JHSCI 2013 v3 I2 September

UNIVERSITY OF SARAJEVO FACULTY OF HEALTH STUDIES
UNIVERZITET U SARAJEVU FAKULTET ZDRAVSTVENIH STUDIJA
Journal of Health Sciences

Editorial Board
Editor in chief
Advisory Board
Dijana Avdi (BiH)
Kasim Bajrovi
Mirza Dili
Associate editor
Faris Gavrankapetanovi
Demal Pecar (BiH)
Ismet Gavrankapetanovi
Mirsada Huki
Secretary
Sebija Izetbegovi
Aida Rudi (BiH)
Lidija Lincender
Slobodan Loga
Members
Farid Ljuca
Renata Dobrila Dintinjana (CRO)
Senka Mesihovi-Dinarevi
Fatima Jusupovi (BiH)
Muzafer Muji
Mirsad Mufti (BiH)
Ljerka Ostoji
Budimka Novakovi (SRB)

Naris Pojski (BiH)
Electronic Publishing
Borut Poljak (SI)
Refet Gojak
Isabelle Rishard (F)
Muris Pecar
Sandra Vegar-Zubovi (BiH)

Zarema Obradovi (BiH)
Technical editor
Faruk pilja
Editorial office
Address: Bolnika 25, 71 000 Sarajevo, Bosna i Hercegovina
Tel. ++387 33 569 800, ++387 33 569 807
Fax. ++387 33 569 825
E-mail: office@jhsci.ba
Journal web site: www.jhsci.ba
Table of contents:
RESEARCH ARTICLES
Dose-volume histogram constrains for small intestine in postoperative
transcutaneous radiotherapy of endometrial carcinoma: comparison
between conventional and conformal techniques
ANELA RAMI, DENITA LJUCA, GORAN MAROSEVI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82-87
Increased expression and levels of human defensins
(hBD2 and hBD4) in adults with dental caries
GIROLAMO JOSE BARRERA, GABRIELA SANCHEZ TORTOLERO, ADRIANA RIVAS,
CARMEN FLORES, JOSE EMANUELE GONZALES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88-97
Abnormal colposcopic images in patients with pre-invasive cervical lesions
ADNAN BABOVI, DENITA LJUCA, GORDANA BOGDANOVI, LEJLA MUMINHODI . . . . . . . . . . . . . 98-102
Effects of the combined swimming, corrective and aqua gymnastics
programme on body posture of preschool age children
ALDVIN TORLAKOVI, MIRSAD MUFTI, DIJANA AVDI, ROMAN KEBATA . . . . . . . . . . . . . . . . . . . . . . . 103-108
Effects of neural mobilization on pain, straight leg raise test
and disability in patients with radicular low back pain
HARIS OLAKOVI, DIJANA AVDI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109-112
Treatment of the Moderate Lumbar Spinal Stenosis with an
Intespinous Distraction Device IMPALA
HASO SEFO, MERSAD BARUCIJA, EDIN HAJDARPASIC, MIRSAD MUFTIC. . . . . . . . . . . . . . . . . . . . . . . . . 113-116
The role of human papillomavirus (HPV) testing in the follow-up of
patients after treatment for cervical intraepithelial neoplasia (CIN)
GORAN DIMITROV, ELENA DZIKOVA, GLIGOR DIMITROV, SASO PANOV,
IRENA ALEKSIOSKA, GJORGJI BABUSKU . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117-122
Pathomorphological Characteristics of Trophoblast and Serum Human
Chorionic Gonadotropin Levels in Diagnosis of Partial Hydatidiform
GORDANA BOGDANOVI, LEJLA MUMINHODI, DENITA LJUCA, ADNAN BABOVI . . . . . . . . . . . . . 123-128
Epidemiological Factors and Pathomorphologic Characteristics of Hydatidiform Mole
LEJLA MUMINHODI, GORDANA BOGDANOVI, DENITA LJUCA, ADNAN BABOVI . . . . . . . . . . . . . 129-137
Correlation between serum concentrations of homocysteine,
folate and vitamin B12 in patients with schizophrenia
SAIDA FISEKOVIC, NAFIJA SERDAREVIC, AMRA MEMIC, RAIF SERDAREVIC,
SABINA SAHBEGOVIC, ABDULAH KUCUKALIC. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 138-144
Efficiency of dental health care in Federation of Bosnia and Herzegovina
EJLA CILOVI-LAGARIJA, MEDIHA SELIMOVI-DRAGA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 145-150
Incidence of impacted mandibular third molars in population of
Bosnia and Herzegovina: a retrospective radiographic study
SADETA EI, SAMIR PROHI, SANJA KOMI, AMRA VUKOVI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 151-158
Etiological factors of preterm delivery

ELVIRA BRKIEVI, GORDANA GRGI, DENITA LJUCA, EDIN OSTRVICA, AZUR TULUMOVI . . . . . . . . 159-163
Sex determination of the Bosnian-Herzegovinian population based
on odontometric characteristics of permanent lower canines
BELMA MUHAMEDAGI, NERMIN SARAJLI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 164-169
CASE REPORTS
Common variable immunodeficiency case report
EMINA VUKAS, AIDA DIZDAREVI, SENKA MESIHOVI - DINAREVI, ADISA ENGI . . . . . . . . . . . . . . 170-172
Uterine cervix squamous cell carcinoma metastatic to the Ampulla of Vater:
a case report with review of the literature
DALMA UDOVII-GAGULA, FARUK SKENDERI, SRAN GORNJAKOVI, NERMINA IBIEVI,
ADISA CHIKHA, SEMIR VRANI, ALEKSANDRA URAN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173-176
LETTERS TO EDITOR
Fostering the practice of rooming-in in newborn care.
SAURABH R. SHRIVASTAVA, PRATEEK S. SHRIVASTAVA, JEGADEESH RAMASAMY . . . . . . . . . . . . . . . . . 177-178
Surface coil in the magnetic resonance imaging of the orbital vessels anatomy
ELDAN KAPUR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179-182
INSTRUCTIONS TO AUTHORS
Instructions and guidelines to authors for the preparation and submission of manuscripts
in the Journal of Health Sciences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183-186
Anela Rami et al. Journal of Health Sciences 2013;3(2):82-87
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Dose-volume histogram constrains for small

intestine in postoperative transcutaneous
radiotherapy of endometrial carcinoma: comparison
between conventional and conformal techniques
Anela Rami1*, Denita Ljuca2, Goran Marosevi1
1
Department of Radiotherapy, Clinic for Oncology, Hematology and Radiotherapy and 2Gynecology and Obstetrics Clinic,
University Clinical Center, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina
ABSTRACT
Introduction: The aim of this study was to determine the dose-volume histogram (DVH) constrains of
conventional and conformal transcutaneous radiotherapy for small intestine and perform their comparison.
Methods: This retrospective-prospective study included patients who were treated for endometrial cancer
using conventional transcutaneous radiotherapy at the Department of Radiotherapy Clinic of Oncology,
Hematology and Radiotherapy, University Clinical Center Tuzla in the period from 2009 to 2011. The study
was performed on patients of all ages suffering from this condition. The study involved 35 patients. DVH
parameters which were analyzed are: minimum dose (Dmin), maximum dose (Dmax), medium dose (Daver) of
the small intestine, as well as the volume of the small intestine, which is included in 75%, 95% and 100%
dose (V33,75Gy, V42,75Gy, V45Gy) expressed in percentages and cubic centimeters of the affected organ. Working
hypothesis was tested with paired t test. The difference between the variables at the level of p <0.05 was
considered statistically significant.
Results: DVH constrains of transcutaneous conformal radiotherapy showed significantly smaller dose
contribution on small intestine than DVH parameters of conventional transcutaneous radiotherapy (p
<0.0001).
Conclusion: The dose contribution on small intestine was significantly lower by planning three-dimensional conformal transcutaneous radiotherapy in comparison to the conventional planning.
Keywords: transcutaneous postoperative radiotherapy, endometrial cancer
INTRODUCTION
*Corresponding author: Anela Rami, Department of Radiotherapy, Clinic for Oncology, Hematology and Radiotherapy, University
Clinical Center, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina
Phone: +38761109766
Email: neca_kurtovic@yahoo.com
Submitted 21 March 2013 / Accepted 7 May 2013
UNIVERSITY OF SARAJEVO
FACULTY OF HEALTH STUDIES
In developed countries, thanks to early detection in

noninvasive stage, endometrial cancer is the most
common malignant tumor of the female genital
organs (1). The application of radiotherapy in the
treatment of endometrial cancer is often used be-
2013 Anela Rami et al.; licensee University of Sarajevo - Faculty of Health Studies. This is
an Open Access article distributed under the terms of the Creative Commons Attribution
License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
http://www.jhsci.ba
cause the results of a combination of surgical treatment and radiotherapy are often better than surgical
treatment only (2). Indications for use of radiotherapy depend on the type and the degree of malignant
disease spread, the clinical condition of the patient
and the use of other therapeutic modalities (3). Radiation planning includes the possibility of objective
quantification of basic planning procedures, which
require the application of methods, which in the
process of creating treatment plan, take into account
the requirements and expectations of radiotherapists
and physicists, the definition of anatomical structures on the basis of patient series CT / MR images,
and interactive / or automated optimization desired
combination of air beams for better dose distribution, the possibility of checking the reliability of the
data entered, ensuring reproducibility and precision
radiation therapy of patients under the same conditions as prescribed by the given plan. Conventional
treatment is based on radiation with two to four coplanar air fields, whose parameters are determined
by standard simulation scopy until the estimation
of isodose distribution is performed on the basis of
body contours and organic structures on one "reference" CT section. 2D radiotherapy planning is still
a standard that is applied in a number of radiotherapy institutions in addition to its limits and disadvantages. The belief that technological advances in
medicine must lead to improved quality and results
of treatment, can sometimes lead to compromising the particular method. Accordingly, the present
opinion is that we are planning and implementing
3D conformal radiotherapy closer to achieving maximum basic objectives of radiotherapy (application
of cancercid dose of radiation on the tumor with the
maximum preservation of the surrounding healthy
tissue), but also the opinion that the use of such
expensive and sophisticated technology allows only
informative view of anatomical structures of interest which does not result in improving the quality
of planning and implementation of radiotherapy
in total (4). Quantitative evaluation of planning
of transcutaneous radiotherapy using dosevolume
histogram (DVH) is the basis for the selection of the
optimal radiotherapy plan in order for tumor to receive the optimal dose sparing surrounding healthy
tissue. The DVH is used to display the dose distribution. It is particularly useful in the evaluation of
dose distribution in case we have more radiotherapy
plans. DVH shows a complete dose distribution in
radiated area, i.e. the amount of dose that is delivered to the target volume and organs at risk (5). The
aim of this study is to determine the DVH parameters of conventional and conformal transcutaneous
radiotherapy for small intestine, and make a comparison of these parameters.
METHODS
Patients
In this retrospective-prospective study patients were

treated for endometrial cancer using conventional
transcutaneous radiotherapy. All patients were treated at the Department of Radiotherapy Clinic of
Oncology, Hematology and Radiotherapy, University Clinical Center Tuzla in the period from 2009
to 2011. The study was performed on patients of
all ages suffering from this condition. The study involved 35 patients. The control group consisted of
plans for patients treated with conventional transcutaneous radiotherapy. Three-dimensional conformal radiotherapy planning was made for the same
patients, and these plans were also included in the
experimental group. Including factors: patients suffering from endometrial carcinoma treated with
conventional transcutaneous radiotherapy. Excluding factors were: patients suffering from endometrial cancer who were not treated with conventional
transcutaneous radiotherapy. Data on patients treated for endometrial cancer are taken from ImpacMosaiq software system for storing data in radiotherapy.
Planning a three-dimensional conformal radiotherapy was performed on the FOCAL and Xio planning system for radiotherapy on which planning was
previously done for conventional transcutaneous radiotherapy.
Procedures
Patients in the control group were treated using conventional transcutaneous radiotherapy technique
with AP / PA pelvic fields. At the same CT topograms, on which the conventional radiotherapy was
planned, 3D conformal radiotherapy planning was
done which formed working group. 3D plan considered contouring the target volume and organs at risk
(bladder, rectum and small intestine). It showed up
in FOCAL system for planning radiotherapy. Delineation of the rectum, bladder and small intestine
was performed on each CT section for rectum at 1
83
http://www.jhsci.ba
TABLE 1. DVH parameters for small intestine in conventional and conformal technique of irradiation
DVH parameters for
small intestine
Dmin
Dmax
Daver
V33,75Gy
V42,75Gy
V45Gy
V33,75Gy(cm3)
V42,75Gy(cm3)
V45Gy(cm3)
Conformal plans (35 patients)

Conventional plans (35 patients)
Mean
range
mean () Mean
range
mean ()
0,84 (0,36)
0, 83
(0 1,89)
2,67(1,40)
2,35
(0,92 6,55)
49,06 (1,32)
48,96
(47,05 54,19) 47,97(0,94)
47,83
(46,08-50,01)
40,35 (3,90)
40,31
(27,21 48,30) 35,77(3,87)
36,09
(26,37-43,52)
83,57(8,76)
83,89
(54,38 -96,14)
56,58 (15,41) 55,72
(15,46-93,51)
79,5 (9,12)
80,31
(51,29 95,14)
41,74 (14,77) 40,67
(7,79 - 80,59)
64,11(12,48)
64,22
(37,69 - 93,44)
30,20(15,97) 30,77
(0,15 71,07)
638,19(183,82) 627,21 (338,08-1082,1) 421,81(143,6) 419,13 (180,11-840,49)
606,41(174,07) 596,79 (325,71-1016,18) 311,64(126,85) 309,84 (90,64-630,85)
491,6(166,84) 474,28 (214,52-785,74) 224,74(124,05) 194,62
(0,87-569,47)
p
< 0.0001
< 0.0001
< 0.0001
< 0.0001
< 0.0001
< 0.0001
< 0.0001
< 0.0001
< 0.0001
Legend: mean average mean

standard deviation
cm from the anus all the way to the rectosigmoidal

crossing of the entire thickness of the wall of organ,
bladder outer contour of the entire volume of organs, and the outer contour of the small intestine
volume in organs that are in the field of radiation
(1). Then, DVH for conventional plans was calculated on the Xio system for calculating the dose
distributions and the obtained parameters consisted
the control group. The amount of transcutaneous
dose that organs at risk received based on planning
for conventional transcutaneous radiotherapy was
examined. For the same patients, after the organs
at risk were contoured the target volume was contoured, too. The target volume included clinical
target volume (CTV) and planning target volume
(PTV). CTV covered dock uterine, vaginal scar, and
regional lymph nodes, depending on the seat of
primary tumor and N stage. CTV was shown as a
margin of 7 mm around vascular structures. Then,
on 10 mm around the CTV, PTV that represents
the safety margin in which the error during patient
repositioning and physiological organ motion (6)
was included, was shown. The geometry of new
conformal fields was determined and three-dimensional dose distribution was calculated on Xio system. New dose-volume histograms for organs at risk
were calculated for conformal plans. We examined
the amount of transcutaneous dose organs at risk
received by planning based on the plan for threedimensional transcutaneous radiotherapy. From
DVH parameters, the following were analyzed: the
minimum dose (Dmin), maximum dose (Dmax), mean
dose (Daver) organs of the risks, as well as the volume
of organs at risks included in 75%, 95% and 100%

dose (V33,75Gy, V42,75Gy, V45Gy) expressed in percentages and cubic centimeters of the affected organs.
Statistical Analysis
In the descriptive analysis, we used the arithmetic

mean as a complete mean and a median as positional average. Also, along with the arithmetic mean, it
was necessary to calculate the absolute measure of
dispersion, which we presented as a standard deviation in order to evaluate the average deviation of a
numerical characteristic of their arithmetic mean.
Numerical range of features from minimum to maximum is shown along with the median. Working
hypothesis was tested with paired t test in order to
compare the DVH parameters organs at risk among
treated groups. The difference between the variables
at the level of p <0.05 was considered statistically
significant. ArcusQuickstat Statistical software (version 1.0.0.88, Medical Computing.) was used for
data analysis.
RESULTS
In this study, DVH parameter plans for radiation

for 35 patients suffering from endometrial cancer,
who were treated with conventional transcutaneous
radiotherapy at the Department of Radiotherapy
Clinic for Oncology, Hematology and Radiotherapy
in the period from 2009 to 2011 were monitored.
The analyzed DVH parameters for small intestine
for 35conventional and 35 conformal radiation
plans are shown in Table 1.
84
http://www.jhsci.ba
ing healthy tissue and organs. Therefore, modern

radiotherapy gives special attention to the doses received by the volume of risk organs (small intestine,
bladder, colon), so as to reduce the risk of post radiation complications to minimum. For each organ at
risk there is a maximum dose that organ may receive
in the course of radiation treatment. For the small
intestine it is recommended that the volume receiving 45 Gy (V45GY) should be less than 195cm3 (7).
This study compared the conventional and conformal radiation technique following and comparing
DVH of these techniques. Our results show that
the contribution of dose to the small intestine was
significantly lower if conformal radiotherapy technique is applied in comparison to the conventional
one. Maximum and mean dose (Dmax and Daver) for
the small intestine were significantly smaller if conformal radiotherapy technique is applied. The only
parameter that was significantly smaller when the
conventional techniques was used, was Dmin. Conformal techniques from multiple fields provide better coverage of therapeutic dose with target volume
and better sparing of organs at risk from high doses
of radiation. However, a bigger number of fields
give a stronger minimum dose to a larger volume
of surrounding organs (such as the small intestine).
The volumes of the small intestine that are covered
by 75%, 95% and 100% dose were significantly
lower when conformal techniques were used. The
reason for this is because 3D planning gets a complete presentation of tumor volume and surrounding structures, based on which the optimum angle
of the air burst and the shape of air field are determined, which ensures maximum possible exclusion
of organs at risk from the air volume, which again
significantly reduces the volume of organs at risk
covered by transcutaneous radiotherapy dose.
In the study Heron et al.(8) compared 3D conformal radiotherapy techniques with other radiation
techniques in which DVH parameters for plans
were monitored and compared. Particular attention
was focused on the volume of organs at risk that received 30 Gy (V30Gy) as well as the volume of organs
at risk that received 45 Gy (V45Gy). V30Gy for small intestine was 30.3%.These results compared with the
results of our study show that the percentage of the
small intestine is far greater. V45Gy in the previously
mentioned study for small intestine was 10%. V30Gy
and V45Gy in our study are slightly higher, which can
DVH parameters for transcutaneous conformal

radiotherapy show significantly smaller contribution dose on small intestine than DVH parameters
for conventional transcutaneous radiotherapy (p
<0.0001). Analysis of the results showed that the
Dmin is significantly lower when using conventional techniques of radiation (0.84 Gyvs2.67 Gy, p
<0.0001). Comparing the values of the parameters
for Dmax a statistically significant lower dose can be
seen if conformal radiotherapy technique is applied
(47.97 Gy versus 49.06 Gy, p <0.0001).
Comparing conventional and conformal radiation
technique, it was observed that Daveris significantly
smaller when using conformal radiation techniques
(35.77 Gy versus 40.35 Gy, p <0.0001). Analyzing
the DVH parameters for conventional and conformal radiation technique it is proven that the volume
of small intestine covered by 75% dose (V33,75Gy) is
statistically significantly lower if using conformal
techniques (56.58% versus 83.57%, p <0.0001).
Comparison of values for the volume of the small
intestine which is covered by 95% of the dose
(V42,75Gy) showed that this volume of the small intestine is significantly smaller if using conformal radiation techniques (41.74% versus 79.5%, p <0.0001
). Volume of the small intestine which is covered by
100% of the dose (V45Gy) was significantly smaller if
using conformal radiation techniques (30.2% versus
64.11%, p <0.0001).
The results for the volume of the small intestine
which is covered by the 75% of the dose (V33,75Gy)
, what is expressed in cubic centimeters, show that
this volume of the small intestine is significantly
lower when using conformal radiation techniques
(421.81cm3 versus 638.19 cm3 p <0.0001). Comparing the results for the volumes of small intestine
covered by 95% and 100% of the dose (V42,75Gy
and V45Gy), which in this case are expressed in cubic
centimeters, show that both of the above volumes
are significantly lower if using conformal radiation techniques (311.64cm3 versus 606.41 cm3, p
<0.0001; 224.74 cm3 vs. 491.6cm3, p <0.0001).
DISCUSSION
Adjuvant radiotherapy is an important factor for

loco regional control of endometrial cancer. However, applying a therapeutic dose to the target volume
is limited by threshold of radio sensibility surround-
85
http://www.jhsci.ba
results of V30Gy, V40Gy and V45Gy for the small intestine were higher in our study in comparison to the
aforementioned study.
Parameters for 3D conformal radiotherapy of patients with endometrial cancer compared with other
techniques were followed in the study conducted
by Jidong Lian et al. (12). Dose contribution to
the small intestine in our study is much lower in
comparison to the mentioned study, which can be
explained by the way of delineating the small intestine. In the aforementioned study as a "gut" they
delineated the entire peritoneal cavity except liver
and spleen, which significantly increased the total
volume of the small intestine. Yang et al. (13,14)
compared the three-dimensional conformal radiotherapy techniques with other radiation techniques.
The results of our studies for the small intestine are
quite similar to the results in this study.
In conclusion, there is a significantly smaller dose
contribution on small intestine by planning based
on three-dimensional conformal radiotherapy in
comparison to conventional planning. This study
opens the way for further research in terms of research of inter and intra observation variations for
delineation of target volume and organs at risk, errors in planning, errors in repositioning during the
implementation of transcutaneous radiotherapy.
be explained by the fact that the CT simulation in

the preceding study conducted in pronation and using belly board immobilization, so that most guts
taken out of the target volume. In their study the
way of delineation of the small intestine in terms of
the volume that is being analyzed was not explained.
In this study, the small intestine was delineated 1
cm above the PTV. In case a larger volume was delineated in their study, of course the result obtained
was that a smaller volume of small intestine receives
30 and 45 Gy. Also, in the above mentioned study it
is not explained whether the delineation of the small
intestine was done in a way to delineate the entire
volume with associated abdominal cavity or only at
intersections visible walls of the small intestine.
Guo et al. (9) published an article in which they
compared the DVH parameters of three different
planning techniques (conventional, conformal and
IMRT). Special attention is given to the volume of
the small intestine which is covered by 100% dose
(V45Gy). For the small intestine, the conventional
plan V45Gy was 24%, while for the conformal plan
it was 20%. In our study V45Gy is higher for conventional as well as conformal plans in comparison to
the results of the mentioned study. The reason for
this difference lies in the fact that the mentioned
conformal technique was done by using box-technique which thanks to side fields gives a minor contribution to the organs at risk. Nadeau et al. (10)
compared the conventional planning with other radiation techniques. And here is a special emphasis
on the volume of organs at risk which were covered
by 100% dose (V45Gy). The mean V45Gy to the small
intestine in the case of conventional plans amounted 45.9%. The results obtained and the reasons why
they differ from the results of this study can be explained in the same way as the results of the previous
studies by Guo et al.
Very similar results were obtained in the study by
Roeske et al (11) when, in their study, they compared the DVH parameters of conventional radiotherapy techniques with other radiation techniques.
From DVH parameters for the organs at risk the
volume of organ receiving 30, 40 and 45 Gy (V30Gy,
V40Gy and V45Gy) was observed, as well as the maximum dose on the organ at risk. V30Gy for the small
intestine was 49.8 11.6%. V40Gy for the small
intestine was 40.7 10.9%. and V45Gy was 33.8
10.3%. Dmax for the small intestine was 50Gy. The
COMPETING INTERESTS
The authors declare that they have no conflict of interest.

REFERENCES
1. Cardens HR, Look K, Michael H, Careso L. Endometrium. In Halperin EC,
Perez CA, Brady LW (eds). Principles and Practice of Radiation Oncology.
Lipincott Williams & Wilkins. Philadelphia, 2008th; p. 1610-1628.
2. Sutton G, Axelrod JH, Bindy BN, et al. Whole abdomen radiotherapy in the
adjuvant treatment of patients with stage III and IV endometrial cancer: a
Gynecological Oncology Group study. Gynecol Oncol. 2005;97:775.
3. amija, M. enski spolni sustav. U: M. amija,ed. Klinika onkologija. Zagreb: Medicinska naklada, 2006th; p. 266-269.
4. Yasushi N, Takehiro N, Mitsuyuki A et al. CT simulator: A new 3-D planning
and simulating system for radiotherapy: Part 2. Clinical application. Int J
Radiat Oncol Biol Phys. 1990;18:505-13.
5. ChaoKSC, CengizM, HerzogT Gynecologic tumors. In Gregoire V. Scalliet
P. Ang KK (Eds). Clinical Target Volumes in Conformal and Intensity Modulated Radiation Therapy. Springer. Berlin, 2004th; p. 171-186.
6. Purdy JA. Current ICRU definitions of volumes: Limitations and futures
directions. Semin. Radiat Oncol. 2004;14:27-40.
7. QUANTEC (Quantitative Analyses of Normal Tissue Effects in the Clinic):
IJROBP, 76(2),Suppl, 2010.
8. Heron DE, Gerszten K, Selvaraj RN et al. Conventional 3D conformal ver-
86
http://www.jhsci.ba
sus intensity modulated radiotherapy for the adjuvant treatment of gynecological malignancies: A comparative dosimetric study of dose volume
histograms. Gynecol Oncol: 2003;91: 131-136
12. Lian J, Mackenzie M, Joseph K, Pervez N, Dundas G, Urtasun R, Pearcey

R. Assessment of extended-field radiotherapy for stage IIIC endometrial
cancer using three-dimensional conformal radiotherapy, intensity-modulated radiotherapy, and helical tomotherapy. Int J Radiat Oncol Biol Phys.
2008;70(3):935-43.
9. Guo S, Ennis D, Bhatia S, et al. Assesement of nodal target definition using

three diferent techniques: implicationes for re-defining the optional pelvic
field in endometrial cancer, Radiat Oncol: 2010; 5:59.
13. Yang R, Xu S, Jiang W, Xie C, Wang J. Integral dose in three-dimensional

conformal radiotherapy, intensity-modulated radiotherapy and helical tomotherapy. Clin Oncol (R Coll Radiol). 2009;21(9):706-12.
10. Nadeau S, Bouchard M, Germain I, Raymond PE, Beaulieu F, Beaulieu L,

Roy R, Gingras L. Postoperative irradiation of gynecologic malignancies:
improving treatment delivery using aperture-based intensity-modulated
radiotherapy. Int J Radiat Oncol Biol Phys. 2007;68(2):601-11.
14. Yang R, Xu S, Jiang W, Wang J, Xie C. Dosimetric comparison of postoperative whole pelvic radiotherapy for endometrial cancer using threedimensional conformal radiotherapy, intensity-modulated radiotherapy, and
helical tomotherapy. Acta Oncol. 2010;49(2):230-6.
11. Roeske JC, Lujan A, Rotmensch J, Waggoner SE, Yamada D, Mundt AJ.
Intensity-modulated whole pelvic radiation therapy in patients with gynecologic malignancies. Int J Radiat Oncol Biol Phys. 2000;48(5):1613-21.
87
Girolamo Jose Barrera et al. Journal of Health Sciences 2013;3(2):88-97
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Increased expression and levels of human defensins (hBD2 and hBD4) in adults with dental caries
Girolamo Jose Barrera1,2*, Gabriela Sanchez Tortolero1, Adriana Rivas1,
Carmen Flores1, Jose Emanuele Gonzales1
1
Laboratorio de Biotecnologia Aplicada L.B.A., Av. Don Julio Centeno, San Diego, Venezuela. 2Universidad de Carabobo,
Departamento Clnico-Integral, Escuela de Bioanlisis, Maracay, Venezuela.
ABSTRACT
Introduction: Defensins are small anti-microbial peptides produced by epithelial cells. These peptides
have a broad range of actions against microorganisms, including Gram-positive and Gram-negative bacteria. Human defensins are classified into two subfamilies, the -, and - defensins, which differ in their
distribution of disulphide bonds between the six conserved cysteine residues. Defensins are found in saliva
and others compartments of the body. Human defensins 2 (hBD2), beta defensins 4 (hBD4) and alpha
defensins 4 (hNP4) in saliva may contributes to vulnerability or resistance to caries. This study aimed to determine a possible correlation between caries and levels of defensins measuring the expression in gingival
tissue and concentrations in saliva samples.
Methods: Oral examinations were performed on 100 adults of both genders (18-30 years old), and unstimulated whole saliva was collected for immunoassays of the three peptides and for the salivary pH, buffer capacity, protein, and peroxidase activity. mRNA levels of defensins in gingival sample were assessed
by semi-quantitative RT-PCR technique.
Results: The median salivary levels of hBD2 and hBD4 were 1.88 g/ml and 0.86 g/ml respectively for
the caries-free group (n=44) and 7.26 /ml (hBD2) and 4.25 g/ml (hBD4) for all subjects with evidence
of caries (n=56). There was no difference in the levels of hNP4, salivary pH, and proteins between groups,
however the peroxidase activity and buffer capacity (interval 6.0-5.0) were reduced in caries group. Transcriptional levels of hBD2 and hBD4 did correlate with caries experience, the mRNA expression of hBD2
and hBD4 were significantly higher in patients with caries than in patients with no-caries (p < 0.01).
Conclusion: We conclude that high salivary levels and expression of beta defensins, low peroxidase activity and buffer capacity may represent a biological response of oral tissue to caries. Our observation could
lead to new ways to prevent caries and a new tool for caries risk assessment.
Keywords: Saliva, Antimicrobial Peptides, Defensins, Caries.
INTRODUCTION
*Corresponding author: Barrera Girolamo Jose;
Laboratorio de Biotecnologia Aplicada L.B.A., Av. Don
Julio Centeno, San Diego, Venezuela. Apartado 2001
Tel: +58-412-5071616; Fax: +58-241-872-6525
E-mail address: girolamobarrera@hotmail.com
Submitted 3 July 2013 / Accepted 10 September 2013
Saliva plays a central role in oral health (1,2). Saliva

is produced and secreted from salivary glands. The
basic secretory units of salivary glands are clusters
of cells called acini. These cells secrete a fluid that
contains water, electrolytes, mucus, enzymes and
2013 Girolamo Jose Barrera et al.; licensee University of Sarajevo - Faculty of Health Studies.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
http://www.jhsci.ba
antimicrobial peptides, all of which flow out of the

acinus into collecting ducts. Antimicrobial peptides
are important members of the host defense system.
They have a broad ability to kill microbes (3). In
human the two main antimicrobial peptide families
are defensins and cathelicidins. Defensins are small
anti-microbial peptides act by disrupting the structure or function of microbial cell membranes, and
are found in saliva and others compartments of the
body (3). Evidence is accumulating that defensins
play an important role in defense against pathogens
and they are considered as part of innate immune
response (3). They have generally been considered
to contribute to mucosal health; however, it is possible that these peptides can be considered biological factors that influence the appearance of caries.
Defensins are cysteine-rich, cationic peptides with
-pleated sheet structures. Mammalian defensins
are classified into three subfamilies, the -, - and
-defensins, which differ in their distribution of and
disulphide bonds between the six conserved cysteine
residues (4). Defensins have activity against a wide
variety of bacteria, fungal, and viral targets. Under
optimal conditions, antimicrobial activity of defensins is observed at concentrations as low as 1-10 g/
mL. The major mechanism of antimicrobial activity
of all defensins is thought to occur through interaction with the membrane of the invading microbe
resulting in a release of the cell contents (5). Model
bacteria (Escherichia coli ML-35) that were treated
by defensins became permeable to small molecules.
In bacteria, permeabilization coincided with the inhibition of RNA, DNA and protein synthesis and
decreased bacterial viability as assessed by the colony
forming assay. Conditions that interfered with permeabilization also prevented the loss of bacterial viability, indicating that permeabilization is essential
for bacterial killing (6).
The human defensins are widely expressed in oral
tissues including gingival epithelium, salivary glands,
ducts and saliva (3,4). It is known that these peptides are involved in defense against bacteria that can
colonize the oral mucosa. The presence of defensins
in saliva implies their potential role in protecting
tooth structure from bacterially-induced caries. The
hBDs have broad antimicrobial activity against oral
microorganisms such as Streptococcus mutans, Porphyromonas gingivalis and Actinobacillus actinomycetemcomitans (3,5). The amount of hBDs expressed
in saliva varies between individuals. This has been

previously demonstrated for - and -defensins,
histatin, and proline-rich proteins (7,8). This study
shows that the levels of these peptides in unstimulated saliva vary greatly between individuals, even
when differences in total salivary protein are considered. To date there are no reports of normal values
of defensins in human saliva. It has been proposed
that the variation in concentration of defensins in
saliva could be attributed to the genetic factors. The
genes for hBDs lie in a cluster on human chromosome 8. Several genes in this region can occur as
multiple repeated copies (9). It is not well known
if human with several copies of hBD2, for example,
produce more defensins than other peoples. In the
same way, individual differences in the quantity of
- and -defensins may be genetically determined.
There is also data for genetically determined factors
in susceptibility to caries. Some evidence suggests
individual differences in caries experience in patients within the same family (9). These individual
differences suggest that genetic factors may play an
important role in caries resistance or susceptibility.
The purpose of this study was to determine a possible correlation between hBDs levels in saliva and
caries experience in adults. We show high levels and
high expression of hBDs in adults with caries experience. Our findings suggest that high salivary levels of
hBD2 and hBD4 may contribute to caries response.
METHODS
Patients
This study was approved by the Institutional Review

Board of the Applied Biotechnology Laboratory.
Written informed consent was obtained from each
participants. One hundred subjects participated in
the study. Oral examinations were performed by
trained calibrated clinicians using standardized procedures. All samples were obtained with informed
consent. Examiners were instructed to rank subjects
separately for active caries as follows: 0, caries-free
group; 1, mild (one to three caries); 2, moderate
(four to six caries); 3, severe (more than six caries). All patients were apparently healthy and were
excluded from the study patients with a history of
systemic disease or taking medications likely to influence periodontal health.
89
Collection of gingival samples
http://www.jhsci.ba
mercapto-ethanol, was read at a wavelength of 412

nm for 20 s. One unit of enzyme activity was defined as the level of enzyme activity needed to cleave
1 mol of NBS/min at 22C, using a molar extinction coefficient of 12,800.
Tissue samples from caries group (n=4) were taken

from interproximal sites showing redness and/or
bleeding on probing, but no clinical attachment
loss. The control specimens (caries-free group) (n=4)
were collected during impacted third molar extraction surgery. All tissue samples were placed in Trizol
solution and stored at -80C until the analysis.
ELISA
We coated 96-well immunoplates (MaxiSorp;

Nunc) with 100 L of Acid-extracted saliva diluted
in 0.05 mol/L carbonate buffer, pH 9.6, 4 C, for
12 h. Subsequently, we blocked the wells with 200
L of 1% bovine serum albumin (BSA) in PBS at
room temperature for 2 h. After washing 5 times
with 200 L PBS containing 1 mL/L Tween 20, we
incubated 100 L/well with PBS containing 1%
BSA and a 1:1000 dilution of anti-human BD2,
BD4 or HNP4 (Santa Cruz Biotechnology) at room
temperature for 2 h. The plates were washed 5 times
with PBS containing 1 mL/L Tween 20, and wells
were incubated at room temperature with 100 L
of peroxidase-coupled secondary antibody (Santa
Cruz Biotechnology, cat. No. sc-2350 (for BD2 and
HNP4) or cat. No. sc-2370 (for BD4) diluted to
1:5000 in PBS plus 1 mL/L Tween 20 for 30 min.
Plates were washed 5 times as described above, and
incubated with 100 L of substrate (0.2M Na2HPO4, 0.1M citric acid, 0.1% H2O2, 15mg O-phenylenediamine dihydrochloride) to each well in the
dark at room temperature for 10 min. Stop solution
(100 l, 0.5M H2SO4) was added to each well. Absorbance was measured at 405nm using a microtiter plate spectrophotometer Synergy HT (BioTek
Instruments, Winooski, VT, USA).We quantified
hBDs by simultaneous ELISA runs using recombinant hBDs as calibrators.
Collection of saliva
Saliva samples were collected (4 to 6 ml) in a tube

containing Nonidet P-40 to a final concentration of
0.2% v/v. Saliva was cleared by centrifugation twice
at 3000 x g for 20 min at 4C. Total protein concentration was evaluated in the supernatant by bradford
assay (10). Cleared unfractionated saliva was used
for pH and buffer capacity determinations. Aliquots
(200 l) of supernatant were acid extracted by the
addition of an equal volume of 1 M HCl/1% trifluoroacetic acid overnight at 4C (11). The sample
was centrifuged, and the supernatant was concentrated by vacuum evaporation and resuspended in
distilled water equal to the starting sample volume
(11). Acid-extracted saliva was used for immunoassay (ELISA).
pH and buffer capacity determinations
Cleared unfractionated saliva was used for pH determination with a portable pH-meter (Cole Parmer
ACCUMET AB15). The buffer capacity was determined by titration using 1 mL of saliva, with 0.01
M HCl and after each addition of acid the change
in pH was monitored up to pH 5.0. The buffer capacity was analyzed by ranges of pH. The volume
of acid added to the saliva was calculated for each
interval considered: initial pH-7.0, pH 7.0-6.0, and
pH 6.0-5.0. The buffer capacity was expressed in
volume (mL) of the acid added to 1 mL of saliva
in the pH range considered, instead of equivalents
of H.
Reverse transcription polymerase

chain reaction (RT-PCR)
Total RNA was extracted from all tissue samples by

TrizolTM (Invitrogen) as previously descried (12, 13).
RNA concentration and purity were measured using
a spectrophotometer Synergy HT (BioTek Instruments, Winooski, VT, USA). Total RNA (1 g) was
reverse transcribed into cDNA using a commercial
kit (Invitrogen ThermoScriptTM RT-PCR System),
according to the manufacturers instructions. Control reactions to check for DNA contamination were
run in parallel with samples processed without reverse transcriptase. PCR was performed in a final vol-
Activity of peroxidase
Peroxidase activity was measured in the patients

saliva according to the 2-nitrobenzoic acid-thiocyanate (NBS-SCN) assay as previously described (12).
Briefly, the calorimetric change induced by the reaction between the enzyme and the substrate, Dithiobis 2-Nitrobensoic Acid (DTNB) in the presence of
90
http://www.jhsci.ba
ume of 25 l containing 1 l of the reverse transcription reaction, 50 M deoxynucleotide triphosphates,

1.5mM MgCl2, 50mM TrisHCl (pH 8.0), 1 IU
Taq DNA polymerase and 0.2 M each of sense and
antisense hBD2 and hBD4 primers (see sequences
below). PCR was performed in an Eppendorf Mastercycler STM thermocycler for 35 cycles consisting
of denaturation at 94oC (1min), annealing at 60oC
(1min) and extension at 72oC (1min). Amplification
was terminated by a final extension step at 72oC for
5min. A negative control without the cDNA template was run with every assay to evaluate the overall
specificity. The integrity of the template RNA was
checked by confirming expression of -actin mRNA.
The primer sequences were: -actin sense, CACGCCATCCTGCGTCGGAC; -actin antisense,
CATGCCATCCTGCGTCTGGAC; hBD2 sense,
TTCCTGATGCCTCTTCCA; and hBD2 antisense, ATGTCGCACGTCTCTGA; hBD4 sense,
GGCAGTCCCATAACCACATATTC; and hBD4
antisense, TGCTGCTATTAGCCGTTTCTCTT,
hNP4 sense, TGCCGGCGAACAGAACTTCGT; and hNP4 antisense, ACCGATGATGGCGTTCCCAGC, Aliquots (10 l) of the polymerase
chain reaction products were electrophoresed on
1.5% agarose gels and stained with SYBR Gold
nucleic acid gel stain (Molecular Probes, InvitrogenTM). Densitometric analyses were performed using the image analysis software Quantity One (BioRad laboratories, Hercules, CA, USA). Briefly, the
digital image was analyzed to determine the pixel
intensity of each band. Relative quantities of hBD2
and hBD4 mRNA among different preparations
were calculated as the ratio of the hBD2: -actin
and hBD4: -actin pixel intensities from three independent RT-PCR experiments. Positive results
were based on the presence of DNA bands of the
expected size.
FIGURE 1. pH, Buffer capacity and oral peroxidase activity in saliva. Cleared unfractionated saliva was used for pH
determination. The buffer capacity was determined by titration
using 1 mL of saliva, with 0.01 M HCl and after each addition
of acid the change in pH was monitored up to pH 5.0. The
buffer capacity was analyzed by ranges of pH. The volume
of acid added to the saliva was calculated for each interval
considered: initial pH-7.0, pH 7.0-6.0, and pH 6.0-5.0. No difference in the saliva pH between the groups was noted (A).
Considering the pH intervals analyzed, the buffer capacity
showed no difference between the groups either in the initial interval pH - 7.0 or pH 7.0-6.0. In the interval pH 6.0-5.0
the caries-free group showed a higher value than the control
group (P<0.05) (B). Peroxidase activity was measured as previously described (12). The caries-free group showed significantly higher oral peroxidase activity than each of the groups
with caries (*, P<0.05).
RESULTS
Caries experience
Fifty-four females and 46 males participated in the

study. All subjects were between 18 and 32 years of
age. Overall, the adults were healthy, with 90% having no history of disease. Oral examination showed
that 15% had loose teeth. Sixty-one percent of the
population reported having regular dental care. Gin-
91
http://www.jhsci.ba
FIGURE 2. Defensins levels in saliva as a function of caries score. Saliva was thawed and cleared by centrifugation twice at
3000 x g for 20 min at 4C, proteins were precipitated with HCl-TCA. Defensins concentrations were determined by ELISA using anti-hBD2, anti-hBD4, or anti-hNP4 as primary antibody, as indicated in Materials and methods (12). The figure shows the
measured concentrations of defensins expressed as g/ml (A), and relative to salivary protein in g/mg protein (B). hBD2, hBD4
and hNP4 concentrations in saliva, expressed as g/ml; (C, E and G) and relative to salivary protein in g/mg protein (D, F and
H). The caries group showed significantly higher hBD2 and hBD4 concentration (A and B) than each of the groups with no caries
(**, P<0.01). Each assay was carried out in three independent experiments, and results are reported as meanS.D.
92
http://www.jhsci.ba
Salivary analysis
givitis was noted in only a small number of subjects

(10%). forty-four subjects (44%) had no dental caries; 19 (19%), 25 (25%), and 12 (12%) had caries
scores of 1, 2, and 3 or greater, respectively.
The median protein concentration of unstimulated

saliva samples (n=44) were 1.35 mg/ml (range from
0.63 to 2.67 mg/ml) for caries-free group and 1.29
FIGURE 3. Quantification of differentially-expressed defensins mRNAs by RT-PCR. (A) Specific primers and annealing temperatures employed. (B) RT-PCRs for hBD2, hBD4 and hNP4 were carried out from gingival samples divided in two main groups:
caries-free (1-4) and caries (5-8). The PCR-products were run onto 2% agarose gel electrophoresis. Control reactions without
reverse transcriptase were carried out. PCR was performed in a final volume of 25l containing 1l of the reverse transcription
reaction, 50M of dNTPs, 1.5mM MgCl2, 50mM TrisHCl (pH 8.0), 1 IU Taq polymerase and 0.2M each of sense and antisense
primers. Specific PCR for a constitutively expressed gene (-actin) was carried out as a positive control (data no shown). The
relative amount of product was quantified by densitometric analysis of DNA bands (C). Defensins-mRNA expression levels are
shownnormalized to -actin. Results are mean SEM of three independent experiments.
93
http://www.jhsci.ba
mg/mL (range from 0.79 to 2.89 mg/mL) for all

subjects with evidence of caries (n=56). The salivary
protein concentration showed no correlation with
age, gender, or caries score (data not shown). No
difference in the saliva pH between the groups was
noted (Figure 1A). Considering the pH intervals
analyzed, the buffer capacity showed no difference
between the groups either in the initial interval pH
- 7.0 or pH 7.0-6.0. In the interval pH 6.0-5.0 the
caries-free group showed a higher value than the
control group (P<0.05) (Figure 1B). The peroxidase
activity was reduced for all subjects with evidence of
caries when compared with the control group (P<
0.05) (Figure 1C). Finally, the levels of salivary defensins hBD2, hBD4 and hNP4 were in the g/ml
range (Figure 2A). hBD levels were also normalized
to the protein concentration in whole saliva for each
sample (Figure 2B).
Association between defensins
and caries experience
In order to evaluate the relationship of defensins

levels and caries experience in the population, we
used the Kruskal-Wallis nonparametric test based
on rank as previously reported (11,14). We found
a significant difference in the level of hBD2 and
hBD4 among different caries groups (P < 0.01).
Differences were observed for both the median level of salivary defensins concentration (g/ml) and
salivary defensins relative to salivary protein (g/
mg) (Figs. 2C-2F). On the other hand, there was
not difference in the level of hNP4 among different group (Figs. 2G and 2H). The median salivary
levels of hBD2, hBD4 and hNP4 were 7.26 g/ml,
4.25 g/ml and 4.52 g/ml respectively for the caries group (n=44) and 1.88 /ml (hBD2), 0.86 g/
ml (hBD4) and 3.91 g/ml (hNP4) for all subjects
with no evidence of caries (n=56). The defensins
value relative to total salivary protein was 3.53 g/
mg (hBD2), 2.07 g/mg (hBD4) and 2.22 g/mg
(hNP4) protein in the caries group and 0.96 g/
mg (hBD2), 0.44 g/mg (hBD4) and 1.98 g/mg
(hNP4) protein in the caries-free group (P < 0.01).
hBD2 and hBD4 concentration was positively correlated with caries score (r = 0.7525 and r = 0,7201
respectively), and the correlation is significant at the
0.0001 level (P < 0.0001). No correlation was found
between caries level and hNP4 concentration. Additionally, semi-quantitative RT-PCR was used to de-
FIGURE 4. Defensins values and caries in the population.

