(/)

Developing Your Intuition For Math

by Kalid Azad 96 comments (https://twitter.com/share)

Our initial exposure to an idea shapes our intuition. And our intuition impacts how
much we enjoy a subject. What do I mean?
Suppose we want to de ne a cat:
Caveman definition: A furry animal with claws, teeth, a tail, 4 legs, that purrs
when happy and hisses when angry
Evolutionary definition: Mammalian descendants of a certain species (F. catus),
sharing certain characteristics
Modern definition: You call those definitions? Cats are animals sharing the
following DNA: ACATACATACATACAT

(Illustration courtesy Common Craft (http://www.commoncraft.com/kalids-cat-whyinitial-understanding-matters))

The modern de nition is precise, sure. But is it the best? Is it what youd teach a child
learning the word? Does it give better insight into the catness of the animal? Not
really. The modern de nition is useful, but after getting an understanding of what a cat

is. It shouldnt be our starting point.

Unfortunately, math understanding (http://betterexplained.com/articles/how-todevelop-a-mindset-for-math/) seems to follow the DNA pattern. Were taught the
modern, rigorous de nition and not the insights that led up to it. Were left with arcane
formulas (DNA) but little understanding of what the idea is.
Lets approach ideas from a different angle. I imagine a circle: the center is the idea
youre studying, and along the outside are the facts describing it. We start in one
corner, with one fact or insight, and work our way around to develop our
understanding. Cats have common physical traits leads to Cats have a common ancestor
leads to A species can be identi ed by certain portions of DNA. Aha! I can see how the
modern de nition evolved from the caveman one.
But not all starting points are equal. The right perspective makes math click and the
mathematical cavemen who rst found an idea often had an enlightening viewpoint.
Lets learn how to build our intuition.

What is a Circle?
Time for a math example: How do you de ne a circle?

There are seemingly countless de nitions. Heres a few:

The most symmetric 2-d shape possible
The shape that gets the most area for the least perimeter (see the isoperimeter
property (http://en.wikipedia.org/wiki/Isoperimetry))
All points in a plane the same distance from a given point (drawn with a
compass, or a pencil on a string)
The points (x,y) in the equation x2 + y2 = r2 (analytic version of the geometric
definition above)
The points in the equation r * cos(t), r * sin(t), for all t (really analytic version)
The shape whose tangent line is always perpendicular to the position vector

(physical interpretation)
The list goes on, but heres the key: the facts all describe the same idea! Its like saying
1, one, uno, eins, the solution to 2x + 3 = 5 or the number of noses on your face
just different names for the idea of unity.
But these initial descriptions are important they shape our intuition. Because we see
circles in the real world before the classroom, we understand their roundness. No
matter what fancy equation we see (x2 + y2 = r2), we know deep inside that a circle is
round. If we graphed that equation and it appeared square, or lopsided, wed know
there was a mistake.
As children, we learn the caveman de nition of a circle (a really round thing), which
gives us a comfortable intuition. We can see that every point on our round thing is
the same distance from the center. x2 + y2 = r2 is the analytic way of expressing that
fact, using the Pythagorean theorem for distance. We started in one corner, with our
intuition, and worked our way around to the formal de nition.
Other ideas arent so lucky. Do we instinctively see the growth
(http://betterexplained.com/articles/an-intuitive-guide-to-exponential-functions-e/)
of e, or is it an abstract de nition? Do we realize the rotation
(http://betterexplained.com/articles/a-visual-intuitive-guide-to-imaginary-numbers/)
of i, or is it an arti cial, useless idea?

A Strategy For Developing Insight

I still have to remind myself about the deeper meaning of e and i which seems as
absurd as remembering that a circle is round or what a cat looks like! It should be the
natural insight we start with.
Missing the big picture drives me crazy: math is about ideas formulas are just a way
to express them. Once the central concept is clear, the equations snap into place.
Heres a strategy that has helped me:
Step 1: Find the central theme of a math concept. This can be difficult, but
try starting with its history. Where was the idea first used? What was the
discoverer doing? This use may be different from our modern interpretation and
application.

Step 2: Explain a property/fact using the theme. Use the theme to make an
analogy to the formal definition. If youre lucky, you can translate the math
equation (x2 + y2 = r2) into a plain-english statement (All points the same
distance from the center).
Step 3: Explore related properties using the same theme. Once you have an
analogy or interpretation that works, see if it applies to other properties.
Sometimes it will, sometimes it wont (and youll need a new insight), but youd
be surprised what you can discover.
Lets try it out.

A Real Example: Understanding e

Understanding the number e has been a major battle. e appears all of science, and has
numerous de nitions, yet rarely clicks in a natural way. Lets build some insight around
this idea. The following section will have several equations, which are simply ways to
describe ideas. Even if the equation is gibberish, theres a plain-english idea behind it.
Heres a few popular de nitions of e:

The rst step is to nd a theme. Looking at es history

(http://en.wikipedia.org/wiki/E_(mathematical_constant)#The_compoundinterest_problem), it seems it has something to do with growth or interest rates. e was
discovered when performing business calculations (not abstract mathematical
conjectures) so interest (growth) is a possible theme.
Lets look at the rst de nition, in the upper left. The key jump, for me, was to realize
how much this looked like the formula for compound interest. In fact, it is the interest
formula when you compound 100% interest for 1 unit of time, compounding as fast as
possible.
Definition 1: Define e as 100% compound growth at the smallest increment
possible.

