Aquaculture 412413 (2013) 125130

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aqua-online

Effects of dietary Bacillus subtilis C-3102 on the production, intestinal

cytokine expression and autochthonous bacteria of hybrid tilapia
Oreochromis niloticus Oreochromis aureus
Suxu He a, Yu Zhang a, Li Xu a, Yalin Yang a, Toshihiro Marubashi b, Zhigang Zhou a,, Bin Yao a,
a
b

Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
Calpis Co., Ltd., Tokyo 150-0021, Japan

a r t i c l e

i n f o

Article history:
Received 12 January 2013
Received in revised form 3 May 2013
Accepted 25 June 2013
Available online 18 July 2013
Keywords:
Bacillus subtilis
Cytokine expression
Autochthonous microbiota
Hybrid tilapia

a b s t r a c t
Bacillus spp. are widely used in aquafeeds as probiotics for enhanced growth performance, innate immune
responses, and disease resistance. The present study aimed to evaluate the effects of low doses of dietary
Bacillus subtilis C-3102 on the production, intestinal cytokine expression and adhesive bacteria of hybrid tilapia Oreochromis niloticus Oreochromis aureus . Juvenile hybrid tilapia were fed B. subtilis C-3102 at
doses of 0 (CK), 2.5 105 (Ta) and 5.0 105 (Tb) CFU g1 of diets for 56 days. The results showed that different diets had no effects on sh growth performance. The B. subtilis supplement was detected in the gut
wall of sh treated with 5.0 105 CFU g1 at 28 days and 56 days by both plate culture and PCR-DGGE
methods, while it was only identied in sh treated with 2.5 105 CFU g1 at 56 days by PCR-DGGE. Supplementation of dietary B. subtilis C-3102 altered the autochthonous gut bacterial communities, signicantly
increased (P b 0.05) the total amounts of adhesive viable bacteria, induced upregulation of intestinal cytokine expression (IL-1b, TGF- and TNF-) and downregulation of intestinal HSP70. Thus dietary supplement
of B. subtilis C-3102 at low dose (105 CFU g1) is benecial to tilapia health.
2013 Elsevier B.V. All rights reserved.

1. Introduction
With the development of commercial-scale aquaculture, disease has
been one of the signicant limiting factors and causes of severe economic loss (Gomez-Gil et al., 2000; Sun et al., 2010). Probiotics are live microorganisms that provide benet to the host animals, such as enhanced
growth performance, innate immune responses, and resistance against
disease, so are widely used in aquaculture (Apn-Molina et al., 2009;
Denev et al., 2009; Nayak, 2010). In sh, Bacillus has been identied to
be probiotics in many studies (Gnther and Jimenez-Montealegre,
2004; He et al., 2011; Nayak, 2010; Sun et al., 2010).
The dose of probiotics is a key factor for optimal benecial effects
on host animals (Minelli and Benini, 2008; Nayak, 2010). It is not
only required for the colonization and subsequent proliferation in
host intestines, but also exerts various benecial effects including
immunostimulatory activity. In previous studies, the variable doses
of Bacillus (1061012 CFU g1) have been tested in aquaculture, and
Bacillus supplement of more than 108 CFU g1 was found to be

Corresponding authors at: Key Laboratory for Feed Biotechnology of the Ministry of
Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12
Zhongguancun South Street, Beijing 100081, PR China. Tel.: +86 10 82106073; fax: +86
10 82106054.
E-mail addresses: zhou_zg@msn.com (Z. Zhou), binyao@caas.cn (B. Yao).
0044-8486/$ see front matter 2013 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.aquaculture.2013.06.028

efcient to improve sh growth performance and immunostimulatory

effects (Liu et al., 2012; Nayak, 2010; Yu et al., 2008; Zhou et al., 2010).
CALSPORIN is a commercial probiotic that contains viable spores of
Bacillus subtilis C-3102, which is heat resistant and highly stable and
widely used in poultry and aquatic animals. In our previous study,
107 CFU g1 strain C-3102 could benet koi carp (Cyprinus carpio)
on feed utilization, gut microbiota, upregulation of cytokine expression (IL-1, IL-10, TNF- and TGF-) and stress response factor
HSP70 (He et al., 2011). But no study has been focused on the effect
of strain C-3102 on hybrid tilapia Oreochromis niloticus
Oreochromis aureus . Tilapia is one of the most important economic sh species in China and south Asian countries due to its fast
growth, popular taste and high economic value (Shelby et al., 2006;
Zhou et al., 2009). The aim of the present study was to evaluate the effect of low doses of B. subtilis C-3102 on the growth performance, gut
autochthonous bacteria and immunity of hybrid tilapia.
2. Materials and methods
2.1. Probiotic and experimental diets
The formulation and chemical composition of the basal diet (which
served as the control diet) are shown in Table 1. These ingredients were
mixed, extruded and air-dried at room temperature as described by He

