You are on page 1of 175

4

biologa
y geologaSolucionario

MADRID barcelona BUENOS AIRES CARACAS GUATEMALA LISBOA MXICO


NUEVA YORK PANAM SAN JUAN SANTAF DE BOGOT SANTIAGO SO PAULO
AUCKLAND HAMBURGO LONDRES MILN MONTREAL NUEVA DELHI PARS
SAN FRANCISCO SIDNEY SINGAPUR ST. LOUIS TOKIO TORONTO

http://www.mcgraw-hill.es

crDiToS

biologa y geologa 4 eSo SoluCionario


no est permitida la reproduccin total o parcial de este libro, ni su tratamiento informtico, ni la transmisin de ninguna forma o por cualquier medio, ya sea electrnico,
mecnico, por fotocopia, por registro u otros mtodos, sin el permiso previo y por escrito
de los titulares del copyright.

derechos reservados 2008, respecto a la primera edicin en espaol, por:

McGraw-Hill/interamericana de Espaa, S.a.u.


Edicio Valrealty, 1. planta
Basauri, 17
28023 aravaca (Madrid)

iSbn: 978-84-481-6309-9
depsito legal:
autores del solucionario del libro del alumno: carlos chapela otero,
Javier lpez Bermdez, Margarita Gonzlez Sabater
autores del solucionario de las adaptaciones: concepcin de Juana Magaa
(Madrid), Esperanza aguilera lpez-Font, M. del Mar Garca Ponce, M. Dolores
Medel Soteras (andaluca), scar Pareja Serna (Valencia)
autores del solucionario de la gua didctica: Esther Snchez Falillas,
Marco de Mesa cceres
autores del solucionario de atencin a la diversidad: concepcin de Juana
Magaa, Francisco Teixid Gmez, Jos antonio Snchez Surez
equipo editorial: alfredo Horas de Prado, Mercedes Heras novillo, anna Katarina Victoria, Julia Valiente Garrido, Marta Hijosa Torices
equipo de preimpresin: Eduardo Mrquez Daz, Mara ngeles ramrez ruiz,
claudia Fernndez alberdi, luis Hernndez andrs
diseo de cubierta: islagraca.com
diseo de interior: Germn alonso
maquetacin: artesa
ilustraciones artsticas: ngel ovejero ovejero, Sergio Guinot aledo, Julia Valiente
Garrido
ilustraciones tcnicas: ngel ovejero ovejero, Sergio Guinot aledo, David Guinot
aledo, Sergio Vilar Peris
Fotografas: age, Joseph M. Barres, cover, Flix ngel romera Garca, Getty
impresin:

imPreSo en eSPaa - PrinTed in SPain

SuMario
SoluCionario libro del alumno

unidad 4. la clula, unidad de vida ....100

unidad 1. Dinmica terrestre: la deriva


continental .............................. 6

unidad 5. Genes y herencia .................103

unidad 2. la tectnica de placas...........13

unidad 6. la evolucin
de la biologa .......................108

unidad 3. la historia de la Tierra .......... 20


unidad 4. la clula, unidad de vida ......28
unidad 5. Genes y herencia ...................35
unidad 6. la evolucin de la biologa ....42
unidad 7. la materia y la energa
en los ecosistemas ..................48
unidad 8. El equilibrio de los
ecosistemas ........................... 55
unidad 9. la evolucin
de los seres vivos ....................62

unidad 7. la materia y la energa


en los ecosistemas ................ 116
unidad 8. El equilibrio
de los ecosistemas ................126
unidad 9. la evolucin
de los seres vivos .................. 137
SoluCionario
aTenCin a la diVerSidad
unidad 1. Dinmica terrestre:
la deriva continental ............150
unidad 2. la tectnica de placas......... 152

SoluCionario adaPTaCioneS

unidad 3. la historia de la Tierra .........154

Comunidad de madrid ..........................70

unidad 4. la clula, unidad de vida ....156

andaluca ..............................................74

unidad 5. Genes y herencia ................. 158

Comunidad de Valencia ....................... 80

unidad 6. la evolucin
de la biologa .......................160

SoluCionario gua didCTiCa

unidad 7. la materia y la energa


en los ecosistemas ................ 162

unidad 1. Dinmica terrestre:


la deriva continental ..............82
unidad 2. la tectnica de placas...........92
unidad 3. la historia de la Tierra ...........96

unidad 8. El equilibrio
de los ecosistemas ................ 165
unidad 9. la evolucin
de los seres vivos .................. 168

Solucionario

libro
del alumno

DINMICA TERRESTRE:
LA DERIVA CONTINENTAL

QU SABES DE...?

1 Te has fijado alguna vez en el parecido existente


entre las costas atlnticas de frica y Sudamrica? Qu
explicacin le daras?
El parecido se debe a que hace millones de aos ambos continentes estuvieron unidos.
2 Cul pudo ser la causa por la que se formaron cordilleras como el Himalaya o los Andes?
Se trata de que se cuestionen por qu se formaron las
cordilleras y planteen alguna hiptesis. Bastara con que
contestaran que se debe al movimiento y choque de los continentes.
3 Cmo se ha podido conocer la composicin del interior de la Tierra?
Mediante mtodos directos, como estudios de muestras
procedentes de minas, sondeos, afloramientos de rocas, e
indirectos, como el estudio del movimiento de las ondas ssmicas, magnetismo, meteoritos
4 Di si estas frases son verdaderas o falsas:
a) La corteza continental es ms densa que la corteza
ocenica.

b) La litosfera es una capa de la Tierra que abarca la corteza


y parte del manto.

c) Endosfera y ncleo son dos trminos equivalentes.

d) Los continentes se mueven horizontal


y verticalmente.

ACTIVIDAD INICIAL
LA SILUETA DE LOS CONTINENTES
Observa una hoja de un mapamundi fsico y vers el parecido entre la costa oriental de Sudamrica y la occidental de frica. Para comprobar cunto se parecen, recorta
ambos continentes y aproxmalos como si el ocano
Atlntico no existiera.

Crees que la semejanza entre ambas costas es pura


coincidencia?

Esta actividad pretende que los alumnos vean por s mismos


lo que a Wegener le llev a elaborar su teora de la deriva continental y que a lo largo de la Unidad intenta demostrarse
con las distintas pruebas que aport y otras de las que hoy
disponemos.

Haz lo mismo con el continente norteamericano. Se


consigue encajarlo aproximadamente con Eurasia y
frica? Se trata de una nueva coincidencia? Si no es
as, qu cabe pensar respecto a estas semejanzas?

Aunque el acercamiento de Norteamrica no d un resultado


tan evidente como el anterior, s es suficiente como para descartar una simple coincidencia, lo que debera permitir a los
alumnos llegar a la conclusin de que todos esos continentes
estuvieron en el pasado reunidos en uno solo.

ACTIVIDADES
1 Explica las dos tendencias que surgieron en la discusin sobre el origen de las cordilleras.
Fijista: afirmaba que los continentes no han variado su posicin
desde el origen de la Tierra. Cuando sta se form se hallaba a
muy altas temperaturas y, al irse enfriando, se redujo su volumen
y esto habra dado lugar a las cordilleras, bien por arrugamiento de la corteza (contraccionismo) o bien por plegamiento de
grandes cuencas sedimentarias (geosinclinales).
Movilista: las masas continentales se desplazan horizontalmente, de manera que en pocas anteriores pudieron estar reunidos
en un solo continente. Al moverse, se plegaran y se elevaran
materiales hasta dar lugar a las alineaciones montaosas.
2 Qu dos circunstancias condujeron a la teora del
geosinclinal?
En primer lugar que las rocas que las forman mostrasen grandes
plegamientos y fracturas, y tambin que buena parte fueran
rocas sedimentarias (que adems contenan fsiles marinos).
3 Consigue un mapamundi fsico (o copia la silueta de
los continentes en tu cuaderno) y dibuja sobre l las franjas de tierra que seran necesarias para explicar la expansin de las siguientes especies segn la hiptesis fijista, de
la misma manera que ves para el caso del Mesosaurus.
a) Glossopteris (helecho fsil).
b) Los reptiles terrestres Lystrosaurus y Cynognatus.

4 Explica por qu la distribucin de seres vivos actuales


y fsiles es una prueba de que los continentes se han separado y de que en algn momento estuvieron juntos.
La existencia de fsiles de mbito terrestre en masas continentales separadas por miles de kilmetros de ocano indica
que cuando vivieron no exista esa separacin y los distintos
continentes eran un mismo territorio, ya que el ancestro comn del que surgen aparece en un nico lugar.

c) Por qu no se han dibujado las flechas en el continente antrtico?


Se ignora el movimiento de los hielos en la Antrtida porque
actualmente est cubierta por el casquete polar, lo cual no
permite estudiar las rocas de su superficie.
7 Resume los tres puntos principales de la deriva continental.

Al contrario, muchos seres vivos terrestres actuales son exclusivos de un solo continente, como por ejemplo la fauna
australiana, debido al aislamiento geogrfico que suponen
los ocanos circundantes.

Hace 200 millones de aos todos los continentes se hallaban


reunidos en una nica masa de tierra, Pangea, que se fragment 20 millones de aos despus, dando lugar con el paso
del tiempo a los continentes actuales.

5 Dibuja los yacimientos de diamantes de la Figura 1.6


sobre el mapamundi que utilizaste para la actividad inicial. Qu ocurre si unes los continentes de frica y Sudamrica? Qu deduccin nos permite extraer esto?

Los continentes flotan sobre el fondo ocenico y, en su desplazamiento, pliegan y elevan los materiales depositados en
l, formando de esta manera las cordilleras. Este movimiento
es causado por la rotacin de la Tierra y la atraccin gravitatoria de la Luna.
8 Por qu motivo no fue aceptada la teora de Wegener?
Porque el mecanismo que Wegener propona como causa del
movimiento no pareca suficiente para vencer el rozamiento
de los continentes con el fondo ocenico.
9 Explica las diferencias existentes entre los dos modelos de la estructura interna de la Tierra.
El modelo dinmico propone cuatro grandes capas, mientras que el esttico slo tres, cada una de las cuales subdividida en dos. La litosfera abarca toda la corteza y una
parte del manto superior. La astenosfera es el resto del
manto superior. La mesosfera sera el manto inferior. Finalmente, s coinciden en la capa ms interna, el ncleo
y la endosfera.

Los yacimientos existentes en frica encajan con los de Sudamrica, lo cual indica que se trata de yacimientos que se partieron en dos al separarse los continentes.
6 En los mapas anteriores, las flechas indican la direccin en que se mova el hielo. Esto se conoce gracias a las
estras dejadas por el hielo en las paredes y fondo de los
valles glaciares.
a) Cul es el motivo de que el sur de Pangea estuviera
ocupado por los hielos?
La razn es que Pangea se hallaba sobre el Polo Sur.

10 Adems de las discontinuidades de Mohorovicic


y Gutenberg, se han establecido otras menos evidentes que dividen a la corteza continental y al manto en
superior e inferior y al ncleo en externo e interno.
Consulta alguna fuente de informacin (por ejemplo
Internet o alguna enciclopedia) y averigua qu nombre
reciben.
Corteza superior
Corteza inferior
Manto superior

b) Dnde se hallara situado el Polo Sur aproximadamente?

Manto inferior

El Polo Sur estara situado aproximadamente en la costa sureste de frica, cerca de la isla de Madagascar.

Ncleo interno

Ncleo externo

discontinuidad de Conrad
discontinuidad de Mohorovicic
discontinuidad de Repetti
discontinuidad de Gutenberg
discontinuidad de Lehmann-Wiechert

DINMICA TERRESTRE:
LA DERIVA CONTINENTAL

11 Explica con tus propias palabras el significado del


concepto de isostasia.
Segn el principio de la isostasia, los continentes estn formados por rocas de menor densidad que las que componen
el manto. ste se halla en un estado de fusin, por lo que los
primeros flotan sobre el manto, como lo hace un iceberg en el
mar. El nivel de flotacin sube o baja segn los continentes
tienen ms o menos carga.
12 Imagina dos casos en los que un continente se mueva verticalmente hacia abajo, uno en relacin al vulcanismo y otro relacionado con las glaciaciones. Explcalos
detalladamente.
La lava procedente del interior de la Tierra, al depositarse
sobre la superficie, aumenta el peso del continente, que se
hundir en el manto para recuperar el equilibrio isosttico.
Las glaciaciones trasladan enormes cantidades de agua de
los ocanos encima de los continentes, en forma de nieve
que se transforma en hielo, el cual puede formar depsitos
de varios kilmetros de altura. El consiguiente aumento de
peso hunde tambin a los continentes dentro del manto.
13 Qu ocurrir en el futuro si se confirma el cambio
climtico actual por el que se espera un calentamiento
general del planeta?
El cambio climtico significara que la tasa de fusin de los
hielos sera mayor que la tasa de acumulacin en forma de
nieve, es decir, una retirada de los hielos que provocara un
nuevo levantamiento de los continentes, algo que ya se est
observando, por ejemplo, en la pennsula escandinava.
14 Encuentra el error en la frase: A medida que un continente gana masa por efecto de la erosin, se eleva para
alcanzar el equilibrio.
Un continente nunca pierde masa por efecto de la erosin,
ms bien al contrario, la erosin produce la prdida del material ms superficial del continente.
15 Explica segn la teora de la expansin del fondo
ocenico la causa de los siguientes hechos:
La actividad volcnica existente a lo largo de toda la
lnea media del ocano Atlntico.
A lo largo de esa zona se halla la dorsal centroatlntica que,
debido a su actividad volcnica, crea nuevo fondo ocenico
y, por tanto, es la responsable de la apertura del ocano.
Las rocas que forman los fondos ocenicos no superan
los 180 millones de aos.
La superficie de la Tierra permanece constante, por lo que,
a medida que pasa el tiempo, las rocas que forman el fondo
ocenico se alejan de la dorsal y llega un momento, unos 200
millones de aos ms tarde como mximo, en que se reintegran al manto al introducirse bajo la corteza continental.

La polaridad del campo magntico terrestre presenta


inversiones distribuidas en zonas paralelas a las dorsales y simtricas a un lado y otro de stas.
La lava que sale por la dorsal se dispone a los lados de sta y
las partculas de hierro que contienen se orientan respecto
del campo magntico terrestre.
Al invertirse la polaridad de ste, tambin cambia la orientacin de la nueva lava. Las inversiones ocurridas quedan
reflejadas en la lava en forma de bandas simtricas respecto
a la dorsal.
La distribucin de edades de las rocas que forman el
fondo ocenico.
Cuanto ms alejado de la dorsal, ms antiguo es el fondo
ocenico.
Los dos tipos de estructuras presentes en el relieve
submarino: las dorsales y las fosas ocenicas.
Las dorsales son grietas por las que sale lava procedente del
manto. En las fosas, la corteza ocenica se reintegra al manto
por subduccin.
La reduccin de grosor de la capa de sedimentos
del fondo ocenico al disminuir la distancia a las
dorsales.
Siguiendo el razonamiento anterior, cuanto ms antiguo es
el fondo ocenico, ms sedimentos se han podido acumular
sobre l.
16 El cientfico Arthur Holmes ya haba expuesto en
1944 las ideas bsicas de la expansin del fondo ocenico. As mismo, W. Morley haba avanzado en la misma
direccin que Vine y Matthews unos meses antes que
ellos. Qu comentario cabe hacer sobre el desarrollo
del conocimiento en la actualidad?
Actualmente, los datos cientficos estn a disposicin de todos los investigadores, por lo que es fcil que distintas personas o equipos lleguen a las mismas conclusiones ms o
menos al mismo tiempo en diferentes lugares.
Esto es mucho ms cierto desde la existencia de Internet, gracias a la cual se ponen a disposicin, no slo de los cientficos,
sino del pblico en general, datos e informes que pueden
servir como base para otras investigaciones.

ACTIVIDADES FINALES
PARA REPASAR
1 Comenta brevemente las tres teoras fijistas que se
desarrollaron en geologa para explicar la formacin de
las cordilleras.
Las tres teoras que se citan en la Unidad son:

Contraccionismo: la Tierra tuvo un origen caliente. A medida


que enfriaba sufri una reduccin de volumen, como ocurre
con cualquier cuerpo (al calentarse se dilatan y al enfriarse se
contraen). En consecuencia, la corteza, ya en estado slido,
se arrug.
Geosinclinal: son grandes zonas sumergidas, en las que
se acumulan kilmetros de espesor de sedimentos (que se
transforman en rocas sedimentarias) las que, al contraerse la
Tierra, se pliegan y elevan muy por encima del nivel del mar,
generando las cordilleras.
Puentes continentales: es un aadido a las anteriores,
que pretende explicar, mediante la supuesta existencia
de largos brazos de tierra que comunicaban entre s a los
continentes, la gran dispersin de seres vivos de mbito
terrestre.
2 Explica brevemente cada una de las evidencias con
las que Wegener apoy su teora de la deriva continental.
Evidencia geogrfica: la costa este de Sudamrica y la oeste
de frica tienen un perfil muy semejante.
Evidencia paleontolgica: el hallazgo de fsiles de organismos terrestres (reptiles, helechos) en continentes hoy separados por grandes ocanos.
Evidencia geolgica: cordilleras existentes a un lado del
ocano Atlntico que se continan al otro lado, terrenos formados por los mismos tipos de rocas y similares yacimientos
a ambos lados del ocano.
Evidencia paleoclimtica: glaciares en distintos continentes
del Hemisferio Sur y la India, que al reunirlos forman un nico
casquete glaciar.
3 Qu diferencia existe entre litosfera y astenosfera?
La litosfera tiene en general un comportamiento rgido: ante
las presiones o tensiones a las que se ve sometida se fractura.
El comportamiento de la astenosfera es plstico: ante los esfuerzos se deforma, debido a la alta temperatura a la que se
encuentran las rocas que la componen.
4 Dibuja en tu cuaderno un diagrama como el siguiente y nombra cada una de las capas de la Tierra representadas y la profundidad a la que se sita el lmite de cada
una.

5 Describe las estructuras que se hallaron al estudiar


el relieve del fondo ocenico.
Los mrgenes continentales, formados normalmente por
la plataforma continental, seguida de una zona de mayor
pendiente, llamada talud continental.
Las dorsales ocenicas, alineaciones de montaas que se
extienden por el planeta unos 70 000 kilmetros. Su eje
central est recorrido por un valle (rift), del que, de manera
intermitente, sale lava procedente del manto.
Las llanuras ocenicas profundas, que se extienden entre
los continentes y las dorsales, forman las llanuras abisales, a
ms de 4 000 metros de profundidad.
Las fosas ocenicas, regiones que, con una fuerte pendiente,
llegan hasta unos 11 000 metros de profundidad.
6 De qu manera puede conocerse la orientacin
del campo magntico terrestre actual y de pocas anteriores?
Para conocer la orientacin del campo magntico terrestre
actual basta con utilizar una brjula.
Para conocer el de pocas anteriores se estudia la orientacin
de las partculas de hierro de rocas (lavas, rocas sedimentarias) que se formaron en dichos momentos. Deben utilizarse
rocas de las que se tenga la seguridad de que no se desplazaron de su lugar de formacin.
7 Escribe y completa en tu cuaderno las siguientes
frases:
a) Segn el contraccionismo las cordilleras seran las arrugas de la corteza producidas al reducir la Tierra su volumen a medida que enfriaba.

DINMICA TERRESTRE:
LA DERIVA CONTINENTAL

b) Los puentes continentales habran unido en el pasado a


distintos continentes, lo que permiti que muchos seres
vivos pasaran de unos a otros fcilmente.
c) El Mesosaurus fue un reptil que viva en los ros, a pesar
de lo cual sus fsiles se han encontrado en dos continentes muy alejados: Surfrica y Sudamrica.

Se aprecia claramente la enorme delgadez de la capa ms


superficial, la corteza.
12 Observa el mapa de fondos ocenicos de las pginas
22 y 23 y explica qu diferencia existe entre los ocanos
Atlntico y Pacfico.

d) Las dorsales ocenicas son alineaciones montaosas


en cuyo eje central, recorrido por un valle, existe una
importante actividad volcnica.

El ocano Atlntico est recorrido en su lnea media por la


dorsal, causante, an en la actualidad, de su expansin. El
ocano Pacfico, en cambio, est circundado, casi en su totalidad, por reas de subduccin.

8 Explica por qu se producen corrientes de conveccin en el interior de la Tierra.

13 Copia el siguiente diagrama y nombra en l cada una


de las partes sealadas.

Se trata de corrientes de conveccin trmicas, ocasionadas


por diferencias de temperatura en el seno de materiales que
se comportan como fluidos debido a que se hallan parcialmente fundidos.
9 Copia en tu cuaderno este crucigrama y coloca en
l ocho palabras relacionadas con el movimiento de los
continentes.
G
A

O
I

S
I

P
D

F
C

S
A

N
D

E
A

14 Relaciona y ordena cronolgicamente en tu cuaderno a los cientficos, con sus afirmaciones en torno a la
distribucin de los continentes:

Francis Bacon

Repar en el parecido de las costas de frica


y Sudamrica.

Conde de Buffon

frica y Sudamrica pudieron estar unidas


alguna vez.

Pellegrini

Fue el primero en hablar de un continente


primitivo que se fragment en los actuales.

Alfred Wegener

Los continentes se deslizan sobre el fondo


ocenico.

Hess y Dietz

Los continentes son arrastrados por corrientes de conveccin del manto.

Vine y Matthews

Existe relacin entre la expansin del fondo


ocenico y las inversiones magnticas.

Tuzo Wilson

Propone la teora de la tectnica de placas.

PARA APLICAR
10 Qu dato permita a Wegener descartar que hace
300 millones de aos un cambio climtico hubiera bajado las temperaturas del planeta produciendo una era
glacial?
El hecho de que en las actuales Norteamrica y Eurasia se estuvieran formando unos importantes yacimientos de carbn,
procedentes de grandes extensiones de bosques tpicos de
clima tropical.
11 Representa a escala las capas composicionales de
la Tierra. Hazlo de manera que 1 cm represente 300 km.
Qu se puede apreciar una vez realizado?

10

PARA AMPLIAR
15 Obtn ms informacin sobre las teoras fijistas
y redacta un informe sobre ellas.

a verse empujados hacia arriba, donde el agua, ms fra, los


vuelve a arrastrar al fondo, permitindonos visualizar las
corrientes de conveccin.

Se mueve el corcho? De qu manera?

En Internet puede recogerse ms informacin sobre las teoras fijistas citadas en la Unidad.

Las dos lminas de corcho se movern por la superficie del


agua, impulsadas por las corrientes de conveccin.

16 Busca informacin en libros, enciclopedias e Internet y redacta una breve biografa de Alfred Wegener.

Respuesta abierta.
17 Podra haber sido utilizada por Wegener la manera
en que se distribuyen los volcanes y terremotos de haberla conocido?
Posiblemente le hubiera permitido encontrar el mecanismo
por el que los continentes se desplazan, si hubiese comprendido el papel de la dorsal centroatlntica.
18 Qu valor tuvo para la geologa el trabajo de Wegener?
Aunque no fuese aceptada, supona un cambio radical en la
imagen que la geologa tena de nuestro planeta, pues hasta ese
momento la idea predominante era la de una Tierra en la que no
se producan cambios de importancia desde su formacin.
19 Consulta libros o Internet y elabora un informe sobre
dos proyectos de perforacin de la corteza realizados en
la segunda mitad del siglo XX, uno de ellos conocido como
el proyecto Mohole y el otro realizado en la pennsula de
Kola.

Qu representan el agua, el papel y el corcho?

El agua representa el material plstico del manto superior; el


papel, el material del manto que asciende y desciende impulsado por las corrientes de conveccin, y el corcho equivale a
la corteza continental.

INVESTIGACIN
CIENTFICA
CMO SE LOCALIZA EL LUGAR EXACTO
DE UN TERREMOTO?
1 Haz una fotocopia del mapa de la pennsula Ibrica
de la Figura y localiza el epicentro de un terremoto que
se produjo a las distancias de tres sismgrafos indicadas
en la tabla:
Observatorio de:

Distancia (km)

Barcelona

240

Santiago

690

Cdiz

820

El proyecto Mohole, realizado en 1960 por Estados Unidos frente


a la costa de California, pretenda atravesar la discontinuidad
de Mohorovicic (de ah su nombre) y, por tanto, llegar a tocar el
manto. Fue abandonado en poco tiempo por su alto coste.
La Unin Sovitica comenz en 1970 una perforacin en
la pennsula de Kola (en el Crculo Polar rtico) llegando a la
corteza continental inferior (ms all de la discontinuidad
de Conrad).

PON EN PRCTICA
OBSERVA LAS CORRIENTES
DE CONVECCIN

El epicentro se situ en Huesca.

Qu movimiento se aprecia en los trozos de papel?


Dibjalo en tu cuaderno.

2 Explica por qu no bastan uno o dos sismgrafos para localizar con exactitud el epicentro de un terremoto.

Los trozos de papel, al principio se habrn ido al fondo, pero


cuando el agua empieza a calentarse por abajo, comienzan

Cada sismgrafo permite averiguar (gracias al desfase que se


produce entre las ondas P y S) a qu distancia de l se produjo

11

DINMICA TERRESTRE:
LA DERIVA CONTINENTAL

el terremoto, pero no informan de la direccin geogrfica de


llegada de las ondas, por lo que pudo haberse producido en
cualquier punto situado a la distancia obtenida. El resultado
es una circunferencia cuyo radio es esa distancia. Con dos
sismgrafos obtenemos dos circunferencias, que se cortan
en dos puntos. El sesmo tuvo lugar en uno de ellos. El tercer
sismgrafo nos permite dibujar otra circunferencia, que corta
a las otras dos en uno de los dos puntos anteriores. En ese
lugar donde coinciden las tres circunferencias es donde tuvo
lugar el epicentro.
3 Busca ms informacin sobre las escalas de Mercalli
y Richter.
En distintos medios puede obtenerse informacin sobre los
autores de dichas escalas, la relacin entre los daos pro-

12

ducidos y los grados de intensidad, la manera en que se establecen los grados de magnitud y la forma de averiguar la
cantidad de energa liberada en el sesmo, etctera.
4 Busca informacin sobre terremotos que hayan tenido lugar en tu localidad o en tu comunidad autnoma en
el pasado. Fue buena la prediccin? Y la prevencin?
Puede servir de utilidad la pgina web del Instituto Geogrfico Nacional, www.ign.es y su enlace a informes ssmicos y
datos ssmicos, donde se consultan los ltimos terremotos de
toda la pennsula Ibrica. Tambin es interesante consultar
el Real Decreto 997/2002 que aprueba la Norma de Construccin Sismorresistente, (publicado en el Boletn Oficial del
Estado, 27 de septiembre de 2002).

LA TECTNICA DE PLACAS
QU SABES DE?
1 Sabes que la litosfera parece estar dividida en grandes bloques? Recuerdas cmo se llaman y en cuntos
tipos se clasifican?
Se trata de las placas litosfricas, que se clasifican en tres
tipos: continentales, ocenicas y mixtas.
2 Recuerdas qu son las dorsales? Dnde estn situadas?
Son cadenas montaosas cuyo eje central est recorrido por
una depresin a modo de valle. Se hallan en los ocanos,
bajo el nivel del mar.
3 En muchos lugares puede verse un paisaje formado
por rocas sedimentarias plegadas. Qu fenmeno ha
podido plegarlas?
Las responsables son fuerzas de compresin debidas a la
dinmica interna del planeta.
4 Di si estas frases son verdaderas o falsas.
F

b) El continente africano se est rompiendo por su lado


occidental.

c) La cordillera del Himalaya se ha formado al chocar la


India contra Eurasia.

d) Una roca sometida a una fuerza intensa responde


plegndose o fracturndose.

ACTIVIDAD INICIAL
LAS FUERZAS DE LA NATURALEZA
Clasifica las siguientes catstrofes naturales segn sean
causadas por fuerzas del planeta internas o externas:
Origen interno

Origen externo

Terremotos

Inundaciones por lluvias


torrenciales

Erupciones volcnicas

Huracanes
Tornados

Tsunamis. Aunque se trata de grandes olas marinas, su


origen es interno, debido a un terremoto o una erupcin
volcnica.
Cada de un gran meteorito. No es causada por fuerzas
del planeta, ya que proceden del espacio exterior.

Cules de ellas son predecibles?

De todas las citadas, quiz slo la cada de un meteorito sea


realmente predecible. Todas las dems son de difcil prediccin,
aunque en algunos casos un seguimiento del fenmeno permite alertar a la poblacin con tiempo suficiente, como ocurre con
los huracanes, los tsunamis o las erupciones volcnicas.

ACTIVIDADES
1 Observa el mapa de las placas litosfricas y haz un
listado de las principales, segn la clasificacin citada
en el texto. Cul crees que es la de mayor tamao de
todo el planeta? Nombra las seis ms pequeas que
veas en el mapa.
Placas continentales

a) Los continentes se mueven arrastrndose por el fondo


ocenico.

Cules de ellas resultan de difcil clasificacin? Explica por qu en cada caso.

Aludes de nieve. Normalmente se producen por accin


de la gravedad, pero pueden ser provocadas por una vibracin ssmica.

Placas ocenicas
Placas mixtas

Arbiga, Iran
Pacfica, Filipina, de Nazca,
de Cocos, del Caribe
Eurasitica, Norteamericana,
Sudamericana, Africana,
Indoaustraliana, Antrtica

La de mayor tamao es la Pacfica.


Las seis ms pequeas del mapa son: la Iran, la de Cocos, la
del Caribe, la de Escocia, la Arbiga y la Filipina.
2 Observa tambin el mapa de distribucin de volcanes y terremotos de la pgina 18. Dnde estn situados
la gran mayora de estos fenmenos geolgicos segn la
tectnica de placas?
La mayor parte de dichos fenmenos se sitan en los lmites
de placas.
3 Si suponemos que Sudamrica y frica se han separado a una velocidad media de 3 cm/ao, podemos
calcular cundo se rompi Pangea y comenz a formarse
el ocano Atlntico? Concuerda con la edad mxima de
los fondos ocenicos citada en la Unidad anterior?
Para saber cuando comenz a abrirse el ocano Atlntico
nos falta conocer su amplitud, es decir, la distancia que separa los continentes americanos del conjunto Eurasia-frica.
Dependiendo de la zona elegida para tomar esa medida,
el dato ser diferente. Un valor medio aproximado es el de
5 000 km.
Si consideramos una velocidad media de separacin de
3 cm/ao:

13

2 LA TECTNICA DE PLACAS
v = e / t; t = e / v; t = 500 000 000 cm / 3 cm/ao 167 millones
de aos.
Esta cifra concuerda con el valor de edad mxima de los fondos ocenicos obtenida por el estudio de muestras de roca,
que es de 180 millones de aos.
4 El diagrama de la figura 2.8 representa una falla
transformante en una dorsal. Las flechas indican la direccin en que se mueven las placas. Cpialo en tu cuaderno
y dibuja otras flechas que indiquen dicho movimiento en
las zonas A y B. Explica si en dichas zonas se producirn
terremotos y por qu.

Es previsible que la dorsal centroatlntica siga actuando durante millones de aos y, por tanto, seguir amplindose el
ocano Atlntico, al tiempo que el Pacfico seguir reducindose por subduccin.
Al plazo de 200 millones de aos, la dorsal se habr extinguido y quiz vuelva a cerrarse el Atlntico.
8 Los dos tipos de cordilleras estudiados son llamados
tambin orgenos mecnicos y trmicos. Qu nombre
corresponde a cada una? Por qu?
Los orgenos de subduccin van acompaados de actividad
volcnica, debido a la fusin de la corteza ocenica. Son, por
tanto, orgenos trmicos.
Las cordilleras de colisin continental se forman al chocar dos
continentes, lo que da lugar a intensa actividad ssmica, pero
no volcnica, luego son orgenos mecnicos.
9 Indica cules son las diferencias existentes entre los
tres modelos elaborados para explicar el mecanismo de
la conveccin.

En A s se producen terremotos, ya que la parte superior y


la inferior se mueven en direcciones contrarias y, por tanto,
hay friccin.
En B las dos partes se mueven en la misma direccin, por lo
que no se mueven entre s. Por tanto, en estas zonas no se
producen terremotos.
5 Quizs hayas odo hablar del cinturn de fuego del
Pacfico. Busca en alguna fuente de informacin a qu
se refiere dicho trmino.
Este trmino se refiere al hecho de que el ocano Pacfico
est limitado en todo su contorno por zonas de subduccin
y dorsales. Por tanto, lo rodea un cinturn de actividad volcnica, de ah su nombre.
6 Explica brevemente cul es el significado del ciclo
de Wilson en cuanto a la generacin y destruccin de las
cuencas ocenicas.

14

El primer modelo propona la existencia de celdas de conveccin en la astenosfera, causadas a su vez por otras que
afectaran al resto del manto.
Ms tarde se sugiri un segundo modelo en el que habra
una sola conveccin en todo el manto.
El tercer modelo propone de nuevo dos capas de conveccin,
en las que la ms interna provocara movimientos ascendentes y descendentes irregulares.
10 Explican la existencia de las islas Hawai las cuatro afirmaciones bsicas de la tectnica de placas? Por
qu?
Las afirmaciones bsicas de la tectnica de placas tan solo
explican los fenmenos y estructuras que se producen en los
lmites de placa, y las islas Hawai se encuentran en el interior
de una placa. Su existencia y origen volcnico quedan explicados por la teora del punto caliente.
11 Slo las estructuras activas de la cadena Hawai-Emperador se hallan actualmente sobre el nivel del mar. El
resto son slo montes submarinos de origen volcnico.
Cul es el motivo?

Segn el ciclo de Wilson, la formacin y destruccin de cuencas ocenicas tienen lugar de forma cclica a lo largo de un
periodo de tiempo de unos 200 millones de aos. En l se
distinguen cinco fases, desde el comienzo de la fractura de un
supercontinente, que dar lugar a la aparicin de una nueva
cuenca ocenica, hasta su desaparicin por subduccin y
nueva reunin de los continentes.

Cuando las islas abandonan el punto caliente, dejan de tener


actividad volcnica y, a partir de ese momento, la erosin
va desgastndolas hasta que quedan por debajo del nivel
del mar.

7 Qu ocurrir con los dos grandes ocanos en los


prximos millones de aos? Y dentro de 200 millones
de aos?

La explicacin, segn la teora de las placas, es que la placa


Pacfica se mova inicialmente en direccin norte y despus
cambi a la que actualmente tiene, hacia el noroeste.

12 Por qu la cadena Emperador tiene una orientacin


distinta a la de Hawai?

13 Qu informacin pueden aportar los puntos calientes respecto al movimiento de las placas? Con los datos
indicados en el texto, calcula la velocidad media a la que
se desplaza la placa Pacfica.
Como vemos en la respuesta anterior, podemos conocer la
variacin en la direccin de movimiento de las placas que se
mueven sobre ellos. Tambin, la velocidad a la que se desplazan.
En el texto se indica que el conjunto Hawai-Emperador tiene
una longitud de unos 5 800 km, y que el monte ms lejano
perteneciente al archipilago Emperador tiene 65 millones
de aos.
La velocidad media de la placa Pacfica ser:
v = e / t; v = 580 000 000 m / 65 000 000 ao 8,9 cm/ao.
14 Observa el ciclo geolgico y explica su relacin con
la tectnica de placas. Indica cules son los procesos internos y externos representados.
El ciclo geolgico presenta la conexin entre los procesos
internos (constructores del relieve, responsables de volcanes y terremotos, cordilleras, fallas y pliegues) y los procesos
externos (destructores del relieve: erosin, transporte y sedimentacin). Los primeros son consecuencia directa de la
tectnica de placas.
15 A la vista de la Figura 2.19, explica cmo se desarrolla el ciclo de las rocas. Para ello observa cmo unas rocas
pueden transformarse en otras si cambian las condiciones en que se formaron.
Las rocas magmticas (gneas) se forman por enfriamiento de
magma, ya sea bruscamente, en superficie (rocas volcnicas)
o lentamente, en profundidad (rocas plutnicas).
Las rocas metamrficas se forman a partir de las gneas
o las sedimentarias, al estar sometidas a altas presiones y/o
temperaturas, a causa de su confinamiento en profundidad
o al contacto con magma.
Tanto las rocas gneas como las metamrficas, si estn sometidas a los agentes geolgicos externos, sern desmanteladas
y convertidas en sedimentos que, por compactacin y litificacin, se transformarn en rocas sedimentarias.
Vemos, entonces, que las rocas no son estables, sino que se
transforman unas en otras segn las condiciones a las que
se hallen sometidas.
16 Dibuja pliegues sinclinales recto, inclinado y tumbado. Nombra sus estratos con nmeros o letras para
precisar su antigedad.

17 Si un anticlinal y un sinclinal estn unidos, cuntos


flancos hay? Por qu?
Hay slo tres flancos, ya que comparten uno, aqul por el
que estn unidos.
18 En la Figura 2.25 se representa un tipo de pliegue
llamado monoclinal (o en rodilla). Como ves, est relacionado con la aparicin de una falla. De qu tipo es dicha
falla? Explica de qu manera se forma el pliegue.
En la Figura vemos que se trata de una falla inversa, ya que
el plano de falla buza hacia el labio levantado.
El empuje de fuerzas de compresin produce una falla que
no llega a afectar a los estratos ms superficiales y levanta
un labio, cuyos estratos se levantan tambin, deformndose
sobre el plano de falla sin llegar a fracturar.
19 Explica qu diferencia existe entre las fallas normales y las inversas en cuanto a la superficie final del
terreno.
Las fallas normales se producen por distensin. Al resbalar
uno de los bloques a favor de la gravedad, el resultado final
es un aumento de la superficie de terreno. Con las fallas
inversas, ocasionadas por compresin, ocurre lo contrario y
la superficie final es menor que la inicial.
20 Una roca con abundantes diaclasas est ms expuesta
a la erosin que una carente de ellas. Explica el motivo.
Las diaclasas son grietas en las rocas, esto significa que una
roca con diaclasas presenta mayor superficie a los agentes
erosivos. De hecho, en las diaclasas la erosin avanza ms
rpidamente que en los bloques de roca.

15

2 LA TECTNICA DE PLACAS
ACTIVIDADES FINALES
PARA REPASAR
1 Cules son las principales afirmaciones de la tectnica de placas?
La litosfera est dividida en grandes bloques llamados
placas litosfricas.
Las placas litosfricas se mueven, desplazando en su movimiento a los continentes incluidos en ellas.
En sus bordes, las placas interaccionan entre s, separndose, chocando o rozando, lo cual genera una intensa
actividad tectnica.
En las dorsales se genera litosfera ocenica y las placas
situadas a ambos lados aumentan su extensin. Como
compensacin, en las fosas ocenicas se destruye la
litosfera ocenica, al hundirse en el manto (subduccin), lo que reduce el tamao de la placa a la que
pertenece.
2 Nombra en tu cuaderno las placas numeradas en el
siguiente mapa:

Estructura
existente

Tipo de lmite

Actividad
tectnica

Divergente

Dorsal

Volcnica

Convergente:
ocenica-continental
ocenica-ocenica
continental-continental

Fosa ocenica
Fosa ocenica
Cordillera

Volcnica
Volcnica
Ssmica

Falla transformante

Ssmica

Pasivo

5 Cmo pueden haberse formado los Pirineos y los


Alpes?
Se forman a causa de la compresin ejercida por el continente africano, al moverse hacia el norte la placa a la que
pertenece.
6 Escribe y completa en tu cuaderno las siguientes
frases:
a) La litosfera est dividida en grandes placas que se separan, chocan o rozan entre s.
b) En las dorsales se genera litosfera ocenica, mientras que
se destruye en las fosas ocenicas.
c) En la subduccin la placa ocenica se incorpora al manto, siguiendo el plano de Benioff, inclinado unos 45
grados.
d) La causa del movimiento de las placas litosfricas se
halla en las corrientes de conveccin que ocurren en el
manto.
e) El archipilago de Hawai se form al moverse la placa
Pacfica sobre un punto caliente.
7 Copia en tu cuaderno este crucigrama y coloca en
l los nombres de los elementos de un pliegue y de los
tipos de pliegues.
R

3 Explica por qu motivo la teora de la tectnica de placas constituy una revolucin en la geologa del siglo XX.

E
C

Porque es una teora sencilla que da una explicacin global a


muchos aspectos de la dinmica terrestre que hasta mediados del siglo XX se intentaban explicar de manera independiente, sin relacin mutua.
4 Completa la siguiente tabla sobre los tipos de lmites
entre placas:

P
H

C
I

D
N

A
U

A
X

16

F
E

PARA APLICAR
8 Explica qu sucede y por qu en la costa de Chile,
Hawai, la fosa de Japn y la costa oeste de California.
Costa de Chile: la placa de Nazca subduce bajo la placa
Sudamericana.
Hawai: un punto caliente genera la actividad volcnica
que ha formado las islas.
Fosa de Japn: formacin de un arco de islas volcnicas a causa de la subduccin de la placa Filipina bajo la
Euroasitica.
Costa oeste de California: las placas Pacfica y Norteamericana se mueven, la primera hacia el norte y la segunda hacia el sur. El rozamiento da lugar a terremotos
de gran intensidad.
9 Por qu en el Himalaya no hay actividad volcnica
y sin embargo s la hay en los Andes?
Porque el Himalaya es una cordillera de colisin continental,
en la que los materiales comprimidos se pliegan. En cambio,
los Andes son una cordillera de subduccin, formada a causa
del choque de la placa ocenica de Nazca con el continente
sudamericano. La placa ocenica se introduce por debajo
y, al llegar al manto, funde y asciende por ser ms ligera,
generndose volcanes.
10 Localiza en un mapa algunos arcos de islas volcnicas. Qu disposicin tienen respecto a los continentes
ms prximos?
Son paralelos a la costa y entre ambos existe un mar interior.
11 En qu fase del ciclo de Wilson se hallan las siguientes reas del planeta?:
Fase
a) Lmite entre
la placa Pacfica
y la de Nazca

b) Lagos orientales
de frica

Fractura de un continente
y formacin de un rift.

c) Lmite sur
de la placa Iran

La cuenca se cierra y se levanta


una cordillera intercontinental.

d) Islas Aleutianas

Subduccin y formacin de un
arco de islas volcnicas.

e) Mar Mediterrneo

La subduccin avanza,
estrechndose la cuenca ocenica.

Desarrollo de una dorsal que


aade corteza ocenica y separa
cada vez ms los bordes
continentales.

br cerrado definitivamente el mar Mediterrneo y Australia


chocar con Eurasia. Sobre la Antrtida, no hay muchos datos
respecto a cul ser su movimiento.
13 Dejarn de moverse las placas litosfricas en un futuro lejano? Por qu? En ese caso, qu aspecto llegara a
tener la superficie del planeta mucho despus? Explcalo.
S, ya que son reflejo de la actividad interna del planeta, la
cual a su vez se debe a su calor interno. Cuando ste se agote, las placas dejarn de moverse. A partir de ese momento,
sobre la superficie del planeta slo actuar la erosin que, pasados muchos millones de aos arrasar los relieves, dando a
los continentes una superficie aplanada en toda su extensin.
Los fondos ocenicos recibirn los sedimentos resultantes
de dicha erosin y en consecuencia desaparecern tambin
buena parte de sus relieves.
14 Busca informacin sobre estos dos trminos: klippe
y ventana tectnica. Con qu estructura estn relacionados? Explica de qu manera se forman.
Ambos trminos estn relacionados con los mantos de corrimiento. Cuando sobre stos acta la erosin, all donde sta
sea ms intensa, sern eliminadas las capas a l pertenecientes y aflorar el terreno autctono sobre el que se desliz, formando una ventana tectnica. All donde la erosin respete
partes del manto, stas constituyen los klippes.
15 Cul es la diferencia entre cabalgamiento y manto
de corrimiento?
Un cabalgamiento es una falla inversa en la que el ngulo del
plano de falla es menor de 30 .
Si en un cabalgamiento las fuerzas de compresin siguen
actuando, el labio levantado se desplaza muchos kilmetros.
Este labio levantado y desplazado forma entonces un manto
de corrimiento.
16 Copia y completa el esquema del ciclo de las rocas:
Roca gnea/plutnicas
Enfriamiento
Erosin
MAGMA

Aumento
de temperatura
y presin

Fusin

12 De qu manera creen los gelogos que se formar


una nueva Pangea en el futuro?
La dorsal centroatlntica se agotar y los continentes a ambos lados del ocano se aproximarn hasta chocar. frica ha-

SEDIMENTOS

Fusin

Erosin

Erosin
Litificacin

Aumento
de temperatura
y/o presin
Roca metamrfica

Roca sedimentaria

17

2 LA TECTNICA DE PLACAS
17 Islandia se halla sobre la dorsal centroatlntica, pero actualmente los gelogos consideran que eso no es
suficiente para explicar su existencia. Consulta alguna
fuente de informacin para averiguar qu otra circunstancia ocurre en dicho lugar.
Muchos cientficos creen que la gran actividad volcnica que
ha formado Islandia se debe a que se halla bajo un punto
caliente.

En la figura se representan cuatro pliegues: vertical, inclinado, tumbado y tumbado. El ltimo pliegue est cortado
por una falla inversa y desplazado formando un cabalgamiento.
2 Copia la figura en tu cuaderno y dibuja con una lnea
cada plano axial.
Respuesta abierta.

18 En los Estados Unidos, la ciudad de Los ngeles se


halla sobre la placa Pacfica; en cambio, San Francisco
pertenece a la placa Norteamericana. Observa el mapa
de las placas (Figura 2.3) y explica cmo es el movimiento relativo de ambas ciudades. Averigua cunto tiempo
tardarn en encontrarse si el desplazamiento es de unos
5,5 cm/ao.

3 Averigua cunto meda el terreno antes de haberse


plegado (supn que el dibujo est realizado a escala E
1:100 000).

Los ngeles se mueve hacia el norte con la placa Pacfica,


mientras que San Francisco se mueve hacia el sur por hallarse
en la placa Norteamericana.
Ambas ciudades estn separadas por unos 530 km (este dato
deben obtenerlo los alumnos consultando un mapa a escala
de Norteamrica), por tanto:
v = e / t; t = e / v; t = 53 000 000 cm / 5,5 cm/ao 9,6 millones de aos.

Aade la longitud de separacin entre los dos flancos


del pliegue cortado.

Para ello, traza una lnea quebrada que recorra los flancos de cada pliegue del estrato superior (de una charnela
a otra) y, luego, mdela.

Mide ahora el ancho de la figura y calcula el acortamiento


producido, expresado en porcentaje.

19 Dibuja en tu cuaderno un esquema de la falla de la


foto, indica de qu tipo es y pon nombre a cada uno de
sus elementos.
LA
AL
F
E

D
LABIO
NO
A
L
LABIO
HUNDIDO P
LEVANTADO
BUZAMIENTO

En la foto se aprecia claramente a la derecha una falla inversa.


Tambin existe una directa a la izquierda adems de otras
muchas de menor entidad.

PON EN PRCTICA
ASOCIACIN DE PLIEGUES
1 Cuntos pliegues hay en la figura? De qu tipo es
cada uno? Qu otra estructura se representa?

18

La lnea quebrada mide aproximadamente 9,7 cm. A ello hay


que aadir el desplazamiento sobre la falla inversa, de 1 cm.
Por tanto, el terreno inicial medira 10,7cm. Al aplicar la escala:
10,7 x 100 000 = 1070 000cm = 10,7 km
El ancho actual es 6,9 cm, luego se ha acortado:
10,7 6,9 = 3,8 cm, que en porcentaje representa:
10,7 100
3,8 100
x=
= 35%
10,7
3,8 x

INVESTIGACIN
CIENTFICA
VOLCANES: LA FUERZA
DE LA TECTNICA
1 Enumera los posibles daos que sobre las personas,
los animales y las cosas puede causar la actividad volcnica.
Los gases desprendidos pueden causar problemas respiratorios y muerte por asfixia.
La lava destruye todo a su paso: cultivos, carreteras, edificaciones.
Adems puede provocar graves incendios.
Las cenizas pueden acumularse en tales cantidades que sepulten viviendas, como ocurri en la antigedad a Pompeya,
vctima de la erupcin del Vesubio.

Las nubes ardientes que en ocasiones descienden por la


ladera causan la muerte de manera inmediata por su elevada temperatura.
2 Una erupcin volcnica puede causar un tsunami?
La erupcin de un volcn va acompaada de movimientos
ssmicos, sobre todo en el caso de las erupciones de tipo explosivo. Si el volcn se halla prximo a la costa, los tsunamis
son un riesgo asociado a la erupcin.
3 Qu ocurrir si un volcn que entra en erupcin
tiene sus laderas cubiertas de nieve?
La lava que se derrama por la ladera se mezcla con la nieve
acumulada. Esto da lugar a una colada de barro que desciende rpidamente ladera abajo y puede sepultar las poblaciones prximas, como ocurri en Colombia en 1985, al entrar
en erupcin el volcn Nevado del Ruiz, causando la muerte
de 25 000 personas.

19

3 LA HISTORIA DE LA TIERRA
QU SABES DE?
1 Recuerdas cuntos aos hace que se form nuestro
planeta?
Se estima que la edad de la Tierra es de unos 4 500 millones
de aos.
2 Explica qu significa el trmino fsil.
Los fsiles son restos de seres vivos antiguos que han
llegado hasta nuestros das conservados en rocas sedimentarias.

3 En cuntas eras se ha dividido la historia de la


Tierra?
Actualmente se consideran cuatro eras en la historia de la
Tierra, aunque, como veremos, es ms correcto dividirla en
cuatro eones.
4 Los dinosaurios vivieron hasta hace unos 65 millones de aos. Cul pudo ser el motivo de su extincin?
La teora ms aceptada actualmente afirma que la causa de
la extincin fue la cada de un meteorito de grandes dimensiones junto a la pennsula de Yucatn.
5 Di si estas frases son verdaderas o falsas.
a) El diluvio universal del que hablan muchas culturas
antiguas est confirmado por datos cientficos.

b) La paleontologa es una rama de la geologa que estudia


los seres vivos que existieron en el pasado.

c) La vida pas a lo largo de su historia por varias extinciones


masivas que redujeron mucho la biodiversidad existente.

d) El ser humano primitivo convivi con los dinosaurios.

ACTIVIDAD INICIAL
TODO SIGUE UN ORDEN
Supn que vas caminando por el campo y te encuentras un corte del terreno realizado para construir una
carretera. Al fijarte en l distingues que en profundidad
est formado por tres estratos horizontales de rocas
sedimentarias, de diferente color y textura. El estrato
superior presenta en superficie los efectos de la erosin. Adems, aprecias que los estratos se interrumpen
en una falla y continan unos centmetros ms abajo al
otro lado. Esa falla se inclina hacia la izquierda.

20

Haz un dibujo de ese corte del terreno. Nombra con


una letra la falla y cada uno de los estratos.

Intenta hacer con plastilina un modelo en tres dimensiones a partir de tu dibujo. Te dars cuenta de que
debes seguir una serie de pasos en un orden concreto.
Explica qu orden has seguido.

Si los alumnos reproducen esa figura en plastilina, seguirn


un orden que coincidir con el orden en que se produjeron
los sucesos geolgicos representados, que indicamos en la
respuesta a la pregunta siguiente.

Explica brevemente la historia de ese terreno. Cul


fue el ltimo proceso que ocurri?

En primer lugar se depositaron los estratos C, B y A. A continuacin se produjo una falla, desplazndose los bloques de
roca. Finalmente la erosin actu modelando la superficie.

ACTIVIDADES
1 Ampla tus conocimientos sobre el desarrollo histrico de las ideas sobre la edad de la Tierra. Busca la
informacin en libros o en Internet.
Respuesta abierta. Se trata de que los alumnos se documenten mediante distintos medios de informacin y realicen un
pequeo trabajo en torno a la discusin no resuelta hasta el
siglo XX sobre la antigedad del planeta.
2 Qu es la teora planetesimal? Explcala de manera
resumida.
La teora planetesimal afirma que el Sistema Solar se form
a partir de los materiales expulsados por la explosin de una
estrella anterior, que habra explotado al final de su existencia. Los acontecimientos siguientes podran resumirse as:
Los materiales expulsados, partculas de gas y polvo, formaran una nebulosa, que se movera girando lentamente sobre s misma.
Por la atraccin gravitatoria, la nebulosa comenzara
a contraerse, lo cual aumentara su velocidad de rotacin.
En su centro, la acumulacin de materia y los continuos
choques aumentaran progresivamente la presin y la

temperatura. Esto comenzara las reacciones nucleares


que dieron lugar al Sol.
El resto del material formara anillos alrededor de la nueva
estrella y, tambin por efecto de la fuerza de gravedad,
se ira reuniendo en cuerpos cada vez ms grandes, llamados planetesimales, que creceran hasta formar cada
uno de los planetas.
3 Clasifica los siguientes procesos geolgicos en graduales y catastrficos:

Una erupcin volcnica. Catastrfico.


La erosin producida por el viento. Gradual.
Un terremoto. Catastrfico.
La sedimentacin en el fondo marino. Gradual.
Una glaciacin. Gradual.
Un tsunami. Catastrfico.
La formacin de un meandro en un ro. Gradual.

4 a) Qu diferencias existen entre las ideas de Cuvier


y Lyell en cuanto a la forma en que se producen los cambios en el planeta?
George Cuvier fue un extraordinario anatomista que, aferrado a
sus creencias religiosas, supona que las extinciones que l mismo pudo estudiar eran causadas por grandes catstrofes que
habran destruido toda forma de vida (la ltima de ellas habra
sido el diluvio citado en la Biblia). Despus de cada aniquilacin,
un ser superior habra realizado un nuevo acto de Creacin, formando nuevas especies, distintas a las anteriores.
Para Charles Lyell los cambios ocurridos en el planeta habran
tenido lugar lentamente y de forma similar a como ahora
suceden.
b) Podemos suponer qu opinaba cada uno sobre la antigedad de la Tierra?
La hiptesis catastrofista de Cuvier requera de una antigedad de tan slo unos 6 000 aos. En cambio, el modelo gradualista de Lyell precisaba de millones de aos.
5 a) Cualquier resto de un ser vivo debe ser considerado un fsil?
No, slo aquellos que despus de la muerte del organismo,
sufren un proceso geolgico llamado fosilizacin.
b) En qu consiste la fosilizacin?
Se trata de un proceso que dura millones de aos, en el que
deben darse dos condiciones:
El cuerpo debe quedar protegido de la erosin, por ejemplo,
al cubrirse de agua, barro, arena o cenizas volcnicas.
Debe ocurrir una sustitucin qumica de la materia orgnica por materia mineral de forma que, terminado el
proceso, del organismo inicial tan slo queda una reproduccin en piedra.

c) En qu tipos de rocas no pueden aparecer fsiles? Por


qu motivo?
En las metamrficas y magmticas, ya que se han formado
en unas condiciones de presin y/o temperatura incompatibles con la existencia de seres vivos. Una excepcin son las
pizarras, que pueden contener fsiles como graptolites, trilobites o braquipodos. La razn se halla en que estas rocas
se generan mediante un metamorfismo de baja intensidad.
En ocasiones, los fsiles estn deformados por las presiones
a las que estuvo sometida la pizarra.
6 Explica si la siguiente frase es cierta o no: Los fsiles incluidos en un determinado tipo de roca aportan
informacin que permite conocer en qu ambiente se
depositaron los sedimentos que dieron lugar a dicha
roca.
La frase es cierta, pues los fsiles se forman generalmente en
el mismo ambiente en que vivan los organismos de los que
proceden. As, unos fsiles de organismos marinos incluidos
en una roca caliza nos indican que dicha roca se form en
el fondo del mar.
7 Crees que existen muchas especies que sirvan como
fsiles gua y, por tanto, que sean tiles para determinar la edad de las rocas en las que se encuentran? Por
qu?
No, pues son pocos los fsiles que renen las condiciones
necesarias para servir como fsiles gua.
8 Observa la Tabla 3.2 y explica cules son las diferencias
entre la Tierra actual y una Tierra carente de vida en cuanto
a la composicin de la atmsfera y de los ocanos.
Composicin en %

Atmsfera

Agua
ocenica

Tierra sin
vida

Tierra actual

CO2

0,03

99

N2

78

O2

21

Ar

Agua

96

63

NaCl

3,5

35

Otros

0,5

La principal diferencia consiste en que una Tierra sin vida


tendra una atmsfera carente por completo de oxgeno
(sera una atmsfera reductora, no oxidante), casi exclusivamente formada por dixido de carbono. Tambin pueden
verse otras diferencias, como la abundancia del nitrgeno
molecular atmosfrico en la Tierra actual o la gran cantidad
de sal en los ocanos si no existiera la vida.
En estas condiciones no sera posible la aparicin de la vida,
al menos como la que conocemos.

