Fish Sci (2010) 76:111117

DOI 10.1007/s12562-009-0183-0

ORIGINAL ARTICLE

Aquaculture

Suitability of genetically modified soybean meal in a dietary

ingredient for common carp Cyprinus carpio
Indra Suharman Shuichi Satoh Yutaka Haga
Toshio Takeuchi Ikuo Hirono Takashi Aoki

Received: 17 July 2009 / Accepted: 6 October 2009 / Published online: 8 December 2009
The Japanese Society of Fisheries Science 2009

Abstract The effect of genetically modified (GM) soybean meal (SBM) in a feed ingredient on growth performance of common carp was investigated in comparison to
nonGM SBM. GM SBM was included at 34 and 48% in
two experimental diets that were formulated with fish meal
(FM) to obtain approximately 38% protein in diet. Two
other experimental diets were formulated to contain the
same levels of nonGM SBM. The diets were fed to juvenile
common carp (22 g initial mean weight) for 12 weeks. The
cauliflower mosaic virus (CaMV) 35S promoter fragment
(205 base pairs) of the GM SBM was examined in fish
muscle and blood samples at the twelfth week. From the
twelfth week, the GM groups were fed with nonGM diets
to determine the residual span of the transferred promoter
fragment. There was no significant difference in growth
and feed performance between GM and nonGM groups at
two inclusion levels after 12 weeks. The CaMV 35S promoter fragment was not detected in fish muscles or blood
receiving either level of GM SBM diet. The results demonstrated that the availability of GM SBM was similar to
that of nonGM SBM and the GM SBM would be a suitable
and safe ingredient in feed for common carp.

I. Suharman
S. Satoh (&)
Y. Haga
T. Takeuchi

I. Hirono
T. Aoki
Department of Marine Biosciences,
Tokyo University of Marine Science and Technology,
4-5-7 Konan, Minato, Tokyo 108-8477, Japan
e-mail: ssatoh@kaiyodai.ac.jp
I. Suharman
Department of Aquaculture,
Faculty of Fisheries and Marine Sciences,
The University of Riau, Pekanbaru 28293, Indonesia

Keywords Availability
Common carp
Diets

Feed efficiency
Genetically modified soybean

Growth

Introduction
Development of cost-effective alternative protein sources
to fish meal (FM) is of interest, both in terms of economy
and the predicted shortage in future FM supplies. Soybean
meal (SBM) is one of the most commonly used plant
ingredients in carp feeds. SBM is widely available and
cheap and has a high protein content and relatively wellbalanced amino acid profile for aquafeed [1]. Globally, the
application of biotechnology has resulted in increased
production and commercial availability of genetically
modified (GM) plants, reaching approximately 60 million ha of cultivated area grown in 16 countries [2].
In 1996 in Canada, the Roundup Ready (RR) soybean
was the first plant approved for food production and is the
most common transgenic line [3]. This RR soybean was
produced by the stable insertion of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) coding sequence
from Agrobacterium sp. strain CP4 into the genome of
conventional soybeans, which confers tolerance to the
herbicide glyphosate [4]. The recombinant gene in GM
soybean is composed of the cauliflower mosaic virus
(CaMV) promoter that regulates the CP4 EPSPS and the
terminator of the nopaline synthase (NOS) genes. GM
soybean crops are estimated to occupy 46% of the global
biotech crop market, thus approximately 9% of the global
seed market [5].
The safety assessment of GM soybeans includes the
analysis of their substantial equivalence [6], i.e. a comparison to their nonmodified counterpart. Published

