo
magnesemie kunnen veroorzaken. Niettemin worden Mg2+ bepalingen nog altijd niet
standaard uitgevoerd bij bloedtesten in de kliniek. Toekomstige studies zouden meer
aandacht moeten besteden aan de rol van Mg2+ in veelvoorkomende ziektes als diabetes
mellitus en chronisch nierfalen. Eerdere studies hebben reeds aangetoond dat hypo
magnesemie de progressie van deze ziekten negatief kan benvloeden. Alleen door de
belangrijke rol van Mg2+ in ziekte en gezondheid verder te benadrukken, zal de klinische
aandacht voor het probleem toenemen. Verdergaande samenwerking tussen artsen,
genetici en onderzoekers is vereist om de patintenzorg van hypomagnesemie te verbeteren
en onze kennis van de Mg2+ huishouding te verbeteren.
Samenvatting | 285
List of Abbreviations | 289
List of Abbreviations
1,25(OH)2D3
1,25 hydroxy-vitamin D3
17E
17-estradiol
28K Calbindin-D28K
2APB
2-amino-ethoxydiphenyl borate
A
Average signal value
ACDP2
Ancient conserved domain protein 2 or CNNM2
ADH
Autosomal dominant hypomagnesemia
ALP
Alkaline phosphatase
ALT
Alanine transaminase
ANOVA
Analysis of variance
AP1
Activator protein 1
AQP1
Aquaporin1
AQP2
Aquaporin2
AS160
Akt substrate of 160 kD or TBC1D4
AST
Aspartate transaminase
ATP
Adenosine 5-triphosphate
ATPase
Adenosine 5-triphosphatase
BCRP
Breast cancer resistance protein
BH4 Tetrahydrobiopterin
BIODEF
International database of tetrahydrobiopterin deficiencies
BSA
Bovine serum albumin
BSND
Gene encoding barttin
C3
Complement component 3
C4
Complement component 4
C57Bl/6
C57 black 6 mouse strain
Ca2+
Calcium ion
CaC2O4
Calcium oxalate
Ca(H2PO4)2
Calcium phosphate
CaSR
Calcium-sensing receptor
CBS
Cystathionine beta synthase
CC
Chelerythrine chloride
CD
Collecting duct
CDH5
Cadherin 5, type 2
CDK5
Cyclin-dependent kinase 5
CGH
Comparative genomic hybridization
Cl-
Chlorine ion
ClC-Kb
Voltage-sensitive chloride channel Kb
CLCNKB
Gene encoding ClC-Kb
CLDN14
Gene encoding claudin-14
CLDN16
Gene encoding claudin 16
CLDN19
Gene encoding claudin 19
CNI
Calcineurin inhibitor
CNNM1
Cyclin M1
CNNM2
Cyclin M2
CNNM3
Cyclin M3
CNNM4
Cyclin M4
CNS
Central nervous system
CNT
Connecting tubule
COPAS
Complex object parametric analyzer and sorter
290 | Chapter 13
COPD
Chronic obstructive pulmonary disorder
CorC
Magnesium and cobalt efflux protein CorC
cRaf
Raf-1 proto-oncogene, serine/threonine kinase
D
Dimerization domain
DAPI
4,6-diamidino-2-phenylindole
DCOH
Dimerization cofactor of hepatocyte nuclear factor 1 alpha
DCT
Distal convoluted tubule
DNA
Desoxy ribonucleic acid
Dpf
Days post fertilization
EAST
Epilesy, ataxia, sensorineuronal deafness and renal tubulopathy
EC50
Half maximal effective concentration
EDTA
Ethylenediaminetetraacetic acid
EEG Electroencephalography
EGF
Epidermal growth factor
eGFP
Enhanced green fluorescent protein
EGFR
Epidermal growth factor receptor
ENaC
Epithelial sodium channel
ER
Endoplasmic reticulum
ERK
Extracellular signal-regulated kinase
FE
Fractional excretion
FHHNC1
Familial hypomagnesemia with hypercalciuria and nephrocalcinosis type 1
FHHNC2
Familial hypomagnesemia with hypercalciuria and nephrocalcinosis type 2
FL Flavagline
FLAG
FLAG octapeptide
FRET
Frster resonance energy transfer
FXYD2
FXYD domain containing ion transport regulator 2
FXYD2
FXYD domain containing ion transport regulator 5
GAPDH
Glyceraldehyde 3-phosphate dehydrogenase
GCK Glucokinase
GEO
Gene expression omnibus
GFR
Glomerular filtration rate
GluR
Glutamate receptor
GNB2L1
Guanine nucleotide-binding protein subunit beta-2-like 1
GO
Gene ontology
GSEA
Gene set enrichment analysis
h Slope
H-89
N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide
HA
Human influenza hemagglutinin
HbA1c
Glycosylated haemoglobin
HCO3-
Bicarbonate ion
H&E
Hematoxylin and eosin
HEK293
Human embryonic kidney clone 293
HNF1B
Hepatocyte nuclear factor 1 beta
HNF4A
Hepatocyte nuclear factor 4 alpha
HPABH4D
Transient neonatal hyperphenylalaninemia and primapterinuria
Hpf
Hours post fertilization
hs-CRP
High-sensitivity C reactive protein
HSH
Hypomagnesemia with secondary hypocalcemia
HSMR
Hypomagnesemia, seizures and mental retardation
IB
Immunoblot
IC50
Half maximal inhibitory concentration
IDH
Isolated dominant hypomagnesemia
IgA
Immunoglobulin A
IgG
Immunoglobulin G
IgM
Immunoglobulin M
IL1
Interleukin 1 beta
IP Immunoprecipitation
IR
Insulin receptor
IRES
Interinal ribosome entry site
IRH
Isolated recessive hypomagnesemia
IV
Current voltage
K+
Potassium ion
KCNA1
Gene encoding Kv1.1
KCNJ1
Gene encoding ROMK
KCNJ10
Gene encoding Kir4.1
KD Knockdown
kDa
Kilo dalton
Kir4.1
Potassium channel 4.1
Km
Michaelis Menten Constant
KO
Knock out
Kv1.1
Voltage-gated potassium channel 1.1
LacZ
-galactosidase cassette
MAPK
Mitogen-activated protein kinase
Mb Megabases
MC
Metabolic cages
MCM2
Minichromosome maintenance complex component 2
MDCK
Madin-Darby canine kidney
mDCT
Murine distal convoluted tubule
MG-132 N-(benzyloxycarbonyl)leucinylleucinylleucinal
Mg2+
Magnesium ion
MGI
Mouse genome informatics database
MgSO4
Magnesium sulfate
MgtE
Bacterial Mg2+ transporter E
MHB
Midbrain hindbrain boundary
MMgT
Membrane magnesium transporter
MO Morpholino
MODY
Maturity-onset diabetes of the young
mpkDCT
Mouse microdissected distal convoluted tubule
MRI
Magnetic resonance imaging
MRS2
Magnesium homeostasis factor
MSRB1
Methionine-R-sulfoxide reductase B1
MT
Mutant
MW
Molecular weight
n
Number of replicates
N
Reference value
Na+
Sodium ion
NCC
Thiazide-sensitive sodium chloride co-transporter
Neo
Neomycin resistance gene
NIPA
Nonimprinted in Prader-Willi/Angelman syndrome
NKCC2
Sodium potassium chloride co-transporter
NLS
Nuclear localization signal
NMDA
N-methyl-D-aspartic acid
NMDG N-methyl-D-glucamine
NPHP
Nephronophthisis
NSAID
Non-steroidal anti-inflammatory drugs
OMIM
Online Mendelian inheritance in man
292 | Chapter 13
P
Probability value
P2X4
P2X purinoceptor 4
P2X6
P2X purinoceptor 6
pA
Poly adenine
PAH
Phenylalanine hydroxylase
PBS
Phosphate buffered saline
PCBD1
Pterin-4 alpha-carbinolamine dehydratase
PCR
Polymerase chain reaction
PDB
Protein data bank
PGE2
Prostaglandin E2
PHB Prohibitin
Pi
Phosphate ion
PI3K
Phosphoinositide 3-kinase
PIP2
Phosphatidylinositol 4,5-bisphosphate
PKA
Protein kinase A
PKC
Protein kinase C
PKHD1
Polycystic kidney and hepatic disease 1
PNGase F
Peptide N-glycosidase F
POUH
Atypical POU homeodomain
POUS
POU-specific domain
PPI
Proton pump inhibitor
PT
Proximal tubule
PTH
Parathyroid hormone
PV Parvalbumin
RAC1
Ras-related C3 botulinum toxin substrate 1
RACK1
Receptor for activated C-kinase 1
RCAD
Renal cysts and diabetes syndrome
REA
Repressor of estrogen receptor activity
RNA
Ribonucleic acid
ROMK
Renal outer medullary potassium channel
RT-PCR
Real time polymerase chain reaction
SA
Splice acceptor
SeSAME
Seizures, sensorineural deafness, ataxia, mental retardation and electrolyte