21

3 LA HISTORIA DE LA TIERRA
9 La temperatura media en la superficie de Venus es
de 460 C, y la de Marte es de 50 C, busca en enciclopedias o en Internet qu temperatura se cree que tendra
la Tierra si no se hubiese desarrollado la vida en ella.

Duracin (sobre 24 h)
millones
de aos

segundos

h, m, s

Cuaternario

1,8

35

35

Por hallarse la Tierra entre Venus y Marte, su temperatura


media se hallara entre los valores que se alcanzan en ellos. En
concreto se calcula que podra ser de unos 15 C bajo cero.

Terciario

63

1 210

20 10

Cretcico

80

1 536

25 36

Jursico

55

1 056

17 36

10 Basndote en la Tabla 3.3 de la pgina anterior, calcula cunto tiempo ha durado cada en, era y periodo.
Por qu en general duran menos a medida que nos acercamos a la actualidad? Realiza un grfico de sectores que
represente la duracin de: hdico, arcaico, proterozoico,
paleozoico, mesozoico y cenozoico.

Trisico

51

979

16 19

Prmico

48

922

15 22

Carbonfero

60

1 152

19 12

Devnico

57

1 094

18 14

Silrico

28

538

8 58

Ordovcico

44

845

14 5

Cmbrico

52

998

16 38

Proterozoico

1 960

37 632

10h 27 12

Arcaico

1 100

21 120

5h 52

Hdico

900

17 280

4h 48

En

Era
Cenozoico 65
Mesozoico
(Secundaria)
186

Fanerozoico 540

Perodo
Cuaternario 1,8
Terciario 63
Cretcico 80
Jursico 55
Trisico 51
Prmico 48

12 Observa el mapa de la Figura 3.25 e indica qu disposicin tienen las cordilleras formadas en la orogenia alpina.

Carbonfero 60
Paleozoico
(Primaria) 289

Devnico 57
Silrico 28
Ordovcico 44
Cmbrico 52

Proterozoico 1960
Arcaico 1 100

Precmbrico 3 060

Hdico 900
La razn de que los intervalos de tiempo se vayan acortando se debe a que existen ms datos sobre las pocas ms
recientes, lo que nos permite percibir muchos ms cambios
y con ms detalle. Esto lleva a los gelogos a establecer ms
divisiones del tiempo en periodos relativamente cortos.

Se trata de que los alumnos consulten un atlas y observen la


disposicin de todas las cordilleras en el mapa. Puede verse
que en Amrica se extienden de norte a sur y en Eurasia lo
hacen de este a oeste.
13 Con qu momento de la historia de la Tierra relacionas cada uno de los siguientes fsiles caractersticos?:
trilobites, nummulites, mamut, peces acorazados, fauna
de Ediacara, ammonites, dinosaurios, Carcharodon megalodon, tigre dientes de sable. Ordnalos en el tiempo e
indica a qu grupo de seres vivos pertenece cada uno.

11 Imagina que toda la historia de la Tierra la redujramos a tan slo 24 horas (la duracin de un da), calcula
cunto tiempo durara aproximadamente cada uno de
los intervalos de tiempo indicados en la Tabla 3.3 de la
pgina anterior.

22

Cuaternario
(Pleistoceno)

Terciario

Mamut

Mamfero

Tigre dientes de
sable

Mamfero

Carcharodon
megalodon

Tiburn

Nummulites

Protozoos

Mesozoico
Paleozoico
Proterozoico

Dinosaurios

Reptiles

Ammonites

Molusco cefalpodo

Trilobites

Artrpodo

Peces acorazados

Peces

Fauna de Ediacara

Gusanos,
medusas

al Pleistoceno). El ltimo acontecimiento es la erupcin


volcnica, en la actualidad.

14 Realiza en grupo una cinta del tiempo, a escala


1 mm = 1 milln de aos, con tiras de papel o cartulina, de
unos 10 cm de alto. Marca en ella el tiempo como en una
cinta mtrica y pon en la parte superior los nombres de
los eones, eras y perodos. Escribe los acontecimientos
ms importantes e ilstrala con dibujos o fotos.
Respuesta abierta.
15 Busca informacin sobre los diferentes homnidos
del Cuaternario.
Respuesta abierta
16 Interpreta los siguientes cortes geolgicos:

1. El orden de los materiales es: C, E, G, D, B, A.


2. No ha habido plegamiento, pero s una falla directa entre
G y D.
3. La presencia de fsiles permite datar los acontecimientos y conocer el ambiente en que se formaron las rocas.
Durante el Cenozoico, y en ambiente marino, ya que E
contiene dientes de tiburn, se depositaron los estratos
C, E y G. A continuacin estos materiales emergieron y se
produjo la falla directa F. Despus actu la erosin, igualando el relieve. Posteriormente, sobre estos materiales se
depositaron los estratos D y B, en ambiente continental,
ya que D contiene huesos de mamut, lo cual indica que
estos dos estratos son del Cuaternario (el D corresponde

1. Orden de los estratos: D, A, G, H, C, J, E, L, K, B, I.


2. En este corte se observan dos fases de plegamiento. La
primera afecta a la serie de estratos D, A, G, H, que corresponden al Paleozoico, ya que uno de ellos contiene
Trilobites. La segunda afecta a los anteriores y adems
a la serie C, J, E, L, los cuales datan del Mesozoico, pues
contienen ammonites. La falla, de tipo directo, es posterior a todos ellos y anterior a la serie K, B, I (del Terciario,
por contener nummulites), ya que no les afecta.
3. La regin se halla sumergida bajo el ocano durante el
Paleozoico, formndose los estratos D, A, G, H. Posteriormente emerge, a consecuencia del plegamiento (Hercnico?) y la erosin arrasa parte de los pliegues formados,
allanando el terreno.
En el Mesozoico la zona vuelve a quedar bajo las aguas y
se deposita la serie C, J, E, L. Al final de la era se produce
un nuevo plegamiento (orogenia Alpina) que inclina los
estratos y despus se produce la falla directa F (distensiva).
La regin queda de nuevo sobre el nivel del mar y sufre la
erosin.
Tiene lugar una nueva invasin del mar, en el Cenozoico y,
sobre los materiales anteriores, se deposita la serie K, B, I, que
quedar despus a la intemperie al retroceder las aguas una
vez ms, y comenzar por tanto un nuevo proceso erosivo.

ACTIVIDADES FINALES
PARA REPASAR
1 En qu consiste el mtodo radiomtrico de datacin en geologa?
El mtodo radiomtrico se basa en la desintegracin espontnea de algunos istopos de elementos qumicos como el

23

3 LA HISTORIA DE LA TIERRA
uranio. Dichos tomos son inestables, emitiendo partculas
muy energticas para transformarse en otros estables. Este
proceso se llama desintegracin radiactiva y ocurre de manera ininterrumpida y a una velocidad constante, igual que
las agujas de un reloj.
2 Nombra y explica los principios bsicos utilizados
en la datacin relativa.
La datacin relativa se basa en tres principios bsicos:
Principio de superposicin de estratos: cada estrato es
ms moderno que el que tiene debajo y ms antiguo que
el que se halla por encima.
Principio de superposicin de fenmenos: cada fenmeno geolgico es ms moderno que aqullos a los que
afecta, y ms antiguo que los que le afectan a l.
Principio de continuidad: un estrato concreto tiene la
misma edad en todos los lugares donde se halle.
3 Qu se entiende por fsiles gua? Qu caractersticas debe tener un fsil para ser considerado fsil gua?
Fsiles gua o caractersticos son los que se usan para determinar la edad de las rocas en las que se encuentran, pues
renen tres importantes condiciones:
Haber existido durante cortos periodos de tiempo.
Haber tenido una gran dispersin geogrfica.
Ser muy comunes en los estratos sedimentarios.

Es interesante crear una discusin en el aula sobre la validez


de la teora, pues ayuda a comprender el funcionamiento de
la biosfera.
6 Escribe y completa en tu cuaderno las siguientes
frases:
El descubrimiento de la energa atmica y la radiactividad han permitido calcular la edad de la Tierra en unos
4 500 millones de aos.
El actualismo afirma que los procesos geolgicos que
tuvieron lugar en el pasado no son diferentes a los
que ocurren actualmente.
Los fsiles ms antiguos datan de hace unos 3 500 millones de aos y son organismos sin ncleo celular (procariotas), posiblemente bacterias filamentosas.
La fauna de Ediacara existi hacia finales del en Proterozoico y eran animales de cuerpo blando, semejantes
a gusanos, medusas y otros tipos hoy desaparecidos.
La mayor parte del carbn se form por la descomposicin anaerobia de los bosques carbonferos, en la
segunda mitad de la era Paleozoica.
7 Copia en tu cuaderno este crucigrama y coloca en l los
nombres de los perodos del Paleozoico y el Mesozoico.
C

La progresiva reduccin del CO2 atmosfrico y su sustitucin por el oxgeno, debido a los organismos fotosintticos. Permiti la aparicin de los organismos aerobios.
El enriquecimiento de la atmsfera en oxgeno dio lugar a
la capa de ozono, la cual comenz a absorber la radiacin
ultravioleta del Sol, impidiendo que sta llegara a la superficie, donde resultaba letal para cualquier organismo.
Esto ltimo permiti la colonizacin de los continentes
por los seres vivos, que cambiaron su aspecto radicalmente.
5 Explica la teora de Gaia y su significado en cuanto
a la evolucin del planeta. Qu opinin te merece dicha
teora?
La teora de Gaia afirma que la biosfera ha ido creando en el
planeta las condiciones adecuadas para el mantenimiento
de la vida a lo largo de miles de millones de aos. As por
ejemplo, a medida que el Sol va emitiendo mayor cantidad
de energa solar, los vegetales reducen el CO2 atmosfrico y
por tanto el efecto invernadero.

24

A
J

4 Explica de qu manera los seres vivos han influido


en la evolucin del planeta.
La actividad biolgica introdujo varios cambios de gran importancia en las caractersticas del planeta, de manera que
actualmente su aspecto es muy diferente al que tendra si en
l no se hubiese desarrollado la vida. Estos cambios fueron:

R
A

A
C

PARA APLICAR
8 Teniendo en cuenta que la vida media del carbono 14
es de 5 730 aos, cul es la edad de un fsil cuya cantidad de C14 se redujo a 1 de la cantidad inicial?
32
En cada vida media, la mitad del carbono 14 existente en la
muestra se transforma en nitrgeno 14, de manera que
la cantidad que permanece en la muestra se ve reducida de
la siguiente manera:
Nmero de vidas
medias

Cantidad
de C14

1
2
3
4
5

12 Imagina que con una mquina del tiempo pudisemos retroceder a pocas pasadas de la Tierra. Qu seres
vivos podramos encontrar si retrocediramos 400, 300,
200, 150, 50 y 1,5 millones de aos?

1
2
1
4
1
8
1
16
1
32

Hace (m.a.)

Han transcurrido cinco vidas medias, por lo tanto, el tiempo


transcurrido es:
5 730 5 = 28 650 aos
9 Responde:
a) Pueden ser considerados fsiles caractersticos las
gimnospermas, los anfibios o los reptiles en general?
Los anfibios y reptiles aparecieron en el Paleozoico y las gimnospermas en el Mesozoico. Ninguno de estos grupos se ha
extinguido, por lo que no cumplen la condicin de haber
existido por un corto periodo de tiempo.
b) Puede serlo alguna especie concreta de dichos
grupos?
Determinadas especies de esos grupos s pueden servir como
fsiles gua, pues cada especie vive durante un intervalo de
tiempo relativamente corto. Para ser considerados fsiles gua
debern cumplir tambin las otras condiciones (gran dispersin geogrfica y haber dejado abundantes restos fsiles).
10 Es compatible la hiptesis de que los dinosaurios
se extinguieron como consecuencia de la cada de un
meteorito con la interpretacin actual de la forma en que
ocurren los cambios en el planeta?
La teora ms aceptada actualmente es el neocatastrofismo, una teora basada en el actualismo que admite la
existencia de acontecimientos catastrficos ocasionales
que dan lugar a cambios bruscos. Por tanto, dicha teora es perfectamente compatible con la suposicin de
la cada de un meteorito como causante de la extincin
mesozoica.

Periodo

Principales seres vivos

1,5

Cuaternario

Mamut, tigre dientes de sable,


oso de las cavernas,
ser humano

50

Terciario

Nummulites, tiburones, algunos mamferos

150

Jursico

Dinosaurios, aves

200

Trisico

Ammonites, reptiles

300

Carbonfero

Bosques de helechos, grandes


insectos

400

Devnico

Moluscos, artrpodos, vertebrados (peces acorazados)

13 Indica a qu en, era o periodo se refieren las siguientes frases y ordnalas por antigedad:
Tienen lugar las cuatro glaciaciones ms recientes.

Cuaternario
(Pleistoceno)

La orogenia alpina da lugar a las cordilleras


actuales.

Cenozoico
(Terciario)

Se rompe Pangea II y se abre el ocano Atlntico. Mesozoico


Se forma la Pangea de Wegener.

Paleozoico
(Carbonfero)

Fragmentacin de Pangea I.

Paleozoico
(Cmbrico)

Las tierras emergidas se renen formando


Pangea I.

Proterozoico

Aparece la vida en la Tierra.

Arcaico

A l pertenecen las rocas ms antiguas.

Hdico

14 Interpreta el siguiente corte geolgico:

11 Nombra las principales orogenias habidas hasta la


actualidad e indica cundo ocurri cada una de ellas. Cita
cuatro cordilleras del continente eurasitico formadas
en la ltima orogenia. Han terminado ya de elevarse?
Orogenia

Era

Alpina

MesozoicoCenozoico

Hercnica

Paleozoico (DevnicoPrmico)

Caledoniana

Paleozoico (CmbricoSilrico)

La cordillera Btica, los Pirineos, los Alpes, los Crpatos, los


Balcanes, el Cucaso, los Urales y el Himalaya.
El plegamiento alpino contina en la actualidad, por lo que
las cordilleras no han detenido su crecimiento.

1. Orden de los materiales: J, C, H, B, I, G, D (un dique de una


roca filoniana), A, E.
2. No hay plegamientos, tan slo la falla inversa F. La primera serie de estratos corresponde al Cenozoico, por conte-

25

3 LA HISTORIA DE LA TIERRA
ner nummulites, y la segunda, al Cuaternario, al haberse
hallado restos de homnidos.
3. La regin se hallaba sumergida en el Cenozoico, habindose depositado la serie J, C, H, B, I, G. A continuacin se
produce la irrupcin de la roca filoniana D y posteriormente la falla inversa F. Los materiales emergen y quedan
expuestos a la erosin.
A continuacin se depositan, en ambiente continental, los
estratos A, E, durante el Cuaternario y despus comienza un
nuevo proceso erosivo, en el que participa tambin un ro
que actualmente discurre por la zona.
15 Copia en tu cuaderno la silueta de los continentes y
representa mediante flechas el movimiento migratorio
del hombre primitivo en su colonizacin de los continentes a lo largo del Cuaternario.

PARA AMPLIAR
16 En qu poca existi el Archaeopteryx litographica? A qu grupo de animales perteneca? Averigua qu
importancia tiene en la paleontologa y en qu rasgos
de su anatoma est fundamentada tal importancia.
El Archaeopteryx fue una de las primeras aves que existieron,
vivi en el Jursico. En realidad parece ser una especie de transicin entre los reptiles y las aves, ya que presenta caractersticas
de ambos: como reptil posee dientes, garras y cola; pero tambin
tiene plumas como las aves. En eso radica su importancia.
17 Identifica los fsiles de la figura. Busca informacin
en guas de fsiles, enciclopedias o Internet y responde
a las siguientes cuestiones:
De qu era son caractersticos?
Describe su anatoma.
En qu ambiente vivan?
Nombre: trilobites Anatoma
Era: paleozoico

Caparazn dividido longitudinalmente


Grupo: artrpodos en tres lbulos. Transversalmente tambin se distinguen tres partes:
Ambiente: marino Cefaln, de forma semicircular. La
zona central es la glabela, y las laterales,
mejillas, en las que se hallan dos ojos compuestos. La boca est bajo la glabela.
Trax, cada segmento tena un par
de apndices para la locomocin y la
respiracin.
Pigidio.

26

Nombre:
ammonites

Anatoma

Era: Mesozoico

Concha arrollada en espiral y diviGrupo: moluscos dida en compartimentos mediante


tabiques, de los que se puede ver
cefalpodos
la lnea de sutura en muchos ejemAmbiente: marino plares.
El animal viva en la ltima cmara
y la concha creca al ir aadindose
nuevos tabiques. El resto de las cmaras estaba ocupado por un lquido y gas, mediante los cuales regulaban su flotabilidad en el mar.
Tambin son frecuentes las costillas,
unos engrosamientos de la concha,
muy marcados, generalmente dispuestos radialmente.

Nombre:
nummulites

Anatoma

Era: Cenozoico

Eran protozoos unicelulares con


pseudpodos que les servan para
desplazarse, capturar el alimento y
construir un caparazn arrollado en
espiral.
El caparazn tena forma de disco,
dividido en cmaras comunicadas
entre s a travs de numerosas aberturas (formenes), por los que extendan sus pseudpodos.

Grupo:
foraminferos
(protozoos)
Ambiente: marino

18 Averigua en qu intervalos de tiempo del Cuaternario coexistieron los hombres de Neandertal y de Croman. Por qu han recibido dichos nombres? De cul de
los dos deriv el ser humano actual?
Posiblemente ambos convivieron unos 10 000 aos, entre
hace 40 000 y 30 000 aos, momento en que el Neandertal
se extingue.
Los nombres proceden de los lugares en que fueron descubiertos por primera vez: el valle de Neander, Alemania, en
1856, y la cueva de Cro-Magnon, en Francia, en 1868.
El Neandertal se extingui sin dejar sucesores. El Croman
continu su existencia y de l deriv la especie humana
actual.

PON EN PRCTICA

Grfica de variacin de la duracin del da

RECONOCIMIENTO DE ALGUNOS FSILES


DEL LABORATORIO
Haz una ficha de cada ejemplar, anotando los siguientes
datos:
Clasificacin: reino, tipo, clase, gnero.
Cundo existi?: era, periodo
En qu medio viva?: marino, terrestre
Dibujo o foto. Puedes dibujar el fsil, hacerle una
foto (o bien obtenerla en Internet) y pegarla en la
ficha.
Breve descripcin del ejemplar (por detrs de la ficha).
Respuesta libre.

INVESTIGACIN
CIENTFICA

La grfica se aproxima bastante a una lnea recta. Representa


el alargamiento de los das a lo largo de toda la historia de la
Tierra. Significara que la duracin del da ha ido aumentando
de manera constante.
4 Tomando como datos de referencia los relativos al
Cmbrico y el Jursico, calcula cunto tiempo se retrasa
la Tierra aproximadamente cada milln de aos en su
movimiento de traslacin.

MTODOS DE DATACIN
1 Cuntos aos se pueden abarcar al relacionar los
anillos de los tres rboles de la figura de la pgina anterior?
Entre los tres rboles estn representados un total de 25 aos.
2 Si actualmente un ao tiene 365 das y cada da consta de 24 horas, completa los datos de la tabla, obtenidos
a partir del nmero de estras de crecimiento de corales
fsiles:
Hace
(m. a.)

Periodo
o en

Estras
(= das)

Duracin
del da (h)

200

Jursico

380

23

360

Carbonfero

390

22,5

400

Devnico

400

22

570

Cmbrico

420

21

1500

Proterozoico

800

11

3 Representa en una grfica estos datos: en horizontal el tiempo pasado, desde el Proterozoico hasta la
actualidad y en vertical utiliza las dos escalas: a la izquierda, el nmero de das del ao y a la derecha la duracin
del da. Cmo es la grfica resultante? Cul es su significado?

Entre el Cmbrico y el Jursico hay en la tabla 370 millones


de aos y el da se ha alargado un total de dos horas (7 200
segundos). Esa tasa de cambio representa unos 20 segundos
de retraso por cada milln de aos.
5 Cuntos aos estn representados en las varvas
glaciares de la foto de la pgina anterior? Numralas de
abajo hacia arriba. Cules corresponden al ao ms clido y al ms fro?
10 varvas glaciares = 10 aos.
Teniendo en cuenta que una varva gruesa se forma porque el deshielo ese ao fue ms intenso porque hubo ms
calor, y las varvas delgadas indican aos fros, podemos
afirmar que:
Varva 1: Sin respuesta, pues no se aprecia la varva en su totalidad.
Varva 2: fro.
Varva 3: fro.
Varva 4: uno de los ms clidos.
Varva 5: clido.
Varva 6: clido
Varva 7: el ms fro.
Varva 8: clido.
Varva 9: uno de los ms clidos.
Varva 10: sin respuesta, pues no se aprecia la varva en su
totalidad.

27

4 LA CLULA, UNIDAD DE VIDA


QU SABES DE?
1 Por qu se considera la clula como la unidad de
vida?
Por ser la estructura ms sencilla capaz de desarrollar autnomamente las funciones vitales de nutricin, relacin y
reproduccin.
2 Cmo y dnde se encuentra almacenada la informacin gentica de la clula?

La informacin gentica se almacena en forma de secuencia


de nucletidos en la molcula de ADN. El ADN se encuentra
en el interior del ncleo en las clulas eucariotas y dispersa en
el citoplasma de las clulas procariotas.

Los dos tipos de clulas a las que se alude en el texto


son las clulas somticas y las clulas reproductoras o
gametos.

3 Cuntos cromosomas tiene una clula humana?


Tienen la misma cantidad de cromosomas todas las
clulas del cuerpo? Esa cifra, es igual en todas las especies?
Las clulas humanas tienen 46 cromosomas. Todas las clulas del cuerpo tienen la misma cantidad de cromosomas,
excepto los gametos que poseen la mitad (23). El nmero de
cromosomas es diferente en cada especie.
4 Sabes qu es la meiosis? Para qu sirve?
La meiosis es un tipo de divisin celular que sirve para que los
organismos con reproduccin sexual formen los gametos.
5 Indica si las siguientes afirmaciones son verdaderas
o falsas:

a) Las clulas procariotas carecen de ncleo, pero poseen


los mismos orgnulos que las eucariotas.

b) Las clulas vegetales carecen de mitocondrias y poseen


cloroplastos.

c) Los genes son segmentos de ADN situados en los


cromosomas.

d) Las clulas producidas tras una mitosis son idnticas


entre s.

e) Todos los gametos de un individuo son iguales.

ACTIVIDAD INICIAL
CLULAS MORTALES E INMORTALES
Los expertos en gentica y en envejecimiento celular
discuten sobre la existencia de un reloj biolgico que
marque un lmite para la vida. Para unos, las clulas estn
programadas para dividirse un nmero finito de veces y

28

morir. Para otros, ese programa no existe, la vida nunca


se rinde ante la muerte.
Quiz la razn est repartida entre ambas partes. En el
cuerpo existen dos tipos de clulas: unas, cuyos genes
no se transmiten a la descendencia, envejecen y mueren
porque acumulan errores a lo largo de su vida, y otras,
consideradas inmortales porque se transmiten de generacin en generacin.

Seras capaz de reconocer en tu cuerpo esos dos tipos de clulas?

Ests de acuerdo con esa distincin entre clulas


mortales e inmortales?

Respuesta abierta.

ACTIVIDADES
1 Por qu los orgnulos celulares no forman parte de
los niveles biticos?
Los orgnulos son asociaciones de macromolculas incapaces de vivir autnomamente.
2 En qu nivel encuadraras a los virus? Por qu?
En el nivel molecular. Los virus son complejos macromoleculares que no pueden llevar vida independiente, para reproducirse necesitan infectar clulas vivas.
3 A qu niveles de organizacin pertenecen los siguientes ejemplos?

Colmena:
Hgado:
Neurona:
ADN:
Mitocondria:
Lago:
Electrn:
Carbono:

nivel de poblacin.
nivel pluricelular.
nivel celular.
nivel molecular.
nivel molecular.
nivel de ecosistema.
nivel subatmico.
nivel atmico.

4 Por qu al evitar el contacto del aire con las muestras se suprime la generacin espontnea?
En el aire se encuentran suspendidos microorganismos (bacterias, esporas de hongos, etc.) que contaminan las muestras
y crecen sobre ellas. Tambin, a travs del aire, los insectos
llegan a las muestras y depositan sobre ellas huevos que originarn nuevos individuos.

5 Qu significa que la clula es la unidad morfolgica,


fisiolgica y gentica de los seres vivos?

12 Indica las semejanzas y las diferencias entre cromatina y cromosomas.

Unidad morfolgica: que todos los organismos estn


constituidos por clulas.
Unidad fisiolgica: que la clula posee las estructuras necesarias para realizar por s sola las funciones de nutricin
y relacin.
Unidad gentica: que la clula contiene sus instrucciones
almacenadas en una molcula que se puede transmitir
de generacin en generacin.

Semejanzas: comparten la composicin, ambos estn


constituidos por molculas de ADN.
Diferencias: en la estructura, la cromatina es el estado
del ADN en la clula interfsica y se encuentra en forma
de filamentos descondensados. Los cromosomas slo
aparecen en la clula en divisin y en ellos el ADN alcanza
su mayor grado de empaquetamiento.

6 Indica cmo se podran observar las siguientes estructuras biolgicas, a simple vista, con el microscopio
ptico o con el electrnico:

Glbulo rojo (7 m): microscopio ptico.


Virus (80 m): microscopio electrnico.
vulo humano (100 m): simple vista.
Molcula de hemoglobina (7 m): microscopio electrnico.

7 Qu tipos de organismos se incluyen en el grupo


de los microorganismos?

Bacterias: reino Procariotas.


Algas microscpicas y Protozoos: reino Protoctistas.
Mohos y levaduras: reino Hongos.
Virus.
8 Dnde se clasifican los virus?

Los virus se clasifican dentro del grupo microorganismos,


pese a ser incapaces de realizar autnomamente las funciones vitales bsicas.
9 Por qu sera incorrecto hacer la siguiente afirmacin: Los tres componentes bsicos de las clulas son
membrana, citoplasma y ncleo?
Porque las clulas procariotas carecen de ncleo. Sera correcto
citar: membrana, citoplasma y material gentico.
10 En la siguiente lista de componentes de una clula
procariota sobran algunos trminos, cules son?
Pared, ncleo, ribosomas, membrana plasmtica, mitocondria, ADN, lisosomas, centrolos.
Sobran: ncleo, mitocondria, lisosomas y centrolos, ya que
las clulas procariotas carecen de ellos.

13 Son siempre visibles los cromosomas de una clula?


Por qu?
No, slo se forman cuando la clula va a dividirse. En la interfase el ADN est en forma de cromatina.
14 Qu es la interfase?
Es la etapa de desarrollo celular y no divisin.
15 Cules son los tres componentes de un nucletido?
Una pentosa (desoxirribosa, en el ADN y ribosa, en el ARN), una
base nitrogenada (hay cuatro diferentes) y un grupo fosfato.
16 Construye una frase que describa la estructura del
ADN en la que figuren los siguientes trminos: doble hlice, antiparalelas, polinucletidos, complementarias.
La estructura del ADN consta de dos cadenas de polinucletidos, con orientacin antiparalela y enlazadas entre
s mediante uniones complementarias entre las bases, que
se disponen en el espacio en forma de doble hlice.
17 Por qu la duplicacin del ADN debe producirse
antes de la divisin celular?
Para que cada clula hija reciba una copia idntica de las
instrucciones genticas contenidas en el ADN.
18 Explica las dos propiedades
del ADN. Haz un dibujo esquemtico sobre la duplicacin del ADN

Capacidad para duplicarse y


formar copias idnticas de s
misma que sern repartidas entre las clulas hijas durante la divisin celular.

Capacidad para almacenar


informacin. La variacin del
nmero y del orden de los nucletidos genera infinidad de

11 Cmo es la estructura de la membrana nuclear?


La membrana nuclear es doble, consta de membrana nuclear interna y externa. La membrana nuclear externa est
comunicada con el retculo endoplasmtico rugoso. Las dos
membranas se fusionan en algunos puntos para formar los
poros nucleares.

29

4 LA CLULA, UNIDAD DE VIDA


secuencias de ADN que constituyen diferentes mensajes genticos.

25 Por qu el material gentico de los gametos no es


idntico al de la clula madre que los ha originado?

19 Sera correcto llamar a la interfase periodo de reposo? Por qu?

Porque durante la profase de la primera divisin meitica


los cromosomas homlogos intercambian informacin de
origen paterno y materno y se origina una recombinacin
gentica en las cromtidas que recibirn los gametos.

No sera correcto porque durante la interfase se registra la


mayor actividad funcional de la clula. En ocasiones se ha
empleado ese trmino para referirse a un periodo de reposo
en relacin con la divisin celular.
20 Qu tipo de divisin es la encargada de originar las
clulas responsables de los siguientes procesos?:

Crecimiento del pelo: mitosis.


Soldadura de un hueso tras una fractura: mitosis.
Cicatrizacin de la piel tras una herida: mitosis.
Produccin de espermatozoides: meiosis.
Aumento de tamao del hgado: mitosis.
Produccin de vulos: meiosis.

21 El ncleo de una clula humana contiene 46 filamentos de cromatina. Cuntos contendrn sus clulas hijas
tras una mitosis? En qu momento del ciclo celular hubo
en ese ncleo 92 filamentos de cromatina?
Al finalizar la mitosis cada clula hija contiene, tambin,
46 filamentos de cromatina.
Durante la interfase, antes de la divisin, se produce la duplicacin del ADN, por lo que, la cromatina aparece duplicada. En una
clula humana habr 92 filamentos (46 filamentos dobles).
22 Tienes que explicar la mitosis en clase y el profesor
te proporciona dos cajones: uno lleno de hilos estirados
y entremezclados, y otro lleno de hilos en madejas. Qu
cajn utilizaras para representar la cromatina y cul los
cromosomas? Te servira ese ejemplo para explicar la necesidad de empaquetar el ADN en la divisin celular?
La cromatina estara representada por el cajn con hilos estirados y entremezclados, mientras que las madejas se referiran a los cromosomas.
S, porque al estar empaquetado resulta ms fcil repartir el
material gentico en la divisin celular.
23 Qu es la tabicacin?

Porque el nmero de cromosomas de la clula madre se reparte a la mitad entre las dos clulas hijas resultantes de la
primera divisin meitica.
27 Establece una relacin entre el nmero de divisiones
y el nmero de clulas resultantes en la mitosis y en la
meiosis.
En la mitosis hay una nica divisin que origina dos nuevas
clulas. En la meiosis se producen dos divisiones sucesivas
que dan lugar a cuatro clulas hijas.

ACTIVIDADES FINALES
PARA REPASAR
1 Cules son los niveles de organizacin abiticos?
Y los biticos?
Niveles abiticos: subatmico, atmico, molecular.
Niveles biticos: celular, pluricelular, poblacional, ecosistema.
2 A qu nivel de organizacin pertenece un individuo? Es el nivel ms complejo que puede alcanzar? Explcalo.
Cada individuo estara encuadrado en el nivel pluricelular.
No es el nivel ms complejo alcanzado por cada individuo, ya
que varios individuos se agrupan para formar una poblacin
y, posteriormente, esa poblacin se agrupara con otras para
constituir un ecosistema.
3 Qu defenda la teora de la generacin espontnea? Cmo se refut esa teora?

Se trata del proceso de construccin de una pared celular


para separar dos nuevas clulas vegetales.

La teora de la generacin espontnea defenda la aparicin


de seres vivos a partir de materia inerte o inanimada.

24 Por qu es necesaria la meiosis en las especies con


reproduccin sexual?

Se refut con varias experiencias (Redi, Spallanzani, Pasteur)


que demostraron que, al aislar convenientemente las muestras (caldos, trozos de carne, etc.), no se apreciaba desarrollo
de seres vivos.

Para reducir a la mitad el nmero de cromosomas en los gametos, de tal modo que la unin de stos en la fecundacin
permita mantener constante el nmero de cromosomas de
la especie.

30

26 Por qu la primera divisin meitica es reduccional?

4 Qu relacin aprecias entre la aparicin de los microscopios y la publicacin de la teora celular?

El descubrimiento y la posterior mejora gradual de calidad


de los microscopios permitieron observar por primera vez
seres microscpicos. Pudo apreciarse cmo tejidos vegetales
y animales estaban constituidos por estructuras ms pequeas, que resultaron ser comunes a todos los seres vivos y se
denominaron clulas.

11 Cules son los componentes del ncleo celular?


El ncleo celular consta de: membrana nuclear, nucleoplasma, nucleolo y cromatina.
12 Haz un dibujo de un cromosoma y sealas sus
partes.

5 Qu unidades de medida se emplean para expresar


el tamao de las clulas eucariotas, de las bacterias y de
los virus?
Clulas eucariotas: empleamos las micras o micrmetros.
Bacterias: se usan los nanmetros.
Virus: requieren los ngstrom.
6 Qu diferencias existen entre las imgenes obtenidas con un microscopio ptico y las de uno electrnico?
El microscopio ptico permite observar clulas enteras
y vivas. Permite observar clulas teidas.
El microscopio electrnico ofrece imgenes en blanco
y negro de clulas muertas, debido a las impregnaciones que deben recibir las muestras antes de su observacin.

13 De qu molculas est compuesto el nucletido


GMP? Y el TMP? En qu se diferencian?

7 Qu reinos estn representados en el grupo de los


microorganismos?

GMP: guanosin monofosfato. Componentes: desoxirribosa,


base (guanina) y grupo fosfato.
TMP: timidin monofosfato. Componentes: desoxirribosa, base
(timina) y grupo fosfato.
Se diferencian en el tipo de base que llevan unida a la desoxirribosa.

El reino Moneras (bacterias), el reino Protoctista (protozoos


y algas microscpicas) y el reino de los Hongos (mohos y
levaduras).

14 Cmo se unen los nucletidos de cada cadena


de ADN? Cmo es la unin entre las dos cadenas del
ADN?

8 Cules son los componentes mnimos de toda clula?

Los nucletidos de cada cadena se unen mediante enlaces


denominados fosfodister.
La unin de las dos cadenas es mediante enlaces entre las
bases de forma complementaria (A-T y G-C).

Membrana plasmtica, citoplasma y material gentico.


9 Cul es la diferencia principal entre clulas procariotas y eucariotas?
La presencia o no de ncleo diferenciado. Las procariotas no
presentan membrana nuclear y no tienen ncleo definido,
mientras que las eucariotas s lo tienen.
10 En cuanto a los orgnulos que poseen, cules son
las diferencias entre clulas animales y vegetales?
Las clulas animales carecen de pared (celulsica), que s est
presente en las clulas vegetales.
Las clulas animales poseen centrolos, que no aparecen en
clulas vegetales.
Las vacuolas de las clulas vegetales son muy grandes y hay
una o dos por clula. En las clulas animales hay muchas vacuolas pequeas (se denominan vesculas).
Las clulas vegetales poseen cloroplastos, orgnulos para realizar la fotosntesis, que no existen en las clulas animales.

15 Cmo se duplica el ADN?


El ADN se duplica abriendo la doble hlice de tal forma que
se puedan utilizar como moldes las dos cadenas originales
para sintetizar (fabricar) dos nuevas cadenas complementarias a las anteriores y originar una nueva molcula de ADN
idntica a la primera.
16 Cmo se encuentra codificada la informacin gentica en el ADN?
La informacin gentica se codifica por medio de la secuencia de nucletidos en la cadena de ADN.
17 Qu ramas de la biologa experimentaron gran
desarrollo tras el descubrimiento de la estructura del
ADN?
La biologa molecular y la biotecnologa.

31

4 LA CLULA, UNIDAD DE VIDA


18 Qu funciones tiene la divisin celular en los organismos pluricelulares?
En los organismos pluricelulares la divisin sirve para crecer,
renovar y reparar tejidos.
19 Cita los principales acontecimientos de cada fase de
la mitosis.
Profase: duplicacin de la pareja de centrolos y migracin
hacia los polos para formar el huso mittico. Desaparicin
de la membrana nuclear. Condensacin de la cromatina para
formar cromosomas.
Metafase: disposicin de los cromosomas en la parte central del
huso mittico. Los cromosomas alcanzan el mayor grado de empaquetamiento y tienen dos cromtidas unidas por un centrmero.
Anafase: los filamentos del huso se acortan y tiran de los cromosomas hacia los polos, llevndose consigo una cromtida
de cada cromosoma.
Telofase: a cada polo ha llegado un juego de cromtidas.
Las cromtidas se descondensan para formar filamentos de
cromatina. Se reconstruye la membrana nuclear.
20 Cmo es la citocinesis en las clulas animales? Y
en las vegetales?

cordero bien caliente, directamente del fuego y lo deposit en una vasija que luego cerr con un tapn tan prieto
que se podra considerar hermtico.. Sin embargo, al
cabo de unos das, el caldo estaba plagado de microorganismos. Cmo lo explicas? Qu haras para evitar que
ese resultado fuese una prueba ms de la generacin
espontnea?
Aunque el envase estuviese bien cerrado contena aire en el
interior y en el aire estn los microorganismos que causaron
la contaminacin del caldo.
Habra que extraer el aire del envase, es lo que se hace en la
actualidad en la conservacin al vaco de muchos alimentos.
24 Relaciona cada ejemplo con su nivel de organizacin:
Bosque
Hidrgeno
Bacteria
Manada
Cloroplasto
Protn

Nivel de ecosistema
Nivel atmico
Nivel celular
Nivel de poblacin
Nivel molecular
Nivel subatmico

25 Completa con S o No la siguiente tabla:


Clula animal

Clula vegetal

Ncleo

Membrana

Pared

No

Mitocondrias

En las clulas vegetales, la existencia de pared impide la estrangulacin por lo que las clulas se separan por tabicacin, por construccin de una nueva pared que divide la clula por la mitad.

Cloroplastos

No

Centrolos

No

Vacuolas

21 Son iguales las clulas hijas de una meiosis? Por


qu?

Ribosomas

Aparato de Golgi

Retculo endoplasmtico

En clulas animales, la citocinesis es por estrangulacin. Un


conjunto de filamentos proteicos forma un anillo contrctil
que se cierra y rompe el citoplasma en dos.

Las clulas hijas o gametos de una meiosis son todas diferentes porque tienen la informacin gentica paterna y materna
entremezclada. El nmero de combinaciones de esa recombinacin hace que, prcticamente, no existan dos gametos,
y, despus, dos personas iguales en el mundo.
22 Cul es la importancia biolgica de la meiosis?
La meiosis es una potente fuente de variabilidad gentica al
producir infinidad de gametos diferentes. Tambin permite
mantener constante el nmero de cromosomas de la especie.

26 Construye la secuencia complementaria de la siguiente cadena de nucletidos:


5. ATCGGCTATAGC.3
Cmo has orientado los extremos? Por qu?
3. TAGCCGATATCG. 5
Los extremos deben ser antiparalelos. Si la original empieza
por 5, la copia debe hacerlo por un extremo 3.
27 Estas afirmaciones contienen errores, corrgelas:

PARA APLICAR
23 John Needham, bilogo ingls del siglo XVIII, relata
la siguiente experiencia: Tom un volumen de caldo de

32

Todas las clulas viven lo mismo. Cada clula presenta


una duracin del ciclo celular diferente.
La divisin del citoplasma se llama interfase. La divisin del citoplasma se llama citocinesis.

La mitosis genera 4 clulas idnticas. La mitosis genera


dos clulas idnticas.
Los organismos con reproduccin asexual forman
gametos mediante meiosis. Los organismos con reproduccin sexual forman gametos mediante meiosis.
En los organismos pluricelulares la mitosis es una
modalidad de reproduccin. En los organismos pluricelulares no es una modalidad de reproduccin; sirve
para crecer, renovar y reparar tejidos.
28 En el siguiente dibujo se muestra una pareja de
cromosomas homlogos que intercambian informacin
durante la profase I de la meiosis. Haz un dibujo del resultado en las clulas hijas de la meiosis I y otro con las
clulas hijas de la meiosis II.

Est representada la mitosis.


a: Telofase
c: Profase
b: Anafase
d: Metafase
30 Completa el siguiente cuadro sobre diferencias entre mitosis y meiosis.
Mitosis

Meiosis

N de divisiones

N de clulas hijas

Dotacin
cromosmica de la
clula madre

2n

2n

Dotacin
cromosmica de las
clulas hijas

2n

Todas las clulas

Clulas madre de
los gametos

Ocurre en

PARA AMPLIAR
31 Busca informacin sobre los distintos tipos de microscopios electrnicos y sus aplicaciones en biologa.
Respuesta abierta.

29 Qu divisin celular representan estos dibujos? Pon


nombre a cada una de las fases y ordnalas.

c)

d)

b)

a)

32 Consigue 46 pinzas plsticas de tender ropa, 23 de


un color y 23 de otro. Esas pinzas representan los 23 pares de cromosomas homlogos de una clula humana
(23 de un color de origen paterno y 23 de otro color de
origen materno). Utiliza esos modelos para explicar en
clase la mitosis y la meiosis.
Cada pinza representa un cromosoma con dos cromtidas. La
parte metlica que une las dos mitades de la pinza representa
el centrmero.
Para explicar la mitosis se debera decir que la duplicacin del
cromosoma ocurri en la interfase. Que el cromosoma en ese
estado (la pinza doble) se hace visible en la profase. Despus se
colocarn todos los cromosomas alineados en el centro de una
mesa y, a continuacin, habra que separar las dos piezas de las
pinzas y llevar cada una a los extremos opuestos de la mesa.
Para la meiosis se deber emparejar los cromosomas (pares
con colores diferentes). Colocarlos ordenadamente y por parejas en el centro de la mesa y, a continuacin, llevar una pinza
entera (un cromosoma) de cada par a los extremos de la mesa.
En cada extremo debe haber 23 pinzas (cromosomas). En la
segunda divisin meitica hacer lo mismo que en la mitosis
citada arriba. El resultado final debe ser cuatro conjuntos de
mitades de pinza (cromtidas).
33 Para demostrar la importancia del descubrimiento
del ADN (ao 1953) en la historia de la biologa, busca
en Internet cuntos premios Nobel de Medicina se han

33

4 LA CLULA, UNIDAD DE VIDA


concedido desde entonces hasta hoy por estudios relacionados con la biologa molecular.
Premios Nobel relacionados con la Biologa Molecular: aos
1958, 1959, 1962, 1965, 1975, 1978, 1980, 1983, 1986, 1987,
1989, 1993, 1994, 1995, 1997, 1999, 2001, 2002, 2006.
Sugerencia: Los alumnos deberan anotar los nombres de los
cientficos y el tema del trabajo que les vali el Nobel.

PON EN PRCTICA
MITOSIS EN CLULAS VEGETALES
Coloca la preparacin en el microscopio y analzala para
encontrar las clulas en divisin. Qu observas?
Respuesta abierta.

INVESTIGACIN
CIENTFICA
UN RELOJ BIOLGICO EN LOS
CROMOSOMAS
1 Cul es el papel de los telmeros en el control del
ciclo celular?

34

Los telmeros se encargan de proteger y organizar a los cromosomas durante la divisin celular. Estn situados en los
extremos de los cromosomas.
2 Por qu la telomerasa convierte en inmortales a las
clulas donde se expresa?
La telomerasa consigue mantener la longitud de los telmeros constante. De esta forma, la divisin celular puede
producirse indefinidamente, pues el telmero no se agota y
puede organizar y proteger al cromosoma durante la divisin
celular indefinidamente.
3 Cmo se podra lograr que las clulas tumorales no
se dividiesen indefinidamente?
Inhibiendo la telomerasa sobre las clulas cancerosas, de
modo que la divisin celular se frenase.
4 Qu es la progeria? Qu caractersticas presentan
las personas afectadas de progeria?
La progeria es el sndrome del envejecimiento prematuro,
debido a una actividad escasa de los telmeros.
Las personas con progeria presentan un acortamiento significativo de los telmeros, de modo que envejecen ms rpido
de lo usual.

GENES Y HERENCIA
QU SABES DE?
1 La informacin que contiene un gen sirve para:
a) Fabricar cada una de las minsculas partes que componen el cuerpo.
b) Fabricar una protena.
c) Fabricar cualquier molcula orgnica de los seres vivos.

Eres capaz de doblar la lengua? Si puedes hacerlo


tendrs los genes AA o Aa. Si eres incapaz de hacerlo,
tus genes sern aa.

Averigua si tus abuelos, padres y hermanos pueden


hacerlo o no y construye un rbol genealgico. Escribe crculos como smbolos que representan a las mujeres y cuadrados para los hombres. Usa lneas para
unir las parejas y sus descendientes. Pon debajo de
cada smbolo sus genes (AA, Aa o aa).

Despus, comenta tus resultados con los obtenidos


por tus compaeros.

Respuesta correcta: b)
2 Si la informacin gentica del ser humano estuviera
formada por 30 000 genes:
a) 15 000 genes seran aportados por el padre y 15 000
por la madre.
b) De los 30 000 genes existen dos copias, una procede
del padre y otra de la madre.
Respuesta correcta: b)
3 Di tu opinin acerca de la exactitud de la siguiente
frase: Los hijos de futbolistas sern buenos futbolistas
porque han heredado de sus padres los genes adecuados
para ese deporte.
Respuesta abierta. La opinin debe ser contraria a lo enunciado
en la frase ya que los caracteres adquiridos no se heredan.
4 Contesta si son verdaderas o falsas las siguientes
afirmaciones:
a) Si ambos progenitores no presentan un carcter determinado no podrn tener un hijo que s lo presente.

b) El sexo en la especie humana depende de la dotacin


de cromosomas del espermatozoide.

c) Existen enfermedades que se manifiestan o no segn el


sexo del individuo.

d) Si una radiacin daa el ADN de cualquiera de mis


clulas, transmitir el dao a mis hijos.

ACTIVIDAD INICIAL
UN GEN PARA DOBLAR LA LENGUA
Determinados caracteres de la especie humana dependen del efecto de un solo gen. De ese gen tenemos dos
copias, una heredada del padre y otra de la madre. Se
utiliza una letra mayscula para simbolizar la copia del
gen cuyo efecto se manifiesta (gen dominante) y una letra minscula para la copia que tambin poseemos, pero
que no se manifiesta (gen recesivo).
La capacidad de doblar la lengua en U es un carcter controlado por un gen dominante (A) y la incapacidad para hacerlo depende de la copia de ese gen y es recesivo (a).

Respuesta abierta. Es interesante para iniciar el estudio de la


gentica utilizar un carcter conocido.

ACTIVIDADES
1 Cmo son los alelos de un gen presentes en las dos
cromtidas de un cromosoma? Y los alelos de un gen de
cromosomas homlogos?
Las dos cromtidas de un mismo cromosoma son idnticas, por lo tanto, los alelos de un gen que contienen son
iguales.
Los cromosomas homlogos tienen los mismos genes pero los alelos de cada gen no tienen por qu ser iguales.
2 En qu se diferencia la codominancia de la herencia
intermedia?
La diferencia se pone de manifiesto en los individuos heterocigotos. En la herencia codominante los heterocigotos presentan
un fenotipo resultado de la expresin de los dos alelos, mientras que en la herencia intermedia, el fenotipo de los hbridos
es una mezcla del de los individuos homocigotos.
3 En los guisantes, la forma lisa de la semilla domina sobre la rugosa. Al cruzar guisantes lisos se obtiene
cierta cantidad de guisantes rugosos. Cmo son los
genotipos de los guisantes lisos cruzados? Por qu?
Qu proporcin de guisantes rugosos se espera encontrar?
L: liso
l: rugoso

Planteamiento:
Liso x Liso

Solucin:
Ll x Ll

Rugosos?

LL Ll ll

Genotipo de los guisantes lisos cruzados: Ll. Al contener


ambos el alelo l, hacen posible la obtencin de guisantes
rugosos (ll) en la descendencia.
Proporcin de guisantes rugosos: .

35

5 GENES Y HERENCIA
4 En un cruce entre dos hbridos de guisantes amarillos se obtienen 120 guisantes. Cuntos sern amarillos?
Y cuntos verdes?
A: amarillo
a: verde
Planteamiento:
Amarillo x Amarillo
20 guisantes

8 Si una pareja tiene tres hijas, cul es la probabilidad


de tener un hijo en el prximo embarazo? Por qu?
La probabilidad de tener hijo o hija es siempre del 50 % independientemente del sexo de los hijos anteriores.

Solucin:
Aa x Aa

AA : Aa: aa
amarillos. de 120 = 90 amarillos
verdes. de 120 = 30 verdes

5 Cuntos fenotipos se obtendrn y en qu proporciones al cruzar una planta dihbrida de guisantes amarillos y lisos con una de guisantes verdes y rugosos?
A: amarillo
L: liso
a: verde
l: rugoso
Planta dihbrida amarillos/lisos: AaLl
Planta guisantes verdes/rugosos: aall

9 Existen hombres portadores de caracteres ligados


al sexo? Por qu?
No existen hombres portadores ya que poseen slo una copia de los genes existentes en sus cromosomas X e Y.
10 Cmo seran los hijos e hijas de una pareja en la
que ella es portadora del gen para el daltonismo y l es
daltnico? Indica los genotipos.
XDXd: mujer portadora
XdY: hombre daltnico
XDXd x XdY

P: AaLl x aall
Gametos: AL, Al, aL, al al
F1:
AL

Al

aL

al

al

AaLl

AaLl

aaLl

aall

Fenotipos

amarillos/lisos

amarillos/lisos

verdes/
lisos

verdes/
rugosos

6 La F2 de un cruce entre dos razas puras de guisantes


amarillos-lisos y verdes-rugosos produjo 566 semillas,
de las cuales 315 eran amarillas-lisas, 101 amarillas-rugosas, 108 verdes-lisas y 32 verdes-rugosas. Pudieron ser
sos algunos de los resultados obtenidos por Mendel?
Por qu?
A: amarilla L: lisa
a: verde
l: rugosa
P: AALL x aall
gametos: AL
al
F1: AaLl
AaLl x AaLl
gametos: AL Al aL al
AL Al aL al
F2: 566 semillas:
315 amarillas/lisas
315/32 = 9,84 9
101 amarillas/rugosas
01/32 = 3,16 3
108 verdes/lisas
108/32 = 3,38 3
32 verdes/rugosas
32/32 = 1

36

Las clulas seleccionadas deben estar en divisin ya que es el


nico estado en que resulta posible observar los cromosomas.

gametos

XD

Xd

Xd

XDXd

XdXd

XDY

XdY

XDXd: hijas portadoras


XdXd: hijas daltnicas
XDY: hijos normales
XdY: hijos daltnicos
11 Imagina el caso de una mujer y un hombre no hemoflicos que esperan un hijo. Supn que el padre y el hermano de ella son hemoflicos y su madre es normal. Qu
probabilidad existe de que su hijo sea hemoflico?

Hermano
XhY

Madre
XHXh

Padre
XhY

Mujer
XHXh

Hombre
XHY

gametos

XH

Xh

XH

XHXH

XHXh

XY

XhY

Hijo hemoflico: XhY Probabilidad: o 25 %

Como las proporciones de la F2 son 9:3:3:1 estos resultados pudieron ser los encontrados por Mendel al cruzar dos razas puras
para dos caracteres, en sus experiencias sobre la tercera ley.

12 Por qu el cdigo gentico relaciona tripletes


de nucletidos de ARN y no de ADN con los aminocidos?

7 En qu estado del ciclo vital deben encontrarse las clulas empleadas para obtener un cariograma? Por qu?

En el cdigo gentico se relacionan tripletes de ARN porque


los ribosomas, los orgnulos traductores, leen la informacin

contenida en el ARNm que es una copia de las instrucciones


del ADN.
13 Por qu extremo comenzar la traduccin de este
ARNm?
1 AAUAUUUCAUAAGUA 2
Razona tu respuesta. Qu aminocidos se obtendrn?
La traduccin comienza siempre por el triplete AUG que en
este fragmento se encuentra en el extremo 2 .
Los aminocidos obtenidos sern:
Met - Asn Thr Leu Stop.
14 Si los rayos ultravioleta del Sol causan mutaciones
en el ADN de las clulas de la piel de una persona, el cncer que padecer se transmitir a sus hijos? Por qu?
El cncer no ser transmitido a sus hijos, ya que slo se transmiten las alteraciones que afecten al material gentico de las
clulas reproductoras o gametos.
15 Cuntos cromosomas contiene el cariotipo de las
personas afectadas por los sndromes de Down, Edwards
y Patau?
Los tres sndromes son debidos a mutaciones cromosmicas
de tipo trisomas por lo que en todos los casos las personas
afectadas tendrn 47 cromosomas (uno ms que los 46 normales).

ACTIVIDADES FINALES
PARA REPASAR
1 Qu informacin contienen los genes?
Los genes tienen la informacin necesaria para sintetizar
una protena relacionada con un determinado carcter del
individuo.

En los hbridos de una herencia codominante se expresan los


dos alelos, por lo que su fenotipo contiene los dos caracteres.
En la herencia intermedia, los hbridos expresan un carcter
intermedio o mezcla de los dos alelos implicados.
Para un gen con dos alelos: rojo y blanco. Hbrido codominante: fenotipo rojo y blanco. Hbrido intermedio: fenotipo
rosa.
5 Cmo obtuvo Mendel las razas puras utilizadas en
sus cruces?
Mendel obtuvo sus razas puras mediante autofecundacin,
usando el polen de una flor para fecundar los vulos de la
misma flor, durante varias generaciones.
6 Cmo son los individuos de la F1 de un cruce entre
dos razas puras? Y los de la F2? Qu leyes de Mendel
explican estos resultados?
Los individuos de la F1 de un cruce entre dos razas puras son
todos iguales. Los individuos de la F2 son diferentes, pertenecen a dos fenotipos en proporcin 3:1 (3 del tipo dominante
y 1 del tipo recesivo).
La uniformidad de la F1 es el principio fundamental de la
1. ley de Mendel y las proporciones 3:1, con la reaparicin
en la F2 del tipo recesivo, son explicadas por la 2. ley de
Mendel.
7 Qu condicin tienen que reunir los genes para que
se cumpla la tercera ley de Mendel?
La tercera ley de Mendel se cumple siempre que los genes
estudiados estn localizados en cromosomas diferentes y as
sean independientes.
8 Qu tipos de cromosomas componen un cariotipo
humano?
Un cariotipo consta de cromosomas autosmicos y cromosomas sexuales. En el caso humano se trata de 44 autosomas
(22 pares) y 2 cromosomas sexuales (1 par).

2 Cuntos alelos posee un individuo diploide para


cada carcter?

9 De qu depende el sexo de los seres humanos?

Los individuos diploides presentan dos dotaciones cromosmicas por lo que para cada carcter tienen dos alelos, un
alelo en cada uno de los dos cromosomas.

El sexo de los seres humanos est determinado cromosmicamente (depende de la dotacin cromosmica del individuo) por la presencia de una pareja de cromosomas sexuales
(XX en las mujeres y XY en los hombres).

3 Qu son los cromosomas homlogos?


Los cromosomas homlogos son parejas de cromosomas,
uno de procedencia materna y otro paterna, que contienen
la misma informacin gentica, con los mismos genes localizados en las mismas posiciones.
4 Cmo son los hbridos en una herencia codominante? Y en una herencia intermedia?