123

112

research on the safety and nutritional quality of GM soybeans in fish feed is limited to only a few studies [711].
These studies reported that biochemical compositions of
GM soybeans were equivalent to nonGM soybeans. In
addition, there were no effects on growth performance and
feed utilization for carnivorous fish species such as catfish
Ictarus punctatus [7], Atlantic salmon Salmo salar [8],
rainbow trout Oncorhynchus mykiss [10], and omnivorous
fish species such as Nile tilapia Oreochromis niloticus [11].
The possibility of foreign deoxyribonucleic acid (DNA)
transfer from GM soybean into fish-derived products (e.g.,
meat) has raised questions regarding the safety of these
products for human consumption. Recently, studies conducted to determine whether GM plant DNA was detectable in the muscle of Atlantic salmon fed a GM SBM diet
indicated that no foreign DNA was deposited in muscle [8].
However, other studies have shown that the CaMV 35S
promoter fragment was detected in the muscle of rainbow
trout [10] and tilapia [11, 12], although it was not detected
on the second day after changing to nonGM SBM diet. This
makes it necessary to study further the fate of foreign DNA
in tissues, especially when high levels of GM plants are
included in diets.
Common carp Cyprinus carpio is one of the most
commercially important species of freshwater fish in the
world. This fish is an omnivorous species, utilizes a wide
spectrum of foods, and has a digestive system whose
function and morphology differ from those of both carnivorous and herbivorous species. In addition, carp utilizes
carbohydrates well since it is an omnivorous species [13].
Plant products such as an SBM should be suitable ingredients for carp. Therefore, examining the safety of GM
SBM is important if the use of SBM in diets is to be
increased. The aim of the present study was to evaluate
GM SBM as an ingredient in diets for common carp. In
addition, the fate of the CaMV 35S promoter fragment was
examined in the muscle and blood of fish fed a GM SBM
diet.

Fish Sci (2010) 76:111117

Table 1 Proximate composition of soybean meal (%)
Crude protein

Crude lipid

Crude ash

Moisture

NonGM SBM

45.4

1.8

8.4

12.5

GM SBM

44.2

3.1

5.9

12.2

Table 2 Formulation and proximate composition of the experimental diets (%)

Diet

NonGM SBM

GM SBM

34%

48%

34%

30

20

48%

Ingredients
Jack mackerel meal
GM SBM
NonGM SBM

34

48

Wheat flour

7.9

7.9

30

20

34

48

7.9

7.9

a-Starch

10

10

10

10

Palm oil

Soybean oil

Mineral premixa

Vitamin premixb

Ca(H2PO4)2

Cellulose

Vitamin E (50%)

0.1

0.1

0.1

0.1

Moisture
Crude protein

2.7
40.3

2.1
40.2

2.0
38.7

5.3
39.1

Crude lipid

9.8

9.6

11.0

10.4

Crude ash

10.3

10.1

9.6

8.9

Proximate composition

GM Genetically modified, SBM soybean meal

a

The vitamin mix had the following components (mg 100 g- 1):
thiamin hydrochloride 6, riboflavin 10, pyridoxine hydrochloride 4,
cyanocobalamin 0.01, ascorbic acid 500, niacin 40, Ca-pantothenate
10, inositol 200, biotin 0.6, folic acid 1.5, p-aminobenzoic acid 5,
vitamin K3 5, vitamin A acetate 4,000 IU, vitamin D3 4,000 IU

P-free mineral mixture is composed of the following (g 100 g- 1):

NaCl 5.0, MgSO4
7H2O 74.5, FeC6H5O7
nH2O 12.5, trace element
mixc 5.0, cellulose 3.0

Materials and methods

Trace element mix includes the following (mg g- 1): ZnSO4
7H2O

353, MnSO4
5H2O 162, CuSO4
5H2O 31, AlCl3
6H2O 10,
CoCl
6H2O 1, KIO3 3, cellulose 440

Experimental diets
Four isonitrogenous diets (38% crude protein) were formulated to include two proportions of either nonGM
SBM or GM SBM (Tables 1, 2). The experimental diets
were pelleted using a laboratory pelletizer (AEZ12 M,
Hiraga-Seisakusho, Kobe, Japan), dried in a vacuum
freeze-drier (RLE II-206, Kyowa Vacuum Tech., Saitama, Japan), and stored at 4C until use. Percent moisture was measured by oven drying at 110C for 4 h and
then weighing each sample at hourly intervals until a

