Professional Documents
Culture Documents
Research article
abstract
articleinfo
Article history:
Received 4 April 2014
Accepted 14 August 2014
Available online 23 August 2014
Keywords:
Antioxidative enzyme
Drought
Hevea brasiliensis
Osmoregulation
Photosynthesis
Reactive oxygen species
Plant drought stress response and tolerance are complex biological processes. In order to reveal the
drought tolerance mechanism in rubber tree, physiological responses and expressions of genes involved
in energy biosynthesis and reactive oxygen species (ROS) scavenging were systematically analyzed
following drought stress treatment. Results showed that relative water content (RWC) in leaves was
continuously decreased with the severity of drought stress. Wilting leaves were observed at 7 day
without water (dww). Total chlorophyll content was increased at 1 dww, but decreased from 3 dww.
However, the contents of malondialdehyde (MDA) and proline were signicantly increased under
drought stress. Peroxidase (POD) and superoxide dismutase (SOD) activities were markedly enhanced at
1 and 3 dww, respectively. Meanwhile, the soluble sugar content was constant under drought stress.
These indicated that photosynthetic activity and membrane lipid integrity were quickly attenuated by
drought stress in rubber tree, and osmoregulation participated in drought tolerance mechanism in
rubber tree. Expressions of energy biosynthesis and ROS scavenging systems related genes, including
HbCuZnSOD, HbMnSOD, HbAPX, HbCAT, HbCOA, HbATP, and HbACAT demonstrated that these genes were
signicantly up-regulated by drought stress, and reached a maximum at 3 dww, then followed by a
decrease from 5 dww. These results suggested that drought stress adaption in rubber tree was governed
by energy biosynthesis, antioxidative enzymes, and osmoregulation.
2014 Elsevier Masson SAS. All rights reserved.
1. Introduction
Water decit is a major constraint to plant growth and productivity (Monclus et al., 2006). Prolonged drought stress leads to
severe problems, such as decrease in water ux, closing of stomata
and reduction in carbon dioxide xation. Tree can die of both hydraulic failure and carbon starvation during drought stress (Zeppel
et al., 2013). Inhibition of photosynthesis and energy dissipation are
common features under drought stress in many plant species,
which reect as Photosystem II thermostability and electron
transport changes (Zhou et al., 2007; Brestic et al., 2012; Yan et al.,
2013; Zivcak et al., 2014). Plant anti-drought characters are mainly
244
Chlorophyll was extracted with 80% ice cold acetone from 0.1 g
leaves samples. The extract was measured spectrophotometrically
at 475, 645 and 663 nm with spectrophotometer (GE Ultrospec
2100 pro UV/visible, USA), respectively. Specic chlorophyll and
MDA content was determined by the thiobarbituric acid reaction (Peever and Higgins, 1989). 1.0 g freshleaves sample was homogenized in 5 ml 0.1% (w/v) trichloroacetic acid (TCA). The
homogenate was centrifuged at 10 000 g for 5 min and 4 ml of 20%
TCA containing 0.5% (w/v) thiobarbituric acid (TBA) were added to
1 ml of the supernatant. The mixture was heated at 95 C for 30 min
and then quickly cooled on ice. The contents were centrifuged at
10 000 g for 15 min and absorbance of the supernatant at 532 and
600 nm was read. After subtracting the non-specic absorbance at
600 nm, the MDA concentration was determined by its extinction
coefcient of 155 mM1 cm1.
2
.
7
.
D
e
t
245
Fig. 1. Relative water content in rubber tree GT1 seedling leaves after withholding
water Values represent the mean SD of 6 replicate samples tested in replicate.
3. Results
3.1. The effect of drought stress on relative water, chlorophyll, and
Table 1
Information of primers used in this study.
Genes
Accession
number
HbCOA
AY461413
HbACAT
AF429387
HbAPX
AF457210
HbATP
X58498
HbCAT
AF151368
HbCuZnSOD
AF457209
HbMnSOD
L11707
HbRbsS
M60274
Hb18SRNA
Reverse: TTCAGCCTTGCGACCATA
AY435212
Forward: GGTGACATGGTGGTGAAT
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
TGAAGTGACGAATGAGGTAA
GAGTATCCAGTTAGGCATCA
CTAGTGAATCATGTCCAAGTC
CCAACTGACACCGTTCTT
CAGCACCATCCTCTACATC
GCTTCACGCAGACTATTATC
TAGAGGATGGAGATGAGGAA
GGTATTGTGGTTCCTGGTAT
ATGGTGATTGTTGTGATGAG
GTCCAACCACCGTAACTG
GCCATCATCACCAACATTG
TGTGCTGTAATGTTGACCTA
GTTCACCTGTAAGTAGTATGC
GCCAAGGAAGTTGAATACC
CCAGTAACGACCATCATAGT
GCTCGAAGACGATCAGATACC
Reference
Amplication
Amplication
length (bp)
efciency
145
1.872 0.0183
119
1.918 0.0099
Direct submission
164
1.815 0.0067
112
1.809 0.0079
153
1.877 0.0093
Direct submission
200
1.901 0.0109
Direct submission
128
1.873 0.00139
123
1.794 0.0256
146
2.062 0.011
Direct submission
b, and Chl a/b were resulted by the degradation of chlorophylleprotein complex under severe drought condition. The b-Car
content was increased slightly at 1 dww, but quickly decreased from
3 dww (Fig. 2). These results suggested that b-Car did not take part in
quenching excess excited energy after chlorophylleprotein complex
broken down under drought stress in rubber tree.