10 Qu son los caracteres ligados al sexo?


Los caracteres ligados al sexo son aquellos que se encuentran localizados en los segmentos diferenciales (los que no
son homlogos) de los cromosomas X e Y. Por ser mucho
ms numerosos, habitualmente reciben este nombre los
caracteres localizados en el segmento diferencial del cromosoma X.

37

5 GENES Y HERENCIA
11 Qu es el cdigo gentico? Cules son sus caractersticas?
El cdigo gentico es la relacin entre tripletes de nucletidos
y aminocidos que sirve a todos los seres vivos para fabricar
protenas a partir de la informacin contenida en los genes.
Sus dos principales caractersticas son: ser universal, utilizado por
todos los seres vivos, y redundante, la mayora de los aminocidos estn codificados por ms de un triplete de nucletidos.
12 Cul es el papel de los distintos tipos de ARN en el
proceso de sntesis de protenas?
El ARNm (mensajero) es el soporte mediante el que se traslada la informacin contenida en el ADN hasta los ribosomas
para que sea traducida.
El ARNt (transferente) es el encargado de transportar los aminocidos, dispersos en el citoplasma, hasta el interior del ribosoma para ser unidos y formar la cadena proteica.
El ARNr (ribosmico) es uno de los componentes de los ribosomas, los orgnulos encargados de la traduccin del
mensaje gentico.
13 En qu dos etapas transcurre la sntesis de protenas? Qu se obtiene en cada una?
La sntesis de protenas consta de dos etapas: transcripcin
y traduccin.
En la transcripcin se obtiene ARNm, una copia de las instrucciones genticas contenidas en el ADN.
En la traduccin se obtiene una protena, una secuencia de
aminocidos determinada por la secuencia de nucletidos
del ARNm.
14 Qu tipos de mutaciones existen segn el agente
causante y segn el material afectado por ellas?
Segn el agente causante: naturales o espontneas y artificiales o inducidas.
Segn el material afectado: gnicas o puntuales y cromosmicas.

PARA APLICAR
15 La planta dondiego de noche presenta dos alelos
para el color de las flores: rojo y blanco. Al cruzar variedades de flores rojas con flores blancas se obtuvieron flores
rojas, rosas y blancas. Qu tipo de herencia presenta ese
gen? Indica los genotipos de las plantas implicadas.
R: rojo.
B: blanco (nota: en la herencia intermedia, como excepcin,
se pueden representar los alelos con letras diferentes).
Rojas x Blancas
Rojas, rosas, blancas

38

La existencia de tres fenotipos en la descendencia nos indica que


se trata de una herencia intermedia.
Genotipos: RR x BB
RR: rojas RB: rosas BB: blancas
16 Un problema con las etiquetas de los nidos en la
maternidad de un hospital genera dudas entre dos familias sobre la paternidad de un recin nacido con grupo
sanguneo 0. Utiliza los datos con los grupos sanguneos
de los afectados para explicar a qu familia pertenece el
beb.
Madre

Padre

Familia 1

Familia 2

AB

Genotipo del beb: 00. Hereda un alelo 0 de su padre y uno


0 de su madre.
Como la madre de la familia 2 carece de alelo 0, el beb no
puede ser suyo.
En la familia 1, el genotipo de la madre sera 00 y el del padre
A0, ambos pueden aportar un alelo 0 a su hijo.
17 En los guisantes, el color de las flores depende de un
gen con dos alelos: rojo y blanco. En la tabla siguiente
se muestran los resultados de diferentes cruzamientos,
observa y contesta:
Cruzamientos

Flores rojas

Flores blancas

I. Rojas x blancas

130

II. Blancas x blancas

140

III. Rojas x rojas

179

58

IV. Rojas x blancas

128

131

a. Qu herencia sigue ese gen?


Herencia dominante. El alelo rojo domina sobre el blanco.
B: rojo b: blanco
b. Cules son los genotipos de los progenitores y de
sus descendientes?
Cuzamiento I:
P: BB x bb
F1: Bb (130 rojas)
Cruzamiento II: P: bb x bb F1: bb (140 blancas)
Cruzamiento III: P: Bb x Bb
F1: BB (rojas) Bb (rojas)
bb (blancas) rojas (179) : blancas (58)
Cruzamiento IV: P: Bb x bb F1: Bb (rojas) bb
(blancas) rojas (128) : blancas (131)
c. Qu ley de Mendel se cumple en el cruce III? Por qu?
Se cumple la 2. ley de Mendel. Al cruzar dos heterocigotos
se obtienen dos fenotipos en proporciones 3:1.

18 El color de las pas de una especie de erizo depende


de un gen con dos alelos, uno produce pas negras y el
otro, pas blancas. Al cruzar dos erizos heterocigotos se
obtuvieron un 25 % de erizos con pas negras, un 25 % con
pas blancas y un 50 % de erizos con pas negras y blancas. Cmo es la relacin de dominancia entre esos alelos?
Haz un esquema con los genotipos del cruzamiento.
Negras x Negras
negras negras y blancas blancas
Estos resultados indican una herencia codominante entre los
alelos negro y blanco.
N: negra
B: blanca (nota: al tratarse de codominancia pueden emplearse letras distintas para los alelos)
NB x NB
NN (negras): NB (negras y blancas): BB (blancas)
19 En el cruce entre dos variedades de plantas con guisantes lisos se han obtenido un total de 7 324 guisantes. Cuntos guisantes del total sern lisos? Y cuntos rugosos?
L: lisos
l: rugosos
Ll x Ll

21 El daltonismo es un carcter ligado al cromosoma X.


Una mujer con padres daltnicos tiene hijos con un hombre de padre daltnico y madre homocigtica normal.
Cmo sern sus hijos con respecto al daltonismo?
XD: normal
Xd: daltnico
Madre
Padre
XdXd
XdY
Mujer
XdXd

Madre Padre
XDXD
XdY
Hombre
XDY

Hijos:
Xd

Xd

XD

XDXd

XDXd

XdY

XdY

Las hijas sern normales portadoras y los hijos sern daltnicos.


22 El siguiente rbol genealgico muestra la transmisin de un carcter ligado al sexo en tres generaciones
familiares. Deduce los genotipos de todos los individuos.

X A Xa

XAY

L_ (lisos)
de 7 324 = 5 493 lisos
ll (rugosos) de 7 324 = 1 831 rugosos
20 En los guisantes la vaina verde (A) domina sobre
la amarilla (a) y las flores rojas (B) sobre las blancas (b).
Cmo ser la F2 de un cruce entre dos razas puras para
ambos caracteres? Si en la F2 se han obtenido 1 648 plantas, cuntas se espera que haya de cada fenotipo?

F2:

P: AABB x aabb
AB
ab
AaBb
AB Ab aB ab

gametos:
F1:
gametos:

Ab

aB

ab

AB

AABB

AABb

AaBB

AaBb

Ab

AABb

AAbb

AaBb

Aabb

aB

AaBB

AaBb

aaBB

aaBb

ab

AaBb

Aabb

aaBb

aabb

A_bb
aaB_
aabb

XAY

XaY

X A Xa

AB

Fenotipos: A_B_

XAXA

9
de 1648 = 927 Verde/rojas
16
3
= 309 Verde/blancas
16
3

= 309 Amarilla/rojas
16
1
= 103 Amarilla/blancas
16

Xa Xa

XaY

XaY

23 La fibrosis qustica es una enfermedad hereditaria


debida a un gen autonmico recesivo. Dos individuos
sanos, pueden tener un hijo con fibrosis qustica? Con
qu probabilidad?
F: normal
f: fibrosis qustica
Sano x sano

Ff x Ff

hijo enfermo FF (sano): Ff (sano): ff (enfermo)


24 Observa el siguiente fragmento de ADN y contesta:
CTATAATACAATACGGCTTCAATCCGA
a. Averigua la secuencia de ARNm obtenida en la transcripcin.
ARNm: GAU AUU AUG UUA UGC CGA AGU UAG GCU

39

5 GENES Y HERENCIA
b. Localiza los tripletes de iniciacin y finalizacin del gen.
Sealados arriba en negrita.
c. Ayudndote del cdigo gentico, escribe la secuencia
de aminocidos que resulta de la traduccin del gen.
GAU AUU AUG UUA UGC CGA AGU UAG GCU
Met leu cys arg ser stop
25 Realiza la transcripcin y la traduccin del siguiente
gen:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
TACCCTTTC G A C A G T T G T A C T
ADN:
ARNm:
Protena:

T A C C C T T T C G A C A G T TG T ACT
AUG GGA AAG CUG UCA ACA UGA
Met - gly - lys - leu - ser - thr - stop

a) Qu ocurrira si, por una mutacin puntual, se introduce una A entre las C de las posiciones 3 y 4?
ADN con la mutacin: TAC ACC TTT CGA CAG TTG TAC T
ARNm: AUG UGG AAA GCU GUC AAC AUG
Protena: Met - trp - lys - ala - val - asn - met
Cambiara por completo la secuencia de aminocidos de la
protena.

Respuesta abierta.
28 En algunas especies la determinacin del sexo no
depende slo de una pareja de cromosomas sino de toda
la dotacin cromosmica en su conjunto. Averigua cmo
se produce la determinacin del sexo en las abejas.
En las abejas la determinacin del sexo depende de toda
la dotacin cromosmica y no slo de una pareja. Los machos slo tienen un juego de cromosomas, son individuos
haploides y surgen de la divisin de un vulo que no ha sido
fecundado. Las hembras son individuos diploides, con dos
juegos de cromosomas, resultado de una fecundacin.
29 Busca informacin sobre qu tipo de mutacin causa
la radiacin ultravioleta del Sol.
La radiacin ultravioleta provoca alteraciones en las secuencias de nucletidos de ADN. En concreto provoca que en los
lugares donde haya dos timinas (T) la distancia que las separa
se modifique. Esto provoca errores en el momento de la duplicacin del ADN que derivan en la aparicin de tumores en
las clulas de la piel (cncer de piel).

b) Cul sera el efecto de una mutacin puntual sobre el


ADN original que cambiase la G del puesto 14 por una C?

30 Documntate sobre las tcnicas para elaborar un


cariotipo con los cromosomas del feto y la informacin
que proporciona a los futuros padres.

ADN con la mutacin: TAC CCT TTC GAC ACT TGT ACT
ARNm:
AUG GGA AAG CUG UGA
Protena:
Met-gly- lys - leu stop

Respuesta abierta. Deben buscar informacin sobre la tcnica de la amniocentesis y sus aplicaciones para detectar anomalas en la estructura de los cromosomas o en su nmero.

Al cambiar el triplete del ARNm UCA por UGA, que es un


triplete de terminacin, la sntesis de la protena se interrumpira en este punto.

PON EN PRCTICA

26 Efecta los pasos necesarios para deducir la secuencia o secuencias de ADN que codifican la siguiente protena: Met Ile Gln Gly Thr.
Por qu son vlidas varias secuencias de ADN?
Protena: Met Ile Gln Gly Thr
ARNm: AUG AUA CAA GGU ACG
ADN:
TAC TAT GTT CCA TGC
Podran hacerse muchas secuencias de ADN porque a cada
aminocido le corresponden ms de un triplete de ARN y
podran darse muchas combinaciones.

40

tipos y construye un rbol genealgico que represente


la transmisin de ese carcter.

1 Fotocopia y ampla a un folio el recuadro con los


cromosomas.
2 Contesta:
a) Cuntos cromosomas hay? A qu especie pertenecern?
46 cromosomas. Han de pertenecer a la especie humana.
b) De qu sexo es el individuo con ese cariotipo?
Mujer. 22 autosomas + XX

PARA AMPLIAR

3 Realiza las siguientes operaciones:


a) Recorta los cromosomas de la fotocopia por las lneas
de puntos.

27 Averigua el grupo sanguneo de tus parientes ms


directos (abuelos, padres y hermanos), indica sus geno-

b) Empareja los cromosomas homlogos y ordena las


parejas por tamaos. Aydate de los nmeros de la

base y de las letras que figuran en su interior. Qu


representan esas letras?
Las letras representan los alelos de un gen presentes en cada
uno de los dos cromosomas homlogos.

H: corea de Huntington
h: normal
Hh x hh
Hh (afectado) : hh (normal)

c) Separa las parejas para formar la dotacin de cromosomas caracterstica de los gametos. Cuntos cromosomas contienen esos gametos?

2 Si una mujer embarazada se hace radiografas y los


rayos X afectan al feto, qu tipo de enfermedad padecer el beb, hereditaria o congnita? Por qu?

Deben hacerse dos conjuntos de 23 cromosomas cada uno,


figurando en cada conjunto uno de los dos cromosomas homlogos de cada pareja. Cada gameto tendr la siguiente
dotacin cromosmica: 22 autosomas + 1 cromosoma X.

El beb padecer una enfermedad congnita, porque se ha


contrado durante el embarazo y no como resultado de una
herencia materna ya que los gametos, tanto maternos como paternos que participaron en la fecundacin, no estaban
afectados por alteracin alguna.

INVESTIGACIN
CIENTFICA

3 Busca informacin sobre el diagnstico preimplantacional como estrategia para evitar las consecuencias
de determinadas enfermedades hereditarias.

LAS ENFERMEDADES HEREDITARIAS

Respuesta abierta. Deben encontrar informacin sobre


las tcnicas de seleccin de embriones exentos de genes
defectuosos como paso previo a su implantacin en el
tero.

1 La corea de Huntington se debe a un gen autonmico


dominante. Explica por medio de un esquema con genotipos
por qu si uno de los progenitores est afectado, la probabilidad de tener un hijo con la enfermedad es del 50 %.

41

6 LA EVOLUCIN DE LA BIOLOGA
QU SABES DE?
1 La insulina es una hormona que deben inyectarse las
personas diabticas y que en la actualidad se obtiene:
a) Del suero sanguneo de cerdos.
b) De forma sinttica en un laboratorio.
c) Por medio de bacterias en las que se inserta el gen
humano de la insulina.
Respuesta correcta: c)
2 Cmo definiras un alimento transgnico?

Cul es tu opinin? Apruebas este tipo de prcticas?


Pondras algn lmite?

Busca informacin y discute sobre este tema en


clase.

Respuesta abierta.

Un alimento transgnico es aquel que procede de un organismo modificado genticamente.


3 Si quisieras hacer un clon de ti mismo, de qu clula
habra que obtener la informacin, una somtica o un
gameto?
La informacin debe proceder de una clula somtica ya
que posee la totalidad de los cromosomas que contienen el
genoma de la especie.
4 Conoces el proyecto Genoma Humano y sus objetivos?
El PGH es un proyecto cientfico internacional para secuenciar
el genoma de la especie humana.
5 Contesta si son verdaderas o falsas las siguientes
afirmaciones:
La ingeniera gentica permite mezclar el ADN de dos
especies diferentes.

Las bacterias producen muchas sustancias humanas.

Los gemelos idnticos son un ejemplo de individuos


clnicos.

Los alimentos transgnicos an no estn disponibles en los


mercados.

El proyecto Genoma Humano pretende la clonacin de un


ser humano.

ACTIVIDAD INICIAL
EMBRIONES HBRIDOS: MONSTRUOS O
DONANTES?
En septiembre de 2007 la prensa public el permiso concedido por la Autoridad de Fertilizacin Humana y Embriologa (HFEA) de Gran Bretaa para crear embriones
hbridos mediante la inyeccin del ncleo de una clula
embrionaria humana en un vulo animal desprovisto
de su ncleo.

42

El objetivo de los cientficos es utilizar esos embriones


para investigar sobre enfermedades como el parkinson
y el alzheimer. Una consulta pblica promovida por la
HFEA aprueba el proyecto mientras que el Vaticano lo
tacha de acto monstruoso.

ACTIVIDADES
1 Por qu se dice que la ingeniera gentica rompe la
barrera natural entre las especies?
Porque permite introducir genes de una especie en el genoma de otra especie diferente. Las especies poseen mecanismos naturales para impedir la reproduccin entre individuos
que no pertenezcan a la misma especie.
2 Cul es la funcin de las enzimas de restriccin?
Las enzimas de restriccin son las encargadas de reconocer
determinadas secuencias de ADN y cortar la cadena para
generar extremos adherentes que facilitan la unin o hibridacin con fragmentos de otro ADN cortado con la misma
enzima.
3 En qu consiste la tecnologa del ADN recombinante?
La tecnologa del ADN recombinante forma parte de la llamada ingeniera gentica cuyas tcnicas permiten localizar
y cortar un gen de una determinada especie e insertarlo en
el genoma de otra especie distinta.
4 Qu son los vectores? Para qu se utilizan?
Los vectores son molculas, microorganismos o partculas vricas que se utilizan para transportar un ADN de inters (ADN
pasajero) hasta el organismo en el que quiere insertar.
5 Cmo se obtiene insulina humana mediante ingeniera gentica?
Se localiza el gen responsable dentro del genoma humano,
se corta mediante enzimas de restriccin y se incorpora a un
vector (un plsmido) que lo har llegar hasta el interior de
bacterias para que produzcan insulina humana.
6 Qu sustancias de inters para el ser humano son
fabricadas por ingeniera gentica?

Adems de la insulina, se obtienen factores de coagulacin, hormona del crecimiento, interfern, antibiticos y
vacunas.
7 Qu tipo de modificaciones llevan los alimentos
transgnicos de origen vegetal?
Las plantas transgnicas suelen llevar incorporados genes
para hacerlas resistentes a condiciones climatolgicas adversas (sequas y heladas), herbicidas y plaguicidas.
8 Cmo se insertan los genes de inters en los animales?
Los genes externos se introducen en los animales mediante
microinyecciones en el cigoto.
9 Qu objetivos tiene la ingeniera gentica aplicada
a la produccin animal?
En la produccin animal, la ingeniera gentica persigue
aumentos de peso de los ejemplares, mayor produccin de
carne o de leche; produccin de sustancias de inters farmacolgico; creacin de rganos adecuados para trasplantes;
cra de animales como modelos para reproducir y estudiar
enfermedades humanas.
10 Qu relacin existe entre la ingeniera gentica y
los xenotrasplantes?
Mediante ingeniera gentica se introducen genes de protenas humanas en rganos de animales (cerdos) para reducir
el rechazo de un posible xenotrasplante (trasplante de un
rgano animal a un humano).
11 Qu significa que una clula embrionaria sea totipotente?
El trmino totipotente hace referencia a la capacidad de las
clulas embrionarias de convertirse en cualquier tipo de clula del individuo adulto. En esa fase de totipotencia la divisin de las clulas embrionarias puede originar un individuo
adulto completo.
12 Por qu es importante para la clonacin que una
clula reprograme su informacin gentica? Qu tipos
de clulas pueden hacerlo?

En la clonacin reproductiva se extrae el ncleo diploide de


una clula somtica adulta y se transfiere al interior de un
ovocito al que previamente se le ha extrado su ncleo. Se
activa la divisin de ese ovocito hasta la formacin de un
embrin en estado de blastocisto. Una vez alcanzada esa
etapa, el embrin se implanta en el tero para completar el
desarrollo del individuo.
14 Por qu la oveja Dolly no tena la cara negra?
La informacin gentica con la que se cre Dolly provena de una
clula de oveja de la raza Finn Dorset (con cara blanca). La oveja de
raza Scottish Blackface (blanca con cara negra) aport un vulo
sin informacin gentica (se le haba extrado el ncleo).
15 Qu tipo de ADN constituye la huella gentica de
cada individuo?
La huella gentica est constituida por un tipo de ADN muy
variable entre los individuos de una especie. Ese ADN est
formado por cortas secuencias de nucletidos que se repiten
en cantidades variables a lo largo de ciertas regiones de los
cromosomas. Cada individuo posee un determinado patrn
de variabilidad que lo hace diferente al resto.
16 Qu es la PCR y para qu se emplea?
La PCR o reaccin en cadena de la polimerasa es un procedimiento bioqumico de replicacin de ADN que permite
duplicar un fragmento original de ADN tantas veces como
se quiera para conseguir amplificar la cantidad de cido nucleico y poder realizar anlisis diversos.
17 Cmo se utiliza la prueba del ADN para resolver los
casos de paternidad dudosa?
La prueba de ADN en casos de paternidad dudosa se fundamenta en la herencia a partes iguales que una persona recibe
de sus padres. La mitad de las bandas de ADN que componen
la huella gentica de una persona proceden de su madre y la
otra mitad de su padre. Conocidas las huellas genticas de la
madre y del hijo deben contrastarse con las de los presuntos
padres para buscar cul de ellos ha aportado la mitad de las
bandas de ADN del hijo.
18 Averigua por qu los glbulos rojos humanos no
sirven para la prueba de ADN.

La reprogramacin es necesaria para que la informacin


gentica aportada por esa clula pueda dar lugar a todos
los tipos de tejidos que componen un individuo adulto. La
reprogramacin es ms habitual en clulas vegetales pero
tambin es posible en clulas animales adultas como se demostr en la clonacin que origin a Dolly.

Los glbulos rojos humanos carecen de ncleo cuando son


maduros por lo que no poseen ADN para realizar la prueba.

13 Cules son los pasos de una clonacin reproductiva?

El PGH ha permitido la elaboracin de dos mapas: uno gentico, con la localizacin de los genes de una especie en los

19 El PGH tuvo como objetivo la elaboracin de dos


mapas del genoma, cules fueron? Qu informacin
contiene cada uno de ellos?

43

6 LA EVOLUCIN DE LA BIOLOGA
distintos cromosomas, y otro fsico, con la secuencia de nucletidos que componen cada uno de los genes del organismo.
20 Qu son los bancos de genes? Para qu sirven?
Los bancos de genes son bases de datos sobre secuencias de
nucletidos y genomas completos de diferentes especies que
se encuentran disponibles en pginas web de instituciones
cientficas.
21 Est todo el ADN del genoma humano dedicado a
la codificacin de protenas? Qu nombre recibe el resto
del ADN que no cumple esa funcin?
El PGH ha desvelado que slo el 1,5 % de los genes que componen el genoma humano codifican para protenas. El resto
de ADN no codificante se denomina ADN chatarra y su funcin todava se desconoce en la actualidad.
22 Qu informacin ha aportado el PGH sobre la similitud gentica de los seres humanos?
Segn los datos del PGH la similitud entre los genomas de
los seres humanos es del 99,98 %.
Esta similitud se encuentra en los genes que codifican para
protenas. Las diferencias entre individuos, que constituyen
el 0,02 % restante, se deben al ADN hipervariable que no codifica para protenas.
23 Cules son los riesgos de los alimentos transgnicos
apuntados por los grupos ecologistas?
Segn los ecologistas los transgnicos incrementan el uso de
sustancias txicas en la agricultura, reducen la biodiversidad,
contaminan el suelo, incrementan la resistencia de las plantas
a los insectos y favorecen la proliferacin de malas hierbas.

ACTIVIDADES FINALES
PARA REPASAR
1 Qu es la biotecnologa? Cules son sus principales
aplicaciones?
La biotecnologa es un conjunto de tcnicas y procesos de
manipulacin del genoma de diversos seres vivos para conseguir organismos y sustancias tiles para el ser humano y
el medio natural.
2 Qu es el ADN pasajero? Para qu se utiliza?
Llamamos ADN pasajero a aquel ADN que contiene un gen
de inters que se quiere insertar en el genoma de otro organismo para conseguir la produccin por parte de ste de la
sustancia deseada.
3 Cules son los pasos para realizar una transferencia
gnica entre organismos?
Primero hay que localizar el gen deseado en el genoma de un
individuo. A continuacin se corta mediante una enzima de
restriccin. Los fragmentos producidos deben insertarse en
un vector apropiado que ser el encargado de transportarlo
hasta la clula de destino.
4 Cules son las herramientas ms utilizadas por la
ingeniera gentica?
Enzimas de restriccin, enzimas ligasas y vectores (los ms
utilizados son los plsmidos y los virus).

24 Por qu existe cierto rechazo social ante la clonacin teraputica?

5 Indica la funcin de las sustancias de inters para el


ser humano obtenidas mediante ingeniera gentica.

El rechazo social obedece a la manipulacin de embriones,


cuyo desarrollo ser detenido, para obtener clulas embrionarias y aprovechar su capacidad de diferenciarse en cualquier tejido adulto.

Insulina: hormona encargada de regular el nivel de glucosa en sangre.


Factor VIII de coagulacin: protena necesaria para la coagulacin de la sangre.
Hormona del crecimiento: hormona proteica que estimula el crecimiento corporal.
Interfern: protena con capacidad para minimizar los
efectos de las infecciones vricas.
Antibiticos: sustancias que impiden la proliferacin de
las bacterias.

25 A qu tipos de discriminacin puede conducir un


uso indebido de la informacin aportada por el PGH?
El uso indebido de informacin gentica personal puede dar
lugar a discriminaciones laborales y de acceso a servicios de
salud, seguros mdicos o educativos, entre otros.
26 Cul es la finalidad del programa ELSI?
El programa ELSI (Ethical, Legal and Social Issues), se crea
al mismo tiempo que el PGH (Proyecto Genoma Humano)

44

para tratar los aspectos ticos, legales y sociales asociados


a la publicacin del genoma humano.

6 Cita alguna de las manipulaciones genticas realizadas para conseguir alimentos transgnicos.
Las manipulaciones genticas ms habituales consisten en
la introduccin en el genoma de diversas plantas de genes

que aumentan su resistencia al fro o al calor, a los herbicidas


y los plaguicidas.
7 Qu es la clonacin?
La clonacin es la obtencin de individuos genticamente
idnticos a su progenitor por medio de mecanismos propios
de la reproduccin asexual.
8 Cules son las diferencias entre clonacin reproductiva y clonacin teraputica?
Ambas modalidades suponen la insercin del material gentico de una clula somtica adulta en un ovocito sin ncleo
y el desarrollo de un embrin. La diferencia estriba en que
en la clonacin reproductiva ese embrin se implanta en un
tero para que se complete el desarrollo y nazca un individuo clnico, mientras que en la teraputica el embrin se
cultiva in vitro durante un tiempo para obtener clulas madre
embrionarias.
9 Qu pasos se siguieron en la clonacin de Dolly?
Se extrajeron y cultivaron in vitro clulas de la glndula
mamaria (la ubre) de una oveja adulta de raza Finn
Dorset.
Esas clulas fueron posteriormente fusionadas, mediante un shock elctrico, con ovocitos procedentes de
una oveja de raza Scottish Blackface (blanca con cara
negra) a los que previamente se les haba extrado el
ncleo.
Los ovocitos, que haban sido fertilizados de manera artificial, fueron activados con una suave descarga elctrica
y comenzaron a dividirse.
Cuando los embriones alcanzaron el estado de mrula
(entre 8 y 16 clulas) se implantaron en el tero de ovejas
Scottish Blackface.
Transcurridos 148 das naci un cordero de 6,6 kg de
peso, totalmente blanco que se convirti en el primer
vertebrado obtenido a partir de una clula extrada de
un mamfero adulto.
10 En qu consiste la prueba del ADN? Cules son sus
principales aplicaciones?
La prueba del ADN consiste en la elaboracin de un patrn
de bandas de ADN hipervariable que caracteriza de manera
inequvoca a cada persona.
La prueba del ADN se emplea en pruebas de paternidad,
anlisis de ADN fsil, relaciones de parentesco evolutivo entre
especies e investigaciones forenses.
11 Qu sustancias son necesarias para poder efectuar
una PCR?
El ADN que se quiere duplicar, nucletidos, cebadores y enzima ADN-polimerasa.

12 Qu es el Proyecto Genoma Humano? Cul fue su


objetivo?
Es un proyecto cientfico internacional creado con el objetivo
de secuenciar el genoma de la especie humana.
13 Qu datos novedosos para la gentica aport el
PGH?
El genoma humano est compuesto por entre 25 000 y
30 000 genes. Antes del inicio del proyecto se barajaba
la cifra de 100 000 genes para el ser humano.
Los genes que codifican protenas constituyen alrededor
del 1,5 % del genoma total. El resto del ADN del genoma, denominado ADN chatarra, tiene funciones todava
desconocidas y su descubrimiento supone un reto para la
continuidad del proyecto.
La similitud entre los genomas de los seres humanos es
del 99,98 %, es decir, las diferencias entre las personas se
deben al 0,02 % de su ADN.
14 Cita las principales aplicaciones de la informacin
aportada por el PGH.
Identificar los genes responsables de las enfermedades
hereditarias.
Facilitar el diagnstico y el tratamiento de las enfermedades genticas, as como la adopcin de medidas preventivas para disminuir sus efectos.
Valorar la predisposicin de las personas a padecer alguna enfermedad a lo largo de su vida.
Mejorar el tratamiento de alguna enfermedad por medio
de la terapia gnica, con la que se podrn insertar genes
correctos en personas con genes defectuosos.
Desarrollar medicamentos especficos para combatir enfermedades comunes como la diabetes, la hipertensin
o el cncer.
Incentivar los estudios sobre la evolucin y el parentesco
evolutivo a travs de anlisis de similitud entre los genomas de diferentes especies.
Facilitar las investigaciones forenses, paleontolgicas
e histricas.
15 Cules son los riesgos ecolgicos de la introduccin
de organismos transgnicos en el medio?
El desplazamiento de las especies naturales de sus nichos
ecolgicos y la introduccin de nuevas enfermedades.
16 Qu valoraciones sociales existen frente a las dos
modalidades de clonacin?
La clonacin reproductiva es ampliamente rechazada por
casi todos los sectores sociales. La clonacin teraputica no
suscita tanto rechazo ya que sus logros pueden servir para
curar o minimizar los efectos de enfermedades muy extendidas en las poblaciones.

45

6 LA EVOLUCIN DE LA BIOLOGA
17 Qu riesgos supone el uso ilegtimo de la informacin gentica de los individuos?
Uno de los mayores riesgos es el estmulo de prcticas eugensicas o de seleccin de variantes genticas ms aptas.
Tampoco son desdeables los efectos discriminatorios en el
acceso a determinados servicios sociales.

18 Relaciona cada herramienta molecular con su funcin en la ingeniera gentica:

Ligasas
Vectores
Plsmidos

SECUENCIA DE ADN

Soja natural

ACGTTACCGAACTCG

Galletas con soja

ACGCCGGAGAACTCG

Leche con soja

ACGTTACCGAATTCG

Pan con soja

ACGTTACCGAACTCG

Qu productos deben ser obligados a llevar una etiqueta que identifique su origen transgnico?

PARA APLICAR

Enzimas de restriccin

PRODUCTO

Reconocen y cortan secuencias


de ADN.
Enzimas que unen fragmentos
de ADN.
Vehculos de transporte de
ADN.
Pequeas molculas de ADN
circular presentes en bacterias.

19 La enzima de restriccin Sal I reconoce la secuencia


GTCGAC
C AGCTG y la corta en los lugares indicados generando
extremos cohesivos. Realiza las siguientes operaciones:
a) Corta el plsmido en los lugares adecuados y dibjalo
abierto con los extremos cohesivos formados.
b) Localiza y corta en el ADN pasajero las secuencias
adecuadas.
c) Une el ADN pasajero y el ADN del plsmido por sus
extremos cohesivos.

PRODUCTO
Soja natural
Galletas con soja
Leche con soja
Pan con soja

SECUENCIA DE ADN
ACGTTACCGAACTCG
ACGCCGGAGAACTCG
Gen resistencia heladas
ACGTTACCGAATTCG
Gen resistencia herbicidas
ACGTTACCGAACTCG

Las galletas con soja y la leche con soja deberan ser etiquetados como transgnicos ya que incorporan genes ajenos a
la especie natural.
21 Los miembros de una misma especie comparten
el patrn de bandas de ADN de sus huellas genticas.
Los paleontlogos que buscaban fsiles en el interior
de una cueva hallaron diferentes huesos mezclados y
quieren descartar los que no sean humanos. Realizada
la prueba de ADN, se obtuvieron los siguientes patrones de bandas:

Cules de las muestras no contienen ADN humano?


20 La Agencia de Control Alimentario ha recibido una
denuncia de una organizacin ecologista por la presencia en el mercado de varios productos elaborados con
soja transgnica. La Agencia ha ordenado secuenciar el
ADN de las distintas variedades de soja para detectar la
presencia de genes aadidos (cuya secuencia se conoce)
y compararlo con el ADN de la soja natural.

46

Gen de resistencia a herbicidas

AATTC

Gen de resistencia a las heladas

CCGGA

Los patrones de bandas que no coinciden con el patrn humano y, por tanto, corresponden a restos no humanos son
los correspondientes a las muestras 1, 3 y 4.
22 A Ana, la joven hija de una afamada actriz televisiva,
le han entrado dudas sobre la identidad de su padre despus de sorprender a su madre hablando de ello con una
amiga. Ana puede ser hija de Pablo, al que desde siempre
ha tenido como padre o de un tal Vctor, actor con el que
su madre rod una pelcula hace aos. Intrigada, Ana
solicita a un juez la prueba de ADN para los implicados
y estos son los resultados:

Madre

Ana

Pablo

Vctor

biotica (otro grupo de alumnos) encargada de legislar


sobre clonacin.
Respuesta abierta.
25 Busca informacin en Internet sobre los alimentos
transgnicos y las ventajas e inconvenientes de su cultivo
y consumo.

Quin es el verdadero padre de Ana? Por qu?


El padre biolgico de Ana es Pablo. Las bandas de Ana coinciden con las transmitidas por su madre y por Pablo.
23 Una mujer ha evitado una agresin sexual al araar
en la cara a su atacante. Los cientficos de la polica han
realizado la prueba del ADN con los restos de sangre
del agresor presentes en las uas de la mujer. Los resultados de la prueba se han contrastado con las huellas
genticas de varios sospechosos. Cul de ellos es el
culpable?

Respuesta abierta.

INVESTIGACIN
CIENTFICA
LA BIOINFORMTICA
1 Encuentras algn parecido entre la bsqueda de un
gen en el banco de genes y la que se realiza habitualmente en el buscador Google para encontrar un trmino?
Los buscadores tipo Google rastrean entre los millones de
textos que componen su banco de informacin las palabras
que pedimos. En los bancos de genes se buscan similitudes
entre secuencias de letras que representan nucletidos.

El patrn de bandas del ADN encontrado en la sangre coincide con el patrn del sospechoso 2, por lo que ste es el culpable.

PARA AMPLIAR
24 Debatid en clase sobre la clonacin. Para ello formad
varios grupos que asumirn los roles de: una multinacional farmacutica (a favor de la clonacin), un equipo de
cientficos (defienden la clonacin teraputica), un grupo
religioso (en contra de la clonacin). Cada grupo aportar sus ideas que sern recogidas por una comisin de

2 Si tras secuenciar el ADN de una muestra utilizamos


un banco de genes para averiguar su similitud con algn gen y obtenemos un resultado negativo (ausencia
de similitud o similitud muy baja con algunos genes),
qu conclusin podemos sacar acerca del ADN secuenciado?
Que el ADN secuenciado pertenece a una especie cuya informacin an no se ha incluido en el banco de genes.
3 Qu beneficios ofrece a la comunidad cientfica la
disponibilidad de los bancos de genes de una manera
gratuita en Internet?
La posibilidad de comparar de una manera rpida cualquier
muestra de ADN con las miles de secuencias de ADN de los
bancos de genes y poder determinar su procedencia.

47

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

QU SABES DE?
1 Pon ejemplos de ecosistemas acuticos y terrestres.
Acuticos: un lago, una charca, un ro, el ocano.
Terrestres: un bosque, una pradera, un jardn, un desierto.
2 Cmo se alimentan los vegetales?
Los vegetales son seres auttrofos que producen su propio
alimento mediante la fotosntesis.
3 Qu crees que ocurrira en un bosque si desaparecieran los vegetales?
Que todos los dems seres vivos acabaran desapareciendo
ya que todos dependen de ellos.
4 Qu crees que ocurrira en un bosque si desaparecieran los microorganismos del suelo?

Podras explicar lo que ocurri?

En el tarro que estuvo expuesto a la luz las algas realizaron la


fotosntesis y crecieron de forma que los animales dispusieron
de alimento. Adems las algas enriquecieron el agua en oxgeno lo que posibilit la supervivencia de los animalillos.
En el tarro sin luz las algas murieron y los animalillos se quedaron sin alimento por lo que murieron tambin.

ACTIVIDADES
1 Nombra cinco seres auttrofos y cinco hetertrofos.
Procura que entre ellos haya representantes de los cinco
reinos.

Lo ms llamativo sera que los cadveres y restos orgnicos


permaneceran intactos e iran acumulndose. Poco a poco
el suelo se empobrecera en las sustancias minerales que los
vegetales necesitan para realizar la fotosntesis ya que no se
completaran los ciclos biogeoqumicos.

Cianobacteria, palmera, alga, diatomea, roble. Vaca, champin, pulpo, bacteria, paramecio.

5 Indica si son verdaderas o falsas las siguientes afirmaciones:

Los seres auttrofos obtienen materia orgnica sintetizndola mediante la fotosntesis. Los seres hetertrofos obtienen la
materia orgnica consumiendo otros seres vivos.

a) Todo el planeta puede ser considerado como un gran


ecosistema llamado ecosfera.

b) La mayora de animales podran vivir sin la luz solar.

c) Trigo ratn halcn es un ejemplo de cadena trfica.

d) Generalmente, en la naturaleza, el nmero de herbvoros


es mucho menor que el de carnvoros.

e) La vida en la Tierra depende del continuo aporte


de materia que nos llega del espacio.

2 Cmo obtienen la materia orgnica los seres auttrofos? Y los hetertrofos?

3 Escribe las ecuaciones qumicas de la respiracin y


la fotosntesis. Explcalas.
La ecuacin de la fotosntesis:
6CO2 + 6H2O + energa del Sol C6H12O6 + 6O2
A partir del dixido de carbono, el agua y la energa de la
luz solar los seres auttrofos sintetizan materia orgnica o
alimento, es decir, glucosa ms oxgeno.

ACTIVIDAD INICIAL

La ecuacin de la respiracin:
C6H12O6 + 6O2 6CO2 + 6H2O + energa

LA LUZ: ENERGA PARA MANTENER LA


VIDA

A partir de la combustin de la materia orgnica, los seres


auttrofos o hetertrofos conseguimos energa acompaada
de la emisin de dixido de carbono y agua.

Los alumnos de un centro escolar llevaron a cabo un experimento. Llenaron con agua dos tarros de cristal, A y
B. Aadieron algas procedentes de una fuente y algunos
animalillos. Cerraron los dos tarros hermticamente.
El tarro A lo situaron en una ventana, expuesto a la
luz, mientras que el tarro B lo cubrieron con un trapo
negro.
En el tarro A las algas y los animalillos siguieron vivos
durante todo el curso.

48

En el tarro B a los pocos das las algas perdieron su color


verde y dejaron de crecer, los animalillos se comieron
las algas, pero cuando stas se acabaron murieron de
hambre.

4 Cul es la principal diferencia entre la materia orgnica y la materia inorgnica?


Las molculas de materia orgnica son molculas formadas
exclusivamente por los seres vivos. Estn compuestas por
cadenas ms o menos largas de carbono, son molculas complejas que almacenan energa en sus enlaces. Las molculas
de materia inorgnica son molculas simples procedentes
del entorno que no contienen energa.

5 Cmo obtienen energa de la materia orgnica los


seres hetertrofos? Y los auttrofos?

ocupan un solo nivel trfico y qu organismos ocupan


ms de uno.

Tanto los auttrofos como los hetertrofos obtienen la energa que necesitan para sus funciones vitales mediante un
proceso denominado respiracin que consiste en degradar
la materia orgnica en presencia de oxgeno. Los seres vivos
utilizan la materia orgnica como combustible.

S, el halcn y el zorro ocupan diferentes niveles trficos.


El zorro es consumidor cuaternario cuando se come a la rana
y consumidor terciario cuando se come al mirlo.
El halcn acta como consumidor secundario al comer a la
ardilla y como consumidor terciario cuando se come al mirlo. Si se comiera a la rana tambin podra ser consumidor
cuaternario.

6 Qu crees que ocurrira si nuestra atmsfera se hiciera tan densa que no dejase pasar la luz del Sol?
La luz del sol es la fuente de energa que utilizan los seres
auttrofos para sintetizar la materia orgnica de la que dependen todos los seres vivos. Por lo tanto, sin la luz del Sol
sera imposible la vida en la Tierra.
7 Identifica las cadenas trficas en la red trfica de la
Figura 7.6. Realiza un esquema de cada una.

10 Pon un ejemplo de cada nivel trfico.


Productor: alga
Consumidor primario: gacela
Consumidor secundario: hiena
Consumidor terciario: len marino
11 Por qu decimos que en los ecosistemas la energa
fluye, es decir, se transfiere en un solo sentido?
Porque la energa circula desde el Sol a los productores y
de stos a los consumidores y los descomponedores, pero
no regresa a los productores, sino que se va disipando a lo
largo de la cadena.
12 Qu cantidad de materia orgnica asimilar un conejo que ingiere 1 kg de forraje (hierba seca)?
El conejo aprovechar solo un 10 % de la energa (en forma de
materia orgnica) contenida en el forraje. Suponiendo que el
forraje no contenga agua, el conejo asimilar 10 g.
13 Define y relaciona los siguientes conceptos: a) biomasa, b) produccin bruta, c) produccin neta.

Hojas oruga escarabajo rana zorro


Hojas oruga mirlo halcn
Hojas oruga mirlo zorro
Hojarasca lombriz mirlo halcn
Hojarasca lombriz mirlo zorro
Bellotas ardilla halcn
8 Indica el nivel trfico que ocupa cada uno de los
organismos en las cadenas que has identificado en la
actividad anterior.
Hojas (P) oruga (C1) escarabajo (C2) rana (C3)
zorro (C4)
Hojas (P) oruga (C1) mirlo (C2) halcn (C3)
Hojas (P) oruga (C2) mirlo (C2) zorro (C3)
Hojarasca (P) lombriz (C1) mirlo (C2) halcn (C3)
Hojarasca (P) lombriz (C1) mirlo (C2) zorro (C3)
Bellotas (P) ardilla (C1) halcn (C2)
9 Puede un ser vivo ocupar ms de un nivel trfico?
En la red trfica de la Figura 7.6 indica qu organismos

a) La biomasa es la cantidad de materia orgnica que poseen los seres vivos. Es una forma de expresar la energa
qumica que contienen.
b) La produccin bruta representa la energa solar que ha
sido fijada y transformada en materia orgnica, es decir,
en energa qumica, por unidad de tiempo.
c) La produccin neta se obtiene al restar a la produccin
bruta la energa consumida en la respiracin por todos
los niveles trficos. PN = PB R.
14 Supn que la produccin bruta en un ecosistema es
de 76 106 cal/ao y las prdidas por respiracin son de
75 106 cal/ao. Se puede decir que est en equilibrio?
Razona la respuesta.
En un ecosistema en equilibrio la produccin neta ha de ser igual
a cero, es decir la produccin bruta ha de ser igual a la respiracin, lo que significa que toda la energa fijada se consume.
En nuestro ecosistema PB = 76 106 cal/ao, R = 76 106 cal/ao,
por lo tanto, PN = 1 106 cal/ao, es decir es un ecosistema
que est creciendo.

49

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

15 En una pradera hay 2 500 000 plantas, 100 000


herbvoros, 9 000 carnvoros y 2 superdepredadores.
a) Dibuja la pirmide ecolgica del ecosistema. b) De
qu tipo es? c) Por qu crees que los consumidores terciarios son slo dos?
a)

a) Los vegetales obtienen el nitrgeno de las sales minerales que absorben, disueltas en agua, a travs de sus
races.
b) Los animales obtienen el nitrgeno principalmente a
travs de las protenas de los organismos de los que se
alimentan.
c) Los hongos obtienen el nitrgeno de los restos de seres
vivos que descomponen.
20 Cules son las principales fuentes de carbono, nitrgeno y fsforo en la naturaleza?

b) Es una pirmide de individuos.


c) Hay slo dos superdepredadores porque una gran parte
de la energa fijada por las plantas se pierde en la transferencia de un nivel trfico a otro. Al ltimo nivel le llega
slo la energa suficiente para mantener a dos superdepredadores.
16 A qu es proporcional el rea de las pirmides de
produccin?
El rea de las pirmides de produccin es proporcional al
incremento de biomasa en cada uno de los niveles trficos
en un periodo de tiempo determinado, es decir, proporcional
a su produccin, bruta o neta.
17 Por qu el carbono, el nitrgeno y el fsforo son
esenciales para los seres vivos?
Estos bioelementos son esenciales para los seres vivos porque forman parte de las biomolculas, es decir, son los tomos con los que se construye la materia orgnica de la que
estn formados los organismos.
18 Participamos los seres humanos en el ciclo del carbono? Si es as, pon algunos ejemplos.
Los seres humanos somos seres hetertrofos y, por lo tanto,
necesitamos ingerir alimentos que nos aportan la materia orgnica, rica en tomos de carbono, que necesitamos.
Nuestras clulas utilizan la materia orgnica como combustible y como producto de desecho devuelven dixido
de carbono, que llega al aire a travs de la sangre, en los
pulmones.
Tambin participamos en el ciclo del carbono al consumir
combustibles fsiles en los vehculos o en la calefaccin porque devolvemos al aire los tomos de carbono que fueron
fijados por los productores hace millones de aos.
19 Cmo obtienen el nitrgeno: a) los vegetales, b) los
animales, c) los hongos?

50

Carbono: la atmsfera y las rocas carbonatadas.


Nitrgeno: la atmsfera de donde solo pueden fijarlo las
bacterias nitrificantes y las sales minerales del suelo.
Fsforo: las rocas fosfricas de donde se desprende en
forma de fosfatos debido a la meteorizacin. Otra fuente
de fsforo son los depsitos de guano.
21 En qu se diferencian el ciclo del nitrgeno y el ciclo
del fsforo?
Algunas diferencias entre los dos ciclos son:
El fsforo, a diferencia del nitrgeno, no existe en estado gaseoso, por lo que no existe reserva alguna de
fsforo en la atmsfera. Los descomponedores al degradar la materia orgnica devuelven fosfatos al medio que pueden ser absorbidos directamente por los
productores.
Con el nitrgeno no ocurre as; porque los descomponedores, al degradar la materia orgnica, liberan amoniaco
que, para poder ser utilizado por los productores, debe
convertirse, previamente, en fosfatos.
22 Explica con tus propias palabras qu es el cambio
climtico.
Respuesta abierta.

ACTIVIDADES FINALES
PARA REPASAR
1 Define fotosntesis y respiracin. Estn relacionados ambos procesos?
La fotosntesis es el proceso mediante el cual algunos seres
vivos, como los vegetales, las algas y las cianobacterias, sintetizan materia orgnica a partir de molculas inorgnicas.
La respiracin es el proceso mediante el que los seres vivos,
sean auttrofos o hetertrofos, obtienen energa a partir de
la materia orgnica.
Ambos procesos estn relacionados porque la fotosntesis
que llevan a cabo los vegetales, las algas y las cianobacterias
aporta a los ecosistemas la materia orgnica necesaria para
que se lleve a cabo la respiracin.

2 Por qu recibe el nombre de respiracin el proceso de obtencin de energa a partir de la materia


orgnica?
Recibe el nombre de respiracin porque es en este proceso
en el que se consume el oxgeno que los organismos toman
constantemente del medio que les rodea.
3 Cul es la principal diferencia entre los seres vivos
auttrofos y los hetertrofos?
La principal diferencia entre ambos tipos de seres vivos radica
en la forma en que obtienen la materia orgnica. Los auttrofos la sintetizan mediante la fotosntesis. Los hetertrofos
la obtienen consumiendo otros seres vivos.
4 Define los siguientes conceptos: a) productor,
b) consumidor, c) descomponedor.
a) Ser vivo que sintetiza materia orgnica a partir de materia
mineral. Los vegetales, las algas y las cianobacterias son
productores.
b) Organismo hetertrofo que consigue materia orgnica
alimentndose de otros seres vivos. Todos los animales
son consumidores.
c) Ser vivo hetertrofo, saprofito, que obtienen la materia
orgnica a partir de los restos de otros seres vivos. Los
hongos y algunos tipos de bacterias son descomponedores.
5 De dnde proceden, en ltima instancia, la energa
y la materia que utilizan los seres vivos?
La energa procede del Sol y la materia procede de la Tierra.
6 Cules son las vas de prdida de energa cuando
sta se transfiere de un nivel trfico a otro?
Una parte de la energa se pierde porque es excretada en
forma de residuos no digeridos. Otra parte es utilizada
por los consumidores como fuente de energa para sus
actividades vitales y, finalmente, se disipa en forma de
calor.
7 Qu entendemos por fijacin del carbono? Qu
seres vivos fijan el carbono atmosfrico?
Entendemos por fijacin del carbono la incorporacin a los
seres vivos de los tomos de carbono procedentes del dixido de carbono atmosfrico.
La fijacin del carbono la llevan a cabo los organismos fotosintticos.
8 Qu seres vivos fijan el nitrgeno atmosfrico?
Los nicos seres vivos que llevan a cabo fijacin del nitrgeno
atmosfrico son las bacterias fijadoras del nitrgeno.

PARA APLICAR
9 Haz corresponder a cada organismo de la columna izquierda las caractersticas de la columna de la derecha.
Tiburn
Oso
Atn
Mariquita
Roble
Saltamontes
Zooplancton
Fitoplancton
Cabra
Hongo

Auttrofo
Hetertrofo
Productor
Descomponedor
Consumidor primario
Consumidor secundario
Consumidor terciario

Tiburn: hetertrofo, consumidor terciario.


Oso: hetertrofo, consumidor primario, consumidor secundario.
Atn: hetertrofo, consumidor terciario.
Mariquita: hetertrofo, consumidor secundario.
Roble: auttrofo, productor.
Saltamontes: hetertrofo, consumidor primario.
Zooplancton: hetertrofo, consumidor primario.
Fitoplancton: auttrofo, productor.
Cabra: hetertrofo, consumidor primario.
Hongo: hetertrofo, descomponedor.
10 Completa las siguientes cadenas trficas:
Trigo rata serpiente rapaz.
Pasto vaca persona.
Fitoplancton zooplancton pez gaviota.
11 Qu ocurrira en un ecosistema si desapareciesen:
a) Los productores?
Si desaparecieran los productores, en poco tiempo desapareceran todos los dems seres vivos pues ninguna cadena
trfica podra mantenerse sin los productores.
b) Los consumidores?
Si desaparecieran los consumidores, el ecosistema podra
seguir funcionando. Sin embargo el ecosistema se desequilibrara y muchos vegetales tendran problemas para dispersar
sus frutos y semillas.
c) Los descomponedores?
En caso de que desapareciesen los descomponedores la
materia orgnica no se reciclara y los vegetales tendran
dificultades para obtener las sales minerales que necesitan.
El ecosistema se llenara de cadveres que no se descompondran.

51

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

12 Con la siguiente lista de seres vivos: lince, hierba, conejo, oruga, mariquita, gorrin, halcn, pulgn,
construye una red trfica y responde a las siguientes
preguntas:
Conejo

Lince

Hierba Oruga Gorrin Halcn

que requiere solamente agua, sales minerales, dixido de


carbono y energa solar.
15 Podras decir cul de las dos pirmides de individuos a o b, pertenece a un bosque templado durante el
invierno y cul a una pradera durante el verano? Cmo
lo has deducido?
a)

Pulgn Mariquita
a) Qu organismo es el productor?
El productor es la hierba.

b)

b) Nombra dos consumidores primarios, dos consumidores secundarios y dos consumidores terciarios.
Consumidores primarios: oruga, conejo.
Consumidores secundarios: gorrin, mariquita.
Consumidores terciarios: lince, halcn.
c) Hay algn organismo que ocupe ms de un nivel trfico?
El lince puede figurar entre los consumidores secundarios, cuando se come al conejo, y entre los terciarios o cuaternarios cuando
se come al gorrin.
d) Como afectara al ecosistema la desaparicin de los
conejos?
Si desapareciesen los conejos, como los linces tambin
pueden alimentarse de gorriones no desapareceran. Pero
la poblacin de gorriones se vera afectada y su nmero disminuira lo que a la larga repercutira tambin en los linces.
Por otra parte las orugas y los pulgones tendran ms alimento, lo que hara aumentar su nmero. Esto tendra un efecto
positivo sobre la poblacin de gorriones que dispondran
de ms alimento.

a) Pradera en verano. En un bosque templado, durante el


invierno, desaparecen las plantas herbceas, por lo que, el
nmero de productores es bajo y, por lo tanto, la superficie
de los productores en la pirmide es pequea.
b) Bosque templado en invierno. En una pradera durante
el verano, en cambio, se da una gran abundancia de plantas
herbceas, por lo que, la superficie correspondiente a los
productores es muy grande.
16 Basndote en los datos de la tabla siguiente construye una pirmide de biomasa del ecosistema:
Seres vivos

Biomasa
(mg de C/m2)

Productores

65 000

Consumidores 1

6 500

Consumidores 2

500

Consumidores 3

55

13 Si un guila come cada da cinco pjaros, cada pjaro


come diez orugas y cada oruga veinte hojas, cuntas
hojas harn falta para mantener un guila durante un
ao?
5 x 10 x 20 = 1 000 hojas para mantener un guila cada da.
1 000 hojas x 365 das/ao = 365 000 hojas hacen falta para
mantener un guila durante un ao.
14 Sabras explicar por qu es ms caro un kilo de carne de ternera que un kilo de pan?
Desde el punto de vista energtico los consumidores son
mucho ms costosos que los productores. Este hecho se
refleja tambin en los mercados, criar una vaca, que se alimenta de pasto, es mucho ms costoso que cultivar trigo,

52

17 Comenta la siguiente afirmacin: Toda la materia


usada por la vida es materia reciclada, materia que
reaparece y nunca se consume.
Esta frase hace referencia a que en la naturaleza la materia pasa de las capas inanimadas (atmsfera, hidrosfera y litosfera)

a la biosfera (los seres vivos) y regresa a ellas continuamente.


Los tomos que hoy forman parte de un ser vivo maana
pueden estar formando parte de la materia mineral y al cabo
de un tiempo regresar a la biosfera.
18 Idea dos circuitos, uno muy corto y otro muy largo,
para un tomo de carbono desde que es fijado por un
vegetal hasta que regresa al aire nuevamente en forma
de dixido de carbono.
El circuito ms corto se dara cuando el dixido de carbono
es utilizado por el vegetal para fabricar glucosa mediante la
fotosntesis pero es devuelto por el mismo vegetal a la atmsfera cuando descompone la glucosa en dixido de carbono y
agua para obtener energa mediante la respiracin.
Un circuito largo se dara, por ejemplo, cuando la glucosa
sintetizada por el vegetal pasa a un consumidor primario que
asimila el carbono y lo transfiere a un consumidor secundario.
El tomo de carbono puede pasar a formar parte de una molcula de una clula reproductora del animal y transferirse a
un hijo suyo. Del hijo del consumidor secundario podra pasar
a un descomponedor y que, finalmente, sea este organismo
el que mediante la respiracin lo devuelva a la atmsfera en
forma de dixido de carbono.
19 Indica si son verdaderas o falsas las siguientes afirmaciones:
a) La fotosntesis es un proceso exclusivo de los vegetales y
la respiracin de los animales.

b) La fotosntesis puede resumirse mediante la ecuacin:


CO2 + H2O+ energa solar C6H12O6 + O2.

c) Las algas y los hongos pertenecen al nivel trfico de los


descomponedores.

d) Los insectos y en general los invertebrados son


consumidores primarios.

e) En una red trfica una misma especie puede ocupar


distintos niveles trficos.

f) Un nivel trfico puede transferir al nivel trfico superior


aproximadamente un 70 % de la energa asimilada.

g) La biomasa referida a los productores de un ecosistema


ha de ser siempre superior a la de los consumidores
primarios.

h) La produccin se define como el aumento de biomasa


por unidad de tiempo.

i) La produccin bruta es igual a la produccin neta menos


la respiracin.

j) La materia que forma parte de los seres vivos se recicla


constantemente.