126

S. He et al. / Aquaculture 412413 (2013) 125130

Wt is the weight of tilapia at day 56, W0 is the initial weight of tilapia,

t is the duration of feeding (in days), and FI is feed intake.

Table 1
Formulations and chemical compositions of the experimental diets.
Ingredients

Fish meal, Peru

Zeolite powder
Soybean meal, dehulled
Wheat our
Corn protein meal
Soy oil
Monocalcium phosphate
Vitamin C phosphate
Vitamin premix
Mineral premix
Silicon chloride choline
B. subtilis C-3102
Chemical compositions (%)
Crude protein
Crude lipid

Percentages (%)
CK

Ta

Tb

18.00
0.30
30.53
32.00
12.27
4.00
2.20
0.10
0.20
0.20
0.20
0.00

18.00
0.295
30.53
32.00
12.27
4.00
2.20
0.10
0.20
0.20
0.20
0.005

18.00
0.29
30.53
32.00
12.27
4.00
2.20
0.10
0.20
0.20
0.20
0.01

36.00
6.00

36.00
6.00

36.00
6.00

et al. (2011). Three diets containing different doses of the B. subtilis

C-3102 (CALSPORIN, Calpis, Tokyo, Japan) were prepared as described
in Table 1. B. subtilis C-3102 was added to the basal diet at two levels,
resulting in 2.5 105 (Ta) and 5.0 105 (Tb) colony-forming units
(CFU) (g1 diet). The pellet feed was stored in a cool dry place until
use. The actual counts of strain C-3102 in feed were determined by plating on B. subtilis selective medium. The medium contained 326 mL of
vegetable juice (V8, Campbell, Davis, CA), 33 g of NaCl, 0.8 g of dextrose, and pH 5.2. To inhibit the fungal and Gram-negative bacterial
growth, 45 mg of cyclohexamide and 22.5 mg of polymyxin B were
added to each liter of the medium (Turner and Backmanm, 1991).
Approximately 0.1 g of feed was homogenized in 1 mL of deionized
water containing 0.05% Tween 20. Serial dilutions were made and
spread onto plates of B. subtilis selective medium and incubated for
72 h at 24 C before counting.
2.2. Fish husbandry and feeding
Juvenile hybrid tilapias were transported from a tilapia hatchery
(Hainan, China) to the Feed Research Institute, Chinese Academy of
Agricultural Sciences (Beijing, China). All sh were fed the basal diet
(without strain C-3102) at least 2 weeks to acclimate to the experimental conditions. After the acclimation, 240 sh (initial body weight
of about 1 g) were randomly assigned to 24 100-L tanks at a density of
ten sh per tank (similar to the culture density in practical pond). Two
probiotic treatments with 2.5 105 (Ta) or 5 105 (Tb) CFU
B. subtilis g1 diet, and the control (CK) without B. subtilis supplement
were set. Each treatment had eight replicates; three tanks were randomly selected for gut sample analysis, and the other ve were monitored for growth performance. The tanks were part of a recirculation
aquaculture system, and 10% of the water was exchanged daily.
During the feeding, water temperature ranged from 23 to 26 C,
dissolved oxygen (DO) 5.67.8 mg L1, pH 7.82 0.05, and the
total ammonium and nitrite kept below 0.1 and 0.05, respectively.
Fish were fed twice daily at 9:00 and 15:00 at 5% body weight, and
adjusted weekly. After feeding, uneaten food from each tank was removed by siphoning to calculate feed utilization.