The number of subjects with no caries (open bars) compared
to those with caries (filled bars) with hBD2 (A), hBD4 (B) and
hNP4 (C) concentrations (g/ml saliva) in the ranges indicated. Note that an increasing proportion of subjects had caries
as the defensins (hBD2 and hBD4) concentration increased.
hNP4 analysis showed no significant differences among the
population, with the same levels of hNP4 in caries and caries
free group.
termine whether the caries group present an increase

in oral epithelial cell expression of hBD2 and hBD4
mRNA. As shown in Figure 3, in the caries group
there was a significantly higher expression of hBD2
and hBD4 compared with defensin levels in cariesfree group. On the other hand, there was no difference in the expression of alpha defensin 4 (hNP4).
Together, the results demonstrate that hBD2 and
94
http://www.jhsci.ba
carbonate in plasma because there are evidence that

the bicarbonate is the most important buffer system
of the saliva (18). In the same way, as Smith suggests
(19), when the concentrations of bicarbonate of sodium in plasma are high, this excess can be excreted
by the salivary glands, probably by the acinar cells.
On the other hand, Lamanda (20) demonstrated
that salivary buffering between pH 3.4 and 5 was
not based on hydrogencarbonate and dihydrogenphosphate but rather on proteins. However, further
studies have to be undertaken to identify the protein
buffer components in the human salivary proteome.
The presence of the low capacity buffer in caries
group evaluated could be related to high dental caries risk, which might cause modifications in the acid-base physiologic homeostasis, causing a decrease
of the systemic buffer system and so, of the capacity salivary buffer. The peroxidase activity is significantly greater in caries-free adults than in those with
caries. Oral Peroxidase (OPO) is composed of two
peroxidase enzymes, salivary peroxidase (SPO) and
myeloperoxidase (MPO). The SPO secreted from
the major salivary glands, mainly the parotid gland
(21), contributes 80% of OPO activity, while MPO,
produced by leukocytes in inflammatory regions of
the oral cavity (22). Oral peroxidase is an enzyme
with antimicrobial properties, and in the mouth, it
is secreted by salivary glands and catalyzes the oxidation of thiocyanate by hydrogen peroxide to produce
on oxidized form of thiocyanate. The product of the
reaction catalyzed by peroxidase inhibits bacterial
growth (23). In this investigation, the decrease of
peroxidase activity observed in caries group may be
linked to the increase of dental caries risk. Numerous studies have investigated the correlation among
these salivary proteins and caries experience, but no
studies have shown reliable association between a
single salivary component and caries experience.
The expression of defensins in saliva and throughout
the oral cavity suggests that they may have a central
role in protecting tooth structure from dental caries as well as protecting oral mucosa. Several reasons
for this proposal are 1) Defensins have broad antimicrobial activity; 2) they stimulate the acquired
immune system and could function to enhance
IgA production as well as IgG production (24); 3)
these defensins may function to keep overall bacteria in check and to help prevent biofilm formation.
Thus, oral defensins may provide a natural antibi-
hBD4 were upregulated in caries group. To further

examine the relationship of defensins with caries,
the hBD2, hBD4 and hNP4 concentration range
was evaluated in subjects with no caries compared
to those with caries (Figure 4A-C). hBD2 analysis
showed an increasing proportion of subjects had
caries as the defensins concentration increased; 86%
of the subjects with defensins levels lower than 3.0
g/ml (n = 48) had no caries, but only 15% of the
subjects with hBD2 levels greater than 3.0 g/ml (n
= 8) had no caries (Figure 4A). Similar analysis for
hBD4 is shown in Figure 4B. The results showed the
same trend with higher levels of hBD4 in the caries
group than in those with no caries. On the other
hand, hNP4 analysis showed no significant differences among the population with the same levels of
hNP4 in caries and caries free group (Figure 4C).
DISCUSSION
Salivary constituents are potential candidates as biological factors influencing caries risk. Many salivary
protein components, such as glycoprotein, immunoglobulins, agglutinin, lactoferrin, and defensins
are thought to have a role in defense in the oral cavity (15). The salivary protein concentration showed
no correlation with age, gender, or caries score. According to Rudney et al. (16) a high protein concentration in the saliva contributes to greater adherence
of S. mutans, the first resident of dental plaque, however, in this work there was no difference in protein levels between caries and no caries groups. The
mean saliva pH values of the 2 groups were similar.
In literature results are conflicting with respect to
saliva pH. Factors such as collection methods (sites
in the oral cavity), the ages, and diet can influence
results (17). In the range of pH 7.0-6.0 the buffer
capacity of saliva of the two groups was no different. In fact, the range pH 7.0-6.0 constitutes the
most important pH interval related to dental cavity
formation, since in this range two pKs of two buffer
systems are found, namely, the bicarbonate/carbonate system with a pK around 6.1 and the phosphate
buffer system with a pK around 6.8. The presence
of these two buffer systems in this range is the cause
of the higher acid consumption in this pH interval.
However, in the interval pH 6.0-5.0 the caries-free
group showed a higher value than the control group
(P<0.05). It is recommended to continue doing investigations in order to assess the levels of sodium bi95
otic barrier. There are several new findings of this

study. First, hBD2, hBD4 and hNP4 are detectable
in saliva but show extensive variation in concentration between subjects (Figure 2A-B). The concentration of defensins (BD2 and BD4) in unstimulated
saliva of adults has not been previously reported, although healthy adults had a mean value of 0.8 g/
ml for other antimicrobial peptide such as human
defensins-1(25). Second, salivary defensins (hBD2
and hBD4) are significantly greater in caries adults
than in those with caries-free, however there are no
difference in hNP4 levels between groups (Figure
2G-H). Third, the defensins levels found in saliva
in this study are in the range of effective antimicrobial function, especially considering the low salt
concentration in saliva and the synergistic action of
the peptides. Fourth, the correlation of a salivary
cationic defensins with caries experience suggests
the possible protective effect of hBD2 and hBD4.
Conversely, low levels of defensins may result in increased susceptibility to caries. In this work, salivary
defensins concentrations showed large variation between individuals, with a significantly higher level
of salivary defensins in adults with caries. Finally,
this study shows the simultaneous expression of
human hBD2 and hBD4 in caries and caries free
gingival tissue samples detected by semi-quantitative RT-PCR. Previous studies demonstrated the
constitutive expression of hBD2 in oral tissues (26).
Our analysis of gene expression in caries and caries
free group showed differential transcriptional levels
for the defensins. In samples isolated from caries
group, hBD2 and hBD4 expression was at a higher
level than caries-free group. The lower expression
of hBD2 and hBD4 in caries-free group could explain the lower concentration of these antimicrobial
peptides in saliva. The salivary levels of hBD2 and
hBD4 may represent a genetically determined factor that contributes to caries susceptibility. The large
variation in the concentration of defensins in saliva
could be due to previously demonstrated polymorphisms in sequence and copy number in the genes
encoding these peptides (27).
Saliva is an easily available sample which can be collected noninvasively and used to measure and monitor the risk for caries (28). The oral cavity, which
is colonized by numerous microorganisms, contains
a wide selection of antibacterial peptides that play
an important role in maintaining its complex eco-
http://www.jhsci.ba
logical homeostasis. We have shown that adults with

caries have a significantly higher expression and levels of defensins (hBD2 and hBD4) based on both
the RT-PCR and ELISA (Figure 2-3). Future studies could lead to development of means to enhance
endogenous oral peptide expression, utilization of
these peptides as therapeutics, and to a simple test
for clinical evaluation of caries risk.
CONCLUSION
Salivary defensins are potential candidates as biological factors influencing caries response. The higher
expression of defensins in saliva suggests that they
may have a central role in protecting tooth structure
from dental caries as well as protecting oral mucosa
We conclude that high salivary levels and expression
of beta defensins may represent a biological response
of oral tissue to caries. However, these suggestions
deserve further investigation.
CONFLICT OF INTEREST
The authors declare no competing interests.

ACKNOWLEDGMENTS
This work was supported by Laboratorio de Biotecnologia Aplicada. L.B.A. Av. Don Julio Centeno,
San Diego, Venezuela., Apartado 2001. We thank
Girolamo Gonzalez-Barrera and Oriana GonzalezBarrera for their cooperation.
REFERENCES
1. Huang CM. Comparative proteomic analysis of human whole saliva. Arch
Oral Biol 2004;49:951-962.
2. Bardow A, Moe D, Nyvad B, Nauntofte B. The buffer capacity and buffer
systems of human whole saliva measured without loss of CO2. Arch Oral
Biol 2000;45:1-12.
3. Ganz T. Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol 2003;3:710-720.
4. Chen H, Xu Z, Peng L, et al. Recent advances in the research and development of human defensins. Peptides 2006;27:931-940.
5. Brogden KA. Antimicrobial peptides: pore formers or metabolic inhibitors in
bacteria?. Nat Rev Microbiol 2005;3:238-250.
6. Lehrer RI, Barton A, Daher KA, et al. Interaction of human defensins
with Escherichia coli. Mechanism of bactericidal activity. J Clin Invest
1989;84:553-561.
7. Oppenheim FG, Xu T, McMillian FM, et al. Histatins, a novel family of histidine-rich proteins in human parotid secretion. Isolation, characterization,
primary structure, and fungistatic effects on Candida albicans. J Biol Chem
1988;263:7472-7477.
8. Tanida T, Okamoto T, Okamoto A, et al. Decreased excretion of antimicrobial proteins and peptides in saliva of patients with oral candidiasis. J Oral
Pathol Med 2003;32:586-594.
96
http://www.jhsci.ba
9. Hollox EJ, Armour JA, Barber JC. Extensive normal copy number variation of a beta-defensin antimicrobial-gene cluster. Am J Hum Genet
2003;73:591-600.
19. Smith PM. Mechanisms of secretion by salivary glands. En: Edgar WM,
Mullane DM, editors. Saliva and oral health. London: British Dental Association 1996. p.9-25.
10. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal
Biochem 1976;72:248-254.
20. Lamanda A, Cheaib Z, Turgut MD, et al. Protein buffering in model systems
and in whole human saliva. PLoS One 2007;2:e263.
21. Nagler RM, Klein I, Zarzhevsky N, et al. Characterization of the differentiated antioxidant profile of human saliva. Free Radic Biol Med 2002;32:268277.
11. Tao R, Jurevic RJ, Coulton KK, et al. Salivary antimicrobial peptide expression and dental caries experience in children. Antimicrob Agents Chemother 2005;49:3883-3888.
22. Pruitt KM, Kamau DN, Miller K, et al. Quantitative, standardized assays for
determining the concentrations of bovine lactoperoxidase, human salivary
peroxidase, and human myeloperoxidase. Anal Biochem 1990;191:278286.
12. Barrera GJ, Sanchez G, Gonzalez JE. Trefoil factor 3 isolated from human
breast milk downregulates cytokines (IL8 and IL6) and promotes human
beta defensin (hBD2 and hBD4) expression in intestinal epithelial cells HT29. Bosn J Basic Med Sci 2012;12(4):256-264.
23. Tenovuo J, Larjava H. The protective effect of peroxidase and thiocyanate against hydrogen peroxide toxicity assessed by the uptake of [3H]thymidine by human gingival fibroblasts cultured in vitro. Arch Oral Biol
1984;29:445-451.
13. Barrera GJ, Sanchez G, Gonzalez JE. Trefoil factor 3 (TFF3) expression is
regulated by insulin and glucose. Journal of Health Sciences. 2013;3(1):112
14. Dale BA, Tao R, Kimball JR, et al. Oral antimicrobial peptides and biological
control of caries. BMC Oral Health 2006; 6 Suppl 1:S13.
24. Yang D, Biragyn A, Hoover DM, et al. Multiple roles of antimicrobial defensins, cathelicidins, and eosinophil-derived neurotoxin in host defense.
Annu Rev Immunol 2004;22:181-215.
15. Amerongen AV, Veerman EC. Saliva-the defender of the oral cavity. Oral
Dis 2002;8:12-22.
25. Mizukawa N, Sugiyama K, Ueno T, et al. Levels of human defensin-1, an

antimicrobial peptide, in saliva of patients with oral inflammation. Oral Surg
Oral Med Oral Pathol Oral Radiol Endod 1999;87:539-543.
16. Rudney JD, Hicckey KL, Ji Z. Cumulative correlations of lysozyme, lactoferrin, peroxidase, S-IgA, amylase, and total protein concentration with
adherence of oral viridans streptococci to microplates coated with human
saliva. J Dent Res 1999;78:759-768.
26. Dommisch H, Ail Y, Dunsche A, et al. Differential gene expression of human beta-defensins (hBD-1, -2, -3) in inflammatory gingival diseases. Oral
Microbiol Immunol 2005;20:186-190.
17. Aframian DJ, Davidowitz T, Benoliel R. The distribution of oral mucosal pH

values in healthy saliva secretors. Oral Dis 2006;12:420-423.
27. Hollox EJ, Armour JA, Barber JC. Extensive normal copy number variation of a beta-defensin antimicrobial-gene cluster. Am J Hum Genet
2003;73:591-600.
18. Counotte GH, van't Klooster AT, van der Kuilen J, et al. An analysis of the
buffer system in the rumen of dairy cattle. J Anim Sci 1979;49:1536-1544.
28. Samaranayake L. Saliva as a diagnostic fluid. Int Dent J 2007;57:295-299.
97
Adnan Babovi et al. Journal of Health Sciences 2013;3(2):98-102
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Abnormal colposcopic images in patients with preinvasive cervical lesions

Adnan Babovi*, Denita Ljuca, Gordana Bogdanovi, Lejla Muminhodi
Department of Gynecology and Obstetrics, University Clinical Center Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina
ABSTRACT
Introduction: The objective of the study was to determine frequency and to compare frequency of the
abnormal colposcopic images in patients with low and high grade pre-invasive lesions of cervix.
Methods: Study includes 259 patients, whom colposcopic and cytological examination of cervix was
done. The experimental group of patients consisted of patents with pre-invasive low grade squamous
intraepithelial lesion (LSIL) and high grade squamous intraepithelial lesion (HSIL), and the control group
consisted of patients without cervical intraepithelial neoplasia (CIN).
Results: In comparison to the total number of satisfactory findings (N=259), pathological findings were
registered in N=113 (43.6 %) and abnormal colposcopic findings in N=128 (49.4%). The study did not
include patients with unsatisfactory finding N=22 (8.5%). Abnormal colposcopic image is present most
frequently in older patients but there are no statistically important difference between age categories
(Pearson Chi-Square 0.47, df -3, p=0.923). Frequency of abnormal colposcopic findings (N=128) is the
biggest in pathological cytological (N=113) and HSIL 58 (45.3%), LSIL 36 (28.1%). There is statistically
significant difference in frequency of abnormal colposcopic images in patients with low-grade in comparison to patients with high-grade pre-invasive cervix lesions (Chi-Square test, Pearson Chi-Square 117.14,
df-12 p<0.0001).
Conclusion: Thanks to characteristic colposcopic images, abnormal epithelium is successfully recognized,
but the severity grade of intraepithelial lesion cannot be determined.
Keywords: Abnormal colposcopic images, pre-invasive cervix lesion.
INTRODUCTION
Organized screening programs protect against cervical cancer by identifying women with abnormal
cytological findings for further review by colposcopy
*Corresponding author: Babovi Adnan, Department of
Gynecology and Obstetrics University Clinical Center Tuzla,
Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina
Phone: +3861280334; Fax: +38735303402
Email address: babovic.adi@gmail.com
and cervical biopsy, and possibly surgical removal of

histological verified cervical intraepithelial neoplasia (CIN), a higher grade, as a precursor of cervical
cancer (1).
Cervical intraepithelial neoplasia (CIN), are the
changes limited to the epithelium, which means that
there is no invasion of the stroma, basal membrane
is preserved, and there is a lack of infiltration (2, 3).
Thanks to the simplicity and reliability of the Pap
test screening cervical cancer can be detected in the

2013 Adnan Babovi et al.; licensee University of Sarajevo - Faculty of Health Studies. This
is an Open Access article distributed under the terms of the Creative Commons Attribution
http://www.jhsci.ba
Statistical analysis was performed by application

software Statistical Package for Social Sciences for
Windows, version 18.0 PASW-SPSS Inc., Chicago,
IL, USA. Categorical variables will be presented as
frequencies and percentages. Continuous variables
will be presented as mean with standard deviation or
medians with interquartile ranges, depending on the
distribution of data. Normality of distribution and
homogeneity of variance was checked by adequate
tests. Testing for differences in the distribution of
cruciate qualitative variables (independent distribution) will be expressed by chi square test. Level of
significance 'p <0.05 was employed.
preclinical stage of CIN / SIL (cervical / squamous

intraepithelial neoplasia), when a cure is possible by
locally destructive or excision methods. In most EU
countries, cytological screening begins at the age of
20 and 25 years, and exceptionally 15 or 30 years,
and the interval between two cytological analyses, in
the case of regular findings, is usually 3 years, rarely
1 or 5 years (4).
Colposcopy is easy to perform diagnostic method
that is not followed by any complications and
provides plenty of elements for triage diagnosis of
abnormal cytological smears during routine gynecological examinations of vulnerable female population (5).
This method provides a reliable estimate of the localization and extent of the pathological epithelial lesions, and the possible target biopsy of the suspected
area. The accuracy of this method lies between 6085%, and in combination with cytology 98-99%.
The incidence of false-positive findings is estimated
at 7% and a false-negative diagnosis in 13%. Colposcopy is, therefore, an excellent diagnostic complement to cytology (6).
The aim was to determine the frequency and compare the frequency of abnormal colposcopy images
in patients with low and high grade pre-invasive cervical lesions.
RESULTS
The analysis included patients (N = 259), of different

age groups, which were taken smears for cytological
analysis, then they underwent colposcopic examination. Abnormal colposcopic findings were found in
128 (49.4%) patients, abnormal cytological findings
in 113 cases (43.6%), normal colposcopic findings
in 131 (50.6%), normal cytological findings in 104
(40.2%), inflammation in 42 (16.2%). By age categories the analysis included 4 (1.5%) patients in
the group <25 years, 53 (20.5%), in the category of
25-34 years, 82 (31.7%) category 35-45 years and
group > = 45 years 120 (46.3%) patients (Figure 1).
The age distribution histogram shows the normal
age distribution in the sample with Mean -43.27
and SD-10.16. The youngest analyzed patient was
21 years old and the oldest 78 years (Figure 2).
Abnormal colposcopic image is seen most frequently
in elderly patients, but there is no significant differ-
METHODS
In this retrospective-prospective study 259 patients

were analyzed in 2007 and 2011. All the patients underwent colposcopy and cervical cytology examinations. The experimental group consisted of (N=113)
patients with pre-invasive cervical lesions classified
by Bethesda classification, while the control group
consisted of the patients with the same demographic
characteristics but with cytological findings with no
signs of intraepithelial lesion (N=146). Colposcopic
images were analyzed in both groups, and obtained
colposcopic findings were duly recorded. Experimental group with preinvasive lesions was divided
into two sub-groups (N=51) with low-grade squamous intraepithelial lesions (LG-SIL), and (N=62),
patients with high-grade squamous intraepithelial
lesions (HG SIL). The patients with unsatisfactory
cytological and colposcopic findings, as well as those
patients having findings indicating an invasive carcinoma were excluded from the study.
FIGURE 1. Age groups in the sample. By age categories the

analysis included 4 (1.5%) patients in the group <25 years, 53
(20.5%), in the category of 25-34 years, 82 (31.7%) category
35-45 years and group > = 45 years 120 (46.3%) patients.
99
http://www.jhsci.ba
FIGURE 2. The age distribution histogram. The age distribution histogram shows the normal age distribution in the sample with Mean -43.27 and SD-10.16. The youngest analyzed
patient was 21 years old and the oldest 78 years.
FIGURE 3. Colposcopic findings. Abnormal colposcopic image is seen most frequently in elderly patients, but there is no
significant differences by age groups (Pearson Chi-Square,
0.47 df-3,(p=0.923), Kendalls tau -0.23)
ences by age groups (Pearson Chi-Syuare 0.47NS)

(Figure 3).
According to the cytological finding 104 (40.40%)
patients had normal findings, 42 (16.2%) patients
had inflammation, 51 (19.7%) patients had squamous intraepithelial lesion low-grade LSIL, 62
(23.9%) patients had a squamous intraepithelial
lesion high-grade HSIL (Figure 4). There is a significant difference in the distribution of colposcopic
images by cytological findings. Most abnormal colposcopy findings are in category of cytological findings HSIL and LSIL (Figure 6).
When the colposcopic image was regular, there were
mostly normal colposcopic images, and cytological

and pathological findings were mostly related to inflammation, to a lesser extent LSIL and HSIL (Figure 7,8).
DISCUSSION
There were unsatisfactory colposcopic findings n=22

(8.5%), in 75% of cases it was the age group >= 45
years (N = 16), which is consistent with the works of
other authors (7), and explains the ambiguous SCJ
mucosal atrophy.
Analyzing the histogram of age distribution the
youngest patient was 21 and the oldest 78, and the
average age of patients who entered the
study was 43 years which is certainly
too late for optimal screening, as recommended by the Europe Code Against
Cancer.
Analyzing frequency of dysplasia changes in relation to different age groups
it is concluded that the incidence of
dysplasia in the age group 25-34 years
(47.1%), age group 35-45 years (42.5%),
age group >=45 years (43.9%), which to
some extent agrees with the data of epidemiological studies according to which
incidence of CIN decreases with increasing age (8).
FIGURE 4. Graphical presentation of cytological findings by Bethesda
classification. According to the cytological finding 104 (40.40%) patients
Percentage of pre-invasive abnormal cyhad normal findings, inflammation had 42 (16.2%) patients, squamous intological findings of cervix is highest in
traepithelial intraepithelial lesion low-grade LSIL had 51 (19.7%) patients, a
the younger age group (30-34 years), it
squamous intraepithelial lesion high-grade HSIL had 62 (23.9%) patients.
100
http://www.jhsci.ba
FIGURE 6. There is a significant difference in the distribution of colposcopic images by cytological findings. Most abnormal colposcopy findings are
in category of cytological findings HSIL and LSIL (Pearson Chi-Square,
97.98, df-3, (p<000.1), Kendalls tau 0.54).
FIGURE 7. Citlogical finding. Abnormal colposcopic image
decreases with increasing age when there

is growing frequency of invasive cancer
(65-74 years) (9).
Analyzing the severity of cytological lesions, of the total number of abnormal
cytological findings of cervix N = 113,
the largest number of patients had the
least severe dysplasia, which corresponds
to other studies, such as the six-year retrospective study conducted in Croatia,
which included 59,901 taken cervix cytological smear (10).
Out of the total analyzed findings (N
= 259), abnormal colposcopy findings
found in 128 (49.4%) patients, abnormal cervix cytological findings in 113
cases (43.6%), normal colposcopic findings in 131 (50.5%), normal cervix cytological findings in 104 (40.1%), which
indicates good correlation of colposcopic and cytological findings.
Abnormal colposcopy findings (N =
128) correlated with pathologic cytological finding of N = 94 (73.4%) and HSIL
58 (45.3%), LSIL 36 (28.1%). Abnormal colposcopic images are most often
related to the present abnormal cytological HSIL and LSIL.
Our study cannot assess the diagnostic
accuracy of cytology and colposcopy, because it is lacking histological confirmation of the lesion, as it is conducted in a
study that examined the diagnostic accuracy of cytology, colposcopy and biopsy
on 151 patients, when it was concluded
that correct evaluation of severity of lesion requires a combination of diagnostic methods (11).
CONCLUSION
FIGURE 8. Citological findings. Normal colposcopic image. When the

colposcopic image was regular, there were mostly normal colposcopic
images, and cytological and pathological findings were mostly related to
inflammation, to a lesser extent LSIL and HSIL.
101
Thanks to characteristic colposcopic images abnormal epithelium is successfully

detected, and a colposcopy may be used
in secondary screening in the control
programme of cervical cancer. Only on
the basis colposcopic images one cannot
determine severity of intraepithelial lesion.
http://www.jhsci.ba
6. Seshadri L, Jairaj P, Krishnaswami H.Colposcopy in diagnosis cervical neoplasi .Indian J Cancer 1990;27(3):180-6.
The authors declare no conflict of interest.
7. Stafl A, Mattingly RF, Colposcopic diagnosis of cervical neoplasia. Obstet

Gynecol 1973; 41:168-176.
REFERENCES
1. Elfgren K, Jacobs M, Walboomers JM, Meijer CJ, Dillner J. Rate of human
papillomavirus clearance after treatment of cervical intraepithelial neoplasia. Obstet Gynecol 2002;100:965-971
2. Pavlovi S . Trofine i proliferativne promene genitalnih organa. U: ivi R
(urednik). Osnovi eksfolijativne citologije. Naa re, 1970; Leskovac.
3. Anderson B .Cytopathology. Pathology. Academic Press 1996; New York
4. Audy-Jurkovi S. Ginekoloka citologija. U: imuni V i sur. Ginekologija.
Zagreb: Naklada Ljevak; 2001, str. 1519.
5. Hatch K. Handbook of Colposcopy. Diagnosis and Tretman of Lowr Genital
Tract Neoplasia and HPV Infections. Little Brown and Company, Boston,
1989.
102
8. Wright TC, Kurman RJ, Ferenczy A. precancerous Lesions of the Cervix.

In: Blaustein Pathology of the femal Genital Tract, 4th edition, Kurman RJ
(ed), Springer-Verlag, 1995
9. erman A, Eljuga D, Strnad M, Chylak V. Pojavnost i mortalitet od raka
vrata maternice u Hrvatskoj: Prijedlog primarne i sekundarne prevencije.
Gynaecol Perinatol 2001.
10. Kos M, Sarkanj-Golub R, upi H, Balievi D. The correlation of inflammation and epithelial changes in the Pap smears of cervix uteri. Acta Med
Croat2005;59(4):297302
11. Matsuura Y, Kawagoe T, Toki N, Sugihara K, Kashimura M. Early cervical
neoplasia confirmed by conisation: diagnostic accuracy of cytology, colposcopy and punch biopsy. Acta Cytol 1996;40:2416.
http://www.jhsci.ba
Aldvin Torlakovi et al. Journal of Health Sciences 2013;3(2):103-108

RESEARCH ARTICLE
Open Access
Effects of the combined swimming, corrective and

aqua gymnastics programme on body posture of
preschool age children
Aldvin Torlakovi1*, Mirsad Mufti2, Dijana Avdi2, Roman Kebata1
1
Olympic Swimming Pool Centre Sarajevo. Bulevar M. Selimovic 83b, Sarajevo, Bosnia and Herzegovina. 2Faculty of Health
Studies, University of Sarajevo, Bolnicka 25, Sarajevo, Bosnia and Herzegovina
ABSTRACT
Introduction: This research paper is aimed at identifying the possible effects that the implementation of
the combined kinesiological programs of swimming and hydro-kinesiological therapy may have on the
body posture in preschool children.
Methods: The survey was conducted on a sample of 50 boys selected from a number of Sarajevo kindergartens, in the age group of 5.20.6 yrs.; mean height=1147 cm; mean weight= 21.84.7 kg. In order
to evaluate the postural status, we used a reduced Napoleon Wolanski method. The activities were carried
out within the period of 16 weeks, twice a week for 60 minutes.
Results: The analysis of the initial and final series of testing with t-test indicates a high level of statistical
significance in the variables of shoulder posture assessment, shoulder blade posture assessment, spinal
cord posture assessment, leg posture assessment, feet posture assessment, overall body posture assessment according to Wolanski, whereas somewhat lower level of statistical significance was found in the
variables of abdominal posture assessment and chest posture assessment. A relatively low level of statistical significance is observed only in the variable of head posture assessment.
Conclusion: It can be concluded that a combined program of corrective gymnastics with games and
exercises in water had significant effects on improving the muscle tone in the respondents, which in turn
had a direct impact on improving their body posture, both in terms of all of the individually surveyed body
parts and in overall terms.
Keywords: Body posture, children's, swimming, corrective gymnastics, Hydro-gymnastics
INTRODUCTION
Movement and various sport activities of largely

comprehensive affect anthropological status of man
*Corresponding author: Aldvin Torlakovic
Olympic Swimming Pool Centre
Bulevar M. Selimovic 83b, 71000 Sarajevo, Bosnia and Herzegovina
Phone:+38761159200; Fax:+ 38733773874
e-mail: aldvint@gmail.com
Submitted 10 April 2013 / Accepted 6 June 2013
and the quality of his life (1). The complex functional transformation of a developing child does not
occur regularly and equally in all of the different
body parts, but it does according to a specific rhythmic flow, which is marked by the so-called development crisis (2). The regular growth and development
in children plays an important role as a foundation
for maintaining their psycho-physical health. Due
to the plasticity and sensitivity of the childs organ-
2013 Aldvin Torlakovi et al.; licensee University of Sarajevo - Faculty of Health Studies.
ism, the process of forming a correct posture is of

particular importance in both the preschool period
of development and the first years of schooling (3).
The fact is that the correct postural position takes
an ever decreasing presence in the children's daily
activities. Improper sitting postures, different kinds
of motion activities and certain endogenous factors
all have a systematic impact on the spinal cord, thus
causing such levels of strain and pressure that often
exceed the zone of tolerance in the soft spinal tissues.
Even though in such situations there are no major
resulting defects, the cumulative effect as a result of
a series of repeating and long-lasting positions and
motions is that the tissues go through certain visible changes. The findings of some research efforts
undertaken thus far lead to the conclusion that the
bad posture in the preschool and early school age
children is actually an indicator of specific health
problems, and these problems can become extremely serious if the bad posture is not corrected in due
time (4). In the age between 5 and 10, when the
growth becomes slower, the postural problems show
somewhat lower rate of incidence, whereas with the
onset of puberty, an increased emergence of abruptly deteriorating postural conditions and a detection
of new cases can be widely anticipated. Therefore, it
is highly important to detect the postural problems
at an early stage and keep them under the strict kinesiological control (5). As it is widely known, body
posture consists of a set automatically regulated
mechanisms activated by a neuromuscular system so
that the body could resist (defy) the force of gravity.
The best posture is the one that provides for maximum energy savings, maximum comfort, maximum
performance while guaranteeing ideal relationships
between the various parts of the body (6). To put it
in simple terms, the posture of the body involves
proper alignment of the body segments and their
balance, which is achieved by providing a minimal
input of power with maximum mechanical efficiency (7). One should bear in mind that among a
number of diverse physical activities, it is undoubtedly the child play that has an extremely important
place in every child's life. Such types of motion activities greatly contribute to the mental and physical
development of the child, the improvement of his or
her psychomotor skills, and consequently to the improvement of their muscle tone, which in turn plays
an important role in enabling the child to adopt
http://www.jhsci.ba
and maintain the proper posture. This research paper is aimed at identifying the possible effects that
the implementation of the combined kinesiological
programs of swimming and hydro-kinesiological
therapy may have on the body posture in preschool
children.
METHODS
Respondents Sample
The survey was conducted on a sample of 50 boys

(medical assessment - boys with poor muscle tone)
from a number of Sarajevo kindergartens, in the
age group of 5.20.6 yrs.; mean height=1147 cm;
mean weight= 21.84.7 kg. The final data processing of the research results captured the children who
participated in the initial and final measurements
and regularly attended the planned programme of
combined kinesiological activities (all respondents
have undergone complete treatment).
Sample of Variables
In order to evaluate the postural status (Table 1),

we used a reduced Napoleon Wolanski method (8).
As part of that evaluation, we used 9 variables for
the observed body parts: head posture assessment
(HPA), shoulder posture assessment (SPA), shoulder blade posture assessment (SBPA), chest posture
assessment (CPA), spinal cord posture assessment
(SCPA), abdominal posture assessment (APA), leg
posture assessment (LPA), feet posture assessment
(FPA) and the overall body posture basement according to Wolanski (OBPAW).
104
TABLE 1. Sample of Variables

Variable
HPA
SPA
SBPA
CPA
SCPA
APA
LPA
FPA
OBPAW
Measured capacity
Head Posture Assessment
Shoulder Posture Assessment
Shoulder Blade Posture Assessment
Chest Posture Assessment
Spinal Cord Posture Assessment
Abdominal Posture Assessment
Leg Posture Assessment
Feet Posture Assessment
Overall Body Posture Assessment by Wolanski
method
http://www.jhsci.ba
TABLE 2. Posture Assessment according to the Negative

Score Model - Wolanski
Scores
0
1
2
TABLE 3. Defining the posture status according to Wolanski

Scores
0
1-4
5-8
9-12
13-16
Degree of deviation from proper posture

No deviation
Partial deviation
Extreme deviation
Grade
5
4
3
2
1
Description
Excellent body posture
Very good body posture
Good body posture
Bad body posture
Very bad body posture
TABLE 4. Implementation of the programme contents by week

Program/Week
Swimming games & exercises
Corrective dryland (out-of-pool)
workouts & exercises
Hydro-gymnastics
Pilates balance ball exercises
3
*
4
*
5
*
6
*
7
*
8
*
*
*
*
*
*
The diagnosing of the body posture status has been

carried out by scoring the deviations that occurred
in the particular body parts compared with the normal (proper) posture. The scoring has been made by
the method of Wolanski - expert evaluation (Table
2). On the basis of the total scores, we have determined the assessment values (grades) for the particular observed body parts, and also an overall grade for
the overall body posture (Table 3).
10
*
11
*
*
*
*
12
*
13
*
*
*
*
14
*
15
*
*
*
*
16
*
*
*
*
20-25 minutes of aerobic water exercises (swimming

games and exercises with hydro-gimnastics) and
5-10 minutes of relaxation and body-calming. During each class, the Introductory-Preparatory and the
Main A stages were performed on dryland outside
the pool, whereas the Main B Stage and the Final
Stage were performed in water.
Statistical analisys
For the analysis of the outcomes of the initial and

final series of testing we used a T-test for dependent
samples, i.e. Paired Samples Test (where differences
are regarded as significant at p < .05).
Exercise Program
A combined program of exercises was undertaken

in the Olympic Swimming Pool Centre Sarajevo in
the afternoon hours. The activities were carried out
within the period of 16 weeks, twice a week for 60
minutes (Table 4). The program of corrective gymnastics, workouts and exercises with Pilates balance
balls was carried out in a sports hall covered with
adequate floor-padding. Hydro-gymnastics exercises and basic swimming games and exercises were
performed in a pool with the multifaceted gradually
sloping floor, whose depth was 40-90 cm. During
the implementation of the swimming and hydrogymnastics programmes, the water temperature was
29.4C on average. The exercises were performed in
groups of 15 respondents under the expert guidance
of a Graduate Physiotherapist and a Professor of
Sports and Physical Education.
Each class of workouts and exercises consisted of
four stages. Warm-up exercises for 5-10 minutes,
aerobic dryland exercises for 20-25 minutes, then
9
*
RESULTS
The Analysis of the initial and final series of testing with T-test (Table 5) indicates a high level of
statistical significance in the variables of shoulder
posture assessment (SPA p=.000), shoulder blade
posture assessment (SBPA p=.000), spinal cord posture assessment (SCPA p=.000), leg posture assessment (LPA p=.000), feet posture assessment (FPA
p=.000), overall body posture assessment according
to Wolanski (OBPAW p=.000), whereas somewhat
lower level of statistical significance was found in
the variables of abdominal posture assessment (APA
p=.004) and chest posture assessment (CPA p=.013).
A relatively low level of statistical significance is observed only in the variable of head posture assessment (HPA p=.083).
105
http://www.jhsci.ba
TABLE 5. Results of T-test for dependent samples (Paired Samples Test) in assessing postures and awarding body posture
grades
Mean
HPA1
HPA2
SPA1
SPA2
SBPA1
SBPA2
CPA1
CPA2
SCPA1
SCPA2
APA1
APA2
LPA1
LPA2
FPA1
FPA2
OBPAW1
OBPAW2
Paired Samples Test

Paired Differences
95% Confidence Interval of
the Difference
Std. Deviation Std. Error Mean
Lower
Upper
df
.060
.240
.034
-.008
.128
1.769
49
.083
.920
.133
.030
.890
1.011
30.000
49
.000*
.980
.141
.020
.940
1.020
49.000
49
.000*
.120
.328
.046
.027
.213
2.585
49
.013*
1.040
.283
.040
.960
1.120
26.000
49
.000*
.160
.370
.052
.055
.265
3.055
49
.004*
.340
.479
.068
.204
.476
5.024
49
.000*
.600
.495
.070
.459
.741
8.573
49
.000*
-1.340
.479
.068
-1.476
-1.204
-19.801
49
.000*
A somewhat lower level of statistical significance

with regard to the variable of abdominal posture
assessment (APA) and the variable of chest posture
assessment (CPA) is most likely an outcome of a
weaker impact of the program on the abdominal
and chest muscle system, which indicates that the
program was implemented for a too short period
of time to be capable of triggering any significant
transformation of these posture segments, which is
FIGURE 1. Comparison between the overall initial and final

assessments of body posture (Wolonski method). OBPAW,
Overall Body Posture Assessment by Wolanski method.
perhaps also suggestive of a need to include additional exercises and workouts in the program that
would deal specifically with these body parts alone.
Generally speaking, there has been a decrease of the
standard deviation in almost all variables in both the
partial and the integral defining of the posture status,
which had a direct impact on the overall body posture assessment (Figure 1).
The low level of statistical significance with regard to
the variable of head posture assessment (HPA) is a
result of a very small deviation from the standard value in this test observed at the initial testing in most
of the respondents. Thus the implemented program
was not capable of making any significant corrections in this regard either. The rates of statistical significance point to the fact that there are significant
differences in almost all variables when it comes to
the initial and final series of testing. Accordingly, the
program of combined kinesiological activities conducted on the treated sample of respondents proved
to be an efficient transformational process for most
of the variables included in the survey.
106
http://www.jhsci.ba
DISCUSSSION
The body posture is the main precondition for good

health, normal growth and development in general. It is quite important that the elimination and
prevention activities are initiated as early as possible and with the youngest age categories possible.
The combined physical training programmes that
include strength and muscle stretching exercises,
particularly with regard to the postural antigravity
muscles, should help in the prevention of health
problems that could occur later in life, since incorrect or improper posture constitutes the basis for
further deterioration of health. As is widely known
from practice, in the kinesics-therapy of children
with defective body posture, as well as in the therapeutic treatments and procedures in general, there
is a very important role of the actions designed in
order to achieve a full degree of control over the
applied motion treatments. It is also important to
stress the crucial role of a timely detection of deviations from proper body posture, which is definitely
the starting point for the success in correcting the
resulting postural changes. An early diagnosis is regarded as the most important element of a successful treatment. In order to identify the moment of
occurrence of a postural disorder, regardless of the
cause of its occurrence, this problem has to be examined from the very moment of inclusion of children
into a new environment or kindergarten. Thereafter,
selection of the adequate kinesics-therapeutic programs in this case through the application of the
hydro-kinesis therapy and swimming, through hard
and concerted work of physical education teachers,
medical doctors, parents and children can result
in the desired levels of success in correcting a bad
posture. The most important role in forming and
maintaining a proper posture is played by muscles
as an active part of the movement apparatus. The
weakness of certain muscle groups and their excessive and unilateral strain can cause the occurrence
of a number of various disorders in the spinal cord,
chest, upper and lower extremities, and particularly
in the foot. The therapy that focuses on correcting
the postural disorders and deformities in children
is often difficult, strenuous, painful, discouraging and uninteresting for children. On the other
hand, the physical training programs that include
strength exercises and muscle stretching, specifically of the group of postural antigravity muscles,
107
should help in the prevention of health problems

that may occur later in life. The outcomes of this
research clearly show that all respondents have absolutely improved in terms of the grades awarded
from their body posture assessment. Similar conclusions were also reached by other authors who believe
that it is possible to improve the body posture to a
considerable extent by implementing adequate motion/movement programs (9-13). In order to make
higher quality changes of a muscle-ligament apparatus in the preschool and early school age children in
whom certain deviations from the correct posture
have been identified (e.g. kyphotic, scoliotic or lordotic posture), it would be necessary to organize
specialised additional programs of corrective gymnastics that would be performed under the control
of physical education teachers and physiotherapists,
in a specially designated and specialized facilities
covered with adequate floor-padding, and equipped
with appropriate devices and equipment.
CONCLUSION
It can be concluded that a combined program of corrective gymnastics with games and exercises in water had significant effects on improving the muscle
tone in the respondents, which in turn had a direct
impact on improving their body posture, both in
terms of all of the individually surveyed body parts
and in overall terms. The results of this research also
provide an opportunity of their comparing with the
effects of other research projects and programs that
set the same or similar objectives. Also, this research
needs to initiate further activities associated with
undertaking closer studies examining the treated
subject matters, all aimed at enabling a timely diagnosis and control of the said disorders and their
curbing through the focused exposure to a number
of efficiently programmed corrective exercises and
workouts.
REFERENCES
1. Rowland TW. Developmental aspects of physiological function relating to
aerobic exercise in children. Journal of Sports Medicine 1990;10(4):255-66
2. Kosinac Z. Igra u funkciji poticaja uspravnog stava i ravnotee u djece razvojne dobi. ivot i kola, 2009; 22(2):11-22
3. Sabo E. Posturalni status dece predkolskog uzrasta na teritoriji AP Vojvodine. Journal of the Anthropological Society of Serbia 2006;40:97-100.
4. Miloevi Z, Obradovi B. Postularni satus dece novosadskih predkolskih
ustanova uzrasta 7 godina. Journal of the Anthropological Society of Serbia. 2008;43:301-309
http://www.jhsci.ba
5. Auxter D, Pyfer J, Huettig C. Principles and Methods of Adapted Physical Education and recreation. Appendix a: Posture and Body Mechanics,
WCB/Mc Graw-Hill, 517-558
10. Popovi I, Milenkovi S. Efekti korektivnog vjebanja na korekciju postularnih poremeaja na kimenom stubu u sagitalnoj ravni. Zbornik radova, 5.
Evropski kongres FIEP-a. 125-135
6. Marchese A, Di Fillipo G, Caruso I, Celestini M. Relazioni tra sistema

posturale, scoliosi e rilievi morfoantropometrici. Journal La Riabilitazione
1999;32 (4):177-84.
11. Torlakovi A, Simiki I, Mufti M. The effects of the combined exercise in

water and on land on body posture of preschool children. 17th Congress of
ECSS 2012, Bruges, Belgium;17:314
7. Garrison L, Read AK. Fitness for every body. Palo Alto: Calif. Mayfield Publishing. 1999.
12. Mufti M, Sari S, Miokovi M, Torlakovi A. Efekti kombinovanog programa vjebi u vodi i korektivnih vjebi na poboljanje posture djece
predkolske dobi. Zbornik radova 4. Kongresa fizijatara Bosne i Hercegovine sa meunarodnim ueem. Banja Luka. 2012.
8. Wolansky N. Tjelesni rast i razvoj s praenjem dranja tijela. Prirunik za

nastavnike, Varava, 1975.
13. Getz M, Hutzler Y, Vermeer A. The relationship between aquatic independence and gross motor function in children with neuro-motor impairments.
Journal Adapted Physical Activity Quarterly 2006;23:339-355.
9. Turkovi S. Mufti M, Tabakovi M, Balta S. Efekti tromjesenog

kineziolokog tretmana u vodi na poboljanje dranja tijela kod djece od
11-14 godina starosti. Zbornik naunih i strunih radova. Sarajevo: NTS;
2005. 419-424 p.
108
http://www.jhsci.ba
Haris olakovi, Dijana Avdi Journal of Health Sciences 2013;3(2):109-112

RESEARCH ARTICLE
Open Access
Effects of neural mobilization on pain, straight leg

raise test and disability in patients with radicular
low back pain
Haris olakovi*, Dijana Avdi
Faculty of Health Studies, University of Sarajevo, Bolnika 25, 71000 Sarajevo, Bosnia and Herzegovina
ABSTRACT
Introduction: Radicular low back pain is a disorder involving the dysfunction of the lumbosacral nerve
roots. Clinical rehabilitation approaches for low back pain include kinesiotherapy, and physical therapy
procedures: ice , rest , heat, ultrasound, TENS, but evidences regarding their effectiveness are lacking. The
purpose of this study was to determine if nerve mobilization brings better improvements in pain, SLR test
and functional disability in patients with radicular low back pain compared to standard physical therapy.
Methods: The study was conducted on a 60 patients with Radicular low back pain, treated in Regional
medical center "Dr Safet Muji", Mostar, during the period from 01.04.2010 untill 31.04.2011. Patients
were divided into two groups. First group (n=30) received a 4-week rehabilitation program including neural mobilization and lumbar stabilization program. Second group (n=30) received a 4-week rehabilitation
program including active range of motion (ROM) exercises and lumbar stabilization program.
Results: At the beginning, the two groups were not significantly different in terms of score or SLR. After therapy there was statistically significant improvement between groups in both VAS scores[Group A:
1.161.5; Group B: 2.252.2] and SLR [Group A: 80.917.4; Group B: 65.916.4]. ]. After the treatment,
in group A, 46.6% (14) participants had been rated with 4, but in Group B: 33.3% (10) participants had
been rated with 3.
Conclusions: Patients treated with neural mobilization and lumbar stabilization showed better VAS scores
and Straight Leg Test scores compared to patients treated with active range of motion exercises and lumbar stabilization. Further research to investigate their long term efficacy is warranted, with emphasis on
greater number of participants.
Keywords: Radicular low back pain, Neural mobilization, SLR test.
INTRODUCTION
Low back pain (LBP) is normally of medically harmless character and most episodes (about 80%) end
*Corresponding author: Haris olakovi; Faculty of Health
Studies, University of Sarajevo, Bolnika 25, 71000 Sarajevo
Phone:+38761385090;
E-mail: hariscolakovic@gmail.com
Submitted 15 August 2013 / Accepted 8 September 2013
within the first month. As a subgroup, radicular low

back pain is a disorder involving the dysfunction of
the lumbosacral nerve roots, with typical symptoms:
radiating pain, often with numbness, paraesthesia,
and/or muscle weakness (1). Today, back pain is a
common problem and a recent systematic review
concludes that low back pain continues to be a common problem at global level. With ageing popula-
2013 Haris olakovi, Dijana Avdi; licensee University of Sarajevo - Faculty of Health Studies. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
tion, the absolute number of people with LBP is

likely to increase over the coming decades. According to the same review, the mean point prevalence
was 18%, the one year prevalence was 38% and the
mean lifetime prevalence was 39% (2). The annual
prevalence in the general population, described as
low back pain with leg pain traveling below the knee,
varied from 9.9% to 25%.
LBP can have a biomechanical origin with nociception generating the pain. Various spinal structures
such as paravertebral muscles, ligaments, facet joints,
annulus fibrosus and spinal nerve roots have been
suggested as the cause of pain. Other pain sources
are disc herniation and spinal stenosis. It has been
suggested that if nociceptive input continues over
time it may result in functional, chemical and structural alterations in peripheral systems and at various
levels within the central nervous system (3).
Clinical examination aims to clarify whether there is
mechanical impingement of a nerve root. The most
common clinical diagnostic tests are the Straight leg
raise test (SLR), and tests for tendon reflexes, motor
weakness, and sensory deficits (4).
A number of physical therapy interventions are used
in the treatment of people with LBP (5). Treatment
for LBP has been the subject of debate among clinicians and researchers. Studies evaluating the effectiveness of physical therapy interventions still
remain sparse. Conservative treatment for LBP
typically includes physical modalities (TENS, Ultrasound, Cryiotherapy, Heat), kinesiotherapy (ROM
exercises, strengthening) (6).
Neuromobilization is a set of techniques designed to
restore plasticity of the nervous system, defined as
the ability of nerve-surrounding structures to shift
in relation to other such structures (7).
Neural mobilization was described by Maitland in
1985, Elvey in 1986 and Butler refined it in 1991
as an adjunct to assessment and treatment of neural
pain syndromes including radicular low back pain.
The goal of mobilization is to increase the flexibility
of collagen that maintains the integrity of the nerve
and movement of the nerve in relation to its surrounding structures.
Neural mobilization has a great role in management
of radiculopathy and low back pain (8). The Straight
Leg Raise (SLR) test is frequently used in the assessment of patients presenting with LBP. It has been
110
http://www.jhsci.ba
suggested that improving the range of SLR has a

beneficial effect in restoring normal movement and
reducing the degree of impairment due to low back
dysfunction (9).
Unfortunately, there is no enough research evidence
to support these conjectures. The aim of this study
was to investigate the effect of neural mobilization
on sciatic pain, SLR test and functional disability.
METHODS
Patients
Sixty patients, both male and femle, with radicular

low back pain were involved, age between 32 and
60 years. Study was conducted in the period from
01.04.2010. to 31.03.2011 in Regional medical
center "Dr. Safet Muji", Mostar. The patients were
randomly allocated into two groups, Group A received neural mobilization and lumbar stabilization
exercises and Group B received active range of motion (ROM) exercises for back and legs and lumbar
stabilization exercises. Patients included into study
were required to reproduce their symptoms with
straight leg raise testing. VAS scale score and positive SLR test (< 45o) were recorded. Criteria for exclusion from the study were patients with metabolic
diseases such as diabetes mellitus, patients with carcinoma in case history, patient leaving the follow up.
Procedures
Group A was treated with neural mobilization in

position on side with oscilatory movements: knee
extension, hip flexion and ankle dorsiflexion. Mobilization procedures were repeated 3 times with 10
oscillatory movements for improving nerve gliding
in intravertebral foramina. After relief of the symptoms, lumbar stabilization exercises according to Kabath were included.
Group B was treated with active ROM exercises for
back and distal extremities, for improving range of
motion in back and legs, and lumbar stabilization
exercises according to Kabath.
Both groups had 4 week therapy program, three
times per week.
Instruments used for verifying the improvements
before and after therapy included: Visual analogue
scale (VAS) scale, with scores 0 to 10 where 0 means
http://www.jhsci.ba
no pain and 10 means the strongest pain; Straight

leg raise (SLR) test with goniometer, was performed
according to the published instructions and the angle between the tibial crest and the horizontal plane
was measured using a goniometer in (nonrounded)
degrees (10).
After the therapy we used evaluation of the results
of the clinical condition, according the following methodology: score 0 - unchanged condition
(without treatment outcomes); score 2 - minimal
improvement; score 3 - satisfactory functional improvement with consequences (sensory or motor);
score 4 - good improvement and satisfactory functional restitution with minimal consequences; score
5 - good restitution without consequences of injury
or illness, score 6 - quit the treatment; score 7 - further medical treatment required (diagnostic or operative) (11).
At the beginning of study, the two groups were not

significantly different in terms of VAS score: Group
A: 8.77 0.86; Group B: 8.95 0.85 and SLR test
measured with goniometer: Group A: 36.84.35;
Group B: 37.2 2.78.
RESULTS
TABLE 5. Results of treatment
TABLE 4. Between-group change score after therapy