The article on e (http://betterexplained.com/articles/an-intuitive-guide-toexponential-functions-e/) describes this interpretation.

Lets look at the second de nition: an in nite series of terms, getting smaller and
smaller. What could this be?

After noodling this over using the theme of interest we see this de nitions shows the
components of compound interest. Now, insights dont come instantly this insight
might strike after brainstorming What could 1 + 1 + 1/2 + 1/6 + represent when
talking about growth?
Well, the rst term (1 = 1/0!, remembering that 0! is 1) is your principal, the original
amount. The next term (1 = 1/1!) is the direct interest you earned 100% of 1. The
next term (0.5 = 1/2!) is the amount of money your interest made (2nd level interest).
The following term (.1666 = 1/3!) is your 3rd-level interest how much money your
interests interest earned!
Money earns money, which earns money, which earns money, and so on the
sequence separates out these contributions (read the article on e to see how Mr. Blue,
Mr. Green & Mr. Red grow independently). Theres much more to say, but thats the
growth-focused understanding of that idea.
Definition 2: Define e by the contributions each piece of interest makes
Neato.
Now to the 3rd, and shortest de nition. What does it mean? Instead of thinking
derivative (which turns your brain into equation-crunching mode), think about what
it means. The feeling of the equation. Make it your friend.

Its the calculus way of saying Your rate of growth is equal to your current amount.
Well, growing at your current amount would be a 100% interest rate, right? And by
always growing it means you are always calculating interest its another way of
describing continuously compound interest!

Definition 3: Define e as a function that always grows at 100% of your current

value
Nice e is the number where youre always growing by exactly your current amount
(100%), not 1% or 200%.
Time for the last de nition its a tricky one. Heres my interpretation: Instead of
describing how much you grew, why not say how long it took?
If youre at 1 and growing at 100%, it takes 1 unit of time to get from 1 to 2. But once
youre at 2, and growing 100%, it means youre growing at 2 units per unit time! So it
only takes 1/2 unit of time to go from 2 to 3. Going from 3 to 4 only takes 1/3 unit of
time, and so on.
The time needed to grow from 1 to A is the time from 1 to 2, 2 to 3, 3 to 4 and so on,
until you get to A. The rst de nition de nes the natural log
(http://betterexplained.com/articles/demystifying-the-natural-logarithm-ln/) (ln) as
shorthand for this time to grow computation.
ln(a) is simply the time to grow from 1 to a. We then say that e is the number that
takes exactly 1 unit of time to grow to. Said another way, e is is the amount of growth
after waiting exactly 1 unit of time!
Definition 4: Define the time needed to grow continuously from 1 to a as ln(a). e
is the amount of growth you have after 1 unit of time.
Whablamo! These are four different ways to describe the mysterious e. Once we have
the core idea (e is about 100% continuous growth), the crazy equations snap into
place its possible to translate calculus into English. Math is about ideas!

Whats the Moral?

In math class, we often start with the last, most complex idea. Its no wonder were
confused were showing DNA and expecting students to see the cat.
Ive learned a few lessons from this approach, and it underlies how I understand and
explain math:
Search for insights and apply them. That first intuitive insight can help

everything else snap into place. Start with a definition that makes sense and
walk around the circle to find others.
Develop mental toughness. Banging your head against an idea is no fun. If it
doesnt click, come at it from different angles. Theres another book, another
article, another person who explains it in a way that makes sense to you.
Its ok to be visual. We think of math as rigid and analytic but visual
interpretations are ok! Do what develops your understanding. Imaginary
numbers were puzzling until their geometric interpretation came to light,
decades after their initial discovery. Looking at equations all day didnt help
mathematicians get what they were about.
Math becomes dif cult when we emphasize de nitions over understanding. Remember
that the modern de nition is the most advanced step of thought, not necessarily the
starting point. Dont be afraid to approach a concept from a funny angle gure out
the plain-English sentence behind the equation. Happy math.

Other Posts In This Series

1. How to Develop a Mindset for Math (http://betterexplained.com/articles/howto-develop-a-mindset-for-math/)
2. Developing Your Intuition For Math
3. Learn Difficult Concepts with the ADEPT Method
(http://betterexplained.com/articles/adept-method/)
4. Brevity Is Beautiful (http://betterexplained.com/articles/brevity-is-beautiful/)
5. Learning To Learn: Embrace Analogies
(http://betterexplained.com/articles/learning-to-learn-embrace-analogies/)
6. Learning To Learn: Pencil, Then Ink
(http://betterexplained.com/articles/learning-to-learn-pencil-then-ink/)
7. Intuition, Details and the Bow/Arrow Metaphor
(http://betterexplained.com/articles/intuition-details-and-the-bowarrowmetaphor/)
8. Finding Unity in the Math Wars (http://betterexplained.com/articles/findingunity-in-the-math-wars/)
9. Why Do We Learn Math? (http://betterexplained.com/articles/why-do-we-learnmath/)
10. Math As Language: Understanding the Equals Sign
(http://betterexplained.com/articles/math-as-language-understanding-the-

equals-sign/)
11. Learning math? Think like a cartoonist.
(http://betterexplained.com/articles/math-cartoonist/)
12. Learning To Learn: Intuition Isn't Optional
(http://betterexplained.com/articles/intuition-isnt-optional/)
Posted in Guides (http://betterexplained.com/articles/category/guides/), Math
(http://betterexplained.com/articles/category/math/)

Join Over 250k Monthly Readers

Hi! I'm Kalid, author, programmer, and ever-curious learner. I want to give you a
lasting, intuitive understanding of math. Join the newsletter and we'll turn Huh? to
Aha!
Email address

Join For Free Lessons

Questions & Contributions

AskaQuestion

ContributeanInsight

Have a question? Ask away.