2.4. Autochthonous intestinal bacteria analyzed by 16S rDNA V3 DGGE

Of the three tanks randomly selected for gut sample analysis, three
sh per tank were randomly sampled at days 28 and 56 for autochthonous intestinal bacterial analysis by 16S rDNA V3 DGGE as described by
Zhou et al. (2009). Intestines of tilapias were aseptically taken out,
opened, and gently agitated three times in phosphate-buffered saline
(PBS: 130 mM NaCl, 10 mM NaH2PO4, pH 7.2) to remove the digesta.
Genomic DNA was obtained using the extraction method described by
He et al. (2009). The target sequence (V3 region of gene ssr) was amplied by PCR using primers 338f (5-ACTCCTACGGGAGGCAGCAG-3)
with a 40-GC clamp and 519r (5-ATTACCGCGGCTGCTGG-3) for
DGGE. DGGE gels were stained with ethidium bromide solution
(5 g mL1; 20 min), washed with deionized water, and viewed by
UV transillumination. Computer-assisted comparison of DGGE banding
patterns was performed with BIO-1 D++ gel analysis software (Vilber
Lourmat, Torcy, France). Cluster analysis was based on the unweighted
pair group method using the arithmetic mean algorithm (UPGMA). The
excised bands were reamplied, puried, and then sequenced.
2.5. Total aerobic bacterial and B. subtilis counts determined by plate
culture
After 56-day-feeding, three sh from each specied tank were
randomly sampled, and the gut wall and digesta were isolated as described by He et al. (2009). The total numbers of cultivable aerobic
autochthonous and allochthonous bacteria were determined with
plate count agar (LAB M, Bury, UK) after incubation at 30 C for
48 h. The viable B. subtilis was enumerated on selective medium as
described above. Populations were reported as CFU g1 wet gut.
2.6. Cytokine expression analyses by qPCR
Three sh per tank were sampled for intestinal cytokine gene expression analysis at day 56. The sh were dissected under sterile conditions, and the hindgut was pulled out and washed with PBS buffer
(pH 7.2) to remove the intestinal contents. To reduce the individual
variation of gene expression, the sampled hindgut from each tank was
pooled and homogenized using a glass homogenizer and stored at
70 C. Total RNA was extracted using a TRIzol Reagent RNA kit
according to the manufacturer's instructions (Promega, Madison, WI),
and was analyzed on a 1.2% agarose gel. RNA was dissolved in 50 L of
RNase-free water and stored at 80 C until use. The reverse transcription (RT-PCR) was performed by using the ReverTra Ace--RT-PCR kit
(Toyobo, Shanghai, China) according to the manufacturer's instructions.
The RT-PCR primers were designed using the Primer Premier 5.0
software based on the available reference sequences in GenBank
(Table 2). The qPCRs were performed with the SYBR Green Premixus
Ex Taq TMII (Takara, Beijing, China) in an iQ5 multicolor real time-

Table 2
Primer sequences for intestinal cytokine analysis by qPCR.
Genes

Primer sequences

Product size (bp)

Reference genes

IL-

F: TGCACTGTCACTGACAGCCAA
R: ATGTTCAGGTGCACTTTGCGG
F: CTTCCCATAGACTCTGAGTAGCG
R:GAGGCCAACAAAATCATCATCCC
F: TGCCTTTGTCCAGACCGTAG
R: GTGTCCAACGCTGTCATCAC
F: TGCGGCACCCAATCACACAAC
R: GTTAGCATAGTAACCCGTTGGC
F: GCTACTCCTTCACCACCACAG
R: CGTCAGGCAGCTCGTAACTC

236

JF957365

183

JF957367

114

JF957370

190

JF957373

233

JF957365

2.3. Effects of dietary B. subtilis on tilapia production

TNF-

Fish were batch weighed from each tank at the initial stage, and at
day 56 after probiotic feeding. Production was assessed in terms of
weight gain (WG, %), feed conversion ratio (FCR) and survival rate
(SR, %). The calculations were performed using the following formulae:
WG (%) = 100 (Wt W0) / W0, FCR = FI / (Wt W0), and SR
(%) = (100 number of nal sh number) / total sh number where