3.2. The effect of drought stress on membrane oxidation and
osmosis indices
Since MDA, a cytotoxic product of lipid peroxidation is generally
taken as an index of ROS level. Therefore, the change of MDA
Fig. 3. Changes of physiological indices in rubber tree after withholding water Values represent the mean SD of 6 replicate samples tested in replicate. Bars with different
uppercase letters show signicant differences at the P < 0.01 level
.
247
L.-f. Wang / Plant Physiology and Biochemistry 83 (2014) 243e249
Fig. 4. Expressions of ROS scavenging systems related genes HbAPX, HbCAT, HbCuZnSOD, and HbMnSOD after withholding water Values represent the mean SD of two
biological replicates tested in triplicate. Bars with different uppercase letters show signicant differences at the P < 0.01 level.
Fig. 5. Expressions of energy biosynthesis related genes HbCOA, HbATP, HbRbsS, and HbACAT after withholding water Values represent the mean SD of two biological
replicates tested in triplicate. Bars with different uppercase letters show signicant differences at the P < 0.01 level.
Acknowledgments
which mainly takes part in fatty acid and amino acid metabolism.
Drought inuenced mitochondria function since decreases of
HbATP, HbCOA and HbACAT transcripts were occurred from 3 to
5 dww (Fig. 5.). These suggested that drought induced several
metabolism pathways synchronously but rst inhibited energy
formation.
ROS may play two different roles: exacerbating damage or
activating defense responses. The numerous ROS generation
sources and complex scavenging systems provide the exibility
necessary for these functions (Dat et al., 2000). Mitochondria is
an important place for ROS production in cell (Mller, 2001). The
intimate relationship between antioxidant enzyme activities and
drought stress were found in woody plant in karst habitats in
Southern China. Transcripts of CAT, MnSOD, and CuZnSOD are
likely to reecting the ability of mitochondria to scavenging ROS
and delaying the aging process. In this study, we found that the
changes of ROS scavenging related genes expressions was tightly
related to the changes of corresponding enzymes activities.
MnSOD is an integral mitochondrial protein known as a rst-line
antioxidant defense against superoxide radical anions produced
as by-products of the electron transport chain. In our study,
HbMnSOD gene expression was later than that of HbCuZnSOD
gene expression. These suggested that HbCuZnSOD was more
important for drought resistance in rubber tree clone GT1, which
was similar with previous study in rubber tree clone PB260
(Leclercq et al., 2012).
5. Conclusion
Taken together, these results suggested that rubber tree seedling
was susceptible to drought stress, and the protection role of
physiological and molecular responses only lasted for 3e5 days
after withholding water. Moreover, adaptation to drought stress
was a complex process involved in osmoregulation, antioxidative
enzymes and energy biosynthesis related genes in mitochondria
and chloroplasts in rubber tree seedling.
Contributions
Conceived and designed the experiments: LF Wang. Performed
the experiments: LF Wang. Analyzed the data: LF Wang. Wrote the
paper: LF Wang.
References
Ahamad, B., 1999. Effect of rootstock on growth and water use efciency of Hevea
during water stress. J. Rubber Res. 2, 99e119.
Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and
signal transduction. Annu. Rev. plant biol. 55, 373e399.
Asada, K., 2006. Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol. 141, 391e396.
Ayutthaya, S.I.N., Do, F.C., Pannangpetch, K., Junjittakarn, J., Maeght, J.-L.,
Rocheteau, A., Cochard, H., 2011. Water loss regulation in mature Hevea brasiliensis: effects of intermittent drought in the rainy season and hydraulic regulation. Tree physiol. 31, 751e762.
Bates, L.S., Waldren, R.P., Teare, I.D., 1973. Rapid determination of free proline for
water-stress studies. Plant Soil. 39, 205e207.
Bigras, F.J., 2005. Photosynthetic response of white spruce families to drought
stress. New. For. 29, 135e148.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal.
Biochem. 72, 248e254.