Ask Question
Name (optional)

Have feedback? Just enter it above. I'm making a curated set of questions and insights for the article.

Thanks!

96 comments
1. Peter says:
First of: I really, really like your posts.
I do explain e from the derivative point of view. We encounter it when were
searching for a formula for derivating exponential functions.
We rst investigate using a computer and numerical aproximation what the
derivative of a^x is. We easily see that this is a^x times a given constant (c_a).
Different as yield different constants.
Using the right questions, we come to the point where pupils ask if theres an a
which constant is 1. Meaning de derivative of the function is the function itself.
We rst approximate it (trial and error). And then try to nd a proper,formal
de nition (yielding the limit de nition)

2. Kalid says:
@Peter: Thanks for the comment!
I think the approach of starting with the rate of change works too. Pretty much any
corner is good, though Ive yet to see a nice, intuitive explanation starting from the
natural log de nition and working its way around to e it just seems too indirect a
starting point.
The key is seeing that exponential functions are linked because they change
proportional to their current amount. e is like the unit circle where the radius is 1
other functions are a scaled version of it.
Thanks for leading students through a path that helps build an understanding.

3. Prateek Sharma (http://www.sharmaprateek.com) says:

Hey Kalid,

Great article! Sometimes I think I should nd out all my math teachers from Senior
School & Engineering School and make them read your articles. I wish you were one
of my teachers! Though now you de nitely are!
I really relish your posts and I think you are my rst virtual math teacher! :) Will
de nitely like to meet you sometime!
Thanks. Keep up the good work.

4. jehan says:
I like that explanation of e, but the notion of developing an intuitive idea behind
mathematical concepts isnt new (perhaps its because I have a different sense of
intuition from most people).
The rst thing that young children learn is counting from 1. They start at 1 instead
of 0 because its considered more intuitive to think of something thats there rather
than something that isnt. After that, basic arithmetic is taught by the notion of
incrementing until students get a feel for how much any given number of
increments affects a particular number.
I could be wrong about that last part. I think it was that intuition that pushed me to
studying math in college, and I de nitely know people who never developed that
intuition!
But, even when we studied concepts such as derivation- we didnt just write down
the limit de nition. We made calculations of slope for very small steps.
Idunno, just something to mull over

5. Samson says:
I am a math major and this is right on the dot. There are so many facets of math
that unless you do something like this to connect them all, you forget most of it very
quickly.

6. Kalid says:
@Prateek: Thanks for the note! Heh, if your old teachers would enjoy it, feel free to
send the articles along :). And sure, feel free to drop me an email if youre ever in
the Seattle area.

@Jehan: Nope, the idea of using an intuitive approach isnt new, but I wanted to
spread the word. Youre lucky that you were able to start with slopes and work to the
limit de nition some people just have limits, epsilons and deltas just thrown at
them without any context.
@Samson: Thanks! I agree, if you learn a subject as a set of disconnected facts it
becomes easy to forget.

7. Kenny says:
I am a second year math teacher and your post help me to better understand the
purpose of mathematics and why I strive to teach this way.

8. Kalid (http://betterexplained.com) says:

@Kenny: Thanks for the comment!

9. nanotrkiye (http://nanoturkiye.net/twitter) says:

Thanks for article.
Actually this is not valid only in math, but in all other topics. As an example, we
learn forecasting in our production planning course, if you study the history of
invention of the theorem, you can understand topic easier.
Cheers.

10. Kalid says:

@nanotrkiye: Thanks for the comment! Yes, I very much agree nearly any
subject can be understood at a more intuitive level by looking at its context.

11. misanthropope says:

determining whether a property of an object is if and only if, ie suf cient to de ne
that object, is an important habit to build for a mathematician. however, all of these
terms have canonical de nitions. For example, the set of all points equally distant
from a common center was what the term circle was invented to refer to.

we know what a circle is, but how do we de ne it? is actually kind of dishonest,
viewed in this context. if you know what it is, that knowledge IS the de nition.
my two cents, anyway.

12. anon says:

Is there a plain English way to explain e^(i*pi) = -1? To me, this is the most
mystifying formula. No amount of staring at De Moivres theorem, the series
expansion, etc seems to offer any real clarity.
anon

13. matt says:

Its always good to see things being explained from a practical point of view;
however, if you intend to study math, such a luxury is not always available and so it
may not be a good habit to get into.
Instead I believe what is just as instructive as studying an intuitive approachin
terms of insight gainedis showing that a number of de nitions are indeed equal by
whatever tools are available to youyes that means epsilon-delta proofs may be
necessary. In fact, I would opt for rigorous arguments over intuitive ones as often
intuition can be just as damaging as it can be helpful in mathematics.
Instead of teaching intuition I think its much more productive to teach the logic
behind the argument.