HSP70
TGF-
Actin

S. He et al. / Aquaculture 412413 (2013) 125130

127

PCR detection system (Bio-Rad, Hercules, CA). The total volume of PCR
reaction was 20 L and consisted of 10 L of SYBR Green Premix Ex
Taq II (2), 1 L primer of each, 2 L cDNA and 6 L ddH2O. The cycling
conditions were as follows: 95 C for 3 min and then 40 cycles of 95 C
for 20 s and 55 C for 20 s and 72 C for 20 s. All real time-PCRs were
performed at least in triplicate. Data analysis was conducted using the
2CT method (Livak and Schmittgen, 2001), and -actin was included
as an internal reference for normalization of gene expression data.
2.7. Statistical analysis
Results were expressed as the mean S.D. Difference between
groups were determined using a one-way analysis of variance
(ANOVA) with the statistical software package SPSS 17.0. Signicant
and very signicant differences were accepted at P b 0.05 and P b 0.01,
respectively.
3. Results
3.1. Production of tilapia
After 56-day-feeding, no signicant difference of FCR, SR, WG and
SGR (P N 0.05) was observed in the sh fed diet Ta and Tb by comparison with the sh fed the control diet (Table 3).
3.2. DGGE ngerprints of autochthonous gut bacteria in tilapia
The 16S rDNA V3 PCR-DGGE ngerprints of the autochthonous intestinal bacterial communities showed that dietary B. subtilis had effects
on tilapia intestinal bacterial communities (Fig. 1). A total of 18 unique
bands, i.e. 18 bacteria representatives, were retrieved from the ngerprints. Their taxa and closest relatives are shown in Table 4. Of them,
12 OTUs were Proteobacteria, 2 were Fusobacteria, 1 was Firmicutes,
and the rest were uncultured bacteria. Eleven of them were detected
in all gut samples, and Bacillus was only detected in the sh fed
5 108 CFU kg1 B. subtilis at day 28 and the sh fed B. subtilis of
both doses at day 56. Some autochthonous gut bacteria changed over
time; for example, bands 5, 11 and 17 only appeared at day 28 and
band 12 was only detected at day 56. The cluster analysis of the band
patterns is displayed in Fig. 2. We found that sh fed different diets
but sampled at the same time point are more similar than that sampled
at different times but fed the same diet. The similarity between CK and
Ta (2.5 105 CFU g1 B. subtilis) was more close than CK and Tb
(5 105 CFU g1 B. subtilis). It indicated that autochthonous bacterial
communities are dynamic, and the effects of probiotic are long-lasting
and dose dependent.
3.3. Total aerobic bacterial and B. subtilis counts determined by plate
culture
After 56-day feeding, the total counts of allochthonous aerobic bacteria in tilapia gut of Ta were signicantly greater (P b 0.05) than those
autochthonous ones in sh fed CK or Tb diets. The total aerobic bacteria
of autochthonous or allochthonous in tilapia fed dietary probtiotics
showed an increase compared to the CK diet. B. subtilis was not detected
in sh fed CK diet. Autochthonous Bacillus was detected in sh fed
higher dose of B. subtilis but not at low dose. Allochthonous Bacillus

Fig. 1. Effects of dietary B. subtilis C-3102 on the intestinal autochthonous microbiota of

tilapia determined by 16S rDNA V3 denaturing gradient gel electrophoresis (DGGE).
CK1 13: the triplicates of the control at the end of 28 feeding days; Ta1 13: the triplicates of the B. subtilis C-3102 2.5 105 treatment at the end of 28 feeding days; Tb1
13: the triplicates of the B. subtilis C-310 5 105 treatment at the end of 28 feeding
days; CK2 13: the triplicates of the control at the end of 56 feeding days; Ta2 13:
the triplicates of the B. subtilis C-3102 2.5 105 treatment at the end of 56 feeding
days; Tb2 13: the triplicates of the B. subtilis C-310 5 105 treatment at the end of
56 feeding days.

was detected in sh with probiotic treatments, and the counts of

those fed higher dose were greater than that of low dose (Table 5).
3.4. Intestinal cytokine gene expression in tilapia
The expression of immune response genes IL-1, TNF-, and
TGF- showed signicant increases (P b 0.05) in tilapia fed B. subtilis
(Fig. 3). The mRNA level of stress tolerance indicator HSP70 was signicantly lower in both probiotic treatments (P b 0.01), especially in
sh fed high dose of B. subtilis (P b 0.01).
4. Discussion
Dietary Bacillus has been reported to have positive effects on sh
production, e.g., 1.0 108 CFU g1 of Bacillus pumilus or Bacillus clausii
results in signicant improvement of FCR in grouper (Epinephelus
coioides) in a 60-day feeding trial (Sun et al., 2010); grouper fed 104,
106, and 108 CFU g1 B. subtilis showed signicant increases in WG
and FCR in a dose-dependent way (Liu et al., 2012); dietary B. subtilis
at 1.35 107 CFU g1 enhanced the survival rate of yellow croaker
(Larimichthys crocea) signicantly (P b 0.01), but not at low dose of
4.2 106 CFU g1 (Ai et al., 2011); B. subtilis C-3102 of 107 CFU g1
improved the WG and SR of koi carp (C. carpio) (P b 0.01) (He et al.,
2011). These probiotic Bacillus spp. as growth promoters contribute to
sh production and nutrient absorption (Barg et al., 2005; Yang et al.,
1984). In the present study, we tried low doses of B. subtilis and found