123

constant weight was obtained. Crude ash content was

determined by using a muffle furnace at 600C overnight
[14]. Crude protein concentration was determined by the
Kjeldahl procedure using a Kjeltec Auto Sampler System
1030 Analyzer (Foss, Tokyo, Japan). Percent nitrogen
was multiplied by 6.25 to obtain an estimate of percent
protein. Crude lipids were extracted from samples in
chloroform/methanol (2:1, v/v) according to the methods
of Folch et al. [15].

Fish Sci (2010) 76:111117

Fish, rearing conditions, and feeding

Common carp juveniles were obtained from the Field
Science Center, Yoshida Station, Tokyo University of
Marine Science and Technology, Shizuoka 421-0302,
Japan. Fish were kept in a flow-through system with a flow
rate of 0.61.0 l/min, and sufficient aeration was supplied.
Throughout the experiment, water temperature was maintained at 22.025.0C.
Prior to the experiment, all fish were acclimatized to the
experimental condition by feeding them a commercial diet
for a week. A total of 160 fish (mean weight SE,
22.0 2.10 g) were randomly assigned to eight 60-l glass
tanks with 20 fish each. Four experimental diets were
randomly assigned to the tanks with duplicates. Fish were
fed twice daily at 09:00 and 16:00 h to apparent satiation
for 12 weeks. After that, fish fed with diets containing GM
SBM were fed the nonGM SBM diets to apparent satiation
for 8 days.
Sampling and biological analysis
At the commencement of the feeding experiment, ten fish
were randomly sampled and anaesthetized with ethylene
glycol monophenyl ether (300 mg/l) before being sacrificed. Approximately 25 g dorsal muscle was dissected
from the right side of the body and immediately frozen
on dry ice and stored at -80C until DNA analysis. The
other resected tissues from ten individual fish were
pooled, minced by knife, and frozen at -20C for wholebody composition analysis. Moisture, crude ash, crude
protein, and crude lipid content in samples were determined as described in Experimental diets. At the termination of the 12-week feeding trial, twenty fish in each
tank were individually weighed and ten were sampled at
24 h after the last feeding for whole-body composition
analysis. For these, approximately 1 ml blood was collected from the caudal veins by a medical syringe
(2.5 ml, TERUMO; Tokyo, Japan) and transferred to
sterile Eppendorf tubes containing EDTA. The blood was
frozen on dry ice and stored at -80C until use. Dorsal
muscle samples from the right side of the body were
dissected for DNA extraction. The rest of them were
pooled, homogenized, and frozen at -20C for wholebody composition analysis. Furthermore, blood samples
and dorsal muscle samples from each treatment were
taken (n = 10) at the second, fifth, and eighth days after
the last feeding of the GM SBM diets for DNA analysis.
Fish were not starved for sampling after changing to
nonGM SBM diets.
Weight gain (WG), specific growth rate (SGR), feed
efficiency (FE), protein efficiency ratio (PER), and protein
retention (PR) were calculated as follows:

113

Weight gain WG) g) final body weight (FW) (g)