S, en ambos casos se utiliza la energa qumica que producen


las molculas orgnicas.
En la motocicleta se produce la combustin de los hidrocarburos de la gasolina que son molculas orgnicas y que en
la combustin liberan la energa contienen.
En el caso de la bicicleta, cuando la persona que pedalea respira, se produce la combustin de la glucosa, una molcula
orgnica. En este proceso se libera la energa que permite
que los msculos se contraigan.
21 Por qu la utilizacin de abonos nitrogenados artificiales en la agricultura altera el ciclo natural de este
elemento?
El ciclo del nitrgeno se ve alterado cuando los abonos artificiales que contienen nitratos son arrastrados por el agua
de lluvia y llegan al mar porque entonces los nitratos sedimentan en el fondo marino y el nitrgeno queda atrapado
durante periodos de tiempo muy largos.
22 Las cadenas trficas marinas suelen tener un nmero ms elevado de eslabones que las cadenas trficas terrestres. Qu significado tiene este hecho? A qu crees
que puede ser debido?
Debido a que en cada paso de la cadena slo se aprovecha un
10 % de la energa, cuantos ms eslabones haya en la cadena,
menos energa llega al eslabn final. Sin embargo, como la
produccin en los ecosistemas marinos es mucho mayor que
en los terrestres, las cadenas trficas pueden ser ms complejas que las terrestres, al haber ms energa inicial disponible.
23 Copia en tu cuaderno y completa el siguiente diagrama del ciclo del nitrgeno.

Bacterias desnitrificantes

Bacterias fijadoras de nitrgeno

Bacterias nitrificantes

Descomponedores

PARA INVESTIGAR
20 Utilizan el mismo tipo de energa una bicicleta y
una motocicleta? Razona la respuesta.

PON EN PRCTICA
UN ECOSISTEMA EN UN TARRO
DE CRISTAL

De dnde procede el O2 que requieren los seres vivos


de este ecosistema?

53

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

El oxgeno procede de las algas, que lo expulsan al realizar


la fotosntesis.

De dnde procede la energa que utilizan los seres


vivos del tarro?

La energa procede del Sol.

De donde procede el CO2 que usan las algas en la


fotosntesis?

El dixido de carbono es liberado al agua por todos los seres


vivos del tarro cuando realizan la respiracin.

2 A qu grupos de animales pertenecen la mayora


de detritvoros?
La mayora de detritvoros son invertebrados. A los vertebrados que se alimentan de cadveres se les llama carroeros.
3 Haz dos cadenas trficas, una acutica y una terrestre en la que participe un animal detritvoro.

INVESTIGACIN
CIENTFICA

Restos orgnicos lombriz pjaro zorro


Restos orgnicos almeja estrella de mar gaviota

LOS OTROS CONSUMIDORES

4 Busca en un diccionario la etimologa de los trminos necrfago y coprfago.

1 En qu se parecen y en qu se diferencia los consumidores detritvoros y los descomponedores?


Se parecen en que ambos obtienen el alimento de la
materia orgnica que contienen los restos de otros seres

54

vivos. Se diferencia en que los detritvoros son animales


y los descomponedores son hongos y bacterias que no
ingieren la materia orgnica sino que la digieren mediante
jugos digestivos que vierten sobre ella y posteriormente
la absorben.

Necrfago: procede del griego nekrs, que significa


muerto y ephagon que significa comer.
Coprfago: procede del griego kopros, que significa estircol y ephagon que significa comer.

EL EQUILIBRIO DE LOS ECOSISTEMAS

QU SABES DE?

Fecha

Poblacin mundial
(en millones)

1 Por qu es perjudicial para los ecosistemas la introduccin de especies forneas?

1700

600

1800

1 000

Las especies introducidas producen un desequilibrio en los


ecosistemas porque alteran las cadenas trficas y adems
porque compiten con las especies autctonas por el espacio
y por el alimento.

1900

1 500

1925

2 000

1950

2 500

1960

3 000

2 Por qu no es conveniente combatir las plagas con


productos qumicos?

1975

4 000

1985

5 000

2000

6 000

2010

7 000

Los productos qumicos que se utilizan para combatir las


plagas pueden pasar de unos organismos a otros a travs
de las cadenas trficas de forma que perjudican a todos los
seres vivos que estn en relacin con los seres causantes de
la plaga.
3 Cules son las consecuencias de los incendios forestales sobre la vida silvestre?
Los incendios destruyen la vida de los bosques. Los vegetales arden y muchos animales mueren o, si consiguen sobrevivir, deben abandonar el rea quemada en busca de
alimento.
4 Nombra tres especies de animales en peligro de extincin.
Tres especies en peligro crtico de extincin pueden ser:
el orangutn, el lince ibrico y el quebrantahuesos.

a. Cuntos aos tuvieron que transcurrir para que la


poblacin mundial se duplicara y pasara de 1 500 millones a 3 000 millones?
Para pasar de 1 500 a 3 000 millones tuvieron que transcurrir
60 aos.
b. Y para que se duplicara de nuevo y pasara de 3 000
a 6 000?
Para pasar de 3 000 a 6 000, es decir, para duplicarse de nuevo, transcurrieron tan solo 40 aos.
c. Crees que la humanidad puede seguir creciendo a
este ritmo indefinidamente? Justifica tu respuesta.
No, porque los recursos del planeta no son ilimitados.

5 Responde si son verdaderas o falsas las siguientes


afirmaciones.
a) Los seres vivos de un ecosistema se relacionan slo con
los seres de su misma especie.

b) La mayor parte de las algas viven a profundidades


superiores a los 1 000 m.

c) Los ecosistemas evolucionan, cambian a lo largo del


tiempo.

d) Los animales homeotermos estn mejor adaptados al


medio terrestre que los poiquilotermos.

e) Doana es uno de los Parques Nacionales de nuestro pas.

ACTIVIDAD INICIAL
EL AUMENTO DE LA POBLACIN
MUNDIAL
Analiza los datos adjuntos sobre la variacin de la poblacin mundial desde el ao 1700 hasta la actualidad y
contesta las siguientes preguntas.

ACTIVIDADES
1 Define el trmino poblacin. Escribe tres ejemplos
de poblaciones.
Una poblacin es el conjunto de individuos de la misma especie
que viven en un ecosistema en un momento determinado.
Las encinas de un bosque, las lagartijas de un islote, los flamencos de un humedal.
2 Qu diferencia existe entre el tamao y la densidad
de una poblacin?
El tamao de la poblacin es un valor absoluto que viene
dado por el nmero total de individuos de la poblacin. La
densidad de poblacin, en cambio, es el nmero de individuos con relacin a una superficie o a un volumen.
3 Por qu la capacidad de supervivencia de una poblacin depende de su tamao?

55

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


Cuando la poblacin crece por encima de unos determinados valores, que dependen de la especie y del ecosistema
considerado, puede acabar con sus recursos de espacio o
de alimento. Cuando la poblacin es reducida, es muy vulnerable a cualquier eventualidad como una enfermedad, un
incendio, etc. Adems, en las poblaciones pequeas existe
un problema de disminucin de variabilidad gentica, que
aumenta su vulnerabilidad, especialmente frente a las enfermedades.
4 Qu le suceder a una poblacin en la que las tasas
de natalidad y de mortalidad sean iguales?
Cuando la tasa de nacimientos es igual a la de muertes la
poblacin no crece, se mantiene estable.
5 Define el trmino comunidad. Escribe tres ejemplos
de comunidades.
Una comunidad o biocenosis es el conjunto de todas las poblaciones de un ecosistema o dicho de otra manera el conjunto de todos los seres vivos del ecosistema.
Las poblaciones de un encinar, de un islote o de un humedal.
6 Es correcto considerar que la depredacin es una
relacin negativa para las comunidades? En qu te basas para creerlo?
La depredacin es una relacin positiva para el conjunto del
ecosistema porque contribuye al control del crecimiento de
las poblaciones de una biocenosis.
7 Qu entendemos por competencia? Explica por qu
la competencia produce un aumento de diversidad en los
ecosistemas.
La competencia es una relacin que surge cuando dos especies tienen los mismos requerimientos, de espacio o de
alimento.
La presin selectiva de las especies en competencia obliga a
la diversificacin para la supervivencia, los nichos ecolgicos
se van reduciendo a la vez que las especies se van especializando lo que redunda en la complejidad y diversidad de los
ecosistemas.
8 Qu es una plaga? Pon ejemplo de actividades humanas que favorezcan la aparicin de plagas.

56

Los cultivos de grandes extensiones de una sola especie de


vegetal tambin favorecen el crecimiento de las poblaciones
de pulgones y otros insectos herbvoros que se convierten
en plagas.
9 Pon ejemplos de distintos lugares de la Tierra en
donde puedan iniciarse sucesiones primarias y sucesiones secundarias.
Las sucesiones primarias pueden darse en lugares excepcionales como una isla volcnica recin formada o sobre los
terrenos que quedan al descubierto cuando se retira un glaciar o tras un incendio o tras un impacto ambiental intenso.
A menor escala puede observarse una sucesin primaria sobre las dunas de arena de la primera lnea de la playa o sobre
los bloques de hormign de una escollera.
Las sucesiones secundarias se producen cuando las alteraciones en el ecosistema no son muy intensas.
10 En qu se diferencian las comunidades de los primeros estadios de la sucesin de las comunidades de los
estadios finales?
Las comunidades de los primeros estadios de la sucesin presentan poca diversidad de especies. Los vegetales y animales
presentan estrategias de supervivencia denominadas de la r
que consisten en producir muchos descendientes en muy poco tiempo para colonizar rpidamente un rea deshabitada.
La produccin supera a la respiracin, por lo que se produce
un aumento de biomasa.
En el estadio final de la sucesin la comunidad clmax presenta una gran variedad de especies con una compleja trama
de relaciones entre las distintas poblaciones. Los animales y
vegetales aumentan su tamao y se reproducen ms lentamente, producen un menor nmero de descendientes, es
decir, la mayora son estrategas de la k. La produccin y la
respiracin se igualan, por lo que no hay incremento de biomasa. Todo lo que se produce se consume, se ocupan todos
los nichos ecolgicos.
11 Qu es una regresin? Pon algn ejemplo para explicarlo.
Las regresiones ecolgicas son alteraciones de los ecosistemas
que suponen una vuelta atrs en la sucesin, es decir, que conducen a estadios de menor diversidad y complejidad.

Una plaga es el crecimiento de una poblacin por encima de


los valores que puede soportar el ecosistema.

Los ecosistemas del litoral de la mayor parte de nuestras


costas han sufrido una prdida de biodiversidad debida a la
presencia humana, por lo que estn en regresin.

Muchas actividades humanas favorecen la aparicin de plagas: La introduccin de especies exticas, la eliminacin de
las poblaciones de depredadores como los lobos o las aves
de presa.

12 Teniendo en cuenta todos los factores que favorecen


la propagacin de un incendio, cul piensas que sera la
situacin ms peligrosa en el momento de encender un
fuego?

La situacin con ms peligro se producira en verano, en un


pinar, en un da de viento, en una zona montaosa.
13 Los cactus son plantas que viven en ambientes con
escasa lluvia y temperaturas muy altas. Podras sealar
algunas adaptaciones de su anatoma que les permiten
sobrevivir en estos ambientes?
Las hojas de los cactus se han transformado en espinas con lo
que reducen la prdida de agua por transpiracin. Las espinas
les sirven adems como proteccin frente a los herbvoros.
Los tallos son gruesos, lo que les permite almacenar agua, y
verdes, porque en ellos se lleva a cabo la fotosntesis, que no
puede tener lugar en las hojas transformadas en espinas.
Otra adaptacin de los cactus a la escasez de agua son sus
extensas races para absorber el mximo de agua.
14 Cules son las principales diferencias entre el medio acutico y el medio terrestre?
La densidad del agua es 700 veces mayor que la del aire. La
temperatura es prcticamente constante en los ocanos y en
cambio sufre grandes oscilaciones en el medio terrestre. La
luz no penetra ms all de los 400 m de profundidad en el
medio acutico, en el terrestre en cambio la luz atraviesa la
atmsfera sin dificultad, solamente las copas de los rboles
en los bosques muy espesos dificultan la llegada de la luz al
suelo. Respecto a la concentracin de oxgeno es unas 25 veces inferior en el medio acutico que en el medio terrestre.

18 Por qu la conservacin ex situ no tiene sentido si


no se ponen los medios para la conservacin de los espacios naturales?
Porque de nada sirve salvar a una especie de la extincin si
no puede reintroducirse posteriormente en la naturaleza.
19 Averigua qu espacios naturales estn protegidos
en tu localidad o en tu comunidad autnoma.
Existen diversas figuras de proteccin, aparte de los Parques
Nacionales, como son: Parque Natural, Reserva Natural, Monumento Natural, Paisaje Protegido, etctera.
Cada una de ellas tiene sistemas de gestin y administracin
ligeramente distintos, pero todas comparten la misma finalidad, que es la proteccin de la naturaleza.
20 Averigua qu especie animal o vegetal es la ms
amenazada de tu localidad y si est incluida en algn
programa de conservacin.
Cada comunidad autnoma tiene su propia lista de especies
amenazadas que habitualmente aparecen en las pginas web
de las Consejeras de Medio Ambiente.

ACTIVIDADES FINALES
PARA REPASAR

15 Qu ventaja presentan los animales homeotermos


frente a los poiquilotermos en el medio terrestre?

1 De qu ndices depende el tamao de una poblacin?

Los animales poiquilotermos en el medio terrestre solo pueden vivir en aquellas zonas en las que las temperaturas son
suaves durante todo el ao. En cambio los animales homeotermos, es decir, las aves y los mamferos, pueden colonizar
prcticamente cualquier zona del planeta.

El tamao de una poblacin depende de los ndices de natalidad y de mortalidad. Adems, si la especie considerada
puede desplazarse a otras poblaciones se han de tener en
cuenta los ndices de emigracin y de inmigracin.

16 Qu cambios se produciran en la atmsfera si los


vegetales desaparecieran?
Si desparecieran los vegetales, disminuira paulatinamente
la concentracin de oxgeno de la atmsfera y, en cambio,
aumentaran los niveles de dixido de carbono.
17 Cul es la principal diferencia entre la conservacin
in situ y la conservacin ex situ?
La conservacin in situ implica la proteccin del hbitat natural de las especies, con lo que se conserva el ecosistema
ntegramente, en cambio, la conservacin ex situ slo persigue la conservacin de ciertas especies fuera de su hbitat
natural. Normalmente, la conservacin ex situ slo se utiliza
para salvar de la extincin a especies que se encuentran en
un estado crtico.

2 Qu condiciones son necesarias para que el crecimiento de una poblacin describa una curva exponencial
(en forma de J)?
El crecimiento exponencial slo es posible en condiciones
ideales en las que no hay limitacin de recursos.
Normalmente esto slo se consigue, artificialmente, en un
laboratorio. Se trata, por lo tanto, de una forma terica de
crecimiento.
3 Define potencial bitico y capacidad de carga.
Se denomina potencial bitico a la tasa de crecimiento de
una poblacin que se dara en condiciones ideales. Representa su tasa mxima de crecimiento y es caracterstica de cada
especie porque depende de muchos factores como la longevidad de los individuos, la edad a la que alcanzan la madurez
sexual, el nmero de descendientes por pareja, etctera.

57

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


Capacidad de carga o capacidad de sostenimiento del medio
es el tamao mximo que puede alcanzar una poblacin en un
ecosistema con una determinada resistencia ambiental.

nidad con una gran diversidad y complejidad de relaciones


que, no obstante, no permanece inmutable, sino que sufre
pequeas oscilaciones que no rompen el equilibrio.

4 Qu es el nicho ecolgico de una especie? Por qu


en un ecosistema no puede haber dos especies que tengan exactamente el mismo nicho ecolgico?

Denominamos sucesin primaria a la que se da a partir de la


roca madre, en un terreno sin seres vivos, como puede ser una isla
volcnica recin formada o tras una perturbacin muy intensa.

Los factores ambientales y las relaciones con el resto de organismos del ecosistema influyen en el potencial bitico de
una especie, de forma que para cada factor y cada relacin
podemos establecer un rango en el que se dan las condiciones ptimas para la supervivencia y reproduccin de una
especie dada. Se define nicho ecolgico de una especie al
conjunto de caractersticas que forman su zona ptima de
supervivencia y reproduccin.

Una sucesin secundaria es la que se establece sobre un


terreno previamente colonizado, como puede ser un campo
de cultivo abandonado o tras una perturbacin poco intensa.

Dos especies que tengan idntico nicho ecolgico entran en


competencia lo que, generalmente, ocasiona que una de las
dos especies desplaza a la otra. A largo plazo la competencia
lo que provoca es una especializacin y diversificacin de las
especies en el ecosistema.
5 Qu son los equivalentes ecolgicos? Pon algn
ejemplo.
Son especies que ocupan el mismo nicho ecolgico en ecosistemas separados geogrficamente. En ocasiones, son especies
que pertenecen al mismo gnero, pero tambin puede ocurrir que pertenezcan a grupos taxonmicos muy distintos.

8 Cita las fases de una sucesin primaria en un ecosistema terrestre.


Se produce la meteorizacin de la roca madre por los
agentes atmosfricos.
Los primeros lquenes y los musgos se instalan sobre la
roca y contribuyen al proceso de meteorizacin.
Cuando hay suelo suficiente se establecen las primeras
plantas herbceas. Aparecen los primeros herbvoros y
sus depredadores.
Las plantas herbceas son sustituidas por las primeras
matas y arbustos. Asociados a ellos aparecen nuevos herbvoros y carnvoros.
Finalmente aparecen los rboles de crecimiento lento que
requieren condiciones que previamente no existan.

Ejemplos:
El orangutn y el gorila ocupan nichos ecolgicos muy
parecidos en las selvas tropicales de Asia y frica respectivamente.
El lobo y el coyote.
6 En qu consiste la lucha biolgica contra las plagas?
Qu ventaja representa este mtodo respecto al uso de
insecticidas?
Consiste en controlar el crecimiento de las poblaciones de
las especies que constituyen la plaga utilizando como arma,
nicamente, a sus depredadores naturales.
Presenta la ventaja de que no se vierten sustancias txicas al
medio ambiente y adems que no se extermina a la especie
sino que, simplemente, se controla su crecimiento.
7 Define sucesin, clmax, sucesin primaria y sucesin secundaria.
Una sucesin es el conjunto de fases por las que pasa un ecosistema desde sus orgenes hasta que alcanza la madurez.
Clmax o comunidad clmax es la comunidad final que se establece al final de la sucesin en el ecosistema. Es una comu-

58

PARA APLICAR
9 En una poblacin formada por 3 000 individuos,
anualmente nacen 350 y mueren 200. Calcula el ndice
de natalidad, el de mortalidad y la tasa de crecimiento.
Expresa los valores en tanto por ciento.
ndice de natalidad = 350 / 3 000 x 100 = 11,7 %
ndice de mortalidad = 200 / 3 000 x 100 = 6,7 %
Tasa de crecimiento = 11,7 6,7 = 5 %
10 La siguiente curva muestra el crecimiento de una
poblacin.

a) Qu parte de la curva A, B, C o D, la poblacin crece


ms rpido?
La poblacin crece ms rpido en B, la curva presenta una
mayor pendiente, porque al haber ms individuos la multiplicacin se acelera.
b) A partir de qu momento la poblacin se estabiliza?
La poblacin se estabiliza en el tramo C.
c) Qu parte de la curva representa el descenso en el
crecimiento de la poblacin?
El descenso en el crecimiento comienza en el tramo C y contina en D.
d) Qu cambios en el medio pueden haber provocado
el declive de la poblacin?
El declive puede deberse al agotamiento de recursos, la falta
de alimento, a la falta de espacio e incluso a un exceso de
sustancias de desecho en el medio.
11 Construye una grfica con los datos que aparecen en la tabla de la pgina 157 sobre el crecimiento
de la poblacin mundial. En el eje de abscisas deben
aparecer las fechas, en el de ordenadas el nmero de
personas, en millones. Despus, contesta las siguientes preguntas:

a) Explica cmo vara el crecimiento de las poblaciones


de paramecios a y b en las grficas I y II.
Ambas poblaciones de paramecios presentan una curva de
crecimiento sigmoidea que significa que la poblacin crece
hasta un cierto valor, que viene determinado por la capacidad de carga del ambiente, a partir del cual permanece
constante.
a. Qu tipo de curva has obtenido?
Se obtiene una curva exponencial.
b. A qu condiciones ambientales corresponde este
tipo de curva?
Este tipo de curvas corresponde a unas condiciones ambientales ideales sin lmite de recursos.
12 Las siguientes grficas muestran el crecimiento de
las poblaciones de dos especies distintas de paramecios
que denominaremos a y b. Las grficas I y II muestran el
crecimiento de las especies a y b cuando se cultivan por
separado. En la grfica III se muestra el crecimiento de las
dos especies a y b cuando se cultivan juntas, en el mismo
medio.

b) Observa la grfica III. Por qu crees que las curvas


de crecimiento de las dos poblaciones son distintas
cuando crecen juntas?
Cuando las dos poblaciones crecen juntas compiten por los
mismos recursos y finalmente la especie a acaba desplazando
a la especie b, que queda reducida a unos pocos individuos.
Hay que sealar tambin que el tamao de la poblacin de la
especie b, en presencia de la especie a, es menor que cuando
crecen separadamente.
13 Un pequeo rebao de alces lleg a una isla situada
en un lago, cuyas aguas se haban helado. Al poco tiempo
el rebao superaba los 2 000 individuos y consumieron,
prcticamente, todos los pastos. La falta de alimento provoc la muerte de la mayora de los alces. Sin embargo,

59

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


poco a poco, la poblacin de alces se fue recuperando.
Unos aos ms tarde lleg a la isla una manada de lobos,
a partir de entonces la poblacin de alces se estabiliz
entre 600 y 1 000 individuos. Lo mismo ocurri con la
poblacin de lobos que alcanz de 20 a 25 individuos.

a) El crecimiento de una poblacin sin lmite de recursos da


lugar a una grfica en forma de S.

a) Por qu creci tanto el rebao de alces al principio?

b) Dos especies ocupan el mismo nicho ecolgico cuando


habitan en el mimo lugar.

La poblacin de alces creci sin control por parte de sus depredadores, que no haban tenido acceso a la isla.

c) Una disminucin drstica en una poblacin


de depredadores puede provocar una plaga de presas.

d) En el estadio final de una sucesin se produce una clara


disminucin de la diversidad de las especies.

e) Los aceites y resinas producidos por algunos vegetales


favorecen la propagacin de los incendios.

f) El medio acutico se caracteriza por la ausencia de luz a


partir de los 400 m de profundidad.

g) Las cianobacterias fueron las responsables de la


aparicin del oxgeno atmosfrico hace 2 500 millones
de aos.

h) Los bancos de semillas son una forma de conservacin


in situ.

b) Qu crees que hubiera pasado si no hubieran llegado


los lobos?
Los lobos contribuyeron a estabilizar la poblacin de alces.
Si no hubieran llegado, probablemente la poblacin de alces hubiera sufrido oscilaciones mucho mayores, pasando
por pocas en las que, debido a la escasez de pasto, podra
peligrar su supervivencia.
14 Qu ventajas tienen los estrategas de la r respecto
a los estrategas de la k en las primeras etapas de la sucesin?
Los estrategas de la r son especies poco exigentes, de talla
pequea y con una tasa de crecimiento muy elevada. Cuando
no tienen competencia, son capaces de colonizar un rea en
muy poco tiempo, por esto reciben el nombre de especies
oportunistas.
15 En los incendios forestales cul crees que es la consecuencia ms grave para el ecosistema?
La consecuencia ms grave para el ecosistema es la degradacin
del suelo que puede producirse como consecuencia de la prdida de la cubierta vegetal, porque la regeneracin del suelo es
un proceso muy lento, que puede llevar miles de aos.
16 Por qu crees que los cuerpos de los vertebrados
marinos, sean peces o mamferos, tienen formas tan parecidas?
Porque ambos estn adaptados a desplazarse en el medio
acutico, para lo cual han adoptado formas hidrodinmicas,
semejantes, que facilitan el movimiento en el agua.
17 Si las adaptaciones son modificaciones que surgen
frente a los cambios del ambiente Por qu hoy en da
muchas especies se extinguen en vez de adaptarse?
El crecimiento de la poblacin humana ha sido extraordinario
en las ltimas dcadas por lo que los cambios ambientales,
que son consecuencia de las actividades humanas, ocurren
a un ritmo cada vez ms rpido. Muchas especies se extinguen porque son incapaces de adaptarse en tan breve lapso
de tiempo. La adaptacin a los cambios del ambiente es un
proceso evolutivo y por lo tanto lento.

60

18 Indica si son verdaderas o falsas las siguientes afirmaciones:

PARA INVESTIGAR
19 La rana comn tiene los ojos y los orificios nasales
muy desplazados hacia la parte superior de la cabeza.
Qu ventaja puede suponer para las ranas esta caracterstica? Conoces otros animales que tengan los ojos
y los orificios nasales en una posicin similar?
La situacin de los ojos y los orificios nasales en la parte superior de la cabeza permite a las ranas permanecer en el agua,
sin tener que salir para respirar, mientras estn al acecho de
sus presas o se esconden de los depredadores.
Es una adaptacin que presentan muchos animales que, como las ranas, pasan gran parte del tiempo en aguas dulces,
como los cocodrilos o los hipoptamos.
20 Por qu los peces mueren asfixiados en el medio
terrestre si el aire contiene ms oxgeno que el agua?
Las branquias de los peces no sirven como rgano respiratorio en el medio terrestre porque slo pueden captar el
oxgeno si est disuelto en el agua.
21 Caulerpa taxifolia es una alga tropical, conocida
como alga txica o alga asesina, que fue introducida
accidentalmente en las costas del mar Mediterrneo.
Busca informacin sobre esta especie de alga y elabora
un informe sobre los perjuicios que ocasiona a las comunidades de los ecosistemas del litoral mediterrneo.
En el litoral mediterrneo se dan extensas praderas de Posidonia oceanica, una planta fanergama entre cuyas hojas viven
una gran cantidad de especies animales y vegetales. Culerpa

taxifolia compite por el espacio y desplaza con facilidad a


Posidonia oceanica, pues tiene un crecimiento mucho ms
rpido, lo que acarrea una importante prdida de biodiversidad en el litoral, pues la flora y la fauna asociada a Posidonia
se ve tambin desplazada.
22 Averigua la superficie de bosque quemado en Espaa
en el ltimo verano. Si cada hectrea de bosque produce
7 toneladas de O2 al ao y consume, tambin anualmente,
2,5 toneladas de CO2, calcula cmo influir la prdida de
superficie forestal en la composicin de la atmsfera.
En 2006 se perdieron en Espaa unas 124 000 hectreas de
bosque arrasadas por incendios. Por lo tanto, se producirn
868 000 toneladas (124 000 hectreas x 7 toneladas/ hectreas) menos de oxgeno. El consumo de CO2 se ver reducido
en 310 000 toneladas.
(124 000 Ha x 2,5 Tm/Ha)

PON EN PRCTICA
CMO CRECE UNA POBLACIN DE MOSCAS DE LA FRUTA?
Deja un tarro grande con un trozo de pltano maduro, abierto,
al aire libre. En la boca del tarro pon un embudo de papel.
Cuando hayan penetrado unas ocho o diez moscas retira
el embudo y tapa el tarro con algodn. Elige un macho
y una hembra e introdcelos en un nuevo tarro (forma
tantas parejas como puedas).
Pronto habr huevos en todos los tarros y, a los pocos
das, aparecern larvas. Coloca un trozo de papel en el interior de los tarros as las larvas podrn adherirse a l para
convertirse en pupas.
Cuando aparezcan las jvenes mosquitas, cuntalas.

Con los datos obtenidos en los diferentes tarros que


hayas preparado calcula cuntos descendientes tiene,
por trmino, medio, una pareja de moscas de la fruta.
Calcula tambin el tiempo medio transcurrido.

Hay que sumar los valores obtenidos en los diferentes tarros


y hallar la media.

Cuntas moscas obtendramos si continuasen reproducindose al mismo ritmo durante un mes? Y


durante un ao?

Los valores dependen de los que se hayan obtenido en la


actividad anterior.

Qu factores impiden en la naturaleza que las mosquitas se conviertan en una plaga?

Los factores ambientales que regulan el crecimiento de cualquier especie son el espacio, el alimento y, especialmente, el
control que sobre sus poblaciones ejercen los depredadores.

INVESTIGACIN
CIENTFICA
LA FOCA MONJE, UNA ESPECIE
EN PELIGRO DE EXTINCIN
1 Enumera las principales adaptaciones que han
desarrollado las focas monje para vivir en el medio
acutico.
Los orificios nasales de las focas se cierran durante la inmersin
y su cristalino cambia de forma para mejorar la visin debajo
del agua. Adems la circulacin sangunea se hace ms lenta y
disminuye la demanda de oxgeno, lo que les permite permanecer debajo del agua, sin respirar, durante unos 15 minutos.
2 A qu tipo de seres vivos, estrategas de la r o de la k,
crees que pertenecen las focas monje?
Por el tamao de su cuerpo, la tasa de reproduccin tan lenta
y el cuidado de las cras, las focas monje son un buen ejemplo
de organismos estrategas de la k.
3 Por qu crees que las focas monje acusan ms que
otros animales el efecto de los vertidos de sustancias
contaminantes al mar?
Algunos contaminantes se van concentrando a medida que
van pasando de unos organismos a otros a travs de las cadenas trficas por lo que los depredadores, como las focas
monje, reciben cantidades tan elevadas de estas sustancias
que ponen en peligro su supervivencia.

61

9 LA EVOLUCIN DE LOS SERES VIVOS


QU SABES DE?

Puedes explicar cmo se origin la oveja de patas


cortas?

1 Cul es el nombre del naturalista ingls que enunci la teora de la evolucin de las especies?
Charles Darwin.
2 Cmo crees que se han llegado a obtener las mltiples razas de perros que existen actualmente?
Por seleccin artificial, que consiste en separar y cruzar entre
ellos a los animales que presentan una caracterstica que el
criador estima ventajosa.
3 Por qu los hijos de los futbolistas no nacen con las
piernas ms fuertes que los dems nios?
Porque el desarrollo de las piernas de los futbolistas es una
caracterstica que se adquiere a base de ejercicio fsico, no
es un carcter hereditario, como puede ser el color del pelo
o el de los ojos.
4 Qu grupo de animales son nuestros parientes ms
prximos?
Nuestros parientes ms prximos son los primates y, dentro
de los primates, los chimpancs.
5 Indica si son verdaderas o falsas las siguientes afirmaciones:
a) Los fsiles son formas peculiares de las rocas sin relacin
con los seres vivos.

b) La teora de la evolucin solo es vlida para los vertebrados.

c) La vida se origin en la Tierra hace unos 4 000 millones


de aos.

d) Las clulas procariotas son ms antiguas


que las eucariotas.

e) La evolucin acab cuando surgieron los seres humanos.

ACTIVIDAD INICIAL
AS, NO PODRN SALTAR LA VALLA
Las ovejas Ancon son originarias de Nueva Inglaterra (Estados Unidos) y se caracterizan porque tienen las patas
muy cortas. Parece ser que esta raza se obtuvo a partir de
un nico ejemplar que naci con las patas ms cortas que
los dems. El granjero, que pens que esta caracterstica
le favoreca, cruz la oveja de patas cortas con otras de
patas largas y de esta manera consigui dos ejemplares
ms con las patas cortas. Al cabo de un tiempo todo su
rebao tena las patas cortas.

62

La oveja de patas cortas naci con esta caracterstica debido


a una mutacin en su material gentico.
Cmo crees que el granjero lleg a conseguir que todo
su rebao tuviera las patas cortas?
El granjero debi cruzar la oveja con las patas cortas con otras
ovejas del mismo rebao y algunas de las descendientes debieron heredar el carcter. De esta manera fue seleccionando
las ovejas de patas cortas y cruzndolas entre ellas.
Crees que en la naturaleza las ovejas de patas cortas
hubieran sobrevivido?
No. Este carcter hubiera supuesto una importante desventaja frente a las ovejas de patas largas a la hora de huir de
los depredadores.

ACTIVIDADES
1 Por qu los fsiles representan importantes pruebas a favor de la evolucin?
Porque demuestran que los seres vivos han cambiado a travs del tiempo, que las especies de pocas geolgicas anteriores no son las mismas que las actuales.
2 Cita algunas evidencias que apoyen el origen de los
tetrpodos (anfibios, reptiles, aves y mamferos) a partir
de un antepasado comn.
Hay muchas semejanzas anatmicas entre los cuatro grupos,
por ejemplo, la disposicin de los huesos de sus extremidades que, aunque son aparentemente distintas, responden
a un patrn comn. El desarrollo embrionario de los cuatro
grupos es tambin prcticamente idntico en los primeros
estadios.
3 Sabras explicar por qu los canguros slo viven en
Australia?
Cuando los canguros evolucionaron, a partir de los primitivos
mamferos marsupiales, Australia estaba separada del resto
de los continentes por un extenso ocano, lo que impidi que
los canguros se dispersasen hacia otros continentes.
4 Qu significado tiene el hecho de que el cdigo
gentico sea universal?
Es una importante prueba a favor de la evolucin de todos
los seres vivos a partir de un nico antepasado comn.
5 Qu es el fijismo?

Es la teora que supone que los seres vivos han permanecido


fijos, inmutables, desde que fueron creados.
6 Responde las siguientes preguntas:
a. Crees que si el tenista Rafael Nadal tuviera hijos stos naceran con el brazo izquierdo ms fuerte que el
derecho?
No.

Si el aislamiento de las poblaciones y las condiciones ambientales se mantuvieran durante un periodo de tiempo suficientemente largo surgiran ms diferencias entre ambas
poblaciones y, probablemente, acabaran dando lugar a dos
especies distintas.
10 En qu se diferencian las barreras geogrficas y las
barreras reproductivas?

Probablemente, s.

Las barreras geogrficas son barreras fsicas que aslan e


impiden el contacto entre poblaciones de una misma especie. Las barreras reproductivas son diferencias anatmicas, fisiolgicas o etolgicas que surgen despus de largos
periodos de separacin entre las poblaciones e impiden la
reproduccin.

c. Cul es la diferencia fundamental entre el desarrollo


del brazo de Nadal y la altura de Gasol?

11 Cul es la principal diferencia entre el gradualismo


y el puntualismo?

El mayor desarrollo del brazo izquierdo del tenista se debe


a que lo ejercita mucho ms que al derecho. Es un carcter
adquirido, en cambio, la altura de Gasol es un carcter hereditario.

Para los gradualistas la formacin de nuevas especies tiene


lugar de forma lenta, paulatina, por acumulacin de pequeos cambios. Para los puntualistas, en cambio, la especiacin
es un proceso que se produce de forma rpida, despus de
un largo periodo de estabilidad de una especie, tal y como
se refleja en el registro fsil.

b. Y los hijos del jugador de baloncesto Pau Gasol seran ms altos que la media de la poblacin?

7 Explica cmo crees que ha actuado la seleccin


natural en el hecho de que algunas bacterias hayan
desarrollado resistencia a ciertos antibiticos.
Los antibiticos, usualmente, matan a todos los individuos de una poblacin bacteriana. Sin embargo, si entre las bacterias de dicha poblacin surgen individuos
mutantes capaces de resistir el antibitico, estas pocas
bacterias sobreviven. El antibitico selecciona a las bacterias resistentes y esta caracterstica es transmitida a la
descendencia. Una nueva aplicacin del mismo antibitico no tendr efecto alguno sobre las nuevas formas
resistentes.
8 Qu crees que ocurri con Biston betularia cuando
las industrias dejaron de emitir gases contaminantes?
Al cesar la contaminacin los abedules fueron recuperando,
paulatinamente, el color claro de su corteza. As, poco a poco,
la situacin se invirti y las mariposas blancas aumentaron su
frecuencia respecto a las negras. Actualmente la mutacin
negra ha vuelto a ser muy escasa.
9 Qu tendra que ocurrir para que las dos formas,
clara y oscura, de la mariposa Biston betularia dieran lugar a dos especies distintas?
En primer lugar, tendra que surgir una barrera geogrfica
que separase dos poblaciones, y, en segundo lugar, que las
dos poblaciones evolucionasen en ambientes distintos. Las
mariposas blancas seran las seleccionadas en reas libres de
contaminacin. Las mariposas oscuras seran las seleccionadas en zonas con contaminacin.

12 Qu factores de la atmsfera primitiva de nuestro


planeta favorecieron la evolucin qumica?
Tres factores fueron determinantes en la evolucin qumica:
La abundancia de molculas simples que sirvieron como bloques de construccin para formar molculas ms
complejas.
La ausencia de oxgeno libre que habra degradado las
molculas orgnicas recin formadas.
Una gran cantidad de energa en forma de violentas tormentas elctricas, impactos de meteoritos y de una intensa radiacin ultravioleta que propiciaron la formacin
de enlaces.
13 Enumera todas las etapas que corresponden a la
evolucin qumica.
1. Molculas inorgnicas sencillas (H2O, H2, CH4, etc).
2. Monmeros (aminocidos, nucletidos, monosacridos,
etc).
3. Polmeros (ADN, ARN, protenas, etc.).
4. Protobiontes (asociaciones complejas de polmeros).
5. Clulas primitivas.
14 Por qu suponen los cientficos que las clulas procariotas proceden de las eucariotas y no al revs?
Porque los primeros vestigios de vida en la Tierra corresponden a estructuras celulares semejantes a las clulas procariotas. Adems, las clulas eucariotas son mucho ms complejas

63

9 LA EVOLUCIN DE LOS SERES VIVOS


que las procariotas, de hecho, parece ser que se formaron
por la unin simbintica de distintos tipos de clulas procariotas.

ACTIVIDADES FINALES

15 Por qu suponen los cientficos que los seres pluricelulares se originaron a partir de organismos eucariotas
unicelulares?

1 Qu es la evolucin? Por qu crees que se necesitan pruebas de su existencia?

Porque todos los seres pluricelulares estn formados por


clulas eucariotas.
16 Cita algunas de las caractersticas que compartimos
con los primates.
Las extremidades largas y esbeltas con dedos prensiles, los ojos
situados en el frente, que nos permiten la visin en tres dimensiones, y un encfalo muy desarrollado. Tambin compartimos
el comportamiento social complejo y el hecho de que los hijos
necesiten un largo periodo de crianza y proteccin.
17 Es errneo afirmar que el ser humano procede del
mono? Por qu?
S, porque los monos actuales no han dado lugar a los seres
humanos. Lo correcto es afirmar que los monos actuales y
los humanos tenemos antepasados comunes.
18 Por qu se piensa que la especie humana se origin
en frica?
Porque todos los fsiles de homnido con edades superiores
a los 2 millones de aos han sido hallados en frica.
19 Indica las principales diferencias entre:
a. Australopithecus y Homo habilis.
Aparte del tamao del crneo y la estatura, Homo habilis fabricaba herramientas y los Australopithecus parece ser que
no lo hacan.
b. Homo habilis y Homo erectus.
Aparte del tamao del crneo y la estatura, Homo erectus
fabricaba herramientas ms avanzadas que Homo habilis y
adems utilizaban el fuego.
c. Homo neanderthalensis y Homo sapiens.
Homo neanderthalensis eran ms robustos, ms altos y tenan tambin un crneo muy grande, de unos 1 600 cm3. El
desarrollo cultural de Homo sapiens era superior al de los
hombres de Neandertal.

PARA REPASAR

La evolucin es un proceso de cambio que experimentan las


especies a lo largo del tiempo para adecuarse a las condiciones del medio. Como toda teora cientfica debe comprobarse de manera experimental; sin embargo, la naturaleza del
proceso es tal que cada suceso evolutivo es nico, de modo
que, nicamente, nos quedan sus huellas o pruebas para intentar reconstruirlos.
2 Cuntos millones de aos tendramos que remontarnos en la historia de la vida para hallar un antepasado
comn a todos los seres vivos?
Unos 3 800, hasta el momento en que surgi la primera clula.
3 Cmo se han obtenido las principales pruebas a
favor de la evolucin?
Las principales pruebas de la evolucin se han obtenido a partir del estudio de los fsiles, la comparacin de la anatoma y la
fisiologa de los seres vivos, la comparacin de los embriones y
de las formas larvarias, la comparacin de las molculas y del
estudio de la distribucin de los seres vivos en el planeta.
4 Qu son los rganos vestigiales? Por qu son importantes como prueba de la evolucin?
Son rganos presentes en muchas especies animales que
han dejado de ser funcionales. Son ejemplos de rganos
vestigiales: los huesos de la pelvis de algunas serpientes y el
apndice o el cccix humanos.
Son una importante prueba de la evolucin porque representan
formas residuales de rganos presentes en el antecesor comn de
las especies emparentadas evolutivamente por ese ancestro.
5 Cul fue la principal aportacin de Lamarck a la
ciencia?
Su principal aportacin fue la de elaborar la primera teora
sobre la evolucin por adaptacin de los organismos al medio ambiente en un momento en que la mayor parte de los
cientficos eran fijistas.
6 Qu entendemos por seleccin natural?

20 Crees que fue posible que H. neanderthalensis se


cruzara con H. sapiens?
La extincin de los neandertales coincidi con la llegada a Europa
de una nueva especie, el Homo sapiens. Algunos autores consideran posible que el Homo Neanderthal se cruzara con el sapiens.

64

Es el proceso mediante el cual los individuos menos dotados


de una poblacin son eliminados.
7 En qu se parecen y en qu se diferencian la seleccin natural y la seleccin artificial?

En ambos casos se obtienen individuos diferentes a los


progenitores producidos de forma espontnea y que suponen una ventaja. Por seleccin artificial, ganaderos y
agricultores seleccionan aquellos individuos con unas caractersticas ventajosas para el criador, como, por ejemplo,
vacas sin cuernos o frutos sin pepitas. Estas caractersticas
no supondran una ventaja en la naturaleza porque no
aumentaran las posibilidades de supervivencia de los organismos que las presentan y no apareceran nunca por
seleccin natural.
8 Cul es la diferencia fundamental entre el darwinismo y el neodarwinismo?
El neodarwinismo utiliza los conocimientos aportados por la
gentica y la biologa molecular para explicar cul es el origen de la variabilidad de los individuos en una poblacin: la
recombinacin gentica que se produce en la reproduccin
sexual y las mutaciones.
9 Cita las tres fases que se dan en la formacin de una
nueva especie.
1. Aislamiento de las poblaciones.
2. Evolucin en ambientes distintos.
3. Aparicin de barreras reproductivas.
10 Explica mediante un esquema la teora endosimbintica sobre el origen de las clulas eucariotas.

PARA APLICAR
11 Qu indica el hecho de que el ADN de dos especies
sea prcticamente idntico?
Significa que son muy prximas evolutivamente. Es el caso,
por ejemplo, de los chimpancs y los seres humanos, que
comparten un 99 % del ADN.
12 En los laboratorios de gentica se obtienen con
frecuencia formas mutantes de la mosquita del vinagre
(Drosophila melanogaster), algunas con las alas atrofiadas, otras con las quetas rotas o incluso algunas formas
sin ojos. Estos mutantes, sin embargo, apenas se presentan en la naturaleza. Sabras explicar por qu?

Porque la seleccin natural elimina las mutaciones que son


perjudiciales. Estas moscas con las alas atrofiadas, sin ojos o
con las quetas rotas no llegan a reproducirse porque son las
primeras que capturan los depredadores.
13 Responde razonadamente las siguientes preguntas:
a. Puede haber evolucin si no hay variabilidad gentica?
No, porque para que haya evolucin se ha de producir la
seleccin de individuos portadores de caractersticas nuevas,
diferentes a las del resto de la poblacin.
b. Puede haber evolucin si las condiciones ambientales no cambian?
No, para que haya evolucin tiene que haber cambio porque, si las condiciones ambientales permanecen constantes,
la seleccin natural sigue favoreciendo la reproduccin de
los organismos ms aptos que son los que constituiran la
poblacin original.
14 Cmo explicaras el ejemplo de las jirafas de Lamarck desde el punto de vista neodarwinista?
Las mutaciones son producto del azar y la mayor parte
de ellas son perjudiciales e, incluso, letales, por lo que,
normalmente, desaparecen. Sin embargo, algunas mutaciones pueden resultar favorables para los individuos,
especialmente cuando las condiciones ambientales cambian.
La mutacin que presentaban algunos miembros de la poblacin de jirafas y que les confera un cuello ms largo se
convirti en una mutacin favorable cuando la vegetacin
del suelo se hizo escasa.
La naturaleza seleccion esta mutacin favorable, adaptativa,
de forma que, tras un periodo de tiempo suficientemente
largo, todas las jirafas tuvieron el cuello largo.
15 Por qu la ausencia de oxgeno fue tan importante
en las primeras fases de la evolucin qumica?
El oxgeno es un gas muy reactivo que hubiera provocado
la degradacin de las primeras molculas orgnicas y, por
lo tanto, hubiera impedido su evolucin hacia formas ms
complejas.
16 Por qu crees que ningn cientfico ha sido capaz,
todava, de crear clulas en un laboratorio?
Porque las clulas, incluso las ms simples, son estructuras
extraordinariamente complejas en comparacin con los protobiontes. Las clulas son capaces de intercambiar materia y
energa con el medio, responder a los estmulos y de reproducirse dando lugar a otras clulas.

65

9 LA EVOLUCIN DE LOS SERES VIVOS


17 Pon texto a las siguientes imgenes:

Algunas de las principales diferencias son:


Humano
Una especie de caracol vive en una zona montaosa de
clima templado.
El clima cambia y el valle se hace demasiado clido para
los caracoles que se refugian en las cimas de las montaas.
Las dos poblaciones quedan aisladas y evolucionan de
manera diferente.
Transcurren miles de aos y el clima cambia de nuevo.
Los caracoles de ambas poblaciones pueden ocupar de
nuevo el valle, pero la reproduccin entre ellos es imposible porque han dado lugar a dos especies distintas.
18 Completa el siguiente prrafo sobre el origen de la
vida:
La vida surgi hace unos 3 800 millones de aos a partir de
materia inanimada. Los primeros seres vivos eran clulas
procariotas, semejantes a las bacterias actuales. Hace unos
2 000 millones de aos aparecieron las clulas eucariotas.
A partir de ellas se originaron todos los seres vivos pluricelulares que han existido sobre la Tierra.
19 Qu homnidos fueron los primeros en?
a. Abandonar el continente africano.
Homo erectus.
b. Enterrar a los muertos.
Homo neanderthalensis.
c. Adoptar la marcha bpeda.
Australopithecus.
d. Decorar con pinturas las paredes de las cavernas.
Homo sapiens.
e. Fabricar herramientas.
Homo habilis.
20 Las diferencias entre el esqueleto de un ser humano
y el de un gorila responden, sobre todo, a la adquisicin
de una postura erguida y marcha bpeda por parte de los
humanos. Puedes sealar algunas de estas diferencias?

66

Gorila

Agujero occipital en el centro


de la base del crneo.

Agujero occipital en la parte


posterior del crneo.

Columna vertebral en forma


de S.

Columna vertebral en forma


de C.

Pelvis pequea y redondeada.

Pelvis muy grande y alargada.

Piernas ms largas que los


brazos.

Brazos mucho ms largos que


las piernas.

Pulgar alineado con los otros


dedos del pie.

Pulgar no alineado con los


otros dedos del pie.

21 Quin es quin? Une el nombre de cada cientfico


con la afirmacin que le corresponda.
a. Lamarck.

Se le atribuye la frase la funcin


hace al rgano.

b. Darwin.

Acu el trmino seleccin


natural.

c. Huxley, Dobzansky y Mayr. Son los padres de la teora


sinttica de la evolucin.
d. Eldredge y Guold.

Son los defensores del equilibrio


puntuado.

e. Miller.

Sintetiz aminocidos a partir


de molculas simples.

f. Oparin.

Trat de explicar cmo se produjo


la evolucin qumica.

g. Margulis.

Propuso la teora endosimbintica.

22 Indica si son verdaderas o falsas las siguientes afirmaciones:


a. La evolucin es un proceso que depende del azar.

b. En la naturaleza la distribucin de las especies es muy


uniforme.

c. Para los creacionistas los fsiles son piedras con formas


peculiares, caprichos de la naturaleza.

d. Darwin public El origen de las especies en 1659.

e. La seleccin natural favorece la supervivencia de los


individuos ms aptos.

f. Las mutaciones siempre son perjudiciales.

g. La variabilidad de las poblaciones depende, en parte, de


las mutaciones.

h. Todos los seres vivos procedemos de un antepasado


comn que se origin hace unos 3 800 millones de aos.

i. Los primeros seres vivos fueron pequeos artrpodos


acuticos.

j. Homo neanderthalensis tena una capacidad craneana


superior a Homo sapiens.

la isla. Los dodos no estaban preparados para hacer frente


o huir de los depredadores, por esto se extinguieron en
pocos aos.

PON EN PRCTICA
CMO EVOLUCIONARON?
Observa los seres imaginarios que aparecen en la figura.
Cada uno representa una especie distinta.

PARA INVESTIGAR
23 El apndice vermiforme es una porcin del intestino
grueso humano que carece de funcin, como demuestra el
hecho de que su extirpacin no tenga consecuencia alguna.
Cmo podra explicarse su presencia en el tubo digestivo?
El apndice vermiforme es una extensin del colon que
debi ser til en algn momento de la evolucin humana,
probablemente, cuando el rgimen alimenticio de nuestros
antepasados era eminentemente herbvoro.
24 Orrorin tugenensis es unos de los pocos fsiles de homnidos hallados en frica con una edad superior a los 4
millones de aos. Consulta en Internet y haz un pequeo
informe sobre sus caractersticas.

Intenta elaborar una serie evolutiva que los relacione.

Una de las soluciones podra ser:

Orrorin tugenensis fueron unos homnidos que vivieron hace


unos 6 millones de aos.
Sus restos fsiles, que fueron descubiertos en 2001 en la localidad de Tugen (Kenia), correspondan a individuos con una
estatura de 1,40 m que, segn se deduce de la forma de los
huesos de las extremidades, eran bpedos.
Adems, tenan unos caninos de pequeo tamao y unos
molares grandes que indican que su alimentacin era esencialmente a base de vegetales y, tal vez, de insectos.
25 En la isla de Mauricio, en el ocano ndico, vivi
un ave muy extraa llamada dodo. Era muy grande, se
mova muy despacio y no poda volar. Cuando los seres
humanos llegaron a la isla, acompaados de animales
procedentes del continente, el dodo rpidamente se extingui. Podras explicar cmo evolucion el dodo y por
qu se extingui?
La evolucin del dodo ocurri en una isla muy alejada del
continente africano, en un ambiente excepcional, libre de
depredadores. La seleccin natural dio lugar a individuos
de gran tamao, lentos, que no podan volar, caractersticas
que no afectaban a su supervivencia, antes de la llegada de
los seres humanos.
Pero estas caractersticas fueron nefastas cuando los humanos aparecieron e introdujeron animales carnvoros en

Intenta explicar tambin porqu la seleccin natural


ha favorecido, en cada caso, el desarrollo o la atrofia
de los distintos rganos: patas, cola, ojos, etctera.

La forma primitiva es la 6, que corresponde a un animal acutico con las extremidades en forma de aletas, a partir de ella
surgen tres lneas:

67

9 LA EVOLUCIN DE LOS SERES VIVOS


Una lnea conduce a animales con cuatro patas bien
desarrolladas idneas para el desplazamiento el medio
terrestre (1). Las formas intermedias son 2 y 5.
Otra lnea conduce a seres con larga cola y ojos prominentes (3) que pueden haber vivido en lagos de cierta profundidad en donde la larga cola les permitira desplazarse
reptando sobre el fondo y los ojos bien desarrollados
aprovechar al mximo la escasa luz. La forma intermedia
es el animal con el nmero 4.
Por ltimo, la forma primitiva 6 da lugar a un tipo de animal acutico muy simple que ha perdido las extremidades superiores. Esta forma 7 podra haber habitado en
aguas dulces de poca profundidad, como su antecesor,
pero habra evolucionado hasta formar una nueva especie cuando el lago principal, debido a una intensa evaporacin, hubiera dado lugar a dos pequeas lagunas.

INVESTIGACIN
CIENTFICA
TIKTAALIK: UN ANIMAL EXCEPCIONAL
1 Cules fueron los motivos para la eleccin de la isla
de Ellesmere?
Eligieron la isla Ellesmere porque en ella las rocas sedimentarias correspondientes a la poca geolgica que los cientficos
buscaban se hallan prcticamente en la superficie y son, por
lo tanto, de fcil acceso.

68

2 Hace 375 millones de aos el clima de la isla Ellesmere era distinto al actual por qu?
Porque hace 375 millones de aos, debido a la deriva de los
continentes, los materiales que hoy conforman la isla estaban
situados en las proximidades del ecuador.
3 Haz una breve descripcin de Tiktaalik roseae.
Tiktaalik era un pez de gran tamao, entre 1,5 y 2 m, con
aspecto de cocodrilo porque tena la cabeza plana. Como
todos los peces tenan el cuerpo cubierto de escamas, sus
extremidades tenan forma de aleta y respiraban por branquias. Adems de branquias, se cree que estos animales
tenan pulmones, como la mayora de los peces primitivos,
que les permitan respirar cuando salan del agua.
Se parecan a los vertebrados terrestres en que podan mover
la cabeza en torno al cuello. Adems, tenan costillas que
les deban facilitar los movimientos respiratorios de la caja torcica. La estructura interna de sus aletas muestra una
disposicin de los huesos semejante a las de cualquier cuadrpedo.
4 Por qu crees que algunos cientficos han comparado el hallazgo de Tiktaalik con el de Archaeopteryx?
Porque Archaeopteryx es tambin una forma de transicin
entre dos grupos distintos, los reptiles y las aves. El hallazgo
de los fsiles de Archaeoptheryx supuso un gran avance en
la comprensin de la evolucin de las aves a partir de los
reptiles.

Solucionario

adaptaciones

coMuniDaD DE MaDriD
actiVidades
1 Indica a qu agente geolgico externo corresponde
cada una de las ilustraciones de la Figura 10.1.
a)
b)
c)
d)

La accin fluvial.
La atmsfera.
Los seres vivos.
El viento.

2 Con tus propias palabras, intenta definir los procesos geolgicos externos.
Leyendo el texto pueden deducir que los procesos geolgicos externos son el tipo de acciones que pueden realizar
los agentes geolgicos externos o los mecanismos que utilizan.
3 Qu diferencias existen entre el proceso de meteorizacin y el proceso de erosin?

Tanto las ras como los fiordos son valles invadidos por el mar
en su ltimo tramo. Sin embargo, las ras son valles fluviales,
mientras que los fiordos tienen origen glaciar.
8 Qu relacin existe entre la cubierta vegetal de una
zona y su sensibilidad frente a la erosin?
La vegetacin protege el suelo del arrastre de partculas que
realiza el viento, o las aguas salvajes, o su cada por gravedad. Es decir, un suelo cubierto de vegetacin est protegido
frente a la erosin.
9 Por qu el viento es el principal agente en las zonas
desrticas y no en las zonas templadas?
En primer lugar, porque las zonas desrticas estn situadas en
reas donde existen vientos intensos de direccin constante.
Esto es algo que no ocurre en las zonas templadas.
10 Utiliza la escala grfica de abajo para calcular la distancia entre los puntos A y B en el mapa.