Variables
VAS scale
SLR testing with goniometer
Group A
42.3 (5.9)
256 (85.3%)
Assessment of treatment
Results
0 - unchanged condition
2 - minimal improvement
3 - satisfactory improvement with
outcomes of injury or illness
4 - good improvement and satisfactory
functional restitution
5 - good functional restitution without
sequels
6 - quit the treatment
7 - further medical treatment required
(diagnostic or operative)
Total
Group B
43.1 (6.4)
44 (14.7%)
Both group A and group B were similar in terms of

age: Group A: 42.36 yrs; Group B: 43.16.4 yrs.
TABLE 2. Gender characteristics of the sample
Groups
Group A
Group B
Total
Sex
Female
19
14
33 (55%)
Total
Male
11
16
27 (45%)
30
30
60 (100%)
Out of total 60 (100%), 33 (55%) participants were

female, and 27 (45%) were male.
TABLE 3. Between-group change score before therapy

Variables
VAS scale
SLR testing with goniometer
Group A
8.778 (0.86)
36.877 (4.35)
Group B
8.95 (0.85)
37.28 (2.78)
Group B
2.25 (2.23)
65.96 (16.43)
After therapy, there was statistically significant improvement between groups in both VAS scores
(Group A: 1.161.54; Group B: 2.252.23, P<0001)
and SLR test measured with goniometer (Group A:
80.917.4; Group B: 65.916.4, P<0001)
TABLE 1. Age characteristics of the sample

Variable
Age
Control
Group A
1.166 (1.54)
80.97 (17.44)
Group A
Group B
0
2
0
0
16
14
10
30
30
After the treatment, in group A , 46.6% (14) participants had been rated with 4, but in Group B: 33.3%
(10) participants had been rated with 3.
DISCUSSION
In this study, 60 participants were included. Out

of total 60,33 (55%) participants were female, and
27 (45%) were male. The two groups were similar
in terms of age [Group A: 42.36 yrs; Group B:
43.16.4 yrs].
Also, at the beginning of study, the two groups were
not significantly different in terms of VAS score
111
[Group A: 8.7 0.86; Group B: 8.9 0.85] and SLR

test measured with goniometer [Group A: 36.84.3;
Group B: 37.2 2.7]. After the therapy, there was
statistically significant improvement between groups
in both VAS scores [Group A: 1.161.5; Group B:
2.252.2] and SLR test measured with goniometer
[Group A: 80.917.4; Group B: 65.916.4]. After
the treatment, in group A , 46.6% (14) participants
had been rated with 4, but in Group B: 33.3% (10)
participants had been rated with 3.
Gurpreet K research confirms that SLR neural mobilisation is more effective than conventional therapy for improving pain and disability in patients with
neurogenic pain syndrome (12).
Sahar also investigated efficacy of neural mobilization in treatment of low back dysfunctions in two
groups. One group (A) had lumbar mobilization
treatment with exercise therapy, another group (B)
had SLR mobilization and lumbar stabilization.
Group B was beneficial in improving pain, reducing
short term disability and promoting centralization
of symptoms (9).
Gupta also found out that Nerve mobilization techniques enhance patient outcomes in the management of sciatica when added to standard care (13).
The results of this study suggest that when neural
mobilization is added to a treatment program of
lumbar stabilization, significant improvement in radicular low back pain may occur. Both forms of statistical analysis revealed that both treatment groups
had meaningful reductions in their ROM, pain and
result of treatment, but group A, which included
neural mobilization, improved significantly.
http://www.jhsci.ba
stabilization. Further research to investigate their

long term efficacy is warranted, with emphasis on
greater number of participants.
COMPETING INTERESTS
CONCLUSION
Patients treated with neural mobilization and lumbar stabilization showed better VAS scores and
Straight Leg Test scores compared to patients treated with active range of motion exercises and lumbar
112
REFERENCES
1. Masters S, Lind R. Musculoskeletal pain - presentations to general practice.
Aust Fam Physician 2010;39:425428.
2. Hoy D, Bain C, Williams G, March L, Brooks P, Blyth F, Woolf A, Vos T,
Buchbinder R. A systematic review of the global prevalence of low back
pain. Arthritis and Rheumatism. 2012;64(6):202837.
3. Airaksinen O, Brox J, Cedraschi C, Hildebrandt J, Klaber J, Kovacs F, Mannion A, Reis S, Staal J, Ursin H, Zanoli G. European guidelines for the
management of chronic nonspecific low back pain in primary care. Eur
Spine J 2006;15(2):192-298.
4. Iversen T, Solberg T, Romner B. et al. Accuracy of physical examination for chronic lumbar radiculopathy. BMC Musculoskeletal Disorders
2013;14:206
5. Cannon D, Dillingham T, Miao H, Andary M, Pezzin L. Musculoskeletal
disorders in referrals for suspected lumbosacral radiculopathy. Am J Phys
Med Rehabil 2007;86:957961.
6. Ellis R, Hing W. Neural Mobilization: A Systematic Review of Randomized
Controlled Trials with an Analysis of Therapeutic Efficacy. The Journal of
manual manipulative therapy. 2008;16(1):822.
7. Dwornik M, Bialoszewski D, Korabievska I, Wronski Z. Zasady stosowania
neuromobilizacji w schorzeniach narzdu ruchu.Ortopedia Traumatologia
Rehabilitacja. 2007;9(2):111-121.
8. Philadelphia Panel. Philadelphia Panel evidence-based clinical practice
guidelines on selected rehabilitation interventions for low back pain. Physical Therapy 2001;81:164174.
9. Sahar M. Efficacy of Neural Mobilization in Treatment of Low Back Dysfunctions. Journal of American Science 2011;7(4):566-573.
10. Ekedahl H, Jnsson B, Frobell RB. Validity of the Fingertip-To-Floor Test
and Straight Leg Raising Test in Patients With Acute and Subacute Low
Back Pain: A Comparison by Sex and Radicular Pain. Archives of Physical
Medicine and Rehabilitation. 2010;91:1243-1247.
11. Pecar D. Ocjena modela baze podataka za fizikalnu rehabilitaciju u zajednici. Magistarski rad. Medicinski fakultet Univerziteta u Sarajevu. Poseban
tisak, 2000.
12. Gurpreet K, Shallu S. Effect of Passive Straight Leg Raise Sciatic Nerve
Mobilization on Low Back Pain of Neurogenic Origin. Indian journal of
Physiotherapy and Occupational therapy An International Journal. 2011;
5:179-184.
13. Gupta M. Effectiveness of nerve mobilization in the management of sciatica.
Indian Journal of Physiotherapy and Occupational Therapy an international journal. 2012;6:45-49.
http://www.jhsci.ba
Haso Sefo et al. Journal of Health Sciences 2013;3(2):113-116

RESEARCH ARTICLE
Open Access
Treatment of the Moderate Lumbar Spinal Stenosis

with an Intespinous Distraction Device IMPALA
Haso Sefo1*, Mersad Barucija1, Edin Hajdarpasic1, Mirsad Muftic2
1
Department of neurosurgery, Clinical Center University of Sarajevo, Bolnicka 25, Sarajevo, Bosnia and Herzegovina.
Faculty of Health Studies, University of Sarajevo, Bolnicka 25, Sarajevo, Bosnia and Herzegovina
ABSTRACT
Introduction: The aim of this study was the evaluation of symptom improvements in patients with moderate lumbar spinal stenosis, who consecutively underwent placement of interspinous distraction device
IMPALA.
Methods: This study included a total of 11 adult patients with moderate lumbar spinal stenosis. Clinical
evaluations were performed preoperatively and 3-months after surgery using the Visual Analogue Scale
(VAS) and Oswestry Disability Index (ODI).
Results: The mean preoperative VAS was 7.09 and fell to 2.27 a 3-months after surgery. The mean preoperative ODI was 59.45 fell to 20.72 a 3-months after surgery.
Conclusions: Using the IMPALA device in patients with moderate lumbar spinal stenosis is a minimal
invasive, effective and safe procedure. Clinical symptoms were improved 3 months after surgery.
Keywords: Spinal stenosis, Minimal invasive procedure, Interspinous device, Impala
INTRODUCTION
Lumbar spinal stenosis (LSS) is a condition involving the narrowing of either the spinal canal or neural
foramina. The stenosis is caused by hypertrophy of
the ligament flavum and facet joints, osteophytes,
spondylolisthesis and disc protrusion, which results
in nerve compression in one or more motion segments (1). The most common symptom associated
with LSS is neurogenic intermittent claudication
*Corresponding author: Haso Sefo,

Department of neurosurgery, Clinical Center University of
Sarajevo, Bolnicka 25, Sarajevo, Bosnia and Herzegovina.
Phone:+38733297343; E-mail: haso_sefo@hotmail.com
Submitted 9 April 2013 / Accepted 1 August 2013
(NIC) and typically concerns patients at the age of

50 or above. NIC is defined as pain or numbness in
the buttocks, thighs and/or legs brought on by either
prolonged standing or exercise in the erect posture.
The symptom is typically relieved by various manoeuvres that flex the lumbar spine, such as bending
forward or sitting, which increases the spinal canal
significantly. The best treatment of NIC due to lumbal stenosis remains controversial. Nonoperative
therapy like epidural steroid injections, nonsteroidal
anti-inflammatory medication, analgesics, physical therapy, and spinal manipulation, is frequently
performed. Decompressive surgery with or without
fusion is the current gold standardtreatment for
moderate to severe symptomatic LSS (1-4). The
first interspinous device, the Wallis system (Abbott
2013 Haso Sefo et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an
Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
http://www.jhsci.ba
Spine), was developed in 1986 and used in patients

with recurrent disc herniation. Recently, a new class
of spinal devices called interspinous spacers (ISPs)
has been introduced. The painful repercussions of
lumbar stenoses can often be mitigated by a combination of decompression and widening of the intervertebral foramen. This permanent widening is
achieved by an interspinous spacer (5,6). IMPALA
made by Signus fulfils this function. It is a threepart implant which is inserted between two spinous
processes. The natural structures are left largely intact in this procedure: the supraspinous ligament is
retained and the bony structures are not damaged.
Thus mobility is maintained in flexion and rotation.
Pain occurring in extension is alleviated.
The positive aspects of using IMPALA are: tensioning the interspinous ligaments, separating the
posterior elements with accompanying unloading
of the facet joints, reducing facetal pain, widening
the intervertebral foramen and thus decompressing
the vertebral canal and relieving the load on the disc,
reducing disc pain and reducing the riskof prolapse.
IMPALAis made of PEEK-OPTIMA, a biocompatible plastic which combines several advantages.
The elasticity module is similar to that of cortical
bone. In addition, plastic ensures artefact-free MRT
imaging. Appropriate markers are incorporated to
enable the position of the implant to be determined
by X-ray.
The indication for IMPALA includes radiologically
confirmed, moderate stenoses of the vertebral canal
in the L1-S1 region, of varying genesis, with neurological impairment, resulting in claudication and/or
radicular symptoms. The procedure is limited to a
maximum of two levels (7).
gery as well as after surgery (Figure 1).

Clinical evaluations were performed preoperatively
and 3-months after surgery using the Visual Analogue Scale (VAS) and Oswestry Disability Index
(ODI) (8).
In our institution, patients are admitted for 24
hours before the day of the procedure. The patient is
out of bed few hours after surgery and discharged on
second postoperative day. Usually, the patients had
regular follow up at 1 and 3 months.
Operative techniques
The operation is typically performed under general anaesthetic. It is advantageous if the patient
is completely relaxed. The patient is placed in the
genupectoral position on a radiolucent table. After
identification of the segment affected and radiological assessment, an incision is made in the midline.
The segment to be operated on is exposed on one
side, leaving the supraspinous ligament intact. With
the aid of the curettes, the interspinous ligament can
then be opened and the muscles detached on the
opposite side. This makes a unilateral approach possible. The distractor is then inserted as far as possible
between the spinous processes. Complete muscular
relaxation is necessary to attain optimal distraction
at the coronal level. The distraction should relieve
the load on the posterior elements of the vertebral
column and result in foraminal decompression. The
appropriate size of implant is determined using the
distractor in the locked position and the trial instrument. The aim is to use the largest size of implant
possible. Thereafter, interspinous distractor was inserted tightly into the interspinous space The implant is finally secured by attaching the locking plate.
A final X-ray check is made on two planes.
METHODS
RESULTS
Patients
The study included a total of 11 adult patients with

moderate lumbar spinal stenosis, who consecutively
underwent placement of interspinous distraction
device at 1 or 2 levels between October 2011 and
February 2013 at Department of neurosurgery,
Clinical Center University of Sarajevo.
Lumbar spinal stenosis in all patients was confirmed
by MRI scans. All patients had lateral and AP standing roentgenograms of the lumbar spine before sur-
A total of 11 patients (7 female and 4 male) with

spinal stenosis were included in the study. The mean
age was 52 (range 42-63). In 7 patients (L4-L5 level), in 2 patients, (L3-L4 and L4-L5 levels) and in
2 patients (L4-L5 and L5-S1 levels) were implanted
(Table 1). The mean preoperative VAS was 7.09 and
fell to 2.27 a 3-months after surgery (Figure 2).The
mean preoperative ODI was 59.45 fell to 20.72
3-months after surgery (Figure 3). There was a significant improvement in the VAS and ODI scores.
114
http://www.jhsci.ba
FIGURE 1. Preoperative (left)

and postoperative (right) lateral
roentgenograms. (Lateral roentgenograms after implantation of
interspinous device shows separation of the posterior elements
with accompanying unloading
of the facet joints, widening the
intervertebral foramen and thus
decompressing the vertebral canal and relieving the load on the
disc).
FIGURE 2. The symptom improvement measured by VAS

scale. VAS pre: preoperative VAS score; VAS 3mts: VAS
score 3 months after surgery.
FIGURE 3. The symptom improvement measured by ODI

scale. ODI pre: preoperative ODI score; ODI 3mts: ODI
score 3 months after surgery.
TABLE 1. Clinical Outcomes of the Patients
DISCUSSION
Age Sex
51
56
58
51
63
54
54
45
50
48
42
F
M
M
M
F
F
F
M
F
F
F
Level(s)
L4-L5
L4-L5
L4-L5
L4-L5
L3-L4 L4-L5
L4-L5
L4-L5
L4-L5 L5-S1
L4-L5
L4-L5 L5-S1
L3-L4 L4-L5
VAS
pre
6
7
8
6
8
6
7
8
8
7
7
VAS
3mts
1
2
3
2
4
2
2
3
2
2
2
ODI
pre
44
52
56
48
80
50
56
78
70
62
58
ODI
3mts
10
16
22
14
32
16
22
30
24
22
20
The interspinous implantation is less invasive than

laminectomy as a gold standard in classical surgical
treatment of spinal stenosis. In general, materials are
well tolerated. There were no broken or permanently
deformed implants in any of the cases. There was
just one case of migration of interspinous-device because of placement of smaller size of device and that
patient was underwent to surgery again. Compared
with literature-reported outcomes of laminectomy
surgery there are significant differences in operative
time, estimated blood loss, hospital stay, complication rate and reoperation rates favouring the interspinous-device (10-15).
115
http://www.jhsci.ba
In our study there was significant improvement of

symptoms according VAS and ODI scores after interspinous-device placement. It was also conformed
in a prospective and randomized multi-center study
made by Zuckerman et al.(16) showed also a success rate of 59% at 1 year postsurgery with an interspinous implant. This result was much better than
that of 12% in the control patients who were treated
only conservatively.
5. Boeree N. Dynamic stabilization of the lumbar motion segment with the

Wallis system. Scientific presentation at the Annual Meeting of the Spine
Arthroplasty Society; 2005 May 4-7; New York, NY.
6. Eif M, Schenke H. The Interspinous-U: Indications, experience, and results.
Scientific presentation at the Annual Meeting of the Spine Arthroplasty Society; 2005 May 4-7; New York, NY.
7. Signus Deutschland GmbH. Products: Posterior instrumentation. (homepage on the Internet). No date. Available from http://www.signus-med.de/
fileadmin/pdf/products/IMPALA_DB_EN_L04_2012_07-02.pdf
8. Fairbank JC, Pynsent PB, The Oswestry Disability Index. Spine. 2000;
25(22):2940-2952.
CONCLUSIONS
Using the IMPALA device in patients with moderate lumbar spinal stenosis is a minimal invasive and
safe procedure. Clinical symptoms were improved
3 months after surgery. The decompression of the
lumbar spine with IMPALA bridges the cleft between usual conservative therapy and aggressive surgical treatment methods reducing symptoms with
minimal surgical risks.
neurogenic
10. Benz RJ, Ibrahim ZG, Afshar P, Garfin SR. Predicting complications
in elderly patients undergoing lumbar decompression. Clin Orthop.
2001;384:116121
11. Deyo RA, Cherkin DC, Loeser JD, Bigos SJ, Ciol MA. Morbidity and mortality in association with operations on the lumbar spine. The influence of age,
diagnosis, and procedure. J Bone Joint Surg Am. 1992;74(4):536543.
12. Postacchini F, Cinotti G, Perugia D, Gumina S. The surgical treatment of
central lumbar stenosis: multiple laminotomy compared with total laminectomy. J Bone Joint Surg. 1993;74:386392.
14. Katz JN, Lipson SJ, Larson MG, McInnes JM, Fossel AH, Liang MH. The
outcome of decompressive laminectomy for degenerative lumbar stenosis.
J Bone Joint Surg Am. 1991;73:809816.
REFERENCES
and
9. Amundsen T, Weber H, Lilleas F, Nordal HJ, Abdelnoor M, Magnaes B.

Lumbar spinal stenosis. Clinical and radiologic features. Spine.1995;
20(10): 1178-1186.
13. Jonsson B, Annertz M, Sjoberg C, Strmqvist B. A prospective and consecutive study of surgically treated LSS. Part II: Five-year follow-up by an
independent observer. Spine.1997;22: 29382944.
COMPETING INTERESTS
1. Porter RW. Spinal stenosis

Spine.1996;21:20462052.
4. Inufusa A, An HS, Lim TH, Hasegawa T, Haughton VM, Nowicki BH. Anatomic changes of the spinal canal and intervertebral foramen associated
with flexion-extension movement. Spine.1996;21:24122420.
claudication.
2. Schonstrom N, Lindahl S, Willen J, Hansson T. Dynamic changes in the

dimensions of the lumbar spinal canal: an experimental study in vitro. J
Orthop Res. 1989;7:115121.
3. Verbiest H. A radicular syndrome from developmental narrowing of the lumbae vertebral canal. J Bone Joint Surg. 1954;36-B:230237.
116
15. Hu RW, Jaglal S, Axcell T, Anderson G. A population-based study of reoperations after back surgery. Spine. 1997;22(19):22652271
16. Zucherman JF, Hsu KY, Hartjen CA, Mehalic TF, Implicito DA,Martin MJ,
Johnson DR 2nd, Skidmore GA, Vessa PP, Dwyer JW, Puccio S, Cauthen JC, Ozuna RM. A prospective randomized multicenterstudy for the
treatment of lumbar spinal stenosis with the X STOP interspinous implant:
1-year results. Eur Spine J. 2004; 13:22-31.
http://www.jhsci.ba
Goran Dimitrov et al. Journal of Health Sciences 2013;3(2):117-122

RESEARCH ARTICLE
Open Access
The role of human papillomavirus (HPV) testing

in the follow-up of patients after treatment for
cervical intraepithelial neoplasia (CIN)
Goran Dimitrov1*, Elena Dzikova1, Gligor Dimitrov2, Saso Panov3, Irena Aleksioska1,
Gjorgji Babusku2
1
University Clinic for Gynecology and Obstetrics, Ss. Cyril and Methodius University, Vod-njanska Street No.17 , 1000 Skopje, Republic of Macedonia. 2General Hospital Remedika, 16-ta Makedonska brigada Street No.18, 1000 Skopje, Republic
of Macedonia. 3Institute of Biology, Faculty of Natural Sciences and Mathematics, Ss. Cyril and Methodius University, Skopje, Republic of Macedonia.
ABSTRACT
Introduction: The aim of this study was to examine the role of human papillomavirus testing in the
follow-up after treatment for CIN, as a prognostic sign for residual/recurrent cervical precancerous lesions.
Methods: A hospital-based analysis was performed on 460 patients previously treated for CIN with cold
knife conization, at the University Clinic for Gynecology and Obstetrics and General Hospital Remedika,
in Skopje, Republic of Macedonia, in a period of 3 years. The patients were followed-up with HPV testing
in addition to cytology, colposcopy and/or biopsy. The first after treatment HPV testing was performed
8 months after cold knife conization, proceeded by follow-up within 24 months after treatment, at 4
months intervals.
Results: Among 460 treated patients, at the first HPV and cytologic testing, 8 months after treat-ment,
69 (15%) were HPV+, and 391 (85%) HPV negative. From the 69 HPV+ patients, 41 (59.4%) were with
cytologic abnormalities and 28 (40.6%) without abnormalities. 12 months after treatment, the number of
HPV+ patients developing cytologic abnormalities raised to 45/70 (64.29%). Within the 24 months after
treatment, the number of patients who had recurrent/ residual CIN from the HPV+ patients reached 50/71
(70.42%); which was 10.87% from all 460 treated patients.
Conclusion: Persistence or clearance of HPV especially 8 months after treatment even in patients with
normal cytology, is an early valid prognostic marker of treatment failure, and is more accurate than cytology at the same follow-up intervals.
Keywords: human papillomavirus, uterine cervix carcinoma, HPV, cervical intraepithelial neoplasia
INTRODUCTION
*Corresponding author: Goran Dimitrov MD, MSc
Adrress: University Clinic for Gynecology and Obstetrics, Ss. Cyril and Methodius University, Vodnjanska Street
No.17, Mk-1000 Skopje, Republic of Macedonia
E-mail: gorandi@hotmail.com; Phone: ++389 70 387387
Submitted 14 March 2013 / Accepted 15 August 2013
Cervical cancer with an estimated 530 000 new

cases in 2008 is the third most common cancer in
women, and the seventh overall. More than 85% of
these cases occur in developing countries, where it
accounts for 13% of all female cancers. The highest-
2013 Goran Dimitrov et al.; licensee University of Sarajevo - Faculty of Health Studies. This
risk regions are Eastern and Western Africa [agestandardized rate (ASR) greater than 30 per 100
000], and the lowest are Western Asia, Northern
America and Australia/New Zealand, where the
rates are less than 6 per 100 000. Above all, in 2008,
cervical cancer proved to be the reason for 275.000
deaths with the mortality incidence ratio of 52%,
and an estimation of 88% of deaths in developing
countries from which 53.000 in Af-rica, 31.700 in
Latin America and the Caribbean, and 159.800 in
Asia (1, 2).
Today, it is well-established that Human papillomavirus (HPV) infection is the most important cause
of cervical cancer, with a special attention to HPV
types 16 and 18, which proved to be the reason in
70% of the world cervical cancer cases. The World
data show that around 11.4% of women are evaluated to capture cervical HPV infection at a given
time. The same data presented that the prevalence of
HPV 16 and/or 18 ranging from normal cytology is
3.8%; through 24.3% in low-grade cervical lesions;
up to 51.1% in high-grade cervical lesion. The same
types are blamed for about 70.9% of the most invasive cases (3). The DNA-HPV detection results of
cervical infection are measured in all cervical morphological lesions ranging from normal findings up
to invasive cervical cancer, showing that the prevalence of HPV increases with the malice of the lesion.
HPV remains the cause of almost 100% of all cases
of cervical cancer. The vaccine-prventable HPV-16
and -18, are still the reason for more than 70% of
all cervical cancer cases in the world, especially in
high-grade cervical lesions, 41-67% (4). After HPV16/18, the six most common HPV types in all world
regions, which account for an additional 20% of
cervical cancers worldwide are the types: 31, 33, 35,
45, 52 and 58. The discovery of Human Papilloma
Virus (HPV) infection to be the prime cause for this
disease, gives a tremendous chance to prevent and
early detect cervical neoplasia (5, 6). Recent studies
demonstrated that HPV test combined with cytology may improve the early de-tection of both primary
cervical neoplasia as well as recurrence of neoplasia
after therapy, decreasing the need for more radical
treatment (7, 8).
Cervical conization is defined as excision of a coneshaped or cylindrical wedge from the uterine cervix
that includes the transformation zone and all or a
portion of the endocervical canal. It is used as a de-
http://www.jhsci.ba
finitive diagnostic and treatment tool for squamous

or glandular intraepithelial lesions and for excluding
micro-invasive carcinomas.
There are several conization techniques: cold-knife
(scalpel) conization, laser conization, or electrosurgical loop conization, each with certain benefits
and disadvantages. The cleanest specimen mar-gins
for patho-histologic analysis is provided only by
cold-knife conization. As an attempt to excise gross
cervical tumors per vaginam, in the early 19th century, similar procedures to conization were used. In
the late 20th century, first conization was used as a
diagnostic tool for cervical lesions and later as treatment as well. Today the use of cold-knife conization
as a diagnostic tool is reduced since wide spreading
the colposcopically directed cervical biopsies combined with endocervical curettage as less invasive
procedure with high diagnostic value. However, in
selected situations, it is still very important diagnostic tool and accepted modality for management and
treatment of CIN (9-12).
Conization site usually heals in 6 weeks. To determine treatment success and avoid possibility of residual or recurrent CIN, Papanicolaou tests should
be performed every 4 months during the first and
second postoperative years and every 6 months
thereafter. A single follow-up Papanicolaou test
shows positive results in fewer than 25% of women with residual disease, therefore we designed our
study to determine the role of human HPV testing
in the follow-up after treatment for CIN, as a valuable prognostic sign for residual/recurrent cervical
precancerous lesions.
METHODS
Patients
A hospital-based analysis was performed on 460

patients previously treated for CIN with cold knife
conization, at the University Clinic for Gynecology and Obstetrics and General Hospital Remedika,
in Skopje, Republic of Macedonia, in a period of
3 years. The patients were followed-up with HPV
testing in addition to cytology, colposcopy and/or
biopsy. The first after treatment HPV testing was
performed 8 months after cold knife conization,
proceeded by follow-up within 24 months after
treatment, at 4 months intervals.
118
http://www.jhsci.ba
TABLE 1. The role of HPV testing in the follow-up of patients 8 months after treatment for CIN
Values entered:
HPV Test Positive
HPV Test Negative
Totals
Prevalence
Sensitivity
Specificity
Positive predictive value
Negative predictive value
True Positives
False Positives
True Negatives
False Negatives
likelihood Ratios
Condition: Recurrent/Residual CIN 8 months after treatment

Totals
Absent
Present
28
41
69
386
5
391
414
46
460
95% Confidence Interval
Estimated Value
Lower Limit
Upper Limit
0.1
0.074864
0.132022
0.891304
0.756386
0.959285
0.932367
0.902598
0.953796
0.15
0.119293
0.186696
0.85
0.813304
0.880707
0.594203
0.469205
0.708661
0.405797
0.291339
0.530795
0.987212
0.968665
0.995283
0.012788
0.004717
0.031335
13.178571
9.088179
19.109962
Procedures
During each of these follow-up visits, patients received colposcopy, conventional PAP or liquid based
PAP (CYTOFAST by HOSPITEX DIAGNOSTICS, Sesto Fiorentino, Italy) and HPV test specimens. Biopsy and/or endocervical curretage was performed to prove recurrent/residual lesion only if the
previous test suggested low-grade or high-grade cervical lesions. Residual/recurrent dis-ease was defined
only if the CIN2+ lesion was histologically confirmed at least 8 months after treatment. After retreatment, women received further follow-up test,s
but were dropped out from the study. If women had
histologically confirmed CIN1, follow-up continued without treatment (wait and see).
Human papillomavirus DNA was detected by
Polymerase Chain Reaction (PCR) method in the
Laboratory for Molecular Biology, Institute of Biology, Faculty of Natural Sciences and Mathematics, Skopje, Macedonia. The material for analysis
(exfoliated cells in medium) was analyzed 24-48
hours after sample collection. The cervical cells were
collected and digested with an appropriate buffer
containing Proteinase K and 0,5% SDS. The total
DNA was isolated with NaCl/chloroform extraction
and ethanol precipitation. The PCR amplification
was performed with 3 pairs of consen-sus primers
(MY09/11, GP5+/6+, HPVpU 1M/2R) specific for
L1 and E6/E7 regions of the HPV genome (thermo-
cycler Perkin Elmer Geneamp PCR System 2400).

Positive and negative controls were included in each
of the tested series. The positive primers were genotyped and digested with 7 restrictional endonucleases (AfaI, HaeIII, PstI, AccI, AvaII, BglII, AvaI) specific for low-risk HPV types (6, 11, 40, 42, 43, 44,
54, 55, 61, 70, 72, 81, MM8, CP6108) and highrisk HPV types (16, 18, 26, 31, 33, 35, 39, 45, 51,
52, 53, 56, 58, 59, 66, 68, 73, 82, MM4, MM7,
MM9). The results were analyzed with agarose gel
electrophoresis and visualised on UV transluminator. The viral genotype was determined through the
length of restrictional fragments of the electrophoresis gel (12).
The results from the conventional PAP or liquidbased smears that were used for cytological analy-sis
were interpreted according to the Bethesda classification III System, 2001.
Statistical analysis
All data gathered during the follow-up period, were

analyzed using the statistical package SPSS 20. We
computed the sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV)
and likelihood ratio with 95% confidence intervals
(95% CI), for cytology abnormalities development
and HPV presence/persistence and the combination
of these tests by making use of cross tabs.
119
http://www.jhsci.ba
Values entered:
HPV Test Positive
HPV Test Negative
Totals
Prevalence
Sensitivity
Specificity
True Positives
False Positives
True Negatives
False Negatives
likelihood Ratios

Totals
Absent
Present
25
45
70
386
4
390
411
49
460
Estimated Value
Lower Limit
Upper Limit
0.106522
0.080563
0.139246
0.918367
0.795162
0.973524
0.939173
0.910335
0.959457
0.152174
0.121257
0.189041
0.847826
0.810959
0.878743
0.642857
0.518666
0.751266
0.357143
0.248734
0.481334
0.989744
0.972124
0.996709
0.010256
0.003291
0.027876
15.097959
10.232947
22.275926
RESULTS
Among 460 treated patients, at the first HPV and

cytologic testing, 8 months after treatment, 69
(15%) were HPV+, and 391 (85%) HPV negative.
From the 69 HPV+ patients 41 (59.4%) were with
cytologic abnormalities; and 28 (40.6%) without
abnormalities.
Twelve months after treatment, the number of
HPV+ patients developing cytologic abnormalities
raised to 45/70 (64.29%). Within the 24 months
after treatment, the number of patients who had
recurrent/ residual CIN from the HPV+ patients
reached 50/71 (70.42%); which was 10.87% from
all 460 treated patients.
Eight months after treatment, HPV Prevalence,
Sensitivity and Specificity are 15%; 89% and 93%
respectively; followed by 15% Positive Predictive
Value; 85% Negative Predictive Value; 59% True
Positive Rate; 41% False Positive Rate; 99% True
Negative Rate; 1% False Negative Rate . The Positive Likelihood Ratio is 13.18 (9.09-19.11) with
95% Confidence Interval (Table 1).
Twelve months after treatment, the HPV Prevalence,
Sensitivity and Specificity are 11%; 92% and 94%
respectively; followed by 15% Positive Predictive
Value; 85% Negative Predictive Value; 64% True
Positive Rate; 36% False Positive Rate; 99% True
Negative Rate; and 1% False Negative Rate. The

Positive Likelihood Ratio is 15.10 (10.23-22.28)
with 95% Confidence Interval (Table 2).
Twenty-four months after treatment, HPV Prevalence, Sensitivity and Specificity are 12%; 94%
and 95% respectively; followed by 15% Positive
Predictive Value; 85% Negative Predictive Value;
70% True Positive Rate; 30% False Positive Rate;
99% True Negative Rate and 1% False Negative
Rate. The Positive Likelihood Ratio is 18.28 (11.9927.87) with 95% Confidence Interval (Table 3).
DISCUSSION
It is evidence-based that HPV, especially the high

risk types, are the most important cause of cervi-cal
cancer (13, 14). It is also clear that there is a relation
between persistent infection of HPV and CIN2+ lesions.
The aim of this study was to examine the role of
HPV testing in the follow-up after treatment for
CIN, as a prognostic sign for residual/recurrent cervical precancerous lesions. Based on many dif-ferent
large studies it was published that at least 95% of
patients who have CIN can be cured by different
conization techniques. However, cure rates as low
as 60% have also been reported. Also, in patients
with positive margins for precancerous lesion in the
120
http://www.jhsci.ba
Values entered:
HPV Test Positive
HPV Test Negative
Totals
Prevalence
Sensitivity
Specificity
True Positives
False Positives
True Negatives
False Negatives
likelihood Ratios

Totals
Absent
Present
21
50
71
386
3
389
407
53
460
Estimated Value
Lower Limit
Upper Limit
0.115217
0.088214
0.14883
0.943396
0.833723
0.985267
0.948403
0.920963
0.966989
0.154348
0.123224
0.191384
0.845652
0.808616
0.876776
0.704225
0.582474
0.803664
0.295775
0.196336
0.417526
0.992288
0.975702
0.998006
0.007712
0.001994
0.024298
18.283917
11.992908
27.874943
conization specimen, according to Felix et al. the

Recurrence or Persistence (16.5%) is significantly
more often than Cure Rate (1.9%) (15). Since a single follow-up Papanicolaou test shows only in 25%
positive results of residual disease, different studies
showed that HPV tests combined with cytology offer clear advantage in the postoperative follow-up
period, especially the redevelopment of CIN can be
caused by the same HPV subtype that induced the
initial disease (16, 17).
In our study the patients were followed-up with
HPV testing in addition to cytology, colposcopy
and/or biopsy. The first after treatment HPV testing was performed 8 months after cold knife conization, proceeded by follow-up within 24 months
after treatment, at 4 months intervals.
Our results regarding the first detection of HPV in
the post-conization period, declared that during the
first 8 months after the end of therapy, HPV persisted in 69 of 460 treated patients (15%). Fur-thermore it pointed out that 59.4% of the HPV positive
patients had cytologic abnormalities 8 months after
treatment, and that number raised to 66.4% after 12
months and at the end reached 72.4%, 24 months
after treatment. These results show that HPV seems
to be of crucial importance in developing recurrent/
residual CIN in the post-operative period.
Multiple studies recognised HPV-DNA test as
100% accurate in identifying development of CIN,

in the follow-up period after treatment (18, 19).
Other studies reported slightly lower sensitivity of
HPV DNA test. One of those is the large Nobbenhuis and Paraskevaidis study reporting 93% sensitivity of HPV DNA test in detecting recurrence of
CIN (20- 22).
Our study, in 8, 12 and 24 months after treatment
showed similar sensitivity of 89, 92 and 94% respectively; but higher specificity at the same points
of follow-up period (93, 94, and 95% respec-tively) .
Specificity given by other authors of HPV tests for
CIN detection are as follows: 88%-Nagai, 86%-Nobbenhuis, and 84%-Paraskevaidis (18, 20-22).
In our study, an increase of specificity and sensitivity was noticed in the further follow-up period
points. Based on these observations, there is a need,
the follow-up period to be increased in longer than
12 months. Diagnostic value of HPV testing in the
follow-up of patients after treatment for CIN, as a
method of detection of recurrent/residual neoplasia,
increases with time and seems to be of great significance the hole period of 24 months after treatment.
An attention should be drawn to significance of initial viral test (8 months after treatment) for prediction of recurrent/residual CIN, since 59.4% of the
patients with CIN recurrence were HPV positive at
the first follow-up visit after conization.
121
CONCLUSION
Persistence or clearance of HPV especially 8 months

after treatment even in patients with normal cytology, is an early valid prognostic marker of treatment
failure, and is more accurate than cytology at the
same follow-up intervals.
REFERENCES
1. Ferlay J, Shin HR, Bray F, Forman D, Mathers C and Parkin DM. GLOBOCAN 2008 v2.0, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 10 [Internet] Lyon, France: International Agency for Research on
Cancer; 2010. Available from: http://globocan.iarc.fr (Accessed on February 10, 2013).
http://www.jhsci.ba
11. Reich O, Pickel H, Lahousen M, Tamussino K, Winter R. Cervical intraepithelial neoplasia III: long-term outcome after cold-knife conization with
clear margins. Obstet Gynecol. 2001 Mar;97(3):42830.
12. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988 Feb
11;16(3):1215.
13. Kjaer SK, van den Brule AJ, Bock JE, Poll PA, Engholm G, Sherman ME, et
al. Human papillomavirus--the most significant risk determinant of cervical
intraepithelial neoplasia. Int. J. Cancer. 1996 Mar 1;65(5):6016.
14. Schiffman MH, Bauer HM, Hoover RN, Glass AG, Cadell DM, Rush BB, et
al. Epidemiologic evidence showing that human papillomavirus infection
causes most cervical intraepithelial neoplasia. J. Natl. Cancer Inst. 1993
Jun 16;85(12):95864.
15. Felix JC, Muderspach LI, Duggan BD, Roman LD. The significance of positive margins in loop electrosurgical cone biopsies. Obstet Gynecol. 1994
Dec;84(6):9961000.
2. WHO/ICO Information Centre on HPV and Cervical Cancer (HPV Information Centre), Human papillomavirus and related cancers in world, Summary Report, WHO/ICO, 2010. Available from: http://www.who.int/hpvcentre (Accessed on February 10, 2013).
16. Costa S, Negri G, Sideri M, Santini D, Martinelli G, Venturoli S, et al. Human papillomavirus (HPV) test and PAP smear as predictors of outcome in
conservatively treated adenocarcinoma in situ (AIS) of the uterine cervix.
Gynecol. Oncol. 2007 Jul;106(1):1706.
3. Clifford G, Franceschi S, Diaz M, Muoz N, Villa LL. Chapter 3: HPV typedistribution in women with and without cervical neoplastic diseases. Vaccine. 2006 Aug 31;24 Suppl 3:S3/2634.
17. Bae JH, Kim CJ, Park TC, Namkoong SE, Park JS. Persistence of human
papillomavirus as a predictor for treatment failure after loop electrosurgical
excision procedure. Int. J. Gynecol. Cancer. 2007 Dec;17(6):12717.
4. Kailash U, Hedau S, Gopalkrishna V, Katiyar S, Das BC. A simple paper

smear method for dry collection, transport and storage of cervical cytological specimens for rapid screening of HPV infection by PCR. J. Med.
Microbiol. 2002 Jul;51(7):60610.
18. Nagai Y, Maehama T, Asato T, Kanazawa K. Persistence of human papillomavirus infection after therapeutic conization for CIN 3: is it an alarm for
disease recurrence? Gynecol. Oncol. 2000 Nov;79(2):2949.
5. Muoz N, Castellsagu X, de Gonzlez AB, Gissmann L. Chapter 1: HPV

in the etiology of human cancer. Vaccine. 2006 Aug 31;24 Suppl 3:S3/110.
6. Kedzia W, Jzefiak A, Pruski D, Rokita W, Marek S. [Human papilloma virus genotyping in women with CIN 1]. Ginekol. Pol. 2010 Sep;81(9):6647.
7. Molijn A, Kleter B, Quint W, van Doorn L-J. Molecular diagnosis of human
papillomavirus (HPV) infections. J. Clin. Virol. 2005 Mar;32 Suppl 1:S43
51.
8. Kolstad P, Klem V. Long-term followup of 1121 cases of carcinoma in situ.
Obstet Gynecol. 1976 Aug;48(2):1259.
9. Bjerre B, Eliasson G, Linell F, Sderberg H, Sjberg NO. Conization as only
treatment of carcinoma in situ of the uterine cervix. Am. J. Obstet. Gynecol.
1976 May 15;125(2):14352.
10. Burghardt E. Diagnostic conization of the portio vaginalis uteri. Surgical
technic, histological diagnosis and clinical results. Geburtshilfe Frauenheilkd. 1963 Jan;23:130.
122
19. Lin CT, Tseng CJ, Lai CH, Hsueh S, Huang KG, Huang HJ, et al. Value of
human papillomavirus deoxyribonucleic acid testing after conization in the
prediction of residual disease in the subsequent hysterectomy specimen.
Am. J. Obstet. Gynecol. 2001 Apr;184(5):9405.
20. Nobbenhuis MA, Meijer CJ, van den Brule AJ, Rozendaal L, Voorhorst
FJ, Risse EK, et al. Addition of high-risk HPV testing improves the current
guidelines on follow-up after treatment for cervical intraepithelial neoplasia.
Br. J. Cancer. 2001 Mar 23;84(6):796801.
21. Paraskevaidis E, Arbyn M, Sotiriadis A, Diakomanolis E, Martin-Hirsch P,
Koliopoulos G, et al. The role of HPV DNA testing in the follow-up period
after treatment for CIN: a systematic review of the literature. Cancer Treat.
Rev. 2004 Apr;30(2):20511.
22. Paraskevaidis E, Lolis ED, Koliopoulos G, Alamanos Y, Fotiou S, Kitchener
HC. Cervical intraepithelial neoplasia outcomes after large loop excision
with clear margins. Obstet Gynecol. 2000 Jun;95(6 Pt 1):82831.
http://www.jhsci.ba
Gordana Bogdanovi et al. Journal of Health Sciences 2013;3(2):123-128