Imbalance
SEM
Standard error of mean
SLC12A1
Solute carrier family 12 type 1, Gene encoding NKCC2
SLC12A3
Solute carrier family 12 type 3, Gene encoding NCC
SLC41A1
Solute carrier family 41 type 1
SLC41A2
SLC41A3
SOX9
SRY (sex determining region Y)-box 9
SPC
Signal peptidase complex
SPFH
Stomatin/prohibitin/flotillin and HflK/C
SRP
Signal recognition particle
t1/2
Time of half-maximal activation
TAL
Thick ascending limb of Henles loop
TBC1D4
TBC1 domain family, member 4
TH
Tamm-Horsfall protein
TM
Transmembrane domain
TNF
Tumor necrosis factor alpha
TRPM6
Transient receptor potential melastatin type 6
TRPM7
Transient receptor potential melastatin type 7
TRPV5
TUSC3
UMOD
WB
WNT4
WT
ZDHHC
Transient receptor potential vanilloid type 5

Tumor suppressor candidate 3
Gene encoding uromodulin
Western blot
Wingless-type MMTV integration site family, member 4
Wild type
Putative ZDHHC-type palmitoyltransferase 6-like
In this thesis protein and gene names are abbreviated and formatted according to the
guidelines of the HUGO Gene Nomenclature Committee (HGNC), the International Committee
on Standardized Genetic Nomenclature for Mice and the Zebrafish Nomenclature Committee:
Human (Homo sapiens)
Mouse
(Mus musculus)
Zebrafish
(Danio rero)
GENE PROTEIN
Gene PROTEIN
gene Protein
List of Publications | 295
List of Publications
De Baaij JHF, Hoenderop JGJ, Bindels RJM. Regulation of Magnesium Balance: Lessons
Learned from Human Genetic Disease. Clin. Kidney J. 5 (Suppl 1): i15-i24, 2012.
De Baaij JHF, Stuiver M, Meij IC, Lainez S, Kopplin K, Venselaar H, Mller D, Bindels RJM,
Hoenderop JGJ. Membrane Topology and Intracellular Processing of Cyclin M2
(CNNM2). J. Biol. Chem. 287: 13644-13655, 2012.
Keuylian Z, De Baaij JHF, Glorian M, Rouxel C, Merlet E, Lipskaia L, Blaise R, Mateo V, Limon
I. The Notch Pathway Attenuates Interleukin 1 (IL1)-Mediated Induction of Adenylyl
Cyclase 8 (AC8) Expression during Vascular Smooth Muscle Cell (VSMC) Trans-Differentiation. J. Biol. Chem. 287: 24978-24989, 2012.
De Baaij JHF, Groot Koerkamp M, Lavrijsen M, van Zeeland F, Meijer H, Holstege F, Bindels
RJM, Hoenderop JGJ, Elucidation of the Distal Convoluted Tubule Transcriptome
Identifies New Candidate Genes Involved in Renal Magnesium Handling. Am. J. Physiol.
Renal Physiol. 305: F1563-1573, 2013.
Ferr S*, De Baaij JHF*, Ferreira P, Germann R, de Klerk JB, Lavrijsen M, van Zeeland F,
Venselaar H, Kluijtmans LA, Hoenderop JGJ, Bindels RJM. Mutations in PCBD1 Cause
Hypomagnesemia and Renal Magnesium Wasting. J. Am. Soc. Nephrol. 25: 574-586,
2014.
Arjona FJ*, De Baaij JHF*, Schlingmann KP*, Lameris ALL, Van Wijk E, Flik G, Regele S,
Korenke GC, Neophytou B, Rust S, Reintjes N, Konrad M, Bindels RJM, Hoenderop JGJ.
CNNM2 Mutations Cause Impaired Brain Development and Seizures in Patients with
Hypomagnesemia. PLOS Genet. 10: e1004267, 2014.
De Baaij JHF*, Blanchard MG*, Lavrijsen M, Leipziger J, Bindels RJM, Hoenderop JGJ. P2X4
Receptor Regulation of Transient Receptor Potential Melastatin Type 6 (TRPM6) Mg2+
Channels. Pflgers Archiv. 466: 1941-1952, 2014.
De Baaij JHF, Hoenderop JGJ, Bindels RJM. Magnesium in Man: Implications for Health
and Disease. Physiol. Rev. in press, 2014.
De Baaij JHF*, Dorresteijn EM*, Hennekam EAM, Kamsteeg EJ, Meijer R, Dahan K, Muller
M, Bindels RJM, Hoenderop JGJ, Devuyst O, Knoers NVAM. Recurrent FXYD2 p.
Gly41Arg Mutation in Patients with Isolated Dominant Hypomagnesemia. Submitted,
2014.
Blanchard MG*, De Baaij JHF*, Verkaart S, Lameris ALL, Dsaubry L, Bindels RJM,
Hoenderop JGJ. Flavaglines Stimulate Transient Receptor Potential Melastatin Type 6
(TRPM6) Channel Activity. Submitted, 2014.
De Baaij JHF, Kompatscher A, Lavrijsen M, Lameris ALL, Van den Brand M, Bindels RJM,
Hoenderop JGJ, Identification of SLC41A3 as a Novel Player in Magnesium Homeostasis.
In preparation, 2014.
* These authors contributed equally to this work
Curriculum Vitae | 297
Curriculum Vitae
Jeroen de Baaij was born in Nijmegen, the Netherlands
on 16 May 1987. In 2005 he obtained his Gymnasium
(VWO) diploma from the Stedelijk Gymnasium
Nijmegen. Subsequently, he studied (Medical) Biology
at the Faculty of Science of the Radboud University
Nijmegen, from 2005-2008 and obtained his diploma
with distinction bene meritum. From 2008-2010 he
enrolled in the Master of Integrative Biology with
specialization Physiology and pathophysiology at the
Universit Pierre et Marie Curie (UPMC, Paris VI) in Paris,
France. During his internship in 2009, he studied the efficiency of glucocorticoid treatment
of cystic fibrosis patients under supervision of Dr. Philippe LeRouzic at the St. Antoine
Hospital in Paris, France. In 2010, under supervision of Prof. Dr. Isabelle Limon, he
investigated the role of AC8 and Notch receptors in the on-set of atherosclerosis at the
UPMC, Paris, France. Jeroen became first of his year and obtained his masters degree with
highest honors (mention tres bien). Subsequently, he started as PhD Student at the
department of Physiology, Radboud university medical center, Nijmegen, in 2010. Under
the supervision of Prof. Dr. Joost G.J. Hoenderop and Prof. Dr. Ren J.M. Bindels, he focused
on new genes involved in the regulation of magnesium transport in the kidney. During his
graduation research, Jeroens work was selected twice (2012, 2013) for oral presentations
at the yearly Kidney Week of the American Society for Nephrology (ASN). Moreover, he
was awarded with the Best Poster Award at the New Frontiers Symposium of the
Nijmegen Center for Molecular Life Sciences (NCMLS) in 2012. In 2014, his poster on
Functiomics of newly identified magnesiotropic genes was awarded with the Best Poster
Price at the annual EURenOmics meeting in Heidelberg, Germany. Moreover, he obtained
a NCMLS Travel Award to attend the International Society of Nephrology (ISN) Forefronts
meeting on Renal Genetics in Boston, USA in 2014. Additionally, Jeroen was selected for
the Radboudumc Da Vinci Talent Program for personal development of excellent PhD
students. During his PhD, Jeroen supervised nine students from Biomedical Sciences,
Medicine, Medical Biology and Molecular Mechanisms of Disease Bachelors and Masters
studies.
RIMLS Portfolio | 299
Radboud Institute for Molecular Life Sciences