Deben contestar que la meteorizacin es la alteracin de


la roca (fsica o qumica), pero sta no pierde materiales. Sin
embargo, la erosin implica desgaste.
4 En el relieve de la zona donde vives, qu factor predomina?
Probablemente, el factor predominante sea el antrpico. Sin
embargo, dependiendo de la zona de la Comunidad donde
vivan puede haber algn otro factor, como el climtico, el
estructural, el litolgico.
5 Por qu podemos encontrar formas de disolucin
en un paisaje calizo si el carbonato clcico, componente
de la caliza, es un compuesto insoluble en agua?
Esta cuestin pretende que recuerden la carbonatacin que
sufre el carbonato clcico por la accin del dixido de carbono disuelto en el agua de lluvia, y su transformacin en
bicarbonato clcico que es un compuesto soluble.

Midiendo la distancia con un papel y trasladndola a la escala


grfica, sale una distancia de 900 m, aproximadamente.

CO2 + H2O H2CO3 (cido carbnico)


CaCO3 + H2CO3 Ca(HCO3)2 (bicarbonato clcico)
6 Puede ser indefinido el retroceso de un acantilado?
No. Al ir retrocediendo el acantilado, se va formando la plataforma de abrasin. Cuanto ms retroceda el acantilado,
mayor ser esta plataforma, hasta llegar a un punto en que
pierdan energa las olas y en ella sedimenten en lugar de
erosionar.
7 Busca informacin acerca de las ras y los fiordos.
Cmo se originan? Existe alguna semejanza entre
ellos?

70

actiVidades FinaLes
paRa RepasaR
1 Cules son los agentes geolgicos externos que
actan en el modelado del relieve?
Son el agua (lquida o en forma de hielo), el viento, la atmsfera y los seres vivos.
2 Completa el siguiente cuadro:
Algunos ejemplos de respuesta son:

Sistema
morfoclimtico

Forma
erosiva

Forma
de depsito

Glaciar

Valle en U

Morrenas

Periglaciar

Coladas de suelo

Pedriza

Templado

Valle en V

Delta

Intertropical

Pan de azcar

Costras salinas en el
suelo

Subdesrtico

Crcavas

Costras salinas en
los uadis

Desrtico

Taffoni

Duna

3 Relaciona los trminos de las dos columnas:


Litolgico

Cueva krstica

Antrpico

Embalse fluvial

Estructural

Cerro testigo

Dinmico

Suelos poligonales

Climtico

Acantilado

4 A qu llamamos paisaje krstico? Cita dos formas


que se originen por disolucin y dos por precipitacin.
Llamamos paisaje krstico al que se origina por disolucin de
la roca caliza con el agua de lluvia, que contiene CO2.
Formas originadas por disolucin: lapiaces, dolinas, simas,
grutas, cavernas, galeras.
Formas originadas por precipitacin: estalactitas, estalagmitas.

e) Las plataformas de abrasin se originan en la base


de los acantilados.
VERDADERA.

paRa apLicaR
6 El Gobierno gallego ofrece hoy los primeros clculos oficiales sobre las hectreas quemadas en los once
das de lucha contra el fuego. Fuentes de la Xunta ya
adelantaron que la superficie arrasada por la oleada de
incendios se encuentra entre 60 000 y 65 000 hectreas.
(Consumer.es, 16 Agosto de 2006).
Las fuertes tormentas que han sacudido Galicia en los
ltimos das han convertido buena parte de las playas
de las Ras Bajas en un inmenso campo de lodo y residuos arrastrados desde los montes. (El Mundo, 26
Octubre de 2006).
Describe la relacin que existe entre los fenmenos descritos en las dos noticias.
Los incendios dejaron la zona desprovista de vegetacin. Las
tormentas erosionaron el terreno, arrastrando los materiales
hasta el mar.
7 Explica con algn ejemplo la accin geolgica de los
seres vivos.

5 Lee las siguientes frases e indica si son verdaderas


o falsas. Si son falsas, corrgelas:

Los seres vivos meteorizan el relieve, actuando como agente externo sobre ste. Puede tratarse de una meteorizacin
mecnica o qumica, como la que realizan las lombrices de
tierra cuando segregan el suelo al desplazarse por su interior
o cuando como descomponedores modifican la composicin
qumica del suelo.

a) La gelifraccin se produce al congelarse el agua que


se acumula en las grietas de las rocas.

8 Cmo explicaras la presencia de formas glaciares


en Pealara si ahora no existen glaciares en esa zona?

VERDADERA.

Un posible ejemplo sera la accin de las races de los


vegetales, fracturando las rocas al introducirse entre
ellas.

b) Las Chimeneas de Hadas se originan por la accin


erosiva del viento.
FALSA. Las chimeneas de hadas se originan por la accin erosiva de las aguas salvajes.
c) Las playas son formas sedimentarias producidas por
el mar en las ensenadas.

9 Por qu crees que las dunas mviles pueden constituir


un peligro para los pueblos, cultivos, carreteras, etc.? Se te
ocurre qu medida se podra adoptar para solucionarlo?

VERDADERA.

Las dunas que se mueven pueden invadir cultivos, carreteras,


etc., si stos se encuentran en su camino de avance.
La mejor solucin es frenar su avance, fijndolas. Para fijarlas
se repueblan con especies, generalmente xerfitas.

d) Los valles en U se deben a la accin erosiva de los torrentes.

10 Dibuja el contorno de una parcela cuadrada de


20 metros de lado a las siguientes escalas:

FALSA. Los valles en U se deben a la accin erosiva de los


glaciares.

a) 1:50
b) 1:100

71

coMuniDaD DE MaDriD
c) 1:500
d) 1:1 000
20 m = 2 000 cm
A escala 1:50 resulta un cuadrado de: 2 000/50 = 40 cm de lado.
A escala 1:100 resulta un cuadrado de: 2 000/100 = 20 cm de
lado.
A escala 1:500 resulta un cuadrado de: 2 000/500 = 4 cm de lado.
A escala 1:1 000 resulta un cuadrado de: 2 000/1 000 = 2 cm
de lado.
11 Cul de estas escalas de la actividad 10 es la mayor?
Cul la menor? Raznalo.
De las escalas del ejercicio anterior, la mayor es la escala 1:50
y la menor es 1:1000, porque cuanto mayor sea el valor al que
se transforma, menor ser el mapa obtenido.
12 Si tuvieras que representar una parcela de 25 x 18
metros, qu escala utilizaras para que el dibujo cupiese
en una hoja tamao A4?
Las dimensiones de la hoja tamao A4 son 29,7 x 21,1 cm.
A escala 1:100, el dibujo tendra unas dimensiones de 25 x
18 cm.

paRa aMpLiaR
13 Recuerda el ciclo del agua en la naturaleza y relacinalo con el modelado del relieve.
El agua de los ocanos se evapora y en la atmsfera es un
agente que produce meteorizacin qumica.
Desde la atmsfera cae en forma de precipitaciones. Si son de
hielo, se puede acumular en zonas de clima fro originando los
glaciares, agentes modeladores del paisaje en esas zonas.
Si son de agua, al caer acta sobre las laderas (aguas de
arroyada o aguas salvajes). stas se pueden reunir formando
torrentes y, posteriormente, ros. Todas estas formas de agua
lquida discurriendo por la superficie modelan el relieve de
las zonas por las que pasan.
Si se infiltran hacia el interior, el agua subterrnea tambin
puede modelar el relieve en zonas krsticas.
En definitiva, el movimiento del agua en ese ciclo modela el
relieve de la superficie terrestre.
14 Busca informacin sobre zonas krsticas importantes en la pennsula Ibrica.
Ejemplos de paisajes krsticos sobre calizas en la pennsula
Ibrica son el Torcal de Antequera (Mlaga) o el Monasterio de Piedra en Zaragoza, as como la Ciudad Encantada en
Cuenca y el Macizo de Larra en Navarra.

72

Ejemplos de modelado krstico sobre yesos existen en el


valle del Ebro, en Sorbas (Almera) o el Parque Natural
de los Calares del Ro Mundo y de la Sima en la provincia de
Albacete.
15 Existen en Espaa ejemplos de todos los sistemas
morfoclimticos?
Aparte de formas debidas a antiguos glaciares, existen glaciares en Pirineos, como el del Aneto. En los mismos Pirineos,
Sistema Central y otras cordilleras existen condiciones periglaciares.
El sistema intertropical con una estacin seca estara representado en Canarias.
Los sistemas desrtico y subdesrtico se encuentran en Murcia, Almera y las Canarias orientales.
Y el ms representado es el sistema templado.
16 Elabora un informe sobre la desertizacin en Espaa, indicando las zonas ms afectadas y las posibles
causas de esta evolucin.
La desertizacin amenaza ya a ms del 30 % del territorio,
sobre todo en el sureste peninsular, aunque sus efectos se
extienden tambin hacia el interior.
Las posibles causas de la desertizacin: los incendios frecuentes, el mal uso del suelo, cultivos inadecuados, etctera.
17 Infrmate sobre el paisaje conocido como Las Mdulas en la provincia de Len. Hoy en da est reconocido
por la UNESCO como Patrimonio de la Humanidad, pero
qu agentes son los responsables de tan peculiares formas del relieve?
Las Mdulas de Carucedo, una explotacin aurfera romana
del siglo I, constituyen un buen ejemplo de cmo puede influir la actividad humana en el modelado del relieve.

pon en pRctica
eL Mapa topoGRFico.
LeVantaMiento de Un peRFiL.
1 Localiza los puntos de cota mxima y mnima del
mapa.
Atendiendo al mapa de la pgina 219 del libro del alumno, la cota mxima corresponde al pico de Abantos con
1 753 m (aunque en este mapa el pico de Los Tientos
aparece con 1 754 m, mientras que en otros le adjudican
1 749 m) y la mnima, aunque no se ve muy claro, pero
parece corresponder a la zona urbanizada inferior derecha (San Lorenzo de El escorial) con menos de 1 100 m
de altura.

Escala 1:50 000


Equidistancia: 20 m
Fragmento de la hoja 0533 del MTN 50: San Lorenzo
de El Escorial (2002)

Refugio de la Naranjera, la Baslica del valle de los Cados, la


carretera que llega a la baslica, el pueblo de San Lorenzo de
El Escorial, el embalse de Tobar, el embalse del Boquern...

2 Calcula la distancia entre la Fuente de las Negras y


el Refugio de la Naranjera.

inVestiGacin
cientFica

Midiendo la distancia en el mapa, son 4,5 cm. Para transformar a escala 1:50000, multiplicamos por 50000 y obtenemos
155 000 cm, es decir 2,25 km.
3 Halla la pendiente entre el punto C y el Pico de
Abantos.
Para calcular una pendiente en tantos por ciento basta con
considerar la siguiente regla de tres:
En la horizontal, mido la distancia entre C y el Pico de Abantos. En el mapa esta distancia es de 2,5 cm. Con el cambio de
escala se obtiene 1 250 m.
Observando las curvas de nivel se ve que el punto C est a
1520 m y Abantos a 1753 m. La distancia en la vertical entre
ambos puntos es de 1753 1520 = 233 m.
Por cada 100 metros se ascender:
X = 233 x 100/1 250 = 18,6 % de pendiente.
4 Dibuja el perfil topogrfico entre los puntos A y B.
Exageramos al doble la escala vertical. Y resulta un perfil con
esta forma:

cUestiones
1 Por qu crees que se engloban bajo la misma definicin de humedal ecosistemas tan variados?
Todos ellos tienen en comn no slo que se basan en el agua,
sino la importancia ecolgica como reserva de muchas especies amenazadas.
2 Cules son las principales funciones que realizan
los humedales?
Albergan muchas especies raras o amenazadas.
Controlan la amenaza de las inundaciones.
Contribuyen al mantenimiento de los acuferos subterrneos.
Ayudan a estabilizar las condiciones climticas locales.
3 Elabora una cadena trfica tpica de un humedal de
la Comunidad de Madrid.
Los alumnos deben buscar informacin y poner en prctica
los conocimientos adquiridos en cursos anteriores y en los
otros temas. Por ejemplo:
Fitoplancton Insecto acutico Barbo Nutria
4 Enumera las actividades humanas que pueden poner en peligro los humedales.

5 Identifica en el mapa un pico, un valle, una zona de


fuerte pendiente y otra de pendiente suave. Qu caractersticas de las curvas de nivel te han permitido localizarlos en el mapa?
El pico que se observa es Abantos. El valle podra ser por el
que discurre el Arroyo de los Tejos. La zona de fuerte pendiente podra ser la cara del monte Abantos que da hacia San
Lorenzo. Y una zona de pendiente suave podra ser la cara de
Los Tientos que da hacia el embalse de Tobar.
El pico se detecta porque es una cota de ms altura dentro
de una curva de nivel cerrada. El valle se detecta por la V
que forman las curvas de nivel.
La zona de fuerte pendiente se muestra con las curvas de
nivel muy prximas, y la de pendiente suave, por lo contrario,
estn muy separadas.
6 Localiza tres construcciones humanas en el mapa.

Se trata de que los alumnos reflexionen y tomen conciencia


de la vulnerabilidad de estas especies de tanto valor ecolgico. Podran ser:
Actividades extractivas: ridos en las riberas de los ros,
etctera.
Construcciones de infraestructuras: carreteras, vas de
ferrocarril, etctera.
Urbanizacin y construccin de viviendas, zonas industriales, etctera.
Actividades agrcolas o ganaderas.
Excursionismo y actividades de ocio incontroladas.
Vertidos de residuos y basuras.
5 Por qu crees que puede ser importante la proteccin oficial de estos ecosistemas?
Los ecosistemas son vulnerables a la alteracin humana, por
tanto es precisa alguna reglamentacin que proteja los humedales de las posibles actividades que los modifiquen.

73

ANDALUCA
UNIDAD 1
INVESTIGACIN CIENTFICA:
CUESTIONES
1 Busca informacin sobre el ocano Japeto. Cundo
se origin? Cmo se cerr? Dnde hay vestigios de l?
El ocano Japeto se form hace unos 525 millones de aos, cuando se fragment Gondwana, en Amrica del Norte por un lado, y
Amrica del Sur, frica y trozos de islas pequeas, por otro. Qued
entonces una masa de agua por medio, el ocano Japeto. Ms
tarde, este ocano se cerr al colisionar islas separadas de Amrica
del Sur con Amrica del Norte. Los restos de la corteza ocenica del ocano de Japeto que fueron plegados y levantados por el
choque entre los dos continentes pueden seguirse por el contorno sur del Macizo de Aracena, donde aflora en amplias reas. El
mejor corte de estos restos del antiguo ocano lo ofrece la carretera que va desde la N-435 a Almonaster, a partir del km 10,3, por
la que se va pasando por una amplia gama de anfibolitas.
2 La sierra de Aracena se form en la orogenia Hercnica. Qu otras orogenias ha sufrido la pennsula
Ibrica?
Se pueden identificar en el relieve europeo tres grandes orogenias: la Caledoniana, desde el Cmbrico (590 millones de aos)
hasta el final del Silrico (408 millones de aos); la herciniana, desde el Devnico (408 millones de aos) hasta el final del Prmico
(245 millones de aos); y la alpina, desde el Trisico (245 millones
de aos) hasta el final del Negeno (1,6 millones de aos).
La pennsula y sus mrgenes son el resultado de la formacin de la
cordillera Hercnica, en el Devnico, hace unos 300 millones de
aos, hasta la actualidad. Es difcil reconstruir los acontecimientos
geolgicos que tuvieron lugar durante el ciclo Caledoniano, antes
de la formacin de Pangea, ya que los ciclos orognicos hercnicos
y alpinos han borrado sus huellas en la mayor parte de Iberia.
3 El periodo del Plioceno es considerado el clmax de
la edad de los mamferos. Comenta esta frase.
El Plioceno, junto con el Pleistoceno, se caracteriz por el
desarrollo de grandes mamferos, muchos de los cuales an
perduran como especies. As, abundaban bfalos, elefantes,
mamuts, antlopes, hipoptamos, tejones, zorros, leones,
linces, nutrias, pumas, etc. En esta poca tambin se produjo la evolucin de los homnidos, con el Homo habilis y el
Homo erectus, antepasados del hombre actual.

UNIDAD 2
INVESTIGACIN CIENTFICA:
CUESTIONES
1 Qu es un mapa de isosistas?

74

Los mapas de isosistas representan mediante curvas las zonas


que presentan el mismo nivel de intensidad de un sesmo, utilizando la escala de Mercalli modificada que posee 12 grados.
2 Es lo mismo un macrosismo que un microsismo?
Qu diferencia hay entre ellos?
Todo sesmo inferior a tres grados en la escala de Richter
se considera como un microsismo. Son como pequeos
terremotos detectados por los sismgrafos, pero que generalmente no son apreciables por las personas. Se les llama
temblores y generalmente son de carcter local.
Los macrosismos son terremotos cuyos efectos sobre los
elementos y las personas que se encuentran sobre la superficie terrestre son perceptibles, causando graves daos. Se
les suelen llamar terremotos.
Todos los sesmos superiores a tres grados, aunque no hayan
sido percibidos por la poblacin ni hayan provocado daos
sobre las construcciones o el paisaje, no pueden ser considerados como microsismos.
3 Qu ventajas puede ofrecernos el estudio la sismicidad histrica de una zona?
Hasta hace poco tiempo, no se conoca el epicentro de terremotos como el de Alhama, en 1884, o el de Mlaga, en 1680,
ya que las estaciones ssmicas que registran los terremotos y
envan la seal a los observatorios no empezaron a funcionar
a pleno rendimiento hasta principios del siglo XX.
Sera interesante conocer el epicentro porque podran repetirse en el futuro con la misma intensidad y en el mismo lugar.
En muchas ocasiones, el epicentro del terremoto se encuentra
en una zona cercana a la zona destruida, en la que, debido a la
falta de poblacin, sus efectos no se dejaron sentir. Pero puede
ocurrir que dichas zonas, al cabo de varios siglos estn pobladas.
Por ello, si analizamos los epicentros de terremotos ocurridos
en el pasado, no slo conoceremos nuestra historia ssmica,
sino que tambin podremos elaborar mapas de riesgo. Esto nos
permitir conocer la localizacin exacta de las zonas que presentan un mayor peligro para evitar daos en el futuro y poner
en marcha medidas de prevencin que incluyan construcciones
sismorresistentes y localizadas en terrenos estables.

UNIDAD 3
INVESTIGACIN CIENTFICA:
CUESTIONES
1 Sabes si en tu localidad hay algn yacimiento paleontolgico? Busca informacin sobre este tema.
Para contestar esta pregunta, adems de consultar las pginas de su ayuntamiento, se puede consultar el inventario
de la Geodiversidad de Andaluca creado por la Junta de la
Comunidad, donde se recogen todos los lugares de inters
geolgico y paleontolgico.

2 En Andaluca existen dos lugares donde hay huellas de


dinosaurios. Localzalos. Encuentra y expn algunas hiptesis que intentan explicar la extincin de estos reptiles.
Los dinosaurios aparecieron sobre la Tierra prcticamente al
mismo tiempo que los primeros mamferos, y desaparecieron
hace 65 millones de aos. Hay que tener en cuenta que dicha
desaparicin o extincin:
Fue progresiva, ya que empez segn las especies desde
10 millones hasta 3 millones de aos antes del fin del
Cretcico.
Coincidi con un descenso brusco de la temperatura y
una regresin marina que caus un descenso del nivel
de las aguas entre 100 y 200 metros.
Se produjo una intensa actividad ssmica en el subcontinente indio.
Por ello, surgieron varias teoras sobre un posible cambio de
temperatura y climtico, una intensa actividad volcnica que
pudo envenenar a los seres vivos y posibles enfermedades
que los afectaron. Se empezaron a considerar otras alternativas, como la de algn fenmeno provocado por un objeto
venido del espacio.
En el ao 1990 se encontr un crter de 200 km de dimetro
en el golfo de Mxico, el crter de Chixulub, cerca de la pennsula del Yucatn. Parece que se origin por un meteorito de 10 km de dimetro que choc contra el planeta a unos
90 000 km/h. Se ha encontrado una delgada capa de arcilla
que contena grandes cantidades de un metal raro y poco
comn en la Tierra, iridio. Dicho estrato coincide en el tiempo
con la poca en la que desaparecieron los dinosaurios.
Recientemente se han descubierto otros de crteres de 30
y 25 km de dimetro en Ucrania (crter de Boltysh) y en el
mar del Norte (crter de Silverpit ), fechados tambin con 65
millones de aos, que hizo pensar que la Tierra sufri probablemente un bombardeo csmico.
El impacto de esos asteroides provoc:
Terremotos de gran magnitud.
Violentas erupciones volcnicas.
La combustin de hasta 13 millones de toneladas de carbono, aumentando de forma considerable la cantidad de
dixido de carbono presente en la atmsfera y elevando
la temperatura unos 7 C.
Parece ser que en estas circunstancias, se alter la cadena alimentaria y slo sobrevivieron los animales de menos de 25 kg,
ya que son ms adaptables y menos sensibles a las variaciones
de temperatura y de dixido de carbono. Los grandes dinosaurios desaparecieron; sin embargo, sobrevivieron numerosos
dinosaurios de tamao reducido. Hoy en da se piensa que
hubo un conjunto de causas adems de la mencionada anteriormente, que provocaron esta extincin:
Los dinosaurios poseen una vida que oscila entre 75 hasta
300 aos, lo que les habra impedido adaptarse de forma
rpida a las nuevas condiciones medioambientales.
Una epidemia podra haber terminado con ellos, pero tras
el estudio de los huesos fsiles no se ha podido encontrar
ninguna prueba que demuestre esta hiptesis.
Los depredadores habran devorado los huevos de los
dinosaurios.

Se pudieron ver afectados por la irradiacin csmica, producida tras la explosin de una supernova; por la alteracin en la capa de ozono o por un descenso o inversin
del campo magntico terrestre.
Variaciones climticas causadas por variaciones en la rbita terrestre ante las que los dinosaurios no pudieron
sobrevivir.
El iridio pudo afectar a los huevos de dinosaurios tal y como se ha comprobado en 11 huevos hallados en la India
y fechados hace 65 millones de aos.
En Andaluca encontramos icnitas en Santiesteban del Puerto
(Jan) y en Los Giles (Almera).
3 Qu circunstancias crees que hacen del yacimiento
de Orce un lugar tan relevante a nivel paleontolgico?
Respuesta abierta. El alumno ha de buscar la informacin en
artculos de prensa o cientficos. La importancia del yacimiento radica en que en l se han encontrado restos humanos,
se cree que de pocas previas a los hallados en Atapuerca,
una gran noticia para la investigacin paleontolgica de la
llegada del ser humano a la pennsula Ibrica.

UNIDAD 4
INVESTIGACIN CIENTFICA:
CUESTIONES
1 Busca informacin referente a las clulas madre y
responde a las siguientes preguntas:
a) Qu tipos existen?
Hay tres tipos: las embrionarias, las adultas y las fetales.

Embrionarias: se obtienen a partir del blastocisto. En


este estadio, el embrin es una masa esfrica con unas
150 clulas, en cuyo interior se localizan las clulas madre. Dichas clulas son pluripotenciales, es decir, pueden
originar cualquier tejido.
Adultas: se originan por la divisin de las clulas madre
embrionarias. Se localizan en muchos tejidos del organismo: cerebro, mdula sea, msculo, piel, intestino, hgado, pncreas y retina. Su funcin es reemplazar las clulas
que mueren, pero su ritmo de divisin es muy diferente:
las de la mdula sea y las de la sangre son muy activas
y se dividen continuamente, a diferencia, por ejemplo,
de las que estn en el intestino delgado, que son menos
activas.
Fetales: se obtienen a partir del cordn umbilical y tienen caractersticas similares a las adultas.

b) Qu aplicaciones pueden tener?


La principal aplicacin es utilizarlas para regenerar rganos
y tejidos daados del organismo.

75

ANDALUCA

Trasplantes: los principales problemas de los trasplantes


son la falta de donantes y el riesgo de rechazo. El uso de
las clulas madre, que pueden originar cualquier rgano o
tejido, sera la solucin al problema. Se podran aplicar en
enfermedades como el parkinson, la diabetes, la distrofia
muscular, infartos y lesiones medulares (parlisis).
Probar frmacos con potencial teraputico: para que
un medicamento sea aprobado tiene que pasar antes por
un largo proceso. Se prueba en voluntarios humanos, pero
previamente se hacen ensayos administrando el frmaco
a animales vivos o con lneas celulares de rata o ratn, por
ejemplo. Pero la respuesta de un animal y del ser humano
ante el medicamento puede ser muy diferente. Por eso, se
suelen probar tambin en lneas celulares humanas in vitro,
que en muchos casos llevan mucho tiempo mantenidas
en el laboratorio y ya no son exactamente iguales a las
originales. Si se utilizaran clulas madre, stas seran ms
parecidas a las originales y, por tanto, podramos comprobar con ms exactitud la efectividad del frmaco.
Se pueden utilizar para testar toxinas.
Terapia gnica: experimentar con nuevas tcnicas de
ingeniera gentica, ya que son clulas en las que podemos introducir genes curativos fcilmente.

c) Cmo podemos obtenerlas?


La obtencin de clulas madre es un proceso largo y complejo. En laboratorio tenemos que recrear las mismas condiciones en el que las clulas actan en el organismo.
El proceso comienza aislando la masa celular interna del embrin y colocndola sobre un soporte de vidrio o plstico
donde hemos depositado previamente un medio con los nutrientes que necesitan las clulas para multiplicarse y crecer.
A la vez que las clulas se van multiplicando y aumentando
en nmero, vamos repitiendo el proceso, obteniendo, al final,
una lnea celular de clulas embrionarias.
En la actualidad, la mayora de las lneas de clulas madre embrionarias se originan a partir de embriones de ratn. Pero ya
se est estudiando la manera de obtenerlas a partir de embriones sobrantes de procesos de FIV (fecundacin in vitro).
Las podemos obtener mediante clonacin teraputica, es
decir, con el mismo procedimiento empleado para originar
clones enteros como la oveja Dolly.
d) A qu crees que son debidos los problemas ticos
generados en su uso?
Como hemos visto, las clulas madre pueden proceder de varias
fuentes, pero las que ms controversia provocan son las originadas a partir de embriones humanos, los cuales son destruidos.
vulos fertilizados, procedentes de mujeres sometidas a tratamientos de fertilidad mediante fecundacin in vitro, se encuentran congelados en algunas instituciones. Dichos vulos se
encuentran en una situacin de vaco legal, ya que no pueden
ser utilizados por otras mujeres y no se puede investigar con
ellos. Adems, en un periodo mximo de cinco aos deben ser
destruidos.

76

Estos embriones se pueden usar como fuente de clulas madre,


ya que podran convertirse en cualquier clase de tejido humano,
y as servir de estudio para obtener tratamientos efectivos para
un gran nmero de enfermedades que afectan al ser humano.
En EE UU., se prohibi la creacin de embriones humanos que
slo sirvan como fuente de clulas madre. Sin embargo, se
permitir que continen las investigaciones con las clulas
madre que ya existen en los laboratorios.
La posicin en Europa es ms compleja, pues, aunque algunos pases tienen legislacin al respecto, muchos an no la
han desarrollado.

UNIDAD 5
INVESTIGACIN CIENTFICA:
CUESTIONES
1 El cncer es una enfermedad cuya causa todava no
se conoce con exactitud. Infrmate sobre las posibles
causas que lo originan, as como las medidas que podemos adoptar para prevenirlo.
El cncer es el producto del acmulo de mltiples alteraciones o
mutaciones en los genes. Estas alteraciones se producen cuando se activan genes especficos que se denominan oncogenes
y que se pueden expresar desarrollando un tumor o cuando se
inactivan otros genes llamados supresores de tumores.
En general, las clulas tumorales se caracterizan por dividirse de forma incontrolada escapando a los mecanismos de
control que rigen la divisin, proliferacin y muerte celular.
En nuestro pas, el cncer es la primera causa de mortalidad
entre los 35 y los 64 aos. Segn estudios recientes, cerca del
40 % de los varones y un 28 % de las mujeres sern diagnosticados de cncer a lo largo de su vida.
Hay factores que predisponen a sufrir cncer, como ciertas
sustancias qumicas, algunas hormonas, las radiaciones ionizantes o determinados virus. Pero tambin existe una predisposicin gentica, de manera que algunos tipos de cncer
son hereditarios (parece que aquellos que estn relacionados
con los genes supresores).
Tumores tan frecuentes como el cncer de mama y el de intestino grueso tienen un componente hereditario, lo que ha
llevado a las autoridades sanitarias a desarrollar programas
de prevencin y diagnstico precoz del cncer en la poblacin con mayor probabilidad de sufrirlo. Para ello, es necesario identificar a los individuos de alto riesgo, estudiando
su historia familiar en relacin al cncer.
Se sabe que el tabaco, la dieta, la obesidad y la falta de ejercicio son factores de riesgo para esta enfermedad. Dos de
cada tres casos de tumores se deben a ello, mientras que los
debidos a un factor gentico (como mama, ovario, colon o
melanoma de piel) constituyen menos del 5 % de los casos.

De esta forma, promover hbitos saludables de vida, acudir


a revisiones que puedan dar lugar a diagnsticos tempranos,
as como conocer nuestra susceptibilidad gentica, son los
mejores mtodos preventivos con los que contamos en la
actualidad.
2 Busca informacin sobre el DGP como estrategia
para evitar las consecuencias de determinadas enfermedades hereditarias.
El Diagnstico Gentico Preimplantatorio (DGP) es una forma de diagnstico temprano para parejas con alto riesgo
de descendencia con enfermedades genticas. La ventaja de
este mtodo es que no conlleva riesgos para el embarazo,
ya que ste an no existe. El DGP se realiza antes de que los
embriones que se han producido por fertilizacin in vitro
sean transferidos al tero. Adems de evitar la interrupcin del embarazo por problemas en el feto, esta tcnica
mejora las probabilidades de xito en lograr un embarazo,
ya que se transfieren nicamente embriones libres de la
enfermedad gentica que se est tratando. Los resultados
que se obtienen con este estudio son fiables, precisos y
comparables con los que se derivan de estudios durante
el embarazo, como la biopsia de vellosidades coriales, (alrededor de la 12. semana de embarazo) o la puncin de
lquido amnitico amniocentesis (aproximadamente en
la 16. semana).
El asesoramiento con el Departamento de Gentica Preimplatacional se aconseja especialmente en casos como: edad
materna avanzada, antecedentes de infertilidad sin causa
aparente, hijo anterior con enfermedad gentica, antecedentes de algn familiar afectado, cariotipo patolgico de
alguno de los padres o antecedentes de prdidas fetales o
abortos espontneos sin causa.
Sin embargo, cualquier pareja puede realizar una consulta
antes de realizar un procedimiento de fertilizacin asistida.
Enfermedades genticas que se pueden detectar mediante
DGP son fibrosis qustica, alpha y beta talasemia, hemofilia
A y B, anemia de clulas falciformes, alzheimer, enfermedad
de Huntington, hidrocefalia ligada al cromosoma X, distrofia
miotnica, retinoblastoma o fenilcetonuria, entre otras.

UNIDAD 6
INVESTIGACIN CIENTFICA:
CUESTIONES
1 Qu es la farmacogentica y la farmacogenmica?
Qu aplicaciones pueden tener?
La farmacogentica se ocupa de estudiar la respuesta de las
personas ante los frmacos teniendo en cuenta su herencia
gentica, ya que los genes, adems de la dieta o el estilo de
vida tambin pueden influir en dicha respuesta.
La farmacogenmica es el estudio de la variabilidad en
expresin de los genes en la respuesta a distintos frma-

cos teniendo en cuenta la caractersticas de las secuencias


genmicas. Se diferencia de la farmacogentica, de la que
deriva, en que la primera estudia genes individuales, y la
segunda, la variabilidad mostrada por grupos de genes.
El objetivo de la farmacogentica y la farmacogenmica
es la creacin de frmacos a medida para cada paciente y
adaptados a sus condiciones genticas. Hay que tener en
cuenta que muchas personas deben ser hospitalizadas por
reacciones adversas a medicamentos. Es necesario, adems,
encontrar las dosis adecuadas para cada persona. Conociendo la gentica de cada cuerpo se puede mejorar la salud de
la poblacin.
2 Busca informacin sobre las ventajas y la situacin
de la agricultura ecolgica en Espaa.
La agricultura ecolgica es aquella que utiliza tcnicas
agrarias que excluyen el uso, en agricultura y ganadera, de
productos qumicos de sntesis, como fertilizantes, plaguicidas, antibiticos, etc., para as proteger el medio ambiente,
preservar o aumentar la fertilidad del suelo y proporcionar
alimentos naturales.
Nuestro pas, por sus condiciones climticas y por los sistemas extensivos que desde hace tiempo se aplican en un
gran nmero de cultivos, rene condiciones muy favorables
para su desarrollo. Respecto a la ganadera, poseemos un
gran patrimonio gentico de razas autctonas adaptadas
al medio, que favorece, por tanto, la cra y explotacin en
rgimen extensivo.
Ventajas de la agricultura ecolgica:
Es saludable al no contener sustancias artificiales, pesticidas,
antibiticos, fertilizantes sintticos, aditivos y conservantes,
por lo que estos alimentos son asimilados correctamente por
el organismo sin alterar las funciones metablicas.
No contiene aditivos sintticos que pueden provocar problemas en la salud, tales como: insuficiencias cardiacas,
osteoporosis, migraas e hiperactividad.
No contiene pesticidas, que segn estudios toxicolgicos
realizados, estn relacionados con enfermedades como
el cncer, las alergias y el asma.
No contiene organismos genticamente modificados.
El cultivo de OGM puede tener consecuencias negativas
para el medio ambiente y faltan investigaciones sobre
las consecuencias de su consumo para la salud.
No contiene antibiticos que hoy en da presentan un
uso creciente en la ganadera tradicional y que poseen
efectos sobre la salud humana.
Es sostenible con el medio ambiente, ya que el cultivo
ecolgico colabora en la conservacin del medio ambiente: evita la contaminacin de la tierra, del agua y del
aire, es respetuosa con la fauna, no genera residuos contaminantes y ayuda al ahorro energtico.
Sus productos tienen mximos niveles de calidad.
Es respetuosa con el bienestar animal, ya que presenta
medidas para evitar el estrs de los animales y favorecer
el crecimiento en semilibertad. Los animales no son ma-

77

ANDALUCA

nipulados para lograr una mayor produccin, ya que no


se practica la inseminacin artificial ni se utilizan hormonas. La alimentacin es a base de pastos naturales, leche
materna y piensos y forrajes ecolgicos, sin pesticidas,
fertilizantes ni transgnicos. Esta ganadera, adems,
potencia las variedades autctonas, que son las mejor
adaptadas a las condiciones de una zona determinada.
Es respetuosa con la naturaleza, favoreciendo un desarrollo sostenible. Evita la desertificacin, disminuye la escorrenta y favorece la retencin del agua, no contamina los
acuferos, fomenta la biodiversidad, mantiene los hbitat
de los animales silvestres, favorece la biodiversidad y el
equilibrio ecolgico con la aplicacin de tcnicas como
la rotacin, uso de abonos verdes, ganadera extensiva,
etc., recicla los nutrientes al usar compost o abonos orgnicos y utiliza de forma ptima los recursos naturales.
Sus productos son ms sabrosos, ya que al ser elaborados de forma artesanal, mantienen el sabor tradicional
y, adems, se conservan mejor que los convencionales.

UNIDAD 7
INVESTIGACIN CIENTFICA:
CUESTIONES
1 Busca informacin sobre alguna zona de tu localidad
que presente o pueda presentar riesgos de eutrofia.
Respuesta abierta.
2 Qu otras actividades humanas, aparte de las mencionadas, pueden generar eutrofia?
Destacamos:
La contaminacin agropecuaria que afecta a suelos y
acuferos. Algunos fertilizantes inorgnicos y los excrementos animales son una fuente de nitrgeno en forma
de nitrato y amonio y de fsforo, como fosfato.
Las contaminaciones forestales, por abandono de residuos forestales y restos del aprovechamiento maderero,
lo que aumenta la materia orgnica disuelta.
La contaminacin atmosfrica por xidos de nitrgeno
(NOx) y xidos de azufre (SOx). stos reaccionan con el
agua atmosfrica para formar ion nitrato (NO3-) e ion sulfato (SO42-), que alcanzan el suelo y reaccionan con los
cationes all presentes, provocando el empobrecimiento
de ste en nutrientes. Las sales formadas son arrastradas
a los acuferos y a los ros, contaminndolos y eutrofizndolos.
La contaminacin urbana. Los efluentes urbanos pueden
aportar:
Residuos orgnicos.
Residuos inorgnicos como el fosfato, empleado en
la fabricacin de detergentes. Por ello, la legislacin
actual promueve la eliminacin del fosfato en la fabricacin de estos productos.

78

3 Describe los cambios fsicos, qumicos y biolgicos


que se producen en el agua por el proceso de eutrofizacin.
Cambios biolgicos:
Aumenta considerablemente el fitoplancton, desarrollndose las algas verdeazules de forma espectacular.
Aumenta la actividad bacteriana.
Los animales acuticos enferman y mueren.
Cambios fsicos:
Los restos de plantas y animales muertos se acumulan en
el fondo.
El agua cambia de color: rojo, verde, amarillo o pardo.
El agua se vuelve maloliente.
Cambios qumicos:
El oxgeno disuelto baja, afectando a los organismos, que
pueden llegar a morir.
Aumenta la concentracin de compuestos nitrogenados
y fosfatados.

UNIDAD 8
INVESTIGACIN CIENTFICA:
CUESTIONES
1 Qu importancia tiene para la biodiversidad la
reintroduccin del quebrantahuesos?
La prdida de la biodiversidad conlleva una prdida de la
calidad de nuestra vida como especie, pudiendo, incluso,
llegar a provocar nuestra extincin. Por tanto, la conservacin
de especies, como es el quebrantahuesos, y espacios naturales, es el principal modo de asegurar nuestro desarrollo, ya
que nuestra propia existencia depende de la diversidad de
ecosistemas que seamos capaces de conservar.
2 Busca informacin acerca de las causas que han provocado la extincin del quebrantahuesos. Cmo podemos evitar su regresin?
Algunas de las causas de la extincin son:

El uso ilegal de cebos envenenados, que afecta sobre


todo a aves adultas y, por tanto, las que poseen capacidad
reproductora. Esta prctica ilegal se considera delito desde 1995, ya que provoca la muerte de miles de animales
silvestres, sobre todo predadores y carroeros.
Las lneas elctricas localizadas en zonas de montaa
provocan la muerte por colisin o electrocucin.
La caza ilegal es el factor que ms ha influido en los procesos de extincin del quebrantahuesos.
La transformacin de su hbitat por las construcciones
en reas de montaa.

Las molestias generadas por la actividad humana.


El abandono de las prcticas ganaderas tradicionales.

Todos podemos colaborar en la proteccin de esta especie:

Senderistas: si encontramos algn ave muerta o herida


debemos informar, y si estamos en algn lugar donde
estn comiendo, no debemos molestarlas.
Escaladores: debemos respetar las zonas donde se prohba
o regule la escalada, sobre todo en la poca de incubacin
y primeros das de vida del pollo (diciembre a abril).
Practicantes del parapente y ala delta: respetar las zonas
excluidas de vuelo en caso de que existan.
Fotgrafos y naturalistas: no debemos acercarnos a los nidos
para no molestar a los polluelos ni afectar a la puesta.
Ganaderos: durante siglos, los restos de animales muertos, siempre y cuando la causa de la muerte no sea una
enfermedad peligrosa, han sido dejados para que lo
aprovechen los carroeros, prctica que hoy en da todava es aconsejable.
Cazadores: no disparar sobre especies protegidas, ya que
es ilegal, y adems, deteriora la imagen de este colectivo
con esta actitud.

3 Busca informacin acerca de la Red Andaluza de


Centros de Recuperacin de Especies Amenazadas.
Podemos encontrar amplia informacin de esta Red Andaluza en la web de La Consejera de Medio Ambiente de la
Junta de Andaluca.

UNIDAD 9
INVESTIGACIN CIENTFICA:
CUESTIONES

be a un abrigo rocoso en Le Moustier (Francia), donde se


descubri en 1860 una industria ltica prehistrica asociada
a fsiles de neandertales.
2 Define un rbol filogentico en taxonoma.
Un rbol filogentico es aquel que muestra la relacin evolutiva que existe entre diferentes especies o taxones. Se utilizan
en biologa para conocer cmo se encuentran emparentados
los organismos vivos. En ellos se usa informacin proveniente
de fsiles y la generada al comparar estructural y molecularmente a los organismos.
Poseen un tronco y ramas, pero en los ltimos se muestran las
relaciones entre especies y no entre individuos. Los rboles
filogenticos se construyen tomando en cuenta la teora de la
evolucin, que nos indica que todos los organismos son descendientes de un ancestro comn: as, todos los organismos,
ya estn vivos o extinguidos, se encuentran emparentados
en algn grado.
3 Por qu la endogamia es negativa para la supervivencia del lince ibrico?
La endogamia es perjudicial para todas las especies, ya que
disminuye la variabilidad gentica. Los organismos transmiten
sus genes a su descendencia, pero esos genes pueden tener
defectos, genes que suelen ser recesivos. Supongamos que
un individuo tiene algunos genes recesivos enfermos, la posibilidad de cruzarse con alguien de un entorno distinto al
suyo con los mismos genes recesivos enfermos es muy baja
y, por lo tanto, su descendencia ser sana. En cambio, si se
cruza con alguien muy cercano, la posibilidad de que ambos tengan ese gen recesivo enfermo aumenta y, por tanto,
la posibilidad de que aparezca en la descendencia no slo
aumenta, sino que pueden juntarse nuevos genes recesivos
y transmitir an ms defectos.

1 Qu se entiende por cultura musteriense?


Es aquella cultura que forma parte del Paleoltico medio, en
la que domina el hombre de neandertal. Su nombre se de-

79

COMUNIDAD VALENCIANA
UNIDAD 2

UNIDAD 8

INVESTIGACIN CIENTFICA:
CUESTIONES

INVESTIGACIN CIENTFICA:
CUESTIONES

1 Qu diferencias encuentras entre las manifestaciones de fenmenos volcnicos y subvolcnicos referidos


en el texto?

1 A qu crees que es debido el considerable aumento


de especies invasoras en los ltimos decenios?

Las manifestaciones volcnicas son ms espectaculares, ya


que son restos de crteres o chimeneas de antiguos volcanes.
Al originarse por salidas violentas del magma al exterior aparecen productos propios de estas erupciones, como bloques,
escorias, lapilli, bombas, cenizas volcnicas y coladas de lava.
La roca predominante es el basalto y tiene una antigedad
de entre 5 y 2 millones de aos.
Las manifestaciones subvolcnicas consisten, generalmente,
en afloramientos de ofitas, son ms abundantes y de mayor
antigedad.
2 Crees que existe alguna relacin entre la existencia
de fallas tectnicas en una zona y la presencia de vulcanismo en la misma?
Normalmente, el vulcanismo est asociado a la presencia de
grietas o fallas en la corteza terrestre, y es por ellas por donde
el magma busca su salida al exterior.

80

Entre otros motivos, cabra destacar el constante intercambio


de mercancas entre pases de todo el mundo, el aumento del
turismo, el trfico de especies exticas y el hbito de adquirir
animales exticos como mascotas.
2 En qu medida puedes colaborar t para frenar dicho avance?
Por ejemplo, evitando la adquisicin de estas especies en
otros pases o en los comercios de nuestra ciudad, e informando a las autoridades competentes de la presencia en
nuestro entorno de cualquiera de ellas.
3 Busca informacin sobre el mejilln cebra y elabora un informe sobre sus caractersticas, posibles vas de
transmisin y los efectos que puede ocasionar fuera
de su hbitat natural.
Respuesta abierta.

Solucionario

GUA
DIDCTICA

DinMica TErrESTrE:
la DEriVa conTinEnTal

ACTIVIDADES
1 Responde verdadero (V) o falso (F) justificando la
respuesta:
a) El origen de las cordilleras suscit dos tendencias
opuestas: el fijismo y el contraccionismo. FALSO. Las
cordilleras son grandes estructuras geolgicas cuyo origen suscit un importante debate entre los gelogos,
que defendan dos tendencias opuestas, llamadas fijista
y movilista.

Amplias zonas de la Tierra (los geosinclinales) se hallaban


a gran profundidad bajo el nivel del mar y, por tanto, estuvieron sometidas, durante millones de aos, a una intensa
sedimentacin.
Los sedimentos acumulados se transformaron en rocas sedimentarias, que posteriormente se plegaran al disminuir el
radio de la Tierra, elevndose por encima del nivel del mar,
lo que entonces dara lugar a las cordilleras.
4 Rellena el siguiente esquema:

b) El fijismo considera que los continentes no han variado su posicin en toda la historia de la Tierra.
VERDADERO.
c) El hecho de que las rocas plegadas de las cadenas
montaosas fueran en su mayor parte sedimentarias
llev a la teora del contraccionismo. FALSO. El hecho
de que las cadenas montaosas estuvieran formadas por
rocas plegadas y que dichas rocas fueran en su mayor
parte sedimentarias llev, a mediados del siglo XIX, a la
teora del geosinclinal.
d) El contraccionismo no explica la presencia de fsiles
idnticos de organismos terrestres en continentes
separados miles de kilmetros por grandes ocanos.
VERDADERO.
2 Define:
a) Movilismo: es una de las dos tendencias que explica
el origen de las cordilleras. Afirma que las masas continentales se desplazan horizontalmente, de manera que
en pocas anteriores pudieron adoptar configuraciones
distintas a la actual, incluso estar reunidas en una sola.
Esos movimientos ocasionaran el plegamiento y levantamiento de determinadas reas, formndose, as, las
cordilleras.
b) Contraccionismo: durante el siglo XIX predominaron las
teoras fijistas, de las cuales la principal representante fue
el contraccionismo. Esta idea afirmaba que el progresivo
enfriamiento de la Tierra desde su origen habra provocado una contraccin de sta, como le ocurre a cualquier
cuerpo que pierde calor. La corteza terrestre, ya en estado
slido, se vera afectada por esta reduccin de volumen,
arrugndose como la piel de una manzana a medida que
se va secando. Las arrugas formadas seran las numerosas
cordilleras que se extienden por su superficie.
3 Rellena el siguiente prrafo con las palabras que
faltan.
El hecho de que las cadenas montaosas estuvieran formadas por rocas plegadas y que dichas rocas fueran en su
mayor parte sedimentarias llev, a mediados del siglo XIX, a
la teora del geosinclinal.

82

5 Define:
a) Puente continental: brazos de tierra firme que habran
unido a unos continentes con otros (como el que hoy une
los continentes americanos), permitiendo as la libre migracin de plantas y animales por todo el planeta. Estos
puentes habran desaparecido posteriormente.
b) Deriva continental: Alfred Wegener, quien opinaba que
la gran extensin de algunos fsiles se deba a que, cuando
dichos organismos existieron, los continentes se hallaban
reunidos en uno slo y posteriormente se separaron. Sus
ideas se renen en la teora de la deriva continental.
6 Quin elabor la teora de la expansin del fondo
ocenico? Y la tectnica de placas?
Hess y Dietz elaboraron su teora de la expansin del fondo
ocenico, a la que sigui la actual teora de la tectnica de
placas de Tuzo Wilson.
7 Cita alguna razn por la cual la existencia de puentes
continentales no sera cierta.
Para poder explicar la gran expansin de muchos fsiles
terrestres, sera necesario que estas estructuras hubiesen sido
muy numerosas y largas.
8 La teora de la tectnica de placas apareci antes o
despus de la deriva continental?
La teora de la tectnica de placas actualmente es la que se
considera como vlida para explicar el origen de las cordille-

ras y apareci despus de la deriva continental (a principios


del siglo XX, por Alfred Wegener).
9 Hemos visto que el contraccionismo no explicaba la
presencia de fsiles idnticos de organismos terrestres
en continentes separados por ocanos. Un ejemplo de
ello es el Mesosaurus, pero tambin existen otros restos
fsiles como el Glossopteris:
a) Qu es el Glossopteris?
El Glossopteris es un helecho.
b) Por qu este fsil no da por verdadera la teora del
contraccionismo?
No da por verdadera la teora del contraccionismo porque se
han encontrado grandes semillas de este helecho distribuidas
por Australia, frica, India, Amrica del Sur y la Antrtica.
c) Cita algn ejemplo ms.
Otro ejemplo seran los marsupiales emparentados en Australia y Amrica.
10 Asocia con flechas los siguientes trminos:
Bacon
Atlntida
Wegener
Semejanzas frica-Amrica
Buffon
Deriva continental
Zinder-Pellegrini
frica y Amrica unidos
Bacon
Wegener
Buffn
Zinder-Pellegrini

Semejanzas frica-Amrica
Deriva continental
frica y Amrica unidos
Atlntida

11 Cules fueron los cuatro tipos de evidencias que


con sus observaciones Wegener logr aportar?
Las observaciones de Wegener le permitieron aportar cuatro
tipos de evidencias: geogrficas, paleontolgicas, geolgicas
y climticas.
12 Define:
a) Pangea: nombre que recibi el gran supercontinente
inicial.
b) Phantalassa: vasto ocano que rodeaba Pangea.
c) Laurasia: uno de los fragmentos en que se parti Pangea,
formando Laurasia, al norte (Eurasia y Norteamrica).
d) Gondwana: uno de los fragmentos en que se parti
Pangea, formando Gondwana al sur (frica, Sudamrica,
India, Australia y la Antrtida).
13 Responde verdadero (V) o falso (F) a las siguientes
afirmaciones razonando en caso negativo:
a) Cada continente posee algunas formas de vida propia. VERDADERO.

b) La dispersin de ciertos fsiles en distintos continentes afirman que stos no estaban reunidos en
uno slo. FALSO. La gran dispersin de fsiles como
el Mesosaurus demostraba que en la poca en la que
vivieron (este reptil se encuentra en rocas con una edad
de 260 millones de aos), los continentes del Hemisferio
Sur se hallaban reunidos en uno solo, de manera que
las tierras que habitaban eran parte de un mismo territorio.
c) Algunas cordilleras se interrumpen en las costas de un
continente para reaparecer al otro lado del ocano.
VERDADERO.
14 Explica cmo las montaas Apalaches de Norteamrica son una evidencia de la existencia de Pangea.
Estructuras geolgicas como algunas cordilleras se interrumpen en la costa de un continente para reaparecer al otro lado
del ocano. Tal es el caso del sistema montaoso de unos
300 millones de aos de antigedad que se extiende desde
el norte de Groenlandia y forma las montaas Apalaches en
toda la costa este de Norteamrica.
15 Hay evidencias geolgicas como ciertas rocas que
demuestran que los continentes estuvieron unidos en
un supercontinente: Pangea que despus fue fragmentndose. Pon algn ejemplo.
Wegener encontr rocas semejantes y de la misma antigedad en frica y Sudamrica, como es el caso de algunas rocas
gneas.
16 Define el trmino tillitas. Las tillitas son una evidencia climtica de la teora de Wegener, explica el por qu.
Las tillitas son rocas sedimentarias de origen glaciar que se
forman por cementacin de los materiales abandonados por
los hielos glaciares. Indicaban la existencia de un fenmeno
glaciar en frica, Sudamrica, Australia e India.
17 Responde verdadero (V) o falso (F) a las siguientes
afirmaciones razonndolas en caso negativo:
a) Norteamrica y Eurasia tuvieron un periodo glaciar
hace 300 millones de aos. FALSO. En Norteamrica
y Eurasia se formaron en esa poca sus principales yacimientos de carbn debido a la descomposicin de
abundantes bosques tpicos de un clima tropical (clido
y hmedo).
b) Los yacimientos de carbn son una prueba de clima
tropical. VERDADERO.
c) Una evidencia geolgica de la teora de la deriva
continental son las tillitas. FALSO. Las tillitas son una
evidencia climtica de la teora de la deriva continental.

83

DinMica TErrESTrE:
la DEriVa conTinEnTal

18 Rellena el siguiente prrafo con las palabras que


faltan.
Una glaciacin de tales dimensiones tendra que haber sido ocasionada por un cambio climtico global; una bajada
de las temperaturas en todo el planeta, que debera haber
dejado huella tambin en el hemisferio norte. Sin embargo,
en Norteamrica y Eurasia se formaron en esa poca sus principales yacimientos de carbn debido a la descomposicin
de abundantes bosques tpicos de un clima tropical, clido
y hmedo.
19 Otros ejemplos de evidencias climticas son los depsitos morrnicos y los depsitos arrecifales:
a) Qu es una morrena?
Es el material de arrastre amontonado en los lados de la lengua del glaciar. Puede aparecer tambin en la parte central
y final de la lengua.
b) Los depsitos arrecifales indican clima glacial o clima tropical?
Clima tropical.
c) Une con flechas:
Morrenas
Arrecifes

Sudfrica
Norteamrica

20 Definir los siguientes trminos:


Sial
Sima

La corteza se divide en dos capas: sima y sial. El sial est


compuesto de rocas ricas en slice y aluminio que flotan
sobre el sima o fondo ocenico, constituido por rocas semifundidas o viscosas, ricas en silicatos de hierro y magnesio.
21 Responde verdadero (V) o falso (F) a las siguientes
afirmaciones:
a) Hace 400 millones de aos los continentes se hallaban reunidos en nica masa de tierra llamada Pangea. FALSO. Hace 200 millones de aos, los continentes
se hallaban reunidos en nica masa de tierra llamada
Pangea.
b) La causa del movimiento de las capas es la propia
rotacin de la Tierra. VERDADERO.
c) La teora de Wegener no fue admitida en su momento
principalmente porque no fue capaz de encontrar el
verdadero mecanismo por el que se movan los continentes. VERDADERO.
22 Escribe un prrafo en el que incluyas las siguientes
palabras:

84

Capas
Sima
Sial
Rocas semifundidas o viscosas
Cordilleras

La corteza se divide en dos capas: sima y sial. El sial est compuesto de rocas ricas en slice y aluminio que flotan sobre el
sima o fondo ocenico, constituido por rocas semifundidas o
viscosas, ricas en silicatos de hierro y magnesio. En su desplazamiento, pliegan y elevan por encima del nivel del mar los materiales depositados, formando, de esta manera, las cordilleras.
23 Enlazar cada capa de la Tierra con la caracterstica
correcta.
Corteza
Manto
Manto
Ncleo

Espesor de 30 a 70 km
82 % del volumen total
Corrientes de conveccin
Ncleo interno

24 Cules son los dos tipos de estudios que podemos


hacer de la estructura interna de la Tierra? En qu consiste el esttico?
Los dos tipos de estudios que existen son composicional
o esttico y el dinmico.
El estudio composicional o esttico consiste en la divisin en
capas en funcin de los datos de composicin qumica del
interior obtenidos a partir de estudios directos e indirectos.
25 Completa el prrafo con las siguientes palabras:
manto, conveccin, temperatura, 82 y 2 900.
El manto representa el 82 % del volumen total de la Tierra. El manto superior llega hasta los 670 km y en l se producen corrientes de conveccin, debidas a diferencias de
temperatura. El lmite del manto inferior est a 2 900 km de
profundidad.
26 El ncleo externo es lquido o slido? Y el ncleo
interno?
Se cree que la parte ms interna del ncleo es slida. Pero la
parte externa de ste aparece derretido, aunque no hay evidencias seguras, de modo que los cientficos no estn seguros
de su composicin exacta. Una idea radical ha sido propuesta
recientemente sugiriendo abrir una grieta en el planeta y enviar
una sonda ah abajo para aprender ms sobre este asunto.
El ncleo de Marte tiene alguna relacin con el de la
Tierra?
Un interesante conjunto de pruebas recientes muestran
que el ncleo de Marte puede ser igualmente esponjoso.
Los cientficos han llegado a esta suposicin estudiando las
mareas en Marte.