 initial body weight (IW) (g);
Specific growth rate (SGR) (% body weight=day)
ln FW (g)  ln IW(g))=duration of feeding trial (days)
 100
Feed efficiency (FE) (g/g) Weight gain (g)/Feed intake (g)
Protein efficiency ratio (PER) (g/g)
Weight gain (g)/protein intake (g)
Protein retentionPR%
100  FW  Final body protein
 IW  Initial body protein=feed intake  feed protein
DNA extraction from muscle and blood samples
DNA extraction from the experimental diets was done
according to Murray and Thompson [16] with minor
modification. In brief, 1 ml hexadecyltrimethyl-ammonium
bromide (CTAB) buffer (20 g/l CTAB, 0.1 M TrisHCl
pH 8.0, 1.4 M NaCl, and 20 mM EDTA) was added to
0.1 g sample, mixed by vortex, and incubated in a water
bath at 60C for 60 min. Then, the solution was centrifuged
at 21,8409g for 3 min at 4C. The supernatant was
transferred to a new tube, filled with 200 ll phenol:chloroform:isoamyl alcohol (PCI, 25:24:1), mixed gently by
inverting for 5 min, and centrifuged at 21,8409g for 3 min
at 4C. The upper layer was transferred to a 1.5-ml tube
and 200 ll PCI was added, mixed gently by inverting for
20 min, and centrifuged at 21,8409g for 10 min at 4C.
The upper layer was gently mixed with 300 ll 2-propanol
for 30 s, and centrifuged at 21,8409g for 5 min at 4C.
The DNA pellet was washed with 800 ll 75% ethanol,
centrifuged at 21,8409g for 5 min at 4C, and dried at
room temperature. The DNA pellet was dissolved in 50 ll
TE buffer (10 mM TrisHCl, 1 mM EDTA, pH 8.0) as a
stock DNA solution, and stored at -20C.
DNA was extracted from fish muscle samples (approximately 0.25 g) using the phenolchloroform method. The
sample was digested with 40 lg proteinase K in 400 ll
TNESurea buffer (10 mM TrisHCl pH 7.5, 125 mM
NaCl, 10 mM EDTA, 0.5% SDS, 5 M urea) overnight at
37C. DNA was extracted with 400 ll PCI for 20 min over
a rotary shaker (NV-220, Nissin, Tokyo, Japan) and centrifuged at 21,8409g for 10 min at room temperature. The
upper layer was transferred to a 1.5-ml tube and 300 ll PCI
was added, mixed gently for 20 min by a rotary shaker, and
then centrifuged at 21,8409g for 10 min at room temperature. For precipitating, 800 ll absolute ethanol (-20C)
was added to the upper layer, followed by centrifugation at
21,8409g for 10 min at room temperature. The DNA pellet

123

114
Table 3 Primers used in the
study

Fish Sci (2010) 76:111117

Sequence (50 30 )

Target
sequence

Amplicon
size (bp)

CaMV1

CCTACAAATGCCATCATTGCG

CaMV 35S promoter

205

CaMV2

GGGTCTTGCGAAGGATAGTG
Common carp beta-actin gene

211

Name
CaMV promoter

b-actin
b-actin1

GTTGCACACTTGATGGATGG

b-actin2

GCACACTGCGCTATTTTTCA

was washed twice with 400 ll 70% ethanol (-20C) and

centrifuged at 21,8409g for 5 min at room temperature.
The DNA pellet was air-dried, dissolved in 30 ll TE buffer, and stored at -20C.
A commercial DNA extraction kit (Dr. GenTLE; Takara
Bio., Japan) was used for extraction of DNA from whole
blood containing EDTA samples according to the manufacturers protocol. The concentrations of the extracted
DNA were measured fluorometrically using the GeneQuant
100 (Biochrom, England).

Statistical analysis

Oligonucleotide primers

Composition of soybean meals and experimental diets

The primer pairs (Table 3) were synthesized by Invitrogen

(Carlsbad, CA, USA) and diluted with an appropriate
volume of distilled water to a final concentration of
30 pmol/ll and stored at -20C until use. Three primer
pairs framing specific target sequences were used. The
primer pair CaMV1/CaMV2 (GenBank accession no.
V00141) was used to amplify the CaMV 35S promoter
fragment. The primer pair b-actin1/b-actin2 (GenBank
accession no. M24113) was used to confirm the feasibility
of PCR amplification of the extracted DNA from muscle
and other tissue samples.