PHD PORTFOLIO
Name PhD student:
Department:
Research School:

Jeroen H.F. de Baaij

Physiology
Radboud Institute for
Molecular Life Sciences
PhD period: 01-09-2010 31-08-2014

Promotors: Prof. dr. Joost G.J. Hoenderop

Prof. dr. Ren J.M. Bindels
Year(s)
ECTS
2011
2011-2014
2011
2012
2011
2012
2013
3
3
1
3
1
1,25
4,25
TRAINING ACTIVITIES
a)
-
-
-
-
-
-
-
Courses & Workshops

RIMLS Graduate Course
RIMLS PhD Retreat
Radiation Safety Course Level 5B
Laboratory Animal Science Article 9
Nierstichting Winterschool
Keystone Proteomics Course
Radboud da Vinci Challenge Talent Program
b)
-
-
-
Seminars & Lectures

RIMLS Seminars
2010-2014
RIMLS Technical Forums
2010-2014
RIMLS in the Spotlight / Forum Evenings / Radboud Research 2010-2014
Rounds
2
2,3
2,2
c) (Inter)national Symposia & Congresses

- Eunefron
- RIMLS New Frontiers 2011 #
- Dutch Physiology Days #
- Keystone Proteomics Course #
- RIMLS New Frontiers 2012 #
- ASN Kidney Week 2012 *
- Kidney Theme *
- ASN Kidney Week 2013 *
- NfN Najaarssymposium *
- EURenOmics Meeting *#
- ERA-EDTA Congress *
- Radboud Research Rounds *
2011
2011
2011
2012
2012
2012
2012
2013
2013
2014
2014
2014
0,5
1,5
0,5
0,5
1,5
1,5
0,5
1,5
0,75
1,5
1,5
0,25
d) Other
- Peer Review Scientific Papers
- Organization RIMLS Technical Forum
2012-2014
2014
0,6
1
2011
2011
2012
2012
2013
2014
2014
2014
1
1
2,3
1
2
1
1
2
TEACHING ACTIVITIES
e)
-
-
-
-
-
-
-
-
Students
Supervision Kelly Menting
Supervision Michelle Damen
Supervision Fariza Bouallala
Supervision Marieke Wever
Supervision Zilin Song
Supervision Stijn Elbers
Supervision Levi van Iersel
Supervision Anke Hoefnagels
TOTAL
47,9
Oral and poster presentations are indicated with a * and # after the name of the activity, respectively.
Dankwoord Acknowledgments Remerciements | 303
Dankwoord Acknowledgements Remerciements