Table 3
Effects of low doses of B. subtilis C-3102 (2.5 105 and 5.0 105 CFU g1) on the growth, diet conversion and survival rates of hybrid tilapia after 56-day-feeding (mean S.D.).
Treatments

IBW (g)

FBW (g)

WG (%)

FCR

SR (%)

CK
Ta
Tb

0.99 0.01
1.00 0.03
1.00 0.01

18.19 1.31
16.85 0.72
17.42 0.60

1731.78 142.24
1579.52 46.78
1634.19 71.52

1.12 0.08
1.05 0.06
1.05 0.02

72.50 10.90
70.00 12.25
85.00 5.00

128

S. He et al. / Aquaculture 412413 (2013) 125130

Table 4
Representative and distributiona of autochthonous bacteria isolated from tilapia gut based on the 16S rDNA V3 DGGE ngerprints.
Phylum

Band no.

Closest relative (obtained from BLAST search)

Identity (%)

CK1

Ta1

Tb1

CK2

Ta2

Tb2

Proteobacteria

4
7
17
8
12
2
13
16
18
9
10
14
1
5
6
11
15

Acinetobacter sp. (JQ072075.1)

Acinetobacter junii (JQ582951.1)
Brevundimonas diminuta (AB374488.1)
Enterobacteriaceae bacterium (JQ595503.1)
Escherichia coli (GU237035.1)
Serratia proteamaculans (JF327454.1)
Serratia proteamaculans (JF327478.1)
Serratia sp. (JN609547.1)
S. proteamaculans (JF327478.1)
Cetobacterium sp. (HM778168.1)
Cetobacterium sp. (HM778168.1)
Bacillus sp. (JQ619845.1)
Uncultured teleost gene (AB649436.1)
Uncultured bacterium clone (GU739874.1)
Uncultured bacterium (GU301230.1)
Uncultured bacterium (JN635276.1)
Uncultured bacterium clone (JN200252.1)

100
100
100
100
100
100
100
100
99
100
100
100
100
99
100
99
100

+
+
+
+

+
+
+
+
+

+
+
+
+
+

+
+
+
+

+
+
+
+
+

+
+
+
+
+

+
+
+
+

+
+
+
+
+
+
+
+
+
+
+

+
+

+
+

+
+
+
+
+

+
+

+
+

+
+
+
+
+
+
+

+
+

+
+
+
+
+
+
+
+
+
+

Fusobacteria
Firmicutes
Uncultured

a
+: If the value of a specic band intensity to the total band intensity percentage N1% mean exist, : If the value of a specic band intensity to the total band intensity percentage
b1% mean non-existent.

no difference in tilapia production based on the parameters tested. The

reason might be that low dose of probiotic B. subtilis fails to dominate
the intestinal bacterial community, and its positive effect on sh production is alleviated correspondingly. Further studies using higher
doses will be conducted to verify this presumption.
Bacillus spp. are ubiquitous in aquatic animals, and most potential
probiotics are isolated from sh (Gomez-Gil et al., 2000; Li et al.,
2009; Merrield et al., 2010), and some can colonize the gut. For example, Bacillus spp. reached log 3.74 and 7.41 CFU g1 wet weight in the
mucosal epithelium and in the digesta, respectively, of rainbow trout
(Oncorhynchus mykiss) fed diets supplemented with 7.75 CFU g1
B. subtilis (Merrield et al., 2010). The gut of juvenile white shrimp
was dominated by Bacillus sp. 20 days after its addition to the water
(Gullian and Rodrguez, 2002). Adhesion and colonization to host mucosal surfaces make probiotics stay in the gut for a long time for competition of binding sites and nutrients. Using plate culture and PCR-DGGE