The proximate composition of GM SBM was comparable

to that of nonGM SBM (Table 1). The GM SBM was lower
in crude protein and ash contents but higher in crude lipid
content when compared to the nonGM SBM. All experimental diets were equivalent in composition with no differences in crude protein, crude lipid, and ash contents
between the GM and nonGM diets within each inclusion
level (Table 2).

Polymerase chain reaction

Polymerase chain reaction (PCR) was carried out in a
reaction mixture (20 ll) containing 2 ll 109 Taq buffer
with 20 mM MgCl2, 1.5 ll deoxynucleotide triphosphate
(dNTP) mixture, 1 ll primers, 0.05 ll Taq polymerase
(Takara, Japan), 14.45 ll distilled water, and 1 ll DNA
template. The PCR conditions were as follows: 94C for
10 min (initial denaturation); 40 cycles of 95C for 25 s
(denaturation), 60C for 30 s (annealing), and 72C for
45 s (extension); followed by 72C for 7 min (final
extension). The PCR products were separated on a 1.5%
(w/v) agarose gel containing 1% ethidium bromide. Electrophoresis was carried out at approximately 100 V for 35
45 min, visualized under ultraviolet (UV) light at 254 nm,
and photographed using a charge-coupled device (CCD)
camera (SFC Instruments, Japan).

123

Results were analyzed using one-way and two-way analysis of variance (ANOVA) (Systat 8.0, SPSS, Chicago, IL,
USA). Differences between treatments were compared by
Fishers LSD test. Values were considered significant at
P \ 0.05.

Results

Growth performance and feed utilization

The growth and feed utilization results are shown in
Table 4. WG, SGR, and PER were significantly reduced as
the proportion of either nonGM or GM SBM in diets
increased, but there were no significant differences in all
parameters between nonGM and GM SBM groups at the
same inclusion level (P [ 0.05). There were no significant
differences in feed efficiency (FE) and protein retention
(PR) between nonGM and GM SBM groups. The results of
the two-way ANOVA demonstrated that the different SBM
types resulted in no significant difference in WG, SGR, FE,
and PR (Table 4). Average fish weight continuously
increased throughout the experiment. Experimental diets
were well accepted by the fish, with no observed rejection,
and all fish fed actively during the entire experiment. Fish
showed 100% survival in all treatments and were not significantly affected by dietary levels of SBM. The general
health and appearance of all test fish were good, and the
fish in all treatments were very active.

Fish Sci (2010) 76:111117

115

Table 4 Growth and feed performance in common carp fed diets with different levels of nonGM and GM SBM for 12 weeks (mean standard
error)
Treatment performance
parameters

Experimental diets
NonGM SBM
34%

P value
NonGM SBM
48%

GM SBM
34%

GM SBM 48%

SBM
types

Inclusion
levels

SBM type 9
inclusion levels

Initial body weight (g)

21.9 0.3

22.1 0.4

22.0 0.4

22.2 0.4

Final body weight (g)

105 3.8

91.7 4.8

108 4.8

87.6 4.1

WGa

82.8 1.8a

69.7 4.9b

85.6 6.6a

65.4 1.1b

NS

\0.05

NS

SGR

1.9 0.0a

1.7 0.0b

1.9 0.1a

1.6 0.0b

NS

\0.05

NS

FEc

0.9 0.0bc

1.0 0.0a

0.9 0.0c

1.0 0.0ab

NS

\0.05

NS

PERd

2.8 0.0b

2.7 0.1c

3.1 0.0a

2.8 0.1b

\0.05

\0.05

NS

46.6 0.3ab

43.3 2.2b

49.4 0.0a

46.3 1.3ab

NS

NS

NS

PRe

Values (mean SE) in the same row followed by different letters are significantly different (P \ 0.05)
GM Genetically modified, SBM soybean meal
a
b

Weight gain (WG) (g) = final body weight (FW) (g) - initial body weight (IW) (g)
Specific growth rate (SGR) (% body weight/day) = [(ln FW (g) - ln IW (g))/duration of feeding trial (days)] 9 100