De anatomische tekeningen die dit proefschrift sieren, tonen dat de kennis van de
nieranatomie van 1500 tot nu steeds gedetailleerder is geworden. Iedere kunstenaar en
wetenschapper leerde van zijn leermeesters, en voegde daarna zijn eigen inzichten toe.
Ik hoop dat ik met dit proefschrift mijn steentje heb kunnen bijdragen aan de kennis van
magnesiumtransport in de nier. Maar ook ik had dit nooit kunnen doen zonder de expertise,
de inspiratie en de motivatie van mijn promotoren, collegas, vrienden en familie.
Natuurlijk wil ik ten eerste mijn promotoren Prof. dr. Joost Hoenderop en Prof. dr. Ren
Bindels bedanken voor alle kansen en mogelijkheden die ze mij de afgelopen jaren
hebben geboden. Joost, jouw enthousiasme en energie zijn onuitputtelijk en motiveren
mij om dat stapje extra te zetten, ook als de resultaten tegen zitten. Het vertrouwen dat je
de afgelopen jaren hebt laten blijken en in mij hebt uitgesproken ervaar ik als iets heel
bijzonders. Hopelijk kunnen we de komende jaren samen nog veel wetenschappelijke
successen vieren. Ren, ik bewonder de georganiseerde en efficiente manier waarop jij
het onderzoek binnen de iontransport groep, de afdeling Fysiologie en het RIMLS richting
geeft. Je leert mij altijd het einddoel voor ogen te houden. Mede dankzij deze focus heb
ik binnen 4 jaar mijn proefschrift kunnen afronden.
To achieve great science, I am convinced that collaborations are essential to continuously
exchange knowledge, ideas and expertise. During my PhD project I have had the privilege
of enjoying many fruitful collaborations, for all of which I am extremely grateful.
Thanks to the joint-effort with Prof. dr. Dominik Mller, Dr. Iwan Meij and Dr. Marchel
Stuiver, publication of the molecular characterization of CNNM2 went extremely
smoothly.
I would like to thank Prof. dr. Martin Konrad and Dr. Karl Peter Schlingmann for the
stimulating and open discussions on the CNNM2 protein. Because of your detailed clinical
characterization of CNNM2 patients, we could further understand its physiological
function.
I have experienced the extensive collaboration with Prof. dr. Olivier Devuyst as highly
motivating. You have challenged me to develop new scientific hypotheses and goals.
Although only a few of our collaborative efforts are currently at the stage of publication, I
am confident that more papers will follow soon.
The expertise of Prof. dr. Jens Leipziger has been an important starting point, when we
embarked on a journey to characterize the purinergic regulation of TRPM6. I remember
our regular discussions to be of great scientific benefit, but also as a lot of fun!
I want to thank Dr. Laurent Dsaubry for the collaboration on the flavaglines project.
Because of the unique properties of the compounds that you synthesize we have new
important tools to study TRPM6.
304 | Chapter 14
Prof. dr. Frank Holstege and Marian Groot Koerkamp, met jullie hulp konden we de
microarray analyse uitvoeren die de basis vormt van drie hoofdstukken in dit proefschrift.
Dr. Hanka Venselaar, bedankt voor de eiwittenstructuren van CNNM2 en PCBD1.
De langlopende samenwerking met de genetica afdelingen van het Radboudumc en het
UMC Utrecht zijn een continue bron van vooruitgang binnen het magnesiumonderzoek.
In het bijzonder wil ik hierbij Dr. Erik-Jan Kamsteeg bedanken. Erik-Jan, geweldig dat je
altijd tijd hebt willen maken om mijn vele vragen te beantwoorden en mij verder te
helpen als ik eens niet verder kwam. Daarnaast dank aan Dr. Kornelia Neveling voor de
exoomanalyse en alle anderen binnen de afdeling genetica die hebben bijgedragen aan
dit proefschrift.
Een speciaal woord van dank voor Prof. dr. Nine Knoers. Nine, jij wees mij erop dat de
afdeling Fysiologie misschien wel iets voor mij was. Wat heb je gelijk gehad! Ik heb het
altijd als leuk en bijzonder ervaren dat ik met je mag samenwerken. Ik hoop dat we de
familie niet teveel hebben verveeld met kleine discussies tijdens verjaardagen. Hopelijk is
hoofdstuk 4 van dit boekje pas het begin van veel mooiere resultaten. Ik kijk uit naar de
verdediging waar ik je tegenover me tref.
Daarnaast ben ik alle artsen dankbaar die direct of indirect betrokken waren bij de studies
die hebben geleid tot dit proefschrift. Hun opmerkzaamheid en zorg in de dagelijkse
klinische praktijk vormen de basis voor veel van het werk dat ik heb kunnen verrichten.