methods, both autochthonous and allochthonous B. subtilis could be detected in tilapia intestines over the whole feeding trial at the dose of
5.0 105 CFU g1. The counts of allochthonous and autochthonous
Bacillus were determined to be 104105 and 102 CFU g1, respectively.
Although strain C-3102 was detected in the gut of tilapia, whether
B. subtilis C-3102 have colonized the tilapia gut still needs further studies.
Treatment of rainbow trout with Bacillus results in the signicantly increased counts of bacteria associated with the intestine (P b 0.05)
(Bagheri et al., 2008). Dietary Bacillus can regulate the gut microbiota of
grouper, selectively stimulate various potentially benecial Enterococcus
sp.-like and B. pumilus-like bacteria, and depress some potential
harmful species like Staphylococcus and Vibrio ponticus (Yang et al.,
2012). B. subtilis under study not only increased the total number of
viable bacteria but also modulated the predominant bacteria in gut
(Tables 4 and 5, Fig. 1). Compared with our previous study that
B. subtilis C-3102 at 108 CFU g1 affected the intestinal microbiota community of koi carp at the early stage and became weaker in the later
stages (He et al., 2011), B. subtilis C-3102 at lower dose also inuenced
the gut microbiota at the early stage, but strengthened its effects over
time. This difference might be attributed to the supplement level of
B. subtilis. On the other hand, B. subtilis might modulate the intestinal
microbiota by producing a number of substances with biocontrol activities, such as turins and cyclic lipoproteins (Rosovitz et al., 1998; Sugita
et al., 1998).
The gut is the organ where probiotics establish and execute functions. Cytokines that regulate innate immunity are produced in response to microbial antigens or compounds released from damaged
cells. IL-1 is an important pro-inammatory cytokine, TNF- is an
interferon tumor necrosis factor, and TGF- is a trans-forming growth

Table 5
The total aerobic bacteria and B. subtilis counts (CFU g1) of tilapia gut determined by
agar culture method at day 56.a

Fig. 2. Cluster analysis of the intestinal autochthonous microbiota of hybrid tilapia fed
B. subtilis C-3102 based on 16S rDNA V3-DGGE. CK1 13: the triplicates of the control
at the end of 28 feeding days; Ta1 13: the triplicates of the B. subtilis C-3102 2.5 105
treatment at the end of 28 feeding days; Tb1 13: the triplicates of the B. subtilis C-310
5 105 treatment at the end of 28 feeding days; CK2 13: the triplicates of the control
at the end of 56 feeding days; Ta2 13: the triplicates of the B. subtilis C-3102 2.5 105
treatment at the end of 56 feeding days; Tb2 13: the triplicates of the B. subtilis C-310
5 105 treatment at the end of 56 feeding days.

Total autochthonous
bacterial count
Total allochthonous
bacterial count
Autochthonous
Bacillus count
Allochthonous
Bacillus count

CK

Ta

Tb

(4.64 3.46)
107b
(3.70 0.70)
108b
Undetected

(3.70 2.80)
108a
(8.00 3.00)
108a
Undetected

Undetected

(5.00 0.20)
104b

(3.05
107b
(6.50
108ab
(1.00
102
(1.40
105a

0.15)
1.00)
0.20)
0.18)

a
Data in the same column that shared a common superscript means no signicant
differences existed (P 0.05).

S. He et al. / Aquaculture 412413 (2013) 125130

129

Fig. 3. Effects of dietary CALSPORIN on the immune responses of tilapia after 56 days feeding. CK, the control group; Ta, the B. subtilis C-310 2.5 105 treatment; Tb, the B. subtilis
C-3102 5 105 treatment. P b 0.01, P b 0.05.

factor. The transcript levels of all these genes relative to the housekeeping gene -actin were signicantly higher in the gut tissue of
sh fed Bacillus diet than that in CK sh (P b 0.05) (Fig. 2). Some studies indicate that a number of probiotics can effectively modulate the
production of proinammatory cytokines including IL-1, TNF-, and
TGF- (Awad et al., 2011; Nayak, 2010; Panigrahi et al., 2007;
Prez-Snchez et al., 2011; Wang et al., 2010). Bacillus can modify
the immune response of the host by interacting with epithelial cells
and by modulating the secretion of anti-inammatory cytokines, consequently resulting in a reduction of inammation (Nayak, 2010). The
70 kDa heat shock protein HSP70 has a number of functions, including the maintenance of cellular homeostasis and the protection of
the individual following pathogenic stress (Liu et al., 2012; Nayak,
2010). Levels of HSP70 are usually induced by some pathogens or disadvantageous conditions (Liu et al., 2012). The downregulated HSP70
in the present study indicates that B. subtilis C-3102 had positive effects on tilapia intestinal cells. The immunostimulatory effects of
Bacillus may ascribe to its production of -glucan and bacteriocins
(Gullian et al., 2004; Rengpipat et al., 2000).
In conclusion, probiotic B. subtilis C-3102 at low dose had no
effects on sh production, but modulated the intestinal microbiota
of tilapia and induced the upregulation of innate cellular cytokines
and downregulation of HSP70. Administration of low-level B. subtilis