Feed efficiency (FE) (g/g) = Weight gain (g)/feed intake (g)

Protein efficiency ratio (PER) (g/g) = Weight gain (g)/protein intake (g)

Protein retention (PR) (%) = 100 9 [(FW 9 final body protein) - (IW 9 initial body protein)]/(feed intake 9 feed protein)

Whole-body composition
Whole-body crude protein, crude lipid, and ash contents
were higher in all experimental groups when compared to
the initial status (Table 5). There were no significant differences in whole-body proximate composition among the
treatments.
Detection of the CaMV 35S promoter fragment
All investigated fish muscle and blood samples were
positive for b-actin expression (Figs. 1, 2). In addition, a
strong positive signal of the CaMV 35S promoter fragment
was only detected in the GM SBM diets. The CaMV 35S
promoter fragment was never detected in either muscle or
blood samples (Figs. 1, 2).

Discussion
The present results showed no difference in the chemical
composition of GM and nonGM SBM. Whole-body composition of common carp was not affected by either
inclusion level or type of SBM. Based on these findings, it
is concluded that SBM prepared from glyphosate-tolerant
soybeans is equivalent to nonGM SBM with regard to the
chemical composition.
The results of this study show that growth performance
and feed utilization of common carp fed diets containing
GM SBM were similar to those fed nonGM SBM diet.
Sissener et al. [17] reported that fish fed diets containing

Table 5 Whole-body composition (% wet weight) of common carp

fed diets with different levels of nonGM and GM SBM for 12 weeks
Crude
protein

Crude
lipid

Crude
ash

Moisture

Initial

14.8 0.0

3.3 0.1

2.4 0.0 79.2 0.0

NonGM SBM
34%

16.2 0.2

6.5 0.1

2.8 0.0 73.6 1.2

NonGM SBM
48%

16.0 0.1

6.3 0.3

2.8 0.1 74.0 0.7

GM SBM 34%

15.8 0.1

7.0 0.2

2.5 0.1 74.2 0.3

GM SBM 48%

16.0 0.2

5.8 0.2

2.8 0.1 74.8 0.4

GM Genetically modified, SBM soybean meal

The whole body included the rest of the fish after a small dorsal
muscle sample and blood samples were taken

either GM or nonGM SBM had similar nutritional and

growth status. These results are also in agreement with
previous studies reported in other species such as catfish
[7], Atlantic salmon [8, 9, 18, 19], rainbow trout [10], and
Nile tilapia [11]. This similar growth performance is a
result of similar feed composition using either GM or
nonGM soybeans given to the experimental fish. It is
concluded that GM SBM is equivalent to nonGM SBM
based on its ability to support good growth of common
carp.
Regarding the foreign DNA investigation, a fragment of
the CaMV 35S promoter was not detected in the muscle
samples of fish fed GM SBM diets. Our results are consistent with findings in Atlantic salmon [8], where the GM

123

116
Fig. 1 Detection of CaMV 35S
promoter fragments in muscle
samples of common carp fed
GM SBM diets at the end of the
twelfth week. M 100 bp DNA
marker, - control without
DNA, ? GM SBM diet, 110
individual common carp
samples

Fish Sci (2010) 76:111117

34% GM SBM
-actin
48% GM SBM
M

10

34% GM SBM
CaMV 35S
48% GM SBM
M

Fig. 2 Detection of CaMV 35S

promoter fragments in blood
samples of common carp fed
GM SBM diets at the end of
twelfth week. M 100 bp DNA
marker, - control without
DNA, ? GM SBM diet, 110
individual common carp
samples