In het bijzonder wil ik hierbij noemen Eiske Dorresteijn, Pattrick Ferreira, Roger
Germann en Johannis de Klerk vanwege de prettige samenwerking.
Aansluitend hierop ben ik ook dank verschuldigd aan de vele patinten en hun familieleden die
toestemming gaven voor genetische analyse en publicatie van hun medische geschiedenis.
Dankzij de welwillendheid van deze patinten hebben we veel wetenschappelijke vooruitgang kunnen boeken.
Avant de dbuter mes tudes doctorales, jai tudi Paris o jai t encourag et
enthousiasm lide de poursuivre dans la recherche. Durant mes stages dans les
laboratoires de Prof. dr. Isabelle Limon et Dr. Philippe LeRouzic, jai appris les techniques
molculaires et cellulaires les plus courantes. Mais plus encore, jai appris construire un
raisonnement scientifique, former des hypothses et intgrer des rsultats molculaires
dans un contexte physiologique. Chers Philippe et Isabelle, grce a vous, jai vraiment
aim mes tudes Paris et me suis retrouv accro a la science! (me suis retrouv
passionn de science) Jai, en particulier, des souvenirs de diner chez Philippe et de mes
visites chez Isabelle. Jespre vous revoir souvent danslavenir, la prochaine fois sera, je
lespre, Nimgue pour la soutenance de ma thse.
Daarnaast waren er de afgelopen jaren gelukkig heel veel mensen die mijn leven in en om
het lab heel plezierig hebben gemaakt!
Eline, jij was jarenlang mijn unit-buurvrouw en ik vind het nog altijd heel gek dat je nu niet
meer op de afdeling rondloopt. Ik heb je enorme inzet altijd bewonderd. Ondanks dat je
er enge mannen in de trein voor moest trotseren, was je al op het lab als ik nog in mijn
bed lag en ging je tot laat door. Maar met een boekje als resultaat waar je trots op mag
zijn! Bedankt voor de leuke tijd die we samen hebben gehad en heel veel succes in je
nieuw baan.
Anke, mijn lab-vriendinnetje, jouw betrokkenheid en zorgzaamheid voor alles wat er in
en om het lab gebeurt, zorgt dat je een soort labmoeder bent geworden ;) (dit zal me wel
weer op een relatiebreuk komen te staan). Bedankt voor je lieve woorden als ik er eens
doorheen zat, maar vooral voor het vele plezier dat we samen hebben gehad! Het is maar
goed dat we nooit in elkaars buurt hebben gezeten, anders was er door het geplaag
weinig meer van werk terecht gekomen. Het is gek dat je binnenkort Fysiologie gaat
verlaten, maar ik ben er zeker van dat je een zonnige toekomst tegemoet gaat. Durf op
jezelf te vertrouwen! Bedankt voor je fantastische hulp bij de dierexperimenten, jij hebt
mij de kneepjes van het vak geleerd. Jouw expertise en wetenschappelijke onderlegdheid
hebben bijgedragen aan ieder hoofdstuk van dit boekje, iedere tekst is door jou van
commentaar voorzien. Daarom ben ik blij dat jij als paranimf ook bij mijn verdediging mijn
steun wil zijn.
Paco, Pacote, Pacito, its a small world! When I got to know all your friends in Cdiz during
my studies, you were in Holland. Luckily you joined the Physiology department during my
PhD and I could meet you too! You brought the zebrafish expertise to the fishiology
department, which is a great asset for the lab and resulted in the nicest paper in this thesis.
I have great memories to our trips to Cadiz, eating kebab after work and seeing you play
against Jonkerboys. Thank you for your help and friendship!
Sjoerd, sjulz, short, helaas heb ik niet zoveel bijnamen voor jou als jij voor mij. Jouw
enthousiasme en vele ideen zijn een continue bron van inspiratie, je propjes en vliegen
een een bron van afleiding. Bedankt voor de vele wetenschappelijke discussies, je kritische
blik op mijn schrijfsels en het vele plezier dat we hebben gehad in de kluizenaar, in Spanje
en op het lab!
EvL, Ellen, het is fantastisch om te zien hoe jij bent gegroeid van twijfel over een PhD tot
een harde werker die tig projecten tegelijk doet. Bovendien ben je met je vrolijke humeur,
je grapjes en je oprechte interesse in al je collegas, de sociale lijm van de afdeling
Fysiologie. Bedankt voor je enthousiasme en betrokkenheid. Daar kan ik veel van leren,
om te beginnen zal ik zorgen dat ik eens bij je presentaties zal zijn. ;)
Two chapters in thesis would not have been possible without Maxime. Maxime, Ive
enjoyed working with you a lot! Your impressive patch clamp expertise, calm attitude and
great sense of humor moved our projects forward. Ive learned a lot from your great
writing skills.
Jenny en Mark H. jullie completeren het magnesium-team. Bedankt voor het vele plezier