C-3102 for at least 28 days ensured the expression of benecial host

genes and healthy intestinal microbiota.
Acknowledgments
This work was supported by the National Natural Science Foundation of China (31272672) and the National Science and Technology
Support Program Project of China (2012BAD25B02).
References
Ai, Q., Xu, H., Mai, K., Xu, W., Wang, J., Zhang, W., 2011. Effects of dietary supplementation of Bacillus subtilis and fructooligosaccharide on growth performance, survival,
non-specic immune response and disease resistance of juvenile large yellow
croaker, Larimichthys crocea. Aquaculture 317, 155161.
Apn-Molina, J.P., Santamara-Miranda, A., Luna-Gonzlez, A., Martnez-Daz, S.F., RojasContreras, M., 2009. Effect of potential probiotic bacteria on growth and survival of
tilapia Oreochromis niloticus L., cultured in the laboratory under high density and
suboptimum temperature. Aquaculture Research 40, 887894.
Awad, E., Mitchell, W.J., Austin, B., 2011. Effect of dietary supplements on cytokine gene expression in rainbow trout, Oncorhynchus mykiss (Walbaum). Journal of Fish Diseases
34, 629634.
Bagheri, T., Hedayati, S.A., Yavari, V., Alizade, M., Farzanfar, A., 2008. Growth, survival
and gut microbial load of rainbow trout (Oncorhynchus mykiss) fry given diet
supplemented with probiotic during the two months of rst feeding. Turkish Journal
of Fisheries and Aquatic Sciences 8, 4348.

130

S. He et al. / Aquaculture 412413 (2013) 125130

Barg, H., Malten, M., Jahn, M., Jahn, D., 2005. Protein and vitamin production in Bacillus
megaterium. Microbial Processes Product 18, 205224.
Denev, S., Staykov, Y., Moutafchieva, R., Beev, G., 2009. Microbial ecology of the gastrointestinal tract of sh and the potential application of probiotics and prebiotics in
nsh aquaculture. International Aquatic Research 1, 129.
Gomez-Gil, B., Roque, A., Turnbull, J.F., 2000. The use and selection of probiotic bacteria
for use in the culture of larval aquatic organisms. Aquaculture 191, 259270.
Gullian, M., Rodrguez, J., 2002. Immunostimulant qualities of probiotic bacteria. Global
Aquacultural Advances 5, 5254.
Gullian, M., Thompson, F., Rodriguez, J., 2004. Selection of probiotic bacteria and study
of their immunostimulatory effect in Penaeus vannamei. Aquaculture 233, 114.
Gnther, J., Jimenez-Montealegre, R., 2004. Effect of the probiotic Bacillus subtilis on
the growth and food utilization of tilapia (Oreochromis niloticus) and prawn
(Macrobrachium rosenbergii) under laboratory conditions. Revista de Biologia
Tropical 52, 937943.
He, S., Zhou, Z., Liu, Y., Shi, P., Yao, B., 2009. Effects of dietary Saccharomyces cerevisiae
fermentation product (DVAQUA) on growth performance, intestinal autochthonous bacterial community and non-specic immunity of hybrid tilapia (Oreochromis
niloticus O. aureus ) cultured in cages. Aquaculture 294, 99107.
He, S., Liu, W., Zhou, Z., Mao, W., Ren, P., Marubashi, T., Ring, E., 2011. Evaluation of
probiotic strain Bacillus subtilis C-3102 as a feed supplement for koi carp (Cyprinus
carpio). Journal of Aquatic Research Developmental S1, 005.
Li, J., Tan, B., Mai, K., 2009. Dietary probiotic Bacillus OJ and isomaltooligosaccharides inuence the intestine microbial populations, immune responses and resistance to white
spot syndrome virus in shrimp (Litopenaeus vannamei). Aquaculture 291, 3540.
Liu, C., Chiu, C., Wang, S., Cheng, W., 2012. Dietary administration of the probiotic, Bacillus
subtilis E20, enhances the growth, innate immune responses, and disease resistance
of the grouper, Epinephelus coioides. Fish & Shellsh Immunology 33, 699706.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2CT method. Methods 25, 402408.
Merrield, D., Dimitroglou, A., Bradley, G., Baker, R., Davies, S., 2010. Probiotic applications for rainbow trout (Oncorhynchus mykiss Walbaum) I. Effects on growth
performance, feed utilization, intestinal microbiota and related health criteria.
Aquaculture Nutrition 16, 504510.
Minelli, E.B., Benini, A., 2008. Relationship between number of bacteria and their probiotic effects. Microbial Ecology in Health and Disease 20, 180183.
Nayak, S.K., 2010. Probiotics and immunity: a sh perspective. Fish & Shellsh Immunology 29, 214.
Panigrahi, A., Kiron, V., Satoh, S., Hirono, I., Kobayashi, T., Sugita, H., 2007. Immune modulation and expression of cytokine genes in rainbow trout Oncorhynchus mykiss upon
probiotic feeding. Developmental and Comparative Immunology 31, 372382.