RESEARCH ARTICLE
Open Access
Pathomorphological Characteristics of Trophoblast

and Serum Human Chorionic Gonadotropin Levels
in Diagnosis of Partial Hydatidiform
Gordana Bogdanovi*, Lejla Muminhodi, Denita Ljuca, Adnan Babovi
Department of Gynecology and Obstetrics, Universitiy Clinical Centre Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina
ABSTRACT
Introduction: Partial molar trophoblast degeneration is a benign disease characterised by numerous
complications such as an invasive mole and malignant alteration.
Methods: This was a retrospective study which recruited 70 pregnant women diagnosed with hydatidiform mole or with physiological pregnancy spontaneously aborted. The pregnant women had similar
demographic features and were included in two groups. 35 pregnant women with a molar pregnancy
diagnosed during the first trimester were included in the study group; while 35 pregnant women with
miscarriages during the first trimester were included in the control group.
Results: Examined trophoblast changes were: type of atypia, amount and mass of trophoblast proliferation. Specific HCG serum levels were observed in all pregnant women before the treatment. Pregnant
women in the study group had statistically significant higher levels of HCG serum in comparison with the
control group (both average levels 60191.3749662.75 and levels according to gestational age). Statistically significant changes of villous trophoblast were observed by the pathomorphological analysis: mild
trophoblast atypia (57.14%); pronounced trophoblast mass (45.71%) and mild trophoblast proliferation
amount (51.43%).
Conclusion: Serum -HCG level measurements and pathomorphological analysis of chorionic villi are reliable and effective methods in a partial mole diagnostics.
Keywords: partial hydatidiform mole, trophoblast, serum -HCG levels
INTRODUCTION
Hydatidiform mole is a condition characterized by

trophoblast tissue altered into numerous and al*Corresponding author: Gordana Bogdanovi, MD, PhD;
Department of Gynecology and Obstetrics, University Clinical
Centre Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina;
Phone: + 387 61 727 958;
e-mail: bogdanovic.g@gmail.com
most transparent vesicles of various size partially or

completely replacing normal chorionic villi. Pathologically changed villi are interconnected by thin but
strong layers of connective tissue so macroscopically
the placenta appears as fish roe-like or as clusters
that resemble grapes hydatidiform mole (1).
Based on differences in morphology, histopathology, karyotype and clinical features, hydatidiform
mole can be categorized into partial and complete
2013 Gordana Bogdanovi et al.; licensee University of Sarajevo - Faculty of Health Studies.
moles. A complete mole (55%-75% of all molar

pregnancies) is characterized by hydropically degenerated villi, absence of embryo and amniotic sac. A
partial mole (25%-45% of all molar pregnancies) is
characterized by a partial degeneration of villi while
trophoblast proliferation is focally pronounced (2).
Hydatidiform mole incidence varies from 0.5 to 8.3
per 1000 live born children and is significantly different across countries. The incidence of molar pregnancy in Asia is seven to ten folds higher than in the
countries of North America and Europe (3). Statistically, 290 cases of pathological trophoblast a year
per 300 000 births and miscarriages were reported
in Croatia (4). 1.5 cases of the gestational trophoblastic disease per 1000 births was reported during
a seven-year-period at the Department of Gynaecology and Obstetrics, Clinical Centre Serbia (5). In
our country, however, the incidence of gestational
trophoblastic disease cannot be precisely reported
since there is neither a register of disease nor a disease specific program and management protocol.
Since HCG is synthesized in syncytiotrophoblast,
it is a significant indicator of its functional condition. Due to trophoblast proliferation, ever present
in molar chorionic villi, HCG titer is increased
although absolute titer value by itself is not a reliable
evidence of hydatidiform mole presence (1).
Normal trophoblast differentiation and function
during an implantation and placentation are of
great importance for a successful pregnancy, while
disorders in those processes contribute to development of numerous pathologic pregnancies including
the gestational trophoblast disease (6). Abnormal
trophoblast hyperplasia is a requirement for the diagnosis of molar pregnancy (7). In practice, it has
been observed that correlation between histological
appearance of mole and its clinical course has not
been constant and absolute. The well differentiated
mole can have a malignant course while anaplastic
mole can be innocent (8).
According to recent studies, most of the authors
found numerous complications in molar pregnancy
(9). Molar pregnancies are considered as premalignant lesions since they can be malignantly altered.
Approximately 15%-25% of mole develops into an
invasive mole and 3%-5% into choriocarcinoma (10).
The gestational choriocarcinoma is preceded by a hydatidiform mole in 30% to 60% patients which is
1000 times higher than after a normal pregnancy (8).
http://www.jhsci.ba
The aim of this study was to investigate the importance of determining serum human chorionic
gonadotropin levels as well as the importance of
pathomorphologic analysis of trophoblast changes
as a source of HCG with a goal of using those
methods in diagnostics.
Participants and Methods
This was a retrospective study which included 70

pregnant women diagnosed with hydatidiform mole
or with physiological pregnancies spontaneously
aborted. Based on survey results and a patients file,
diagnostic test data were processed while findings
were pathohistologically verified at the Department
of Pathology, UCC Tuzla. The pregnant women
were reported to have almost similar demographic
characteristics and were included in two groups.
35 pregnant women with a molar pregnancy diagnosed during the first trimester treated by evacuating the molar tissue by uterine suction or curettage
were included in the study group.
35 pregnant women with physiological pregnancy
spontaneously aborted during the first trimester
treated by uterine suction or curettage were included in the control group.
Molar pregnancy diagnosis was suggested by detailed patient history; gynaecological and ultrasound
examination; serum HCG level and pathohistological tissue verification after an evacuation of the
uterine cavity.
Inclusion criteria: 1) singleton pregnancy, 2) gestational age until the 12th week (the first trimester), 3)
reliable gestational age (exact date of the last menstrual period, early ultrasound examination), 4) molar pregnancy diagnosis, 5) physiological pregnancy
terminated by miscarriage due to cervical insufficiency.
Specific serum HCG levels were noticed in all
pregnant women (study and control group) before a
pregnancy termination, which were determined by
a quantitative HCG assay (the Architect total
HCG) using ARCHITECT CI 800. Blood samples
were extracted from a cubital vein according to a
standard procedure. Available data were compared
with reference values for a gestational age (11).
Conception tissue obtained after the suction curettage of the cavum uteri was fixed in buffered formaldehyde solution (pH 7.2-7.4), paraffin embedded,
124
http://www.jhsci.ba
while 4m tick histological sections were stained by

haematoxylin and eosin method to examine the basic light-microscopic morphological characteristics.
Derived values were processed by standard statistical methods such as calculation of mean and standard deviation or median and interquartal range
depending on data distribution. The chi-square test
was used for determining differences in distribution
of cross-section qualitative variable (independent
distribution). ANOVA was used to test equality of
arithmetic mean of quantitative variable and a factor.
The results are shown in tables and graphs but also
in clear written presentation with numerical analysis.
Standard level of significance p<0.05 was chosen as
the statistical significance and non-parametric statistical tests the Mann Whitney test, X test and Fisher
test were also used for evaluation.
RESULTS
Serum HCG Values
The average HCG levels are shown in Table 1 and

Figure 1. The average HCG levels in the study
FIGURE 1. Average HCG levels in the groups according to

a gestational age
group was 60191.37 mIU/L and in the control

group 2021.76 mIU/L.
Based on the standard level of significance p< 0.05
with the risk of 5%, it can be concluded that there
was a statistically significant difference in the average HCG levels between the groups. Therefore,
the higher average HCG level was recorded in the
study group.
TABLE 1. Difference in average HCG levels between groups

Observed Characteristics
Serum HCG value
Hydatidiform Mole
60191.37 49662.75
Physiological Pregnancy
2021.76 2974.73
df1
df2
68
47.846
0.000
TABLE 2. Number and Characteristics of Pregnant Women according to Pathomorphologic Trophoblast Characteristics
Trophoblast
Proliferation
Amount
Trophoblast
Proliferation
Mass
Types of
Atypia
Observed characteristics
Moderate
Mild
Pronounced
Total
Moderate
Mild
Pronounced
Total
Moderate
Mild
Pronounced
Total
F
10
20
5
35
10
9
16
35
18
15
3
35
%
28.57
57.14
14.29
100.00
28.57
25.71
45.71
100.00
51.43
42.86
8.57
100.00
125
Molar Pregnancy (35)

Chi square
Df
10.00
0.0070
2.46
0.2930
12.40
0.0020
http://www.jhsci.ba
DISCUSSION
The most important part of routine preoperative diagnostic screening of molar

pregnancy is a quantitative HCG level
measurement as well as measurement
of its subunit . The hyperplastic trophoblastic epithelium, either normal
or atypical, produces increased HCG
levels. The levels exceed those recorded
in an early pregnancy and are substantially above 50000 IU. The upper limit
of HCG values is not determined and
can amount to several hundred thousand IU/L (13). The HCG secretion
is proportional to the amount of viable
FIGURE 2. Relationship between the most significant pathomorphological
changes and HCG levels
trophoblast (14). The literature suggests
to variability in HCG levels in molar
pregnancy. Genest et al. (15) pointed to
Significantly higher HCG levels were recorded in
the preevacuation HCG level over 100000 IU in
pregnant women with hydatidiform mole at all ges46% cases. Menczer (16) reported that 30 (41%) of
tational ages.
74 patients with molar pregnancy showed the preevacuation HCG level over 100000 IU. The presPathomorphological Characteristics of Tro- ent study results suggest that the average HCG
phoblast
serum level in patients with molar pregnancy was
Microscopic characteristics of trophoblastic chori- 60191.37 49662,75 which was statistically signifionic villi in partial mole were examined following cantly higher in comparison with normal pregnancy
the molar pregnancy guidelines according to Genest (2021.76 2974.73). Those obtained results are in
(12). Pathomorphological characteristics were pres- compliance with the results of other studies.
ent only in the study group.
In his study Ben Temime (17) examined 90 cases of
The results of examination of types of atypia, mass
molar pregnancy and noticed that HCG serum
and amount of trophoblast proliferation are shown
levels ranged from 20000 IU/L to 40000 IU/L. Trisin Table 2.
sy (18) described a patient who was at 12th week of
The prevalence of mild atypia was observed in
gestational age and who had HCG level of 59540
57,14% of cases, analyzing the trophoblast atypia in- IU.
cidence. Statistically significant difference in propor- Partial hydatidiform mole is associated with lower
tional prevalence of individual types of trophoblast HCG levels in comparison with complete hydaproliferation mass was not observed. The most prev- tidiform mole. The Soto-Wright study (19) reported
alent was the pronounced trophoblast proliferation
the preevacuationa HCG level over 100000 IU/L
mass in 45.71% of cases. Examining the amount of in only 6% of patients with the partial hydatidiform
villi affected by trophoblast proliferation, the mod- mole, and Berkowitz (20) also reported in 2 (6%)
erate trophoblast proliferation amount was observed
patients of 30.
in 51.43%, which was significantly higher in conCzernobilski et al. (21) reported the preevacuation
trast to the mild trophoblast proliferation amount
urinary level over 300000 IU/L in one (6%) of 17
42.86%.
patients with the partial hydatidifrom mole. In his
The Figure 2 illustrates that among the most sig- study Chechia (22) reported even 91.4% of cases
nificant histopathological villous changes in partial with HCG level over 50000IU/L in 60 examined
hydatidiform mole more than 1/2 cases had high molar pregnancies.
HCG levels.
126
http://www.jhsci.ba
-HCG levels in molar pregnancy do not double

as they should every two days but they are much
higher than in a normal pregnancy. Therefore, dynamic increase of titer should be monitored during
pregnancy especially in the postevacuation period.
Our results also suggest that -HCG serum measurements are vital and reliable parameter for accurate diagnosis of hydatidiform mole. High HCG
levels were recorded in all statistically most significant pathomorphological vilous changes. Its levels
as well as dynamic oscillations in serum values are
the key parameters for disease severity scoring and
further treatments.
The basic functional unit of placenta contains chorionic villi, finger-like projections of chorion, and
terminal villi represent end branches of villous
tree (23). There is epithelium (trophoblast) on the
chorionic villi surface which consists of two clearly
defined layers until the first trimester syncytiotrophoblast and cytotrophoblast. Disorder in regulation of blastocyst invasion is associated with the
most pathological pregnancies (24).
Partial mole appears as a mosaic of normal and
pathologically changed villi, it is characterized by
the existence of a mixture of various villi population consisting of morphologically normal villi and
edematous ones of irregular shape that have cisterns
and trophoblastic hyperplasia (7). Molar pregnancy
is characterized by various degree of hyperplasia and
anaplasia of chorionic epithelium (25). Trophoblast
proliferation was present in all examined mole. Mild
trophoblast proliferation typically matching a gestational age was noticed in a normal pregnancy. However, it was not considered to be pathological.
Abnormal, nonpolar trophoblast hyperplasia was
present in molar pregnancy and it was almost always
local and less pronounced then in complete mole.
It was usually multifocal rather than circumferential
showing a lace-like patter or vacuolar appearance
resembling cell cavities (7). Presence of trophoblast
proliferation in partial mole was suggested by numerous authors (7,12,26).
Unlike a normal pregnancy, presence of trophoblast atypia was observed in all cases with partial
mole. Mild atypia was statistically most significant
(57.14%) in comparison with moderate (28.57%)
and pronounced (14.29%). Montes (27) in his
study on trophoblast atypia incidence reported the
focal atypia in 5% cases out of 22 spontaneously

aborted pregnancies, predominantly focal in 40%
of 30 partial mole out of which 33% moderate and
7% pronounced, and predominantly diffuse in 87%
of 47 cases of complete mole.
Abnormal trophoblast hyperplasia is a requirement
for the diagnosis of molar pregnancy (7). An atypical patter of trophoblast hyperplasia with peripheral
or multifocal pattern rather than the polar accentuation seen in a normal first trimester placenta seems
to be the important diagnostic feature for partial
mole (28).
Examining trophoblast proliferation mass in our
study, we noticed that the pronounced one prevailed
in 45.71% of cases, while moderate and mild were
observed in 28.57% and 25.71% of cases respectively. The amount of villi affected by trophoblast
proliferation was the most significant in moderate
(51.43%).
Salafia (29) reported the highest percentage of moderate mass and amount of trophoblast proliferation.
Of 20 examined partial mole, Jaffar (30) reported
focal and diffuse trophoblast proliferation in 75%
and 15% cases respectively.
The results on the presence of variability of villous trophoblast were also reported by the authors
(26,31). The presence of three types of trophoblast
proliferation in molar pregnancy was suggested by
Ishikawa (32).
There are great differences in mass and amount of
trophoblast proliferation atypia in certain pathological pregnancies. Supporting the idea, Park and Lees
in 1950 quoted: Morphologically, trophoblast with
benign future is completely similar to trophoblast
with malignant future (25). Therefore, the material obtained by curettage after the molar tissue has
been evacuated is of a great importance in diagnostics. The tissue is the most significant evidence of the
extent to which the chorionic epithelium invaded a
wall of the uterus and blood vessels indicating damaging effects as well as clinical potential of mole (25).
Hydatidiform mole with pronounced trophoblastic
cells hyperplasia indicates to a precancerous condition, i.e. a state associated with a significantly increased risk of cancer. Choriocarcinoma occurs to
ten times more frequently after the pregnancy with
hydatidiform mole then in normal pregnancy (1).
Risk of developing cancer is six times lesser with
127
partial mole then it is seen with complete mole (10).

Since we recognized the typical microscopic trophoblast characteristics of molar pregnancy according to
(12), it can be concluded that the pathomorphologic
analysis of evacuated tissue is a reliable indicator as
well as a gold standard for partial mole diagnostics.
CONCLUSION
http://www.jhsci.ba
tial diagnosis ploidy and molecular studies and gold standards for diagnosis. Int J Ginecol Pathol. 2001;20(4):355-322.
13. Petronijevi A, Kesi V. Gestacijske trofoblastne bolesti. U: Dinulovi DS.
Opstetricija. Slubeni list SRJ, Beograd, 1996; 522-543.
14. Hertz R. Choriocarcinoma and related Gestational Ttrophoblastic Tumors
in women. Raven Press, New York, 1978.
15. Genest DR,Laborde O, Berkowitz RS,Goldstein DP, Bernstein MR, Lage
J. A clinico-pathologic study of 153 cases of complete hydatidiform mole
(1980-1990): Histologic grade lacks prognostic significance. Obstet Gynecol. 1991;78:402-409.
16. Menczer J, Modan M, Sea DM. Prospective follow-up of patients with hydatidiform mole. Obstet Gynecol. 1980;55:346-9.
-HCG level measurements and pathomorphological analysis of trophoblast changed villi are significant in diagnosis of early disease stages enabling
making the right treatment decisions as well as reducing morbidity and mortality.
18. Trissy Chun, Dickman E. Molar pregnancy. West Jemerg Med. 2010;11(2):
228
19. Soto-Wright V, Bernstein MR, Goldstein DP, Berkowitz RS. The changing clinical presentation of complete molar pregnancy . Obstet Gynecol.
1995;86:775-779.
The authors declare no conflict of interest
20. Berkowitz RS, Goldstein DP, Bernstein MR. Natural history of partial molar
pregnancy. Obstet Gynecol 1985; 66: 677-681.
17. Riadh BT, Chechia A, Hannachi W, Attia L, Makhlouf T, Koubaa A. Clinical

analysis and Management of gestational trophoblastic disease: A90 cases
study. International Journal of Biomedical Science 2009;5(4):321-325.
21. Czernobilsky B, Barash B, Lancet M. Partial moles: A clinicopathologic

study of 25 cases. Obstet Gynecol. 1982;59:75-77.
REFERENCES
1. Goldstein DP. Gestational trophoblastic neoplasia: Where we came from,
where we stand today, where we are heading. Keynote adress. J Reprod
Med. 2010;55(5-6):184-193.
2. Haller H. Gestacijska trofoblastina bolest. U: Kuvai I, Kurjak A, elmi J
i suradnici Porodnitvo. Medicinska naklada Zagreb, 2009;257-259.
22. Chechia A, Koubaa A, Makhlouf T, Terrask, Hamouda B, Mezni F. Mollar

pregnancy. Retrospective study of 60 cases in Tunisia. Tunis Med. 2001;79
(8-9):441-446.
23. Kaufman P, Sendek, Schweikhartg. Classification of human placental villous tree. Bibl Anat. 1979;22:29-39.
24. Cross JC. Placental function in developement and disease. Reprod Fertil
Dev. 2006;18:71-6.
3. Shih IM. Gestational trophoblastic neoplasia: pathogenesis and potential

therapeutic targets. Lancet Oncol. 2007;8(7):642-650.
4. Grgurevi M. Trofoblastna bolest. U: Draani A i sur. Porodnitvo.
kolska knjiga Zagreb, 1994; 242-248
5. Lazovi B, Milenkovi V, Mirkovi Lj. Morbiditet i mortalitet pacijentkinja oboljelih od gestacijske trofoblastne bolesti na klinici za ginekologiju i akuerstvo Klinikog centra Srbije od 2000. do 2007. Med Pregl.
2011;64(11-12):579-582.
25. Robbins SL. Patologijske osnovne bolesti. N.B. Saunders Co. Philadelphia-London-Toronto Mazur MT, Kurman RJ.Gestational trophoblastic disease. IN: Sthrnberg SS, Mills SE.Editors. Surgical pathology of the female
reproductive system and peritoneum. Raven press: New York, 1991.
26. Sebire NJ. Hystopathologyical diagnosis of hidatidiform mole:contemporary
features and clinical implications. Fetal Pediatr Pathol. 29(1):1-10
6. Pereza N, Ostoji S. Funkcionalna nejednakost roditeljskih genoma u etiologiji gestacijskih trofoblastinih bolesti. Medicina. 2008;44(1):22-37.
27. Montes M, Roberts D, Berkowitz RS, Genest DR. Prevalence and significance of implantation site throphoblastic atypia in hydatidiform moles and
spontaneous abortions. AMJ Clin Pathol. 1996;105(4):411-416.
7. Sebire NJ, Fisher RA, Ress CH. Histopathological diagnosis of partial and
complete hydatidiform mole in the first trimester of pregnancy. Pediatric
and developmental pathology. 2002;69-77.
28. Howat AJ, Beck S, Fox H, Harris SC, Hill AS, Nicholson CM et al. Can
histopathologists reliably diagnose molar pregnancy? J Clin Pathol.
1993;46(7):599-602.
8. Berkowitz RS, Goldstein DP. Gestational trophoblastic disease. In: Berek

JS. Novaks Gynecology. Lippincott Philadelphia, 2003;pp1353-1374.
29. Salafia C, Maier D, Vogel C, Pezzullo J, Burns J, Silberman L. Placental

and decidual histology in spontaneous abortions: Detailed description and
correlations with chromosom number. Obstet Gynecol. 1993;282-295.
9. Lurain JR. Gestational trophoblastic disease. In: Epidemiology, pathology,

clinical presentation and diagnosis of gestational trophoblastic disease, a
management of hydatidiform mole. Am J Obstet Gynecol. 2010;203(6):531539.
10. Berkowitz RS, Goldstein DP, Bernstein MR. Reproductive experience after
complete and partial molar pregnancy and gestational trophoblastic tumors.
J Reprod Med. 1991;36(1):3-8.
11. Kurjak A. Ginekologija i perinatologija. Naprijed, Zagreb,1989.
12. Genest DR. Partial hydatidiform mole:Clinicopathological features differen-
128
30. Jaffar R, Kalsoom R, Quershi A. Histopathological reviev of partial and

complete hydatiform moles in a tertiari care hospital, Lahore-Pakistan. Biomedika. 2011;27:76-80.
31. Mazur MT, Kurman RJ. Gestational. Can histopathologists reliably diagnose molar pregnancy? Am J Obstet Gynecol 1991;164:1270-1277.
32. Ishikawa N, Haraba Y, Tokuyasu Y, Nagasaki M, Maruyama R. Reevalution
of the histological criteria for complete hydatidiform mole: Comparasion
with the immunohistohemical diagnosis using p 57KIP2 and CD34. Biomedical Research. 2009;30(3):141-147.
http://www.jhsci.ba
Lejla Muminhodi et al. Journal of Health Sciences 2013;3(2):129-137

RESEARCH ARTICLE
Open Access
Epidemiological Factors and Pathomorphologic

Characteristics of Hydatidiform Mole
Lejla Muminhodi*, Gordana Bogdanovi, Denita Ljuca, Adnan Babovi
Department of Gynecology and Obstetrics, Universitiy Clinical Centre Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina
ABSTRACT
Introduction: Hydatidiform mole is a gestational trophoblastic disease characterized by a range of disorders of abnormal trophoblastic proliferation.
Methods: This was a retrospective study of 70 singletone pregnancies until the 12th week of gestational
age diagnosed with hydatidiform mole or spontaneously aborted physiological pregnancy. The pregnant
women had almost similar demographic features and were divided into two groups. 35 pregnant women
with a molar pregnancy were included in the study group; while 35 pregnant women with physiological
pregnancy spontaneously aborted were included in the control group. Analyzed parameters included a
pregnant womans age, blood type, parity and previous pregnancies (course and outcomes).
Results: In the study group 11.43% of cases had hydatidiform mola during previous pregnancies as well
as the advanced average gestational age of an ongoing pregnancy (9.631.83 in contrast to 8.252.03
in the control group). The pregnant women with the hydatidiform mole were reported to have statistically
significantly greater number of irregular villous borders (71.43%); slightly enlarged villi (54.29%); moderated presence of cisterns (65.71%) as well as mild avascularisation of villi (57.14%).
Conclusion: It was concluded that a previous molar pregnancy represents the highest risk for hydtidiforme mole and the pathomorphologic analysis of vilous changes can be a reliable parameter for establishing proper diagnosis of partial hydatidiform mole.
Keywords: hydatidiform mole, epidemiologic factors, resorption villi
INTRODUCTION
Hydatidiform mole is a gestational trophoblastic

disease characterized by a range of disorders of abnormal trophoblastic proliferation. Based on dif-
*Corresponding author: Lejla Muminhodi; Department of

Gynecology and Obstetrics, Universitiy Clinical Centre Tuzla,
Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina;
Phone: + 387 61 187 234;
e-mail: lejla.muminhodzic@bih.net.ba
Submitted 21 March 2013 / Accepted 7 May 2013.
ferences in morphology, histopathology, karyotype

and clinical features, hydatidiform mole can be categorized into partial and complete moles. A partial
mole (25-45% of all molar pregnancies) is characterized by a partial degeneration of villi while trophoblast proliferation is focally pronounced (1).
Molar pregnancy incidence varies across countries.
The incidence of molar pregnancy in Asia is 1:100300, choriocarcinoma 1:1000-2000 of live born
children; while the incidence of molar pregnancy
in the countries of America and Europe is 1:1500-
2013 Lejla Muminhodi et al.; licensee University of Sarajevo - Faculty of Health Studies.
2000, and choriocarcinoma 1:20000-40000 of live

born children (2). However, the precise incidence
date cannot be reported for Bosnia and Herzegovina.
Limited data are available regarding risk factors for
the occurrence of partial mole associated with oral
contraception, irregular menstrual cycles, higher educational levels, smoking, history of molar pregnancy resulted in a live born male infant (3). Hydatidiform mole risk is more likely for pregnant women
aged over 35 (4) and in women with the blood type
A (5). Recurrent hydatidiform mole occurred in approximately 0.5-2.5% women in a subsequent pregnancy. The risk of invasive mole or choriocarcinoma
is substantially increased in those women (6). Partial
mole appears as a mosaic of normal and pathologically changed villi, it is characterized by the existence
of a mixture of various villi population consisting of
morphologically normal villi and edematous ones
of irregular shape that have cisterns and trophoblastic hyperplasia (7). Hydatidiform mole is also
characterized by complications which could affect
the womans health: the likelihood of disseminated
intravascular coagulation with excessive bleeding;
risk of perforation and infection during the removal
of molar tissue from the uterus (4). Hydatidiform
mole was benign in 75-80% patients and was spontaneously reduced after the uterine evacuation. The
molar pregnancies, however, are regarded as premalignant lesions as well. Approximately 15-25% of
moles developed into invasive moles, and 3-5% into
a choriocarcinoma (8). Gestational choriocarcinoma was preceded by hydatidiform mole in 30-60%
of cases which was 1000 times greater than after a
normal pregnancy (4).
METHODS
This was a retrospective study which included 70

pregnant women diagnosed with hydatidiform
mole or with physiological pregnancies spontaneously aborted. Based on survey results and a patients
file, diagnostic test data were processed while findings were pathohistologically verified. The pregnant
women were reported to have almost similar demographic characteristics and were included in two
groups. 35 pregnant women with a molar pregnancy
diagnosed during the first trimester treated by evacuating the molar tissue by uterine suction or curettage were included in the study group. 35 pregnant
women with physiological pregnancy spontaneously
http://www.jhsci.ba
aborted during the first trimester treated by uterine

suction or curettage were included in the control
group. Inclusion criteria: 1) singleton pregnancy, 2)
gestational age until the 12th week, 3) reliable gestational age (exact date of the last menstrual period,
early ultrasound examination), 4) molar pregnancy
diagnosis (history, gynecological and ultrasound
examination, serum HCG levels and pathohystological tissue verification).
Analyzed parameters included age, blood type, parity and previous pregnancies (course and outcomes)
and a gestational age of an ongoing pregnancy.
Conception tissue obtained after the suction curettage of the cavum uteri was fixed in buffered formaldehyde solution (pH 7.2-7.4), paraffin embedded,
while 4m tick histological sections were stained by
haematoxylin and eosin method to examine the basic light-microscopic morphological characteristics.
Derived values were processed by standard statistical methods such as calculation of mean and standard deviation or median and interquartile range
depending on data distribution. Standard level of
significance p<0.05 was chosen as the statistical significance statistical tests the Mann Whitney test, X
test and Fisher test were also used for evaluation.
RESULTS
Pregnant Women Age
Information on a number and characteristics of

patients in both groups according to their age are
shown in Figure1.
The prevalent age was between 30 and 34 years in the
study group, while the prevalent age was 35-39 years
in the control group. There were 2.86% of pregnant
woman aged over 40 years in the study group, which
was not, however, recorded in the control group.
The obtained results and the collected data show
that the average age was 29.92 years in the study
group with the average deviation of 7.96 years. The
most frequent age in the study group was 33 years
while the median age was 30 years. The youngest
pregnant woman was 17 years old, and the eldest
one was 46 years old, in the study group, while the
age range was 29 years.
130
http://www.jhsci.ba
the median age was 27 years. The youngest and the

eldest pregnant woman in the control group were
17 and 40 years old respectively, while the age range
was 23 years.
Based on the results of the hypothesis test of difference of the median value in the groups, the empirical measure p>0.05 was determined at the significance level, which was used for testing a variable Age
indicating that differences in average age between
the groups were not statistically significant.
Parity characteristics
Table 2 displays the characteristics of pregnant

women in the groups according to parity.
The p value in all parities was >0.05 at the significance level indicating that the statistically significant difference in the relative modality between the
groups was not observed.
FIGURE 1. Characteristics of pregnant women according to

their age
The average age was 28.63 years in the control group

with the average deviation of 8.17 years. The most
frequent age in the control group was 22 years while
TABLE 1. Average pregnant womans age
Age
Hydatidiform Mole
29.92 7.96
28.63 8.17
Total
29.27 8.03
df1
df2
68
0.445
0.507
TABLE 2. Number and characteristics of patients according to parity and group

Parity
Primipara
Multipara
Grand multipara
Total
Patient group
F
%
17
48.57
14
40.00
4
11.43
35
100.00
Molar Pregnancy
f
%
19
54.29
14
40.00
2
5.71
35
100.00
Total
f
36
28
6
70
p
%
51.43
40.00
8.57
100.00
0.632
1.000
0.391
TABLE 3. Number and characteristics of pregnant women according to a type of miscarriage and hydatidiform mole prevalence
in a previous pregnancy
Previous Pregnancy
Miscarriage type
Spontaneous abortion
Induced abortion
Spontaneous and
induced abortions
Total
Hydatidifrom mole in a previous pregnancy
Molar
Pregnancy (35)
f
%
9
25.71
6
17.14
PATIENT GROUP
Physiological
Pregnancy (35)
f
%
10
28.57
6
17.14
Total (70)
f
19
12
%
27.14
17.14
0.250
1.000
8.57
0.00
4.29
0.070
18
4
51.43
11.43
16
0
45.71
0.00
34
4
48.57
5.71
0.810
0.034
131
http://www.jhsci.ba
TABLE 4. Number and characteristics of patients according to number and gestational age of spontaneous abortions
PATIENT GROUP
Physiological
Pregnancy (35)
f
%
2
5.71
1
2.86
1
2.86
2
5.71
3
8.57
1
2.86
10
28.57
Molar
Pregnancy (35)
F
%
3
8.57
4
11.43
0
0.00
1
2.86
1
2.86
0
0.00
9
25.71
Gestational age of spontaneous

abortions
6-7 weeks
8-9 weeks
10-11 weeks
12-13 weeks
14-15 weeks
17-18 weeks
Total
Total (70)
F
5
5
1
3
4
1
19
%
7.14
7.14
1.43
4.29
5.71
1.43
27.14
0.642
0.158
0.310
0.554
0.299
0.310
0.788
TABLE 5. Difference in the average gestational age of spontaneous abortions in the groups
Gestational age of previous
spontaneous abortions
Hydatidiform Mole
Total
df1
df2
9.00 2.55
11.70 3.77
10.42 3.45
17
3.26
0.089
df1
df2
68
8.783
0.004
TABLE 6. Difference in the average gestational age of pregnancy in the groups

Gestational age
Hydatidiform Mole
9.63 1.83
8.25 2.03
Unfavourable Obstetrical History
The number and type of previous miscarriages and

hydatidiform mole prevalence in previous pregnancies in the groups are shown in Table 3.
Analyzing the miscarriage type and number in previous pregnancies, the statistically significant difference in the relative prevalence between the groups
was not observed. 4 (11.43%) cases of the same
complications as in a previous pregnancy were reported in the study group.
Total
8.94 2.04
cally significant difference in the average gestational

age of spontaneous abortions in the groups is shown
in Table 5.
The statistically significant differences in the average
gestational age of spontaneous abortions between
the study and control group were not observed,
based on the test results p>0.05 at the reliability
level of 95% or the risk of 5%. Whereas at the reliability level of 90% or the risk of 10%, the statistically significant differences in the average gestational
age of spontaneous abortions were observed.
Gestational Age of Previous

Spontaneous Abortions
Gestational Age of Pregnancy
Gestational age of previous pregnancies spontaneously aborted in women with hydatidiform mole
and miscarriage is displayed in Table 4.
The most frequent spontaneous abortions in the molar and physiological pregnancy were recorded in the
8th and 9th week and in the 14th and 15th week of
pregnancy respectively.
The results obtained testing the presence of statisti-
The statistically significant differences in the average gestational age of pregnancy between the study
and control group were observed, based on the test
results p>0.05 at the reliability level of 95% or the
risk of 5%.
Blood Type and Hydatidiform Mole
The pregnant women examined according to their
132
http://www.jhsci.ba
TABLE 7. Number and characteristics of patients according to the blood type
Blood type
Observed variable
"0"
"A"
"B"
"AB"
Total
PATIENT GROUP
Physiological Pregnancy (35)
F
%
10
28.57
11
31.43
9
25.71
5
14.29
35
100.00

F
%
8
22.86
14
40.00
8
22.86
5
14.29
35
100.00
TOTAL (70)
F
18
25
17
10
70
%
25.71
35.71
24.29
14.29
100.00
X2 = 0,641; v=3; p=0.887
TABLE 8. Number and characteristics of patients according to pathomorphological characteristics
Cisterns and
their type
Villous enlargement
Villous
borders
Smooth and regular
Irregular
Markedly irregular
Total
Pronounced
Mild
Moderate
Total
No cisterns
Pronounced cisterns
Moderate cisterns
Total
f
1
25
9
35
4
19
12
35
2
10
23
35
%
2.86
71.43
25.71
100.00
11.43
54.29
34.29
100.00
5.71
28.57
65.71
100.00
25.60
Df
2
p
0.0000
9.66
0.0080
19.26
0.0000
blood type and their groups (study and control) are

shown in Table 7.
A contingency table displays that the statistically significant difference in prevalence of individual modalities was not observed.
villi (54.29%); moderate cisterns (65.71%); mild

avascularisation of villi (57.14%).
Pathomorphological Characteristics
of Hydatidiform Mole Villi
Age is a likely risk factor for hydatidiform mole in

addition to the geographical variations. The lowest hydatidiform mole incidence was reported in
women between age 25 and 29 years (10). Risk of
hydatidiform mole was tenfold increased in women
conceiving at maternal age under 16 or after 40
years (11). Sebire (7) reported ten to twenty fold
increased risk of molar pregnancy in women conceiving under age 15; for women aged over 45 and
50 the risk was 20 times higher; for women over 50
the risk was even 200 times higher. Failure in fertilization might be one of the causes. The younger
DISCUSSION
Pregnant Women Age
The typical microscopic characteristics were examined following the guidelines according to Genest
(9).
Table 8 displays the pathomorphologic characteristics seen only in the study group. However, the variables presented below were not seen in the control
group.
The prevalence of hydatidiform mole villi is statistically significant having the following characteristics:
irregular borders of villi (71.43%); slightly enlarged
133
women more frequently have triploid conceptions,

while the maternal triploid occurs more frequently
in elderly patients.
In this study, maternal age ranged from 17 to 46
years and 17 to 40 in hydatidiform mole and in
physiological pregnancy respectively. The most
frequent incidence was seen at age 30 to 34 years
(28.57%) in the study group, and at age 35 to 39
years (31.43%) in the control group.
The average age of the study group was 29.927.96
years, and of the control group was 28.638.17 years
thus, the difference between the groups was not significant. In the study conducted by Osamur, the
average age was 28 years (12), and in the Khabouse
study it was 28 years (13). The molar pregnancy
prevalence was seen to be higher in elderly women
(14). In his study Ben Temime (15) reported 30% of
patients aged over 35.
In our study we found 22.85% and 2.86% of patients with hydatidiform mole aged 35 to 39 years
and over 40 respectively. The eldest pregnant woman
was 46 years old. However, the difference in relation
to a miscarriage caused by the cervical insufficiency
was not statistically significant.
The molar pregnancy risk was increased in elderly
women and progressively increased with age (8).
The abnormal ovum fertilization is more likely to
occur in elderly women than it is seen in younger
women. The increased risk was particularly seen in
pregnant women aged over 35 and 40 years (1,16).
According to literature date on age as a likely risk
factor, we found that 11.43% and 14.29% of pregnant women were under 20 years in the study and
control group respectively, thus with no significant
difference.
In women under 20 years of age, who are at the
beginning of their reproductive years, the increased
incidence of hydatidiform mole was observed (8).
Other authors described the higher risk of molar
pregnancy in younger women as well (17,4). It was
reported that a relative risk was six time higher for
women under 15 years of age (10). Audu (17) reported 17.5 years of age as the greatest risk for molar
pregnancy, while Hancock (18) reported the twofold higher incidence in teenage women than in
elderly women. Parazzini (19), however, stated that
advanced age increased only the complete mole risk,
but not the partial mole.
http://www.jhsci.ba
Difference in age among the patients in this study

was not observed complying with the study conducted by Slim (20) in which the clear correlation
between the incidence of hydatidiform mole and
maternal age was not observed as well. It might have
been caused by marriage age and pregnancy across
countries, environmental factors or by relatively few
patients.
Parity Characteristics
It is well known that maternal age, parity and difference between births significantly affect both mother
and childs health. Number of births is biologically,
medically and socially significant. Most authors emphasized that the first pregnancy was at the highest
risk (21).
Ben Temime (15) reported the molar pregnancy in
nullipara (28.88%). The similar results were reported by Audu (17) and Altieri (22) as well. In contrast, Nowak (23) reported the higher incidence of
hydatidiform mole among women who had given
more births. Our results indicate that women with
hydatidiform mole who gave birth once prevailed
(54.29%). Women who gave birth once also prevailed in the control group (48.57%). Statistically,
there was no significant difference between the
numbers of births in the groups. The risk of molar
pregnancy is present whether a woman has already
given a birth or not.
Unfavorable Obstetrical History
According to Kuvai (24), the analysis of previous reproductive health is important for assessment
of reproductive health as well as differences in an
ongoing pregnancy. It was noticed in epidemiological studies that previous spontaneous abortions increased the risk of gestational trophoblastic disease
whereas one or more previous pregnancies decreased
it (25).
Although the statistically significant difference in
relative incidence (number and types of spontaneous abortions) was not observed in this study, it was
noticed that spontaneous and induced abortions
prevailed in the study group (8.57%), while spontaneous abortions prevailed in the control group (1927.14%). The cervical insufficiency which causes a
spontaneous abortion apparently had been present
before an ongoing pregnancy causing its negative
outcome.
134
http://www.jhsci.ba
Hydatidiform mole was recognized as the risk factor for spontaneous abortion (8). The majority of
molar pregnancies were discovered by warning signs
indicated a threatened or started spontaneous abortion (11). In his study Kashanian (26) reported the
increased risk of mole in women who had history of
two or more miscarriages. Rezavanet (27) reported
14.5% of patients with hydatidiform mole who had
previous spontaneous miscarriages in contrast to
9.5% of non-molar pregnancies. However, the difference was not statistically significant.
Investigating the gestational age of previous spontaneous abortions, we found that the majority of pregnant women with molar pregnancy had had spontaneous abortions in the 8th and 9th (11.43%), whereas
the majority of pregnant women with physiological
pregnancy had had previously spontaneous abortion
in the 14th and 15th week (8.57%).
The prevalence of spontaneous abortions at advanced gestational age in the control group proved
the theory that the cervical insufficiency is a factor
which causes termination of pregnancy but not insufficiency of yellow body or hormonal abnormality.
History of hydatidiform mole in previous pregnancy
was recognized as the risk factor in literature it is a
predisposition to another molar pregnancy. Women
who had molar pregnancy were at risk of recurrence
in a subsequent pregnancy (27). Moreover, the recurrence of molar pregnancies was likely to occur
at random after one or more normal pregnancies
regardless of a partner (1).
According to Grgurevi (11) women who suffered
from mole had 20 to 40 times greater risk of a recurrent molar pregnancy, and the similar results were
reported by Audu (17).
We found that 4 (11.4%) patients had a history of
previous molar pregnancy, and 1 (2.85%) patient
had two previous molar pregnancies. These findings
are in accordance with the study conducted by Sebire
(28) suggesting that the risk of recurrence in patients
who had two previous molar pregnancies increased
10% to 20%. Recurrent molar pregnancy increased
the risk of choriocarcinoma as well (28). Rezavanet
(27) in his study reported history of previous molar
pregnancy in 2.5% of cases, while Ben Temime (15)
in 3.3% of cases. In Garret study (29) in the US,
hydatidiform mole recurrence was likely in 1.2% of
cases, and in Vakili study (30) 1.2%. Lorigan study
(31) emphasized that women with history of molar

pregnancy had greater risk of proliferation. Potential
reasons might have been the presence and continuance of previous causes of molar pregnancy (genetic,
environmental and diet).
Blood Type and Hydatidiform Mole
Bagshawe (5) and Berkowitz (4) suggested the

blood type A as a risk factor for molar pregnancy.
In the study group, 40% of pregnant women had
the blood type A, regarded as a risk factor in literature. However, differences in blood types were not
statistically significant. In Rezavanet study (27) the
blood type 0 prevailed due to its predominance in
population. He further suggested that discrepant
study results were indicated by various blood types
in regions, which might be applied to an interpretation of our results.
Gestational Age of Pregnancy
Hydatidiform mole, a pathological condition, affects the course of a normal pregnancy (32). Our
results on gestational age of pregnancy in partial
mole and physiological pregnancy terminated by
spontaneous abortion indicate to the prevalence of
advanced gestational age in molar pregnancy. According to Ben Temime (15) in 81.24% of patients
molar pregnancy was diagnosed between the 8th and
16th weeks. Our results suggest that spontaneous
abortions, caused by the cervical insufficiency, may
have some typical symptoms rather than signs indicated the molar disorder. Gestational age of pregnancy is an important parameter for establishing
diagnosis of molar pregnancy since the reliability of
diagnostic methods significantly increases with gestational age (8).
135
Pathomorphologic Analysis
Hystophathologically, the partial hydatiform mole

was diagnosed when four microscopic features coexist: 1) two populations of villi; 2) enlarged villi
(more than 3 to 4 mm with central presence); 3) irregular villi with geographical divided borders with
trophoblastic inclusions; 4) trophoblastic hyperplasia usually focal and with syncytiotrophoblast (9).
Partial hydatidiform mole or transitional mole occurs when a normal egg is fertilized by two sperms
or by one diploid sperm. The developed tissue might
be larger than expected for a gestational age (33).
Partial mole appears as a mosaic of normal and

pathologically changed villi, it is characterized by
the existence of a mixture of various villi population consisting of morphologically normal villi and
edematous ones of irregular shape that have cisterns
and trophoblastic hyperplasia (7). In this study, we
found in all examined partial hydatidiforme moles
the enlarged villi, statistically slightly enlarged
(54.29%). The results comply with the results reported by other authors, thus Fowler (34) reported
diameter of villi to be statistically significantly greater in partial mole, while. Howat (35), in the study of
histological examination, reported 50 cases of molar
pregnancy.
We also found the evidence that only particular villi
were changed in partial mole. In all examined moles,
the presence of normal villi was seen in this study as
well, which was also reported by other authors (36).
Sebire (37) is his study emphasized the importance
of villous dysmorphism, and Szulman (33) reported
dual populations of villi. The enlarged villi were
not seen in physiological pregnancies reported by
Van Lijnschoten as well (38). However, Salafia (39)
found mild/moderate enlarged villi in 35% of cases
and markedly enlarged in 20% of cases in spontaneously aborted pregnancies with no chromosome abnormalities. According to Sebire (7) the enlarged hydropic villi in molar pregnancy usually had irregular
outline, while in spontaneously aborted pregnancies
the enlarged villi were of a round outline with hypocellular villous stroma on cross section.
Examining villous borders, we found statistically
great number of irregular ones (71.43%) in contrast
to 100% of smooth and regular ones in physiological pregnancies. Sebire (7) reported that in partial
mole the enlarged hydorphic villi can have abnormal irregular jagged-like appearance with cleft formation, and round or oval pseudo inclusions are
often present in some cross sections of villi.
Microscopically, the one of main characteristics of
molar pregnancy is the hydropic swelling of chorionic villi. The villi consist of loose mucous edamotouse storma (40).
The great number of moderate cisterns (65.71%)
were seen in this study. Cisterns, however, were not
noticed in physiological pregnancies. Mild cisterns
in partial mole were also reported by Salafia (39).
Examining pathomorphological changes in partial
http://www.jhsci.ba
mole, Jaffar (14) found cisterns present in 80% of

cases.
In earlier studies, the hydropic swelling of villi (cisterns) were suggested to be the most significant
characteristic of conception affected by the molar
disease. The degree of hydropic changes was less pronounced and incomplete during the first trimester
(7). Therefore, this explains the greater number of
moderate cisterns in contrast to pronounced once
seen in this study. There was not enough time for
complete hydropic degeneration of villi in an earlier
gestation. Nonexistence of cisterns in physiological
pregnancies in our study complies with the results
reported by Funkunaga (41). He found hydropic
degeneration of villi and focal hyperplasia only in
pregnancies spontaneously aborted with abnormal
karyotype.
The presence of villous avascularity was seen in all
examined molas especially statistically the great
number of slightly avascular ones (57.14%), in contrast to moderate ones (34,29%). The similar results
were reported by other authors (7.39). Normal villi
in physiological pregnancies were vascularised in
100% of cases. Salafia (39) reported a normal villous
circulation in 46% and 59% of euploid and aneuploid spontaneous abortions respectively.
Amnion and fetus elements might be present in partial mole, and chorionic villi usually have blood vessels frequently containing fetal nucleated red blood
cells. In some cases angiomatoid change might be
seen focally with advancing gestational age appearing as dilated vessels with thick walls within swollen
villi (42).
CONCLUSION
Risk factors were the most likely present in patients

who had mole in previous pregnancies, symptoms
were more typical for advanced gestational age; however, differences in age, parity and blood type were
not observed. Chorionic villi of hydatidiform mole
show typical pathomorphologic changes that are an
important factor for establishing a proper diagnosis.
The proper diagnosis is important in the successful
management and prevention of complications of
hydatidiform mole. Further education of women
with molar pregnancies and the follow up after the
treatment are required in order to maintain and improve reproductive health.
136
http://www.jhsci.ba
21. Dinulovi D. Normalni rast. U:Davidovi M, Gari B. Opstetricija. Beograd,

Novinsko izdavaka ustanova, 1996;561-565.
22. Altieri A, Franceschi S, Ferlay J. Epidemiology and an etiology of gestational trophoblastic disease. Lancet Oncol. 2003;4(11):670-8.
REFERENCES
23. Nowak E, Drews K, Spacznski M. Gestational trophoblastic disease.

2000;71(8):767-72.
1. Haller H. Gestacijska trofoblastina bolest. In: Kuvai I, Kurjak A, elmi

J et al. Porodnitvo. Medicinska naklada Zagreb, 2009;257-259.
24. Kuvai I. Spontani i habitualni pobaaji. U: Draani A. Porodnitvo. Zagreb: kolska knjiga, 1994;218-220.
2. Lurain JR. Gestational trophoblastic disease. I: Epidemiology, pathology,

clinical presentation and diagnosis of gestational trophoblastic disease, a
management of hydatidiform mole. Am J Obstet Gynecol. 2010;203(6):531539.
25. Semer DA, Macfee MS. Gestational trophoblastic disease epidemiology.

Semin Oncol. 1995;22:109-15.
3. Schorge Johno et al. Williams Gynecology. New York: Mc Graw Hill Co.
2008;755-756.
JS. Novaks Gynecology. Lippincott Philadelphia. 2003; pp1353-1374.
5. Bagshawe KD. Throphoblastic tumors: diagnostic methods, epidemiology,
clinical features and management. In: Coppleson M (ed) Gynecologic Oncology. Churchill Livingstone. 1992; pp1027-1043.
6. Goldstein DP. Gestational trophoblastic neoplasia: Where we came from,
where we stand today, where we are heading. Keynote adress. J Reprod
Med. 2010;55(5-6):184-193.
7. Sebire NJ, Foskett M, Fisher RA, Ress CH, Seckl M, Newlands E. Risk of
partial and complete hydatiform molar pregnancy in relation to maternal
age. BJOG 2002;109:99-102.
26. Kashanian M, Baradaran HR, Teimour IN. Risk factors for complete molar
pregnancy: A study in Iran. J Reprod Med 2009;54(10):621-4.
27. Rezavanet N, Kamravamanesh M, Safdari Z, Ghodsi F. Study hydatidiform
mole frequency and some of its relevant factors. IJAR. 2011;3(2):834-837.
28. Sebire NJ, Fisher RA, Ress HC. Histopathological diagnosis of partial
and complete mole in the first trimester of pregnancy. Pediatr Dev Pathol.
2003;6: 69-77.
29. Garrett L, Garner E, Feltmate C, Goldstein D. Subsequent pregnancy outcomes in patients with molar pregnancy and persistent gestational trophoblastic neoplasia. J Reprod Med. 2008;53(7):481-6.
30. Vakilli Z, Moudav SGA, Mesdaghi-Nin E, Rasti S. Hydatidiform mole abundancy within the samples sent to pathology laboratories of Kashan city
during 1992-1999. Scientific and research quarterly periodical of Kashan
Medical Sciences and Health Services University. 2002:6(24):64-69.
31. Lorigan P, Sharma S, Bright N. Characteristics of women with recurrent
molar pregnancies. Ginecol Oncol. 2000;78-288.