dat we samen hebben en de wetenschappelijke discussies die onze projecten sterker maken.
306 | Chapter 14
Tijdens mijn PhD heb ik de ongekende luxe gehad een aantal mensen te mogen uitkiezen
om mee samen te werken. Andreas, ik herinner me het gesprek tijdens onze eerste
onmoeting als enorm leuk en al snel hielp je me met het SLC41A3 project. Met jouw
humor en geduld houd je me scherp en weet je ieder probleem te relativeren. Wat ben ik
blij dat je nu als PhD je eigen project runt op onze afdeling! Al was het alleen maar om niet
alleen als laatste over te blijven op feestjes/avondjes in de kluizenaar.
Caro, ik heb veel bewondering voor hoe jij jezelf onmisbaar hebt gemaakt op onze afdeling
tijdens een enorme hectische periode! Helaas heb je nu als chief CDL niet zoveel tijd meer
voor mijn projectjes, maar ik ben blij dat je nog zolang aan ons lab verbonden bent!
Daarnaast ben ik ongelooflijk veel dank verschuldigd aan alle analisten op onze afdeling
zonder wiens hulp mijn projecten nooit allemaal hadden kunnen worden uitgevoerd.
Marla, telkens als ik weer aankwam met een nieuw idee voor een kleuring of een
dierexperiment, zag ik je denken: Hoe gaan we dit dan weer doen?. En toch maakte je
altijd weer ruimte in je planning en bedacht je een nieuwe technische oplossing. Bedankt
voor je hulp, je humor en het enorme plezier dat we ook buiten het lab hebben gehad, in
de kluizenaar en bij de Backstreet Boys. Femke L., bij welk project was jij niet betrokken?
Jij bent degene die mij wegwijs hebt gemaakt op het lab toen ik net begon. Bedankt voor
al je hulp, inzet en Hek cellen! ;) AnneMiete, Hans, Judy, zonder jullie had ik nooit alle
dierexperimenten kunnen uitvoeren, bedankt! Lonneke, Mark d. G., Marleen, jullie inzet
en hulp bij de vele moleculaire experiment zijn van grote waarde.
Irene, jouw bijdrage aan de afdeling Fysiologie is onschatbaar groot. Bedankt voor alle
hulp, je begrip als ik weer eens ongeduldig was en je hart onder de riem als NEC weer
eens verloor. Femke K., bedankt voor het vele regelwerk als ik weer eens een onmogelijk
afspraak wilde inplannen. Nu nog de avondjes aeculaaf goed inplannen zonder afspraken
met honden en goudvissen! ;)
Daarnaast wil ik alle collegas bedanken die ieder op hun eigen wijze hebben bijgedragen
aan een geweldige tijd op het lab: Liz, Lauriane, Marcel, Erik, Silvia, Kukiat, Jitske,
Ramon, Rick, Steef, Sabina, Theun, Anil, Sergio, Pedro, Wilco, Sandor, Miyuki, Marco,
Sami, Omar, Mohammad, Annelies, Ganesh, Joanna, Fareeba, Milne, Joris, Melissa,
Claudia, Seng, Christiane, Genoveva, Tomasz, Anne, Dennis, Sjoeli, Peter, Michiel,
Femke v.d. H., de collegas van integratieve fysiologie en iedereen die ik hier nog vergeet!
Ik heb tijdens mijn promotie het geluk gehad dat ik veel studenten heb mogen begeleiden.
Ik heb van ieder van hen minstens net zoveel geleerd als zij hopelijk van mij. Michelle,
Kelly, Fariza, Marieke, Robert, Stijn, Levi, Anke, Daan, Britta en adoptie-studentes
(puppies) Julia en Rosalie bedankt voor jullie hulp en inzet!
De dierstudies die beschreven zijn in dit boekje waren onmogelijk geweest zonder de
geweldige hulp van de medewerkers van het centraal dierenlaboratorium. Karin, zonder
jou kunnen ze de VGD beter opheffen! Bedankt voor je hulp, humor en altijd positieve
benadering, ook als ik weer eens de administratie niet goed had gedaan. Jij bent altijd
bereid om mee te denken om tot goede en snelle oplossingen te komen. Heel erg
bedankt. Daarnaast dank aan Maikel, Alex H., Alex I., Jeroen, Wilma en alle andere
mensen binnen het CDL die hebben geholpen om mijn dierstudies tot een goed einde
te brengen.
Tijdens mijn promotie heb ik de unieke ervaring gehad van deelname aan de Radboud da
Vinci Challenge. De bijzondere gesprekken met Ellen van der Linden en Anja Schumann
hebben mij geholpen mezelf beter te zien. Ook wil ik alle deelnemers bedanken voor de
geweldige tijd die we samen hebben gehad. Michiel, leuk dat we samen hebben kunnen
werken aan het SLC41A3 project! Sami en Dennis, de gezellige avondjes met wijn, humor
en goede gesprekken zijn de ideale voortzetting van het Da Vinci gevoel.
Cas, toen jij het lab op kwam lopen, kon ik niet vermoeden hoe snel we een hechte
vriendschap zouden ontwikkelen. We hebben eigenlijk geen woorden nodig en toch
praten we oneindig veel. Ik vind het heel bijzonder hoe je mij aanvoelt en begrijpt. Met