Prez-Snchez, T., Balczar, J., Merrield, D., Carnevali, O., Gioacchinid, G., de Blas, I.,
Ruiz-Zarzuelaa, I., 2011. Expression of immune-related genes in rainbow trout
(Oncorhynchus mykiss) induced by probiotic bacteria during Lactococcus garvieae
infection. Fish & Shellsh Immunology 31, 196201.
Rengpipat, S., Runkpratanporn, S., Piyatiratitivorakul, S., Menasaveta, P., 2000. Immunity
enhancement on black tiger shrimp (Penaeus monodon) by a probiont bacterium
(Bacillus S11). Aquaculture 191, 271288.
Rosovitz, M.J., Voskuil, M.I., Chambliss, G.H., 1998. Bacillus. In: Balows, A., Duerden, B.I.
(Eds.), Systematic Bacteriology. Arnold Press, London, pp. 709720.
Shelby, R.A., Lim, C., Yildirim-Aksoy, M., Delaney, M.A., 2006. Effects of probiotic diet
supplements on disease resistance and immune response of young Nile tilapia,
Oreochromis niloticus. Journal of Applied Aquaculture 18, 2334.
Sugita, H., Hirose, Y., Matsuo, N., Deguchi, Y., 1998. Production of the antibacterial substance by Bacillus sp. strain NM12, an intestinal bacterium of Japanese coastal sh.
Aquaculture 165, 269280.
Sun, Y., Yang, H., Ma, R., Lin, W., 2010. Probiotic applications of two dominant gut
Bacillus strains with antagonistic activity improved the growth performance and
immune responses of grouper Epinephelus coioides. Fish & Shellsh Immunology
29, 803809.
Turner, J.T., Backmanm, P.A., 1991. Factors relating to peanut yield increases after seed
treatment with Bacillus subtilis. Plant Disease 75, 347353.
Wang, G., Liu, Y., Li, F., Gao, H., Lei, Y., Liu, X., 2010. Immunostimulatory activities of
Bacillus simplex DR-834 to carp (Cyprinus carpio). Fish & Shellsh Immunology
29, 378387.
Yang, M., Ferrari, E., Henner, D.J., 1984. Cloning of the neutral protease gene of Bacillus
subtilis and the use of the cloned gene to create an in vitro-derived deletion mutation. Journal of Bacteriology 160, 1521.
Yang, H., Sun, Y., Ma, R., Ye, J., 2012. PCRDGGE analysis of the autochthonous gut
microbiota of grouper Epinephelus coioides following probiotic Bacillus clausii
administration. Aquaculture Research 43, 489497.
Yu, M., Li, Z., Lin, H., Wen, G., Ma, S., 2008. Effects of dietary Bacillus and medicinal
herbs on the growth, digestive enzyme activity, and serum biochemical parameters of the shrimp Litopenaeus vannamei. Aquaculture International 16,
471480.
Zhou, Z., He, S., Liu, Y., Shi, P., Huang, G., 2009. The effects of dietary yeast culture or
short-chain fructo-oligosaccharides on the intestinal autochthonous bacterial
communities in juvenile hybrid tilapia, Oreochromis niloticus Oreochromis
aureus. Journal of the World Aquaculture Society 40, 450459.
Zhou, X., Tian, Z., Wang, Y., Li, W., 2010. Effect of treatment with probiotics as water
additives on tilapia (Oreochromis niloticus) growth performance and immune
response. Fish Physiology and Biochemistry 36, 501509.