JS. Novaks Gynecology. Lippincott Philadelphia. 2003; pp1353-1374.
9. Berkowitz RS, Goldstein DP, Bernstein MR. Reproductive experience after
complete and partial molar pregnancy and gestational trophoblastic tumors.
J Reprod Med. 1991;36(1):3-8.
32. Lazovi B, MilenkoviV, Mirkovi Lj. Morbiditet i mortalitet pacijentkinja

oboljelih od gestacijske trofoblastne bolesti na Klinici za ginekologiju
i akuerstvo Klinikog centra Srbije od 2000. do 2007. Med Pregl.
2011;LXIV(11-12):579-582.
10. Genest DR. Partial hydatiform mole: Clinicopathological features differential diagnosis ploidy and molecular studies and gold standards for diagnosis. Int J Ginecol Pathol 2001;20(4):355-22.
33. Szulman AE, Surti U. The syndromes of hydatidiform mole: I. Citogenetic

and morphologic correlation. AM. J Obstet Gynecol. 1987;131:655.
11. Grgurevi M. Trofoblastna bolest. U: Draani A i sur. Porodnitvo.

kolska knjiga Zagreb. 1994;242-248.
34. Fowler DJ, Lindsay I, Selki MJ, Sebire NJ. Histomorphometric features of
hydatigorm mole in early pregancy: relationship to decetabilitiy by ultrasound examination. Ultrasound Obstet Gynecol. 2007;29(1):76-80.
12. Osamor J, Oluwasola A, Adewole I. A clinico-pathological study of complete and partial hydatidiform moles in a Nigerian population. J Obstet
Gynecol. 2002;22(4):413-415.
35. Howat AJ, Beck S, Fox H, Harris SC, Hill AS, Nicholson CM, Williams RA.
Can histopathologists reliably diagnose molar pregnancy? J Clin Pathol.
1993;46(7):599-602.
13. Khabouze S, Erchidi J, Bouchikhi C. Gestational Trophoblastic Disease.

Gynecol Obstet Fertile. 2002;30(1):42-9.
36. Sebire NJ, Ress H, Paradinas F, Seckl M, Newlands E. The diagnostic

implications of routine ultrasound examination in histologically confirmed
early molar pregnancies. Ultrasound Obstet Gynecol. 2001;18:662-665.
14. Jaffar R, Kalsoom R, Quershi A. Histopathological reviev of partial and

complete hydatiform moles in a tertiari care hospital, Lahore-Pakistan. Biomedika, 2011;27:76-80.
37. Sebire NJ. Histopathological diagnosis of hydatiform mole: contemporary

features and clinical implications. Fetal Pediatr Pathol. 2010;29(1):1-10.
15. Ben Temime Riadh, Chechia A, Hannachi W, Attia L, Makhlouf T, Koubaa A. Clinical analysis and Management of gestational trophoblastic
disease: A 90 cases study. International Journal of Biomedical Science.
2009;5(4):321-325.
38. Van Lijnschoten G, Arends J.W, Thunnisshn FBJM, Gerafdts JPM. A morphometric approach to the relation of karyotype, gestational age and histological features in early spontaneus abortions. Placenta, 1994;15(2):189200.
16. Harriet O.S. Gestational trophoblastic disease, epidemiology and tends.

Clin Obstet Gynecol. 2003;46:541-5.
39. Salafia CM, Maier D, Vogelc et al. Placental and deidual histology in spontaneous abortions: Detailed description and correlations with chromosom
number. Obstet Gynecol 1993;82-295.
17. Audu BM, Takai IU, Chama CM, Bukar M, Kyari O. Hydatidiform mole as
seen in a University Teaching Hospital: A 10-year review. J Obstet Gynaecol. 2009;29(4):322-325.
18. Hancock B, Tidy J. Curent management of molar pregnancy. J. Repord
Med 2002;47:347-354.
19. Parazzini F, LA Vecchia S, Pampallona S. Parental age and risk of complate and partial hydatidiform mole. BJOG. 1986;93(4):582-585 .
20. Slim R, Mehio A. The genetics of hydatidiform moles: New lights on an
ancient disease. Clin Genet. 2007;71:25-34.
137
40. Robbins. Mazur MT, Kurman RJ. Gestational trophoblastic disease. IN:
Sthrnberg SS, Mills SE. Surgical pathology of the female reproductive system and peritoneum. Raven press: New York, 1991.
41. Fukunaga M. Is there a correlation between histology and Karyotype in
early spontaneus abortion? Int J Surg Pathol. 1995;2(4):295-300.
42. Paradinas FJ, Fisher RA, Brown P, Newlands ES. Diploid hydatidiform
moles with fetal red blood cells in molar vill. Pathology, incidence and prognosis. J Pathol. 1997;181:183-188.
Saida Fisekovic et al. Journal of Health Sciences 2013;3(2):138-144
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Correlation between serum concentrations of

homocysteine, folate and vitamin B12 in patients
with schizophrenia
Saida Fisekovic1*, Nafija Serdarevic2, Amra Memic1, Raif Serdarevic3,
Sabina Sahbegovic1, Abdulah Kucukalic1
1
Department of Psychiatry, Clinical Center University of Sarajevo, Bolnika 25, Sarajevo, Bosnia and Herzegovina. 2Institute
for Clinical Chemistry and Biochemistry, Clinical Center University of Sarajevo, Bolnicka 25, Sarajevo, Bosnia and Herzegovina. 3Department of Ophthalmology, Clinical Center University of Sarajevo, Bolnika 25, Sarajevo, Bosnia and Herzegovina.
ABSTRACT
Introduction: The role of hyperhomocysteinemia in psychotic disorder can be explained by partial antagonism of homocysteine on NMDA-glycine receptor. Plasma concentration of homocysteine is an indicator of the status of the B-vitamins (folate, B12, B6). Folate deficiency may have different effects on the
neurochemical processes of schizophrenia. This suggests that the association between elevated levels of
homocysteine and schizophrenia is biologically very likely.
Methods: The study was consisted of 20 patients with schizophrenia and 20 healthy controls. We investigated the levels of serum homocysteine concentration using AxSYM (Abbott), levels of folate assay is
two-step immunoassay to determine the presence folate in human serum using CMIA (chemiluminescent
microparticle immunoassay) technology and Axsym Holo Tc is microparticle enzyme immunoassay (MEIA)
for the quantitative determination of human holo TC in serum and determination deficit of vitamin B 12.
Results: The patients group has higher levels of homocysteine in compare with controls group for 3.85
mol/L while the concentration of folate in the group of patients was lower for 9.17 ng/mL. The mean
level of vitamin B-12 in investigation groups were in reference range 19.1-119 pmol/L, but patient group
have lower average concentration of vitamin B-12 lower for 24.81 pmol/L compared to the control group.
Conclusion: Our results showed that homocysteine concentration is inversely proportionate to folate concentration, i.e. as homocysteine concentration in serum increases, folate concentration falls. Shizophrenic
patients with elevated tHcy level and low folate levels should have vitamin supplementation with folic acid.
Keywords: Schizophrenia, homocysteine, folate, vitamin B-12.
*Corresponding author: Prof. Saida Fisekovic, MD, PhD.

Department of Psychiatry, Clinical Center University of Sarajevo
Bolnicka 25. 71000 Sarajevo.
Bosnia and Herzegovina.
e-mail: saida_fisekovic@yahoo.com
Submitted 26 March 2013 / Accepted 7 August 2013
INTRODUCTION
Conceptualization of glutaminergic system in the

last fifty years follows the historical development
of models phencyclidine (PCP) in patients who
suffering from schizophrenia, a description of its
2013 Saida Fisekovic et al.; licensee University of Sarajevo - Faculty of Health Studies. This
http://www.jhsci.ba
psyhomimetic effect, through the discovery of Nmethyl-D-aspartate glutamat receptor (NMDAR),

and finally the nineties years set new treatment
strategies to base on these receptors (1, 2). NMDAR
antagonists induce an increase of the positive and
negative symptoms of schizophrenia. In this connection we now have several hypotheses that explain the
mechanism by which NMDAR dysfunction leads to
abnormalities in thinking, perception disorders, bizarre behavior and cognitive damage, which schizophrenia remains of intrigue when it comes to the
status of reality as the notion of mental deterioration, as well as several theories in the new concept of
treatment. Oxidation of homocysteine leads to the
formation homocysteine sulfuric acid and homocysteine acid; both products have expressed excitotoxic
action of the different subtypes of the N-methyl-Daspartate (NMDA) glutamat receptor. Excitotoxic
cell type was observed when human cells in different
parts of the brain exposed to homocystein excitotoxic acids and amino acids. Recent studies in rats
have shown that homocysteine causes DNA damage
to neurons inducing apoptosis of hypersensitivity
to excitotoxicity. In, the brain, there is a limited capacity for homocysteine methabolism. In addition,
folate metabolism play a critical roles in the methabolism of homocysteine (4). The level of 5-methyltetrahydrofolate in cerebrospinal fluid is at least
three times that found in plasma and an active transport process exists at the blood-brain-barrier. The folates have important role in the brain and the necessity for protection agains the effects of deficiency (5).
Tests on rats have shown that elevated homocysteine
leads to apoptosis of neurons in the hippocampus.
Relatively large storage of folate in CSF provides the
brain with folate and thereby protects nerve cells
from the toxic effects of increased concentrations of
homocysteine. Besides folate deficiency may have
different effects on the neurochemical processes of
schizophrenia, because it works as a carbon donor
in the synthesis of glycine from serine. Folate is also
involved in the synthesis of dopamine, norepinephrine and serotonin through pathways the methylation of S-adenosyl-methionine and conversion of
methionine to homocysteine (6). Homocysteine is
an amino acid produced by demethylation of methionine, an essential amino acid that in the body
intake of food. Homocysteine was first described
in 1932 in the works by Butz and Vigneauda that
homocysteine synthesis activity concentrated strong
acid on methionine. In the body comes from food

or produced during degradation of endogenous proteins. Methyl group of methionine is activated by
switching to S-adenosyl-methionine (SAM). The
reaction catalyzes of L-methionine-S-adenoziltransferaza the presence of ATP. After the transfer of the
methyl group exceeds S-adenosyl-methionine in
tioester S-adenosyl-homocysteine (SAH). S-adenosyl-methionine is a donor of numerous reactions in
the brain, including many that are involved in the
synthesis and metabolism of monoamines such as
dopamine, norepinephrine and serotonin (6). This
suggests that the association between elevated levels
of homocysteine and schizophrenia is biologically
very likely. Numerous epidemiological studies have
linked increased levels of homocysteine with vascular disease, dementia, defects of fetal development,
increasing the level of mortality and with neuropsychiatric disorders (2) such as schizophrenia, bipolar
affective disorder and depression (6,7,8). Homocysteine is at about 45% of elderly patients increased
and its concentration correlates well with the severity of the memory functions. Therefore homocysteine it is better for diagnosis of cognition (cognitive
impairment) than the concentration of folate and
vitamin B12 in serum (9).
Today there is interest in measuring the biologically
active form of cobalamin. The vitamin B 12 (cobalamin) in serum is bound to two proteins, transcobalamin (TC) and haptocorrin (HC). About 20%
of cobalamin is related to transcobalamin and it is
biologically active, while 80% is related to haptocorrin is biologically inactive. The transcobalaminvitamin B-12 complex is called holotranscobalamin
(Holo Tc) and it is used in vitro diagnostic assay for
the quantitative determination of cobalamin. The
reduced concentration of Holo Tc, it is an indicator
of deficit vitamin B 12. Notably, low values have
been reported in vegetarians and populations with
low intake of vitamin B 12. The tests for measuring
total vitamin B 12 are based on the measurement
of active and inactive fractions, but very often do
not correlate with existing symptoms of the deficit.
The reference area of vitamin B 12 is difficult to determine because it is too close to normal samples.
Holo Tc levels reflect vitamin B 12 status, independent of recent absorption of the vitamin (10,11).
Homocysteinaemia is a newly defined term connected to the increased risk of atherothrombotic
139
http://www.jhsci.ba
and atherosclerotic systemic and retinal vascular occlusive diseases, and its role in the course of many
anatomical or functional abnormalities of the vessels of the optic nerve head such as arteriosclerosis
or vascular dysregulation, homocistein might be the
causative factor (12,13). Some studies showed that
elevated Hcy may increase the risk of retinal vascular diseases, such as retinal artery and vein occlusion
and non-artheritic ischemic optic neuropathy (14,
15). Hcy-induced vascular problem may be a multifactorial case, including direct toxic damage to the
endothelium, stimulation of proliferation of smooth
muscle cells, enhanced low density lipoprotein peroxidation, increased platelet aggregation, and effects
upon the coagulation system (16).
Maybe, this reason of much work in the cognitive
neuroscience of schizophrenia has focused on attention, memory, and executive functioning. To
date, less work has focused on perceptual processing. However, perceptual functions are frequently
disrupted in schizophrenia, and thus this domain
has been included available ophthalmology tests in
this article, how we can describe the basic science
presentation and the breakout group discussion on
the topic of perception when we use some test for
the assessment of cognitive function in schizophrenia. The importance of perceptual dysfunction in
schizophrenia, the nature of perceptual abnormalities in this disorder, and the critical need to develop
perceptual ophthalmology tests appropriate for future clinical trials and validity of some tests for the
assessment of cognitive function in schizophrenia
were discussed.
METHODS
Patients
The patients group consisted of inpatients (n=20)

with Schizophrenia (Sch) diagnosed according to the
tenth revision of the International Classification of
Diseases (ICD-10), treated at the Psychiatric Clinic, Clinical Centre University of Sarajevo (CCUS).
The patients were followed for eight weeks during
2012. All participants signed an informed consent
and study was approved by the Ethics Committee
of the Clinical Center of the University of Sarajevo.
The study was, for the most part, conducted via the
prospective method of clinical research and partly as
a descriptively controlled study. The patients were

treated with typical antipsychotics (haloperidol and
fluphenazine) (n = 14) and atypical antipsychotics
(olanzapine and risperidone) (n = 6) for at least eight
weeks.
The inclusion criteria were female and male patients
with a diagnosis of schizophrenia according to ICD10 criteria (International Classification of Diseases);
The presence of positive and negative symptoms,
cognitive deficits and functioning on a social level;
Antipsychotic therapy, typical or atypical; Subjects
18-65 years of age; One or more hospitalizations.
The exclusion criteria were comorbidity; organic
brain damage; other medical conditions (diabetes
mellitus, hypertension, neurological disorders, inflammatory disease or gastroenterological disease);
alcohol and drug abuse.
Blood samples
The patient samples of blood were collected in serum separation Vacutainer test tubes (Beckton
Dickinson, Rutherford, NJ 07,070 U.S.) in volume
of 3.5 mL. Test tubes with gel were used. After collection, samples were placed in ice and after 30 to 60
minutes, samples were obtained by centrifugation
at 3000 rpm using centrifuge (Sigma 4-10). After
centrifuging, serum concentration of homocysteine,
folate, active form of vitamin B-12 and creatinine
were determined.
Determination of homocysteine (Hcy)
The value of serum homocysteine concentration

was determined using AxSYM (Abbott), based on
measurements of fluorescence polarization immunoassay (FPIA) technology. The reaction principle
is conversion of homocystine, mixed disulfide and
protein-bound forms of homocysteine in the sample
to form of free homocysteine by the use of dithiothreitol (DTT). After that free homocysteine is converted to S-adenosyl-L-homocysteine (SAH). Under
physiological conditions, SAH - hydrolases converts
SAH to homocysteine. Existing methods is to determine L-homocysteine in human serum. Normal
concentration of homocysteine in serum of women
is 3.36-20.44 mol/L and in men is 5.90-16 mol/L
(17). The creatinin was determined using automatic
analyzer Dimension (Dade Behring). Method for
determination of creatinine is a modification of the
kinetic reaction of Jaffee. The reference value for
140
http://www.jhsci.ba
serum creatinine concentration is 45-115 mol/ L

(18).
RLU detected by Architect System optics. The reference value for serum folate concentration is 7.0-31.4
ng/mL (19).
Determination of folate
All immunoassays require the use of labeled material

in order to measure the amount of antigen or antibody. A label is a molecule that will react as a part of
the assay, so a change in signal can be measured in
the blood after added reagent solution. CMIA (chemiluminescent microparticle immunoassay) is noncompetitive sandwich assay technology to measure
analytes. The amount of signal is directly proportional to the amount of analyte present in the sample. Architect folate asssay is two-step immunoassay
to determine the presence folate in human serum
using CMIA technology. Two pre-treatment steps
mediate the release of folate from endogenous folate binding protein. In pre-treatment step 1 sample
ans pre-treatment reagent 2 (dithiothreitol or DDT)
are aspirated and dispensed into a reaction vessels
(RV). In pre-treatment step 2, an aliquot of sample/
pre-treatment reagent 2 mixture is aspirated and
dispensed into a second RV. Pre-treatment reagent
(KOH) is then added. An alliquot of the pre-treated
sample is transfered into a third RV, followed by
the addition of folate binding protein (FBP) coated
paramagnetic microparicles and assay specific diluent. Folate presented in the sample binds to the FBP
coated microparticles. After washing, pteroic acidacridinium labeled conjugate is added and binds to
unoccupied sites on the FBP-coated microparticles.
Following another incubation and wash, pre-trigger
and trigger solutions are then added to the reaction
mixture. The pre-trigger solution (hydrogen peroxide) creates an acidic environment to prevent early
release of energy (light emission), helps to keep microparticles from clumping and splits acridinium dye
off the conjugate bound to the microparticle complex (this action prepares the acridinium dye for the
next step). The trigger solution (sodium hydroxide)
dispenses to the reaction mixture. The acridinium
undergoes an oxidative reaction when is exposed
to peroxide and an alkaline solution. This reaction
causes the occurence of chemiluminescent reaction.
N-methylacridone forms and releases energy (light
emission) as it returns to its ground state. The resulting chemiluminescent reaction is measured as
relative light units (RLU). A direct relationship exists between the amount of folate in the sample and
Determination of active B-12
Axsym Holo Tc is microparticle enzyme immunoassay (MEIA) for the quantitative determination of
human holo TC in serum and determination deficit
of vitamin B 12. Microparticles are coated with an
Anti-Holo Tc monoclonal antibodies in the presence of human antigens on the Holo Tc microparticles arises immune complex. On Anti-Holo Tc antibodies present a conjugate of alkaline phosphatase
in the next reaction, which reacts with the substrate
4-methylumbelliferyl phosphate (MUP). The resulting fluorescent product is measured by MEIA optical system. The reference value for the healthy population Holo Tc is 19.1-119 pmol/L (20).
The results were statistically analysed using SPSS

version 12 and Microsoft Office Excel 2003. Average values, standard deviation (SD) and Pearson correlation coefficient (r) were calculated, as well Wilcoxon signed rang test with statistical significance
level of 0.05 P<0.05.
RESULTS
The investigation included 20 patients with shizophrenia and 20 healty subjects. The study included 6
(30%) men and 14 (70%) women in control group.
The group with shizophrenia have 5 (25 %) men
and 15 (75%) women. The average age in the control group was 49.45 years and in shizophrenia patients was 44.5 years. Normal homocysteine concentration in serum is 3.36-20.44 mol/L for women
and 5.90-16 mol/L for men. The reference folate
concentration is 7.0-31.4 ng/mL and vitamin B-12
19.1-119 pmol/L.
The mean concentration of homocysteine, folate
and vitamin B-12 in shizophrenia patients and control group are shown in Table 1. The patients with
shizophrenia have higher levels of homocysteine in
compare with controls group for 3.85 mol/L while
the concentration of folate in the group of patients
was lower for 9.17 ng/mL. The patients with shizophrenia have a folate deficiency. The mean level of
vitamin B-12 in investigation groups were in ref-
141
http://www.jhsci.ba
TABLE 1. The mean concentration of homocysteine, folate

and vitamin B-12 in shizophrenia patients and control group.
mean vitamin B-12 concentration was significant

for P<0.05 in investigated groups.
The correlation between homocystein and vitamin
levels in patients serum are shown in Table 3. There
was a significant difference between the mean serum
homocysteine and folate (P <0.05) with a negative
Pearson correlation coefficient (r = -0.52) in the
group of patients. Using the same test, a significant
difference between the mean serum homocysteine
and vitamin B-12 (p <0.05) with a negative Pearson
correlation coefficient (r = - 0.47).
Groups
Xsr
S.D.
S.E.
Xsr
Control group
S.D.
(N=20)
S.E.
Shizophrenia
patients
(N=20)
Homocysteine Folate Vitamin B-12

(mol/L)
(ng/mL)
(pmol/L)
14.22
5.94
54.00
4.19
2.30
23.65
0.93
0.51
5.28
10.37
15.11
78.81
2.16
7.00
24.25
0.48
1.56
5.42
TABLE 2. Comparison of serum concentration of homocysteine, folate and vitamin B-12 in shizophrenia patients and
control group.
Z
P
Homocysteine
- 2.800
0.005*
Folate
-3.920
0.000*
DISCUSSION
Vitamin B-12
- 2.800
0.005*
* P<0.05 (Wilcoxon signed ranks)
TABLE 3. Correlation between homocysteine and vitamins in

patients with shizophrenia.
Shizophrenia
patients
r
p
Folate
- 0,52
0,017*
Vitamin B-12
-0,47
0,035*
* Statistical significant for P<0.05
erence range 19.1-119 pmol/L, but patient group

have lower average concentration of vitamin B-12
lower for 24.81 pmol/L compared to the control
group. Folate deficiency significantly changes the
concentration of homocysteine, which could affect
the differences between patients with shizophrenia
and control group.
It is indicated that high level of homocysteine follows low level of folate in serum at patients with
shizophrenia.
We have shown in Table 2. Z and P values mean
serum homocysteine, folate and vitamin B-12 concentration in patients and control subjects. Using
Wilcoxon signed ranks test we have concluded that
average concentration of homocysteine in shizophrenia patients were significantly differend (P<0.05)
from serum concentration in control subjects. There
was a significant difference in folate serum concentration between patient group and control group
for P<0.05. According Wilcoxon signed ranks test
The role of hyperhomocysteinemia in psychotic

disorder can be explained by partial antagonism
of homocysteine on NMDA-glycine receptor (21).
Epidemiological studies show a correlation between
total plasma homocysteine concentration and the
risk of neurodegenerative diseases (22). Plasma concentration of homocysteine is an indicator of the status of the B-vitamins (folate, B12, B6). It was found
that the values of homocysteine levels are significantly elevated in young male patients with schizophrenia and BP, especially those who show signs of
cognitive deterioration, compared to the general
population (23). However, there are studies whose
results indicate no difference in homocysteine levels
between bipolar patients and healthy controls (24).
Increased levels of homocysteine can cause apoptosis
and exocytosis as important mechanisms of neurodegeneration. The brain tissues utilize three mechanisms for maintaining low steady state concentrations of homocysteine: 1) efficient recycling through
cobalamin-dependent methionine synthase, given
an adequate supply of cobalamin and folate; 2) catabolism throught CBS to cystathionine; 3) export
homocysteine into the circulation (25). In our study
group patients with shizophrenia have higher levels
of homocysteine in compare with controls group for
3.85 mol/L while the concentration of folate in the
group of patients was lower for 9.17 ng/mL. Our
results are compared with the results Mabrouk et al
(26) have shown that the increased value of homocysteine and a lower value of folate in patients with
schizophrenia compared with the control group.
The low folate status in schizophrenics and folate-responsive schizophrenic-like behavior are connected
with deficiency of MTHFR of TT genotype (27).
Eren et al (28) have shown to the increased value of
142
http://www.jhsci.ba
homocysteine in patients group with schizophrenia

than in the control group, but no significant differences in the values of folate and vitamin B12, which
is possible due to prolonged use of typical neuroleptics. These results are not consistent with our results
because we also had a larger number of patients who
were treated with typical neuroleptics. In our study
presented Z and P values mean serum homocysteine,
folate and vitamin B-12 concentration in patients
and control subjects. Using Wilcoxon signed ranks
test we have concluded that average concentration
of homocysteine in shizophrenia patients were significantly differend (P<0.05) from serum concentration in control subjects. The reason for this is the
cours of the illness, because in the work of Erna et
al it was a chronic schizophrenic patient. Low folate/high homocysteine level leads to increased sensitivity of neurons and brain damage. We get the
following results, there was a significant difference
between the mean serum homocysteine and folate
(P <0.05) with a negative Pearson correlation coefficient (r = -0.52) in the group of patients. Using the
same test, a significant difference between the mean
serum homocysteine and vitamin B-12 (p <0.05)
with a negative Pearson correlation coefficient (r =
- 0.47). We have got a good correlation of homocystene with folate and vitamin B-12. The negative
Pearson correlation coefficient we could explain that
high level of homocysteine is probably resulted with
low folat serum concentration. In our study we have
got vitamin B-12 in reference range which could be
explained with wide range of vitamin B-12 in human body. Epidemiological studies have found a
link between folate deficiency and hyperhomocysteinemia in neurodegenerative and neuropsychiatric
disorders, including Alzheimer's and Parkinson M.,
depression and schizophrenia. There is also evidence
on the connection between B-vitamin deficiency
and depression (29). Folic acid and SAM can be
used as a complementary means for the treatment
of depression. On the other hand, folate deficiency
in depressed patients may be a consequence of inadequate nutrition. Regardless of whether folate deficiency in primary or secondary depression, administration of folate may be useful in recovering from
depression and improve mental status. It would be
interesting to extend our research to other psychiatric diagnostic groups such as depression and bipolar
affective disorder.
It is known that a diet rich in animal protein may in-
crease, and foods rich in beans and green vegetables

to lower homocysteine levels. Different groups of
drugs, such as drugs for lowering fat (fibrates and
niacin), oral hypoglycemics (metformin), insulin,
drugs used to treat rheumatoid arthritis and anticonvulsants may cause an increase in serum levels
of homocysteine (30), which could in the future be
interesting in expanding the study introduce more
detailed and complete test diet. With regard to gender differences in the prevalence of hyperhomocysteinemia results of numerous studies indicate that the
values of homocysteine levels are generally higher in
men (31). All of the above would be fully subject of
our next study, given that they are now working on
the preliminary results.
CONCLUSION
These findings support the hypothesis that altered

levels of homocysteine, folate and vitamin B12 may
coexist in patients with schizophrenia and contribute to pathophysiological aspects of this illness. The
homocysteine could be an independent risk factor for neuropsychiatric disorders and risk factor
for development of cerebrovascular disease. In our
group of shizophrenia patients we have a limited
number of patients and we have not informations
about concentration of homocysteine, folate and
vitamin B-12 during shizophrenia treatment. The
hyperhomocysteinemia is presented in about 25 %
and low folat leves in 60 % of shizophrenia patients.
In patients group homocysteine level were elevated
compared to the levels of controls when folate levels
were low, these resuls indicate that enzymatic defect
could be involved. Our results showed that homocysteine concentration is inversely proportionate to
folate concentration, i.e. as homocysteine concentration in serum increases, folate concentration falls.
The shizophrenia patients with elevated tHcy level
and low folate levels should have vitamin supplementation with folic acid. This would be the view
of the preliminary results of our research, which in
the future demanded a larger sample, the relationship between these biochemical parameters related
to the predominance of positive or negative symptoms of schizophrenia, with the inclusion of other
diagnostic entities, depression and bipolar affective
disorder, and complete processing of data related to
the metabolic syndrome and nutrition, which will
be planned.
143
http://www.jhsci.ba
16. Finkelstein JD: The matabolism of homocysteine: pathways and regulation.

Eur J Pediatr. 1998;157:40-44.
17. Operator Manual AxSym System. Abbott Diagnostic Homocysteine, REF

5F51 ABBL 143/R09, 2012.
18. Operator Manual Dimension System. Dade Behring 2000, pp. 51-60.
REFERENCES
19. Operator Manual ARCHITECT I 2000 SR Abbott Diagnostic Folate, REF

1P74, 34-5955/R03, B1P740, 2010.
1. Coyle JT. The NMDA receptor and schizophrenia: a brief history. Schizophr
Bull. 2012. In press.
2.
Javitt DC. Has an angel shown the way? Etiological and therapeutic implications of the PCP/NMDA model of schizophrenia. Schizophr Bull. In press.
3. Bolander-Gouaille C, Bottiglieri T. Homocysteine related vitamins and neuropsychiatric disorders, Springer-Verlag. France, 2007:15-57,109-163.
4. Broch O, Ueland P.M. Regional distribution of homocysteine in the mammalian brain. J. Neurochem. 1984;43:1755-1757.
5. Herbert V, Zalusky R. Selective concentration of folic acid activity in cerebrospinal fluid. Fed. Proc. 1961;20: 453.
6. Bottiglieri T, Laundy M, Crellin R, Toone BK, Carney MWP, Reynolds EH.
Homocysteine, folate, methylation, and monoamine metabolism in depression. Journal of Neurology Neurosurgery and Psychiatry. 2000;69(2):228
232.
20. Operator Manuel AxSym System. Abbott Diagnostic Active B-12, REF
1P43-20 ABOL039/R1, 2007.
21. Neeman G, Blanaru M, Bloch B, Kremer I, Ermilov M, Javitt DC, Heresco-Levy U. Relation of plasma glycine, serine, and homocysteine levels to schizophrenia symptoms and medication type. Am J Psychiatry.
2005;162(9):1738-40.
22. Stanger O, Fowler B, Piertzik K, Huemer M, Haschke-Becher E, Semmler
A, Lorenzl S, Linnebank M. Homocysteine, folate and vitamin B12 in neuropsychiatric diseases: review and treatment recommendations. Expert Rev
Neurother. 2009;9(9):1393-412.
23. Osher Y, Sela BA, Levine J, Belmaker RH. Elevated homocysteine levels
in euthymic bipolar disorder patients showing functional deterioration. Bipolar Disord. 2004;6(1):82-6.
7. Muntjewerff JW, Kahn RS, Blom HJ, den Heijer M. Homocysteine, methylenetetrahydrofolate reductase and risk of schizophrenia: a meta-analysis.
Mol Psychiatry. 2006;11(2):143-9.
24. Bromberg A, Bersudsky Y, Levine J, Agam G. Global leukocyte DNA

methylation is not altered in euthymic bipolar patients. J Affect Disord.
2009;118(1-3):234-9.
8. Kevere L, Purvina S, Bauze D, Zeibarts M, Andrezina R, Rizevs A, Jelisejevs S, Piekuse L, Kreile M, Purvins I. Elevated serum levels of homocysteine as an early prognostic factor of psychiatric disorders in children and
adolescents. Schizophr Res Treatment. 2012.
25. Scott J.M, Molloy A.M, Kennedy D.G, Kennedy S, Weir D.G. Effects of
disruption of trans methylation in the central nervous system: An animal
model. Acta. Neurol. Scand. 1994;89 (154): 27-31.
9.
Kang S.S, Wong P.W.K. Genetic and nongenetic factors for moderate hyperhomocysteinemia. Atherosclerosis. 1996;119:135-138.
10. Lothar T. Labor und Diagnose. TH-Books Verlagegesellschaft mbH, Frankfurt/Main, 5. erweiterte Auflage. 2000;1507-1513.
11. Kajan J.P, Twardowski T, Jakubowski H. Mechanisms of homocysteine
toxicity in humans. Amino. Acids. 2007;32: 561-572.
12. Flammer J, Orgul S, Costa VP, Orzalesi N, Krieglstein GK, Serra LM, Renard JP, Stefansson E: The impact of ocular blood flow in glaucoma. Prog
Retin Eye Res. 2002;21:359-393.
13. Hayreh SS: Blod flow in the optic nevre head and factors that may influence
it. Prog Retin Eye Res. 2001;20:595-624.
26. Mabrouk H, Douki W, Mechri A, Younes MK, Omezzine A, Bouslama A,

Gaha L, Najjar MF. Hyperhomocysteinemia and schizophrenia: case control study. Encephale. 2011;37(4):308-13.
27. Freeman JM, Finkelstein JD, Mudd, SH. Folate-responsive homocystinuria
and schizophrenia. A defect in methylation due to deficient 5,10-methylenetetrahydrofolate reductase activity. N Engl J Med 1975;292:491-496.
28. Eren E, Yein A, Yilmaz N, Herken H. Serum total homocystein, folate
and vitamin B12 levels and their correlation with antipsychotic drug doses
in adult male patients with chronic schizophrenia. Clin Lab. 2010;56(1112):513-8.
29. Obeid R, McCaddon A, Herrmann W. The role of hyperhomocysteinemia
and B-vitamin deficiency in neurological and psychiatric diseases. Clin
Chem Lab Med. 2007;45(12):1590-606.
14. Bousse V, Newman NJ, Sternberg P: Retinal vein occlusion and transient
monocular visual loss associated with hiperhomocysteinemia. Am J Ophthalmol. 1997;124:257-260.
30. Dierkes J, Westphal S. Effect of drugs on homocysteine concentrations.

Semin Vasc Med. 2005;5(2):124-39.
15. Brown BA, Marx JL, Ward TP, Hollifield RD, Dick JS, Brozetti JJ, Howard
RS, Thach AB: Homocysteine: a risk factor for retinal venous occlusive
disease. Ophthalmology. 2002;109:287-290.
31. Applebaum J, Shimon H, Sela BA, Belmaker RH, Levine J. Homocysteine levels in newly admitted schizophrenic patients. J Psychiatr Res.
2004;38(4):413-6.
144
http://www.jhsci.ba
ejla Cilovi-Lagarija, Mediha Selimovi-Draga Journal of Health Sciences 2013;3(2):145-150

RESEARCH ARTICLE
Open Access
Efficiency of dental health care in Federation of

Bosnia and Herzegovina
ejla Cilovi-Lagarija1, Mediha Selimovi-Draga2
1
Institute for Public Health of Federation of Bosnia and Herzegovina, Marala Tita 9. 71000 Sarajevo, Bosnia and Herzegovina. 2Department of Preventive and Pediatric Dentistry, Faculty of Dentistry, University of Sarajevo, Bolnika 4a, 71000
Sarajevo, Bosnia and Herzegovina.
ABSTRACT
Introduction: Despite the great improvements in the oral health status of the population across the world,
oral diseases remains a major public health issue connected with a lost of numerous school days for children and absenteeism from work in adults. This effect is particularly evident in low and middle income
countries as Bosnia and Herzegovina. This retrospective study presents the efficiency of dental health care
in Federation of Bosnia and Herzegovina measured by number of visits and performed dental treatments
during the time period of six years, from 2005-2011.
Methods: Data were collected by evaluation of the results obtained by forms which are mandatory to be
completed by dentists.
Results: The number of graduated dentists from 2007 to 2011 decreased from 108 in 2007 to 68 in 2011.
In the same time, number of dentists employed in public sector slightly increased from 529 in 2005 to
587 in 2011. Number of extracted permanent teeth decreased from the 412 extracted permanent teeth
per dentist in 2005 to 364 in 2011. Small number of filled primary teeth comparing to large number of
extracted primary teeth showed negligence in their treatment.
Conclusion: Having in mind that improving oral health in developing countries is a very challenging objective we can conclude that dental health care system in Federation of Bosnia and Herzegovina need to be
reform in order to improve oral health in general, particularly in children population.
Keywords: oral health, efficiency, Federation of Bosnia and Herzegovina
INTRODUCTION
Dental health care as a part of the health care system in general, is essential for promoting, improving and maintaining oral health of the population.
Through an efficient dental health service, patients
*Corresponding author: ejla Cilovi-Lagarija,
Institute for Public Health of Federation of Bosnia and Herzegovina, Marala Tita 9. 71000 Sarajevo, Bosnia and Herzegovina
E-mail: seila.cilovic@gmail.com, s.cilovic@zzjzfbih.ba
Submitted 3 August 2013 / Accepted 8 September 2013
can be advised of risks factors whose modification

could reduce the incidence of oral diseases, and further, how controlling such factors can contribute to
maintain a good quality of life. Comparing with developed countries, where most of dental clinics are
equipped with the latest technical facilities and supported by health professionals from various specialties that allow their cooperation to benefit the patient, dental health services in developing countries,
are mostly directed to provide emergency care only
or interventions towards certain age group popula-
2013 . Cilovi-Lagarija, M. Selimovi-Draga; licensee University of Sarajevo - Faculty of Health

Studies. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
tion. The most common diseases are dental caries

and periodontal disease and frequently intervention
procedures consists of treating existing problems
and restoring teeth and related structure to normal
function (1).
Bosnia and Herzegovina with the principle of organization of the dental health care is no exception.
Federation of Bosnia and Herzegovina (FBH) is organized in 10 Cantons covering an area of 26 110,5
km2 with the population of 2 338 277 people (2).
Health care system in FBH is organized on federal
level, cantonal level and municipality level that have
different jurisdiction, determined by law. The organization of health care system on Cantonal level
with the coordination from Federal level represents
a real situation with the possibility of decentralization of health care system according to the experiences of developed countries.
Oral health care in FBH is organized as insurance
funded public health services and private practice.
Accessibility to oral health care facilities differs between administrative units (3), which has its repercussion on oral health of population in general.
Dental health care in FBH is organized as a primary,
secondary and tertiary oral health care and all dental profesionals are obliged by law to fulfill the report forms about deseases, conditions and injuries
according to the International Statistical Classification of Diseases and Related Health Problems
tenth revision (ICD-10) (4).
The aim of this study is to evaluate the efficiency of
dental health care in FBH presented by number of
visits and performed dental treatments during the
time period of six years from 2005-2011.
http://www.jhsci.ba
years, from year 2005 to 2011. The data includes

number of dentists graduating during the time period year 2005 to 2011, number of doctors of dental
medicine (DDM) employed in public sector, between years 2005 and 2011 and visits and delivered
services in dental care for the same time period. The
lack of data of number of doctors of dental medicine employed in the private sector was partially
determined, indirectly, by the number of graduate
doctors of dental medicine. The assumption is that
one part of graduates is employed in the private sector, but that data were not available yet. Variables,
number of doctors of dental medicine (DDM) have
been analyzed as the number of DDM per 100.000
population, morbidity data as number of disease
per 10.000 population and number of visits and
performed treatments per doctor of dental medicine.
Relationship between variables is computed by analyzing Pearson coefficient of linear correlation. Preliminary analyzes were conducted to prove the satisfaction of the assumptions of normality, linearity
and homogeneity of variance.
RESULTS
This section outlines the main characteristics of

outcome data in dental service in FBH over the six
years based on publication Health statistics annual
of Federation of Bosnia and Herzegovina. Table 1
shows how the number of graduated doctors of den-
METHODS
Procedures
Monthly rates of total dental care procedures, preventive procedures, collective procedures, restorations and extractions for every single dental office
were collected and presented as a unique anual report of dental care in FBH published by Institute for
Public Health of FBH in their publication Health
statistics annual of Federation of Bosnia and Herzegovina" (5). The data for this study were colected
from Health statistics annual of Federation of Bosnia and Herzegovina " during the time period of six
146
TABLE 1. The number of graduated doctors of dental medicine during the period from 2005 to 2011 and number of doctors of dental medicine/ number of DDM per 100.000 populations employed in public sector during the same time period.
Year
2005
2006
2007
2008
2009
2010
2011
Number of graduated Number of Doctors of Dental

Doctors of Dental
Medicine/ number of DDM per
Medicine
100.000 populations*
57
529/23
107
573/25
108
547/23
66
514/22
78
515/22
55
595/25
68
587/25
* The data of number of doctors of dental medicine employed in

the private sector is missing.
http://www.jhsci.ba
TABLE 2. Diseases, injuries and health related problems (ICD-10) registered by dental health care professionals in Federation
of Bosnia and Herzegovina during time period from 2005.to 2011.
Diseases, injuries and health related problems (ICD-10)
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Malignant neoplasms (C00-C08)