14. Kalid (http://betterexplained.com) says:

@misanthropope: Interesting point, thanks for the comment. Yes, sometimes a
given property can be described as the de nition of an item. However, sometimes
the reason for picking that particular property can be obscured. In the circle
example, I imagine its inventor focused on the roundness/symmetry before
noticing that all points were the same distance from the center. A better way to
phrase We know what a circle is, but how do we de ne it may be We understand
the concept that a circle conveys, but how is it described in math?

@anon: I think that De Moivres/Eulers identity can be understood intuitively

Im planning on getting that one eventually :).
@matt: Thanks for the note. I think theres a balance between intuition and rigor.
Unfortunately, I think math education has skewed too far on the rigor side (symbol
manipulation) while losing the deeper meaning of the meaning of what the
equations are trying to convey.
I think it is a cycle though you use intuition to formulate ideas, rigor to re ne and
clarify them, intuition to formulate more detailed ideas, rigor to re ne those, and so
on.

15. Nobody says:

Great article. In the chemistry course that Im taking, for example, no one can
understand what is being taught because the teacher rarely explains why certain
things are true. The only reason why Im doing well in the class is I take some time
to understand what Ive been told.
For example the order in which electron orbitals ll was simply given to us. I never
memorized the order as if it was a new alphabet I learned the reason why it
follows a certain order and produced that sequence to see that indeed I was taught
correctly.
Finally, I agree that it is intuition that produces ones love for a subject. I dont like
mathematics simply because I solve a bunch of problems for homework. I enjoy the
subject because I learn more of its secrets with each question that I answer.

16. Kalid (http://betterexplained.com) says:

@Nobody: Thanks for the comment. I totally agree many subjects come together,
and are even fun when understood at an intuitive level.

17. anonymous says:

Nice post! One problem is that as a math teacher, ones instinct is to only say true
things which ironically can get you into real trouble with exposition.

Case in point: me. I read your de nition of a circle as the most symmetric 2D shape
possible, and immediately started thinking, but wait, a set of concentric circles is
just as symmetric. As is a point. And hey, the entire plane has even more
symmetries.
Then I realized, wow, I shouldnt be a jerk. Pedantry like mine is exactly the problem
youre complaining about! Thanks for making me take a look at myself.

18. Kalid (http://betterexplained.com) says:

@anonymous: Thanks for the insightful comment! Yes, sometimes the nitty gritty is
useful to focus on, but often it can be a hurdle to beginners.
In this context, word shape means something along the lines of a smooth,
unbroken convex curve in 2d which should hopefully eliminate the plane itself and
a single point :).
Thanks for the comment.

19. J says:
Hi Kalid,
Thank you kindly for your clear and unobstructed de nition of e and ln. Learning
basic principles is often very frustrating for maths inept individuals such as myself. I
certainly bene t from a simple yet useful explication of what are, at rst, abstract
topics. Website such as yours have inspired and enabled me to teach myself the very
topics from which I once shyed away. Heck, Im even nding derivatives of complex
functions! haha
Thanks again, and please continue to add to your website.
J

20. Kalid says:

@J: Thanks for the note! Glad you found it helpful and have moved onto doing crazy
things like differentiating complex functions :). Ill try to keep the articles coming.

21. seyed amirreza mircheraghi says:

hello.im from iran but im human an i have some idea in mathemtic symetry and i
play with some formula but i cant now relate theme to a thing please send for me
some article about all basic in math please.because i want to study phyzics in the
best university with all instrooment for this situation that i want it i most improve
very well me math because the mathematics is the base of physics.i read in the
petroliom ingeneering in iran in scine and research university but i dont like it im in
the end of third year.i want read math in the best university and then study
quantom physics in the best univerrsity .here when we say an idea, they
laugh.thanks alot and goodbye

22. chaos6174 (http://ki55u.blogbus.com) says:

simple object,great idea!

23. Saman says:

Great articles you have written. They help me a lot in my quest for understandning
mathematics not just doing it. Keep up the good work!

24. Kalid says:

@Seyed: Glad to see youre interested in education the articles on the site are
what I have now, but Wikipedia and other resources are good jumping off points for
more details and references, especially for an area like quantum physics. Good luck.
@Saman: Thanks! Really glad they were useful to you.

25. Frank Delano (http://www.a4995.com) says:

I sumbled upon your site not too long ago but the superb comments made about
your posts forced me to read through your posts. You de nitely explain things really
well. Many people can understand things but cannot explain them well. You
understand things very well and you also explain those things very well!

26. Kalid (http://betterexplained.com) says:

@Frank: Thank you! I try to explain things as I wish they were taught to me when I
was rst learning. Im happy youre nding the site useful :).

27. BAReFOOt says:

Sorrym but there are some bad grammar errors in the text, which makes it hard to
understand certain things, because rst, you have to guess what you could have
meant. One example is We then say that e is the number that takes exactly 1 unit
of time to grow to.. To what? The sentence makes no sense.
There are many more such bugs. I think your article is pretty nice, but please
proofread your texts before posting them.

28. BAReFOOt says:

Sorry, but there are some bad grammar errors in the text, which makes it hard to
understand certain things, because rst, you have to guess what you could have
meant. One example is We then say that e is the number that takes exactly 1 unit
of time to grow to.. To what? The sentence makes no sense.
There are many more such bugs. I think your article is pretty nice, but please
proofread your texts before posting them.