Brestic, M., Zivcak, M., Kalaji, H.M., Carpentier, R., Allakhverdiev, S.I., 2012. Photosystem II thermostability in situ: environmentally induced acclimation and
genotype-specic reactions in Triticum aestivum L. Plant physiol. Biochem. PPB/
Soc. francaise De. physiologie Veg. 57, 93e105.
Chye, M.L., Tan, C.T., 1992. Isolation and nucleotide sequence of a cDNA clone
encoding the beta subunit of mitochondrial ATP synthase from Hevea brasiliensis. Plant Mol. Biol. 18, 611e612.
Chye, M.L., Tan, S., Tan, C.T., Kush, A., Chua, N.H.i., 1991. Nucleotide sequence of a
cDNA clone encoding the precursor of ribulose-1, 5-bisphosphate carboxylas
249
L.-f. Wang / Plant Physiology and Biochemistry 83 (2014) 243e249
small subunit from Hevea brasiliensis (rubber tree). Plant Mol. biol. 16,
1077e1078.
Couee, I., Sulmon, C., Gouesbet, G., El Amrani, A., 2006. Involvement of soluble
sugars in reactive oxygen species balance and responses to oxidative stress in
plants. J. Exp. bot. 57, 449e459.
Creelman, R.A., Mason, H.S., Bensen, R.J., Boyer, J.S., Mullet, J.E., 1990. Water decit
and abscisic acid cause differential inhibition of shoot versus root growth in
soybean seedlings: analysis of growth, sugar accumulation, and gene expression. Plant Physiol. 92, 205e214.
Dat, J., Vandenabeele, S., Vranova, E., Van Montagu, M., Inze, D., Van Breusegem, F.,
2000. Dual action of the active oxygen species during plant stress responses.
Cell. Mol. life Sci. : CMLS 57, 779e795.
Deng, L.H., Luo, M.W., Zhang, C.F., Zeng, H.C., 2012. Extraction of high-quality RNA
from rubber tree leaves. Biosci. Biotechnol. Biochem. 76, 1394e1396.
Devakumar, A., Gururaja Rao, G., Rajagopal, R., Sanjeeva Rao, P., George, M.,
Vijayakumar, K., Sethuraj, M., 1988. Studies on soil-plant-atmosphere system in
Hevea: II. Seasonal effects on water relations and yield. Indian J. Nat. Rubber Res.
1, 45e60.
Dhindsa, R.S., Plumb-Dhindsa, P., Thorpe, T.A., 1981. Leaf senescence: correlated
with increased levels of membrane permeability and lipid peroxidation, and
decreased levels of superoxide dismutase and catalase. J. Exp. bot. 32, 93e101.
Gonalves, P.d.S., Aguiar, A.T.d.E., Costa, R.B.d., Gonalves, E.C.P., Scaloppi Jnior, E.J.,
Branco, R.B.F., 2009. Genetic variation and realized genetic gain from
rubber
tree improvement. Sci. Agric. 66, 44e51.
Gururaja Rao, G., Devakumar, A., Rajagopal, R., Annamma, Y., Vijayakumar,
K.,
Sethuraj, M., 1988. Clonal variations in leaf epicuticular waxes and
reectance:
possible role in drought tolerance in Hevea. Indian J. Nat. Rubb Res. 1,
84e87.
Hoekstra, F.A., Golovina, E.A., Buitink, J., 2001. Mechanisms of plant
desiccation
tolerance. Trends Plant Sci. 6, 431e438.
Huang, Z.D., Pan, Y.Q., 1992. Rubber Cultivation Under Climatic Stresses in
China.
Elsevier, Amsterdam.
Leclercq, J., Martin, F., Sanier, C., Cle ment-Vidal, A., Fabre, D., Oliver, G.,
Lardet, L.,
Ayar, A., Peyramard, M., Montoro, P., 2012. Over-expression of a cytosolic
isoform of the HbCuZnSOD gene in Hevea brasiliensis changes its response
to a
water decit. Plant Mol. Biol. 80, 255e272.
Li, Y., Zhao, H.X., Duan, B.L., Korpelainen, H., Li, C.Y., 2011. Effect of drought
and ABA
Monclus, R., Dreyer, E., Villar, M., Delmotte, F.M., Delay, D., Petit, J.M., Barbaroux, C.,
on growth, photosynthesis and antioxidant system of Cotinus coggygria seedLe Thiec, D., Brechet, C., Brignolas, F., 2006. Impact of drought on productivity
lings under two different light conditions. Environ. Exp. Bot. 71, 107e113.
and water use efciency in 29 genotypes of Populus deltoides x Populus nigra.
Lichtenthaler, H.K., 1987. Chlorophylls and carotenoids: Pigments of photosynthetic
New. Phytol. 169, 765e777.
biomembranes. Methods Enzymol. 148, 350e382.