Disorders of tooth development and eruption (K00)
Embedded and impacted teeth (K01)
Dental caries (K02)*
Other diseases of hard tissues of teeth (K03)
Diseases of pulp and periapical tissues (K04)
Gingivitis and periodontal diseases (K05)
Other disorders of gingiva and edentulous alveolar
ridge (K06)
Dentofacial anomalies including malocclusion (K07)
Other disorders of teeth and supporting structures
(K08)
Cysts of oral region, not elsewhere classified (K09)
Other diseases of jaws (K10)
Diseases of salivary glands (K11)
Stomatitis and related lesions (K12)
Other diseases of lip and oral mucosa (K13)
Diseases of tongue (K14)
Injury of head, face and oral cavity (SOO-SO9,TOOTO4,T20,T90)
2005.
26
11890
9010
292493
71889
219896
56569
2006.
91
13601
13305
358061
69796
231382
69252
2007.
4
9865
13389
263564
71408
231965
51884
Time period
2008.
15
10857
8825
312689
55780
267357
49864
2009.
9
12573
8174
303447
39654
250842
55219
2010.
36
11729
8509
309097
41864
249602
54522
2011.
44
12625
8691
316248
36999
221733
51442
3704
4041
6735
5000
5595
5299
6195
30641
30201
29239
34485
36844
41280
43070
21289
23484
25921
24846
23247
24505
21608
1000
8900
602
4690
2438
537
947
10854
310
4792
3504
703
967
15378
374
3816
2608
666
1423
18346
197
4964
3182
639
1280
18089
210
4371
2814
622
1132
18535
497
11767
2965
972
1394
19364
374
3752
2669
1074
1372
768
204
268
364
358
433
* Dental caries is still the most prevalent oral disease in FBH.
tal medicine and the number of doctors of dental fication of Diseases (ICD-10) (4) with the intention
medicine employed in public sector changed dur- to provide a coherent system for coding and classifying the period from 2005-2011. Visible reduction ing data on oral and dental disorders. In 2011 dental
of number of dentists employed in public sector caries (K02) and periodontal diseases (K05) are still
in years 2008 and 2009 is not statistically signifi- most prevalent oral diseases and rate for Dental caries (K02) is 1352 per 10.000 population, for K04
cant. Pearson coefficient of linear correlation shows
positive correlation between an increased number of - rate 948 per 10.000 population, and K05 - 219 per
dentists employed in public sector and an increased 10.000 population. Rate for Dental caries (K02) in
number of graduate dentists where r = 0.012, n = 7 2005 is 1256 per 10.000 population, in 2006. rate
and p = 0.979 (Table 1) (5). It is noteworthy that is 1540 per 10.000 population, in 2009. rate is 1303
there is no evidence of number of doctors of den- per 10.000 population and in 2010. rate is 1322 per
tal medicine employed in the private sector so total 10.000 population.
number of employed dentists can be estimated only. Considering a number of registered malignant neoplasms (C00 C08), from 91 cases in year 2006 to
Table 2 presents number of diseases, injuries and
health related problems registered by dental health 4 cases in 2007 it can be concluded that neoplasms
care professionals in Federation of Bosnia and Her- are not detected occasionally. All other lesions that
zegovina during time period from 2005.to 2011. are suspicious, benign, malignant or diagnosed as
some of autoimmune diseases were classified as K13
rate per 10.000 population (5). Those results where
coded and classified by Application of the Interna- or K10 group (Table 2) (5).
tional Classification of Diseases to Dentistry and Diseases diagnosed as dental caries (K02), other
Stomatology (ICD-DA) (6). It is derived directly diseases of hard tissues of teeth (K03), diseases of
from the Tenth Revision of the International Classi- pulp and periapical tissues (K04) and gingivitis and
147
http://www.jhsci.ba
FIGURE 1. Number of dental caries (K02),

diseases of pulp and periapical tissues (K04),
gingivitis and periodontal diseases (K05) and
dentofacial anomalies (K07) per 10.000 populations, recorded in time period from year 2005
to 2011. Diseases diagnosed as dental caries
(K02), other diseases of hard tissues of teeth
(K03), diseases of pulp and periapical tissues
(K04) and gingivitis and periodontal diseases
(K05) per 10.000 populations showed a little
variation compared to the observed time period.
FIGURE 2. Number of dentofacial anomalies

and number of removable orthodontic appliances recorded in time period 2005 to 2011. The
figure shows increased number of dentofacial
anomalies during the time period from 2005 to
2011. This trend can be considered one of the
reasons for the increased number of removable
orthodontic appliances recorded in the same
period.
periodontal diseases (K05) showed a little variation

compared to the observed time period (Figure 1) (5).
Table 3 shows number of visits and performed treatments per doctor of dental medicine in public dental
service during the time period years 2005 to 2010. It
is interesting to note a small number of filled deciduous teeth (30 per doctor of dental medicine in 2010.)
comparing with the number of extracted deciduous
teeth in the same time period (119 per doctor of
dental medicine in 2010.) Having in mind that early
extraction of deciduous teeth usually leads to loss of
space, a large number of extractions of primary teeth
can be partly considered as the cause of increased
number of dentofacial anomalies (KO7) (5).
A strong positive correlation has been seen between
the increased number of dentofacial anomalies
(K07) and increased usage of removable orthodontic appliances where r = 0.126, n = 7, and p =0.788
(Figure 2) (5).
Very interesting information, from the dentists
point of view, is the almost equal number of fillings
in permanent dentition and extracted permanent
teeth, which certainly increased the number of patients who needs partial dentures or even total prosthesis as a treatment (Table 3) (5).
DISCUSSION
The biggest recent changes in European oral healthcare were found to have occurred in Eastern Europe,
where there has been wide scale privatization of the
previously public dental services (7). Bosnia and
Herzegovina is no exception. This paper reports the
findings of retrospective study that was designed to
deepen understanding about the impact of organization of dental health care in Federation of Bosnia and Herzegovina on oral health of population
in general. The main findings were: The number of
dentists employed in public sector slightly increased
from 529 in year 2005 to 587 in 2011, but there
are no data for private sector in FBH; diseases diagnosed as dental caries (K02), other diseases of hard
tissues of teeth (K03), diseases of pulp and periapical tissues (K04) and gingivitis and periodontal diseases (K05) showed a little variation compared to
148
http://www.jhsci.ba
TABLE 3. Number of visits and performed treatments per doctor of dental medicine in public dental service during the time
period year 2005 to 2010.
Treatments
Filled primary teeth
Filled permanenth teeth
Extracted primary teeth
Extracted permanenth teeth
Complete dentures
Partial dentures
Single crowns
Removable orthodontic appliances
Periodontal treatment
All visits. total
Year
2005
34.0
439.0
163.0
412.0
8.0
8.0
5.0
9.4
200.6
1775.1
2006
29.0
436.0
163.0
421.0
8.1
6.8
3.6
9.7
172.2
1716.8
2007
28.0
433.0
143.7
411.3
7.7
6.3
4.5
11
197.6
1696.0
2008
34.0
563.0
152.0
473.4
10.4
8.2
3.2
21.2
260.5
2063.2
2009
38.0
548.2
141.3
445.3
9.5
6.9
3.6
11.9
267.0
2032.2
2010
30.0
479.5
118.6
370.6
8.1
5.9
2.9
10.7
251.5
1840.6
Small number of filled deciduous teeth per doctor of dental medicine comparing with the number of extracted deciduous teeth in the
same time period.
the observed time period; almost equal number of dren and adults. This kind of organization neglected
fillings in permanent dentition and extracted per- population as a whole.
manent teeth, which certainly increased the num- Changes in organization of oral health care in Fedber of patients who needs partial dentures or even
eration of Bosnia and Herzegovina, which have haptotal prosthesis as a treatment; it has been observed
pened lately, corresponds with recent changes in
a small number of filled deciduous teeth (30 per European oral health care. Bosnia and Herzegovina,
doctor of dental medicine in year 2010) comparing like some EU member states, operate the Bismarkwith the number of extracted deciduous teeth in the
ian system with health insurances which proclaim
same time period (119 per doctor of dental medi- Universal health insurance offering wide populacine in year 2010).
tion coverage, comprehensive treatment and some
benefits. Despite wide option for the people to get
More than 20 years after widespread adoption, the
strategy of WHO Health for All through primary health care it is estimated that 15 % of population
health care still has not been fully implemented. in general are not covered by health insurance. PopBosnia and Herzegovina national capacity and re- ulation coverage with health care deviates in cantons
and regions, deviations is even more noticeable in
sources like human, financial and material, are still
municipalities (8). In order to reduce inequities in
insufficient to ensure availability and open access to
essential health services of high quality for individu- access to oral health services and improves the efals and population, especially in deprived communi- ficiency of the health system in general the process
of change is indispensable.
ties.
The health system in Bosnia and Herzegovina is Limited access to oral health services can be considcharacterized by centralized structure, providing ered as one of the reasons for such a big number of
treatments on demand, with increasing number of extracted primary teeth as well as permanent teeth
doctors specialist in different areas, who basically (Table 3). Because of limited access to oral health
provide health care on primary level. Organization
services teeth were often left untreated and later extracted because of pain or discomfort.
of dental health sector in Bosnia and Herzegovina
and the oral health of the population depend on
method of financing, on relationship between so- Visits and performed treatments in dental sercioeconomic factors of dental health care and the
vice
level of utilization of dental services. Dental health The results of this study found that the extraction of
care is based on the specific population group like
permanent teeth is the most common treatment in
pregnant women, preschool children, school chil149
dental offices in FBH (Table 3.). These results correspond with the results registered by WHO where 78
% of edentulous adults in Bosnia and Herzegovina,
aged 65 years and more, present the biggest percentage of edentulous people in the world (9). Although,
losing teeth as a natural consequence of aging, is still
seen by many people throughout the world, those
results indicates the need to reorient oral health services in Bosnia and Herzegovina towards prevention
and oral health promotion. Having in mind a pain
and suffering that accompany oral diseases, impairment of function and reduced quality of life, those
needs become more pronounced.
Incidence rates of malignant neoplasms found in
this study (Table 3) coincide with the incidence
rates in most countries worldwide (10). Those incidence rates relate directly to risk behaviors such as
smoking and alcohol consumption. It seems, while
oral and pharyngeal cancers are both preventable,
in BH, like in most countries, they remain a major
challenge to oral health programmes.
http://www.jhsci.ba
oral health but the health in general. Unfortunately,

the human, financial and material resources are still
insufficient to meet the need for oral health care
services and to provide universal access, especially
in disadvantaged communities. Having in mind
evident accelerated aging of the population which
will be intensify over the coming years, it is obvious
that improving oral health for health authorities in
Federation of Bosnia and Herzegovina will be a very
challenging objective.
CONCLUSIONS
This study highlighted the importance of oral health

in public health outcomes, with the goal of developing a comprehensive public health strategy that
would include preventive oral health measures
within overall prevention and wellness approaches.
The need for strengthening disease prevention and
health promotion programmes in order to improve
oral health conditions in general is evident.
Oral health personnel and morbidity
The issue of oral health personnel - which categories of personnel need to be educated, their duties
and the numbers of each - has for many years been
of great concern. The importance of this matter really has become evident in a number of dental caries
(K02), diseases of pulp and periapical tissues (K04)
and gingivitis and periodontal diseases (K05) recorded in time period years 2005 to 2011 (Table
2). According to the fact that oral health in Bosnia
and Herzegovina can be considered as the worst
in the Europe (11) it seems that the production of
dentists in BH appears irrelevant to the oral health
needs and demands. Severity of oral health burdens
registered in this study partially can be considered as
the result of changing of socio-demographic factors.
In order to improve oral health, the adjustment of
existing oral health manpower structures with the
training programmes for types of personnel which
would match the oral health needs, are needed in
Bosnia and Herzegovina.
Reform of oral health services in Federation of Bosnia and Herzegovina should lead to increased interest in basic preventive oral health interventions
(especially in high-risk populations) as an easy and
reliable approach to reduce systemic load of curative
dental treatments with the aim to improve not only
150
REFERENCES
1. Kandelman D, Arpin S, Baez RJ, Baehni PC, Petersen PE. Oral health
care systems in developing and developed countries. Periodontol 2000.
2012;60(1):98-109. doi: 10.1111/j.1600-0757.2011.00427.x.
2. Federal office of statistic. Statistical Yearbook 2012. Sarajevo; 2012.
3. Arslanagi-Muratbegovi A, Markovi N, Zukanovi A, Kobalija S,
Selimovi-Draga M, Juri H. Oral Health Related to Demografic Features
in Bosnian Children Aged Six. Coll Antropol. 2010; 34(3): 1027-1033.
4. WHO. International Statistical Classification of Diseases and Related
Health Problems. Tenth revision. Vol.2. Instruction manual. Geneva: 1993.
[cited 2012.]. Available at: http://www.who.int/classifications/icd
5. Institute for Public Health of FBH. Health statistics annual of Federation of
Bosnia and Herzegovina. Sarajevo; 2006-2012..
6. WHO. Application of the International Classification of Diseases to dentistry
and stomatology: ICD-DA. 3rd ed. World Health Organization; 1995. [cited
2012.]. Available at: whqlibdoc.who.int/ications/1995/9241544678_eng.
pdf
7. Widstrm E, Eaton KA. Oral healthcare systems in the extended European
union. Oral Health Prev Dent. 2004;2(3):155-94.
8. Hraba B, unje A, Bodnaruk S, Huseinagi S. Reforma socijalnog zdravstvenog osiguranja u Federaciji Bosne i Hercegovine za vrijeme tranzicije.
South Estern Europe Health Sciences Journal. 2011; 1(1):7-17.
9. Petersen PE. The World Oral Health Report 2003: continuous improvement of oral health in the 21st century-the approach of the WHO Global
Oral Health Programme. Community Dent Oral Epidemiol. 2003;31(Suppl.1):3-24.
10. Stewart BW, Kleihues P. World Cancer Report. Lyon: WHO International
Agency for Research on cancer; 2003.
11. World Health Organization. WHO Oral Health Country /Area Profile. [cited
2012.]. Available at: http://www.whocollab.od.mah.se/index.html.
http://www.jhsci.ba
Sadeta ei et al. Journal of Health Sciences 2013;3(2):151-158

RESEARCH ARTICLE
Open Access
Incidence of impacted mandibular third molars

in population of Bosnia and Herzegovina: a
retrospective radiographic study
Sadeta ei1*, Samir Prohi1, Sanja Komi1, Amra Vukovi2
1
Department of Oral Surgery, Faculty of Dentistry, University of Sarajevo. 2Department of Preclinical Dentistry, Faculty of
Dentistry, University of Sarajevo
ABSTRACT
Introduction: Impaction may be defined as the failure of complete eruption into a normal functional
position of one tooth within normal time due to lack of space in the dental arch, caused by obstruction by
another tooth or development in an abnormal position. The mandibular third molar is the most frequently
impacted tooth. The incidence varies from 9.5% to 68% in different populations.
Methods: The study was conducted in Department of Oral Surgery, Faculty of Dentistry, University in Sarajevo. Study represents retrospective analysis of panoramic radiographs (orthopantomograms) of patients
referred to Department of Oral Surgery from January 2010 to February 2013 with indication for surgical
removal of impacted third molars.
Results: Of the 2000 radiographs, 761 presented with at least one impacted third molar (38%). A total
of 1034 impacted mandibular third molars were present (51.7%). The most common age group was third
decade (61.2%). Significant statistical difference in incidence of third molar impaction was found between
females and males (p<0.05), but there was no statistical difference in incidence in urban and suburban
population (p=0.374). Vertical angulation was the most common pattern of impaction (65%). Frequency
of third molars erupted into their normal position (class IA) was 42%. Impacted mandibular molars were
associated with periodontal pockets in 134 (6.5%) cases and with dentigerous cysts in 5 cases (0.2%).
Conclusion: The present study provides useful data regarding the clinical status of third molars in population of Bosnia and Herzegovina.
Keywords: impacted mandibular third molars, incidence, Bosnia and Herzegovina
INTRODUCTION
Impaction may be defined as the failure of complete
*Corresponding author: Sadeta ei, DDS, PhD

Department of Oral Surgery; Faculty of Dentistry
University of Sarajevo; Bolnika 4a, 71000 Sarajevo;
Bosnia and Herzegovina
E-mail: sadetas@gnet.ba
Submitted 14 March 2013 / Accepted 3 June 2013
eruption into a normal functional position of one

tooth within normal time due to lack of space in the
dental arch, caused by obstruction by another tooth
or development in an abnormal position (1). The
most often congenitally missing as well as impacted
teeth are the third molars, which are present in 90%
of the population with 33% having at least one impacted third molar (2). They account for 98% of all
the impacted teeth (3). The mandibular third molar
2013 Sadeta ei et al.; licensee University of Sarajevo - Faculty of Health Studies. This is
http://www.jhsci.ba
is the most frequently impacted tooth (4). The incidence varies from 9.5% to 68% in different populations (5-8).
Several factors have been reported to be responsible for the high rate of impaction of mandibular
third molars. These include deficient space in the
dental arch (9), unfavourable angulations and aberrant path of eruption, density of overlying soft and
hard tissues, and the late eruption sequence (4). Mesiodistal width of the third molar may also play a
role in the tendency for impactions. Svendsen and
Maertens have reviewed in detail the etiology of
third molar impactions. Two of the cited causes are:
1. lack of space: insufficient anterior-posterior
dimension, transverse distance of the alveolar
process in the third molar region. Wide alveolar
shelves and a greater mandibular width at the ramus in relation to the intermolar width is important for succesful eruption of the third molars.
2. Late third molar mineralization and early physical maturation (10).
Some of the pertinent causes of insufficient anterior-posterior space are tooth jaw size discrepancy
from evolutionary changes, and insufficient sagital
growth of the mandible as continuous elongation of
the third molar region between 8 and 20 years of
the age is necessary. According to Richardson, this
elongation provides for forward movement of the
first molar, together with ramus resorption to provide third molar space for eruption (11). Although
third molar impaction has multifactorial elements,
inadequate retromolar space for eruption is considered to be the major factor (12,13).
Most studies have reported no sexual predilection
in third molar impaction (8,13,14). Some studies,
however, have reported a higher frequency in females than males (8,15): in white European females
(15,16) and Singapore Chinese females than males
(8). Impacted teeth are often associated with pericoronitis, periodontitis, cystic lesions, neoplasm,
root resorption and can cause detrimental effects on
adjacent tooth (17).
Several methods have been used to classify impaction, in which impaction is described based on the
level of impaction (18), the angulations of the third
molars (19), and the relationship to the anterior border of the ramus of the mandible (18). Winters (19)
and Pell and Gregory (18) classifications are most

commonly used to classify impacted mandibular
third molars. In Winter's classification, the angulation of impaction of the mandibular third molar is
determined by the angle formed between the intersected longitudinal axes of mandibular second and
third molars (19). Level (depth) of impaction can
be classified using the Pell and Gregory classification system, where the impacted teeth are assessed
according to their relationship to the occlusal surface of the adjacent second molar, and their position according to anterior border of the ramus of the
mandible (10).
The aim of our study was to evaluate the incidence
and the pattern of impaction of mandibular third
molars in population of Bosnia and Herzegovina
using panoramic radiographs of patients referred to
Department of Oral Surgery Faculty of Dentistry,
University in Sarajevo.
METHODS
Study sample
The study was conducted in Department of Oral

Surgery, Faculty of Dentistry, University in Sarajevo.
Study represents retrospective analysis of panoramic
radiographs (orthopantomograms) of patients referred to Department of Oral Surgery from January
2010 to February 2013 with indication for surgical removal of impacted third molars. Upon giving
necessary information to patients regarding medical procedure, the patients signed the consent. Two
thousand radiographs were reviewed and related
data were selected from their dental records. Data
were entered in data base specially designed for this
study. Inclusion criteria of the study group was complete root formation of mandibular third molar. Exclusion criteria were: patients younger than 19 years,
poor quality of OPG, incomplete records, presence
of dentoalveolar trauma or other pathological dentoalveolar condition, presence of any systemic or
craniofacial anomaly or syndrome (such as Down
syndrome, cleiodocranial dysostosis) and absence of
mandibular second molar.
152
Radiography analysis
To eliminate the inter-examiner errors, the radiographs were analyzed by a single examiner in a dark
http://www.jhsci.ba
TABLE 1. Winter's classification of impacted mandibular third molars

Impaction pattern
Angulation (angle formed between the intersected longitudinal axes of the second and third Radiograph showing impaction pattern
molars)
Vertical impaction
10 to -10
Mesioangular impaction
11 to 79
Horizontal impaction
80 to 100
Distoangular impaction
-11 to -79
Other impactions
111 to -80
Buccolingual impaction
any tooth oriented in a buccolingual direction

with crown overlapping the roots
room using an appropriate X-ray viewer and magnifying lenses. The angulation and class and type
pattern of impaction were established via visual impression. The radiographs were interpreted for the
following:
1. Presence of impacted mandibular molars. Third
molar was considered impacted if it was not in
functional occlusion and at the same time, its
roots were fully formed.
2. Angulation pattern of impacted mandibular
153
molars. The angulation of impacted third molar

was documented based on Winters classification
with reference to the angle formed between the
intersected longitudinal axes of the second and
third molars: the vertical impaction (10 to -10),
mesioangular impaction (11 to 79), horizontal
impaction (80 to 100), distoangular impaction
( -11 to -79), others (111 to -80) and buccolingual impaction (any tooth oriented in a buccolingual direction with crown overlapping the
roots) (table 1).
http://www.jhsci.ba
Table 1 shows the angulation of impacted third molar based on Winters classification with reference to
the angle formed between the intersected longitudinal axes of the second and third molars.
3. Class and type pattern of impacted mandibular
molars. The level of eruption was documented
according to the classification of Pell and Gregory as follows:
Class I: The crown of the impacted mandibular
third molar is completely anterior to the anterior
border of the ramus of the mandible.
Class II: Approximately one half of the crown is
covered by the ramus
Class III: The impacted mandibular third molar is located completely within the mandibular
ramus.
Position A: Occlusal surface of the impacted
mandibular third molar is level or nearly level
with the occlusal plane of the second molar.
Position B: Occlusal surface of the impacted
mandibular third molar is between the occlusal
plane and cervical line of the second molar.
Position C: Occlusal surface of the impacted
mandibular third molar is below the cervical line
of the second molar.
The data were recorded into specially designed forms

containing the following information: age, gender,
place of residence, region, impacted tooth, angulation of impaction (according to Winter's classification), level of impaction (according to Pell and
Gregory classification), pathology and complications associated with impacted and semi-impacted
third molars. To facilitate the analysis and presentation of data in tables, numerical codes were asigned
for each variable. Data were analyzed using Statistical package for Social Sciences SPSS (SPSS Inc,
Chicago, USA) version 20.0. An unpaired t-test was
used for the statistical analysis at significance level
of P<0.05 to compare variables between groups. All
data regarding patient identification and medical
history were kept confidental.
RESULTS
Of the 2000 radiographs, 761 presented with at

least one impacted third molar (38%). A total of
1034 impacted mandibular molars were present:

508 (24.5%) mandibular left third molar (38) and
526 (25.4%) mandibular right third molar (48). Of
the 761 patients, 270 (36%) were male and 491
(64%) female. The male to female ratio was 1:1.8.
The age range was from 19 to 85 years with mean
age standard deviation = 27 9. The most common age group was third decade (61.2%) followed
by the forth (19.3%). Significant difference in incidence of impaction was found between females and
males (p<0.05). There was no statistical significance
in prevalence of impacted third molars in urban and
suburban population (p=0.374). Impacted mandibular third molars were predominantly associated with impacted maxillary third molars: bilateral
maxillary and mandibular impaction of third molars
were present in 139 (23.5%) cases. Unilateral impacted mandibular third molars were present in 116
(19.6%) cases and bilateral impacted mandibular
third molars in 92 cases (15.6%).
Vertical angulation was the most common pattern of
impaction (65%), followed by mesioangular (20%),
horizontal (9%), distoangular (5%) and buccolingual (1%). Other angulation (inverted) was present
in less than 1% of cases (table 2, figure 1). The occurrence of different pattern of angulation of impacted
mandibular third molars in males and females shows
statistical significance (p<0.05).
The occurrence of different level of impaction is
shown in table 2. Majority of patients presented
with class I (59%), followed by class II (29%) and
class III (12%). Frequency of third molars erupted
into their normal position (class IA) was 42%. Most
common pattern of impaction is IIB (13.6 %), IIA
(11.7 %), IB (10.7 %) and IIIC (10.2%). Rarest
patterns are IIIA (0.8%) and IIIB (0.7%).
The most common pathology associated with impacted third molars is dental caries in the second or
third molar (figure 2) which was recorded in 174
cases (17% of cases). Impacted mandibular third
molars were associated with periodontal pockets (fi
gure 3) in 134 (13 %) cases, dentigerous cysts (fi
gure 4) in 5 cases (0,5 %) and root resorption of
second molar (figure 5) in 2 cases (0.2%). Majority of periodontal pockets were present in impacted
molars with vertical angulation (81%) and Class II
of level of impaction (52%), which was statistically
significant (p<0.05).
154
http://www.jhsci.ba
TABLE 2. Angulation pattern of mandibular third molars based on Winters classification).

ANGULATION PATTERN OF MANDIBULAR THIRD MOLARS
Total
Vertical
Mesioangular
Horizontal
Distoangular
Other
Bucolingual
angulation
angulation
angulation
angulation
angulations
angulation
Fre- Percent- Fre- Percent- Fre- Percent- Fre- Percent- Fre- Percent- Fre- Percentquency age quency age quency age quency age quency age quency age
Mandibular
left molar
(38)
Mandibular
right molar
(48)
Total
318
31%
116
11%
45
4%
23
2%
0.40%
0.80%
508
355
34%
90
9%
47
5%
31
3%
0.40%
0.20%
526
673
65%
206
20%
92
9%
54
5%
0.80%
1%
FIGURE 2. Pathology associated with impacted mandibular

third molars: radiograph of dental caries in semi-impacted
mandibular third molar.
FIGURE 1. Angulation pattern of impacted mandibular third

molars (based on Winters classification).
TABLE 3. Level pattern of mandibular third molars according
to the classification of Pell and Gregory.
LEVEL PATTERN OF MANDIBULAR THIRD MOLARS
(PELL & GREGORY CLASSIFICATION)
Percent- Frequency PercentFrequency
age
(Total)
age (Total)
Class I
437
41.9
620
59.6
Position A
Class I
112
10.7
Position B
Class I
71
7.0
Position C
Class II
122
11.7
299
28.7
Position A
Class II
142
13.6
Position B
Class II
35
3.4
Position C
Class III
9
0.8
122
11.7
Position A
Class III
7
0.7
Position B
Class III
106
10.2
Position C
FIGURE 3. Pathology associated with semi-impacted mandibular third molars: Radiograph of periodontal pocket at the
distal aspect of mandibular third molar.

third molars: Radiograph of dentigerous cyst arising around
impacted mandibular third molar.
155
http://www.jhsci.ba

third molars: radiograph of root resorption of second mandibular molar as result of semi-impacted third molar.
DISCUSSION
This is the first study to evaluate incidence of impacted third mandibular molars in population of Bosnia
and Herzegovina. According to Institute for Public
Health of Federation of Bosnia and Herzegovina,
there is no data regarding incidence of impacted
teeth in population of Bosnia and Herzegovina (20).
Also, there is no conducted and published researches
from other institutions in Bosnia and Herzegovina
which deal with impacted teeth. The sample size
used was equivalent to the samples used in many
other international studies (7,8,21,22), and selection of patients was also like other studies which
enables comparison of results. Since study sample
consists of all patients reffered to Department of
Oral Surgery from ten Cantons of the Federation
of Bosnia and Herzegovina, study sample represents
population of the Federation of Bosnia and Herzegovina. The predominant age group in our study is
third decade, which is in agreement with results of
other authors (17,23,24,25). This may be related
to early removal of impacted third molars due to
prophylactic indication in orthodontic patients
and increasing awareness about oral health. Many
studies reported gender predilection in third molar
impactions (8,15,17,34). Results of our study are
in agreement with previous reports, since there is
statistical significance in distribution of impacted
teeth between females and males (p<0.05). The
higher frequency reported in females is due to the
con-sequence of difference between the growth of
males and females. Females usually stop growing
when the third molars just begin to erupt, whereas
in males, the growth of the jaws continues during
the time of eruption of the third molars, creating
more space for third molar eruption (9). The frequency of patients with at least one impacted third
molar in our study is 38%, which is in accordance
with findings of other authors: Hassan (40%) (21),
Rajasuo et al (38%) (22), Hattab (33%) (6) and Eliasson (30%) (27). Higher prevalence of impacted
teeth was found in study of Morris and Jerman in
a study conducted in USA on 5000 subjects (65%)
(28), probably as a result of different age groups included in study since our study represents all age
groups; and also in study of Quek et al. on 1000
subjects of Chinese population (68%) due to higher
jaw teeth size discrepancy, wider teeth and smaller
dental arch length of Chinese population compared
with Caucasians (8). The frequency of normally
erupted third molars in our study is 42%, which is
lower than findings of other studies conducted on
Afro-American population (58%) (29) and Indian
population (65%) (30) which suggests racial and
ethnic factors contributing to impaction of third
molars. Olasoji reported impacted third molars are
up to 7 times more common in the urban than rural
areas in Nigeria and also, when it occurred, third
molar impactions affected all the four third molars
much more frequently in urban than in rural population. This suggests impaction of third molars is urban phenomenon since dental arch length of urban
population is undergoing an unnoticed transition
process of disuse atrophy. This is in accordance with
many surveys which have shown that impactions
and malocclusions attain high levels in industrialized countries of Europe and North America. In
contrast, surveys carried out in communities with
a simple mode of life have in general shown a lower
incidence of dental irregularities (31). However, our
study did not show statistically significant difference
in prevalence of impaction in urban and suburban
areas (p>0.05). According to majority of the studies, the most common angulation of impaction is
mesioangular (8,21,28,30,32,33). However, in our
study the most common angulation of impaction is
vertical (65%), which is in accordance with findings
of Hugoson and Kugelberg in a study conducted on
Swedish population (15). This again underlines the
significance of racial and ethnic factors in pattern of
third molar impactions, since study sample of our
study and study of Hugoson was European Caucasian population. Differences may also be partly due
to different method of classification of angulation
that was used in studies. Level of impaction was as-
156
http://www.jhsci.ba
sessed according to the relationship of level of occlusal surface of third molar with adjacent second molar. The most common type of impaction regarding
Pell and Gregory classification is IIB (13.6%) like
reports of Almendros-Marques from Spain (34), following by IIA (11.7%) which is the most common
type in Italian population (35). Consequently, the
findings of this study are in agreement with large
number of reports that show that most impacted
third molars were at Class II position where half of
the crown was in the ramus and the position of the
highest portion of third molar was between the occlusal plane and cervical line of the second molar,
which is position B. The Pell and Gregory and Winter classifications are used to document the position
of the impacted man-dibular third molars, but also
these classifications can be used to predict the surgical difficulty and to evaluate the risk of postoperative complications. Most of the complications are
associated with a greater degree of impaction and
it seems that position of angulation has impact on
postoperative complications (36). That why evaluation of pattern, type and class of impaction has also
the clinical significance, not just the epidemiological.
CONCLUSION
The present study provides useful data regarding

the clinical status of third molars in population of
Bosnia and Herzegovina. 38% of patients presented
with at least one impacted third molar. The most
common age group was third decade. Significant
difference in incidence of impaction was found between females and males, but there was no statistical
significance in prevalence of impacted third molars
in urban and suburban population. Vertical angulation was the most common pattern of impaction.
Majority of patients presented with class I of level
of impaction. The most common pathology associated with impacted third molars is dental caries
in the second or third molar. Future studies should
be conducted on randomized sample representative
of all regions of Bosnia and Herzegovina. They are
required to evaluate the etiology of impacted third
molars in population of Bosnia and Herzegovina as
well as linking epidemiological data with incidence
of postoperative sequelae and complications associated with surgical removal of impacted mandibular
molars.
157
REFERENCES
1. Khawaja NA. Third molar impaction: a review. J Pak Dent Assoc
2006;15:97-101.
2. Haq Z. A Survey of reasons for Surgical Removal of Impacted Mandibular
third Molar in Armed Forces Personnel at AFID Rawalpindi. Pak Oral Dent
J 2002;22:137-9.
3. Sadermi Fayad J, Levy JC, Yazbeck C, Cavezian R, Cabanis EA. Eruption
of third molars: relationship to inclination of adjacent molars. Am J Orthod
Dentofacial Orthop 2004;125:200-2.
4. Peterson LJ. Principles of management of impacted teeth. In: Peterson LJ,
Eills E, Huup JR, Tucker MR, editors. Contemporary oral and maxillofacial
surgery. 4thed. New York: Mosby, 2003;184-213.
5. Lima CJ, Silva LC, Melo MR, Santos JA, Santos TS. Evaluation of the
agreement by examiners according to classifications of third molars. Med
Oral Patol Oral Cir Bucal. 2012;17:281-216.
6. Hattab FN, Fahmy MS, Rawashedeh MA. Impaction status of third molars in Jordanian students. Oral Surg Oral Med Oral Pathol Radiol Endod.
1995;79(1):2429.
7. Haidar Z, Shalhoub SY. The incidence of impacted wisdom teeth in a Saudi
community. Int J Oral Maxillofac Surg. 1986;15(5):569571.
8. Quek SL, Tay CK, Tay KH, Toh SL, Lim KC. Pattern of third molar impaction
in a Singapore Chinese population: a retrospective radiographic survey. Int
J Oral Maxillafac Surg. 2003;32(5):548552.
9. Bishara SE, Andreasen G. Third molars: a review. Am J Orthod
1983;83:131-7.
10. Svendsen H, Maertens JKM. Etiology of third molar impaction. In: Andreasen JO, Petersen JK, Laskin DM, eds: Textbook and Color Atlas of
Tooth Impactions. Copenhagen: Munskgaard 1997;223-227.
11. Richardson ME. Lower third molar space. Angle Orthod 1987;57:155-161.
12. Olive R, Basford K. Reliability and validity of lower third molar space assessment techniques. Am J Orthod 1981;79:45-53.
13. Niedzielska IA, Drugacz J, Kus N, Kreska J. Panoramic radiographic predictors of mandibular third molar eruption. Oral Surg Oral Med Oral Pathol
Oral Radiol Endod 2006;102:154-8.
14. Kaya GS, Aslan M, mezli MM, Dayi E. Some morphological features related to mandibular third molar impaction. J Clin Exp Dent. 2010;2:12-7.
15. Hugoson A, Kugelberg CF. The prevalence of third molars in a Swedish population. An epidemiological study. Community Dental Health.
1988;5(2):121138.
16. Murtomaa H, Turtola I, Ylipaavalniemi P, Rytomaa I. Status of the third
molars in the 20- to 21-year-old Finnish university population. J Am Coli
Health. 1985;34(3):127129.
17. Maaita J, Alwrikat A. Is the mandibular third molar a risk factor for mandibular angle fracture? Oral Surg Oral Med Oral Pathol Oral Radiol Endod.
2000;89:143-6.
18. Pell GJ, Gregory BT. Impacted mandibular third molars: classification and
modified techniques for removal. Dent Digest. 1933;39:330338.
19. Winter GB. The Principles of Exodontia as Applied to the Impacted Third
Molar. St. Louis, MO: American Medical Book Co; 1926.
20. Institute for Public Health Federation of Bosnia and Herzegovina. Health
Condition of Population of Federation of Bosnia and Herzegovina and
Health Care in Federation of Bosnia and Herzegovina in 2011. 2012 Jul
[cited 2013 Jul 29]; 35-37. Available from: http://www.zzjzfbih.ba/wpcontent/uploads/2009/02/Zdravstveno-stanje-stanovnis%CC%8Ctva-izdravstvena-zas%CC%8Ctita-u-FBiH-2011.pdf
21. Hassan AH. Pattern of third molar impactions in a Saudi population. Clinical, Cosmetic and Investigational Dentistry 2010;2:109113
22. Rajasuo A, Murtomaa H, Meurman JH. Comparison of the clinical status of
third molars of young men in 1949 and in 1990. Oral Surg Oral Med Oral
Pathol. 1993;76(6):694698.
23. Osborn TP, Frederickson Jr G, Small IA, Torgerson TS. Prospective study
of complications related to mandibular third molar surgery. J. Oral Maxillofac Surg 1985; 43(10):767-9.
http://www.jhsci.ba
24. Ishfaq M, Wahid A, Rahim AU, Munim A. Patterns and presentations of

impacted mandibular third molars subjected to removal at Khyber College
of Dentistry Peshawar. Pak Oral Dent J 2006;26:221-6.
31. Olasoji HO, Odunsaya SA. Comparative study of third molar impaction
in rural and urban areas of South-western Nigeria. Odonto-Stomatologie
Tropicale. 2000; 90:25-29.
25. Ayaz H, Rehman A. Pattern of impacted mandibular third molar in patients

reporting Department of Oral and Maxillofacial Surgery, Khyber College of
Dentistry, Peshawar. JKCD, 2012.2(2):50-53
32. Byahatti S, Ingafou MSH. Prevalence of eruption status of third molars in

Libyan students. Dental Research Journal, 2012.9;2:152-157
33. Jaffar RO, Mon Mon TO. Impacted mandibular third molars among patients
attending Hospital Universiti Sains Malaysia. Archives of Orofacial Sciences (2009),4(1):7-12
26. Kim JC, Choi SS, Wang SJ, Kim SG. Minor complications after mandibular
third molar surgery: type, incidence and possible prevention. Oral Surg
Oral Med Oral Pathol Oral Radiol Endod. 2006;102:4-11.
27. Eliasson S, Heimdahl A, Nordenram A. Pathological changes related to
long-term impaction of third molars. A radiographic study. Int J Oral Maxillofac Surg. 1989;18(4):210212.
28. Morris CR, Jerman AC. Panoramic radiographic survey: a study of embedded third molars. J Oral Surg 1971:29:122-125
29. Kramer RM, Williams AC. The incidence of impacted teeth. Oral Surg Oral
Med Oral Pathol. 1970;29(2):237241.
30. Ramamurthy A, Pradha J, Jeeva S, Jeddy N, Sunitha J, Kumar S. Prevalence of mandibular third molar impaction and agenesis: a radiographic
south Indian study. J Indian Aca Oral Med Radiol 2012;24(3):173-176
158
34. Almendros-Marqus N, Berini-Ayts L, Gay-Escoda C. Influence of lower

third molar position on the incidence of preoperative complications. Oral
Surg Oral Med Oral Pathol Oral Radiol Endod. 2006;102:725-32.
35. Monaco G, Montevecchi M, Bonetti GA, Gatto MR, Checchi L. Reliability
of panoramic radiography in evaluating the topographic relationship between the mandibular canal and impacted third molars. J Am Dent Assoc.
2004;135:312-8.
36. Blondeau F, Daniel NG. Extraction of Impacted Mandibular Third
Molars: Postoperative Complications and Their Risk Factors. JCDA;
2007;73(4):325
http://www.jhsci.ba
Elvira Brkievi et al. Journal of Health Sciences 2013;3(2):159-163

RESEARCH ARTICLE
Open Access
Etiological factors of preterm delivery

Elvira Brkievi1, Gordana Grgi2*, Denita Ljuca2, Edin Ostrvica3, Azur Tulumovi2
1
Health Center Lukavac, Majevikih brigada bb, Lukavac, Bosnia and Herzegovina. 2Department of Gynecology and Obstetrics, Universitiy Clinical Centre Tuzla, Trnovac bb, Tuzla, Bosnia and Herzegovina. 3Health Center Dr Mustafa ehovi,
Albina Hreljevia 1, Tuzla, Bosnia and Herzegovina.
ABSTRACT
Introduction: Preterm delivery is the delivery before 37 weeks of gestation are completed. Preterm birth
is a major course of neonatal morbidity and mortality, the incidence of premature delivery in developed
countries is 5 to 9%. Aims of this study were to determine the common etiological factors for preterm
delivery, most common weeks of gestation for pretern delivery, and most commom way of delivery for
preterm delivery.
Methods: The study included 600 patients divided into two groups, experimental group (included 300
preterm delivered pregnant women), control group (included 300 term delivered women).
Results: The incidence of preterm delivery in pregnant women younger than 18 years was 4.4%, and in
pregnant women older than 35 years was 14%. 44.6 % of preterm delivered women at the experimental
group had lower education. In the experimental group burdened obstetrical history had 29%, 17.2% had
a preterm delivery, 35.6% had a premature rupture of membranes, 15% had a preterm delivery before
32 weeks of gestation, 12.4% between 32-33.6 weeks of gestation, while 72.6% of deliveries were between 34- 36.6 weeks of gestation. Multiple pregnancy as an etiological factor was present in 10.07% of
cases. Extragenital diseases were present in 10.4%. In the experimental group there were 29%, while in
the control group there were 15% subjects with burdened obstetrical history.
Conclusions: Preterm birth more often occurs in a pregnant women younger than 18 and older than
35 years, and in a pregnant women of lower educational degree. Preterm delivery in the most common
cases was finished in period from 34 to 36.6 weeks of gestation. The most common etiological factor of
preterm delivery in the experimental group was preterm rupture of membranes and idiopathic preterm
delivery.
Keywords: preterm delivery, etiological factors, complications of preterm delivery
INTRODUCTION
Preterm delivery, defined by the WHO and American Pediatrics Academy is the delivery before 37
*Corresponding author: Gordana Grgi, MD, PhD

Department of Gynecology and Obstetrics, Universitiy Clinical
Centre Tuzla, Trnovac bb, 75000 Tuzla, Bosnia and Herzegovina
Phone: 387 61 150 848
E-mail: gordana.grgic@bih.net.ba
weeks of gestation are completed (1). According to

the International Classification of Diseases since
2001 the lower limit of preterm birth is 22 weeks of
gestation from the date of the last menstrual period
(or birth weight 500 grams). The incidence of preterm birth ranges from 5 to 15%. Preterm delivery
is a major couse of neonatal morbidity and mortality.
It is believed that the preterm delivery is the cause of
neonatal death in 75% of cases and in 50% of cases
leads to the creation of permanent neurological se-
2013 Elvira Brkievi et al.; licensee University of Sarajevo - Faculty of Health Studies. This
http://www.jhsci.ba
quelas (2). In the undeveloped part of the world the

major couses of the preterm deliveres are infections,
malnutrition and poor antenatal care, while in developed countries major couses are methods of assisted
reproductions and earlier completition of vunerable
pregnancies (3). According to the latest researches
of preterm delivery is a syndrome caused by many
causes, knowledge of these causes would improve
the prevention and treatment of preterm delivery
(4). Behr et al., (5) causes of preterm delivery are divided to: fetal, placental, uterine, maternal and other
causes. Fetal causes include: fetal distress, multiple
gestation, eritroblastosis and the nonimune hydrops.
Placental causes are: placenta previa and placental
abruption. Uterine causes are the anomalies of the
uterus and incompetent cervix. Maternal causes are:
preeclampsia, chronic diseases, infections and using drugs. Other causes are: premature rupture of
membranes, polyhydramnion, iatrogenic causes. It
is believed that premature rupture of membranes is
responsible for 1/3 of all preterm deliveris (6). Increased risk of preterm delivery is in young pregnant women and the older pregnant women. Young
women more often have vaginal infection, antenatal
care is weak and therefore they have the higher incidence of pathological pregnancies. Older women
(>35 years) with increasing of age have increased risk
of preterm delivery. At this age, greater is the incidence of systemic and degenerative diseases, EPH
gestosis, and changes in the uterus. Higher risk is for
chromosomal and other fetal anomalies (3). Reproductive history is a major factor in the prognosis for
the current pregnancy. Previous artificial abortions
have an impact on the occurrence of preterm delivery. Susceptibility for premature delivery increases
with the number of previous miscarriages, particularly with the regarding the abortion in the second
trimester. The most important factor is the existence
of earlier preterm births. Patients who previously
had a preterm delivery have a 14% higher incidence
of preterm delivery in the current pregnancy. Large
share in the development of premature births have
anomalies of the uterus (7). Cervical incompetence,
characterized as painless cervical canal expansion in
the second trimester is often the cause of miscarriage
or preterm delivery. The increased concentration of
relaxin is an endocrine cause of cervical incompetence (8). Numerous studies have shown that there
is an association between increased concentrations
of relaxin and the occurrence of preterm birth (9).
Multiple pregnancy is an important factor for preterm delivery, accounts for 10-15%, six times more
frequent than in singleton pregnancies. It is especially important fruiting low birth weight (<2500
grams), and higher is incidence of intrauterine
growth retardation. Psycho-social stress of mother is
an important risk factor of preterm delivery. Stress
increases secretion of epinephrine, norepinephrine,
and cortisol, which leads to activation of placental
corticotropin-releasing hormone, leading to the
biological cascade that results in a formation of preterm birth (10). Preterm labor of unknown cause
(idiopathic preterm labor) is represented in the total
number of preterm births and up to 50% (11). In
idiopathic preterm labor there is no change in the
production of prostaglandins, and it is possible that
in these cases is increased the myometrial sensitivity
to the current values of endogenous oxytocin.
METHODS
This retrospective study included 600 patients hospitalized and delivered in the Department of Gynecology and Obstetrics, University Clinical Center of
Tuzla. All the subjects were divided into two groups:
experimental and control groups. In the experimental group there were 300 of preterm delivered
patients (24-37 weeks of gestation), control group
was coposed of 300 patients term delivered (37-42
weeks of gestation) with same demographic caracteristics. The following parameters were analyzed:
maternal age, level of education, burdened obstetrical history (previous preterm births, miscarriages,
stillbirth), the presence of extragenital diseases
(hypertensive disease-preeclampsia, eclampsia, diabetes, hypothyroidism, hyperthyroidism) weeks of
gestation at the time of birth in the experimental
group, the prevalence of some etiologic factors in
the etiology of preterm delivery in the experimental
group, the method of delivery. Etiologic factors are
classified into: multiple pregnancy, premature rupture of membranes, idiopathic preterm labor and
other causes (placental abruption, placenta previa,
polyhydramnios).
These results were analyzed by standard methods of

descriptive statistics. Statistical significance between
samples was tested by 2 test at level of =0.05.
160
http://www.jhsci.ba
RESULTS
Table 2. shows that there is a statistically significant

correlation between the level of mother's education
and membership in a particular group (2=6.03,
p=0.049).
TABLE 1. The age of mother

Group
Experimental
Control
<18 N
(%)
13
(4.4%)
5
(1.6%)
19-34 N
(%)
245
(81.6%)
271
(90.4%)
>35 N
(%)
42
(14%)
24
(8%)
Total
N (%)
TABLE 3. Burned obstetrical history
300 (100%)
Group
Experimental
Control
300 (100%)
2 test has shown correlation between the age of

the pregnant women, and the group they belong to
(2=9.77, p=0.008). This tells us that the higher incidence of premature births was in pregnant women
younger than 18 and older than 35 years.
Yes N (%)
87 (29%)
45 (15%)
No N (%)
213 (71%)
255 (85%)
Total N (%)
300 (100%)
300 (100%)
2 test showed a statistically significant association

between a particular group and burned obstetrical
history. Burned obstetrical history was more frequent in the experimental group. Chance of preterm
delivery at present burdened obstetrical history in
the experimental group was 2.31 times higher than
in the control group (95% CI: 1:55 to 3:46).
TABLE 4. Extragenital diseases of mothers
Group
Experimental
Control
FIGURE 1. Weeks of gestation at the time of birth in the experimental group
Figure 1. shows weeks of gestation in a moment

of delivery in the experimental group. The largest
number of births was in the period between 3436.6 weeks of gestation (7.6%), while the smallest
number was in the period between 32-33.6 weeks of
gestation (12.4%). Frequency of deliveries before 32
weeks of gestation was 15%.
TABLE 2. Level of education (mother's degree)

Group
Experimental
Control
Housvifes
and primary
school N (%)
134
(44.6%)
105
(35%)
Medium
schools N
(%)
120
(40%)
137
(45.6%)
Diseases of mothers N (%)

31 (10.3%)
9 (3%)
Table 4. shows the prevalence extragenital diseases

of mothers (hypertensive disease-preeclampsia, eclampsia, diabetes, hypothyroidism). It indicated
that there was a statistically significant correlation
between the frequency of the extragenital diseases of
mothers and the group (2=11.81, p=0.0006). The
incidence of extragenital diseases at the experimental group was higher than in the control group. The
chance of mothers having preterm delivery is 3.73
times higer in the experimental group if the mother
has extragenital diseas than in control group (95%
CI: 1.69-9.05).
TABLE 5. Etiological factors of preterm delivery in the experimental group
University
degrees and
students N (%)
46
(15.4%)
58
(19.4%)
Eksperimental
group
161
Premature
rupture of
membranes
107
(35.6%)
Idiopathic
pretem
delivery
108
(36%)
Multiple
pregnancy
Other
causes
31
(10.07%)
57
(19%)
http://www.jhsci.ba
The most common factors are the preterm delivery

of unknown cause (36%), and the preterm delivery
with premature rupture of membranes (35.6%).
TABLE 6. Method of delivery
Group
Experimental
Control
Per vias natuS.C.

ralis N (%)
N (%)
178 (59.3%) 122 (40.7%)
256 (85.3%)
44 (14.7%)
Total
N (%)
300 (100%)
300 (100%)
Table 6. shows method of delivery (per vias delivery

or delivery by cesarean section). It was found that
there were a statistically significant association between method of delivery and membership of a particular group (2=49.38, p<0.0001). The incidence
of delivery per vias is greater in the control than in
the experimental group. Chance of delivery per vias
was 3.99 times higher in control than in the experimental group (95% CI: 2.65-6.06).
DISCUSSION
Preterm delivery remains the leading problem of

modern obstetrics in the whole world it results in
birth of premature infants with a high risk of morbidity and mortality. Reports on the incidence of
preterm delivery, partly because of different definitions, different races, ethnic groups, climate, countries and institutions. It is considered that 5-15%
of pregnancies end before the date (12). Preterm
birth is multifactorial disorder in wich creation
are involved various exogenous and endogenous
risk factors whose interactions initiated early, start
asynchronous delivery mechanism. All risk factors
for preterm birth can be classified into the following categories: maternal characteristics, reproductive
history and characteristics of the actual pregnancy
(13). In our study, we investigated the etiological
factors who have lad to the preterm delivery. We
investigated the mother age as one of the factors. In
our sample in the experimental group was 4.4% of
mothers who had preterm delivery younger than
18 years, and 14% of mothers who had preterm
delivery were older than 35 years. The incidence of
preterm birth was higher in mothers younger than
18 and older than 35 years. The study of Vilendei
et al., (14) found 1.7% of pregnant women preterm delivered who were less than 18 years old, and
11,9% of pregnant women preterm delivered who

were older than 35 years. In our research, we got a
slightly higher percentage wich is probably related
to the sample size of the author. The next parameter
is mothers degree. In the experimental group was
44.6% houswifes and mothers with primary school
education, the data were compared with the corresponding data of the control group. 2 test shown
the correlation between the degree and group. In
our sample, most prematurely delivered infants were
by mothers with lower education, as evidenced in
the work of Astolfo-I and Zonta's (15).
Under burdened obstetric history we include a previous preterm birth, previous miscarriage, stillbirth,
genital organs surgery, assisted reproduction procedures and anomalies of the uterus. In a study 29%
of pregnant women in the experimental group had
burdened obstetric history, and in the control group
15%. There were a statistically significant difference between the experimental and control group.
Chance for preterm delivery in the experimental group is 2.31 times higher than in the control
group. Our study, wich included the total number
of pregnant women with the burdened obstetrical
hisory, shows that 17.2% of pregnant women who
preterm delivered already had a preterm delivery.
Mercer et al.,(16) said if you had a previous preterm
delivery, the risk of recurrence of preterm delivery in
the next pregnancy is more than double. Virk et al.
suggest that pregnant women with a previous pregnancy terminations have a significantly higher risk
for preterm delivery in the next pregnancy (17). The
presence of maternal extragenital diseases (hypertension in pregnancy-preeclampsia, eclampsia, diabetes,
hypothyroidism, hyperthyroidism) was evaluated in
the experimental and control groups. In the experimental group there was 10.3% of pregnant women
with extragenital diseases, while in the control group
there was 3% of pregnant women with extragenital
diseases. There was statistically significant difference
between the groups. The chance of occurrence of
preterm birth among mothers attending extragenital diseases was 3.73 times higher in the experimental group than in the control group. The research of
urkovi et al., shows the presence of extragenital
diseases in 53% of pregnant women delivered prematurely (18).
In our study, 15% deliveres were before 32 week
of gestation, 12.4% were between 32-33.6 week of
162
http://www.jhsci.ba
gestation, 72.6% were between 34-36.6 weeks of

gestation. Multiple pregnancy as an etiological factor was present in 10.07% of cases. Similar results
are found in the study Vilendei et al., where the
percentage of preterm delivery completed before
32 weeks of gestation was 13.8% (14). Also, in the
study of Vilendei et al. (14) it is shown that 10.5%
of preterm delivery was caused by twin pregnancy.
Goldenberg et al. (3) found the presence of about
20% of preterm births up to 32 weeks of gestation,
20% of preterm births between 32-33.6 weeks of
gestation, 60-70% is between 33.6-36.6 weeks of
gestation. In aur study multiple pregnancy as an etiological factor was present in 10.07%. We analyzed
the method of delivery, per vias delivery or caesarean section. In our study 59.3% of preterm delivery
has been completed per vias (naturally) more than
half, while 40.7% completed surgically by caesarean
section. There was a statistically significant association between the method of delivery and groups.
The incidence of delivery per vias is greater in the
control than in the experimental group. The chance
of vias per birth was 3.99 times greater in the control than in the experimental group. Our results are
different from the results Vilendei et al., who has
shown that vaginal delivery completed in 77.8% of
cases, while the cesarean in 22.1% of preterm births
(14). In terms of frequency of premature rupture of
membranes different studies show a wide range in
preterm and term delivery. While some argue that
10% of all pregnancies is complicated with premature rupture of membranes, 80% of premature rupture of membranes is at term of delivery (19), others
state that the premature rupture of membranes as a
cause of premature birth is present in the 25-30% of
the cases (3). The results of our study shows that preterm delivery with premature rupture of membranes
had 35.6% of our patients.
preterm delivery are premature rupture of the fetal

membranes and idiopathic preterm labor. Cesarean
section as a method of delivery is more common in
the experimental group than in the control group.