29. BAReFOOt says:

See, thats the difference between proofreading, and not proofreading.

30. RF_Guy says:

Thank you very much for creating this site and for sharing your ideas. I nd them
very-very helpful. Being a Radio Designer I have to use math/calculus to solve
problems every day. Dry/rigorous approach never worked for me. I was lucky
enough to go through university in very competitive class and our teachers seemed
to abuse the idea to explain as little as possible to make you think let alone trying
to come up with intuitive explanation. The only way to succeed was to come up with
my own theory. But I have to admit that yours are way better. Thats why I nd
your articles invaluable. And yes, e bothered me forever, but not anymore :-).

31. Kalid says:

@RF_Guy: Thanks for the note and encouragement! Im working through my notes
& would love to make a calculus book one day. Im going back and revisiting
concepts I thought I understood, and seeing more and more insights that I

completely missed the rst time around.

I really agree with you about the need for rigor it has its place, but more
important is to nurture an enthusiasm/enjoyment for the subject. Ill de nitely keep
contributing to the site!

32. Hank says:

I totally agree with your POV as a struggling math undergrad.
In particular, in the area of Analysis, pedagogy is lacking in the majority of texts.

33. hitendra says:

Hi kalid,
This is a bit long and you may nd it amusing or funny but I wrote it straight as i
was thinking; I hope you would pardon me and please pardon me!!!
If you recall I had posted a comment earlier mentioning that I go blank while trying
to nd relationships etc.
Same thing happened again with higher concepts, but one day I recalled that I was
doing same thing long time ago while I was in primary school.
(Pardon me coz this may sound childish)
I had rote learned this particular formula :
(a+b)2=a2 + b2 + 2ab (a2 as in a square).
I thought about going to basic and start from top down.. i.e. from formula to history
using my imagination.
First que: How does it help? if i know 3 square = 9 & 4 square equals 16.. will this
help in getting to know 7 square?
Sec que: How did they arrive at it in rst place?
all i could envision (gaphically) was two square boxes. one of length 3 & other of
length 4.
Now I moved on to bigger box of length 7 & now I was thinking of relating it to
formula & I divided it into two lengths of 3 & 4.

Within this bigger box i could draw area of 3 square & 4 square with there edges
meeting at a point inside the 7 square box.
left over areas were two recangles, one had length 3 & breadth 4 while the other had
opposite gures so i could think of graphicall division in terms of area in a plane.
But now I want some input regarding how am I doing and if my directin is correct at
all I would to know how ancient engineers could have used these equations to solve
what kind of problem?
(BTW i dont how to post my drawings here so i had to explain them sorry for
inconvenience)
Thanks & Regards
hitendra

34. Kalid says:

@hitendra: Thanks for writing! Yes, I like visualizing the multiplication with the
diagram I think I know what you mean. You can take a square of side 7 (3 + 4) and
break it into a 33, a 44, and two 34 rectangles.
In terms of use, its a neat algebraic property some people might think that
(3+4)^2 = 3^2 + 4^2 but clearly that is not the case. So when solving any problem
with area, its important to know the correct result of that equation. In terms of
everyday use, lets see if you are marking off a square plot of land, its better to
make one big square (77) instead of two smaller ones (33 and 44), so the king can
collect more taxes :). Or, if arranging soldiers in a eld, and you see an army
approaching (77) you know your two squadrons (44 and 33) will not be enough
to ght them. Im stretching here, but algebra is general is pretty useful :).

35. hitendra says:

Hi kalid,
I have arrived at a conclusion that your approach towards learning maths basically
encompasses these areas:
1. Philosophy : Observing world as it is without any bias would help us to see
shapes, changes in gures that do not naturally tally with our innate logical
conclusions or calculations.

2. Abstraction : Once a person identi es a real world problem scenario then he can
break it down to simpler and easier to tackle diagrams or gures ( for e.g. straight
lines instead of actual continuosly changing landscape).
3. Pattern Finding : This would require collecting abstracts from multiple problem
scenarios and nding common link or relationship.
4. Language : Finding or labelling abstractions,patterns and relationship with
proper word, and best possible phrases with example for consumption by other
people.. i can say communication.
5. Symbolizing & Reduction: Replacing general language statments with symbols as
much as possible to reduce ambiguity (Formalism).
6. Rigor : working with Formal methods on huge chunk of data or repeating above
steps to make sure proof is strong and is factually correct.
But considering vast requirement of educating childern worldwide, plus geopolitical turnmoils that we face; Providing such proper math education seems
overwhelmingly mammoth task and extremely dif cult to plan and execute.
However, If we nd historical concepts dif cult to grasp or imagine me thinks that
we can start rightway with following generalized method:
Listing out problems that we face today like social, political, infrastructural (we can
easily get correct data which is in abundance these days) and applying above listed
methods on them.. may be that would bring in faster cognition for 14+ age students
(even for adults like me who have missed out an opportunity).
What do you think about that?
Thanks and Regards
hitendra

36. Seamus says:

DNA: ACATACATACATACATACATACAT lol

37. Kalid says:

@Seamus: Glad you liked it :).