10

34% GM SBM
-actin
48% GM SBM
M

10

34% GM SBM
CaMV 35S
48% GM SBM
M

soy DNA fragment was never detected in the muscle of

Atlantic salmon fed a GM SBM-based diet. We assume
that most foreign DNA was rapidly degraded to fragments
smaller than 180 bp in the digestive tract, being below the
level of detection. It is estimated that inclusion level of GM
SBM in the diet, degradation of DNA in the digestive tract,
or degradation of DNA in the tissues after absorption from
the digestive tract could affect detection of the promoter
DNA fragment in muscle and blood samples of fish that
consumed GM SBM diets. In previous studies, the CaMV
35S promoter fragment was detected in the muscle of
rainbow trout fed diets containing 15% GM SBM [8]. The
CaMV 35S promoter fragment was also detected in the
muscle of Nile tilapia fed diets containing 34 and 48% GM
SBM [11]. In apparent contrast, CaMV 35S promoter
fragment was not detected in the muscle of common carp
fed 48% GM SBM diet. This inclusion level of GM SBM
in the diet is as high as the maximum level of inclusion that
has ever been tested in fish. Chainark et al. [8] detected the
CaMV 35S promoter fragments in the muscle of rainbow
trout that consumed a diet including 15% GM SBM, a
much lower content compared to that which we tested for
common carp. If the inclusion level of GM SBM in the diet
is the critical factor for transfer of recombinant DNA in fish
muscle, CaMV 35S promoter fragment should have been
detected in the present study. These results suggest that

123

10

inclusion level is not the defining factor for detection of

foreign DNA in fish muscle.
It is important that differences in digestive physiology
among the species tested should be taken into consideration. Rainbow trout and Nile tilapia are gastric fish,
whereas common carp is an agastric fish. In rainbow trout
and Nile tilapia, virus promoter fragment was detected in
the muscles. Therefore, it should be pointed out that the
existence of a stomach in the digestive system in tested fish
and the detection of the virus promoter fragment in the
muscle is well-correlated. These findings suggest that the
stomach is not able to degrade the CaMV 35S promoter
fragment in the digestive system in fish. It is unclear why
the CaMV 35S promoter fragment in the blood and muscle
of carp consumed GM SBM diets could not be detected.
The presence of DNase in the hepatopancreas of carp has
been reported [20]. Krawczenko et al. [21] reported that
carp hepatopancreatic DNase has the ability to digest both
native and denatured DNA. It is hypothesized that DNase
secreted from the pancreas would digest DNA in the diet
and eventually degrade DNA in the digestive tract of
common carp.
In conclusion, the results obtained in this study demonstrate that GM SBM in the diet did not adversely affect
growth and feed efficiency of common carp. The promoter
fragments were not detected in either the muscle or blood

Fish Sci (2010) 76:111117

117

samples of fish fed GM SBM diets, suggesting the suitability and safety of GM SBM in common carp diets.
Acknowledgments The authors are grateful to the Japanese Ministry of Education, Culture, Sports, Science, and Technology (MEXT)
for the scholarship grant extended to Indra Suharman. This study was
financially supported in part by a Grant-in-Aid for Scientific Research
from Japan MEXT (B, 19380121) to Shuichi Satoh.

10.

11.

12.