27 Responde a las siguientes cuestiones con verdadero


(V) o falso (F), justificando tu respuesta:
a) La litosfera tiene un comportamiento rgido, ya
que las rocas ms profundas se encuentran a mayor
temperatura. FALSO. No toda la litosfera tiene un comportamiento rgido, ya que las rocas cercanas al lmite
litosfera-astenosfera se hallan a una mayor profundidad
y las condiciones de temperatura a las que se encuentran
son mayores, llegando incluso a encontrarse cerca de su
temperatura de fusin, lo que confiere a la litosfera un
carcter dctil.
b) La mesosfera se corresponde con el manto inferior.
VERDADERO.
c) La astenosfera se comporta de manera plstica
permitiendo que la mesosfera se deslice sobre
ella. FALSO. La astenosfera se comporta de manera
plstica permitiendo que la litosfera se deslice sobre
ella.
d) Las condiciones de temperatura en la endosfera suponen que slo el 2 % de su estructura se halla en estado de fusin. FALSO. Las condiciones de temperatura
de las endosfera son las ms altas.

peratura a las que se encuentran son mayores, llegando


incluso a encontrarse cerca de su temperatura de fusin,
lo que confiere a la litosfera un carcter dctil.
31 Define brevemente los siguientes trminos:

Plataformas estables: algunos escudos estn cubiertos


por una capa de rocas sedimentarias no deformadas y
dispuestas horizontalmente. Estas reas reciben el nombre de plataformas estables.
Escudo: las zonas internas de los continentes suelen
tener una antigedad de ms de 600 millones de aos
(algunas rocas llegan a los 4 000 millones de aos). Generalmente se trata de terrenos que fueron montaosos,
pero su relieve fue arrasado por la erosin, que dio lugar
a estas zonas llanas, llamadas escudos.
Cordillera: la larga formacin de montaas situadas
normalmente en los bordes de los continentes recibe el
nombre de cordilleras.

32 En un mapamundi seala las siguientes cordilleras:


cordillera Norteamericana, cordillera de los Alpes, cordillera de los Andes y cordillera del Himalaya.

28 Ordena de menor a mayor profundidad los siguientes


trminos: mesosfera, litosfera, endosfera y astenosfera.
litosfera astenosfera mesosfera - endosfera
29 Desde finales del siglo pasado se ha puesto en duda
la existencia de la astenosfera. Explica el por qu de esta
teora.
Desde finales del siglo pasado se ha puesto en duda la existencia de esta capa. Actualmente, a partir del estudio del
movimiento de las ondas ssmicas se ha desarrollado la tomografa ssmica, una tcnica que proporciona una secuencia
de imgenes por ordenador en planos consecutivos con las
que se realizan reconstrucciones tridimensionales del interior de la Tierra. Estas imgenes presentan islas calientes de
comportamiento plstico, separadas por zonas rgidas ms
fras (en azul).
Se puede concluir entonces que entre los 100 y los 670
km de profundidad no existe realmente una astenosfera
o capa continua de tipo plstico, ya que tambin hay zonas a esa profundidad donde los materiales siguen siendo
rgidos.
30 Completa el siguiente prrafo sobre la litosfera:
La litosfera tiene un espesor medio de unos 100 km, aunque puede llegar a los 250 km bajo los continentes. Su temperatura es baja, por lo que se comporta en general como
un slido rgido.
Pero no toda la litosfera tiene un comportamiento rgido,
ya que las rocas cercanas al lmite litosfera-astenosfera, se
hallan a una mayor profundidad y las condiciones de tem-

33 Enumera las diferencias que encuentres entre los


Apalaches y el Himalaya.
Los Apalaches son cinturones montaosos antiguos, mientras
el Himalaya es joven (de menos de 100 millones de aos). La
cordillera de los Apalaches se encuentra ms erosionada que
la del Himalaya. El Himalaya est en el continente asitico,
mientras que los Apalaches estn en Norteamrica.
34 Qu es una isla? Explica el origen de las islas. Qu
significa el trmino islas continentales? Enumera algunos
ejemplos de islas continentales.
Una isla es una porcin de tierra menor que un continente que
se encuentra totalmente rodeada de agua. Toda su superficie
tomada a la misma altura sobre el nivel del mar est sometida
a un clima similar, a diferencia de lo que ocurre en los continentes. Existen islas en los ros, lagos, mares y ocanos. El tamao de las islas es variable, pudiendo tener desde unos pocos
metros cuadrados de superficie hasta ms de dos millones de
kilmetros cuadrados, como es el caso de Groenlandia.
Las islas pueden tener diversos orgenes, como la erosin
y la sedimentacin, en especial las que estn ubicadas en

85

DinMica TErrESTrE:
la DEriVa conTinEnTal

mares y ocanos. Pueden evolucionar y aumentar su tamao


por depsitos de sedimentos o por acumulacin de material
volcnico u orgnico. En ocasiones, pueden ser formadas
por procesos erosivos en los cuales una porcin de tierra
queda separada de un continente. El aumento del nivel del
mar tambin provoca el surgimiento de islas, cuando se sumergen las tierras bajas y quedan separadas las zonas ms
altas de las islas.
Las islas continentales son partes de tierra conectadas por
la plataforma continental a un continente. Esto significa que
estas islas son parte del continente adyacente y estn localizadas en su plataforma continental. Ejemplos de este tipo
de islas son:

Groenlandia de Amrica del Norte.


Gran Bretaa de Europa.
Granada, Trinidad, islas Malvinas de Amrica del Sur.
Sicilia de Europa.
Sumatra y Java de Asia.
Papa y Tasmania de Oceana.
Isla de Vancouver de Canad.
Terranova de Canad.
Cuba de Caribe.
La Espaola de Caribe.

35 Explica cmo se demostr que los continentes adems de tener movimientos horizontales de acercamiento
o separacin, tambin poseen movimientos verticales.
Adems de los movimientos horizontales de acercamiento o
separacin, se ha demostrado que los continentes tambin
poseen movimientos verticales de ascenso y descenso.
Los estudios realizados demostraron que el lmite inferior de
la corteza continental a lo largo de su extensin no se halla
siempre a la misma profundidad, sino que bajo las cordilleras
la corteza es ms gruesa y, por tanto, alcanza una profundidad mayor que en las zonas bajas de los continentes.
36 Responde a las siguientes cuestiones con verdadero
(V) o falso (F), justificando la respuesta:
a) Bajo las cordilleras la corteza es menos gruesa. FALSO.
Bajo las cordilleras la corteza es ms densa.
b) A medida que un continente pierde masa por efecto
de la erosin, ste se eleva para alcanzar su posicin
de equilibrio. VERDADERO.
c) Se denomina isostasia al concepto de una corteza
que se halla en equilibrio con el manto mediante flotacin. VERDADERO.
37 Define brevemente los siguientes trminos:

86

Sismgrafo: un sismgrafo registra la intensidad de los


terremotos y la hora exacta a la que ocurren.
Volcn: un volcn, en esencia, es un aparato geolgico, comunicante temporal o permanentemente entre el

manto y la superficie terrestre. Un volcn es tambin una


estructura geolgica, por la cual emerge magma (roca
fundida) y gases del interior de un planeta.
Terremoto: se denomina sismo, o simplemente temblor a
las sacudidas o movimientos bruscos del terreno generalmente producidos por disturbios tectnicos o volcnicos.

38 Los fenmenos vulcanismo y sismicidad se distribuyen al azar? Razonar la respuesta.


Ninguno de los dos fenmenos (vulcanismo y sismicidad)
se distribuye al azar, sino que, en ambos, la mayor actividad
tiene lugar principalmente en dos zonas muy concretas: a lo
largo de las costas que delimitan el ocano Pacfico (lo que
se ha llamado el cinturn de fuego), y de este a oeste por el
sur de Eurasia, desde el Mediterrneo hasta el Himalaya e
Indonesia. Adems, existe actividad ssmica y volcnica en los
ocanos, siguiendo lneas que recorren todo el planeta.
39 Responde a las siguientes cuestiones con verdadero
(V) o Falso (F), justificando la respuesta:
a) Los mrgenes continentales se definen como la zona
submarina prxima a los continentes. VERDADERO.
b) La plataforma y el talud no estn formados por los
mismos tipos de rocas. FALSO. La plataforma y el talud
estn formados por los mismos tipos de rocas.
c) Las llanuras abisales son cuencas submarinas con
una fuerte pendiente: FALSO. Las fosas ocenicas son
cuencas submarinas con una fuerte pendiente.
d) Las fosas ocenicas son cadenas montaosas que se
extienden a lo largo de un eje central formado por
una depresin a modo de valle: FALSO. Las dorsales
ocenicas son cadenas montaosas que se extienden
a lo largo de un eje central formado por una depresin a
modo de valle.
40 Completar el siguiente prrafo sobre las dorsales
ocenicas.
Las dorsales ocenicas o relieves submarinos son cadenas
montaosas que se extienden a lo largo de un eje central
formado por una depresin a modo de valle en cuya parte
inferior existe una grieta (rift, en ingls) por la que asciende
intermitentemente lava procedente del manto. La actividad
volcnica existente en las dorsales es la causante de la creacin de nueva corteza ocenica. La primera dorsal en ser estudiada fue la dorsal atlntica, que recorre de norte a sur la
parte media del ocano Atlntico. Todas las dorsales se unen
a travs de los ocanos, llegando a superar los 70 000 km de
longitud.
41 lvaro y Miguel estn viendo la edad de dos rocas.
Una de ellas (la roca A) se hallaba en el rift, mientras la roca B se encontraba en la plataforma continental. lvaro
dice que la roca B es ms antigua que la roca A, mientras
Miguel piensa lo contrario. Quin tiene razn? Razona
la respuesta.

Tiene razn lvaro, la variacin de la edad coincide con la del


grosor de sedimentos, es decir, los materiales ms recientes
se hallan en el rift y a ambos lados de las dorsales. Progresivamente, segn nos alejamos de las dorsales y nos acercamos
los continentes, los materiales son ms antiguos y mayor es
el espesor de los sedimentos.

d) La teora de la expansin ocenica fue redactada


por Harry Hess y no fue aceptada hasta que Robert
Dietz la relacion con las inversiones magnticas.
FALSO. La teora de la expansin ocenica fue redactada por Harry Hess y Robert Dietz. No fue aceptada hasta
que Vine y Matthews la relacionaron con las inversiones
magnticas.

42 Cmo se origina el campo magntico terrestre?


El campo magntico terrestre se origina porque el ncleo acta como un imn debido a la interaccin entre el ncleo
externo fluido y el interno slido (rico en hierro).

46 Define:

Subduccin: debe existir un mecanismo compensador,


pues en caso contrario la Tierra se hinchara como un
globo. Tal compensacin se produce en las fosas ocenicas, en las que la corteza ocenica, en su colisin con
la corteza continental, se introduce por debajo de sta y
se incorpora al manto, en un proceso denominado subduccin.

Corrientes de conveccin: las corrientes de conveccin


son movimientos cclicos de fluidos debidos a diferencias
de densidad.

43 Qu tipo de rocas se encuentra en la parte inferior


del fondo ocenico? Dnde se encuentra la capa de sedimentos? Qu otro tipo de roca encontramos y en qu
capa se encuentra?
Las muestras obtenidas al perforar el fondo ocenico revelan
tres capas: en la parte inferior est formado por rocas plutnicas del tipo del gabro, encima se hallan rocas volcnicas
y sobre ellas una capa de sedimentos, que llega a tener un
grosor de casi 1,5 km cerca de los continentes disminuyendo progresivamente al aproximarnos a las dorsales, donde
desaparecen.
44 Las aves migratorias como las cigeas son maestras de la navegacin. Para orientarse utilizan tres tipos
de brjula: el campo magntico, las estrellas y el Sol.
Explica el mecanismo de orientacin por el campo magntico en las aves migratorias. Este tipo de orientacin
ocurre en otro animal que no sea un ave? Pon algn
ejemplo.
Las aves pueden detectar cambios en el campo magntico
de la Tierra ayudadas por los cristales de magnetita que
poseen en su cerebro. Esta teora fue propuesta a mediados del siglo XX al observarse que al colocar imanes
en la cabeza de palomas mensajeras stas se desorientaban. Esta forma de orientacin explica cmo algunas
aves encuentran su ruta en cielos muy cerrados y bajo
condiciones atmosfricas adversas. Algunos animales que
tambin se orientan gracias al campo magntico terrestre
son las abejas.
45 Responder a las siguientes cuestiones con verdadero (V) o falso (F), justificando tu respuesta:
a) En la teora del fondo ocenico se afirma que no es
necesario un mecanismo compensador. FALSO. Debe
existir un mecanismo compensador, pues en caso contrario la Tierra se hinchara como un globo.
b) A travs de las dorsales ocenicas asciende material
fundido del manto que se sita a ambos lados de la
dorsal. VERDADERO.
c) El factor principal por el que se producen las corrientes de conveccin es la densidad. VERDADERO.

47 Completa el siguiente prrafo sobre la teora de la


expansin del fondo ocenico.
Los continentes no se desplazan sobre el fondo ocenico,
sino que son arrastrados por corrientes de conveccin trmicas existentes en el manto, formando celdas convectivas
cuya rama ascendente coincide con el rift de la dorsal y la
descendente con la zona de subduccin.
48 En el siglo XIX se realizaron los grandes viajes del descubrimiento del fondo ocenico. Como hemos visto, el
primer viaje a gran escala dedicado exclusivamente a la
expedicin oceanogrfica fue el Challenger. Contesta:
a) Cul fue la primera expedicin martima, terrestre
y naturalista?
La expedicin del Beagle en 1820.
b) Robert Fitzroy fue reasignado como comandante en el
segundo viaje y, esta vez, jefe de la segunda expedicin
hidrogrfica (1832-1835), complementaria de la primera. Qu ilustre personaje viaj como naturista?
Charles Darwin.
c) Los datos y las observaciones tanto de fauna, flora,
as como de fsiles, le ayudaron a elaborar su teora.
Sabras decir a qu teora nos referimos?
Elabor la teora de la evolucin basada en la seleccin
natural.
49 Rellena la siguiente tabla de las magnitudes en escala Richter:

87

DINMICA TERRESTRE:
LA DERIVA CONTINENTAL

Magnitud Escala Richter

Efectos del terremoto

< 3,5

No se siente, pero se registra

3,5-5,4

Daos menores

5,5-6,0

Daos ligeros

6,1-6,9

Daos severos

7,0-7,9

Daos graves

>8

Destruccin total

A qu magnitud de la escala Richter corresponde un


grado VI de la escala Mercalli?
Entre 5,5-6,0 de la escala Richter.

ACTIVIDAD PRCTICA
Corrientes de conveccin
a) Qu observas?
Las gotas de colorante alimentario suben y bajan.
b) Cmo se llama este proceso?
Este movimiento se debe a corrientes de conveccin.
c) Explica el mecanismo por el cual ocurre este proceso.
Al estar calentando el recipiente, el material de fondo est
a mayor temperatura, por lo que las gotas de colorante alimentario tienen menor densidad y ascienden. En la zona
superior la temperatura es menor y las gotas se enfran,
aumentando su densidad, por lo que desciende. Y as sucesivamente.

EXAMEN TIPO TEST


Marca la/s respuesta/s correctas en las siguientes cuestiones:

88

c)
d)

Evidencia biolgica.
Evidencia geogrfica.

3) Los puntos de la teora de la deriva continental son:


a)
b)
c)
d)

Existencia de Pangea hace 200 millones de aos.


La rotacin de la Tierra es la causa del movimiento.
Existencia de las capas sima y sial en la corteza.
La atraccin gravitatoria de la Luna es capaz de desplazar los continentes.

4) Las capas de la Tierra segn su composicin son:


a)
b)
c)
d)

Ncleo interno.
Endosfera.
Corteza ocenica.
Manto.

5) Ejemplos de cordilleras que no tienen ms de 100


millones de aos son:
a)
b)
c)
d)

Los Apalaches.
Los Andes.
El Himalaya.
Los Urales.

6) Cules de las siguientes estructuras forman parte


del relieve ocenico?
a)
b)
c)
d)

Cordilleras.
Talud continental.
Llanuras abisales.
Plataforma continental.

7) Cules de las siguientes afirmaciones no explican la


teora de la expansin ocenica?
a) Existe un proceso de subduccin.
b) Los continentes son arrastrados por corrientes de
conveccin.
c) Existe un fenmeno de isostasia.
d) Las tillitas.

1) Las teoras fijistas son:

8) Cules de los personajes contribuyeron al desarrollo


de las ideas movilistas?

a)
b)
c)
d)

a)
b)
c)
d)

La teora de los puentes continentales.


La teora de la expansin del fondo ocenico.
El contraccionismo.
La teora geosinclinal.

Francis Bacon.
George Zinder.
Alfred Wegener.
Alexander Pellegrini.

2) Las observaciones de Wegener sobre el parecido


entre las costas continentales le permitieron aportar
cuatro tipos de evidencias:

9) Cules de los siguientes trminos dan nombre a algunos de los continentes u ocanos de la teora de la
deriva continental?

a) Evidencia paleomagntica.
b) Evidencia paleontolgica.

a) Panthalassa.
b) Mesosauro.

c) Gondwana.
d) Laurasia.

Ninguno de los estudios realizados posteriormente ha encontrado evidencias de dicha contraccin.

10) La exploracin del fondo ocenico aport una serie


de datos de gran importancia sobre:

Adems, el contraccionismo no explicaba la presencia de


fsiles idnticos de organismos terrestres en continentes separados miles de kilmetros por grandes ocanos, como es
el caso de algunas especies de plantas y de reptiles. Es obvio
que cada especie surgi en uno de los continentes; entonces,
cmo viaj hasta los otros?

a)
b)
c)
d)

Su expansin.
Su edad.
Su riqueza.
Su relieve.

EXAMEN DE
DESARROLLO
1 Explica las dos tendencias opuestas que suscitaron
el debate entre los gelogos sobre el origen de las cordilleras.
Las cordilleras son grandes estructuras geolgicas cuyo origen suscit un importante debate entre los gelogos, que
defendan dos tendencias opuestas, llamadas fijista y movilista.
El fijismo considera que los continentes no han variado su
posicin en toda la historia de la Tierra.
El movilismo, en cambio, afirma que las masas continentales
se desplazan horizontalmente, de manera que en pocas
anteriores pudieron adoptar configuraciones distintas a la
actual, incluso estar reunidos en uno solo. Esos movimientos
ocasionaran el plegamiento y levantamiento de determinadas reas, formndose, as, las cordilleras.
Durante el siglo XIX predominaron las teoras fijistas, de las
cuales la principal representante fue el contraccionismo. Esta idea afirmaba que el progresivo enfriamiento de la Tierra
desde su origen habra provocado una contraccin de sta,
como le ocurre a cualquier cuerpo que pierde calor. La corteza
terrestre, ya en estado slido, se vera afectada por esta reduccin de volumen, arrugndose como la piel de una manzana
a medida que se va secando. Las arrugas formadas seran las
numerosas cordilleras que se extienden por su superficie.
El principal dato en el que se apoya esta teora es el hecho
de que las cadenas montaosas estuvieran formadas por
rocas plegadas. Que dichas rocas fueran en su mayor parte
sedimentarias llev, a mediados del siglo XIX, a la teora del
geosinclinal.
Amplias zonas de la Tierra (los geosinclinales) se hallaban a
gran profundidad bajo el nivel del mar y, por tanto, estuvieron sometidas, durante millones de aos, a una intensa sedimentacin. Los sedimentos acumulados se transformaron
en rocas sedimentarias que posteriormente se plegaran al
disminuir el radio de la Tierra, elevndose por encima del
nivel del mar, lo que entonces dara lugar a las cordilleras.

Por ejemplo, el Mesosaurus es un pequeo reptil adaptado


a la vida en los ros, incapaz de atravesar un ocano. Sin embargo, se han hallado fsiles de esta especie en Surfrica y
en Sudamrica, separadas por ms de 4 000 km.
2 Define el trmino estudio composicional. Responde:
a) En qu se diferencia del estudio dinmico?
b) Explica el estudio composicional de la Tierra.
El estudio composicional o esttico consiste en la divisin
en capas en funcin de los datos de composicin qumica
del interior obtenidos a partir de estudios directos e indirectos.
El estudio dinmico se basa en el estado fsico (slido o
lquido) de los materiales existentes en el interior, as como en
su comportamiento (rgido o plstico), mientras que el composicional se basa en la composicin qumica del interior.
El estudio composicional divide a la Tierra en tres capas
en funcin de su composicin: corteza, manto y ncleo.
Los lmites entre ellas se establecen all donde las caractersticas cambian bruscamente y se conocen como discontinuidades.

La corteza es una capa muy delgada (si consideramos


que la Tierra es una manzana, la corteza sera la piel).
Existen dos tipos de corteza: la que forma los continentes, con un espesor de entre 30 y 70 km, y la que forma
el fondo de los ocanos, ms pesada y de tan slo unos
7 km de grosor.

El manto representa el 82 % del volumen total de la


Tierra. El manto superior llega hasta los 670 km y en l
se producen corrientes de conveccin debidas a diferencias de temperatura. El lmite del manto inferior est
a 2 900 km de profundidad.

El ncleo se divide en dos capas: el ncleo externo, hasta


los 5 150 km y el ncleo interno, cuyo centro se halla a los
6 378 km.

3 Adems de los movimientos horizontales de acercamiento o separacin, los continentes tambin poseen
movimientos verticales de ascenso y descenso. Explica
todo lo que sepas de este movimiento.

89

DinMica TErrESTrE:
la DEriVa conTinEnTal

Adems de los movimientos horizontales de acercamiento o


separacin, se ha demostrado que los continentes tambin
poseen movimientos verticales de ascenso y descenso.
Los estudios realizados demostraron que el lmite inferior de
la corteza continental a lo largo de su extensin no se halla
siempre a la misma profundidad, sino que bajo las cordilleras
la corteza es ms gruesa y, por tanto, alcanza una profundidad mayor que en las zonas bajas de los continentes.
Este hecho llev entonces a pensar que la corteza, formada
por rocas ligeras, flota sobre el manto, ms denso y deformable (de comportamiento plstico). All donde la corteza tiene
mayor grosor, ms se hunde en el manto. Este concepto de
una corteza que se halla en equilibrio con el manto mediante
flotacin se denomina isostasia.
De igual manera, a medida que un continente pierde masa por efecto de la erosin, ste se eleva para alcanzar su
posicin de equilibrio. No se ha podido comprobar que el
movimiento vertical de los continentes se rija por el principio
de la isostasia.
4 Movilismo: realiza un anlisis acerca de los siguientes temas:
a) Personajes que contribuyeron al desarrollo de las
ideas movilistas.
b) Evidencia fsil.
c) Evidencia climtica.
Fueron muchos los que contribuyeron al desarrollo de las
ideas movilistas, entre ellos:
Francis Bacon, a principios del siglo XVII, ya repar en la semejanza entre las lneas de costa de frica y de Amrica del
Sur.
George Leclerc de Buffon (conocido como conde de Buffon)
propuso, en 1766, que ambos continentes haban estado unidos en el pasado.
El gegrafo Zinder-Pellegrini, a mediados del siglo XIX, sugera ya la existencia de un continente primitivo que se habra
fragmentado en dos: Norteamrica con Sudamrica (al que
llama Atlntida y cuyo contorno se habra visto deformado
desde que empezara a desprenderse) y frica con Europa,
para posteriormente dar lugar a los continentes actuales.
Pero es el meteorlogo alemn Alfred Wegener quien elabora toda una teora movilista despus de haber realizado
numerosas observaciones a partir del parecido entre las costas continentales. Dichas observaciones le permitieron aportar cuatro tipos de evidencias: geogrficas, paleontolgicas,
geolgicas y climticas.
En la actualidad, cada continente posee algunas formas de
vida propias, muy distintas de las existentes en los dems.

90

Por ejemplo, los avestruces, las cebras y las jirafas de frica,


y las llamas y alpacas de Sudamrica. La razn de que no se
hayan extendido a otros continentes radica en los miles de
kilmetros de ocano que los separan. Para Wegener, la gran
dispersin de fsiles como el Mesosaurus demostraba que en
la poca en la que vivieron (este reptil se encuentra en rocas
con una edad de 260 millones de aos), los continentes del hemisferio sur se hallaban reunidos en uno solo, de manera que
las tierras que habitaban eran parte de un mismo territorio.
Ser meteorlogo ayud a Wegener a aadir a su teora una
importante evidencia climtica. Al estudiar huellas de posibles cambios climticos en el pasado encontr tillitas de
unos 300 millones de aos de antigedad, que indicaban la
existencia de un fenmeno glaciar en frica, Sudamrica,
Australia e India. Una glaciacin de tales dimensiones tendra
que haber sido ocasionada por un cambio climtico global,
una bajada de las temperaturas en todo el planeta, que debera haber dejado huella tambin en el hemisferio norte.
Sin embargo, en Norteamrica y Eurasia se formaron en esa
poca sus principales yacimientos de carbn, debidos a la
descomposicin de abundantes bosques tpicos de un clima
tropical (clido y hmedo).
Al reunir los continentes formando la Pangea, como en la
Figura 1.8 b, se observa que los hielos slo abarcaban una
pequea parte de las tierras emergidas, correspondiente al
sur de Pangea, que posea un clima glacial, mientras que en
el norte exista un clima tropical.
5 Explica todo lo que conozcas acerca del:
a) Relieve.
b) Composicin.
c) Conclusiones.
En el estudio del fondo ocenico.
El fondo ocenico no es plano, presenta un relieve en el que
se distinguen cuatro estructuras: los mrgenes continentales, las llanuras ocenicas, las dorsales ocenicas y las fosas
ocenicas.

Los mrgenes continentales se definen como la zona


submarina prxima a los continentes. Estn formados generalmente por una llanura con ligera pendiente, llamada
plataforma continental, que llega hasta unos 200 metros de profundidad. A continuacin existe una zona de
mayor inclinacin, el talud continental, que desciende
hasta los 2 000 metros.

La plataforma y el talud estn formados por los mismos tipos de rocas que los continentes, por lo cual se consideran
una parte inundada de stos y, por tanto, forman parte de la
corteza continental.

Las llanuras abisales u ocenicas profundas se extienden entre los taludes y las dorsales y pueden alcanzar los
6 000 metros de profundidad.

Las dorsales ocenicas o relieves submarinos son cadenas montaosas que se extienden a lo largo de un eje
central formado por una depresin a modo de valle en
cuya parte inferior existe una grieta (rift, en ingls) por
la que asciende intermitentemente lava procedente del
manto. La actividad volcnica existente en las dorsales
es la causante de la creacin de nueva corteza ocenica.
La primera dorsal en ser estudiada fue la dorsal atlntica, que recorre de norte a sur la parte media del ocano
Atlntico. Todas las dorsales se unen a travs de los ocanos, llegando a superar los 70 000 km de longitud.
Las fosas ocenicas son cuencas submarinas con una
fuerte pendiente que pueden llegar a alcanzar profundidades de hasta 11 000 metros.

Las muestras obtenidas al perforar el fondo ocenico revelan


tres capas: en la parte inferior est formado por rocas plutnicas del tipo del gabro. Encima, se hallan rocas volcnicas
y sobre ellas, una capa de sedimentos, que llega a tener un
grosor de casi 1,5 km cerca de los continentes disminuyendo
progresivamente al ir aproximndonos a las dorsales donde
desaparecen.
La distribucin de volcanes y terremotos y los datos obtenidos del estudio de los fondos ocenicos llev a Harry Hess,
en 1960, y a Robert Dietz, en 1961, a redactar por separado
dos artculos cientficos en los que llegan a la misma conclusin: la teora de la expansin del fondo ocenico, que
bsicamente afirma que:

A travs de las dorsales ocenicas asciende material fundido del manto, que se sita a ambos lados de la dorsal. Esto genera nuevo fondo ocenico (nueva corteza
ocenica), que separa lentamente a unos continentes de
otros.

Debe existir un mecanismo compensador, pues en caso


contrario, la Tierra se hinchara como un globo. Tal compensacin se produce en las fosas ocenicas, en las que
la corteza ocenica, en su colisin con la corteza continental, se introduce por debajo de sta y se incorpora al
manto, en un proceso denominado subduccin.

Los continentes no se desplazan sobre el fondo ocenico,


sino que son arrastrados por corrientes de conveccin
trmicas existentes en el manto, formando celdas convectivas cuya rama ascendente coincide con el rift de la
dorsal y la descendente con la zona de subduccin.

Las corrientes de conveccin son movimientos cclicos de


fluidos debidos a diferencias de densidad.
En este caso, el material profundo del manto tiende a ascender por hallarse muy caliente y tener menor densidad que el
que se halla ms arriba, justo bajo la corteza ocenica, el cual,
ms denso, desciende hacia el interior del manto.
Esta teora no fue ampliamente aceptada hasta que Vine y
Matthews la relacionaron con las inversiones magnticas,
que resultaron ser la prueba definitiva.

91

2 LA TECTNICA DE PLACAS
ACTIVIDADES
1 Da un ejemplo de cada uno de los fenmenos geolgicos que pueden explicarse mediante la teora de la
tectnica de placas.
Formacin de orgenos: cordillera del Himalaya.
Existencia de islas volcnicas: islas Hawai.
Existencia de volcanes y terremotos: volcanes de Islandia.
Formacin de las cuencas ocenicas: fosa de las Marianas.
Ciclo de las rocas: formacin de basaltos en la Dorsal Atlntica.
2 Completa los espacios en blanco para que el siguiente texto tenga coherencia:
Nuestra corteza terrestre, tambin llamada litosfera, est
dividida en una serie de placas. Estos fragmentos litosfricos se mueven a lo largo del planeta, generando diversos
fenmenos geolgicos, de acuerdo a la teora de la tectnica
de placas. De esta manera, las placas pueden separarse,
colisionar o rozarse. Las placas estn en continua remodelacin y pueden ser de tres tipos: continentales, ocenicas
o mixtas. Por ltimo, cabe resaltar el hecho de que las placas
contienen, a su vez, otras de tamao inferior que se denominan microplacas.
3 Indica si las siguientes afirmaciones son verdaderas
o falsas, razonando tu respuesta en cada caso.
a) La litosfera tiene una densidad homognea en toda
su extensin. FALSO.
b) La formacin de dorsales ocenicas se debe a la presencia de fallas transformantes. FALSO.
c) La subduccin de corteza ocenica tras su colisin
con corteza continental puede generar sesmos.
VERDADERO.
d) Las placas litosfricas pueden estar constituidas por
corteza ocenica y por corteza continental al mismo
tiempo. VERDADERO.
e) Los arcos islas se originan tras la colisin de dos cortezas continentales. FALSO.
4 Cul es la razn de que se origine un fenmeno de
subduccin cuando se produce una colisin entre litosfera ocenica y litosfera continental? Por qu no ocurre
lo mismo cuando el choque es entre dos litosferas de tipo
continental?
El primer fenmeno se debe a que la litosfera ocenica tiene menor grosor y presenta mayor densidad que la corteza
continental.
En el segundo caso no se produce subduccin, puesto que
ambas cortezas son muy ligeras como para hundirse en el
manto.
5 Ordena las siguientes fases para configurar, de manera correcta, el ciclo de Wilson.

92

a)
b)
c)
d)
e)
f)
g)
h)
i)
j)

Formacin de un ocano interior


Formacin de un supercontinente
Separacin de los continentes
Engrosamiento de la litosfera
Formacin de un rift
Estrechamiento de la litosfera
Fragmentacin de la litosfera
Elevacin de algunas zonas
Aproximacin de los continentes
Formacin de zonas de subduccin

Respuesta correcta: f, g, e, a, c, d, j, i, h, b.
6 Clasifi ca los siguientes sistemas montaosos en
pericontinentales e intercontinentales:
a)
b)
c)
d)
e)

Himalaya.
Montaas Rocosas.
Andes.
Alpes.
Pirineos.

Pericontinentales: b, c.
Intercontinentales: a, d, e.
7 El gran terremoto de Chile provoc una cascada de
desastres. Busca informacin acerca de ellos en Internet
o en cualquier otro tipo de fuente bibliogrfica.
Puede encontrarse algo de informacin en:
http://es.wikipedia.org/wiki/Tsunami#1960_-_Terremoto_
de_Valdivia.
8 Qu es un punto caliente (hot spot)? Busca informacin de las teoras, acerca de su origen y encuentra algn
ejemplo de manifestacin de un hot spot en la superficie
de la Tierra.
Un punto caliente es una reducida zona de actividad volcnica que se origina por la presencia de una pluma ascendente
del manto. Como ejemplo, Hawai.
9 Contesta a las siguientes cuestiones relacionadas
con la actividad prctica que hemos visto en esta pgina.
a) Qu recorrido seguan las partculas de caf en el
aceite del recipiente?
El recorrido tpico de las corrientes de conveccin.
b) Cul es el motivo, desde el punto de vista de la fsica,
de que se produzcan dichas corrientes?
Se basa en la diferencia de temperatura existente entre
la zona ms cercana a la fuente de calor y la zona ms
distante.

c) Se podran originar corrientes de conveccin en un


slido? Por qu?
No. Para que se generen corrientes de conveccin se requiere
de un fluido.
10 Busca tres volcanes que se encuentren en cada una
de las siguientes localizaciones:

a) Una zona de subduccin entre dos placas ocenicas.


Anathan, Guguan, Alamagan (en las Marianas).
b) Una cordillera pericontinental.
Quizap, Llaima y Hudson (en los Andes).
c) Una zona en la que exista un punto caliente.
Kilauea, Nuhaua y Koko (en las islas Hawai).
11 El caso de las islas Hawai es el ejemplo ms representativo del fenmeno de los puntos calientes. Busca
otros ejemplos de formaciones geolgicas cuya causa
radique en la misma fenomenologa.
Parque de Yellowstone, archipilago Tuamotu, Samoa y quizs las islas Canarias.
12 Por qu en las dorsales ocenicas se originan rocas
magmticas de tipo basltico?
Esto se debe al rpido enfriamiento que se da cuando el magma entra en contacto con el agua ocenica.
13 Cules son las dos fuerzas motoras de los procesos
geolgicos externos?
El Sol y la gravedad.
14 Averigua en qu consisten cada una de las meteorizaciones que se han descrito en la lectura anterior.

Canchales: la congelacin y el deshielo que sufren los


bloques en la montaa producen la disgregacin de
los mismos. El efecto de este proceso son piedras angulosas, al no se producirse redondeo por el transporte.
Al final, los bloques caen por las laderas formando los
canchales. Un ejemplo: en Sierra Nevada, Granada.
Pedreras: lo mismo que los canchales. Un ejemplo: Pedrera de la Ortijuela, Extremadura.
Conos de derrubios: son grandes acumulaciones de
rocas fragmentadas por el hielo y deshielo, de grandes
dimensiones. Un ejemplo: Picos de Europa, Cantabria.
Lapiaces: en las formaciones rocosas compuestas de
yesos o calizas se produce la meteorizacin qumica en
forma de disolucin de los componentes solubles de esa

roca. Aparecen, as, paisajes con forma de canales superficiales, que se llaman lapiaces. Un ejemplo: Belea de
Sorbe, Guadalajara.
Depsitos de grus: la meteorizacin qumica puede descomponer los diferentes minerales que forman una roca,
hasta reducirla a arena. Un ejemplo: Sierra de la Estrella,
Portugal.
Pilancones: el agua de lluvia o de deshielo acumulada
puede disolver algunos componentes de las rocas, y dar
lugar a oquedades o pilas, a veces de gran tamao, como
los pilancones. Un ejemplo: Garganta de la Camorza, La
Pedriza, Madrid.

15 Completa los espacios en blanco para dotar de sentido al siguiente texto:


Las rocas de nuestro planeta estn sometidas a una serie
de fuerzas debido a la dinmica de las placas litosfricas.
Ante este tipo de fuerzas se producen deformaciones. Estas
varan en funcin del tipo de comportamiento que se d
en la roca.
Se dice que una estructura tiene comportamiento rgido cuando ante una fuerza intensa se produce una rotura. Cuando,
por el contrario, la estructura recupera su morfologa inicial
tras el esfuerzo, se dice que tiene un comportamiento elstico. En otras ocasiones en las que el esfuerzo es ms prolongado, el material no recupera su forma original y queda
plegado. En este ltimo caso, la estructura en cuestin tiene
un comportamiento plstico.
16 Elabora un esquema en el que detalles la clasificacin de los pliegues.
En funcin de su curvatura: anticlinal o sinclinal.
En funcin del ngulo que tenga respecto al plano axial: recto, inclinado, tumbado.
17 Indica cul es el valor del buzamiento en cada uno
de los siguientes tipos de fallas:
a)
b)
c)
d)

Falla directa: mayor de 90.


Falla inversa: menor de 90.
Falla vertical: 90.
Falla de cizalla: 0.

18 Es correcto decir que las fallas y las diaclasas son


dos tipos de deformaciones? Por qu?
S, es correcto, dado que en ambos casos se da un cambio
de forma.
19 Qu deformacin tiene lugar cuando las rocas presentan un comportamiento plstico? Qu ocurre cuando
las rocas se comportan de manera rgida?
En el primer caso, se originan pliegues. En el segundo caso,
se originan fracturas.

93

2 LA TECTNICA DE PLACAS
20 Cul es la principal diferencia entre una falla y una
diaclasa?
En una falla siempre se produce un movimiento de los dos
bloques fragmentados a lo largo de la zona de ruptura. En
la diaclasa, no existe ningn movimiento entre los bloques
nacientes.
21 Indica si los siguientes trminos guardan relacin
con los pliegues o con las fallas.
a)
b)
c)
d)
e)
f)
g)
h)

Manto de corrimiento: fallas.


Labio: fallas.
Sinclinal: pliegues.
Cabalgamiento: pliegues.
Buzamiento: fallas.
Charnela: pliegues.
Horst: fallas.
Flanco: pliegues.

22 La antigua isla de Krakatoa se encontraba en las inmediaciones de una zona de subduccin. Ayudndote de
las pistas geogrficas que te da el texto, indica qu dos
placas estaban implicadas en dicha subduccin.
Las placas implicadas en la formacin de la isla de Krakatoa
son: la placa indoaustraliana y la placa euroasitica. La australiana subduce bajo la euroasitica.
23 En 1884, un ao despus de la explosin de Krakatoa, el clima sufri un cambio a escala planetaria. Razona
cul pudo ser la razn de tal hecho.

6. La zona de mxima curvatura de un pliegue se denomina buzamiento. FALSO.


7. Los procesos geolgicos externos intervienen en la
generacin de cuencas sedimentarias. VERDADERO.
8. Los arcos isla se originan por la presencia de un punto
caliente. VERDADERO.
9. En los orgenos de colisin continental no encontramos ni actividad ssmica ni actividad volcnica.
FALSO.
10. En los bordes pasivos se generan fuerzas de tipo cizalla. VERDADERO.

EXAMEN DE DESARROLLO
1 Elabora un mapa conceptual de los diferentes tipos
de deformaciones que se pueden producir en rocas, indicando el comportamiento que stas presentan en cada
caso, los elementos que constituyen dichas deformaciones y las posibles subclases que podemos encontrar
dentro de cada tipo.
TIPOS DE DEFORMACIONES

PLIEGUES
cuando
las rocas
presentan

COMPORTAMIENTO
PLSTICO

Di si son verdaderas (V) o falsas (F) las siguientes afirmaciones:


1. Las diaclasas no pueden ser consideradas como un
tipo de deformaciones. FALSO.
2. El movimiento de las placas tectnicas se produce
gracias a las corrientes de conveccin. VERDADERO.
3. Los fenmenos de subduccin nunca generan actividad volcnica. FALSO.
4. Segn el ciclo de Wilson, las cordilleras intercontinentales se forman en una fase comprendida entre
la formacin de un rift y la gnesis de una cordillera
pericontinental. FALSO.
5. Los bordes destructivos son tambin llamados divergentes. FALSO.

94

ELEMENTOS
CONSTITUYENTES

COMPORTAMIENTO
RGIDO

SUBTIPOS

CHARNELA
FALLAS

Quizs este hecho pueda deberse a la gran cantidad de ceniza que se liber a la atmsfera. Esta ceniza habra actuado
como pantalla solar, lo que se habra traducido en un ligero
descenso de la temperatura global durante el ao siguiente
a la explosin.

EXAMEN TIPO TEST

FRACTURAS

cuando
las rocas
presentan

DIACLASAS

NCLEO
FLANCOS
PLANO
AXIAL
CLASIFICACIN
en
funcin
del
GRADO DE
CURVATURA
ANTICLINAL

ELEMENTOS
CONSTITUYENTES
CLASIFICACIN
LABIOS
PLANO DE
FALLA
BUZAMIENTO

NGULO QUE
FORMA EL
PLANO AXIAL
CON EL EJE
HORIZONTAL

en
funcin
del

SALTO DE
FALLA
EJE DE
DESPLAZAMIENTO

SINCLINAL
TUMBADO
INCLINADO

FALLAS DE
DESPLAZAMIENTO
VERTICAL

RECTO

NORMAL

INVERSA

FALLAS DE
DESPLAZAMIENTO
HORIZONTAL
(DE CIZALLA)

VERTICAL

2 Explica en qu consiste la teora de la tectnica de


placas, describe cmo se produce el movimiento de las
placas litosfricas y cita las pruebas que apoyan o corroboran dicho movimiento.
La teora de la tectnica de placas expone que las superficies continentales y ocenicas forman parte de una litosfera
fragmentada en placas que se encuentran en continuo movimiento. Debido a este movimiento, las placas pueden alejarse, rozarse o colisionar. Esto hace que se genere y destruya
corteza terrestre de manera continua, as como que se den
diferentes fenmenos y procesos de carcter geolgico.
Tal movimiento es posible gracias a la existencia de unas
corrientes de conveccin que se generan en el interior de
nuestro planeta y que pueden ser explicadas desde diferentes modelos.
Cules son las pruebas que nos permiten afirmar este hecho? Muchas son las que se pueden citar: comprobacin del
movimiento relativo de los continentes mediante tcnicas de
GPS, coincidencia entre los bordes continentales, fenmenos geolgicos activos y formaciones tambin geolgicas
en incontables lugares del mundo, presencia de seres vivos
similares en regiones muy alejadas del planeta, presencia de
rocas idnticas en diferentes partes del mundo, etctera.
3 Realiza un cuadro sinptico basado en las clases de
placas litosfricas, los tipos de bordes entre ellos y la
fenomenologa geolgica asociada en cada caso.

Borde
divergente

Entre
cortezas
ocenicas

Creacin de
corteza ocenica en las dorsales.
Vulcanismo.
Sesmos.

Subduccin
de la corteza
ocenica ms
densa.
For maciones
volcnicas (arcos islas).
Sesmos.

Subduccin de
corteza ocenica bajo continental.
Cordilleras pericontinentales
Vulcanismo.
Sesmos.

Fallas
transformantes.
Sesmos.

Cordilleras intercontinentales por plegaBorde


miento.
convergente Sesmos.

Borde
pasivo

Entre corteza
ocenica y
corteza
continental

Entre
cortezas
continentales

4 Describe las fases del ciclo de Wilson y expn un


ejemplo de proceso geolgico externo y otro de proceso
geolgico interno que ocurran en alguna fase de dicho
ciclo.
I) Formacin de un rift continental por la fractura de un
continente.
II) Generacin de corteza ocenica a partir de la nueva dorsal, progresin de la cuenca ocenica y separacin progresiva
de los bordes continentales.
III) Rotura, como consecuencia de las fuerzas ejercidas, de
una de las placas a nivel del lmite entre la superficie continental y la ocenica.
IV) Subduccin de la placa ocenica bajo la continental y
formacin de una fosa ocenica.
V) Plegamiento de los sedimentos depositados en la fosa y
gnesis de una cordillera pericontinental.
VI) Estrechamiento de la cuenca ocenica por el cese de la
actividad en la dorsal.
VII) Subduccin de toda la corteza ocenica, cierre de la cuenca y colisin entre las cortezas continentales, lo que origina
un orgeno intercontinental.
Ejemplo de proceso geolgico externo: deposicin de sedimentos en una fosa ocenica.
Ejemplo de proceso geolgico interno: formacin de basaltos
a partir del magma expulsado en las dorsales atlnticas.
5 Explica brevemente cmo se han originado los siguientes accidentes geogrficos.

Cordillera del Himalaya: cordillera intercontinental


originada por la colisin entre corteza continental de la
placa Euroasitica y corteza continental de la placa Indoaustraliana.
Islas Hawai: archipilago volcnico formado por la presencia de un punto caliente bajo la placa Pacfica.
Cordillera de los Andes: cordillera pericontinental formada por la subduccin de la corteza ocenica perteneciente a la placa de Nazca bajo la corteza continental de
la placa Sudamericana.
Mar Rojo: cuenca ocenica originada por la inundacin
de un rift generado entre la placa Africana y la placa Arbiga.
Fosa de las Marianas: cuenca formada por la subduccin
de la corteza ocenica de la placa Pacfica bajo la corteza
continental de la placa Euroasitica.

95

3 LA HISTORIA DE LA TIERRA
ACTIVIDADES

5 Resume los hechos que hicieron del medio terrestre


una parte ms de la biosfera.

1 Enumera los acontecimientos que dieron lugar a


nuestro planeta de acuerdo a la teora planetesimal.

En primer lugar, surgieron una serie de organismos fotosintticos a partir de un grupo de microorganismos, que hicieron
que la concentracin de dixido de carbono disminuyera
a escala planetaria. Simultneamente, el ambiente se enriqueci progresivamente en oxgeno, gracias a estos nuevos
grupos.

1. Explosin de una estrella primigenia.


2. Movimiento de la nebulosa de gas y polvo alrededor de
la zona central.
3. Contraccin de la materia de la nebulosa y aumento de
la velocidad de sta.
4. Formacin de una nueva estrella (nuestro Sol) a partir
de las reacciones nucleares generadas en el centro del
sistema.
5. Formacin de anillos alrededor del Sol y reunin de partculas en los denominados cuerpos planetesimales.
6. Aumento del tamao de los planetsimos y gnesis de
los planetas.
2 Completa los siguientes huecos para darle coherencia al texto:
Aunque ya en la Grecia Antigua, Herodoto dedujo que
aquellas rocas que presentaban conchas marinas fosilizadas
se habran formado en el medio marino, no fue hasta el siglo
XVII, cuando aparecieron las primeras teoras para explicar los
cambios terrestres.
El catastrofismo y el gradualismo fueron dos corrientes
contrapuestas. La primera, liderada por Cuvier, defenda
que los cambios en la Tierra se producan como consecuencia de sucesos catastrficos. Por el contrario, la segunda, encabezada por Lyell, apostaba por la idea de que
los cambios se producan de manera gradual.
Ya en el siglo XX , se enunci otra teora: el neocatastrofismo.
Esta teora defiende que los cambios en la corteza terrestre
se dan de forma gradual aunque, en ocasiones, se pueden
dar acontecimientos catastrficos que generan cambios
bruscos.
3 Por qu piensas que es incorrecto el trmino neocatastrofismo?
Por que el neocatastrofismo defiende que los diferentes cambios que se dan en la Tierra se producen, mayoritariamente,
de manera gradual. Slo algunos, y de manera puntual, tienen un carcter catastrfico.

96

En segundo lugar, se gener una capa de ozono. El ozono es


una molcula que surge por la reaccin del oxgeno. Hasta
que ste no estuvo en suficiente cantidad, no pudo generar
el ozono. Esto provoc que se absorbiera la radiacin ultravioleta procedente del Sol.
De esta manera, los diferentes organismos pudieron colonizar el medio terrestre, solventados los problemas de la
anaerobiosis, la alta concentracin de dixido de carbono y
la nociva radiacin ultravioleta.
6 Di si pudieron coincidir o no en el tiempo los siguientes grupos de seres vivos:
a)
b)
c)
d)
e)

Crinoideos y dinosaurios. No.


Trilobites y dinosaurios. No.
Nummulites y mamuts. No.
Helechos gigantes y trilobites. S.
Ammnonites y pterosaurios. S.

7 Indica si las siguientes afirmaciones son verdaderas


(V) o falsas (F):
a) Los primeros vestigios de vida datan del en Hdico.
FALSO.
b) El impacto de numerosos meteoritos y las altsimas
temperaturas imperantes en la Tierra retrasaron la
formacin de una corteza estable. VERDADERO.
c) Adems de amoniaco y metano, la atmsfera del en
Arcaico tambin tendra vapor de agua que habra sido incorporada durante el en Hdico. VERDADERO.
d) Las rocas magmticas formadas durante el en Arcaico constituyen una prueba de que nuestro planeta ha
sufrido un progresivo enfriamiento hasta nuestros
das. VERDADERO.

4 Relaciona cada uno de los siguientes trminos con


los mtodos de datacin absoluta o de datacin relativa:
fsil gua, istopo radiactivo, principio de continuidad,
periodo de semidesintegracin, uranio-plomo, principio
de superposicin.

8 El Prmico termin con la mayor extincin que


se haya producido jams en la historia de la vida. El
95 % de las especies desaparecieron en aquel momento. Busca informacin acerca de los seres vivos que se
extinguieron as como de las causas que llevaron a este
desenlace.

Datacin relativa: fsil gua, principio de continuidad, principio de superposicin.


Datacin absoluta: istopo radiactivo, periodo de semidesintegracin, uranio-plomo.

Existe informacin disponible en:


http://www.solociencia.com/geologia/05040601.htm
http://es.wikipedia.org/wiki/Extinci%C3%B3n_masiva_del_
P%C3%A9rmico-Tri%C3%A1sico

9 Elabora un esquema para clarificar la clasificacin


de los amniotas basndote en la lectura que figura en
esta pgina.
Saurpsidos
Anpsidos (tortugas);
Dipsidos.
Arcosaurios: cocodrilos, dinosaurios, aves y pterosaurios;
Lepidosaurios: serpientes, lagartos y tutara;
Ictiosaurios;
Sauropterigios: notosaurios y plesiosaurios.
Sinpsidos
Reptiles mamiferoides;
Mamferos.
10 Haz un seguimiento de los continentes y supercontinentes de los que ha formado parte la pennsula Ibrica desde la aparicin de la corteza terrestre hasta nuestros das.
Pangea I Armrica Pangea II Laurasia II Eurasia
11 Sita los siguientes continentes en la era geolgica
que corresponda:

Pangea I (Rodinia): Proterozoico.


Pangea II (Pangea de Wegener): Paleozoico.
frica: Cenozoico.
Bltica: Paleozoico.
Laurasia I: Paleozoico.
Laurasia II: Mesozoico.
Armrica: Paleozoico.
Gondwana II: Mesozoico.
Norteamrica: Cenozoico.
Gondwana I: Paleozoico.

12 Si tuvieras que elegir entre un calamites y un trilobites, cul sera mejor fsil gua?
Un calamites sera mejor fsil gua que un trilobites, ya que
es representativo de un periodo geolgico ms corto.
Mientras que el trilobites se encuentra en todos los estratos
del Paleozoico, el calamites slo aparece en aquellos estratos
propios del Carbonfero.
13 Pudieron coincidir un ejemplar de nummulites y
otro de nautilus en algn momento de la historia de la
Tierra?
S. Los nummulites vivieron en el Terciario, y la historia evolutiva del gnero nautilus arranca a principios del Paleozoico.
14 Busca informacin acerca de los belemnites en
alguna web o en cualquier otro tipo de fuente bibliogrfica, y haz una ficha tcnica de este tipo de organismos.

Existe informacin en:


http://es.wikipedia.org/wiki/Belemnites
15 Un corte geolgico presenta los siguientes estratos
de manera sucesiva:
A.
B.
C.
D.
E.
F.
G.
H.

Estrato con restos de plesiosaurio.


Estrato con rocas de tipo magmtico.
Estrato con restos de calamites.
Estrato con fsiles de graptolites.
Estrato con ammonites fosilizados.
Estrato con rocas de tipo magmtico.
Estrato de roca sedimentaria.
Estrato con restos de mamut.

Suponiendo que el estrato H es el ms superficial de


todos:
a) Representa grficamente los siguientes estratos.
b) Reconstruye la historia geolgica que ha llegado a
configurar este corte.
A principios del Paleozoico (CmbricoSilrico), se sedimentaron los restos de graptolites. A continuacin, durante el
Carbonfero, le toc el turno a los de calamites. Posteriormente, hubo una deposicin de restos magmticos y una
sedimentacin de un plesiosaurio. En algn momento del
Mesozoico, se produjo una inversin de estos cuatro estratos.
Tambin en el Mesozoico, se produjo la fosilizacin de unos
ammonites. Por ltimo, se depositaron los siguientes estratos
en dicho orden (el ltimo durante el Cuaternario).
c) En qu te has basado para llevar a cabo dicha reconstruccin?
Principio de continuidad, principio de superposicin y conocimientos de fsiles gua.
d) Sita cada uno de los estratos en la escala cronoestratigrfica.
Estrato con restos de plesiosaurio. Mesozoico.
Estrato con rocas de tipo magmtico. Carbonfero-Mesozoico.
Estrato con restos de calamites. Carbonfero.
Estrato con fsiles de graptolites. Cmbrico-Silrico.
Estrato con ammonites fosilizados. Mesozoico.
Estrato con rocas de tipo magmtico. Mesozoico-Cenozoico.
Estrato de roca sedimentaria. Mesozoico-Cenozoico.
Estrato con restos de mamut. Cuaternario.
e) Busca un fsil gua para el estrato G, suponiendo que
pertenece a un periodo diferente al del estrato H, pero a la misma era que ste.
Nummulites (Terciario).

97

3 LA HISTORIA DE LA TIERRA
EXAMEN TIPO TEST
Di si son verdaderas (V) o falsas (F) las siguientes afirmaciones:
1. El nummulites es un buen fsil gua para datar los estratos de un corte geolgico pertenecientes al Terciario. VERDADERO.
2. El neocatastrofismo es, en realidad, una matizacin
del gradualismo. VERDADERO.
3. Una icnita no puede ser considerada como un fsil ya
que slo es el testimonio de una actividad biolgica
del pasado. FALSO.
4. De acuerdo a la teora planetesimal, los planetas se
habran formado a partir de los denominados planetsimos que se encontraban alrededor del sol. VERDADERO.
5. En el Mesozoico, algunos reptiles comenzaron a evolucionar hacia mamferos y aves. VERDADERO.
6. Los restos fsiles ms antiguos de bacterias filamentosas demuestran que la vida comenz en el en Hdico. FALSO.
7. La estimacin de la antigedad de un estrato en base a los fsiles que presenta es un buen mtodo de
datacin absoluta. FALSO.
8. Los primeros microorganismos fotosintticos propiciaron, en ltimo trmino, la formacin de la capa de
ozono. FALSO.
9. Los trilobites nunca llegaron a coincidir en el tiempo
con los dinosaurios. VERDADERO.
10. Las primeras plantas vasculares colonizaron el sustrato del supercontinente Pangea I. FALSO.

EXAMEN DE
DESARROLLO
1 Explica qu es un fsil y en qu consiste el proceso
de fosilizacin. Indica, as mismo, un fsil gua del Terciario y otro del Carbonfero.
Un fsil es el resto de un ser vivo del pasado, o de su actividad, que ha perdurado hasta nuestros das en rocas sedimentarias y metamrficas gracias a la intervencin de algunas
transformaciones qumicas.
La fosilizacin es el proceso de millones de aos que conlleva
a la gnesis de un fsil. Las etapas de este proceso son las
siguientes:
Muerte y deposicin del organismo en una cuenca sedimentaria.
Desaparicin de las partes blandas.
Enterramiento y sustitucin qumica de sus componentes.
Un ejemplo de un fsil gua del Terciario sera el nummulites. En el caso del Carbonfero, tendramos como fsil gua
al calamites.

98

2 Explica en qu consisten los mtodos de datacin


geolgica.
Son estrategias que nos permiten estimar la edad de una
roca. Existen dos tipos: la datacin absoluta y la datacin relativa. La datacin absoluta consiste en obtener el momento
concreto en el que se gener la roca. Empleando radiometra
se puede saber la edad de una roca en funcin del grado de
desintegracin que ha sufrido.
La datacin relativa permite situar en el tiempo un acontecimiento dado en relacin a otros. La aplicacin de este mtodo se basa en la presencia de fsiles gua, en el principio de
superposicin y en el principio de continuidad.
3 Un corte geolgico presenta los siguientes estratos
de manera sucesiva:
A.
B.
C.
D.
E.
F.
G.
H.
I.
J.