38. Anonymous says:

I just encountered this site tonight, in search of a way to convince a friend that the
magic number e essentially always represents proportionality when it appears in
physical equations, due to the fact that powers of e are their own derivatives.
Mission accomplished in that regard, but what I found interesting, and that Id
never thought of before (and Im fty-something), is the connection of the
individual terms in the in nite series for e to the integrated compound interest
mechanism. Thanks!!

39. Kalid says:

@Anonymous: Awesome, glad you enjoyed it! There are so many things Im just
guring out after visiting them a second time.

40. Vera says:

I am a Math teacher and I like this site dearly. Reading it is like talking to a friend
whom you youve known for long time. Thanks!

41. Kalid says:

@Vera: Wow, thank you for the kind words! Im really happy the site comes across
like that, I want it to be a conversation and not a lecture ;).

42. Frank says:

Thank you for succintly listing out a method to go about intuitively thinking about
and understanding math
Im taking a math senior seminar and I have to present on the Euler-Lagrange
equation and give a short intro. into the history, derivation, and basics of calculus of
variationsI am pretty lost still but your site (though it doesnt deal with the topic)
has helped me immensely in better understanding fundamental math ideas and
helped me nd a way to focus the paper I have to write too.
I especially like how you mention looking into the history of an idea to nd its
central theme, and your example with e. Seriously, this takes away at least a little of
the anxiety Im feeling about the paper and the presentation.

43. Kalid (http://betterexplained.com) says:

@Frank: Awesome, glad its coming in useful! I dont know much about the Euler
Lagrange equation but it sounds intriguing :).
Yes, its funny how some historical context can really help get our heads around why
/ how an equation developed.

44. Parag Shah (http://www.adaptivelearningonline.net) says:

Thanks for the excellent post Kalid.

45. Whit Ford (http://mathmaine.wordpress.com) says:

Great job with this site! I am delighted to see more people taking an
intuitive/conceptual approach to explaining core topics in math.

46. Kalid says:

@Whit: Thanks! I just checked out your site too, it looks interesting!

47. Kalid says:

@Parag: Youre more than welcome, glad you liked it.

48. Dave says:

Kalid: thank you, so much, for writing this article.
Im a second year university student in, gasp, the liberal arts.
As you may infer from that statement, Im not exactly good at mathematics.
Thing is, I want to be good at mathematics. I want to be able to see a proof and be
able to understand it and tell that its beautiful, or whether its not elegant and so
on.
I think the approach here will be useful in my attempt to self-educate myself in
mathematics. First thing Im looking at is Euclids Elements; hopefully, attempting
to use the approach that you have here will help me in my understanding. Once Ive

got Euclid, Im moving into trigonometry and calculus, and so deeper and deeper
until Im at least competent in number theory, which is where Im interested.
Who knows, I might end up as a Fermat- he didnt put a lot of focus into his
mathematics study until he was around my age; who knows?

49. Kalid (http://betterexplained.com) says:

@Dave: Thanks for the comment! Glad it was helpful.
To be honest, I dont think many people who are good at math really have a grasp
of the beauty and elegance. Its a bit like saying some who aces spelling bees would
be a good writer, since they have a great vocabulary. Maybe, maybe not. Real
understanding comes from seeing a lot of the subtle connections, not mechanical
techniques.
I think your interest in nding insights and real understanding will really help you
re-learning math now, Im nally starting to see connections I completely missed
in college and high school. Youre lucky that youre able to start so early :).

50. Dave says:

I can suggest a challenge for intuitive mathematical explanations- if you can put
this onto an intuitive basis, you are a math-teacher god.
Set theory. And the existence of in nite in nities.
Remember, all in nities are in nite, but some are more in nite than others. =D
Cheers!

51. Anonymous says:

@Dave
Set theory: the abstraction of the is an element of operation.

52. Colby says:

Ive been extraordinarily fortunate to have had two math teachers in my high school
(Im currently a senior in AP Calc BC) who teach exactly the same way, since for
high school students our ability to conceptualize hasnt completely developed yet. I
have to say, that Ive never learned more in my life on any subject in so few words
and so little time. I think that your approach on intuition is the only way that
anything (that mathematicians think they completely understand) should be taught
when introducing new/abstract topics.
One of my math teachers has a mantra that sums it up perfectly:
My job, he says, is to make the new stuff look like the old stuff.
Before he blows our minds with some new info that leaves jaws on the oor, he
states his motto, and he follows up with So lets start with what we already
know/have de ned
Thats teaching. Thank you for blowing my mind.

53. Kalid says:

@Colby: Wow, thank you for the comment! I completely agree with that mantra of
making the new stuff look like the old stuff. You really need to start with the
previous ideas (since thats how most new ideas get developed variations /
combinations of existing ideas) and work your way up. If done correctly, the new
ideas almost seem obvious or inevitable which is great, because it means they
make sense! Thanks again for the note.