References
1. Hertrampf JW, Piedad-Pascual F (2000) Handbook on ingredients
for aquaculture feeds. Kluwer Academic, Dordrecht, pp 482483
2. Kok EJ, Kuiper HA (2003) Comparative safety assessment for
biotech crops. Trends Biotechnol 21:439444
3. Rott ME, Lawrence TS, Wall EM, Green MJ (2004) Detection
and quantification of Roundup Ready soy in foods by conventional and real-time polymerase chain reaction. J Agric Food
Chem 52:52235232
4. Padgette SR, Kolacz KH, Delannay X, Re DB, Lavallee BJ, Tinius CN, Rhodes WK, Otero YI, Barry GF, Eichholtz DA, Peschke VM, Nida DL, Taylor NB, Kishore GM (1995)
Development, identification and characterization of a glyphosatetolerant soybean line. Crop Sci 35:14511461
5. James C (2005) Executive summary of global status of commercialized biotech/GM crops: 2005. ISAAA briefs no. 34.
ISAAA, Ithaca
6. Schauzu M (2000) The concept of substantial equivalence in
safety assessment of foods derived from genetically modified
organisms. AgBiotechNet 2(044):14
7. Hammond B, Vicini JL, Hartnell GF, Naylor MW, Knight CD,
Robinson EH, Fuchs RL, Padgette SR (1996) The feeding value
of soybeans fed to rats, chickens, catfish and dairy cattle is not
altered by genetic incorporation of glyphosate tolerance. J Nutr
126:717727
8. Sanden M, Bruce IJ, Rahman MA, Hemre G (2004) The fate of
transgenic sequences present in genetically modified plant products in fish feed, investigating the survival of GM soybean DNA
fragments during feeding trials in Atlantic salmon, Salmo salar L.
Aquaculture 237:391405
9. Hemre GI, Sanden M, Bakke-McKellep MA, Sagstad A, Krogdahl A (2005) Growth, feed utilization and health of Atlantic

13.
14.

15.

16.
17.

18.

19.

20.

21.

salmon (Salmo salar L.) fed genetically modified compared to

non-modified commercial hybrid soybeans. Aquac Nutr 11:157
167
Chainark P, Satoh S, Tokuya H, Viswanath K, Hirono I, Aoki T
(2006) Availability of genetically modified soybean meal in
rainbow trout (Oncorhynchus mykiss) diets. Fish Sci 72:1072
1078
Suharman I, Satoh S, Haga Y, Takeuchi T, Endo M, Hirono I,
Aoki T (2009) Utilization of genetically modified soybean meal
in Nile tilapia Oreochromis niloticus diets. Fish Sci 74:967973
Ran T, Mei L, Lei W, Aihua L, Ru H, Jie S (2009) Detection of
transgenic DNA in tilapias (Oreochromis niloticus, GIFT strain)
fed genetically modified soybeans (Roundup Ready). Aquac Res
40:13501357
Wilson RP (1994) Utilization of dietary carbohydrate by fish.
Aquaculture 124:6780
Takeuchi T (1988) Chemical evaluation of dietary nutrients. In:
Watanabe T (ed) Fish nutrition and mariculture. Japan International Cooperation Agency (JICA), Kanazawa, pp 79228
Folch J, Lee M, Stanley GHS (1957) A simple method for the
isolation and purification of total lipids from animal tissues. J
Biol Chem 226:497507
Murray M, Thompson W (1980) Rapid isolation of high-molecular-weight plant DNA. Nucleic Acids Res 8:43214325
Sissener NH, Sanden M, Bakke AM, Krogdahl A, Hemre GI
(2009) A long term trial with Atlantic salmon, Salmo salar L. fed
genetically modified soy; focusing general health and performance before, during and after the parr-smolt transformation.
Aquaculture 284:108117
Sanden M, Berntssen MH, Krogdahl A, Hemre GI, BakkeMckellep AM (2005) An examination of the intestinal tract of
Atlantic salmon, Salmo salar L. parr fed different varieties of soy
and maize. J Fish Dis 28:317330
Sanden M, Krogdahl A, Bakke-Mckellep AM, Buddington RK,
Hemre GI (2006) Growth performance and organ development in
Atlantic salmon, Salmo salar L. parr fed genetically modified
(GM) soybean and maize. Aquac Nutr 12:112
Malicka-Blaszkiewicz M, Majcher I, Nowak D (1994) DNase Ilike enzyme from the carp liver-inhibition by muscle and
endogenous actin. Int J Biochem 26:11471155
Krawczenko A, Ciszak L, Malicka-Blaszkiewicz M (2005) Carp
liver DNase-isolation, further characterization and interaction
with endogenous actin. Comp Biochem Physiol 140B:141151

123