Estrato con restos de graptolites.


Estrato con restos de calamites.
Estrato con polen fsil de gimnospermas.
Estrato con restos de calamites.
Estrato con restos de graptolites.
Estrato con fsiles de ammonites.
Estrato con rocas de tipo magmtico.
Estrato con fsiles de pterosaurios.
Estrato con restos de mamut.
Estrato con fsiles de nummulites.

a) Representa grficamente los siguientes estratos.


b) Reconstruye la historia geolgica que ha llegado a
configurar este corte.
A.
B.
C.
D.
E.
F.
G.
H.
I.
J.

Deposicin de graptolites.
Sedimentacin de calamites.
Sedimentacin de polen de gimnospermas.
Formacin de un pliegue tumbado a partir de estos tres
estratos con el polen fsil en su ncleo.
Deposicin de ammonites.
Deposicin de lava.
Sedimentacin del pterosaurio.
Deposicin de los nummulites.
Fosilizacin de los restos de mamut.
Inversin de los dos ltimos estratos.

c) En qu te has basado para llevar a cabo dicha reconstruccin?


En los fsiles gua y en el principio de superposicin.
d) Sita cada uno de los estratos en la escala cronoestratigrfica.
A.
B.
C.
D.
E.

Cmbrico-Silrico
Carbonfero
Prmico-Mesozoico
Carbonfero
Cmbrico-Silrico

F.
G.
H.
I.
J.

Mesozoico
Mesozoico
Mesozoico
Cuaternario
Terciario
4 Explica en qu consiste la teora planetesimal.

La teora planetesimal permite explicar el origen del Sistema


Solar y de nuestro planeta. Dicho proceso se puede dividir
en una serie de etapas:
Explosin de una estrella primigenia.
Rotacin de la nebulosa de polvo y gas resultante en torno a la parte central.
Contraccin paulatina de la nebulosa y aumento de su
velocidad de rotacin.
Acumulacin de la materia central y generacin de explosiones nucleares que dieron lugar a nuestro Sol.
Formacin de anillos alrededor del Sol y gnesis progresiva de los denominados planetesimales que originaran
los planetas.
5 Describe los aspectos fundamentales de la geologa,
el clima y la vida en el Mesozoico.
En el Mesozoico, se inici la constitucin de los continentes tal y como hoy los conocemos. Durante el Trisico, el

supercontinente Pangea II se fragment en Gondwana II y


Laurasia II. Ya en el Jursico y en el Cretcico, Gondwana II
dio lugar a Norteamrica y Eurasia, mientras que Laurasia II
origin Sudamrica, frica, Australia, India y la Antrtida.
En los tiempos de Pangea II exista una continentalidad extrema y el clima era bastante rido. Este hecho cambi con
la fragmentacin progresiva del supercontinente, ya que las
corrientes ocenicas suavizaron paulatinamente el clima. El
resultado fue un clima global de carcter tropical.
Tras la extincin del Prmico, la biodiversidad sufri una
renovacin. Debido al clima rido inicial, los grupos adaptados al clima hmedo se vieron desplazados por otros que
encontraron ventaja evolutiva en la nueva situacin. Las
gimnospermas, por ejemplo, sustituyeron a los helechos, y
los reptiles, a los anfibios. Los reptiles tuvieron una gran expansin y sus mayores representantes fueron los dinosaurios.
Adems, durante el Mesozoico, algunos reptiles dieron lugar
a los primeros mamferos y aves.
Sin embargo, los dinosaurios no fueron los nicos protagonistas de esta era, ya que el medio marino estuvo lleno de
unos cefalpodos con concha: los ammonites.
Al igual que ocurri en el Paleozoico, el Mesozoico termin
con una gran extincin que elimin muchos taxones. Entre
ellos se encontraban los dinosaurios y los ammonites.

99

4 LA CLULA, UNIDAD DE VIDA


ACTIVIDADES
1 Indica si las siguientes afirmaciones son verdaderas
(V) o falsas (F):
a) El hecho de que los seres vivos presenten diferentes
niveles de organizacin favorece su evolucin a formas ms complejas. VERDADERO.
b) Los ribosomas, como constituyentes de la clula, pertenecen al ms bajo de los niveles biticos. FALSO.
c) Una ameba puede alcanzar el nivel pluricelular.
FALSO.
d) Los electrones no pueden encuadrarse en ningn
nivel de organizacin. FALSO.
e) Los virus no pueden encuadrarse en ningn nivel de
organizacin. FALSO.
f) Un grupo de bacterias puede formar parte de un ecosistema. VERDADERO.
g) Un grupo de bacterias puede conformar, por s mismo, un ecosistema. VERDADERO.
2 Puede un virus ser considerado un ser vivo de
acuerdo a los postulados de la teora celular? Razona tu
respuesta.
No, ya que no tiene a la clula como unidad morfolgica,
fisiolgica y gentica.
3 Un macrfago tpico puede medir 18 m. Cul es su
tamao en ngstrom? A qu tamao en milmetros se
vera al microscopio ptico si empleamos un ocular x 10
y un objetivo x 40?

a) R. Franklin y M. Wilkins: estudio del ADN por difraccin


de rayos X.
b) F. Redi, L. Spallanzani y L. Pasteur: erradicacin de la
teora de la generacin espontnea.
c) M. Schleiden, T. Schwann y R. Virchow: enunciado de
la teora celular.
d) A. van Leeuvenhoek y R. Hooke: primeras visualizaciones de clulas al microscopio ptico.
6 Completa los espacios en blanco para dotar de sentido al siguiente texto:
El ADN es una macromolcula con una estructura en doble
hlice y est formada a partir de una serie de monmeros
que se denominan nucletidos. Cada una de estas unidades est constituida, a su vez, por tres componentes. El
primero de ellos es el monosacrido desoxirribosa, perteneciente al grupo de las pentosas. El segundo es una base
nitrogenada. En el caso del ADN, esta puede ser adenina,
guanina, timina y citosina. A la hora de formar la doble
hlice, la primera interacciona con la tercera y la segunda
con la cuarta. Esta interaccin se produce mediante los denominados puentes de hidrgeno. El ltimo componente es
un grupo fosfato, el cual se une a la desoxirribosa mediante
un enlace fosfodister.
7 Realiza un mapa conceptual indicando los diferentes
aspectos de la composicin, la estructura y las propiedades del ADN.

ADN

Su tamao en ngstrom es de 180 000 .


Al microscopio ptico, con las premisas dichas, se podra visualizar a 7,2 mm.
4 Indica si las siguientes afirmaciones son verdaderas
(V) o falsas (F):
a) La membrana nuclear est constituida por dos membranas similares a la plasmtica. VERDADERO.
b) El intercambio de sustancias entre citoplasma y ncleo es prcticamente inexistente. FALSO.
c) El nucleolo es la regin del ncleo en la que se sintetizan los ribosomas. VERDADERO.
d) El ADN nuclear est asociado a unas protenas llamadas histonas. VERDADERO.
e) La cromatina puede verse tanto al microscopio ptico
como al electrnico. FALSO.
f) Durante la mitosis, la cromatina se condensa para dar
lugar a los cromosomas. VERDADERO.
5 Watson y Crick pasaron a la historia por su modelo de la doble hlice para el ADN. Cules fueron
las aportaciones a la ciencia de los siguientes personajes?

100

COMPOSICIN

DESOXIRRIBOSA

PROPIEDADES
CAPACIDAD PARA
DUPLICARSE

FOSFATO

CAPACIDAD PARA
ALMACENAR
INFORMACIN

BASES
NITROGENADAS

ADENINA
TIMINA
GUANINA
CITOSINA

ESTRUCTURA
DOBLE HELICE CON ENLACES
FOSFODISTER ENTRE FOSFATOS
Y DESOXIRRIBOSA Y CON PUENTES
DE HIDRGENO ENTRE LAS BASES
NITROGENADAS

8 Busca informacin acerca del Proyecto Genoma Humano y haz una puesta en comn con tus compaeros
en clase.
Informacin en:
http://www.monografias.com/especiales/genoma/index.
shtml

9 Cul es la funcin de la mitosis en los organismos


unicelulares? Es la misma en los organismos pluricelulares?

Mitosis

En organismos unicelulares la mitosis tiene una funcin reproductiva. Por el contrario, en organismos pluricelulares,
este proceso tiene la funcin de renovar las clulas del individuo.

1 division
meitica

10 Dibuja un cromosoma profsico, un cromosoma metafsico, un cromosoma anafsico y un cromosoma telofsico.

2 divisin
meitica

Profase

Metafase

Anafase

Telofase

a) Qu diferencias hay entre ellos?


Las diferencias radican, principalmente, en el nmero de cromtidas y en el grado de condensacin.
b) Cuntas cromtidas tiene el cromosoma metafsico?
Cuntas tiene el anafsico?
El metafsico tiene dos cromtidas y el anafsico tan slo
una.
11 Di si las siguientes afirmaciones son verdaderas (V)
o falsas (F):
a) Una clula haploide puede sufrir mitosis. VERDADERO.
b) En condiciones normales, nunca podremos encontrar
un cromosoma anafsico rodeado de membrana nuclear. VERDADERO.
c) Todas las clulas eucariticas presentan centrosoma.
FALSO.
d) En la mitosis de clulas vegetales intervienen los microtbulos. VERDADERO.
e) Los microtbulos slo son necesarios para que los
cromosomas se siten en la placa ecuatorial durante
la metafase. FALSO.
12 La dotacin haploide de una clula diploide es
considerada como su juego bsico de cromosomas. Esto quiere decir que se tiene un solo cromosoma como
representante del par homlogo. En qu intervalo del
ciclo celular una clula diploide presenta tetraploida?
Desde el final de la fase de duplicacin (fase S) hasta el principio de la mitosis.
13 Conoces algn tipo de divisin celular en la que la
citocinesis d lugar a dos clulas hijas de diferente tamao?
Se trata de la gemacin, en el que existe una divisin desigual
del citoplasma.
14 Dibuja un esquema para la mitosis y otro para la
meiosis de una clula 2n = 6.

15 Busca informacin acerca de la relacin existente


entre los denominados radicales libres y el envejecimiento. Qu alimentos de nuestra dieta podran ser tiles
para ralentizar el proceso de envejecimiento?
Existe informacin disponible en:
http://revista.consumer.es/web/es/20060901/alimentacion/70676.php

EXAMEN TIPO TEST


Di si son verdaderas (V) o falsas (F) las siguientes afirmaciones:
1. De acuerdo a la teora endosimbionte, los ancestros
de los cloroplastos habran pertenecido al nivel celular y, en la actualidad, ocuparan el nivel molecular.
VERDADERO.
2. Toda clula procede de otra ya preexistente. VERDADERO.
3. Por desgracia, las tcnicas de biologa molecular no
han servido, hasta ahora, para producir frmacos.
FALSO.
4. En la mitosis, las clulas hijas poseen idntica dotacin
cromosmica a la de la clula madre. VERDADERO.
5. El microscopio ptico permite la visualizacin de la
cromatina con toda claridad. FALSO.
6. Las clulas procariotas carecen de orgnulos membranosos. VERDADERO.
7. Tras la replicacin del ADN se obtienen dos cadenas:
una de ellas est constituida por las dos hebras antiguas y la otra por las dos hebras recin sintetizadas.
FALSO.
8. Cierta proporcin de los ribosomas generados en el
nucleolo acaban adheridos a la zona de la membrana nuclear que es baada por el citoplasma. VERDADERO.
9. El ADN presenta en su estructura cuatro bases pricas: adenina, timina, citosina y guanina. FALSO.
10. Durante la profase II de la meiosis, se llevan a cabo
los procesos de recombinacin gentica. FALSO.

101

4 LA CLULA, UNIDAD DE VIDA


EXAMEN DE
DESARROLLO
1 Enuncia y explica brevemente los postulados de la
teora celular.
La teora celular expone que:
Toda clula procede de la divisin de una preexistente.
La clula es la unidad estructural de todos los seres vivos,
por lo que todos ellos estn constituidos por una o ms
clulas.
La clula es la unidad fisiolgica de los seres vivos, ya que
es en ella donde se llevan a cabo las funciones vitales.
La clula es la unidad gentica de los seres vivos, puesto
que contiene la informacin necesaria para autorregularse y perpetuarse.
2 Dibuja una clula animal, indica sus principales estructuras y componentes y realiza una pequea descripcin de cada uno de ellos. Qu diferencias existen entre
este tipo de clulas y una bacteria?

Centrosoma: divisin celular.


Mitocondria: generacin de energa.

Las clulas animales, como clulas eucariotas que son, presentan un ncleo que alberga el material gentico. En las
bacterias (procariotas), sin embargo, el material gentico se
encuentra disperso en el citoplasma y no se encuentra contenido en ninguna estructura. Adems, las clulas animales
presentan orgnulos membranosas. Estas estructuras, por
el contrario, no existen en bacterias. Otra diferencia entre
unas y otras es que las clulas animales pueden encontrarse
en organismos pluricelulares. En bacterias no existe ningn
organismo pluricelular conocido.
3 Detalla las dos principales propiedades que caracterizan al ADN.
Por un lado, el ADN tiene capacidad para duplicarse. Esto
quiere decir que a partir de una molcula se pueden generar
dos copias idnticas para que sean portadas por las clulas
hijas tras la divisin celular. Cada hebra de la molcula antigua sirve como molde para generar cadenas nuevas. De
esta manera, la molcula de ADN nueva presenta una cadena
antigua y otra recin sintetizada.
Por otro lado, el ADN tiene la capacidad de almacenar la informacin gentica. Para ello, utiliza un alfabeto de cuatro
letras constituido por las bases nitrogenadas adenina, timina,
guanina y citosina. De esta manera, las diferentes instrucciones vienen codificadas por las infinitas combinaciones de
estas cuatro bases.
4 Indica las principales aplicaciones que pueden derivarse de la ingeniera gentica.
La ingeniera gentica nos permite:
Unir ADN de diferentes especies para obtener organismos transgnicos de utilidad.
Obtener clones de animales.
Emplear a las bacterias como factoras de compuestos de
inters como, por ejemplo, la insulina.
Avanzar en el conocimiento de los diferentes genomas.
En el caso de nuestra especie, est ayudando a descifrar
todas las claves de nuestro genoma en el denominado
Proyecto Genoma Humano.

102

Membrana plasmtica: intercambio de informacin y


compuestos con el medio externo.
Ncleo: almacn, replicacin y transcripcin de la informacin gentica.
Ribosoma: responsable de la sntesis proteica.
Retculo endoplasmtico: funciones diversas relacionadas
con lpidos y protenas. Existen dos tipos: rugoso y liso.
Aparato de Golgi: modificacin proteica y secrecin de
sustancias.
Lisosomas: degradacin de nutrientes.
Vacuola: almacn de compuestos.

5 Esquematiza la mitosis de una clula haploide n = 3


y la meiosis de una clula diploide 2n = 4.
Para la mitosis, los alumnos deben dibujar las fases de profase, metafase, anafase y telofase, tomando como referencia
la Fig. 4.20 del Libro del alumno, con la diferencia de que el
nmero de cromosomas de la clula es de tres.
Para la meiosis, los alumnos deben dibujar las fases de la primera y segunda divisin meitica tomando como modelo la Fig.
4.22 del Libro del alumno, con la diferencia de que en nuestro
caso, la clula contiene cuatro pares de cromosomas.

GENES Y HERENCIA
ACTIVIDADES

Est actuando el tipo de herencia intermedia, ya que se obtiene un color que es la mezcla de los iniciales.

1 Explica cules son las diferencias existentes entre


los siguientes conceptos: gen, carcter, alelo y locus.
Un gen es el fragmento de ADN que contiene las instrucciones necesarias para la generacin de una protena. Dicho
fragmento se localiza fsicamente en un lugar concreto del
genoma. Esta localizacin se denomina locus.
Un gen puede tener diferentes alternativas o alelos. As, los
alelos para un mismo gen se diferencian en poseer una secuencia ligeramente distinta.
Por ltimo, el carcter codificado por un gen es el resultado
que se obtiene de manera patente, ya sea en morfologa o
en fisiologa.
2 Supongamos un carcter diallico en el que el alelo
A codifica para color rojo y a para color blanco. Realiza un cuadro indicando los fenotipos que corresponden
a los genotipos homocigoto AA, homocigoto aa y
heterocigoto Aa en los siguientes supuestos:
a) Herencia dominante
b) Herencia codominante
c) Herencia intermedia

Dominante Rojo
TIPO DE
HERENCIA

Codominante

Rojo

Intermedia Rojo

5 Rellena los espacios en blanco para dotar de sentido


al siguiente texto:
En el siglo XIX, el monje agustino Mendel estableci las leyes
que rigen la transmisin de caracteres a la descendencia. Para ello, utiliz caracteres cualitativos que tenan nicamente
dos formas de expresin o alelos. Ms tarde, en 1900, De
Vries, Tschermark y Correns corroboraron los resultados de
Mendel. De esta manera, el monje checo pas a la historia
como el padre de la gentica.
6 Cmo consigui Mendel obtener las razas puras
que luego utiliz para llevar a cabo sus cruzamientos?
Para obtener razas puras, Mendel autofecund plantas durante varias generaciones hasta que obtuvo el mismo carcter en todos los descendientes.
7 Crees que el carcter tamao del guisante habra
sido un carcter idneo a la hora de llevar a cabo sus
experimentos? Razona tu respuesta.
No. El carcter tamao del guisante probablemente sea un
carcter cuantitativo en el que puede haber un gran nmero de fenotipos y, seguramente, se ve afectado por varios
genes.

GENOTIPO
Homocigoto AA

Heterocigoto Aa

Homocigoto aa

Rojo

Blanco

Rojo y
blanco

Blanco

Rosa

Blanco

8 Imagina que el carcter mendeliano color de los


guisantes tuviera un tipo de herencia codominante.
Indica:
a) El fenotipo y genotipo de los descendientes en la primera generacin filial (F1).
Genotipo Aa y fenotipo mosaico amarillo-verde.

3 Indica la diferencia existente entre genotipo y fenotipo. Aydate de un ejemplo en tu explicacin.


El genotipo de un individuo es el conjunto de todos sus genes. Sin embargo, el fenotipo es la manifestacin de algunos de esos genes; manifestacin que, por otro lado, se ve
influenciada por el ambiente.
Aplicado a un carcter concreto, el genotipo sera la secuencia
del genoma relacionada con ste, mientras que el fenotipo
sera la expresin de dicho carcter. Por ejemplo, el cambio de
una nica base en un gen puede desembocar en una patologa dada. Dicha patologa sera el fenotipo en este caso.
4 Un jardinero cruza dos razas de cierta especie de
planta y obtiene unos descendientes cuyas flores presentan un color azul claro. Si las flores de las plantas de
partida eran azules y blancas, respectivamente, qu
tipo de herencia est actuando en este caso?

b) El fenotipo y genotipo de los descendientes en la segunda generacin filial (F2), suponiendo que slo se
cruzan entre s aquellas plantas que presentan igual
color de guisantes.
Genotipos AA, Aa y aa. Fenotipos verde, mosaico amarilloverde y amarillo.
c) Los porcentajes totales de fenotipos en la F2.
25 % AA, 50 % Aa y 25 % aa.
d) Los porcentajes totales de genotipos en la F2.
25 % verdes, 50 % mosaicos, 25 % amarillos.
9 Supongamos el carcter tamao de las alas para
cierto insecto en el que el fenotipo alas largas (L) do-

103

5 GENES Y HERENCIA
mina frente al fenotipo alas cortas (l). Si se cruza un
macho heterocigoto con una hembra de igual genotipo,
indica:
a) El porcentaje de descendientes que presentan alas
cortas.

b) El nmero aproximado de descendientes que presentan alas largas si el nmero medio de huevos en cada
puesta es 150 y la viabilidad de stos es del 16 %.

a) Si tras cruzar una hembra heterocigoto para ambos caracteres y un macho de iguales caractersticas obtenemos un 25 % de posibilidades de obtener aves con plumas largas en su cola, cmo ser
el fenotipo plumas largas frente al de plumas
cortas?

75 % (porcentaje de descendientes con alas cortas en la F1) x


150 (huevos) x 16 % = 18 descendientes con alas largas.

El genotipo que origina el fenotipo plumas largas ser recesivo frente al de plumas cortas.

10 Una determinada planta da unos frutos cuyo color


puede ser rojo o amarillo. Las hojas de esta misma planta pueden ser aserradas o enteras. Suponiendo que los
caracteres rojo en el fruto y aserrada en las hojas
son dominantes, y que el tipo de herencia es dominante,
indica:

b) Imaginemos un supuesto en el que los caracteres


recesivos fueran dominantes y viceversa. Qu probabilidad habra de obtener aves con plumas largas
en su cola?

a) El genotipo y el fenotipo de la descendencia en la F1


y en la F2.

12 Lleva a cabo una encuesta entre tus familiares, amigos y conocidos para averiguar con qu frecuencia se
presentan los diferentes caracteres mendelianos de la
Tabla 5.1 que figura en esta pgina. Ten en cuenta que,
cuanta ms gente sea partcipe de tu encuesta, ms se
aproximarn los resultados que obtengas a la realidad
social.

25 % de descendientes con alas cortas en la F1.

A (rojo) > a (amarillo); E (aserradas) > e (enteras).


Cruzando las lneas puras AAEE y aaee, En la F1 se obtendra un 100 % de plantas con genotipo AaEe y fenotipo rojo
aserrado.
Para ver la descendencia de un cruce entre dos plantas de la
F1, hacemos un cuadro de Punnet con los gametos:
AE

Ae

aE

ae

AE

AAEE

AAEe

AaEE

AaEe

Ae

AAEe

AAee

AaEe

Aaee

aE

AaEE

AaEe

aaEE

aaEe

ae

AaEe

Aaee

aaEe

aaee

Los genotipos de la F2 seran: 1 AAEE: 2 AAEe: 2 AaEE: 1 AAee:


4 AaEe: 1 aaEE: 2Aaee: 2 aaEe: aaee
Los fenotipos de la F2 seran: 9 rojo aserrado: 3 rojo entero:
3 amarillo aserrado: 1 amarillo entero.
b) El nmero de frutos rojos que podemos obtener en
la F2 si tenemos 100 plantas en cada generacin filial
y cada planta da una media de 50 frutos.
La proporcin de frutos rojos en la F2 es de 12:4, es decir, el
75 %. Por tanto, el nmero de frutos rojos ser el siguiente:
75 % x 100 x 50 = 3 750 frutos rojos.
11 Un ave de venta frecuente en pajareras y tiendas de
animales presenta una coloracin oscura. Sin embargo,
en algunos ejemplares es posible encontrar una coloracin clara causada por una mutacin recesiva. Por otra

104

parte, dicha ave puede presentar dos alternativas para


el carcter longitud de las plumas de la cola: plumas
largas y plumas cortas. Tanto el carcter coloracin
como el carcter longitud de las plumas de la cola son
de tipo mendeliano.

Tendramos un 75 % de posibilidades.

Respuesta libre.
13 Rellena los espacios en blanco que existen en los
siguientes enunciados relacionados con el cariotipo humano:
a) El cariotipo est constituido por 44 autosomas y dos
cromosomas sexuales.
b) Las mujeres son el sexo homogamtico, ya que poseen dos cromosomas X.
c) Los hombres son el sexo heterogamtico, ya que poseen un cromosoma X y otro Y.
d) Los cromosomas sexuales comparten algunos genes
que estn situados en las regiones homlogas.
e) Si una mujer es heterocigota para cierto carcter se
la denomina portadora, ya que en su genotipo se encuentra el alelo recesivo aunque quede enmascarado
por el alelo dominante.
14 Si una mujer sana tiene hijos con un hombre daltnico:
a) Cul es la probabilidad de que una hija padezca daltonismo?
La probabilidad sera del 100 %.

b) Cul es la probabilidad de que un hijo padezca daltonismo?

a) La regin celular en la que se da el proceso.

El hijo nunca podra padecer daltonismo.

Replicacin: ncleo; Transcripcin: ncleo; Traduccin: citoplasma.

c) Poda ser el padre de la mujer un individuo daltnico?

b) El sustrato o materia prima de cada uno de los procesos.

No, ya que uno de los cromosomas X de la mujer proviene


del padre, y se trata de una mujer sana.

Replicacin: Desoxirribonucletidos; Transcripcin: ribonucletidos; Traduccin: aminocidos.

d) Poda ser la madre de la mujer portadora?

c) El producto de cada uno de los procesos.

S, en el supuesto de que haya cedido a su hija el cromosoma


X dominante para el trastorno.

Replicacin: ADN; Transcripcin: ARN; Traduccin: protenas.

e) Influye algo que el padre del hombre fuera daltnico


para que ste lo sea?
No, ya que el padre del hombre cedi a ste el cromosoma Y.
15 Busca en libros, Internet o cualquier otro tipo de
fuente bibliogrfica informacin acerca de otras enfermedades genticas ligadas al cromosoma X.
Se puede encontrar informacin en:
http://es.wikipedia.org/wiki/Cromosoma_X#Enfermedades
16 Escribe tres secuencias de ARN mensajero que den
lugar al siguiente pentapptido: Val-Leu-Gln-Gly-His.
GUU CUA CAA GGU CAU
GUA UUA CAA GGU CAU
GUG UUG CAA GGC CAC
17 La hormona liberadora de tirotropina (TRH) es secretada por el hipotlamo, estimulando la liberacin de
tirotropina (TSH) y prolactina (PRL) en la hipfisis. La TRH
es un tripptido que responde a la siguiente secuencia
aminoacdica: Glu-His-Pro. Encuentra un posible ARN
mensajero que la genere.
GAA CAC CCU
18 La RNA polimerasa de E.coli transcribe 70 nucletidos por segundo, aproximadamente. Suponiendo que un
gen dado tiene una longitud de 1,2 kb, cunto tiempo
tardar la RNA polimerasa en transcribirlo?
Se trata de una simple regla de tres:
70 bases
----------- 1 segundo
1 200 bases ----------- x
x = 17,143 segundos.
19 Indica para los procesos de replicacin, transcripcin y traduccin:

d) Los componentes del sustrato.


Replicacin: bases nitrogenadas, desoxirribosa y fosfato;
Transcripcin: bases nitrogenadas, ribosa y fosfato; Traduccin: no hay.
e) Los componentes del producto.
Replicacin: nucletidos; Transcripcin: nucletidos; Traduccin: aminocidos.
20 Qu es una mutacin?
Una mutacin es una alteracin en el genoma, ya sea en la
secuencia de las bases, en la estructura del cromosoma o en
el nmero de stos.
21 Indica si las siguientes afirmaciones son verdaderas
(V) o falsas (F):
a) Las mutaciones son alteraciones del genoma que
siempre tienen resultados negativos. FALSO.
b) Una mutacin puede, en algunos casos, ser letal. VERDADERO.
c) El fenmeno de las mutaciones puede ser considerado como uno de los principales motores de la evolucin, en funcin de las teoras aceptadas hoy da.
VERDADERO.
d) Las mutaciones nunca se dan por causas naturales.
FALSO.
e) Los agentes mutgenos pueden ser tanto fsicos como qumicos. VERDADERO.
f) Un individuo afectado por una mutacin transmitir
sta a sus descendientes. FALSO.
g) Las mutaciones en la lnea germinal pueden pasar a
la descendencia. VERDADERO.
22 Qu diferencias hay entre mutacin gnica y otra
de carcter cromosmico?
La mutacin gnica es aquella que se da en una regin puntual
cambiando una secuencia muy localizada del genoma. La mutacin cromosmica es aquella que vara la estructura de un
cromosoma o que afecta al nmero de estos elementos.

105

5 GENES Y HERENCIA
23 Clasifica las siguientes enfermedades en funcin de
que su origen resida en una mutacin gnica o que, por
el contrario, se deriven de una mutacin cromosmica.

a)
b)
c)
d)
e)
f)

Sndrome de Cri du Chat. Mutacin cromosmica.


Hipercolesterolemia familiar. Mutacin gnica.
Fenilcetonuria. Mutacin gnica.
Sndrome de Prader-Willi. Mutacin cromosmica.
Enfermedad de Tay-Sachs. Mutacin gnica.
Sndrome de Wolf-Hirschhorn. Mutacin cromosmica.

EXAMEN TIPO TEST


Di si son verdaderas (V) o falsas (F) las siguientes afirmaciones:
1. Un gen es un fragmento de ADN que contiene la informacin necesaria para sintetizar una protena.
VERDADERO.
2. Las leyes de Mendel no se cumplen en algunos casos.
VERDADERO.
3. En la herencia codominante, el fenotipo resultante es
el intermedio al de ambos caracteres por separado.
FALSO.
4. En humanos, los varones presentan sexo homogamtico. FALSO.
5. El resultado de cruzar dos lneas puras es una descendencia uniforme. VERDADERO.
6. Un hombre con hemofilia y una mujer portadora de
esta enfermedad pueden tener hijos varones sanos.
VERDADERO.
7. El cariograma de un individuo con sndrome de Patau
presenta 47 cromosomas. VERDADERO.
8. En la traduccin, la informacin del ARN transferente
es codificada como protenas. FALSO.
9. Las mutaciones pueden ser beneficiosas en el proceso evolutivo. VERDADERO.
10. El cdigo gentico se caracteriza por ser universal y
no degenerado. FALSO.

EXAMEN DE
DESARROLLO
1 Define los siguientes conceptos:

106

Gen: fragmento de ADN que contiene la informacin


gentica necesaria para generar una protena.
Alelo: cada una de las alternativas en las que se puede
encontrar un gen.
Fenotipo: resultado de la expresin de uno o ms genes,
con influencia del medio ambiente.
Autosoma: cada uno de los cromosomas que contienen
genes implicados en caractersticas somticas comunes
a ambos sexos.

Locus: lugar fsico de un cromosoma en el que se encuentra un gen.


Cariotipo: conjunto de todos los cromosomas presentes
en una clula.
Mutacin: alteracin en la secuencia, en la estructura o en
el nmero de los cromosomas de una clula o individuo.

2 Explica brevemente de qu manera se expresa un


gen.
La expresin de un gen tiene como ltimo fin la sntesis de
una protena. Para ello, se suceden una serie de pasos:
I) El ADN se transcribe a ARN mensajero (ARNm) en el ncleo de la clula.
II) Este ARNm sale del ncleo y se une a un ribosoma del
citoplasma.
III) De acuerdo al cdigo gentico, el ribosoma va leyendo
el ARNm y ligando aminocidos que son suministrados por
ARNs transferentes.
IV) Finalmente, la unin de todos los aminocidos conforma
la protena.
3 El grupo sanguneo de una persona queda determinado por el grupo Rh adems de por el sistema AB0. El
carcter Rh es diallico, siendo dominante el fenotipo
Rh+ y recesivo el fenotipo Rh. Los abuelos maternos
de un recin nacido son A+ y AB. Los abuelos paternos
son A y 0. El padre del recin nacido es 0. La madre,
en cambio, es B.
a) Determina el genotipo de padres y abuelos.
(A: alelo A, B: alelo B, i: alelo 0, R: alelo Rh+, r: alelo Rh)
Genotipo del abuelo paterno: Airr
Genotipo de la abuela paterna: iirr
Genotipo del padre: iirr
Genotipo del abuelo materno: AiRr
Genotipo de la abuela materna: ABrr
Genotipo de la madre: Birr
b) Qu probabilidad hay de que el recin nacido tenga
un fenotipo 0?
La probabilidad es del 50 %.
c) Podra el recin nacido ser del grupo A? Por qu?
No, ya que no existe el alelo A en ninguno de los padres.
4 Qu tipo de mutaciones existen? Explica en qu consiste cada una de ellas y da un ejemplo para cada caso.
En funcin del material gentico afectado, podemos clasificar
las mutaciones en dos tipos:
Mutaciones puntuales: consisten en la alteracin de la secuencia de bases de un gen y desembocan en la sntesis
de una protena diferente a la convencional. Un ejemplo

de patologa causada por este tipo de mutaciones sera la anemia falciforme. Las personas que padecen este
trastorno presentan una mutacin puntual en el gen de
la hemoglobina.
Mutaciones cromosmicas: implican un cambio ya sea
en la estructura o en el nmero de genes. Entre ellas,
encontramos las trisomas, como la trisoma del par 13
que da lugar al sndrome de Patau.
5 Explica brevemente las caractersticas de la dotacin
cromosmica humana.

de cromosomas. De ellos, 22 pares son autonmicos y el par


restante lo conforman los cromosomas sexuales. Las mujeres son el sexo homogamtico, puesto que presentan dos
cromosomas sexuales X. Por el contrario, los hombres son el
sexo heterogamtico presentan un cromosoma sexual X y
un cromosoma sexual Y.
Para terminar, cabe decir que a lo largo de estos 23 pares de
cromosomas, se estima que existen alrededor de 20 000 o
30 000 genes. La mayora de ellos son cuantitativos, aunque
tambin existen cualitativos.

Los seres humanos tenemos una dotacin cromosmica diploide, ya que nuestro genoma est constituido por 23 pares

107

6 LA EVOLUCIN DE LA BIOLOGA
ACTIVIDADES
1 Responde verdadero (V) o falso (F) justificando la
respuesta:
a) El ADN que se introduce en el genoma de otra especie se llama ADN recombinante. FALSO. El ADN que se
quiere introducir en el genoma de otra especie recibe el
nombre de ADN pasajero.
b) Una de las aplicaciones de la biotecnologa es el
diagnstico y la deteccin precoz de enfermedades.
VERDADERO.
c) Algunas bacterias son capaces de digerir los hidrocarburos de las mareas negras. VERDADERO.
d) A partir de las tcnicas de la ingeniera gentica no
se pueden crear especies diferentes a las naturales.
VERDADERO.
2 Define:

Biotecnologa: es un conjunto de tcnicas y procesos de


manipulacin del material gentico de diferentes seres
vivos para obtener sustancias de inters para el ser humano y el medio natural.
Ingeniera gentica: utiliza diversas tcnicas de manipulacin de ADN con el propsito de introducir genes de
un organismo (virus, bacteria, vegetal, animal e incluso
humano) en el material hereditario de otro.
ADN pasajero: el ADN que se quiere introducir en el genoma de otra especie recibe este nombre.

3 Por qu se dice que la ingeniera gentica rompe el


flujo natural de la transmisin de los genes?
La ingeniera gentica rompe el flujo natural de la transmisin de los genes contemplado en la definicin de
especie, segn la cual los individuos de una especie se
reproducen entre s y producen una descendencia frtil.
Las tcnicas de la ingeniera gentica sobrepasan la barrera interespecfica y crean nuevas especies diferentes
a las naturales.
4 Hemos visto que el ser humano ha utilizado bacterias y levaduras para elaborar alimentos y bebidas. Responde:
a) Qu es la fermentacin alcohlica?
La fermentacin alcohlica es un proceso anaerbico realizado por las levaduras, ordinariamente, pero tambin lo
pueden realizar algunas bacterias.
b) Enumera productos que se obtengan de este proceso.
De la fermentacin alcohlica se obtienen muchos productos, como: vino, cerveza, alcohol, chocolate, pan, etctera.

108

c) Explica brevemente en qu consiste este proceso.


Las levaduras son microorganismos unicelulares, que consiguen su energa por medio de la fermentacin alcohlica,
en la que rompen las molculas de glucosa para obtener la
energa para sobrevivir y producen el alcohol como consecuencia de la fermentacin.
5 En qu se diferencian las enzimas de restriccin de
las enzimas ligasas?
Las enzimas de restriccin son enzimas que reconocen secuencias especficas dentro del ADN que cortan la doble
cadena de nucletidos y generan fragmentos con extremos
cohesivos o adherentes (los nucletidos de uno de los extremos son complementarios a los del otro extremo). Mientras,
las enzimas ligasas son las encargadas de unir los distintos
fragmentos de ADN cortados por las enzimas de restriccin
con el ADN de los vectores.
6 Qu es un vector? Cul es su funcin?
Vectores son estructuras con capacidad de penetracin en
las clulas utilizadas para introducir en ellas los fragmentos
de ADN de inters. Los vectores ms utilizados son los plsmidos y los virus.
7 Ordena los siguientes procesos para que sea posible
la transferencia gentica:
a)
b)
c)
d)
e)
f)

Insercin en vectores.
Localizacin del gen.
Introduccin
Extraccin del gen.
Clula humana.
Bacterias recombinantes.
Localizacin del gen

Clula humana
Extraccin del gen
Insercin en vectores
Introduccin
Bacterias recombinantes

8 Define el trmino bacterifago.


Un virus que infecta a bacterias se denomina bacterifago.
9 Responde verdadero (V) o falso (F) a las siguientes
afirmaciones razonando en caso negativo:
a) Para que las bacterias y levaduras produzcan sustancias de inters el primer paso es la localizacin del gen
responsable del producto de inters. VERDADERO.

b) Si el proceso va a ser efectuado por bacterias los vectores ms indicados son los virus. FALSO. Si el proceso
va a ser efectuado por bacterias, los vectores ms indicados son los plsmidos.
c) Actualmente la insulina es producida por levaduras a las
que se les ha insertado el gen humano responsable de
la sntesis de esa hormona. FALSO. Actualmente, la insulina es producida por bacterias a las que se les ha insertado el
gen humano responsable de la sntesis de esa hormona.
10 Antes de que las bacterias sintetizaran la insulina,
cmo se obtena esa hormona? Qu ventajas ha supuesto este cambio?

cadveres sin controlar resultaron contagiados por la enfermedad de Creutzfeldt-Jacob, la variante humana de la
enfermedad de las vacas locas.
15 Por qu introducir genes externos es ms complicado en clulas animales o vegetales que en bacterias?
La introduccin de genes externos en clulas vegetales o animales es ms complicada que en bacterias. La existencia de una
pared celulsica vegetal y de una membrana plasmtica dificulta la penetracin de los vectores. En ocasiones, debe recurrirse
a insertar el ADN mediante microinyecciones o a adherirlo a
microbalas que se disparan al interior de las clulas.

Las personas diabticas deben inyectarse regularmente insulina y, antes de que la ingeniera gentica lo remediara, la insulina se obtena de los cerdos, lo cual encareca el producto
y provocaba reacciones de rechazo en algunos enfermos.

16 De la siguiente lista indica cuales son manipulaciones genticas de alimentos transgnicos de origen vegetal:

11 Completa el siguiente esquema sobre la produccin


de insulina humana mediante la ingeniera gentica.

Resistencia a tamaos grandes.


Resistencia a los plaguicidas.
Resistencia a sequas.
Resistencia a herbicidas.

Respuesta correcta: b), c) y d).


17 Cules son los factores que pueden condicionar a
la produccin y la calidad de los cultivos vegetales?

12 Define:

Antibiticos: son sustancias naturales o sintticas que


impiden la proliferacin de microorganismos, sobre todo
bacterias.
Interfern: es una protena que producen las clulas animales infectadas por virus, y que es capaz de minimizar
los efectos causados por la infeccin.

13 Responde verdadero (V) o falso (F) a las siguientes


afirmaciones, razonando en caso negativo:
a) El factor XV es una de las protenas necesarias para la
coagulacin. FALSO. El factor VIII es una de las protenas
necesarias para la coagulacin.
b) La hormona de crecimiento es una hormona proteica
producida por la hipfisis y encargada de estimular
el crecimiento corporal. VERDADERO.
c) El interfern se emplea como tratamiento contra la
hepatitis o el herpes. VERDADERO.
14 Completa el prrafo sobre la hormona de crecimiento:
En los aos ochenta del pasado siglo, miles de nios tratados con hormona del crecimiento extrada de hipfisis de

Los cultivos vegetales se hallan condicionados por diversos


factores que pueden afectar tanto a su produccin como a
su calidad. Entre estos, se encuentran: el clima de la zona,
las enfermedades, las plagas de parsitos y el crecimiento
de malas hierbas.
18 Las patatas son una de las plantas que se han intentado mejorar genticamente para mejorar la alimentacin. Responde:
a) Cul es la sustancia principal que puede modificar
la calidad de este tubrculo?
El almidn.
b) A qu llamamos patatas de variedad waxy?
Es una variedad de patata modificada genticamente, que no
tiene amilasa. Tiene una represin antisentido del gen GBSS.
c) Jos quiere tomar de aperitivo patatas fritas, pero
no sabe qu variedad escoger. La variedad A tiene
un alto contenido en amilosa mientras la variedad B
tiene un alto contenido en amilopeptina. Qu opcin le recomendaras a Jos?
Jose debera coger la variedad A con alto contenido en amilosa, ya que impide la penetracin de fuera, lo que mantiene
las patatas crujientes.

109

6 LA EVOLUCIN DE LA BIOLOGA
19 Completa el siguiente cuadro sobre la insercin de
genes en animales:

24 Define:

Clonacin
Clulas madre

La clonacin es un proceso que permite obtener una o ms


copias exactas de un individuo por medio de mecanismos
propios de la reproduccin asexual.

Implantacin en
el tero

Blastocito

Diferenciacin
in vitro

25 Completa la siguiente tabla con s (S) o no (N) sobre


las modalidades de clonacin:

Oocito
enucleado

Los xenotrasplantes son trasplantes de donantes animales al


ser humano. El animal ms utilizado es el cerdo.

Clula
somtica adulta
2n

20 Qu son los xenotransplantes? Qu animales son


los ms utilizados?

Las primeras clulas del embrin, llamadas clulas madre


embrionarias, son totipotentes, es decir, pueden especializarse en cualquier tipo de tejido adulto.

Reproductiva

Teraputica

21 Completa el prrafo sobre las granjas transgnicas:


La mayor complejidad en el desarrollo de los animales
exige tcnicas de manipulacin gentica ms sofisticadas
que en los microorganismos o las plantas. Por esta razn, la
produccin y comercializacin de animales transgnicos est
ms atrasada que la de vegetales.
La insercin de genes externos en animales se realiza mediante microinyecciones de ADN en un vulo fecundado.
Cuando el cigoto duplique su material gentico tambin lo
har el gen inyectado y as, todas las clulas del individuo
llevarn el gen deseado.

26 Completa el siguiente esquema sobre el nacimiento


de Dolly.

22 La bacteria Bacillus thurigiensis se ha utilizado en


la ingeniera gentica para evitar plagas de insectos en
plantas como el maz. Indica para qu plagas se utilizan
cada una de estas cepas: Bacillus thurigiensis israelensis,
Bacillus thurigiensis kurstaki y Bacillus thurigiensis tenebriosis.
Bacillus thurigiensis israelensis: se usa para combatir plagas
de dpteros
Bacillus thurigiensis kurstaki: se usa para combatir plagas de
dpteros y lepidpteros
Bacillus thurigiensis tenebriosis: se usa para combatir plagas
de colepteros.
23 Responde a las siguientes cuestiones con verdadero
(V) o falso (F), justificando tu respuesta:
a) En los animales superiores la reprogramacin gentica de las clulas adultas no es posible. FALSO. En los
animales superiores la reprogramacin gentica de las
clulas adultas es posible.
b) Existen dos tipos de clonacin: la reproductiva y la
terapetica. VERDADERO.
c) Los esquejes facilitan el crecimiento de un ejemplar
completo idntico de la planta que ha aportado el
fragmento cortado. VERDADERO.

110

27 Cundo se implantaron los embriones? Dnde se


implantaron?
Cuando los embriones alcanzaron el estado de mrula (entre
8 y 16 clulas) se implantaron en el tero de ovejas Scottish
Blackface.
28 Completa el siguiente prrafo sobre el nacimiento
de Dolly.
La clonacin animal no es fcil. Fueron necesarios ms de
270 intentos (embriones) para obtener a Dolly. Muchos
cientficos sostienen que este proceso es todava ms difcil
en primates.

29 Adems de Dolly existe otra oveja tambin muy conocida, que se llama Polly, que al igual que Dolly naci
en Roslin Institute de Edimburgo. Encuentra informacin
acerca de Polly.
La oveja Polly es la primera oveja clnica y transgnica a la
vez. Su nacimiento fue llevado a cabo en el Instituto Roslin de
Edimburgo cinco meses despus del nacimiento de la oveja
Dolly y por el mismo equipo de Ian Wilmut.
En este caso, el proceso se llev a cabo insertando un gen
humano de valor teraputico en clulas fetales de oveja y
aplicaron el procedimiento habitual ya realizado con xito
en la oveja Dolly.
Polly fue bautizada as por ser de la raza Poll Dorset. Son
ovejas transgnicas (en esencia no clnicas) que producen
la protena alfa-1antitripsina as como los factores de coagulacin VII y IX.
30 De la siguiente lista, indica cules son aplicaciones
de la denominada huella gentica:
a)
b)
c)
d)

Pruebas de clonacin.
Parentesco evolutivo.
Investigacin forense.
Anlisis de ADN fsil.

Respuesta correcta: b), c) y d).


31 Responde a las siguientes cuestiones con verdadero
(V) o falso (F), justificando tu respuesta:
a) El ADN que marca las diferencias entre individuos
se denomina ADN recombinante. FALSO. El ADN que
marca las diferencias entre los individuos y que presenta
una gran variabilidad entre los mismos se denomina ADN
hipervariable.
b) La tcnica PCR permite obtener, a partir de un nico
fragmento de ADN, millones de copias en cantidad
suficiente para la realizacin de cualquier tipo de
anlisis. VERDADERO.
c) La identificacin de especies es una de las aplicaciones de la prueba del ADN. VERDADERO.
32 Ordena los siguientes pasos para la realizacin correcta de la tcnica PCR:
a) Calentamiento de la muestra de ADN a 98 C.
b) Introduccin en el termociclador del fragmento de
ADN junto los cebadores y la enzima ADN-polimerasa.
c) Calentamiento a 72 C.
d) Enfriamiento a 50 C.
e) Repeticin de los ciclos de replicacin.
Respuesta correcta: b a d c e

33 Adems de la PCR existen otras tcnicas moleculares, una de ellas es la huella dactilar de plsmidos (PF).
Responde:
a) En qu consiste esta tcnica?
La huella dactilar de plsmidos fue la primera tcnica molecular utilizada como una herramienta de tipificacin. El
nmero y tamao de los plsmidos presentes son utilizados
como base para la identificacin de cepas. Esta tcnica de
tipificacin de cepas ha sido utilizada con xito en el anlisis de brotes de infecciones nosocomiales y en infecciones
adquiridas en comunidad causadas por una variedad de especies de bacterias gram-negativas.
b) Define plsmido.
Los plsmidos son elementos de ADN extracromosmico
que estn presentes en muchos aislamientos clnicos y pueden ser identificados por simples procedimientos de lisis de
clulas seguidos de electroforesis en gel.
c) Cita los usos de esa tcnica.
En general, esta tcnica es ms utilizada para estudios
epidemiolgicos que estn limitados tanto temporalmente como geogrficamente, y puede complementar otras
tcnicas para proporcionar una base para diferenciar aislamientos que estn relacionados genotpicamente, pero
que estn separados epidemiolgicamente por periodos
moderados de tiempo, como varios meses.
34 De la siguiente lista indica cules seran ptimos
para realizar la huella gentica:

Orina.
Pelos.
Saliva.
Sangre.

Respuesta correcta: pelos y sangre.


35 En qu se basa la prueba de ADN? Para casos de
paternidad es solamente necesario el ADN del padre?
Razona la respuesta.
La prueba de ADN se basa en la comparacin entre distintas muestras de ADN. En los casos de paternidad dudosa,
se compara el ADN del hijo con el de sus presuntos padres
para encontrar coincidencias en los patrones de bandas.
Debe tenerse en cuenta que aproximadamente la mitad de
las bandas de una persona proceden de su madre y la otra
mitad, de su padre.
36 En un hospital ha habido dos partos. Por un descuido, no saben cul es el beb de cada familia. Se les
ha tomado una muestra de ADN para realizar la huella

111

6 LA EVOLUCIN DE LA BIOLOGA
gentica a los dos matrimonios implicados (la familia
Daz y la familia Garca) y a uno de los bebs. ste es el
resultado obtenido:

a) Los organismos recombinantes pueden llegar a


desplazar a los naturales de sus nichos ecolgicos
o contribuir a la aparicin de nuevas enfermedades.
VERDADERO.
b) Ninguno de los campos de la biotecnologa est
exento de polmica a causa de sus aplicaciones.
VERDADERO.
c) Las implicaciones que provoca la ingeniera gentica,
la clonacin y el Proyecto Genoma Humano son sociales nicamente. FALSO. Las implicaciones que provoca
la ingeniera gentica, la clonacin y el Proyecto Genoma
Humano son sociales, ticas y ecolgicas.
41 Define biotica.

El beb es de la familia Daz.

La biotica es una disciplina de reciente implantacin que


trata los problemas morales relacionados con la vida, el medio ambiente, el trato a los animales, la investigacin cientfica y la prctica de la medicina.

b) Hubiera sido necesario tomarle una muestra al otro


beb?

42 Completa el siguiente prrafo sobre la clonacin


teraputica:

En este caso no hara falta porque slo hubo dos partos y


que un beb sea de una familia hace que automticamente
el otro sea del otro matrimonio.

El punto ms espinoso sobre la clonacin teraputica es la


utilizacin de embriones para obtener clulas madre cuyo
cultivo proveera tejidos y rganos para trasplantes. La posibilidad de interrumpir el desarrollo de un embrin para este
fin suscita un considerable rechazo en determinados sectores
sociales. Para reducir esos reparos y poder aprovechar la
enorme potencialidad de la clonacin teraputica existen
investigaciones dirigidas a utilizar las clulas de naturaleza
embrionaria presentes en los tejidos adultos de todas las
personas.

a) De qu matrimonio es el beb?

37 Indica el significado de las siguientes siglas:

PGH: Proyecto Genoma Humano.


ADN: cido Desoxirribonucleico.
38 Define:

Mapa gentico: muestra la posicin relativa de los genes


presentes en cada cromosoma.
Mapa fsico: constituye la secuencia real de nucletidos que
compone cada uno de los genes.

43 Define los siguientes trminos:

39 Responde a las siguientes cuestiones con verdadero


(V) o falso (F), justificando tu respuesta:
a) El ADN se encuentra repartido entre los 23 cromosomas que constituyen la dotacin haploide de una
persona. VERDADERO.
b) Los genes que codifican protenas constituyen alrededor del 15 % del genoma total. FALSO. Los genes
que codifican protenas constituyen alrededor del 1,5 %
del genoma total.
c) Las diferencias entre individuos supone un 0,02 %
del genoma. VERDADERO.
d) El genoma humano est compuesto por 100 000 genes. FALSO. El genoma humano est compuesto por
entre 25 000 y 30 000 genes.
40 Responde a las siguientes cuestiones con verdadero
(V) o falso (F), justificando tu respuesta:

112

Programa ELSI. La gran trascendencia tica y social de los


resultados aportados por el PGH motiv que al mismo tiempo que se puso en marcha el Proyecto Genoma se creara
un programa internacional para tratar los aspectos ticos,
legales y sociales asociados al genoma humano, denominado programa ELSI (Ethical, Legal and Social Implications).
Eugenesia. Doctrina que defiende la mejora gentica
de las poblaciones facilitando la reproduccin de genes
considerados como aptos e impidiendo la reproduccin
de los no aptos.

44 Por qu el conocimiento del genoma humano constituye una poderosa herramienta para la investigacin
biomdica?
Conocer la secuencia completa del genoma humano constituye
una poderosa herramienta para la investigacin biomdica. El
PGH aportar informacin muy valiosa para prevenir y combatir
muchas de las enfermedades actuales, pero, dada su enorme
potencialidad, el uso indebido de los datos personales puede
provocar serios problemas ticos y legales a las sociedades.

El conocimiento del genoma humano puede impulsar prcticas eugensicas, seleccin de embriones, discriminacin
laboral, educativa y social, desigualdad de oportunidades,
problemas en la suscripcin de seguros de vida y un largo
etctera que debe ser evitado con legislaciones que conjuguen el respeto a los derechos de las personas y el avance
en el conocimiento cientfico.

2 Las herramientas moleculares para la transferencia


gentica son:

45 El primer microrace o microchip de ADN que se hizo


consisti en preparar dos tipos de muestras en la sonda:

3 La ingeniera gentica permite obtener sustancias


de gran utilidad para el ser humano:

a)
b)
c)
d)

Clulas crecidas sin suero.


Clulas crecidas con suero.

stas se marcaron de la siguiente forma: las clulas sin


suero de color rojo y las clulas con suero de color verde,
por lo que la mezcla de ambos daba el color amarillo.
Con este microrace se queran ver los niveles de expresin
de los genes en ambos tipos de clulas. Los resultados
obtenidos fueron los siguientes:
Responde:
a) Qu significa que el color resultante sea amarillo?
El color amarillo indica que el gen se expresa igual tanto en
las clulas crecidas con suero como en las crecidas sin presencia de suero.
b) Qu nos indica que el color resultante sea verde?
El color verde nos indica que los niveles de expresin del gen
son mayores en las clulas crecidas en suero que las que lo
hacen sin presencia de l.
c) Por qu hay verdes con distintas intensidades?
Hay distinta intensidad dependiendo de la expresin del gen
en las clulas sin suero. A medida que la expresin del gen en
las clulas crecidas sin suero sea ms baja mayor ser la intensidad del color verde.

EXAMEN TIPO TEST


Marca las respuestas correcta/s en las siguientes cuestiones:

a)
b)
c)
d)

Produccin de vitamina C.
Produccin de vacunas.
Anlisis gentico de individuos.
Produccin de hidratos de carbono.

Interfern.
Antibiticos.
Factor VII de la coagulacin.
Hormona del crecimiento.

4 Cules de las siguientes aplicaciones no han sido


realizadas para obtener alimentos transgnicos de origen vegetal?
a)
b)
c)
d)

Produccin de insulina.
Anlisis de ADN fsil.
Produccin de plantas resistentes a los plaguicidas.
Produccin de plantas resistentes a herbicidas.

5 Algunas de las aplicaciones de las granjas transgnicas son:


a) Alteracin de ciertas condiciones de desarrollo de la
planta.
b) Aumento de la produccin animal.
c) Xenotrasplantes.
d) Produccin de plantas resistentes a condiciones climticas desfavorables.
6 Las modalidades de la clonacin son:
a)
b)
c)
d)

Clonacin inductiva.
Clonacin reproductiva.
Clonacin clnica.
Clonacin teraputica.

7 Algunos de los procesos seguidos para la obtencin


de Dolly fueron:
a) Los ovocitos que haban sido fertilizados artificialmente fueron activados con una descarga.
b) Eliminacin del ncleo del vulo.
c) Desarrollo del embrin in vitro.
d) Extraccin de clulas de la glndula mamaria.

1 Algunas de las aplicaciones de la biotecnologa


son:
a)
b)
c)
d)

Hormonas.
Plsmidos.
Enzimas ligasas.
Bacterias.

8 Algunas de las aplicaciones de la prueba del ADN son:


a)
b)
c)
d)

Test de paternidad.
Anlisis de ADN fsil.
Parentesco evolutivo.
Investigacin forense.

113

6 LA EVOLUCIN DE LA BIOLOGA
9 Las etapas del anlisis del ADN del genoma humano
son:
a)
b)
c)
d)

Plsmidos: pequeas molculas de ADN circular presentes en el citoplasma de las bacterias y que, cuando
estn libres en el medio, pueden penetrar en otras
bacterias.
Virus: formas acelulares compuestas por una envoltura proteica que encierra el material gentico del virus.
No pueden reproducirse por s solos y necesitan introducirse en una clula viva para multiplicarse. Pueden
infectar bacterias (los virus que lo hacen se llaman
bacterifagos) y clulas vegetales y animales.

Mapa fsico.
Extraccin del ADN humano.
Mapa gentico.
PCR.