54. marisha says:

I am a woman and I love the way you explained e. But I am confused on the
derivative de nition. I understand that e represents the fastest continuous 100%
growth (at the end of an interest period). The derivative de nition appears to be an
snapshot which says that my current amount is equal to my growth rate (100%) at
this instance in time. My problem is that I dont know how one would arrive at e
(the value at the end of an interest period) from an instaneous snapshot of a single
point in time. In other words, how did this de ne e? Could you help me
understand or correct my misperceptions?
Marisha

55. Kalid says:

@Marisha: Great question. The tricky thing about the derivative de nition is it
describes properties of e without saying what number it is! Its like telling someone
The number Im thinking of is 3 more than half its value. Technically, youve
described what number youre thinking of (x = 3 + x/2, so x = 6) but you didnt make
it easy!
The derivative de nition (d/dx e^x = e^x) is saying Your rate of change at any time
x (d/dx e^x), is exactly equal to your current amount at time x (e^x). That is, your
_instantaneous growth rate (per unit time)_ is 100% of your current amount. If
youre at 10, you expect to grow 10 in the next unit of time (but as you hit 11, you
expect to grow 11 in a unit of time and as you hit 12, you expect to grow 12 in a
unit of time).
This isnt much to work with we need to nd some exponential function that
equals its own growth curve. Trial and error it is.
We can say Hrm, maybe e is 2 and see does d/dx 2^x = 2^x? It doesnt d/dx
2^x, the rate of change, grows too slowly (see graph
(http://www.wolframalpha.com/input/?i=2^x+vs+d%2Fdx+2^x)). d/dx 2^x is only
about 70% of 2^x, not equal.
Ok, how about 3^x? Whoops, that grows a smidgen too fast! d/dx 3^x is about 110%
of 3^x (graph (http://www.wolframalpha.com/input/?i=3^x+vs+d%2Fdx+3^x)). But
now we can try 2.5 (too slow), 2.7 (really close, 99%) 2.71 (even closer!) until we
get a guess for e is satisfyingly close to 100%. (By the way, e goes on forever
without repeating, so we dont really know the exact value we just have a really
good guess).
There are other ways of calculating e, even formulas for it (that have an in nite
number of steps, but the more steps you take the closer you get). The derivative
de nition sort of forces you to use trial and error to guess what number e might be.
Hope this helps!

56. sabindra says:

i always thought how Euler ,Newton got their formula ..is that their intuition
or their hard work ..they have solved such problem that we can see only through
modern days computers..

57. Stephen says:

Hey Kalid,
Great website!! Just a quick question.with regard to your interesting explanation
of es Taylor series, could you maybe explain to me the math as to why the interest
of the interest is 1/2! and the interest of the interest of the interest is 1/3! and so on
and so forth? I see the principal value and the direct interest in the series, but after
that, Im a little lost as to why those next terms are the mathematical expressions of
the subsequent interests..
Thanks so much!!
Sincerely,
Stephen

58. kalid says:

@Stephen: Great question. The reason is were constantly computing integrals to
nd the interest, interest that the interest earned, etc. Breaking it down:
* Original value: 1 (this is our starting amount, and can be written 1/0! = 1)
* First-level interest: 1 (this is our basic 100% return, and can be written 1/1! = 1)
* Second-level interest: 1/2! (this is the interest on our 100% return, which is the
integral of x: 1/2 * x^2 where x = 1)
* Third-level interest: 1/3! (interest on our second-level interest (1/2 x^2) is 1/3 * 1/2
x^3 = 1/6 x^3 = 1/6)
and so on. Basically, e^x can be seen as
1 + x + x^2/2! + x^3/3! + x^4/4! + .
and each term is computing the interest on the term before it by taking its integral.
We plug in x = 1 to get e^1 = e. Hope this helps! (I should write a follow up on this,
its a good point). Also, see the article on sine to see another example of this

interest on interest pattern: http://betterexplained.com/articles/intuitiveunderstanding-of-sine-waves/ (http://betterexplained.com/articles/intuitiveunderstanding-of-sine-waves/)

59. Stephen says:

Thanks, Kalid! Makes perfect senseplease keep up the great work

60. kalid says:

@Stephen: Glad it helped! Thanks for the encouragement :).

61. Siddartha Guttamaaa says:

I LOVE THIS

62. kalid says:

@Siddartha: Thanks :).

63. Dan (http://www.deebster.com) says:

So we start in a corner of a circle? Youve lost me already

64. kalid says:

@Dan: Hah! Pick your favorite corner

65. Mehdi says:

Hi, I totally agree with you kalid. In school they just go straight to the hard
complicated bit without mentioning why e.g. x is x and what happens when there is
2 in front of it. Thank you for these posts and also can you please tell me how to
do/ nd the discriminant, completing the square, solving and sketching graphs.
Thanks.

66. kalid says:

Thanks Mehdi appreciate the suggestions. Ill put them on my list :).

67. Anonymous says:

i love you.
this has been the holiest moment of my life thank you!

68. Niyas.A says:

I am on the same train as you are.. im re-learning my math. Im soooo happy to see
your success.. I think all the great math wizards, scientists etc. some how stumbled
upon the intuitive way and they forgot how the layman felt about them. And you
could produce these things , only because you have been taught the wrong way and
are courageous enough to take the long and arduous path of re-learning.
thanks and lots of hugs my dear brother

69. ml says:
This is so sexy! Beautiful!

70. sampath kumar.p (http://nil) says:

hi ! ur explanations are amazing. any dull headed . wil also understand very well. i
have no fear of math now, after browsing better explained website. hats off. pl carry
on ur mission.

71. kalid says:

Hi Sampath, glad you enjoyed it! Thanks for the warm words :).