REFERENCES
1. World Health Organisation. Prevention of perinatal mortality. Public Health
Papers 42. 1969, Geneve WHO.
2. Prodan M, Petrovi O. Lijeenje prijeteeg prijevremenog poroda. Gynecol
Perinatol. 2008;17(4):207-215.
3. Goldenberg RL, Culhane JF, Iams DJ, Romero R. Epidemiology and
causes of preterm birth. Lancet. 2008;371:75-84.
4. Romero R, Baumman P, Gonzales R, Gomez R, Rittenhouse L, Behnke E.
Amniotic fluid prostanoid concentrations increase early during the course
of spontaneous labor at term. Am J Obstet Gynecol. 1994;171:1613-1620.
5. Behram RE, Gottof SP, Kliegman RM. The fetus and neonatal infant. In:
Behram RE (ed). Nelson textbook of pediatrics. Fourthteenth edition. Philadelphia: WB Sauders Company, 1992:421-525.
6. Guinn DA, Goldenberg RL, Hauth JC, Andrews WW, Thom E, Romero R.
Risk factors for the development of preterm premature rupture of membranes after arrest of preterm labor. Am J Obstet Gynecol. 1995;173:13101314.
7. Tucker J, McGuire W. ABC of preterm birth-Epidemiology of preterm birth.
British Medical Journal. 2004;329:675-678.
8. Iams JD. Cervical incompetence. In: Creasy R, Resnik R (eds). Maternal
fetal medicine. 4th edition. Saunders Company, Philadelphia. 1999:445464.
9. Lee KY, Jun HA, Kim HB, Kang SW. Interleukin-6 but not relaxin, predicts
outcome of rescue cerclage in women with cervical incompetence. Am J
Obstet Gynecol. 2004;191:784-789.
10. Lu MC, Chen B. Racial and ethnic disparities in preterm birth: The role of
stressful life events. Am J Obstet Gynecol. 2004;191:123-135.
11. Newman RB, Richmond GS, Winston YE, Hamer C, Katz M. Antepartum
uterine activity characteristics differentiating true from threated preterm
labour. Obstet Gynecol. 1990;76:S39-S41.
12. Kuvai I, Elvedij-Gaapovi V. Prijevremeni poroaj. U: Kuvai I, Kurjak
A, Delemi J. Porodnitvo. Medicinska naklada, Zagreb. 2009:323-332.
13. Mirkovi . Klinike strategije u prevenciji preterminskog poroaja. U:
Radunovi N (ur) Novine u perinatalnoj medicini. Beograd, 2012:74-79.
14. Vilendei R, Perendija V, Savi S, Grahovac S, Eim V, Vilendei Z,
et al. Prevremeni poroaj i perinatalni ishod. Zbornik radova, pedeseta
ginekoloko-akuerska nedelja SLD. Beograd, 2006:102-7.
15. Astolfi P, Zonta L.A. Risks preterm delivery and association with maternal
age, birth order and fetal gender. Human Reproduction. 1999;11(14):28912894.
CONCLUSIONS
Preterm birth is more common in pregnant women

younger than 18 and older than 35 years of life and
in the pregnant women of lower educational level.
The largest number of preterm births was completed in the period between 34-36.6 weeks of gestation. Pregnant women delivered prematurely atend
to have burdened obstetrical history, and presence
of extragenital diseases is also significantly higher.
The most common etiological factors who lead to
163
16. Mercer BM, Goldenberg RL, Moawad A. The Preterm Prediction Study: Effect of gestatinal age and cause of preterm birdh on subsequent pregnancy
outcome. Am J Obstet Gynecol. 1999;181:1216-21.
17. Virk, Zhang J, Olsen J. Medical abortion and the risk of subsecquent adverse pregnancy outcomes. N Engl J Med. 2007;357:648- 53.
18. urkovi A, Sokolovi D, utura N, Karadov Orli N, Soldo V, Zamurovi N
et al. Neonatalne komplikacije prevremenih poroaja. Zbornik radova, pedeset i esta ginekoloko- akuerska nedelja SLD. Beograd, 2012:100-115.
19. Dinulovi D i Terzi M. Preterminska prevremena ruptura plodovih ovojaka
(PPROM). U: Davidovi M i Gari B (ur). Opstetricija. Novinsko-izdavaka
ustanova, Beograd. 1996:595-606.
Belma Muhamedagi et al. Journal of Health Sciences 2013;3(2):164-169
http://www.jhsci.ba

RESEARCH ARTICLE
Open Access
Sex determination of the Bosnian-Herzegovinian

population based on odontometric characteristics of
permanent lower canines
Belma Muhamedagi1*, Nermin Sarajli2
1
Private Dental Office, Sarajevo, Bosnia and Herzegovina. 2Department of Forensic Medicine, Faculty of Medicine, University
of Sarajevo, Bosnia and Herzegovina
ABSTRACT
Introduction: Sex determination is one of first and most important steps in identifying disintegrated
bodies and skeletal remains. During the exhumation of bodies from the mass graves and archaeological
excavations, it is quite often the case that not all bones of one person are found, therefore, teeth and the
scull are the only true identification material. Canines are teeth most appropriate for sex determination.
The aim of the research was to determine sex identity of the Bosnian-Herzegovinian population based on
odontometric characteristics of permanent lower canines.
Methods: The research sample included 180 patients of the Dental Office, of both sexes. All patients with
permanent lower right and left canines, without caries, with healthy state of gingiva and periodontium,
without crown restorations were included in the research. Measurement was done directly in the patients'
mouth using a digital sliding caliper. Greatest mesiodistal width of the lower right and left canine and
intercuspal distance of the lower jaw were measured.
Results: All parameters were higher in case of male, including Mandibular Canine Index (MCI) (p<0.01).
The precision of appraising the sex identity for the Bosnian-Herzegovinian population, based on MCI on
the right, amounts 68.89% and 68.54% on the left.
Conclusions: The study showed that right canines are significantly broader than the left ones and they
are broader in case of males. Lower right canines, that is, MCI on the right, indicates greater accuracy in
sex determination in relation to left lower canines. The accuracy in sex determination for all variables is
higher for the female.
Keywords: identification, sex determination, canines, Mandibular Canine Index.
INTRODUCTION
*Corresponding author: Belma Muhamedagi
Private Dental Office Biaki, Marala Tita 7,
Sarajevo, Bosnia and Herzegovina
Phone: +38761993234
E-mail: belma81@bih.net.ba
Submitted 21 May 2013 / Accepted 23 June 2013
Sex determination is one of first and most important

steps in identifying disintegrated bodies and skeletal
remains. The past war in Bosnia and Herzegovina
(1992-1995) took a large number of human lives
and many families are still searching for their relatives. According to data of the Missing Persons In 2013 Belma Muhamedagi et al.; licensee University of Sarajevo - Faculty of Health Studies.
http://www.jhsci.ba
stitute and International Commission for Missing

Persons (ICMP), it is believed that during the war
in Bosnia and Herzegovina, about 17.000 human
remains were exhumed including many those still
not identified. Around 9.000 persons have still not
been found and identified (1). Therefore, there is a
need to identify a large number of human remains
exhumed from many mass graves on the territory
of Bosnia and Herzegovina because it provides a
discovery for survived family about the fate of their
loved ones.
Pelvis and scull bones are most frequently used for
sex determination based on skeleton although the
measurement of humerus and femur head diameter
enables highly credible sex determination (2,3). Very
frequently, bones of one person cannot be found
during exhumations of bodies from mass graves, especially secondary and tertiary, where death remains
are quite mixed, and archaeological excavations,
therefore, teeth and the scull are the only real material for identification (4).
The analysis of teeth and identification of discovered
bodies using teeth characteristics showed as the first,
irreplaceable and highly important procedure in determining the identity of unknown human remains
(5-7).
Canines are teeth most appropriate for sex determination. Studies on permanent canines show that
those are teeth that are less frequently taken out
probably due to reduced caries incidence and they
are the least affected by periodontal diseases and
they are last teeth to be taken out in view of age.
Moreover, those are teeth that can survive many
traumas and disasters. All the aforementioned indicate that canines are teeth that can be used as key
teeth for identification (8-10).
Sex determination using odontometric techniques is
of great interest in cases of great disasters when bodies are severely damaged to the extent that identification is not possible. There are many methods for
studying canines dimensions such as Fourier analysis, Moire topography, measurement of linear teeth
dimension such as mesiodistal width, buccolingual
width and inciso-cervical height (11-14). One of

them is the method according to Rao et al that is
simple, credible, inexpensive, easily performed and
it provides satisfactory results and it is used on greater population. Method according to Rao includes
the measurement of mesiodistal width of permanent
lower jaw canines as well as the measurement of intercuspal distance, that is, measurement of distance
between tips of canine cusps (15). The success rate
of sex determination based on Raos formula is up
to 89% (16).
Aim of this study is to appraise the sex identity of
the Bosnian-Herzegovinian population based on
odontometric characteristics of lower jaw canines by
applying the method according to Rao et al.
METHODS
Study sample
Research sample included patients of the Dental Office, of both sex, including the total of 180 patients,
90 male and 90 female patients. All patients with
permanent lower right and left canines, without
caries, with healthy state of gingiva and periodontium, without crown restorations were included in
the research. All patients were explained the type of
measurements, its method and purpose and they all
signed voluntary acceptance for teeth measurement.
Methods
Research was retrospective, clinical and descriptive.

It was done directly in the patients' mouth using a
digital sliding caliper and values were expressed up
to the hundredth part of millimeter. Parameters that
were measured include: greatest mesiodistal width of
the lower right and left canine and intercuspal distance of the lower jaw. Mesiodistal width of canines
is measured in the manner that the greatest span between the mesial and distal approximate surface on
vestibular tooth surface is measured using a digital
sliding caliper. Intercuspal distance is measured in
the manner that the distance between the tips of canine cusps of the right and left canine is measured
Mesiodistalcrown width of permanent lower jaw canine

MCI =
Intercuspal distance of the lower jaw
165
http://www.jhsci.ba
(Mean male MCI - SD) + (Mean female MCI + SD)

Std.MCI =
2
SD standard deviation
using a digital sliding caliper. On grounds of the
aforementioned, using formulas developed according to Rao et al, Mandibular Canine Index (index
of lower canines / MCI) and Standard Mandibular
Canine Index (standard index of lover canines / Std.
MCI) have been calculated (15).
Standard Mandibular Canine Index (Std.MCI) is
used as a key point for differentiating male versus female. If obtained Mandibular Canine Index (MCI)
for individual is higher than the Standard Mandibular Canine Index (Std. MCI), then it is believed that
it is the case of male and if it is smaller, then it is the
case of a female (15).
Data were processed with application of descriptive

statistics, t-tests for independent samples and chisquared test. P-value was considered statistically significant if it was lower than 0.01. A statistical software IBM statistics SPSS V19.0 was used for data
analysis.
RESULTS
The analysis of sample according to sex identity and

age indicated that the group is homogenous according to age and that average age of male amounted
35.0113.18 years, and female 35.4713.11 years.
TABLE 1. Parameters of descriptive statistics of analyzed upper and lower jaw variables
Mesiodistal width of permanent

lower canine - right
Mesiodistal width of permanent
lower canine - left
Intercuspal distance of the lower
jaw
Male
Female
Total
Male
Female
Total
Male
Female
Total
N
90
90
180
90
90
180
90
90
180
Mean
7.41
6.87
7.14
7.14
6.62
6.88
28.57
26.86
27.72
SD
0.40
0.32
0.45
0.38
0.31
0.43
1.41
1.80
1.82
SEM
0.04
0.03
0.03
0.04
0.03
0.03
0.14
0.19
0.13
Min.
6.24
6.12
6.12
6.12
6.01
6.01
25.52
21.28
21.28
Max.
8.63
7.68
8.63
8.28
7.42
8.28
32.62
31.01
32.62
t-stat
p-value
95.87
<0.001
98.65
<0.001
50.12
<0.001
t-stat
p-value
29.30
<0.01
27.43
<0.01
27.43
<0.01
N: Number of samples; All values are expressed in millimeters; SD: standard deviation; SEM: standard error
TABLE 2. Standard Mandibular Canine Index
MCI - Right
MCI - Left
MCI
Male
Female
Total
Male
Female
Total
Male
Female
Total
N
90
90
180
90
90
180
90
90
180
Mean
0.259
0.247
0.253
0.250
0.238
0.244
0.250
0.238
0.244
SD
0.015
0.014
0.016
0.014
0.015
0.016
0.014
0.015
0.016
SEM
0.001
0.001
0.001
0.001
0.001
0.001
0.001
0.001
0.001
Min.
0.23
0.21
0.21
0.22
0.20
0.20
0.22
0.20
0.20
MCI: Mandibular Canine Index (index of lower canines); SD: standard deviation; SEM: standard error
166
Max.
0.32
0.29
0.32
0.30
0.27
0.30
0.30
0.27
0.30
http://www.jhsci.ba
TABLE 3. Rate of incorrectly classified individuals on grounds

of Mandibular Canine Index
N
%
MCI
N
Female
%
N
Total
%
Male
DISCUSSION
Sex
Rate of incorTotal
rectly classified
Male Female
59
28
87
28
65.6
31.5
48.6
31.5
31
61
92
31
34.4
68.5
51.4
34.4
90
89
179
59
100.0 100.0 100.0
32.95
Std. MCI =0.244; MCI: Mandibular Canine Index (index of lower

canines); N: Number of samples; Std. MCI: Standard Mandibular
Canine Index (Standard index of lower canines)
TABLE 4. Percentage of probability of exact identification

Right
Left
Total
MCI
68.89
68.54
68.54
MCI: Mandibular Canine Index (Lower Canines Index)
No statistically significant difference was identified

(p>0.05), and it could be considered that the age
shall not affect research results. Mesiodistal widths
of permanent lower canines as well as the width of
intercuspal distance, set forth in Table 1, indicate
that they were higher with male in relation to female,
with statistically highly significant difference according to sex of all observed parameters (p<0.001).
Examination of Mandibular Canine Index (index
of lower canines/MCI) in Table 2 indicates that its
values were greater with male in relation to female,
with statistically significant difference according to
sex of all observed parameters (p<0.01). Based on
Mandibular Canine Index, 31.5% of male persons
were classified as females by error and 34.4% of females were classified as males, which is set forth in
Table 3.
Table 4 indicates that Mandibular Canine Index
(MCI) is useful for appraising the sex identity of
the Bosnian-Herzegovinian population since precision of appraising the sex identity amounts 68.89%
based on the right Mandibular Canine Index and
68.54% on the left.
Mesiodistal widths of permanent lower canines in

this research as well as the width of intercuspal distance, were statistically significant higher with male
in relation to female. Mesiodistal widths of permanent lower canines were greater on right side in
relation to left side. Mandibular Canine Index was
greater with male in relation to female, with statistically significant difference according to sex of all
observed parameters. Values were greater on right
side in relation to left side. Arya et al (17), then
Staley and Hoag (18) in their research with American Caucasians and Rao et al (15), Sherfudhin et al
(13) and Khangura et al with Indian population (19)
also confirmed that male have higher dimensions
for all variables. In their research on skeletal remains
coming from archeological site of Bijelo Brdo near
Osijek, Vodanovi et al have also determined that
male have larger teeth dimensions in comparison to
female (20).
This research presented that accuracy of sex determination of Bosnian-Herzegovinian population
amounts 68.89% based on the right Mandibular
Canine Index and 68.54% based on the left. The
study of Anderson established that sex classification
on grounds of measuring the width of lower canines
and intercuspal distance of the Canadian population is correct in 74.3% cases. Al-Rifaiy determined
that accuracy of sex determination with Saudi population amounts 65.5% (14). Rao et al, by measuring mesiodistal widths of lower canines as well as
intercuspial distance with South-Indian population,
concluded that 84.3% of male and 87.5% of female
can be exactly differentiated in terms of sex (15).
Prabhu determined that in 76.2% cases, it is possible do identify the sex based on measurements of
mesiodistal widths of upper and lower canines also
with Indian population, 72.4% if measurement is
done only on lower teeth or 67.6% if only upper
teeth are considered (21). Khangura et al, by measuring mesiodistal widths of upper canines and intercuspial distance of the North-Indian population,
determined that 64% of female and 58% of male
are properly classified (19). Yadav determined that
in 83.3% of cases it is possible to accurately identify the sex with male and 81% with female, also by
measuring mesiodistal widths of lower canines and
intercuspial distance of the Indian population (22).
Mughal et al determined that based on lower ca-
167
nines in 75.97 % of cases it is possible to determine

sex with Pakistani population including 71.67% of
male and 78.72% of female (23). Reddy et al, on
grounds of lower canines and Mandibular Canine
Index with the Indian population exactly identified
the sex in 70% of cases (24). Vodanovi et al have
determined the accuracy of sex determination of
86% if craniofacial and odontometric features are
combined (20).
The percentage of accuracy of determininging sex
of the Bosnian-Herzegovinian population based on
odontometric characteristics of permanent lower
canines obtained with this research is somewhat
smaller in relation to presented research for most
other populations. One of possible reasons is the
size of sample for this study since the research was
performed on the sample of only 180 patients of
both sexes. The examination of intraobserver and
extraobserver error would provide answer whether
the method itself has impact on obtained results. It
is also possible that there are differences between
populations in application of the method itself. For
more precise results, it is necessary to perform research on a larger sample of patients.
However, the measurement of mesiodistal width
of permanent lower jaw canines as well as the measurement of intercuspal distance, is simple, quick,
credible, inexpensive, easily performed, noninvasive
method which provides satisfactory results in sex determination of the Bosnian-Herzegovinian population, which was the overall aim of this research.
This study shall have its practical value in sex identification during anthropological processing and
identification of victims from the past war in Bosnia
and Herzegovina, considering the fact that a large
number of death remains is found in secondary or
tertiary mass graves where death remains were greatly mixed or whereby only some body parts are found
on the surface (25). Therefore, it is not uncommon
to find only damaged scull and/or lower jaw and
thereby, results of this research might provide one of
methods to choose for sex determination.
http://www.jhsci.ba
greater accuracy in sex determination in relation to

left lower canines. Accuracy in sex determination is
higher for the female for all variables. Research established specific standards for sex determination, in
population terms, for used sample of the BosnianHerzegovinian population but further research is
needed for more precise values.
CONCLUSIONS
REFERENCES
1. Sarajli N, Gradaevi A. Morphological characteristics of pubic symphysis for age estimation of exhumed persons. Bosn J Basic Med Sci.
2012;12(1):51-4.
2. Iscan MY, Kennedy KAR, editors. Reconstruction of life from the skeleton.
New York: Alan R. Liss Inc; 1989.
3. Krogman WM, Iscan YM. The Human Skeleton in Forensic Medicine (2nd
edition). Charles C. Thomas Pub Ltd, Springfield, Illinois, U.S.A. 1986.
4. Brki H. Odreivanje spola. U: Brki H. i sur. Forenzina stomatologija. Zagreb: kolska knjiga, 2000:55-8.
5. Kaushal S, Patnaik VVG, Agnihotri G. Mandibular Canines in Sex Determination; J Anat Soc India. 2003;52(2):119-24.
6. Kaushal S, Patnaik VVG, Sood V, Agnihotri G. Sex determination in North
Indians using Mandibular canine index. JIAFM. 2004;26(2):45-9.
7. Srivastava PC. Correlation of Odontometric Measures in Sex Determination. J Indian Acad Forensic Med. 2010,32(1):56-61.
8. Bossert WA, Marks HH. Prevalence and characteristics of periodontal
disease in 12.800 persons under periodic dental observation. J Am Dent
Assoc. 1956;52(4):429-42.
9. Krogh HW. Permanent tooth mortality: a clinical study of causes of loss. J
Am Dent Assoc. 1958;57(5):670-5.
10. Anderson DL, Thompson GW. Inter relationships and sex differences of
dental and skeletal measurements. J. Dent. 1973;52:431-8.
11. Minzuno O. Sex determination from maxillary canine by Fourier analysis.
Nihon Univ Dent J. 1990;2:139-42.
12. Suzuki T, Yokosawa S, Ueno M et al. A study on sex determination based
on mandibular canines. Nihon Univ Dent J. 1984;26:246-55.
13. Sherfudhin H, Abdullah MA, Khan N. A cross-sectional study of canine
dimorphism in establishing sex identity: comparison of two statistical methods. J Oral Rehabil.1996;23(9):627-31.
14. Al-Rifaiy MQ, Abdullah MA, Ahraf I, Khan N. Dimorphism of mandibular and
maxillary canine teeth in establishing sex identity. Saudi Dent J. 1997;9:1720.
15. Rao NG, Rao NN, Pai ML, Kotian MS. Mandibular canine index - A clue for
establishing sex identity. Forensic Sci Int. 1989,42:249-54.
16. Rai B, Kaur J. Evidence-Based Forensic Dentistry. Springer-Verlag, Berlin,
Heidelberg. 2013. 75-7.
17. Arya BS, Thomas DR, Savara BS, Clarkson QD. Correlations among tooth
sizes in a sample of Oregon Caucasoid children. Hum Biol.1974;46(4):6938.
18. Staley RN, Hoag JF. Prediction of the mesiodistal widths of maxillary permanent canines and premolars. Am J Orthod. 1978;73(2):169-77.
The study showed that right canines are significantly

broader than the left ones and that they are broader
for male than for female. Lower right canines, that
is, Mandibular Canine Index on the right indicates
19. Khangura RK, Sircar K, Singh S, Rastogi V. Sex determination using mesiodistal dimension of permanent maxillary incisors and canines. J Forensic Dent Sci. 2011; 3: 81-5.
20. Vodanovi M, Demo , Njemirovskij V, Keros J, Brki H. Odontometrics: a
useful method for sex determination in an archaeological skeletal popula-
168
http://www.jhsci.ba
24. Reddy VM, Saxena S, Bansal P. Mandibular canine index as a sex determinant: A study on the population of western Uttar Pradesh. J Oral Maxillofac
Pathol. 2008;12:56-9.
tion? J Arch Sc. 2007;34(6):905-13.

21. Prabhu S, Acharya AB. Odontometric sex assessment in Indians. Forensic
Sci Int. 2009;192(1-3):129.e1-5.
25. Yazedjian L, Kesetovic R. The Application of Traditional Anthropological

Methods in a DNA-Led Identification Process. In: Adams BJ, Byrd JE
(Eds.). Recovery, Analysis, and Identification of Commingled Human Remains. New York, Humana Press, 2008:271-85.
22. Yadav S, Nagabhushana D, Rao BB, Mamatha GP. Mandibular canine

index in establishing sex identity. Indian J Dent Res.2002;13(3-4):143-6.
23. Mughal IA, Saqib AS, Manzur F. Mandibular canine index (MCI); its role in
determining gender. Professional Med J. 2010;17(3):459-63.
169
Emina Vukas et al. Journal of Health Sciences 2013;3(2):170-172
http://www.jhsci.ba

CASE REPORT
Open Access
Common variable immunodeficiency case report

Emina Vukas*, Aida Dizdarevi, Senka Mesihovi - Dinarevi, Adisa engi
Pediatric clinic, Clinical centre University in Sarajevo, Patriotske lige 81, 71000 Sarajevo, Bosnia and Herzegovina
ABSTRACT
Common variable immunodeficiency (CVID) or acquired hypogammaglobulinemia is the type of primary
immunodeficiency. Deregulation of the immune system, leading to hypogammaglobulinemia, defective
activation and proliferation of T cells and dendritic cells, and malfunction of the cytokines are observed
in CVID. The clinical picture of CVID varies, any organ or system can be affected, therefore the diagnosis
is often difficult and delayed and sometimes is not always possible. This article describes a twelve years
old boy with all the clinical signs of immunodeficiency, as confirmed by laboratory. The main treatment
consists of life-long immunoglobulin substitution in intravenous or subcutaneous form.
INTRODUCTION
Recurrent infections are the big challenge for both

pediatricians and general practitioners. Recurrent
pneumonia and bronchitis, prolonged, unresponsive to standard treatment sinusitis or otitis should
catch the doctors attention and prompt him to
differential diagnosis towards primary immunodeficiency disease (PIDD). Such disorders occur in
clinical practice very rarely, but they shouldnt be
missed considering that early diagnosis provides
rapid implementation of treatment and avoidance
of complications. Common variable immunodeficiency (CVID) or acquired hypogammaglobulinemia is the type of primary immunodeficiency
(1). Deregulation of the immune system, leading
to hypogammaglobulinemia, defective activation
*Corresponding author: Emina Vukas,

Pediatric clinic, Clinical centre University in Sarajevo,
Patriotske lige 83, 71000 Sarajevo, Bosnia and Herzegovina
Phone: +3861364347
E-mail: emina_vs@yahoo.com
Submitted 10 June 2013 / Accepted 25 July 2013
and proliferation of T cells and dendritic cells, and

malfunction of the cytokines are observed in CVID
(2). Common variable immunodeficiency frequency
varies from 1 : 10 000 to 1 : 50 000, and the diagnosis is based on a reduced level of IgG and IgA and/or
IgM, which is a consequence of impaired B cell development (3). The disease manifests itself between
5 and 10 years of age and between 20 and 40 years of
age (4). Genetic basis of CVID is still unknown (1).
The clinical picture of CVID varies, any organ or
system can be affected, therefore the diagnosis is often difficult and delayed. There is, however,a broad
spectrum of clinical manifestations including recurrent infections of the respiratory tract and chronic
lung disease, various autoimmune pathology, gastrointestinal disease, granulomatous infiltrative diseases,
lymphoproliferative disorders and malignancies (5).
It is estimated that about 78% of patients underwent lower respiratory tract infection at least once
before diagnosis of CVID (6).
Recurrent infections, poorly responding to conventional antibiotics, can lead to the formation of bronchiectasis, which are particularly common medical
2013 Emina Vukas et al.; licensee University of Sarajevo - Faculty of Health Studies. This is
http://www.jhsci.ba
problem, leading to frequent hospitalization and

severe respiratory impairment. Early diagnosis usually protects the patient against this complication,
however, development of bronchiectasis occurs even
in 30% of patients, despite optimal treatment (7,8).
About 20% of CVID patients developed different
gastrointestinal pathology, such as inflammatory
bowel disease, protein-loss enteropathy, spru-like
syndrome, chronic enteritis caused by Giardia lamblia or Campylobacter infection, celiac sprue (9,10).
Here, we report a case of 12 year boy with recurrent
infections of the respiratory system who was diagnosed to have CVID.
CASE REPORT
The patient is twelve years old boy who was admitted to Department of Pediatric Allergy Immune
Rheumatology with history of recurrent infections
of the respiratory system, sinusitis, allergic rhinitis,
allergies to nuts, conjunctivitis starting from the
childhood. Bronchial asthma is diagnosed before
three months. His medical history included severe
swine flu two years ago, tonsillectomy, appendectomy, inflammation of the nail bed of thumbs on
both legs, severe form of varicella. Every two weeks
he has oral ulcers. In his family history there is no
evidence of hereditary immunodeficiency or autoimmune disease. Not regularly vaccinated. On admission the general physical examination revealed
remarkable pallor, fever (40oC), cough, no enlargement of liver, spleen or peripheral lymph nodes.
Routine laboratory parameters were found to be
normal, except markers for inflammation. Repeated
hemocultures were negative. Microbiological analysis excluded some viral infections (hepatitis B, C
and HIV). Standard immunological markers (ANA,
AMA, ANCA, ANTI ds DNA, and rheumatoid factor) were excluded for autoimmune and rheumatoid
diseases. Screening tests of serum immunoglobulin's
showed decreased concentrations of three types of
immunoglobulin's: IgA: in traces, IgM 0.4 g/L and
IgG 4.9 g/L. Lymphocyte immunophenotypisation
revealed inversed CD4+/CD8+ T cells ratio: 0.96.
Switched memory B cells were decreased. Chest X
ray expressed bronchiectasis. 24 h pH monitoring
indicate the presence of gastro esophageal reflux
disease (GERD). During the hospitalization the
patient was treated with parenteral antibiotics. Re-
171
ceived replacement therapy with intravenous immunoglobulin at dosage 200mg/kg.

DISCUSSION
CVID is essentially a diagnosis of exclusion, as

other causes of hypogammaglobulinemia, including
known gene defects, medications, protein loss, or
malignancy, must be excluded (1). Correct diagnosis of immune deficiency is not easy, and sometimes
is not always possible (1,2). It often requires quite
detailed studies that are not available in routine
diagnostics. However, the initial suspicion of immunodeficiency in a patient (Table 1) is possible at
the level of every general practitioner (3). A careful
investigation of past medical history is the first step
in the diagnosis. Past medical history should include
the presence of allergic diseases. Also very important
is the knowledge of the possible occurrence of immunodeficiency in relatives. It should be established
when the first symptoms of immunodeficiency such
as persistent, recurrent infections occur. Children
up to 6 month of age possess maternally derived
antibodies, therefore, in accordance with European
Society for the Immunodeficiency's (ESID) criteria
(Table 2) CVID can be recognized after 2 years of
age (1,3). In addition to infections such as sinusitis,
otitis media, bronchitis, pneumonia, or gastrointestinal disorder, the nutritional status of the patient
should be evaluated. Unexplained weight loss is
relatively common symptom in CVID. Besides recurrent infections, CVID patients have an increased
tendency to develop autoimmunity, lymph-proliferative disease and malignancies (2). Although these
TABLE 1. Problems suggesting immune deficiency disorders
in children (for suspected immunodeficiency just one of the
following)
Eight or more infections per year
Two or more serious sinus infections within 1 year
Antibiotic therapy lasting two months or more without a clear
improvement
Two or more pneumonias within 1 year
Growth and weight failure in infant
Recurrent deep skin or organ abscesses
Persistent thrush in mouth or fungal skin infection
Need for intravenous antibiotics to clear infections
Two or more deep-seated infections including: encephalitis,
osteomyelitis, dermatitis, sepsis.
A family history of PID
http://www.jhsci.ba
TABLE 2. European Society for the Immunodeficiency's

(ESID) Criteria for the diagnosis of CVID
CONCLUSION
This case highlights the importance of increasing

awareness among primary care doctors for suspecting and confirming a diagnosis of CVID and
to emphasize the need to perform basic laboratory
tests and to determine immunoglobulin classes in
clinical practice in patients with recurrent infections.
Although IVIG provides improvement in these patients, early diagnosis is the key to preventing significant morbidity and mortality and improving
prognosis.
Probable
Male or female patient who has a marked decrease of IgG (at
least 2 SD below the mean for age) and a marked decrease
in at least one of the isotypes IgM or IgA, and fulfills all of the
following criteria:
1) Onset of immunodeficiency at greater than 2 years of age
2) Absent isohemagglutinins and/or poor response to vaccines
3) Defined causes of hypogammaglobulinemia have been
excluded
Posible
Male or female patient who has a marked decrease (at least 2
SD below the mean for age) in one of the major isotypes (IgM,
IgG and IgA) and fulfills all of the following criteria:
1) Onset of immunodeficiency at greater than 2 years of age
2) Absent isohemagglutinins and/or poor response to vaccines
3) Defined causes of hypogammaglobulinemia have been
excluded
REFERENCES
1. Cunningham-Rundles C. How I treat common variable immune deficiency.
Blood 2010;116:715.
2. Agarwal S, Cunningham-Rundles C. Autoimmunity in common
immunodeficiency. Curr Allergy Asthma Rep 2009;9:347-352.
variable
3. Geha RS, Notarangelo LD, Casanova JL, et al. Primary immunodeficiency diseases: an update from the International Union of Immunological
Societies Primary Immunodeficiency Diseases Classification Committee. J
Allergy Clin Immunol 2007;120: 776-794.
disease complications cause severe morbidity, the

enormous heterogeneity in the clinical presentation
of CVID. Failure to make a diagnosis at the early
stage can result in complications of recurrent infections particularly those of the chest (8). The clinical
relevance of under diagnosing this disorder is that
it precludes appropriate management by the use of
intravenous immunoglobulin (IVIG). The primary
treatment of CVID is replacement of antibody by
either an intravenous or subcutaneous route, usually in doses of 400 to 600 mg/kg body weight per
month (1). Our patient is receiving a lower dose
because still produces some immunoglobulin's. This
dose is usually divided into once or twice a week, or
every 2 weeks (for the subcutaneous route) or every
3 or 4 weeks (for the intravenous route). Although
expensive, the use of IVIG can allow patients to lead
a near normal life and perform productive work.
172
4. Cunningham-Rundles C, Lieberman P, Hellman G, et al. Non-Hodgkin lymphoma in common variable immunodeficiency. Am J Hematol 1991;37:6974.
5. Piqueras B, Lavenu-Bombled C, Galicier L, Bergeron-van der Cruyssen F,
Mouthon L, Chevret S, et al. Common variable immunodeficiency patient
classification based on impaired B cell memory differentiation correlates
with clinical aspects. J Clin Immunol. 2003;23:385400.
6. Cunningham-Rundles C, Bodian C. Common variable immunodeficiency:
clinical and immunological features of 248 patients. Clin Immunol 1999;92:
34-48.
7. Kainulainen L, Nikoskelainen J, Vuorinen T, et al. Viruses and bacteria in
bronchial samples from patients with primary hippogammaglobulinemia.
Am J Respir Crit Care Med 1999;159: 1199-1204.
8. de Gracia J, Vendrell M, Alvarez A, et al. Immunoglobulin therapy to control
lung damage with common variable immunodeficiency. Int Immunopharmacol 2004;4:745-753.
9. Zullo A, Romiti A, Rinaldi V, Vecchione A, Tomao S, Aiuti F, et al. Gastric pathology in patients with common variable immunodeficiency. Gut.
1999;45:7781.
10. Kalha I, Sellin JH. Common variable immunodeficiency and the gastrointestinal tract. Curr Gastroenterol Rep 2004;6:377-383.
http://www.jhsci.ba
Dalma Udovii-Gagula et al. Journal of Health Sciences 2013;3(2):173-176

CASE REPORT
Open Access
Uterine cervix squamous cell carcinoma metastatic

to the Ampulla of Vater: a case report with review
of the literature
Dalma Udovii-Gagula1*, Faruk Skenderi1, Sran Gornjakovi2, Nermina Ibievi1,
Adisa Chikha1, Semir Vrani1, Aleksandra uran1
1
Department of Clinical Pathology and Cytology, University of Sarajevo Clinical Center, Bolnika 25, 71000 Sarajevo, Bosnia and Herzegovina. 2Department of Gastroenterohepatology, University of Sarajevo Clinical Center, Bolnika 25, 71000
Sarajevo, Bosnia and Herzegovina
ABSTRACT
Metastases to gastrointestinal tract are uncommon. In particular, metastases to the ampulla of Vater are
very rare and may represent a significant diagnostic challenge. Metastases from the uterine cervix to the
ampulla of Vater are exceedingly rare and only one case has been described in the available literature. We
describe here a second case of metastatic squamous cell carcinoma of the cervix to the ampulla of Vater in
a 45-year-old woman. Poorly differentiated squamous cell carcinoma presented as an isolated metastasis
to the ampulla of Vater, two years after the initial diagnosis. While the squamous cell carcinoma could occur as primary ampullary carcinoma, albeit very rare, it is necessary to exclude the possibility of metastatic
cancer.
Keywords: Ampulla of Vater, Neoplasms, Metastasis, Squamous Cell Carcinoma, Cervix, Uterus
INTRODUCTION
Primary tumors of the ampulla of Vater are rare

and are usually adenocarcinomas (1, 2). Metastases
to the gastrointestinal tract (GI) tract are uncommon, while metastases to the ampulla of Vater are
extremely rare and therefore may pose a significant
diagnostic pitfall. Not many cases of metastasis to
*Corresponding author: Dalma Udovii-Gagula

Department of Clinical Pathology and Cytology
University of Sarajevo Clinical Center; Bolnika 25
BA-71000 Sarajevo; Bosnia and Herzegovina
Phone: +387 61 505315; Fax: +387 33 297826
E-mail address: dalma_u@yahoo.com
the ampulla of Vater are described, most of them

being metastasis of primary melanoma of the skin
(3-7), renal cell carcinomas (8-10) and a few cases
of squamous cell carcinoma (SCC) from different
primary sites (11-13). SCC of the uterine cervix is
likely to early metastasize into the adjacent lymph
nodes, but hematogenous dissemination is the least
common metastatic pathway of this carcinoma (14).
Only one case of uterine cervix SCC metastasis to
the ampulla of Vater has been described up to now
(13).
Here, we report a second case of metastasis of squamous cell carcinoma (SCC) of the uterine cervix to
the ampulla of Vater.
Submitted 28 July 2013 / Accepted 20 August 2013

2013 Dalma Udovii-Gagula et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
http://www.jhsci.ba
CASE REPORT
Histopathology and immunohistochemistry
Clinical history
Grossly, the specimen measured 20x15x4 mm, oval

shaped, grayish tissue with smooth surface and visible superficial ulceration.
Histological examination revealed a highly cellular
tumor, composed of heterogeneous population of
the neoplastic cells with oval to round nuclei and
cells with spindle appearance, diffusely infiltrating
mucosa and submucosa of the ampullar region. Tumor cells were arranged as solid islands with focal
fascicular pattern. There was a sporadic mitotic activity and focal necrosis (Figure 1). Tumor surface
was ulcerated and replaced by granulation tissue.
The morphology indicated poorly differentiated
malignant neoplasm including primary tumors (e.g.
neuroendocrine carcinoma, gastrointestinal stromal
tumor (GIST) with spindled pattern and poorly
differentiated carcinoma). Because of her history of
primary cervical cancer the metastasis was also considered in differential diagnosis.
Immunochistochemical (IHC) analysis revealed that
the tumor cells were negative for Chromogranin-A,
CD56, c-Kit (CD117), CD34, ruling out the neuroendocrine carcinoma and GIST (Figure 2). Cytokeratins (CK)7 and 20 were also negative which
excluded primary, poorly differentiated ampullary
carcinoma (Figure 2). The tumor cells were strongly
positive for CK5/6 and p16 (Figure 2), which favored metastatic poorly differentiated squamous cell
carcinoma originating from uterine cervix.
The patient was administered new cycles of cisplatinbased chemotherapy.
A 45-year-old woman presented with one month

history of abdominal pain, jaundice and dark-colored urine. Physical examination revealed skin and
conjunctival jaundice. Two years earlier she had
been diagnosed with the primary squamous cell carcinoma of the uterine cervix (grade 3, FIGO stage
IIIB). Due to the advanced stage, it was treated with
a concomitant radiochemotherapy.
Laboratory tests on admission revealed elevated levels of total bilirubin 114.8 mol/L, aspartate amino
transferase (AST) 158 IU/L and alanin amino transferase (ALT) 210 IU/L. Other laboratory findings
were within or close to normal: white blood cell
(WBC) count 7x109/L, red blood cell (RBC) count
4.16x1012/L, platelet (Plt) count 459x109/L, hemoglobin (Hb) 121 g/L, glucose 6.4 mmol/L, urea 4.4
mmol/L and creatinine 74 mol/L.
Abdominal ultrasound revealed a folded gall bladder
and dilatation of intra- and extrahepatic bile ducts,
while common bile duct and pancreatic duct were
not clearly exposed due to the presence of air within
the intestinal lumen. Abdominal and pelvic CT scan
revealed enlarged retroperitoneal lymph nodes with
possible external compression of excretory bile ducts
causing obstruction and jaundice.
Endoscopic retrograde cholangiopancreatography
was performed and during the endoscopy a polypoid tumor with ulcerated surface was found at the
ampulla of Vater site (Figure 1). In the same procedure, papillectomy was performed and stent was
placed. The specimen was submitted for histopathologic evaluation.
FIGURE 1. Polypoid tumor with ulcerated surface at the Ampulla of Vater (A). Histopathologic examination revealed a highly
cellular tumor nests and islands composed of heterogenous population of malignant cells diffusely infiltrating mucosa and submucosa of the ampullar region (B, C).
174
http://www.jhsci.ba
FIGURE 2. Immunohistochemical profile of the tumor. Chromogranin-A, CD56, CD117, CD34, CK7 and CK20 were negative (A,
B, C, D, E and F, respectively). CK5/6 and p16 were strongly positive (G and H, respectively). CK: cytokeratin.
DISCUSSION
Primary carcinomas of the ampulla of Vater comprise about 0.5% of all GI tumors and most of them
are adenocarcinomas (90%) (15). Metastases to the
ampulla of Vater are unusual and small number of
cases are reported in the available literature. We report here a second case of metastatic squamous cell
carcinoma from the uterine cervix that presented as
an isolated metastasis to the ampulla of Vater, two
years after the initial diagnosis. Our extended literature search (PubMed, Google Scholar, Scopus, Web
of Science) revealed only three metastatic squamous
cell carcinomas to the ampulla of Vater, including
single cases originating from larynx, esophagus and
uterine cervix (11-13).
175
Majority of these patients present with obstructive symptoms of the biliary tract. Our patient also
presented with jaundice and abdominal pain; her
laboratory findings showed elevated bilirubin and
liver enzymes in the serum and dark-colored urine,
which was consistent with cholestasis and presence
of obstructive pathology. Although there was a
known history of uterine cervix carcinoma, the most
common cause of obstructive jaundice, i.e. trapped
gallstones, had to be excluded.
Recent studies suggest that one third of patients
with ampullary carcinoma could have synchronous
malignancy (16). Endoscopic findings and morphologic appearance of the tumor were inconclusive and
therefore we performed an extended IHC panel to
render the correct diagnosis. Negativity for CK7,

CK20, Chromogranin-A, CD56, CD34, and c-Kit
along with diffuse and strong positivity for CK5/6
and p16 (INK4a) strongly favored metastatic squamous cell carcinoma originating from uterine cervix.
We conclude that metastatic tumors to the GI sites
such as the ampulla of Vater are exceptionally rare
and may pose a substantial diagnostic challenge. In
such cases, a thorough histopathologic examination and an extended immunohistochemical panel,
along with clinical history, are of utmost importance
for the appropriate diagnosis and optimal clinical
management of the patients.
http://www.jhsci.ba
6. van Bokhoven MM, Aarntzen EH, Tan AC. Metastatic melanoma of

the common bile duct and ampulla of Vater. Gastrointest Endosc. 2006
May;63(6):873-4.
7. Nakayama H, Miyazaki S, Kikuchi H, Saito N, Shimada H, Sakai S, et al.
Malignant vaginal melanoma with metastases to the papilla of Vater in a
dialysis patient: a case report. Intern Med. 2011;50(4):345-9.
8. Venu RP, Rolny P, Geenen JE, Hogan WJ, Komorowski RA, Ferstenberg
R. Ampullary tumor caused by metastatic renal cell carcinoma. Dig Dis Sci.
1991 Mar;36(3):376-8.
9. Franssen B, Chan C, Ramirez-Del Val A, Llamas F, Lopez-Tello A. [Renal
cell carcinoma metastatic to the duodenum and Vater ampulla: Report of
two cases]. Rev Gastroenterol Mex. 2011 Oct-Dec;76(4):375-9.
10. Leslie KA, Tsao JI, Rossi RL, Braasch JW. Metastatic renal cell carcinoma
to ampulla of Vater: an unusual lesion amenable to surgical resection. Surgery. 1996 Mar;119(3):349-51.
11. Buyukcelik A, Ensari A, Sarioglu M, Isikdogan A, Icli F. Squamous cell carcinoma of the larynx metastasized to the ampulla of Vater. Report of a case.
Tumori. 2003 Mar-Apr;89(2):199-201.
12. Sreenarasimhaiah J, Hoang MP. Esophageal squamous cell carcinoma
with metastasis to the ampulla. Gastrointest Endosc. 2005 Aug;62(2):3101; discussion 1.
13. Lee TH, Park SH, Lee CK, Lee SH, Chung IK, Kim SJ, et al. Ampulla of
Vater metastasis from recurrent uterine cervix carcinoma presenting as
groove pancreatitis. Gastrointest Endosc. 2011 Feb;73(2):362-3.
REFERENCES
14. Witkiewicz AK, Wright TC, Ferenczy A, Ronnett BM, Kurman RJ. Carcinoma and Other Tumors of the Cervix. In: Kurman RJ, Ellenson LH, Ronnett BM, editors. Blausteins Pathology of the Female Genital Tract. 6th ed.
Heidelberg: Springer; 2011. pp. 253-303.
1. Heinrich S, Clavien PA. Ampullary cancer. Curr Opin Gastroenterol. 2010

May;26(3):280-5.
2. Ishibashi Y, Ito Y, Omori K, Wakabayashi K. Signet ring cell carcinoma of
the ampulla of vater. A case report. JOP. 2009;10(6):690-3.
15. Albores-Saavedra J, Schwartz AM, Batich K, Henson DE. Cancers of the

ampulla of vater: demographics, morphology, and survival based on 5,625
cases from the SEER program. J Surg Oncol. 2009 Dec 1;100(7):598-605.
3. Uiterwaal MT, Mooi WJ, Van Weyenberg SJ. Metastatic melanoma of the
ampulla of Vater. Dig Liver Dis. 2011 Apr;43(4):e8.
4. Bendic A, Glavina Durdov M, Stipic R, Karaman I. Melanoma in the ampulla
of Vater. Hepatobiliary Pancreat Dis Int. 2013 Feb;12(1):106-8.
5. Marks JA, Rao AS, Loren D, Witkiewicz A, Mastrangelo MJ, Berger AC.
Malignant melanoma presenting as obstructive jaundice secondary to metastasis to the Ampulla of Vater. JOP. 2010;11(2):173-5.
176
16. Pathak GS, Deshmukh SD, Yavalkar PA, Ashturkar AV. Coexistent ampullary squamous cell carcinoma with adenocarcinoma of the pancreatic duct.
Saudi J Gastroenterol. 2011 Nov-Dec;17(6):411-3.
http://www.jhsci.ba
Saurabh R. Shrivastava et al. Journal of Health Sciences 2013;3(2):177-178