Luo, P., He, J.J., Yao, Y.L., Dai, X.H., Cheng, R.X., Wang, L.F., 2012. Differential responses Nair, D.B., Dey, S.K., Rajagopal, R., Vijayakumar, K.R., Sethuraj, M.R., 1996. Synergistic
effect of heat and osmotic stress in causing membrane injury in Hevea brasiof two rubber tree clones to chilling stress. Afr. J. Biotechnol. 11, 13466e13471.
liensis. J. Plant Biol. 39, 177e181.
Mai, J., Herbette, S., Vandame, M., Kositsup, B., Kasemsap, P., Cavaloc, E., Julien, J.L.,
Peever, T.L., Higgins, V.J., 1989. Electrolyte leakage, lipoxygenase, and lipid peroxiAme glio, T., Roeckel-Drevet, P., 2009. Effect of chilling on photosynthesis and
dation induced in tomato leaf tissue by specic and nonspecic elicitors from
antioxidant enzymes in Hevea brasiliensis Muell. Arg. Trees 23, 863e874.
Cladosporium fulvum. Plant Physiol. 90, 867e875.
Miao, Z.H., Gaynor, J.J., 1993. Molecular cloning, characterization and expression of
Priyadarshan, P.M., Hoa, T.T.T., Huasun, H., de Gonalves, P.S., 2005. Yielding poMn-superoxide dismutase from the rubber tree (Hevea brasiliensis). Plant Mol.
tential of rubber (Hevea brasiliensis) in sub-pptimal environments. J. Crop
Biol. 23, 267e277.
Improv. 14, 221e247.
Mller, I.M., 2001. Plant mitochondria and oxidative stress: electron transport,
Qin, B., 2013. The function of Rad6 gene in Hevea brasiliensis extends beyond DNA
NADPH turnover, and metabolism of reactive oxygen species. Annu. Rev. Plant
repair. Plant physiol. Biochem. PPB/Soc. francaise De. physiologie Veg. 66,
Biol. 52, 561e591.
134e140.
Ranasinghe, M.S., Milburn, J.A., 1995. Xylem conduction and cavitation in Hevea
brasiliensis. J. Exp. bot. 46, 1693e1700.
Reddy, Y., 2000. Effect of moisture stress on stability of membrane integrity in
Hevea brasiliensis across temperature regimes. Indian J. For. 23, 110e111.
Rhodes, D., Hanson, A., 1993. Quaternary ammonium and tertiary sulfonium compounds in higher plants. Annu. Rev. Plant Biol. 44, 357e384.
Shao, H.B., Liu, Z.H., Zhang, Z.B., Chen, Q.J., Chu, L.Y., Brestic, M., 2013. Biological
roles of crop NADP-malic enzymes and molecular mechanisms involved in
abiotic stress. Afr. J. Biotechnol. 10, 4947e4953.
Webster, C.C., Baulkwill, W.J., 1989. Rubber. Longman scientic & technical.
Yan, K., Shao, H., Shao, C., Chen, P., Zhao, S., Brestic, M., Chen, X., 2013. Physiological adaptive mechanisms of plants grown in saline soil and implications
for sustainable saline agriculture in coastal zone. Acta Physiol. Plant. 35,
2867e2878.
Zeppel, M.J., Anderegg, W.R., Adams, H.D., 2013. Forest mortality due to drought:
latest insights, evidence and unresolved questions on physiological pathways
and consequences of tree death. New. phytol. 197, 372e374.
Zhou, Y.H., Lam, H.M., Zhang, J.H., 2007. Inhibition of photosynthesis and energy
dissipation induced by water and high light stresses in rice. J. Exp. Bot. 58,
1207e1217.
Zhou, G.A., Chang, R.Z., Qiu, L.J., 2010. Overexpression of soybean ubiquitinconjugating enzyme gene GmUBC2 confers enhanced drought and salt tolerance through modulating abiotic stress-responsive gene expression in Arabidopsis. Plant Mol. Biol. 72, 357e367.
Zhou, M.L., Ma, J.T., Zhao, Y.M., Wei, Y.H., Tang, Y.X., Wu, Y.M., 2012. Improvement of
drought and salt tolerance in Arabidopsis and Lotus corniculatus by overexpression of a novel DREB transcription factor from Populus euphratica. Gene
506, 10e17.
Zhu, J.K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev.
Plant Biol. 53, 247e273.
Zivcak, M., Kalaji, H.M., Shao, H.B., Olsovska, K., Brestic, M., 2014. Photosynthetic
proton and electron transport in wheat leaves under prolonged moderate
drought stress. J. Photochem. Photobiol. B Biol. 137, 107e115.