72. Ko says:
Thanks for the articleIm returning to math after a very very long time of being
away from it, in t I never really done math or science at high school. In an attempt
to catch up on these things I am trying to stay away from plug and chug and
actually nd out what is an formula to equation actually saying. i.e what does it
really mean.
Finance has lots of great examples to try and work with
eg
FV/PV = (1+ i)^n

So I read this as the ratio of future value to present value is equal to the initial
investment + what ever interstate Im given. I then need to to multiply this by itself
by ever how many time periods it will be invested for.
But developing actual insight beyond this I nd dif cult, and all Ive really done is
read the formula.
so if someone came to me and said hey my ratio of FV/PV after 6 years is blah blah
(insert answer) I wouldnt be able to sit there and say wow thats great you must be
getting an awesome interest rate, or hey thats really bad , the interest you are
getting is horrible.
So I guess my hurdle is how to get being just reading the formula

73. Knut Ryager says:

Hi Kalid, I am really liking your math articles. I am currently working on an Android
app to teach math in easy to understand ways, (mainly equations), and when
looking around and coming over your sine wave article, I was surprised to see our
approach in teaching this concept was pretty alike. So I am drawing a lot of
inspiration from your articles from now on!
Do you have any plans of trying to get your methods into schools? I am hoping for a
future in math education with interactivity and animations to easily convey
concepts. For example, I think seeing the moving sine wave instead of a 2D static
plot is a huge improvement in understandability. (So many people only see fancy
drawings in graphs instead of time plots)

74. kalid says:

Hi Knut, really glad youre able to make use of the material here. I would like to
organize the content on the site so its easier for teachers to use (no direct plans
yet), but my goal is to provide a grocery store of explanations that teachers can
work into their own lessons. Thanks for the note!

75. Science Kiddo (http://www.sciencekiddo.com/) says:

Hi Kalid!

My website is geared toward teaching young children math and science. I am writing
an article about playing with spirograph and was having a dif cult time describing
the mathematical importance of it for kids when I came across your website. I love
what you have said about building an intuition for math before diving into the
formulas. Thats exactly the point I want to get across! I will be linking back to this
article so that my readers can enjoy it as well. Thank you

76. Max says:

This is the best article related to How to learn Math, I have ever read. How to
learn has always been a big question for me and nally I am at the right spot.
Thank you and I am going to read your other articles too !

77. Ben says:

Hi kalid, Im a math major student in korea.
Thank you for writing this lovely article. I really appreciate this
Your approach to learn math is just what I dreamed and naively practiced until now
searching for the history of the concept, making analogy, gathering examples,
playing with exercises, explaining the concept with plain languages
My professor always told me you should stop being inef cient and follow the
lecture.
But I didnt want to study like that. Relying on the lecture full of de nitions merely
one or two de nitions, faster than my ability to keep track of and not interesting.
Your article helped me to ensure my learning habit is not inef cient.
Anyway thank you for writing this article.

78. LJ says:
I think if you can show more of how to develop your intuition, and how to apply it to
mathematics, and problem solving, you can help make mathematics more enjoyable
for us. The rote method of learning the subject is tired.

79. kalid says:

@Ben: Thank you, glad it helped. We have to go beyond the formal de nition in the
lecture and nd ways to truly internalize new ideas.

@LJ: Thanks, I hope to have more posts on applications of math.

Your feedback is welcome -- leave a reply!

Your email address will not be published.
Name

Email

Comment

LaTeX: $$e=mc^2$$

Post Comment

Send me followup comments by e-mail. Or, subscribe (http://betterexplained.com/articles/commentsubscriptions?srp=104&sra=s) without commenting.

In This Series
1. How to Develop a Mindset for Math (http://betterexplained.com/articles/how-to-develop-amindset-for-math/)
2. Developing Your Intuition For Math
3. Learn Difficult Concepts with the ADEPT Method
(http://betterexplained.com/articles/adept-method/)
4. Brevity Is Beautiful (http://betterexplained.com/articles/brevity-is-beautiful/)
5. Learning To Learn: Embrace Analogies (http://betterexplained.com/articles/learning-tolearn-embrace-analogies/)
6. Learning To Learn: Pencil, Then Ink (http://betterexplained.com/articles/learning-to-learn-

pencil-then-ink/)
7. Intuition, Details and the Bow/Arrow Metaphor
(http://betterexplained.com/articles/intuition-details-and-the-bowarrow-metaphor/)
8. Finding Unity in the Math Wars (http://betterexplained.com/articles/finding-unity-in-themath-wars/)
9. Why Do We Learn Math? (http://betterexplained.com/articles/why-do-we-learn-math/)
10. Math As Language: Understanding the Equals Sign
(http://betterexplained.com/articles/math-as-language-understanding-the-equals-sign/)
11. Learning math? Think like a cartoonist. (http://betterexplained.com/articles/mathcartoonist/)
12. Learning To Learn: Intuition Isn't Optional (http://betterexplained.com/articles/intuitionisnt-optional/)

About The Site

BetterExplained helps 250k monthly readers with clear, insightful lessons.
Search articles...

Calculus Course
(/calculus)Calculus insights within minutes. Free to read online (/calculus).

Math, Better Explained

(/ebook/math) A dozen math essentials (/ebook/math). Amazon bestseller.

If you can't explain it simply, you don't understand it well enough. Einstein (more (/philosophy/))
About (/about/)

Privacy (/privacy/)

Contact (/contact/)