veel plezier kijk ik terug op onze tripjes naar Antwerpen en door Australi. Het was voor
mij de ideale manier om los te komen van 4 jaar PhD. Jouw bijdrage aan dit proefschrift
moet niet worden onderschat. Bedankt voor het vele proeflezen, je hulp bij de lekenfolder
en je bijdrage aan de experimenten. Ik ben blij dat Maxime onze poepexplosie heeft
overleefd! Ik ben onder de indruk van de kennis en kwaliteiten die jij als beginnende
wetenschapper laat zien, hopelijk kan jij in je toekomstige baan als arts tijd voor de
wetenschap blijven vrijmaken.
Nog zon cadeautje uit het laatste jaar van mijn promotie was jij, Koen. Jouw denkvermogen
en muziekkennis zijn indrukwekkend. Bedankt voor de tekening die de voorkant van dit
hoofdstuk siert. Wees niet te bang voor de onbekende toekomst! De chocolade staat
altijd voor je klaar.
Mijn oud-klasgenoot, mede NEC-supporter, tennispartner, maar vooral goede vriend,
Roel, hoe vaak hebben we niet tegen elkaar gezegd: We zien elkaar wel weer heel vaak
deze week.? Jij hebt misschien wel de meest labverhalen moeten aanhoren. Ik voel me
gelukkig dat ik iedere week een avond bij je kan aanschuiven, de tennis nemen we dan
maar op de koop toe! Bedankt voor alle keren dat je mij hebt losgetrokken van het werk,
door concerten, sportwedstrijden, tennis of de vele reisjes die we hebben gemaakt. Ik ben
blij dat je bij mijn verdediging naast me staat als paranimf.
Yvo, Jonathan, Birgitta en alle andere vrienden en vriendinnen die mij de afgelopen
jaren hebben afgeleid van mijn werk. Bedankt, ga zo door! ;)
308 | Chapter 14
Linde, Mieke, Tijmen, Anne, Antal, Myrthe, Wouter, Silke, Janneke, Marc mijn lijstje
van broertjes en zusjes is de afgelopen jaren steeds langer geworden. Er is altijd wat te
doen in de huizen De Baaij-Wijgerde, Knoers-Princen! Maar wat is het fijn om zoveel lieve
mensen om me heen te hebben. Bedankt voor al het plezier en de zorgzaamheid.
Lieve Opa Fons en Oma Riet, helaas zijn jullie er niet meer bij om mijn promotie te vieren.
Bedankt voor jullie aanmoedigingen, interesse en trots die zelfs in jullie laatste dagen
bleek. Ik mis de bezoekjes aan de Beunigerbeemd. Opa, het is bijzonder om mijn
proefschrift te verdedigen aan de universiteit waar jij mij voorging.
Lieve Papa, in jouw grote tuin is het heerlijk bijkomen van het drukke leven. Samen met
Jeanne zorg je dat deur in Stevensbeek altijd open staat. Het is bijzonder hoe julie samen
een veilig thuis creren waar iedereen zichzelf kan zijn. Bedankt voor je hulp, zorg en
betrokkenheid, ook in de voorbereiding van dit proefschrift.
Lieve Mama, we kijken terug op een jaar dat niet makkelijk was. Maar juist op dat soort
momenten besef je wat we samen hebben. Zonder jouw liefde, zorg en aandacht had ik
nooit gestaan waar ik nu ben. Ik ben dankbaar voor de bijzondere momenten in Spanje,
in Parijs en in Nijmegen en ben blij dat je er samen met Thijs altijd voor me bent.
Principles for the Development of a Complete Mind: Study the science of art.
Study the art of science. Develop your senses- especially learn how to see.
Realize that everything connects to everything else.
Leonardo da Vinci (1452-1519)
In this thesis our senses were stimulated by artistic scientific drawings that show the development of renal
anatomy and renal physiology. The anatomical drawings that are presented in thesis are adapted from:
Chapter 1 Leonardo da Vinci, A Kidney with Notes (1509).
Chapter 2 Andreas Vesalius, De Humani Corporis Fabrica (1543).
Chapter 3 Bartholomeus Eustachius, Opuscola Anatomica (1564).
Chapter 4 Frederik Ruysch, Thesaurus Anatomicus (1709).
Chapter 5 Govard Bidloo, Anatomia Humani Corporis (1685).
Chapter 6 Alexander Schumlansky, De Structura Renum (1782).
Chapter 7 Friedrich Gustav Jacob Henle, Zur Anatomie der Niere (1862).
Chapter 8 Camillo Golgi, Annotazioni Intorno allIstologia dei Reni dellUomo e di Altri Mammiferi e
SullIstogenesi dei Canalicoli Oriniferi (1889).
Chapter 9 William Bowman, The Physiological Anatomy and Physiology of Man (1857).
Chapter 10 Homer W. Smith, The Kidney: Structure and Function in Health and Disease (1951).
Chapter 11 Andreas Vesalius, De Humani Corporis Fabrica (1543).
Chapter 12 William Cheselden, Anatomy of the Human Body (1750).
Chapter 13 Richard Quain, The Anatomy of the Arteries of the Human Body, with its Applications to Pathology
and Operative Surgery (1844).
Chapter 14 Koen Ketelaars (2014).