LETTER TO EDITOR
Open Access
Fostering the practice of rooming-in in newborn

care.
Saurabh R. Shrivastava, Prateek S. Shrivastava, Jegadeesh Ramasamy
Department of Community Medicine, Shri Sathya Sai Medical College & Research Institute, Kancheepuram, India
ABSTRACT
Practice of rooming-in meant that baby and mother stayed together in the same room day and night in
the hospital, right from the time of delivery till the time of discharge. Adoption of rooming-in offers multiple benefits to the newborn, mother, and mother-child as a unit. It is a cost-effective approach where
fewer instruments are required and spares additional manpower. Rooming-in endeavors the opportunity
to contribute significantly in the childs growth, development and survival by assisting in timely initiation of
breastfeeding. To ensure universal application of rooming-in in hospitals, a comprehensive and technically
sound strategy should be formulated and implemented with active participation of healthcare professionals. Measures such as advocating institutional delivery through outreach awareness activities; adoption
of baby-friendly hospital initiative; inculcating a sense of ownership among health professionals, can be
strategically enforced for better maternal and child health related outcomes.
Keywords: Rooming-in, breastfeeding, maternal and child health, Baby-friendly hospital initiative.
The beginning of 20th century witnessed a rise in

the number of institutional deliveries among pregnant women which was associated with a subsequent
increase in nursery-based newborn care. One of the
significant consequences of such practice was an ascent in the incidence of cross-infections among neonates (1). This then led to adoption of rooming-in
in different hospitals and maternity homes. Practice
of rooming-in meant that baby and mother stayed
*Corresponding author: Dr. Saurabh RamBihariLal Shrivastava

Address: Department of Community Medicine, Shri Sathya
Sai Medical College & Research Institute, 3rd floor, Ammapettai village, Thiruporur - Guduvancherry Main Road, Sembakkam Post, Kancheepuram - 603108, Tamil Nadu, India
Telephone: +919884227224
Email: drshrishri2008@gmail.com
Submitted 1 July 2013 / Accepted 5 August 2013
together in the same room day and night in the hospital, right from the time of delivery till the time of
discharge (2).
Rooming-in offers multiple benefits to the newborn, mother as well as mother & child as a unit
in terms of successful initiation of breastfeeding
helps prevent hypoglycemia (1); direct skin-to-skin
contact with the mother's chest aids in thermoregulation in newborn (1); reduces risk of infections /
cross-infections (2,3); offers emotional stability (4);
makes mother more confident in taking care of her
child (1); reduces anxiety (5); aids mother in understanding baby's natural physiology (3); and facilitates mother-child bonding (3). Rooming-in has
also been found to be useful in early diagnosis of the
hearing loss (6); and in reducing the need of treatment of opiate withdrawal in the newborn (7). In
2013 Saurabh R. Shrivastava et al.; licensee University of Sarajevo - Faculty of Health Studies. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
Saurabh R. Shrivastava et al. Journal of Health Sciences 2013;3(2):177-178
addition, rooming-in is a cost-effective approach

where fewer instruments are required and spares additional manpower (1,3).
Rooming-in endeavors the opportunity to contribute significantly in the childs growth, development and survival by assisting in timely initiation
of breastfeeding (2). This attracts further attention
as despite the proven advantages of exclusive breastfeeding, only 35% of infants (0-6 months) are exclusively breastfed globally (2). Rooming-in can act
as a stepping-stone in saving the lives of an additional 1.5 million under-five children annually (2).
In a study to assess the utility of rooming-in among
pre-term infants, it was concluded that rooming-in
not only accelerated weight gain in pre-term babies
but also cut-down maternal anxiety associated with
birth of a pre-term child (5). However, adopting the
practice of rooming-in universally, in a blind-folded
manner has its own limitations. Conditions such as
maternal diseases of the postpartum period, neonatal complications, maternal pain and discomfort
immediately after delivery (3); hospital associated
factors inadequately trained healthcare and nursing staff (8); dearth of family members support (9);
can be the potential barriers in adopting rooming-in.
To ensure universal application of rooming-in in
hospitals, a comprehensive and technically sound
strategy should be formulated and implemented
with active participation of trained healthcare professionals. Measures such as advocating institutional
delivery through outreach awareness activities;
adoption of baby-friendly hospital initiative (1);
inculcating a sense of ownership among health
professionals (10); training of nursing staff to facilitate rooming-in (10); counseling sessions by the
medical social workers to encourage family support
(1,2); and establishment of grading/accreditation
standards for acknowledging the hospitals offering
http://www.jhsci.ba
better healthcare services in neonatal care; can be

strategically enforced for better maternal and child
health related outcomes.
To conclude, multiple health as well as psychological benefits in relation to maternal and child health
have been attributed to the practice of rooming-in.
Healthcare institutes should assume the responsibility of training their healthcare professionals in establishing the practice of rooming-in thereby reducing
a significant proportion of neonatal morbidity and
mortality.
COMPETING INTERESTS
The authors declare no conflict of interests.
178
REFERENCES
1. World Health Organization. Evidence for the ten steps to successful breastfeeding. WHO Press: Geneva, 1998.
2. World Health Organization. World breastfeeding week, 2010. [cited 2013
May 22]. Available from: http://www.who.int/maternal_child_adolescent/
news_events/events/2010/1_8_10/en/
3. Lee YM, Song KH, Kim YM, Kang JS, Chang JY, Seol HJ, et al. Complete
rooming-in care of newborn infants. Korean J Pediatr. 2010;53(5):634-638.
4. Ahn SY, Ko SY, Kim KA, Lee YK, Shin SM. The effect of rooming-in
care on the emotional stability of newborn infants. Korean J Pediatr.
2008;51(12):1315-1319.
5. De Carvalho Guerra Abecasis F, Gomes A. Rooming-in for preterm infants:
how far should we go? Five-year experience at a tertiary hospital. Acta
Paediatr. 2006;95(12):1567-1570.
6. Grasso DL, Hatzopulos S, Cossu P, Ciarafoni F, Rossi M, Martini A, et al.
Role of the "rooming-in" on efficacy of universal neonatal hearing screening programmes. Acta Otorhinolaryngol Ital. 2008;28(5):243-246.
7. Hodgson ZG, Abrahams RR. A rooming-in program to mitigate the need
to treat for opiate withdrawal in the newborn. J Obstet Gynaecol Can.
2012;34(5):475-481.
8. Kim Y, Kim EY. Maternal and hospital factors impacting the utilization of
rooming-in care in South Korea: secondary analysis of national health data.
J Korean Acad Nurs. 2011;41(5):593-602.
9. Schmidt ML, Bonilha AL. Rooming-in: the father's expectations regarding
the care of his wife and child. Rev Gaucha Enferm. 2003;24(3):316-324.
10. Soares AV, Gaidzinski RR, Cirico MO. Nursing intervention identification in
rooming-in. Rev Esc Enferm USP. 2010;44(2):308-317.
http://www.jhsci.ba
Eldan Kapur Journal of Health Sciences 2013;3(2):179-182

LETTER TO EDITOR
Open Access
Surface coil in the magnetic resonance imaging of

the orbital vessels anatomy
Eldan Kapur
Department of anatomy, Medical faculty, University of Sarajevo, ekalua 90, Sarajevo, Bosnia and Hercegovina
ABSTRACT
In this paper, we demonstrate a capability of surface coil magnetic resonance imaging in the review of
orbital blood vessels anatomy. Surface coil allows a better detection of small anatomic structures including
vessels such as ophtalmic artery and its branches, and also orbital veins, particularly superior and inferior
ophtalmic veins with accompanying branches. The best results are obtained by the use of T1 sequences
with short TE and TR.
Keywords: orbital vessels, anatomy, MRI, surface coil
The orbit is amenable to radiological investigation

by several methods (1). Besides standardized echography, computed tomography (CT) and magnetic
resonance imaging (MRI) have become the most
important tools for the evaluation of orbital anatomy and pathology (2). In most medical centers, CT
is still the method of choice for orbital imaging because of low costs and excellent depiction of orbital
and paraorbital osseous anatomy. The resolution in
CT within the orbit has been shown to be sufficient
to demonstrate structures such as ophtalmic artery
and some of its branches, ie. the superior ophtalmic
vein, frontal, or oculomotor nerves (3,4). Compared
with CT, orbital MRI provides a better soft-tissue
contrast resolution, particularly when the small-diameter surface coil is used. Surface coils allow high-
*Corresponding author: Eldan Kapur

Department of anatomy
Medical faculty, University of Sarajevo, ekalua 90,
Sarajevo, Bosnia and Hercegovina
Phone:+387 33 665949
eldan.kapur@mf.unsa.ba
Submitted 9 May 2013 / Accepted 2 September 2013
resolution imaging of the orbit by increasing the

signal-to-noise ratio (SNR) (5,6). Because there is
no exposure to ionizing radiation, MRI is an excellent tool for anatomical studies in vivo.
The aim of study was to demonstrate the potential of
surface coils in view of normal anatomic structures
in the eye sockets and its advantages, in comparison
to the standard coil.
METHODS
Ten healthy subjects (ages 32 to 56 years) were examined (n=20 orbits). The study was approved by
the Ethical Committee of the Medical Faculty in
Sarajevo. Magnetic resonance imaging of the orbit
was performed on 1,5 Tesla scanner (Magnetom
Impact, Siemens, Germany) using surface coil with
a diameter of 7,5 and 10 cm (Figure 1). T1 images were obtained using spin-echo sequences with
TE=15 msec and TR=440-520 msec in axial, coronal and oblique-sagittal sections. Thinner sections (2
to 3 mm) are preferable. The field of view ranged
between 140x140 mm with 256x256 matrix and
230x230 mm with 512x512 matrix.
2013 Eldan Kapur; licensee University of Sarajevo - Faculty of Health Studies. This is an Open
Access article distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
http://www.jhsci.ba
FIGURE 1. Surface coils with a dimeter of 10 cm (1), 7.5 cm

(2) and double phase array surface coil (3)
FIGURE 2. Obligue-sagittal T1 magnetic resonance imaging (up-gaze, male, 39 years). 1-Ophtalmic artery, 2- Central
retinal artery, 3-Inferior rectus, 4-Inferior oblique, 5- Levator
palpebrae superioris, 6-Superior rectus, 7-Optic nerve
RESULTS
Arteries
On sagital images, the intraorbital part of the ophthalmic artery appears at the lateral side of the optic
nerve (Fig. 2). In this position ophthalmic artery
branches to the central retinal artery. The central
retinal artery is the most important branch of the
ophthalmic artery. It pierces the optic nerve inferomedially about 12-15 mm posterior to the globe
(Figure 2).
Axial images show the further course of the ophtalmic artery. Distal to the lateral knee, it crosses the
optic nerve, and courses forward to the medial angle
of eye. At the crossing with the optic nerve, the ophtalmic artery gives off posterior ciliary arteries on the
both sides of the optic nerve (Figure 3). The vessel that runs posteriorly from the medial side of the
ophtalmic artery represents the posterior ethmoidal
artery (Figure 3). On the axial sections in the level
of trochlea, the curved anterior ethmiodal artery is
noted (Figure 4). Inferior to the trochlea, we can see
that ophtalmic artery terminates in the dorsal nasal
artery (Figure 3).
On the coronal images in the level of the anterior
orbita, supratrochlear and supraorbital vessels with
accompanying nerves are visible.
Veins
The trunk of the superior ophtalmic vein starts posterior to the reflected part of the superior oblique
180
tendon and courses from anteromedially to posterolaterally (Figure 5). In contrast, superior ophtalmic
vein crosses with lesser obliquity, enabling the distiction from the ophtalmic artery. Proximal to the juntion with the lacrimal vein, superior ophtalmic vein
FIGURE 3. T1 axial image (male, 41 years). 1-Optic nerve,

2-Lateral rectus, 3-Long posterior ciliary artery, 4-Meningeal
reccurens artery, 5-Superior oblique, 6-Ophtalmic artery,
7-Medial rectus, 8-Long posterior ciliary artery, 9-Anterior
ethmoidal artery, 10-Ophtalmic artery, 11-Dorsal nasal artery,
FOS-Fissura orbital superior
http://www.jhsci.ba
FIGURE 4. T2 axial image (male, 36 years). 1- Anterior ethmoidal artery, 2-Posterior ethmoidal artery, 3-Superior ophtalmic vein, 4-Lacrimal vein, 5-Ophtalmic artery, 6- Superior
ophtalmic vein, 7-Optic nerve
runs posteriorlly to the superior orbital fissure.

The inferior ophtalmic vein lies on the orbital floor
between the lateral and inferior rectus (Figure 6). It
communicates through the inferior orbital fissure
with the pterygoid venous plexus in the pterygopalatine fossa. The medial and lateral collateral veins can
be seen on axial images in the level of the inferior
orbita (Figure 5).
FIGURE 5. T1 axial image (male, 45 years). Standard head

coil. 1-Lacrimal vein, 2-Superior ophtalmic vein
The vorticose veins can be seen in adequate sections,

expecially on parasagittal section laterally to the anterior part of the optic nerve.
DISCUSSION
FIGURE 6. T1 axial image (female, 32 years). 1-Lacrimal sac,

2-Lateral collateral veins, 3-Inferior ophtalmic vein 4-Orbitalis
muscle, 5-Fissura orbitalis inferior, 6-Inferior rectus, 7-Medial
collateral veins
The fat content of the orbit is responsible for the

excellent contrast in orbital MRI. It allows a better
detection of small anatomic structures including
vessels and nerves (7). Orbital fat is hyperintense on
T1 images, and other structures such as muscles, vessels and nerves are hypointense. Blood vessels appear
dark on T1 images because of the signal void of flowing blood. In our images, vessels were usually darker
than other structures such as muscles and nerves.
Generally, arteries showed a curved course compared
with more strainght veins. These facts, together with
detailed knowledge of orbital anatomy on human
specimens, allowed the identification of various vascular structures on MRI (8-10). The highest spatial
resolution is achieved with surface coil (5,6,11). We
have demonstrated that surface coil MRI on clinical
magnetic resonance unit is capable of imaging the
anatomy of the vessels in the orbit with sufficient
details. The best results is obtained by the use of T1
sequences with short TE and TR.
181
http://www.jhsci.ba
CONCLUSION
Imaging of the orbit necessitates sophisticated techniques because of its anatomical complexity. An understanding of normal anatomy will allow a better
appreciation of proximity of normal structures to
pathological processes. A potential clinical application of high-resolution orbital MRI will be the
evaluation of orbital vascular lesions. The ability of
anatomical details in the orbit will be important for
orbital surgery.
2. Conneely MF, Hacein Bey L, Jay WM. Magnetic resonance imaging of the
orbit.Semin Ophtalmol, 2008; 23(3):179-89
3.
4. Wirtschafter JD, Berman EL, McDonald CS. Clinical Neuro-Orbital Anatomy, American Academy of Ophtalmology. 1992, San Francisco
5. Nayak BK, Desai S, Maheshwari S. Interpretation of magnetic resonance
imaging of orbit: Simplified for ophthalmologists (Part I). J Clin Ophthalmol
Res 2013;1:29-35
6. Ehman RL. MR imaging with the surface coils, Radiology. 1985;157:549550
7. Lee AG, Brazis PW, Garrity JA, White M. Imaging for neuro-ophthalmic and
orbital disease. Am J Ophthalmol 2009;138:852-62
8.
Ettl A, Salomonowitz E, Koornnef L. Magnetic resonance imaging of the

orbit: Basic principles and anatomy, Orbit. 2000 Dec; 19(4):211-237
De Potter P, Shields JA, Shields C. MRI of the eye and orbit, Lippincott.
1995; Philadelphia
9. Bilaniuk LT. Orbital vascular lesions. Role of imaging, Radiol Clin North Am.
1999; 37(1):169-81
The author declares no conflict of interest
10. Simha A, Irodi A, David S. Magnetic resonance imaging for the ophthalmologist: A primer. Indian J Ophthalmol 2012;60:301-10
REFERENCES
11. Atlas SW, Bilaniuk LT, Zimmermann RA. Orbit: Initial experience with surface coil spin echo MR imaging at 1,5 T, Radiology. 1987; 164:501-509
1. Aviv RI, Casellman J. Orbital imaging. Part 1. Normal anatomy, Clinical

radiology. 2005; 60:279-287
182
Journal of Health Sciences 2013;3(2)
http://www.jhsci.ba
INSTRUCTIONS FOR AUTHORS

Instructions and guidelines to authors for the preparation and submission of manuscripts in the
Objectives and scope of the journal
The Journal of Health Sciences (JHSci) is an international journal
in English language, which publishes original papers in the field
of physical therapy, medical laboratory diagnostics, radiology technology, sanitary engineering, health and ecology, health care and
therapy, and other related fields.
ent manuscripts, letters or parts that cannot be sent electronically,

or it is requested by the editorial staff. For authors who do not have
the possibility to submit online, the printed manuscript has to be
mailed, together with an electronic version on CD or DVD at the
following address: the Journal of Health Sciences, Faculty of Health
Studies, University of Sarajevo, 71000 Sarajevo, Bolnicka 25, Bosnia
and Herzegovina.
Types of papers that can be sent for publication in the JHS
Editorial policy
Original paper: original experimental laboratory and clinical studies should not exceed 4500, including tables and references.
Case report: presentation of clinical cases that may suggest the creation of new working hypotheses, with appropriate overview and
references. The text should not exceed 2400 words.
Review Article: Articles of renowned scholars, invited to write
them for the JHSci. The editorial board will also review individual
applications.
Editorial: short articles or comments which represent the opinions
of recognized leaders in medical research.
Authorship
All authors must sign the submission form. It is necessary that all
authors of confirm with their signature that: they meet the criteria
for authorship in the work, established by the International Committee of Medical Journal Editors; believe the manuscript represents honest work and being able to validate these results. Authors
are responsible for all statements and opinions in their papers.
More information is available at (http://bmj.com/cgi/collection/
authorship).
Submitting a manuscript for publication

The manuscript to be sent to JHSci must be in accordance to the
policy on the content, appearance and quality, which is defined
in these instructions for authors and the web site of the Journal,
www.jhsci.ba. Policy about the content, appearance and quality
of scientific research in JHSci is in accordance with international
recommendations and propositions given by the International
Committee of Medical Journal Editors: "Uniform Requirements for
Manuscripts Submitted to Biomedical Journals" New Engl J Med
1997, 336:309-315 (www.icmje.org), and the recommendations of
the international working group to standardize the appearance and
quality of scientific papers: STROBE (www.strobe-statement. org),
CONSORT (www.consort-statement.org) STARDA (www.stardstatement.org) and others.
Templates
JHSci prepared templates for the layout and content of scientific
work. Templates contain all the necessary subheadings and are
supplemented with the instructions on the contents of each chapter
which could facilitate the process of writing of paper. JHSci recommends the use of templates for writing research papers. Templates
can be found on the website of the journal www.jhsci.ba at the Information for authors section.
Submission form
All the authors must sign a submission form. It contains the permission to publish the submitted manuscript, statement of conflict of
interest, a statement of respecting the ethical principles in research
and a statement on the transfer of copyright to JHSci. This form has
to be downloaded from the web site www.jhsci.ba, printed, filled
out and scanned. If there are two scanned files they must be compressed to a ZIP file.
Uploading the files
Uploading of files is exclusively done through the website www.jhsci.ba, using the web form. Web form contains four pages: 1. list of
items to be considered prior to the submission of work; 2. Information on the author for correspondence; 3. information on the
manuscript; 4. part for sending files. In the web form, authors are
required to properly fill out the information, enter correct e-mail
address for correspondence, and send the 2 files: 1. submission
form (ZIP); 2. Manuscript (doc, docx, rtf). IT IS NOT NECESSARY to send the printed version, unless the authors want to pres-
183
Plagiarism or duplication of a published work

Authors confirm with signature that at the time of submitting the
manuscript has not been published in its present form or substantially similar form (in paper or electronic form, including on the
website), that has not been accepted for publication in another
journal, or considered for publication in another journal. The International Committee of Medical Journal Editors has given a detailed
explanation of what is a duplicate (www.icmje.org). More information can be found on www.jhsci.ba.
Patient consent form
Protecting patients' rights on privacy is of paramount importance.
Authors should, if the editors request, send copies of patient consent form which clearly show that patients, or other subjects of the
experiments, give permission for publishing of photographs and
other material that could identify them. If authors do not have the
necessary consent for research, they must exclude the data that
identifies the subject.
Approval of the Ethics Committee
Authors must clearly state in the submission form and in the manuscript, in section "Methods", that the study conducted on human
subjects or patients is approved by the national or local Ethics committee. More information can be found in the latest version of the
Helsinki Declaration (http://www.wma.net/e/policy/b3.htm). Also,
authors must confirm that experiments involving animals were
conducted in accordance with ethical standards.
Statement on Conflict of Interest
Authors are required to include all sources of financial assistance
they received for research (grants for projects, or other sources of
funding). If you are sure that there is no conflict of interest, then
state it briefly. For more information, see the editorial in the British
Medical Journal, "Beyond conflict of interest '(http://bmj.com/cgi/
content/short/317/7154/291).
Publishing Rights
In the submission form the authors are required to transfer publishing rights to the Faculty of Health Studies. The transfer of the
copyright becomes valid if and when the manuscript is accepted for
publication. The general public has the right to reproduce the contents or a list of articles, including abstracts for internal use at their
institutions. Publisher's consent is required for the sale or distribution outside the institution and for other activities arising from the
distribution, including compilations and translations. If the copy-
Instructions and guidelines to authors for the preparation and submission of manuscripts in the Journal of Health Sciences
righted materials are used, authors must obtain written permission

from the publisher and properly cite the reference in the article.
Formatting (appearance, layout) of manuscripts
Templates
JHSci has provided template on its website www.jhsci.ba according
to which manuscript should be formatted. Templates also contain
instructions made by the working group to standardize the format
of writing of scientific papers and objectively show the results of
the study. More information about the structure of scientific papers can be found on the website www.jhsci.ba and on the website
of the working groups www.consort-statement.org, www.strobestatement.org, www.stard-statement.org, and others. Templates can
be downloaded at the following link: http://jhsci.ba/informationfor-authors.html
Abbreviations and symbols
Abbreviations should be defined at their first appearance in the
text. Those not internationally recognized should be avoided. Use
of standard abbreviations is recommended. It is necessary to avoid
abbreviations in the title of manuscript and abstract.
Keywords
After the abstract, 3-10 key words or short phrases should be written, that will assist in indexing the article. Whenever possible, use
terms from Medical Subject Headings list of the National Medical
Library (MeSH, NLM). For more information:
(http://www.nlm.nih.gov/mesh/meshhome.html).
Text
The text of the work must be formatted in standard scientific format.
More information can be obtained by downloading templates from the
website of the journal: http://jhsci.ba/information-for-authors.html
Review articles may have a different structure.
The introduction is a concise part of manuscript. It must contain a
description of the problem that this paper deals with, by showing
the problem from the broader context and current situation, moving to specific problem which this paper tries to resolve. At the end
of the introduction it is necessary to clearly point out the purpose,
goals and/or hypothesis this study.
Methods. This section should be brief. The templates that JHSci has
provided on the website have more information about the content
of this chapter.
Results. Give priority to a graphical representation of the results of
studies, whenever applicable. Use subheadings in order to achieve
greater clarity of work. More information can be found in the templates.
Discussion. This section should give meaning to the results obtained, indicate the new discoveries which have been identified,
indicate the results of other studies that have dealt with a similar
problem. Compare your results with other studies and highlight the
differences and novelties in own results. In this chapter the results
should be comprehensively interpreted, analyzed and new knowledge synthesized from the analysis.
Conclusion. Should be brief and contain the most important facts
which have been identified in the paper. Conclusions must arise
from the results obtained during the investigation, and should include the possible application of these results. Both affirmative and
negating conclusions should be stated.
Acknowledgments
In this section you can specify: (a) contributions and authors who
do not meet enough criteria to be authors, such as support from
colleagues or heads of institutions, (b) thanks for technical assistance, (c) thanks for material or financial assistance, stating the
character of that assistance.
Statement on Conflict of Interest
Authors must identify all sources of funding of their studies and any
financial aid (including obtaining a salary, pay, etc.) by the institu-
184
tions whose financial interests may depend on the material in the

manuscript, or that might affect the independence of the study. If
you are sure that there is no conflict of interest, indicate that in the
manuscript. More information can be found here:
(http://bmj.com/cgi/content/short/317/7154/291).
References
References should be numbered in order of appearance in the paper. In text, references should be put in brackets, i.e. (12). When the
reference has up to 6 authors, list all authors. If 7 or more authors,
list only first 6 and add et al. References should include name and
source of information (Vancouver style). Names of journals should
be abbreviated as in PubMed. http://www.ncbi.nlm.nih.gov/journals
Examples of references:
Article: Meneton P, Jeunemaitre X, de Wardener HE, MacGregor
GA.Links between dietary salt intake, renal salt handling, blood
pressure, and cardiovascular diseases. Rev. Physiol. 2005;85(2):679715
More than 6 authors: Hallal AH, Amortegui JD, Jeroukhimov IM,
Casillas J, Schulman CI, Manning RJ, et al. Magnetic resonance
cholangiopancreatography accurately detects common bile duct
stones in resolving gallstone pancreatitis. J Am Coll Surg.2005;
200(6):869-75.
Books: Jenkins PF. Making Sense of the chest x-ray: a hands-on
guide. New York: Oxford University Press; 2005. 194 p.
Book Chapter: Blaxter PS, Farnsworth TP. Social health and class
inequalities. In: Carter C, Peel SA, editors. Equalities and inequalities in health. 2nd ed. London: Academic Press; 1976th p. 165-78.
Internet source: HeartCentreOnline. Boca Raton, FL: HeartCentreOnline, Inc.., C2000-2004 [cited 2004 Oct 15]. Available from:
http://www.heartcenteronline.com/
Personal communications and unpublished works should not appear in the references and should be put in parentheses in the text.
Unpublished paper, accepted for publication, may be cited as a reference with the words "in press", next to the name of the journal. All
the references must be verified by the author.
Tables
Tables have to be placed after the references. Each table must be on
a separate page. Tables should NOT be formatted other than simple
borders and no colors.
Table number and title is written above the table. Table gets number
in the order of appearance in the text, with a clear and sufficiently
informative title, i.e. "Table 3. Text table name.... A reference to the
table in text is written in parentheses, i.e. (Table 3). All the abbreviations in the table must be explained in full below the table. It is desirable to give explanations and comments below the table, which
are essential for the presented results to be understood. Display the
statistical measures of variations such as standard deviation and
standard error of the mean, when applicable.
Figures
Figures have to be placed behind the references and tables (if any).
Each figure must be on a separate page. Figures get the titles by the
order of appearance in the text. The title and number are written
below the figure, for example, "Figure 3. Title text When referring to a figure in the manuscript text, number of the figure has to
be written in parentheses, eg (Figure 3). It is essential that the figure
has a clear and informative title and text below the title which explains the presented results with sufficient details. Figure resolution
must be at least 250-300 dpi, JPG or TIFF.
Units of Measure
Measures of length, weight and volume should be written in metric units (meter, kilogram, liter). Hematological and biochemical
parameters should be expressed in metric units according to the
International System of Units (SI).
Journal of Health Sciences 2013;3(2)
http://www.jhsci.ba
UPUTSTVO AUTORIMA
Upute i smjernice autorima za pripremu i predaju rukopisa u Journal of Health Sciences
Ciljevi i okvir asopisa
ako autori ele predstaviti rukopis, pismo ili dijelove koji ne mogu
biti poslani elektronski, ili je to zatraeno od urednitva. Za autore
koji nemaju mogunost elktronskog slanja rada, potrebno je poslati
potom jedan primjerak rada, zajedno s elektronskom verzijom na
CD-u ili DVD-u na sljedeu adresu: za Journal of Health Sciences,
Fakultet zdravstvenih studija Univerziteta u Sarajevu, 71000 Sarajevo, Bolnika 25, Bosna i Hercegovina.
The Journal of Health Sciences (JHSci) je internacionalni asopis

na engleskom jeziku, koji objavljuje orginalne radove iz oblasti fizikalne terapije, medicinsko-laboratorijske dijagnostike, radioloke
tehnike, sanitarnog inenjerstva, zdravlja i ekologije, zdravstvene
njege i terapije, te drugih srodnih oblasti.
Pravila redakcije
Vrste znanstvenih radova koje se mogu poslati za objavljivanje

u JHS
Orginalni radovi: orginalne laboratorijske eksperimentalne i klinike studije ne bi trebao prelaziti 4500 ukljuujui tabele i reference.
Prikaz sluajeva: prezentacije klinikih sluajeva koji mogu sugerisati kreiranje nove radne hipoteze, uz prikaz odgovarajue literature. Tekst ne bi trebao prelaziti 2400 rijei.
Pregledni lanci: lanci afirmiranih znanstvenika, pozvanih da ih
napiu za asopis. Redakcija e, takoer, razmatrati i samostalne
aplikacije.
Uvodnici: lanci ili kratki uvodniki komentari koji predstavljaju
miljenja prepoznatih lidera u medicinskim istraivanjima.
Autorstvo
Svi autori morati potpisati formular za podnoenje rada (Manuscript Submission form). Potrebno je da svi autori potpisom potvrde
da: su zadovoljili kriterije za autorstvo u radu, utvreno od strane
International Committee of Medical Journal Editors; vjeruju da
rukopis predstavlja poteni rad i da su u mogunosti potvrditi valjanost navedenih rezultata. Autori su odgovorni za sve navode i
stavove u njihovim radovima. Vie informacija se moe dobiti na
(http://bmj.com/cgi/collection/authorship).
Plagijarizam ili dupliciranje objavljenog rada
Od autora se zahtjeva da svojim potpisom potvrde da u momentu
podnoenja rad nije objavljen u sadanjem obliku ili bitno slinom
obliku (u tampanom ili elektronskom obliku, ukljuujui i na web
stranici), da nije prihvaen za objavljivanje u drugom asopisu ili
razmatran za objavljivanje u drugom asopisu. Meunarodni odbor urednika medicinskih asopisa dao je detaljno objanjenje ta
jeste, a ta nije duplikat (www.icmje.org). Vie informacija moe se
nai i na stranici www.jhsci.ba.
Podnoenje rada za objavljivanje

Rad koji se alje u JHSci mora biti u skladu sa propozicijama o sadraju, izgledu i kvalitetu, koje je urnal propisao u ovim instrukcijama za autore i na web stranici urnala, www.jhsci.ba. Propozicije
o sadraju, izgledu i kvalitetu naunog rada u skladu su sa meunarodnim propozicijama i preporukama datim od strane International Committee of Medical Journal Editors. Uniform Requirements
for Manuscripts Submitted to Biomedical Journals New Engl J
Med 1997, 336:309315 (www.icmje.org), te preporuka meunarodnih radnih grupa za standardizaciju izgleda i kvaliteta naunih
radova: STROBE (www.strobe-statement.org) , CONSORT (www.
consort-statement.org), STARD (www.stard-statement.org) i drugih.
Predloci
JHSci je pripremio predloke (engl. template) za izgled i sadraj
naunog rada. Predloci sadre sve neophodne podnaslove i obogaeni su uputama o sadraju svakog poglavlja naunog rada, te e
autorima znatno olakati proces pisanja rada. JHSci preporuuje
koritenje predloaka za pisanje naunih radova koji se nalaze na
web stranici urnala www.jhsci.ba u dijelu Information for authors.
Formular saglasnosti bolesnika

Zatita prava pacijenta na privatnost je od iznimnog znaaja. Autori trebaju, ako redakcija zahtjeva, poslati kopije formulara Suglasnosti bolesnika iz kojih se jasno vidi da bolesnici ili drugi subjekti
eksperimenata daju doputenje za objavljivanje fotografija i drugih
materijala koji bi ih identificirali. Ako autori nemaju potrebnu saglasnost za istraivanje, moraju je dobiti ili iskljuiti podatke koji
identificiraju subjekte, a za koje nisu dobili saglasnost.
Odobrenje Etikog komiteta
Autori moraju u formularu za podnoenje rada i u dijelu rada
Metode jasno navesti da su studije koje su proveli na humanim
subjektima, odnosno pacijentima, odobrene od strane odgovoarajueg etikog komiteta. Vie informacija moete nai u najnovijoj verziji Helsinke deklaracije (http://www.wma.net/e/policy/
b3.htm). Isto tako, autori moraju potvrditi da su eksperimenti koji
ukljuuju ivotinje provedeni u skladu sa etikim standardima.
Pismo za podnoenje rada

Svi autori rada moraju potpisati formular za podnoenje rada. On
sadri odobrenje za publiciranje poslanog rada, izjavu o sukobu
interesa, izjavu potivanju etikih principa u istraivanju i izjavu o
prijenosu autorskih prava na JHSci. Ovaj formular se mora preuzeti
sa web stranice www.jhsci.ba u dijelu Information for authors, te
odtampati, popuniti i skenirati. Ukoliko se skeniranjem dobiju dva
ili tri fajla, moraju se pretvoriti u jedan ZIP fajl.
Izjava o sukobu interesa

Od autora se zahtjeva da navedu sve izvore finansijske pomoi koje
su dobili za istraivanje (grantovi za projekte, ili drugi izvori finansiranja). Ako ste sigurni da nema sukoba interesa, onda to i navedite kratko. Za vie informacija pogledajte uvodnik u British Medical
Journal, 'Beyond conflict of interest' (http://bmj.com/cgi/content/
short/317/7154/291).
Slanje rada
Vri se iskljuivo preko web stranice www.jhsci.ba preko predvienog web formulara. Web formular sadri etiri stranice na kojima
se nalazi: 1. popis stavki koje treba ostvariti prije podnoenja rada;
2. informacije o autoru za korespondenciju; 3. informacije o naunom radu; 4. dio za slanje fajlova. U web formularu autori su
duni ispravno popuniti informacije, unijeti ispravnu e-mail adresu za korespondenciju, te poslati 2 fajla: 1. Pismo za podnoenje
rada; 2. Nauni rad. NIJE POTREBNO slati tampanu verziju, osim
Izdavaka prava
U okviru Pisma za podnoenje rada od autora se zahtjeva da prenesu izdavaka prava na Fakultet zdravstvenih studija. Prijenos izdavakih prava postaje punovaan kada i ako rad bude prihvaen
za publiciranje. ira javnost ima prava reproducirati sadraj ili listu
lanaka, ukljuujui abstrakte, za internu upotrebu u svojim institucijama. Saglasnost izdavaa je potrebna za prodaju ili distribuciju
van institucije i za druge aktivnosti koje proizilaze iz distribucije,
ukljuujui kompilacije ili prijevode. Ukoliko se zatieni materijali
185
Upute i smjernice autorima za pripremu i predaju rukopisa u Journal of Health Sciences
koriste, autori moraju dobiti pismenu dozvolu izdavaa i navesti

izvor, odnosno referencu u lanku.
materijala u radu, ili koji bi mogli uticati na nepristranost studije. Ako ste sigurni da ne postoji sukob interesa, navedite to u radu.
Jo informacija se moe nai ovdje: (http://bmj.com/cgi/content/
short/317/7154/291).
Formatiranje (izgled) rada

Predloci (engl. template) za pisanje radova
JHSci je na svojoj web stranici www.jhsci.ba dao predloke (engl.
Template) prema kojima treba formatirati radove. Predloci, takoer, sadre i upute preuzete od strane radnih grupa za standardiziranje formata u pisanju naunih radova i objektivno i potpuno
prikazivanje rezultata studija. Vie informacija o strukturi naunih
radova moe se nai na web stranici www.jhsci.ba i na web stranicama radnih grupa: www.consort-statement.org, www.strobe-statement.org, www.stard-statement.org, i drugih. Predloci se mogu
preuzeti na sljedeem linku: http://jhsci.ba/information-for-authors.html
Skraenice i simboli
Skraenice se moraju definisati prilikom njihovog prvog pojavljivanja u tesktu. One koje nisu internacionalno i generalno prihvaene
trebaju se izbjegavati. Koristiti standardne skraenice. Potrebno je
izbjegavati skraenice u naslovu rada i u saetku.
Kljune rijei
Nakon abstrakta treba staviti 3-10 kljunih rijei ili kratkih fraza
koje e pomoi u indeksiranju rada. Uvijek kada je to mogue, treba koristiti termine iz Medical Subject Headings liste Nacionalne
Medicinske Bibiloteke (MeSH, NLM). Vie informacija na:
(http://www.nlm.nih.gov/mesh/meshhome.html).
Tekst rada
Tekst rada mora biti standardnog naunog formata. Vie informacija dobiete preuzimanjem predloaka sa web stranice urnala:
http://jhsci.ba/information-for-authors.html
Pregledni lanci mogu imati drugaiju strukturu.
Uvod je koncizan dio rada. U njemu se predstavlja problem kojim
se rad bavi i to kreui od ireg konteksta problema i trenutnog
stanja i dosadanjih dostignua u vezi konkrtnog problema, prema
specifinom problemu koji e obraditi ova studija. Na kraju uvoda
je potrebno jasno istaknuti svrhu, ciljeve i/ili hipoteze ove studije.
Metode. Ovaj dio ne treba biti kratak. U predlocima koje je JHSci dao na web stranici nalazi se vie informacija o sadraju ovog
poglavlja.
Rezultati. Dati prednost grafikom prikazu rezultata studije u odnosu na tabelarni, kada je god to primjenjivo. Koristiti podnaslove
radi postizanja vee jasnoe radova. Vie informacija nai u predlocima.
Diskusija. U ovoj sekciji treba dati smisao dobivenim rezultatima,
ukazati na nova otkria do kojih se dolo, ukazati na rezultate drugih studija koje su se bavile slinim problemom. Uporediti svoje
rezultate sa drugim studijama i naglasiti razlike i novine u svojim
rezultatima. U ovom poglavlju treba interpretirati, sveobuhvatno
sagledati dobijene rezultate, te sintetizirati novo znanje iz analize.
Zakljuak. Treba da bude kratak i da sadri najbitnije injenice do
kojih se dolo u radu. Navodi se zakljuak, odnosno zakljuci koji
proizilaze iz rezultata dobivenih tokom istraivanja; treba navesti
eventualnu primjenu navedenih ispitivanja. Treba navesti i afirmativne i negirajue zakljuke.
Zahvala
U ovom dijelu se mogu navesti: (a) doprinosi i autori koji ne zadovoljavaju dovoljno kriterija da budu autori, kao npr. podrka kolega
ili efova institucija; (b) zahvala za tehniku pomo; (c) zahvala za
materijalnu ili finansijsku pomo, obrazlaui karakter te pomoi.
Izjava o sukobu interesa
Autori moraju navesti sve izvore finasiranja svoje studije i bilo koju
finansijsku potporu (ukljuujui dobijanje plae, honorara, i drugo) od strane institucija iji finansijski interesi mogu zavisiti od
186
Reference
Reference se trebaju numerisati prema redoslijedu pojavljivanja u
radu. U tekstu, reference je potrebno navesti u zagradama, npr. (12).
Kada rad koji citirate ima do 6 autora, navesti sve autore. Ukoliko
je 7 ili vie autora, navesti samo provih 6 i dodati et al. Reference
moraju ukljuivati puni naziv i izvor informacija (Vancouver style).
Imena urnala trebaju biti skraena kao na PubMedu. http://www.
ncbi.nlm.nih.gov/journals
Primjeri referenci:
Standardni rad: Meneton P, Jeunemaitre X, de Wardener HE,
MacGregor GA. Links between dietary salt intake, renal salt handling, blood pressure, and cardiovascular diseases. Physiol Rev.
2005;85(2):679-715
Vie od 6 autora: Hallal AH, Amortegui JD, Jeroukhimov IM, Casillas J, Schulman CI, Manning RJ, et al. Magnetic resonance cholangiopancreatography accurately detects common bile duct stones in
resolving gallstone pancreatitis. J Am Coll Surg. 2005;200(6):86975.
Knjige: Jenkins PF. Making sense of the chest x-ray: a hands-on
guide. New York: Oxford University Press; 2005. 194 p.
Poglavlje u knjizi: Blaxter PS, Farnsworth TP. Social health and
class inequalities. In: Carter C, Peel JR, editors. Equalities and
inequalities in health. 2nd ed. London: Academic Press; 1976. p.
165-78.
Internet lokacija: HeartCentreOnline. Boca Raton, FL: HeartCentreOnline, Inc.; c2000-2004 [cited 2004 Oct 15]. Available from:
http://www.heartcenteronline.com/
Osobne komunikacije i nepublicirani radovi ne bi se trebali nai u
referencama ve biti navedeni u zagradama u tekstu. Neobjavljeni
radovi, prihvaeni za publiciranje mogu se navesti kao referenca sa
rijeima U tampi (engl. In press), pored imena urnala. Reference moraju biti provjerene od strane autora.
Tabele
Tabele se moraju staviti iza referenci. Svaka tabela mora biti na posebnoj stranici. Tabele NE TREBA grafiki ureivati.
Broj tabele i njen naziv pie se IZNAD tabele. Tabela dobija broj
prema redoslijedu pojavljivanja u tekstu, a naziv treba biti jasan i
dovoljno opisan da je jasno ta tabela prikazuje. npr Table 3. Tekst
naziva tabele..... U radu prilikom pozivanja na tabelu treba napisati
broj tabele u zagradi, npr. (Table 3). Za skraenice u tabeli potrebno
je dati puni naziv ispod tabele. Poeljno je ispod tabele dati objanjenja i komentar, koji su neophodni da se rezultati u tabeli mogu
razumjeti. Prikazati statistike mjere varijacije, kao to je standardna devijacija i standardna greka sredine, gdje je primjenjivo.
Slike
Slike staviti iza referenci i tabela (ako postoje). Svaka slika mora biti
na posebnoj stranici. Slika dobija broj prema redoslijedu pojavljivanja u tekstu. Naziv i broj se piu ISPOD slike, npr. Slika 3. Tekst
naziva slike... U radu, prilikom pozivanja na sliku treba napisati
broj slike u zagradi, npr (Slika 3). Neophodno je da slika ima jasan
i indikativan naziv, a u tekstu ipod slike objasniti sliku i rezultat
koji ona prikazuje, sa dovoljno detalja da ona moe biti jasna bez
pretrage teksta koji je objanjava u radu. Slika mora biti kvaliteta
najmanje 250-300 dpi, formata JPG, TIFF ili BMP.
Jedinice mjere
Mjere duine, teine i volumena trebaju se pisati u metrikim jedinicama (meter, kilogram, liter). Hematoloki i biohemijski parametri se trebaju izraavati u metrikim jedinicama prema International System of Units (SI).

JHSCI 2013 v3 I2 September

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

JHSCI 2013 v3 I2 September

Uploaded by

Copyright:

Available Formats

UNIVERSITY OF SARAJEVO FACULTY OF HEALTH STUDIES

UNIVERZITET U SARAJEVU FAKULTET ZDRAVSTVENIH STUDIJA

Journal of Health Sciences

Dijana Avdi (BiH)

Demal Pecar (BiH)

Aida Rudi (BiH)

Renata Dobrila Dintinjana (CRO)

Fatima Jusupovi (BiH)

Mirsad Mufti (BiH)

Budimka Novakovi (SRB)

Borut Poljak (SI)

Isabelle Rishard (F)

Sandra Vegar-Zubovi (BiH)

Etiological factors of preterm delivery

Anela Rami et al. Journal of Health Sciences 2013;3(2):82-87

Journal of Health Sciences

Dose-volume histogram constrains for small

In developed countries, thanks to early detection in

Anela Rami et al. Journal of Health Sciences 2013;3(2):82-87

In this retrospective-prospective study patients were

Anela Rami et al. Journal of Health Sciences 2013;3(2):82-87

Conformal plans (35 patients)

Legend: mean average mean

cm from the anus all the way to the rectosigmoidal

of organs at risks included in 75%, 95% and 100%

In the descriptive analysis, we used the arithmetic

In this study, DVH parameter plans for radiation

Anela Rami et al. Journal of Health Sciences 2013;3(2):82-87

ing healthy tissue and organs. Therefore, modern

DVH parameters for transcutaneous conformal

Adjuvant radiotherapy is an important factor for

Anela Rami et al. Journal of Health Sciences 2013;3(2):82-87

be explained by the fact that the CT simulation in

The authors declare that they have no conflict of interest.

Anela Rami et al. Journal of Health Sciences 2013;3(2):82-87

12. Lian J, Mackenzie M, Joseph K, Pervez N, Dundas G, Urtasun R, Pearcey

9. Guo S, Ennis D, Bhatia S, et al. Assesement of nodal target definition using

13. Yang R, Xu S, Jiang W, Xie C, Wang J. Integral dose in three-dimensional

10. Nadeau S, Bouchard M, Germain I, Raymond PE, Beaulieu F, Beaulieu L,

Girolamo Jose Barrera et al. Journal of Health Sciences 2013;3(2):88-97

Journal of Health Sciences

Saliva plays a central role in oral health (1,2). Saliva

Girolamo Jose Barrera et al. Journal of Health Sciences 2013;3(2):88-97

antimicrobial peptides, all of which flow out of the

in saliva varies between individuals. This has been

This study was approved by the Institutional Review

Girolamo Jose Barrera et al. Journal of Health Sciences 2013;3(2):88-97

Collection of gingival samples

mercapto-ethanol, was read at a wavelength of 412

Tissue samples from caries group (n=4) were taken

We coated 96-well immunoplates (MaxiSorp;

Saliva samples were collected (4 to 6 ml) in a tube

Reverse transcription polymerase

Total RNA was extracted from all tissue samples by

Peroxidase activity was measured in the patients

Girolamo Jose Barrera et al. Journal of Health Sciences 2013;3(2):88-97

ume of 25 l containing 1 l of the reverse transcription reaction, 50 M deoxynucleotide triphosphates,

Fifty-four females and 46 males participated in the

Girolamo Jose Barrera et al. Journal of Health Sciences 2013;3(2):88-97

Girolamo Jose Barrera et al. Journal of Health Sciences 2013;3(2):88-97

givitis was noted in only a small number of subjects

The median protein concentration of unstimulated

Girolamo Jose Barrera et al. Journal of Health Sciences 2013;3(2):88-97