De Baaij Thesis PDF

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

De Baaij Thesis PDF

Uploaded by

Copyright:

Available Formats

The research presented in this thesis was performed at the department of Physiology,

Ipskamp Drukkers BV, Enschede, the Netherlands

Susan Rolffs, Stevensbeek, the Netherlands

Promotie In Zicht, Arnhem, the Netherlands

2014, J.H.F de Baaij, Nijmegen, the Netherlands

The Distal Convoluted Tubule:

ter verkrijging van de graad van doctor

Jeroen Herman Frans de Baaij

Realists do not fear the results of their study

Happy is he who gets to know the reason for things

Art History: An Introduction to Magnesium in Health

Elucidation of the Distal Convoluted Tubule Transcriptome

Mutations in PCBD1 Cause Hypomagnesemia and

Recurrent FXYD2 p.Gly41Arg Mutation in Patients

Identification of SLC41A3 as a Novel Player in

Membrane Topology and Intracellular Processing of

CNNM2 Mutations Cause Impaired Brain Development

P2X4 Receptor Regulation of Transient Receptor Potential

Flavaglines Stimulate Transient Receptor Potential

Contemporary Art of Magnesium Transport: A Discussion

Summary: The Art of Magnesium Transport

Samenvatting: De Kunst van het Magnesiumtransport

Dankwoord Acknowledgments Remerciements

Magnesium in Health and Disease | 11

Magnesium in Health and Disease

Figure 1 Magnesium in health and disease

Magnesium in Health and Disease | 13

Heart and Vasculature

< 0.7 mmol/L

< 0.4 mmol/L

> 1.1 mmol/L

Complete heart block

Clinical symptoms of disturbed Mg2+ homeostasis.

Magnesium in Health and Disease | 15

Magnesium Uptake in Intestine

Figure 2 Magnesium Homeostasis

Magnesium in Health and Disease | 17

Figure 3 Magnesium Absorption in the Intestine

Magnesium Storage in Bone

Magnesium Reabsorption in Kidney

Magnesium in Health and Disease | 19

is sufficient to favor Mg2+ transport. Generally, PT Mg2+ reabsorption is considered to be a

Thick Ascending Limb of Henles Loop

Figure 4 Magnesium Reabsorption in the Kidney

Magnesium in Health and Disease | 21

Box 1 Genetic Disorders of TAL Mg2+ Reabsorption

Familial hypomagnesemia with hypercalciuria and nephrocalcinosis Type 1

Bartters syndrome was originally described by Dr. Bartter in 1962 and is

Magnesium in Health and Disease | 23

Distal Convoluted Tubule

Moreover, indirect inhibition of ROMK by aldosterone or Epithelial Na+ Channel (ENaC)

Magnesium in Health and Disease | 25

Box 2 Genetic Disorders of DCT Mg2+ Reabsorption

Hypomagnesemia with secondary hypocalcemia (HSH, OMIM: 602014) is

Isolated autosomal recessive hypomagnesemia (IRH, OMIM: 611718) is caused

In a Brazilian family mutations in KCNA1 encoding voltage-gated K+ channel

Therefore, a cerebral MRI was performed in this patient, showing slight

Hypomagnesemia with hypokalemia are the cardinal symptoms of a

Mutations in CNNM2 have been shown to be causative for hypomagnesemia

Magnesium in Health and Disease | 27

Gene linkage studies identified FXYD domain containing ion transport

Renal cysts and diabetes syndrome (RCAD, OMIM: 137920) is caused by