10 Algunos de los puntos ms polmicos de la ingeniera gentica son:


a) Introduccin en los ecosistemas de organismos modificados genticamente.
b) Reduccin biodiversidad.
c) Incrementan el uso de sustancias txicas.
d) Prcticas eugensicas.

2 Define clonacin y explica las modalidades de clonacin que existen.

EXAMEN DE
DESARROLLO

Existen dos modalidades de clonacin: reproductiva y teraputica.

La clonacin es un proceso que permite obtener una o ms


copias exactas de un individuo por medio de mecanismos
propios de la reproduccin asexual.

1 Define organismo transgnico u organismo modificado genticamente. Explica el proceso de transferencia


gentica y las herramientas moleculares usadas.
La ingeniera gentica posibilita la obtencin de organismos
transgnicos u organismos modificados genticamente, seres que poseen su genoma modificado por la introduccin
de uno o ms genes de otra especie.
La transferencia gnica, es decir, la insercin de un gen en el
ADN de otro organismo, requiere varios procesos:
1. Localizacin y extraccin del gen que se quiere transferir.
2. Insercin del gen aislado en un vector, un vehculo de
transporte que facilitar su entrada en la clula receptora.
3. Introduccin del vector cargado con el gen en el interior
de la clula de destino.
La realizacin de las operaciones anteriores se efecta a travs de una serie de herramientas moleculares, entre las que
destacan:

114

Enzimas de restriccin: enzimas que reconocen secuencias especficas dentro del ADN que cortan la doble cadena de nucletidos, y generan fragmentos con
extremos cohesivos o adherentes (los nucletidos de
uno de los extremos son complementarios a los del otro
extremo).
Enzimas ligasas: encargadas de unir los distintos fragmentos de ADN cortados por las enzimas de restriccin
con el ADN de los vectores.
Vectores: estructuras con capacidad de penetracin en
las clulas utilizadas para introducir en ellas los fragmentos de ADN de inters. Los vectores ms utilizados son
los plsmidos y los virus:

Clonacin reproductiva: consiste en la introduccin


del ncleo diploide (2n) de una clula somtica adulta
en un ovocito (vulo inmaduro) al que previamente se
le ha retirado el ncleo (ovocito enucleado) y que, por
tanto, no conserva su ADN. Despus de activar la divisin
del ovocito para conseguir un embrin (blastocisto), ste
se implanta en el tero donde el embarazo se llevar a
trmino.
Clonacin teraputica: el procedimiento es similar al anterior hasta la obtencin del blastocisto, pero, al alcanzar
esta fase, el embrin, en vez de implantarse en el tero, es
cultivado in vitro para obtener clulas madre embrionarias,
que al ser estimuladas convenientemente se diferenciarn
en diferentes tipos celulares susceptibles de ser utilizados
con fines teraputicos.

3 Indica qu aplicaciones tiene la huella gentica. En


qu consiste el PCR?
La prueba de ADN tiene mltiples aplicaciones:
Test de paternidad: empleado en casos de paternidad
dudosa.
Anlisis de ADN fsil: estudios de ADN presentes en restos
fosilizados.
Identificacin de especies: se recurre al estudio del ADN
cuando los ejemplares son muy parecidos en sus caractersticas externas.
Parentesco evolutivo: el grado de similitud en el ADN
permite establecer relaciones de parentesco evolutivo
entre las especies.
Investigacin forense: identificacin de sospechosos y
de vctimas de delitos.
Para poder realizar la prueba de ADN es necesario disponer de
una cantidad mnima de cido nucleico. En muchas ocasiones,
el ADN extrado de las muestras es insuficiente para realizar

anlisis. La tcnica de la PCR (reaccin en cadena de la polimerasa), desarrollada por Kary Mullis en 1983 (le vali el premio
Nobel de Qumica en 1993) permite obtener, en muy poco
tiempo y a partir de un nico fragmento de ADN, millones de
copias en cantidad suficiente para la realizacin de cualquier
tipo de anlisis. El procedimiento de la PCR est hoy completamente automatizado y consta de los siguientes pasos:
1. Se introduce en la mquina (el termociclador) un tubo con
el fragmento de ADN que se quiere duplicar, los nucletidos,
los cebadores (pequeos trozos de ADN a partir de los cuales
arranca la duplicacin) y la enzima ADN-polimerasa, encargada de fabricar las nuevas cadenas.
2. Se calienta la muestra de ADN a 98 C para separar las
dos hebras.
3. Se enfra hasta los 50 C para permitir la unin de los cebadores a un extremo de cada hebra separada.
4. Se vuelve a calentar hasta 72 C. La polimerasa se activa y
fabrica una cadena nueva de nucletidos complementaria a
cada una de las dos hebras originales. Al cabo de 1 minuto, tras
completarse el primer ciclo de replicacin, se han conseguido
dos nuevas molculas de ADN idnticas a la de la muestra.
5. Se repiten los pasos anteriores a lo largo de varios ciclos
de replicacin.
4 Explica el proceso seguido para la obtencin de Dolly. Haz un esquema de dicho proceso.
El proceso seguido para la obtencin de Dolly mediante clonacin fue el siguiente:
1) Se extrajeron y cultivaron in vitro clulas de la glndula
mamaria (la ubre) de una oveja adulta de raza Finn Dorset.
2) Esas clulas fueron posteriormente fusionadas mediante
un shock elctrico con ovocitos procedentes de una oveja
de raza Scottish Blackface (blanca con cara negra) a los que
previamente se les haba extrado el ncleo.
3) Los ovocitos, que haban sido fertilizados de manera artificial, fueron activados con una suave descarga elctrica y
comenzaron a dividirse.
4) Cuando los embriones alcanzaron el estado de mrula
(entre 8 y 16 clulas) se implantaron en el tero de ovejas
Scottish Blackface.
5) Transcurridos 148 das naci un cordero de 6,6 kg, totalmente blanco, que se convirti en el primer vertebrado obtenido a partir de una clula extrada de un mamfero adulto.
5 Cules son las principales aplicaciones del Proyecto
Genona Humano? Cules son sus principales riesgos?
Adems de elaborar un mapa gentico de los cromosomas
y secuenciar todo el ADN que codifica para las protenas

humanas, el PGH potenci el desarrollo de rpidas mquinas secuenciadoras y potentes ordenadores para albergar
toda la informacin que se iba recogiendo. En la actualidad, existen grandes bases de datos de acceso libre que
contienen informacin sobre el genoma humano y el de
otras especies.
Los datos aportados por el PGH permitirn acometer las siguientes acciones:

Identificar los genes responsables de las enfermedades


hereditarias.
Facilitar el diagnstico y el tratamiento de las enfermedades genticas, as como la adopcin de medidas preventivas para disminuir sus efectos.
Valorar la predisposicin de las personas a padecer alguna enfermedad a lo largo de su vida.
Mejorar el tratamiento de alguna enfermedad por medio
de la terapia gnica, con la que se podrn insertar genes
viables en personas con genes defectuosos.
Desarrollar medicamentos especficos para combatir enfermedades comunes como la diabetes, la hipertensin
o el cncer.
Incentivar los estudios sobre la evolucin y el parentesco
evolutivo a travs de anlisis de similitud entre los genomas de diferentes especies.
Facilitar las investigaciones forenses, paleontolgicas e
histricas.

La gran trascendencia tica y social de los resultados aportados por el PGH motiv que al mismo tiempo que se puso
en marcha el Proyecto Genoma se creara un programa internacional para tratar los aspectos ticos, legales y sociales
asociados al genoma humano, denominado programa ELSI
(Ethical, Legal and Social Implications).
Conocer la secuencia completa del genoma humano constituye una poderosa herramienta para la investigacin biomdica. El PGH aportar informacin muy valiosa para prevenir
y combatir muchas de las enfermedades actuales, pero, dada
su enorme potencialidad, el uso indebido de los datos personales puede provocar serios problemas ticos y legales a
las sociedades.
El conocimiento del genoma humano puede impulsar prcticas eugensicas, seleccin de embriones, discriminacin
laboral, educativa y social, desigualdad de oportunidades,
problemas en la suscripcin de seguros de vida y un largo
etctera que debe ser evitado con legislaciones que conjuguen el respeto a los derechos de las personas y el avance
en el conocimiento cientfico.

115

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

ACTIVIDADES
1 Responde verdadero (V) o falso (F) justificando la
respuesta:
a) Para mantener la actividad de los ecosistemas requieren solamente un aporte de energa. FALSO. Para mantener su actividad, los ecosistemas y, por extensin, toda
la ecosfera, requieren un aporte constante de materia y
energa.
b) Los auttrofos sintetizan materia orgnica a partir de
molculas sencillas inorgnicas utilizando la energa
del Sol. VERDADERO.
c) Los protozoos y las bacterias son seres vivos auttrofos. FALSO. Algunas bacterias s son auttrofas, los
protozoos son hetertrofos.
d) A partir de la glucosa los seres vivos auttrofos pueden sintetizar todas las dems biomolculas que necesitan para vivir. VERDADERO.
2 Define:

Ecosistema: se define como sistema natural, dinmico


y complejo, en el que los seres vivos y el ambiente interaccionan constantemente.
Ecosfera: el conjunto de todos los ecosistemas de la Tierra
forman la ecosfera.
Fotosntesis: es el proceso mediante el cual algunos
seres vivos como los vegetales, las algas y las cianobacterias sintetizan materia orgnica a partir de molculas
inorgnicas.

3 Por qu se dice de las plantas que son el pulmn


del planeta?
Las plantas son auttrofas y, por tanto, realizan la fotosntesis. Aunque la fotosntesis en realidad es un proceso extremadamente complejo, puede resumirse en la siguiente
ecuacin:

b) Resultan beneficiosas estas bacterias para las plantas? Justifica tu respuesta.


S, ya que son los auttrofos que realizan cambios importantes en los suelos al fijar en ellos el nitrgeno atmosfrico.
5 En qu se diferencia la fotosntesis de la respiracin?
Mediante la fotosntesis, los seres vivos auttrofos sintetizan materia orgnica. Mediante la respiracin, tanto los auttrofos como los hetertrofos obtienen energa de la materia orgnica.
6 La respiracin es el proceso mediante el que los
seres vivos hetertrofos obtienen energa a partir de la
materia orgnica?
La respiracin es el proceso mediante el que los seres vivos
hetertrofos obtienen energa a partir de la materia orgnica.
Pero no slo utilizan la respiracin los seres vivos hetertrofos, sino tambin los auttrofos.
7 En el siguiente dibujo haz un ciclo en que se relacionen los siguientes trminos: fotosntesis, respiracin,
energa y oxgeno.

Energa
Oxgeno

Fotosntesis
Respiracin

6CO2 + 6H2O + energa del Sol C6H12O6 + 6O2


8 Contesta a estas cuestiones:
Por lo que liberan oxgeno a la atmsfera, sta es la razn por
la que se dice que son los pulmones del planeta.
4 Hemos visto que los seres auttrofos pueden sintetizar el resto de biomolculas para vivir a partir
de la glucosa, pero adems para ello necesitan elementos qumicos como son el nitrgeno y el fsforo.
Responde:
a) Define bacterias nitrificantes y pon algn ejemplo.
Son las bacterias llamadas nitrosomas y nitrobacter encargadas de transformar el amoniaco y el amonio en nitritos y
nitratos.

116

a) A qu llamamos respiracin aerobia y respiracin


anaerobia?
La respiracin aerobia es un tipo de metabolismo energtico en el que los seres vivos extraen energa de molculas
orgnicas, como la glucosa, por un proceso complejo en el
que el carbono queda oxidado y en el que el oxgeno procedente del aire es el oxidante empleado. En la anaerobia el
oxidante no es el oxgeno, sino otra molcula; este tipo de
respiracin es tpica de bacterias.
b) Define fermentacin. Enumera algunos usos que le
da el ser humano al proceso de fermentacin.

Es un proceso anaerobio en el que el resultado es un compuesto orgnico que caracteriza cada tipo de fermentacin.
El ser humano usa la fermentacin, por ejemplo, para hacer
pan, cerveza, vino

9 Responde verdadero (V) o falso (F) a las siguientes


afirmaciones razonando en caso negativo:

a) Las relaciones trficas son las relaciones que se establecen en la naturaleza cuando los seres vivos se
alimentan de otros. VERDADERO.
b) Los animales carnvoros que se alimentan de otros
carnvoros son consumidores secundarios. FALSO: son
consumidores terciarios.
c) Los descomponedores son el nivel trfico de los hongos y las bacterias que aprovechan para alimentarse
de la materia orgnica que contienen los restos de
otros seres vivos. VERDADERO.
10 Qu tienen en comn los herbvoros y los carnvoros? En qu se diferencian los herbvoros de los omnvoros?
Los herbvoros y los carnvoros son consumidores. Los omnvoros se alimentan indistintamente de plantas y de animales,
los herbvoros, slo de vegetales.
11 Responde a las siguientes cuestiones:
a) Qu es el parasitismo?
Cuando la relacin es entre un organismo (parsito), generalmente ms pequeo, que utiliza a otro (hospedero) como
fuente de alimento (sustancias orgnicas o alimentos ingeridos) sin matarlo, al menos en forma inmediata, se la conoce
como parasitismo.
b) Qu clases de parasitismos existen?
El parasitismo puede ser de varias clases:

Ectoparasitismo.
Endoporasitismo.
Parasitismo social.

c) Pon algn ejemplo de parasitismo.


Los mosquitos.
12 Clasifica las siguientes especies en productores, consumidores primarios, consumidores secundarios, consumidores terciarios y descomponedores:

Tiburn: consumidor terciario.


Roble: productores.
Bacteria: descomponedores.
Vaca: consumidores primarios.

Zorro: consumidores secundarios.


Hombre: consumidores terciarios.
13 Define:

Cadena trfica: es un esquema sencillo que representa


las relaciones trficas.
Red trfica: surge de la representacin completa de las
relaciones trficas de un ecosistema y se trata de redes
complejas en las que una misma especie puede ocupar
ms de un nivel trfico.

14 Responde verdadero (V) o falso (F) a las siguientes


afirmaciones razonando en caso negativo:
a) En las cadenas trficas e el primer nivel siempre aparece un consumidor. FALSO. En el primer nivel siempre
aparece un productor.
b) Las relaciones trficas que se establecen en los ecosistemas son generalmente mucho ms complejas de lo
que representan en las cadenas trficas. VERDADERO.
c) Cuanto ms variada sea la alimentacin de una especie
ms probabilidades tiene de sobrevivir. VERDADERO.
15 Ordena los siguientes animales segn el nivel trfico
que ocupan:
a)
b)
c)
d)

guila.
Hoja.
Gusano.
Gorrin.

Respuesta correcta: b)-c)-d)-a).


16 Qu quiere decir que la energa circula en un nico
sentido?
Los productores transforman la energa del Sol en energa
qumica contenida en la materia orgnica y la transfieren
a los dems seres vivos. La energa del Sol fluye a travs
de las cadenas trficas de eslabn en eslabn. Finalmente, se disipa y regresa al espacio en forma de calor. Por
tanto, la energa circula en un solo sentido, del Sol a los
productores y de stos a los consumidores y descomponedores, pero no puede retornar a los productores. Por
esto decimos que los ecosistemas son sistemas abiertos
respecto a la energa.
17 Completa el prrafo sobre la energa solar que alcanza nuestro planeta:
Del total de la energa solar que alcanza nuestro planeta una
parte retorna al espacio porque es reflejada por las nubes,
por el polvo atmosfrico y por la propia superficie del globo.
Otra parte produce el calentamiento de la atmsfera, de la
hidrosfera y de la litosfera, pero retorna tambin al espacio
en forma de ondas calorficas; de otro modo el planeta se ira

117

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

calentando progresivamente. Solamente un 0,1% del total


de la energa que incide sobre la Tierra puede ser utilizada
por los productores.
18 Cules son los seres vivos capaces de captar la energa del Sol y usarla para producir materia orgnica?
Los productores.
19 Existe algn ser vivo capaz de sintetizar materia orgnica sin usar la energa luminosa? En caso afirmativo,
pon algn ejemplo.
S, ciertos grupos de bacterias.
20 Hemos visto que solamente un 0,1 % del total de la
energa del Sol que incide sobre la Tierra puede ser utilizada por los productores. Uno de los factores que influye
en esto es la capa de ozono. Responde:
a) Define capa de ozono.
Se denomina capa de ozono, u ozonosfera, a la zona de la
estratosfera terrestre que contiene una concentracin relativamente alta de ozono, gas compuesto por tres tomos
de oxgeno.
b) Qu son los rayos ultravioletas?
La radiacin ultravioleta, cuyas longitudes de onda van
aproximadamente desde los 400 nm hasta los 15 nm, es emitida por el Sol en las formas UV-A, UV-B y UV-C, pero a causa
de la absorcin por parte de la atmsfera terrestre, el 99 % de
los rayos ultravioletas que llegan a la superficie de la Tierra
son del tipo UV-A. Estos rangos estn relacionados con el
dao que producen en el ser humano. La radiacin UV-C no
llega a la tierra porque es absorbida por el oxgeno y el ozono
de la atmsfera, por lo tanto, no produce dao. La radiacin
UV-B es parcialmente absorbida por el ozono y llega a la superficie de la Tierra, produciendo dao en la piel.

118

Energa para
mantenerse

Formar
estructuras

Residuos no
digeridos

Crecer

21 Completa la siguiente tabla poniendo los consumos


correspondientes con: s (S) o no (N).

Productor

Consumidor

mal para crecer. Esta parte es la que podr ser transferida al


siguiente nivel trfico. Algo semejante ocurre en los niveles
trficos siguientes, cuando un carnvoro se come a un herbvoro o cuando un superdepredador se come a otro carnvoro. Como regla general, se puede decir que un nivel trfico
puede transmitir al siguiente nivel, como mximo, un 10 %
de la energa que asimil. Es decir, la energa se disipa a lo
largo de la cadena trfica.
23 Completa el prrafo sobre el aprovechamiento de
la energa en la cadena trfica.
Al principio de la cadena trfica hay materia orgnica suficiente para alimentar a un gran nmero de herbvoros,
pero despus de tres o cuatro transferencias slo queda la
suficiente para sostener un nmero reducido de carnvoros.
Esto puede explicar por qu la mayor parte de las cadenas
trficas tienen un nmero reducido de eslabones, generalmente menos de seis.
24 Responde a las siguientes cuestiones con verdadero
(V) o falso (F), justificando tu respuesta:
a) El trmino biomasa se usa para referirse a la materia
orgnica contenida en un nivel trfico o en un ecosistema. VERDADERO.
b) Nunca se puede dar la situacin en la que la produccin neta sea igual a cero. FALSO. Es la situacin caracterstica de los ecosistemas estables en los que la materia
orgnica que se produce es igual a la que se consume por
respiracin.
c) Que la produccin neta sea mayor que cero se presenta en ecosistemas jvenes. VERDADERO.
d) La biomasa suele expresarse en unidades de masa
por unidades de superficie. VERDADERO.
25 Define:

Biomasa: se denomina biomasa a la cantidad de materia


orgnica que contienen los seres vivos.
Produccin: el incremento de biomasa de un ecosistema
en un periodo de tiempo determinado recibe el nombre
de produccin.
Produccin neta: la produccin neta se obtiene al restar
a la produccin bruta la energa consumida en la respiracin por todos los niveles trficos.
Produccin bruta: la produccin bruta representa la
energa solar que ha sido fijada y transformada en materia orgnica por unidad de tiempo.

26 De los siguientes ecosistemas, indica cul tendra


mayor produccin neta y razona la respuesta.

22 Por qu se dice que la energa se disipa a lo largo


de la cadena trfica?

a) Bosque talado.
b) Bosque frondoso.

Cuando un consumidor primario come un productor, un 10 %


de la energa introducida puede ser aprovechada por el ani-

Tendra mayor produccin neta el ecosistema a), ya que en


los que la cantidad de materia orgnica que se produce por

fotosntesis es menor que la que se destruye por respiracin


estn en regresin. La biomasa del ecosistema disminuye.
Esta situacin suele darse en los sistemas muy explotados
por los seres humanos, como podra ser un bosque en el que
se produce una tala excesiva.

4. Consumidores terciarios
(superdepredadores)
2. Consumidores primarios (herbvoros))
3. Consumidores
secundarios (carnvoros)

27 Completa el siguiente prrafo sobre la biomasa:


Pesar todos los organismos de un nivel trfico sera imposible, por lo que las medidas de biomasa se llevan a
cabo por extrapolacin, es decir, se determina la biomasa
de una fraccin del nivel trfico y, a partir de ese valor,
se calcula la biomasa del ecosistema por unidad de superficie o por unidad de volumen, si es un ecosistema
acutico.
28 Define brevemente los siguientes trminos:

Pirmides ecolgicas: las pirmides ecolgicas son


grficas que permiten interpretar las relaciones trficas
de un ecosistema.
Pirmides de individuos: las pirmides de individuos son
proporcionales al nmero de individuos del ecosistema.
Pirmides de biomasa: en las pirmides de biomasa
el rea de cada sector es proporcional a la biomasa del
nivel trfico, por lo que representan mejor la realidad del
ecosistema.
Pirmides de produccin: en las pirmides de produccin, el rea de cada nivel trfico es proporcional a
su produccin, bruta o neta.

29 Las pirmides de biomasa pueden encontrarse invertidas alguna vez? Si la respuesta es positiva, indica
un ejemplo de ecosistema en que suceda.
La pirmide de produccin es la Fig. 7.14. b del libro del
alumno. Estas pirmides nunca se pueden presentar invertidas, ya que no representan el estado de un momento concreto del ecosistema, como las pirmides de biomasa, sino
su dinmica a lo largo de un periodo de tiempo, que suele
ser de un ao. En los ecosistemas acuticos el fitoplancton
se reproduce activamente a lo largo del ao y genera la
suficiente biomasa para sustentar a los consumidores primarios.
30 Qu son las pirmides de energa? Indica en la pirmide de energa dnde estaran situados los siguientes
niveles:
a)
b)
c)
d)

Productores.
Consumidores primarios.
Consumidores secundarios.
Consumidores terciarios.

En estas pirmides se representa la produccin neta de cada


nivel trfico; es decir, la energa que queda disponible para
el nivel trfico superior.

1. Productores (auttrofos)

31 Los productores necesitan elementos qumicos para


sintetizar la materia orgnica. Responde:
a) Cules son esos elementos qumicos?
Los elementos qumicos que usan los productores para sintetizar la materia orgnica son: C, H, O, N y P.
b) De dnde proceden esos elementos qumicos?
Proceden de molculas inorgnicas tales como el dixido
de carbono (CO2), el agua (H2O) y sales como nitratos (NO3-)
y fosfatos (PO4-) que toman de su entorno: el suelo, el aire o
el agua.
32 Responde a las siguientes cuestiones con verdadero
(V) o falso (F), justificando tu respuesta:
a) Los elementos qumicos se combinan y forman complejas molculas orgnicas. VERDADERO.
b) Las molculas orgnicas que forman son grasas y protenas. FALSO. Forman las molculas orgnicas: glcidos,
lpidos, protenas y cidos nucleicos.
c) Los elementos qumicos que forman la materia orgnica son reutilizados de manera espordica. FALSO.
Los elementos qumicos que forman la materia orgnica
son reutilizados constantemente.
33 Los seres vivos descomponedores transforman
las molculas orgnicas en molculas inorgnicas sencillas y las devuelven al entorno. Hemos visto como
ejemplos de estos seres vivos las setas y las bacterias,
pero:
a) Existen ms ejemplos de seres vivos descomponedores?
S, existen ms seres vivos descomponedores o saprfitos.
b) En caso afirmativo enumera ms ejemplos.
En este grupo estn las lombrices de tierra, cangrejos de ro,
termitas, hormigas, escarabajos.
34 Con las siguientes imgenes describe el ciclo de materia:

119

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

a)

b)

Es una protena.
Las enzimas, las hormonas
39 Define:

c)

consumidores

descomponedores

productores

35 Define brevemente los siguientes trminos:

Ciclo biogeoqumico: se denomina ciclo biogeoqumico de un bioelemento al recorrido que ste realiza en la
naturaleza desde que es incorporado por los productores
hasta que regresa al medio.
Fijacin de carbono: la fotosntesis hace posible que
los tomos de carbono de las molculas de CO2 pasen a
formar parte de las molculas del productor. Este proceso
se conoce con el nombre de fijacin del carbono.

40 Por qu se dice que las leguminosas son beneficiosas para los cultivos?
Algunos vegetales de la familia de las leguminosas tienen en
sus races unos pequeos abultamientos, llamados ndulos,
en los que albergan bacterias nitrificantes. Dichas bacterias
viven en simbiosis con el vegetal del que obtienen proteccin, mientras que la planta recibe nitratos de las bacterias.
De esta forma, las leguminosas son beneficiosas para los cultivos porque enriquecen el suelo en nitratos.

36 Puede quedarse parte del carbono temporalmente


fuera del ciclo? Razona la respuesta.

41 Responde a las siguientes cuestiones con verdadero


(V) o falso (F), justificando tu respuesta:

S, en ocasiones, una parte del carbono fijado por los vegetales puede quedar temporalmente fuera del ciclo. Esto
ocurre con el carbono de la madera de los rboles, que
est atrapado y no regresar a la atmsfera hasta que el
rbol muera y sea descompuesto. En algunas especies,
como los olivos o las secuoyas gigantes, el tomo puede
tardar miles de aos en ser liberado nuevamente a la atmsfera.

a) Los vegetales absorben el nitrgeno de la atmsfera


y lo utilizan para la sntesis de biomolculas. FALSO.
Los vegetales absorben los nitratos del suelo y utilizan el
nitrgeno en la sntesis de biomolculas.
b) Las bacterias desnitrificantes transforman parte del
nitrgeno gaseoso de la atmsfera en nitratos del suelo. FALSO. Realizan una accin contraria a las anteriores
porque transforman parte de los nitratos del suelo en
nitrgeno gaseoso que regresa a la atmsfera.
c) Los descomponedores liberan el nitrgeno de las
biomolculas convirtindolo en amoniaco que es
liberado al suelo. VERDADERO.

Pero el carbono puede quedar retenido durante periodos de


tiempo an mayores. Las molculas orgnicas que forman
el petrleo, por ejemplo, proceden de la descomposicin de
seres vivos que vivieron hace millones de aos y que desde
entonces han permanecido en el subsuelo sin incorporarse
a la atmsfera.
37 Cul es la razn por la que un atmo de carbono
que forma parte de una biomolcula de tu cuerpo, por
ejemplo, de la hemoglobina, hubiera pertenecido a un
Tyrannosaurus rex?
Porque la materia que forma los seres vivos constantemente se
reutiliza y, por lo tanto, cualquiera de los tomos que forman
parte de tus biomolculas puede haber pertenecido a otro
organismo, de cualquier poca de la historia de la Tierra.
38 Qu tipo de biomolcula orgnica es la hemoglobina? Pon algn ejemplo ms de este tipo de biomolcula.

120

Nitrgeno: el nitrgeno es un elemento indispensable


para los seres vivos porque forma parte de molculas tan
importantes como las protenas o los cidos nucleicos.
Bacterias nitrificantes: las bacterias nitrificantes transforman el amoniaco en nitratos.
Bacterias fijadoras del nitrgeno: las bacterias fijadoras
del nitrgeno son capaces de fijar el nitrgeno atmosfrico y convertirlo en nitratos.

42 Responde a las siguientes cuestiones con verdadero


(V) o falso (F), justificando tu respuesta:
a) El fsforo no existe en forma de gas, por lo que no se
encuentra en la atmsfera. VERDADERO.
b) Los descomponedores liberan el fsforo de las rocas
fosfatadas y lo convierten en fosfato que queda disponible nuevamente en el suelo para los vegetales.
FALSO. Los descomponedores liberan el fsforo de las
molculas y de los esqueletos de los animales y lo convierten en fosfato que queda disponible nuevamente en
el suelo para los vegetales.
c) El fsforo forma parte de biomolculas tan importantes como los cidos nucleicos y constituye una
porcin considerable del esqueleto de los animales.
VERDADERO.

d) El guano es un material muy rico en fsforo y nitrgeno y ha sido utilizado durante dcadas como abono
natural. VERDADERO.

La principal fuente de fsforo est en las rocas fosfatadas.


Cuando estas rocas se alteran debido a la meteorizacin, liberan fosfatos que pasan al suelo.

c) Los ciclos del carbono y el nitrgeno se ven alterados debido a la produccin y al uso de fertilizantes
artificiales en los campos de cultivo. FALSO: Los ciclos naturales del nitrgeno y del fsforo se ven alterados por los seres humanos debido a la produccin
y al uso de fertilizantes artificiales en los campos de
cultivo.
d) En la actualidad, los ciclos naturales de los bioelementos estn alterados de forma importante a causa
de la actividad humana. VERDADERO.

44 Completa el siguiente prrafo sobre el ciclo del fsforo en los ecosistemas marinos:

48 Define el trmino eutrofizacin. Cul es la causa


principal por la que se produce este fenmeno?

Una parte de los fosfatos producidos por la erosin de


las rocas es arrastrada por los ros y arroyos hasta el mar
donde puede ser captada por los productores de los ecosistemas marinos, algas y fitoplancton, y circular en un ciclo
semejante al del ecosistema terrestre o bien depositarse
en el fondo, donde puede permanecer durante millones
de aos.

El crecimiento de algas unicelulares que enturbian las aguas


y producen daos importantes en el equilibrio de los ecosistemas se conoce con el nombre de eutrofizacin. Los suelos
agrcolas a los que se les aaden los fertilizantes, ricos en
nitratos y fosfatos, son fcilmente lavados por el agua de escorrenta que disuelve los fertilizantes y los arrastra a ros y
lagos. En los ros y los lagos el exceso de nitratos y fosfatos
provoca una explosin en el crecimiento de algas unicelulares.

43 Cul es la principal fuente de fsforo? Cmo llegan


los fosfatos al suelo?

Una pequea parte de los fosfatos que llegan al mar


puede regresar a tierra cuando las aves acuticas, que se
alimentan de peces y pequeos invertebrados, defecan
en tierra. Los excrementos de las aves contienen grandes
cantidades de nitrgeno y fsforo que, una vez en el suelo, pueden ser absorbidas por los vegetales.
45 Cules son las tres formas alotrpicas en las que se
presenta el fsforo? Cules de ellas tienen importancia
a nivel industrial?
El fsforo se presenta en tres formas alotrpicas diferentes:
fsforo ordinario (o blanco), fsforo rojo y fsforo negro.
De los tres, solamente el blanco y el rojo tienen importancia
a nivel comercial.
46 Cul es la causa principal por la que se ha incrementado el efecto invernadero? Qu consecuencias lleva a
cabo este aumento?
El constante aumento de la concentracin de CO2 en la atmsfera debido a la actividad humana ha producido un incremento considerable del efecto invernadero natural, lo
que se ha traducido en un aumento de la temperatura media
del planeta y en el inicio de un cambio climtico, cuyas consecuencias pueden llegar a ser devastadoras.
47 Responde a las siguientes cuestiones con verdadero
(V) o falso (F), justificando tu respuesta:
a) Los ciclos naturales del nitrgeno y del fsforo se ven
alterados por los seres humanos. VERDADERO.
b) Los fosfatos para producir abonos se obtienen mediante extraccin minera de rocas sedimentadas.
FALSO. Los fosfatos para producir abonos se obtienen
mediante extraccin minera de rocas fosfatadas.

49 Responde a las siguientes cuestiones:


a) Qu es la lluvia cida?
La lluvia cida se forma cuando la humedad en el aire se combina con el xido de nitrgeno y el dixido de azufre emitidos por fbricas, centrales elctricas y vehculos que queman
carbn o productos derivados del petrleo. En interaccin
con el vapor de agua, estos gases forman cido sulfrico y
cidos ntricos. Finalmente, estas sustancias qumicas caen a
la tierra acompaando a las precipitaciones, constituyendo
la lluvia cida.
b) Qu efectos produce?
La lluvia cida provoca graves efectos ambientales. La
acidificacin de las aguas de lagos, ros y mares dificulta
el desarrollo de vida acutica en estas aguas aumentando en gran medida la mortandad de peces. Igualmente,
afecta directamente a la vegetacin, produciendo daos
importantes en las zonas forestales, as como acabando con
microorganismos fijadores del nitrgeno, favoreciendo la
eutrofizacin.
c) Define el trmino estrs en las plantas. Es un efecto directo o indirecto de la lluvia cida?
Un efecto indirecto muy importante es que los protones procedentes de la lluvia cida arrastran ciertos iones del suelo.
Por ejemplo, cationes de hierro, calcio, aluminio, plomo, zinc.
Como consecuencia, se produce un empobrecimiento en
ciertos nutrientes esenciales y el denominado estrs en las
plantas, que las hace ms vulnerables a las plagas.

121

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

50 De la siguiente lista de seres vivos seala cules son


auttrofos:
a)
b)
c)
d)
e)

Seta
Paramecio
Roble
Alga
Rhizobium

Respuesta correcta: c), d) y e).


51 Une con flechas los siguientes trminos:
Halcn
Vaca
Hierba
Len

Consumidor terciario
Consumidor primario
Productor
Consumidor secundario

52 Desde el punto de vista energtico, qu es ms costoso, alimentar a un halcn o a una oruga?


Un halcn, porque como regla general, se puede decir que un
nivel trfico puede transmitir al siguiente nivel, como mximo,
un 10 % de la energa que asimil. Es decir, la energa se disipa
a lo largo de la cadena trfica. Y el halcn es un consumidor
terciario, mientras la oruga es un consumidor primario.

Las lombrices, como ya hemos estudiado a lo largo de esta


Unidad, son muy beneficiosas, ya que aumentan el contenido
de nutrientes de los suelos. Por este motivo, y por algunos
ms, como el hecho de generar galeras que aumentan la
aireacin y permeabilidad del suelo, son muy beneficiosas
para la agricultura. Por lo tanto, podemos decir que suelos
con poblaciones altas de lombrices son muy frtiles donde
la productividad agrcola es elevada.
Otro aspecto relacionado con esto sera la lombricultura.
La lombricultura es una actividad que consiste en la cra de
lombrices cuya finalidad es la produccin de un abono de
muy buena calidad que se denomina humus de lombriz o
lombricompuesto. Este humus se produce de la digestin de
materiales orgnicos por parte de las lombrices y posee todas
las propiedades que tiene un suelo rico en lombrices. Este
humus es usado en agricultura, as como en el mantenimiento
de jardines ornamentales.
56 Cul de las siguientes redes trficas tiene ms posibilidades de sobrevivir?
a)

b)

53 Obtn la produccin neta del ecosistema sabiendo


los siguientes datos:
PB

3 000 kg/m al ao
2

2 550 kg/m2 al ao

Qu puedes decir sobre este ecosistema segn el resultado obtenido?


PN = 450 kg/m2 al ao.
Se trata de un ecosistema joven, en expansin, en el que se
produce ms materia orgnica de la que se consume en la
respiracin. La biomasa del ecosistema aumenta.
54 En qu tipo de pirmide ecolgica tiene el mismo
valor un rbol que una hierba? Esto qu puede dar?
En las pirmides de individuos, que son proporcionales al
nmero de individuos del ecosistema. En algunos ecosistemas terrestres, este tipo de grficas pueden tener formas paradjicas al no tener en cuenta la masa de los seres vivos.
55 Reflexiona acerca de todo lo que has aprendido durante este apartado de investigacin cientfica.
Una vez que hayas hecho esto, sabras decir qu tipo de
aspectos de la ecologa de las lombrices de tierra pueden
ser aplicados por el ser humano para obtener beneficios
econmicos? Debes pensar acerca de actividades econmicas que pudieran verse beneficiadas sustancialmente
por un enriquecimiento de los suelos.

122

La b) porque cuanto ms variada sea la alimentacin de una


especie, ms probabilidades tiene de sobrevivir, por lo que
cuanto ms compleja sea una red trfica, ms estable ser la
comunidad de organismos que representa.

ACTIVIDAD PRCTICA
a) Qu observas en la cucharilla?
En la cucharilla aparece un material negro que parece carbn.
b) Qu ha ocurrido cuando hemos quemado el azcar?
Los elementos que componen el azcar son tres: hidrgeno,
oxgeno y carbono. El hidrgeno y el oxgeno forman agua
que se evapor, y queda como residuo el carbono.

EXAMEN TIPO TEST


Marca la/s respuesta/s correcta/s en las siguientes cuestiones:

1 Para que la fotosntesis tenga lugar son precisos:


a)
b)
c)
d)

Glucosa.
Nitrgeno.
Agua.
Oxgeno.
2 Los niveles trficos son:

a)
b)
c)
d)

Productores primarios.
Superdepredadores.
Descomponedores.
Detritvoros.
3 De la energa del Sol que alcanza nuestro planeta:

a)
b)
c)
d)

Una parte retorna al espacio.


Una parte calienta la atmsfera.
Un 20 % es utilizada por los productores.
La totalidad circula en sentido nico.

4 En cules de los siguientes procesos no est implicada directamente la materia orgnica en un consumidor
primario?
a)
b)
c)
d)

Produccin de energa mediante la respiracin.


Formacin de estructuras.
Excrecin en forma de residuos no digeridos.
Crecimiento.

5 Para obtener la produccin de un ecosistema usamos los siguientes valores:


a)
b)
c)
d)

Biomasa.
Respiracin.
Produccin bruta.
Excrecin.
6 Los distintos tipos de pirmides ecolgicas son:

a)
b)
c)
d)

De poblacin.
De individuos.
De biomasa.
De produccin.

7 Los elementos qumicos que usan los productores


para sintetizar la materia orgnica son:
a)
b)
c)
d)

b) El nitrgeno de las biomolculas circula a travs de


la cadena trfica.
c) Los descomponedores liberan amoniaco.
d) Las bacterias nitrificantes liberan nitratos.
9 Los ciclos biogeoqumicos son:
a)
b)
c)
d)

Ciclo del carbono.


Ciclo del agua.
Ciclo del nitrgeno.
Ciclo del fosfato.

10 Algunas causas del impacto humano en los ciclos


biogeoqumicos son:
a)
b)
c)
d)

Los automviles.
Los fertilizantes.
Las calderas de la calefaccin.
La extraccin minera.

EXAMEN DE
DESARROLLO
1 Explica los dos grupos de seres vivos que existen
segn la manera en que consiguen la materia orgnica.
Cita los dos motivos principales por los que los seres vivos necesitan materia orgnica.
Todos los seres vivos necesitan materia orgnica por dos
motivos esenciales: porque con ella construyen su propio
cuerpo y porque la utilizan como combustible para obtener
energa.
En funcin de su manera de conseguir la materia orgnica,
los seres vivos pueden clasificarse en dos grupos: auttrofos
y hetertrofos.

Carbono.
Hidrgeno.
Fsforo.
Silicio.

La mayora de los seres vivos auttrofos sintetizan materia orgnica a partir de molculas sencillas inorgnicas
(dixido de carbono y agua) utilizando la energa del Sol.
Los vegetales, las algas y algunos grupos de bacterias son
auttrofos.
Los seres vivos hetertrofos obtienen materia orgnica a
partir de otros organismos. Los animales, los protozoos, los
hongos y algunas bacterias son hetertrofos. Los hetertrofos
dependen de los auttrofos para vivir, ya que stos son los
nicos organismos capaces de sintetizar materia orgnica.
2 Explica las relaciones trficas de:

8 En el ciclo del nitrgeno se distinguen los siguientes


procesos:

Consumidores secundarios.
Descomponedores.

a) Los vegetales usan el nitrgeno en la sntesis de biomolculas.

Consumidores secundarios (C2). El nivel est formado por los


animales carnvoros, que se alimentan de herbvoros, que a su

123

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

vez se haban alimentado de vegetales. A los consumidores


secundarios se les denomina tambin depredadores, porque
han de cazar a los animales que les sirven de alimento, que
reciben el nombre de presas.
Descomponedores (D). Es el nivel trfico de los hongos y
las bacterias que aprovechan para alimentarse de la materia orgnica que contienen los restos de otros seres vivos:
excrementos, hojas cadas, mudas, cadveres, etc. Los descomponedores tienen la capacidad de transformar la materia
orgnica nuevamente en materia inorgnica de forma que
sta queda otra vez disponible para los productores.
3 Explica cmo se distribuye la energa en el ecosistema contestando a las siguientes preguntas:

Cmo circula la energa?


Cul es el aprovechamiento de la energa?

Los productores transforman la energa del Sol en energa


qumica contenida en la materia orgnica y la transfieren
a los dems seres vivos. La energa del Sol fluye a travs
de las cadenas trficas de eslabn en eslabn. Finalmente, se disipa y regresa al espacio en forma de calor. Por
tanto, la energa circula en un solo sentido, del Sol a los
productores y de stos a los consumidores y descomponedores, pero no puede retornar a los productores. Por
esto decimos que los ecosistemas son sistemas abiertos
respecto a la energa.
Los productores utilizan la materia orgnica que sintetizan
de dos maneras distintas:

Una parte la usan como combustible para producir energa mediante la respiracin para su mantenimiento.
Otra parte, aproximadamente la mitad, la incorporan a
sus tejidos, es decir, la utilizan para formar sus estructuras
y crecer por lo que est disponible para el nivel trfico
siguiente, los consumidores primarios.

Cuando un consumidor primario come un productor, la materia orgnica que ingiere sigue diferentes caminos:

Una parte es excretada en forma de residuos no digeridos.


Otra es utilizada por el consumidor primario como fuente
de energa para su mantenimiento.
Y otra parte, que tan slo representa un 10 % de la energa introducida, puede ser aprovechada por el animal
para crecer. Esta parte es la que podr ser transferida al
siguiente nivel trfico.

Algo semejante ocurre en los niveles trficos siguientes,


cuando un carnvoro se come a un herbvoro o cuando un
superdepredador se come a otro carnvoro. Como regla general, se puede decir que un nivel trfico puede transmitir
al siguiente nivel, como mximo, un 10 % de la energa que
asimil. Es decir, la energa se disipa a lo largo de la cadena
trfica.

124

4 Explica cmo obtenemos la produccin neta de un


ecosistema y las distintas situaciones que podemos encontrar.

La produccin bruta representa la energa solar que ha


sido fijada y transformada en materia orgnica por unidad de tiempo.
La produccin neta se obtiene al restar a la produccin
bruta la energa consumida en la respiracin por todos
los niveles trficos.
Produccin neta = Produccin bruta Respiracin
(PN)
(PB)
(R)

El valor de la produccin neta vara de unos ecosistemas a


otros, pero, en general, se pueden plantear tres situaciones:
Que la produccin neta sea igual a cero:
Si PN = 0, entonces PB R = 0. Por tanto. PB = R.
Es la situacin caracterstica de los ecosistemas estables en
los que la materia orgnica que se produce es igual a la que
se consume por respiracin.
Que la produccin neta sea mayor que cero:
Si PN > 0, entonces PB R > 0. Por tanto, PB > R.
Esta situacin se presenta en ecosistemas jvenes, en expansin, en los que se produce ms materia orgnica de la
que se consume en la respiracin. La biomasa del ecosistema
aumenta.
Que la produccin neta sea menor que cero:
Si PN < 0, entonces PB R < 0. Por tanto, PB < R.
Los ecosistemas en los que la cantidad de materia orgnica que se produce por fotosntesis es menor que la que se
destruye por respiracin estn en regresin. La biomasa del
ecosistema disminuye. Esta situacin suele darse en los sistemas muy explotados por los seres humanos, como podra
ser un bosque en el que se produce una tala excesiva.
5 Explica lo que entiendes por ciclos biogeoqumicos,
respondiendo a los puntos:

Ciclos biogeoqumicos: definicin.


Ciclo del carbono.

Se denomina ciclo biogeoqumico de un bioelemento al


recorrido que ste realiza en la naturaleza desde que es incorporado por los productores hasta que regresa al medio.
El ciclo del carbono empieza cuando los seres vivos fotosintticos absorben las molculas de CO2 del aire o del agua. La
fotosntesis hace posible que los tomos de carbono de las
molculas de CO2 pasen a formar parte de las molculas del
productor. Este proceso se conoce con el nombre de fijacin
del carbono.

Un tomo de carbono fijado por un productor puede ir pasando de un nivel a otro a travs de la cadena trfica o puede
regresar al medio, ms o menos rpidamente, si alguno de los
seres vivos de la cadena utiliza la molcula que lo contiene
para producir energa mediante la respiracin.
En ocasiones, una parte del carbono fijado por los vegetales
puede quedar temporalmente fuera del ciclo. Esto ocurre con
el carbono de la madera de los rboles, que est atrapado y
no regresar a la atmsfera hasta que el rbol muera y sea

descompuesto. En algunas especies, como los olivos o las


secuoyas gigantes, el tomo puede tardar miles de aos en
ser liberado nuevamente a la atmsfera.
Pero el carbono puede quedar retenido durante periodos de
tiempo an mayores. Las molculas orgnicas que forman
el petrleo, por ejemplo, proceden de la descomposicin de
seres vivos que vivieron hace millones de aos y que desde
entonces han permanecido en el subsuelo sin incorporarse
a la atmsfera.

125

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


ACTIVIDADES
1 Responde verdadero (V) o falso (F) justificando la
respuesta:
a) Las poblaciones de los seres vivos cambian a lo largo
del tiempo exclusivamente porque unos individuos
nacen y otros mueren. FALSO. Las poblaciones, sean de
liebres, de ranas o de cualquier otro ser vivo, cambian a
lo largo del tiempo, no tan slo porque unos individuos
nacen y otros mueren, sino porque las poblaciones reaccionan frente a los cambios en el ambiente.
b) Para calcular la tasa de crecimiento de una poblacin
se debe conocer su ndice de natalidad y su ndice de
mortalidad. VERDADERO.
c) El tamao de una poblacin viene dado por el nmero de individuos que la forman. VERDADERO.
d) La capacidad de supervivencia de una poblacin depende en buena medida de su densidad. FALSO. La
capacidad de supervivencia de una poblacin depende
en buena medida de los recursos y no slo de la densidad
de poblacin.
2 Define:

Poblacin: una poblacin es un conjunto de individuos


de la misma especie que, en un momento determinado,
viven en el mismo lugar.
ndice de natalidad: el ndice de natalidad (b) de una
poblacin es el nmero de nacimientos que se producen
en un tiempo determinado. Suele referirse al periodo de
un ao y expresarse en tanto por ciento o por mil.
ndice de mortalidad: el ndice de mortalidad (d) de una
poblacin es el nmero de muertes ocurridas en un determinado periodo de tiempo. Tambin suele expresarse
en tanto por ciento o por mil, y como unidad de tiempo
se toma el ao.

3 El tamao de la poblacin de conejos en cierto bosque en 2005 fue de 1 250 individuos, al ao siguiente
subi a 10 000 individuos. Crees que esta subida de individuos puede provocar la extincin de esta poblacin?
Un nmero excesivo tambin puede ser negativo para la
poblacin porque provoca el agotamiento de los recursos
de que dispone.
4 Cules de las siguientes grficas tendra una poblacin con las condiciones ideales para su crecimiento
y creciera de manera exponencial?

126

5 Completa el siguiente prrafo sobre el clculo de la


tasa de crecimiento de las poblaciones:
Para calcular la tasa de crecimiento de algunas poblaciones, adems de su ndice de natalidad y de mortalidad,
es necesario conocer su ndice de emigracin (e), que es el
nmero de individuos que abandonan la poblacin en un
tiempo determinado, y su ndice de inmigracin (i), que es
el nmero de individuos que en un determinado periodo de
tiempo se incorporan la poblacin.
6 Define brevemente los siguientes trminos:

Potencial bitico: la tasa mxima de crecimiento de una


poblacin que se dara en condiciones ideales se denomina potencial bitico y es caracterstica de cada especie.
Capacidad de carga: el tamao mximo que puede
tener una poblacin en un ecosistema con una determinada resistencia ambiental se conoce como capacidad
de carga o capacidad de sostenimiento del medio.

7 Haz un esquema en el que representes la relacin


interespecfica que hay entre una gacela y un len. Qu
le pasa a la poblacin de gacelas si la de leones aumenta
mucho?
La poblacin de depredadores tiene una influencia negativa
sobre la poblacin de presas; cuanto mayor es el nmero de
depredadores, menor ser el de presas, por lo que disminuira la poblacin de gacelas.
8 Pueden darse en una grfica donde se represente
el sistema depredador-presa solamente picos mximos
en la poblacin de la presa? Razona tu respuesta.
No, debido a la influencia mutua, el nmero de individuos
tanto de presas como de depredadores se mantiene constante
dentro de unos valores que representan el estado de equilibrio. As, las fluctuaciones que se producen en la poblacin
de presas son compensadas por las que aparecen en la poblacin de depredadores.
Si se representa la variacin en el nmero de individuos de las
poblaciones de presas y depredadores, a lo largo del tiempo
se obtienen grficas semejantes, pero con los picos de los
mximos y los mnimos ligeramente desplazados. A un mximo en la poblacin de la presa le sigue, con un cierto retraso,
un mximo en la poblacin de depredadores. Despus de un
mnimo, en la poblacin de presas aparecer un mnimo en
la poblacin de depredadores.
9 Define el trmino biocenosis. Las nicas relaciones interespecficas que existen son las de depredador-presa?
El conjunto de todas las poblaciones de un ecosistema recibe
el nombre de comunidad o biocenosis.
No, existen ms, pero entre todas las relaciones interespecficas,
la depredacin y la competencia son las que mayor repercusin
tienen sobre el equilibrio de la mayora de los ecosistemas.

Y que los encuentros de la especie depredadora con las


especie presa eran igualmente probables.

b) Cul es la ecuacin del modelo de Volterra-Lotka?


Di lo que representa cada parmetro.
Las ecuaciones son las siguientes:
x (t) = ax (t) bx (t) y (t)
y (t) = cy (t) + dx (t) y (t)
Donde a es la tasa instantnea de aumento de presas en ausencia de depredadores; mientras que c es la tasa instantnea
per cpita de disminucin de depredadores en el caso de
ausencia de presas. Originalmente, Volterra interpret esto
diciendo que:
...los parmetros constantes a y c representan la razn de nacimiento y muerte de las dos especies; mientras que b mide la
susceptibilidad de la especie presa a la depredacin y d mide
la habilidad de depredacin de esta especie. Las constantes
b y d son la proporcin de encuentros perjudiciales para las
presas y la correspondiente de encuentros beneficios para
los depredadores, respectivamente...
c) Posteriormente formul dos leyes relacionadas con
su modelo presa-depredador. Enumralas.
Ley de conservacin de los promedios y ley de la perturbacin de los promedios.
11 Define:

Nicho ecolgico: se denomina nicho ecolgico de una especie a la funcin que sta desempea dentro del ecosistema, entendiendo como funcin el conjunto de actividades
que realiza: las poblaciones con las que interacta, de qu
se alimenta, a qu poblaciones sirve de alimento, etctera.
Equivalentes ecolgicos: las especies que ocupan idnticos nichos ecolgicos en ecosistemas distintos reciben
el nombre de equivalentes ecolgicos.
Hbitat: el hbitat es el lugar que ocupa una determinada especie en un ecosistema y puede compararse a su
domicilio.

10 Hay distintos modelos que definen el sistema depredador-presa. Uno de ellos es el modelo de VolterraLotka. Contesta:

a) Qu criterios estableci Volterra para el inicio de su


investigacin matemtica?

12 Responde verdadero (V) o falso (F) a las siguientes


afirmaciones razonando en caso negativo:

Para iniciar su investigacin matemtica estableci ciertas


cosas:
Que la especie depredadora se alimentaba exclusivamente de la especie presa, mientras que sta se alimentaba
de un recurso que se encontraba en el hbitat en grandes
cantidades, el cual slo intervena as (pasivamente).
Que ambas poblaciones eran homogneas, es decir, no
intervenan factores como la edad o el sexo.
Que, as mismo, el medio era homogneo, es decir, que
las caractersticas fsicas, biolgicas, entre otras, eran las
mismas en el hbitat.

a) Los recursos disponibles en un ecosistema, tales


como el espacio o los alimentos, no son limitados.
FALSO. Los recursos disponibles en un ecosistema, tales
como el espacio o los alimentos, son limitados.
b) En un mismo ecosistema no puede haber dos especies
que compartan exactamente el mismo nicho ecolgico porque entraran en competencia y una de ellas
acabara desplazando a la otra. VERDADERO.
c) Dos especies distintas pueden ocupar el mismo nicho
ecolgico si habitan en ecosistemas semejantes. VERDADERO.

127

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


13 Tenemos dos animales: el animal A y el animal B.
Ambos se alimentan de saltamontes. Contesta:
a) Pueden el animal A y el animal B ocupar el mismo
nicho ecolgico?
S, ya que el nicho ecolgico es el oficio que dicha especie
desempea en la comunidad.
b) Podran el animal A y el animal B habitar en un mismo ecosistema?
No, en un mismo ecosistema no puede haber dos especies
que compartan exactamente el mismo nicho ecolgico
porque entraran en competencia y una de ellas acabara
desplazando a la otra.
14 Responde:
a) Qu es competencia interespecfica y competencia
intraespecfica?
La competencia puede ser interespecfica (entre organismos
de distintas especies) o competencia intraespecfica (entre
organismos de la misma especie).
b) A qu se le conoce el principio de exclusin de Gause? De qu tipo de competencia se trata?
La competencia interespecfica tiene dos resultados posibles.
En el primero, una de las especies resulta perdedora y es
eliminada del hbitat. Esto se conoce como el principio de
exclusin de Gause. Generalmente, la especie ganadora tiene
un crecimiento ms rpido que la otra especie o tiene alguna
caracterstica que inhibe el crecimiento de la otra.
c) A veces una especie puede resultar ganadora en un
ambiente con determinadas condiciones. Este es el
caso de las especies de escarabajos Tribolium castaneum y Tribolium confusum. Indica las condiciones en
las que ganara cada una de ellas.
La especie Tribolium castaneum resulta ganadora en climas
clidos y hmedos, mientras que la especie Tribolium confusum vence en climas fros y secos. Cuando las dos especies
estn solas pueden sobrevivir en cualquier clima, as que es
el efecto del competidor el que determina la capacidad de
supervivencia en cada clima.

16 Completa el prrafo sobre el origen de las plagas:


Las plagas pueden tener su origen en un desequilibrio
del ecosistema producido por causas naturales, como una
sequa prolongada, un periodo de excesivas lluvias, etc. Sin
embargo, es muy frecuente que las plagas se produzcan como consecuencia de la actividad humana. Por ejemplo, la
drstica disminucin de las poblaciones de aves rapaces
debida a la caza incontrolada y a la destruccin de su hbitat ha producido tal proliferacin de las poblaciones de
sus presas, ratas y conejos, que, en algunos lugares, se han
convertido en plagas.
17 A qu se conoce con el trmino lucha biolgica? Pon
algn ejemplo ms de lucha biolgica.
La lucha biolgica es el control de las plagas que se realiza
en las reas agrcolas. Se caracteriza porque, a diferencia de
la lucha mediante plaguicidas, combate al insecto introduciendo en el rea algn depredador natural de estos insectos,
controlando as su crecimiento.
Como ejemplo, el tordo regula la presencia de caracoles en
cultivos.
18 Slo se pueden combatir las plagas de la agricultura con insecticidas y plaguicidas? Razona la respuesta.
Tradicionalmente, se han combatido con insecticidas y plaguicidas, que, si bien matan a los agentes responsables de
la plaga, tienen efectos nocivos para el resto los seres vivos
y para el medio ambiente.
Para evitar este problema, actualmente se tiende a controlar
las plagas mediante la denominada lucha biolgica.
19 Hemos visto que el galpago de Florida ha resultado
una plaga en nuestro pas.
a) Con qu especies de tortugas autctonas compite
provocando su desaparicin?
Galpago europeo (Emys orbicularis).
b) Define el trmino cimarrn.
Cimarrn es cualquier animal domstico que escapa de sus
amos y se asilvestra.
c) Enumera algn ejemplo ms de este tipo.

15 Define el concepto de plaga. Pon algn ejemplo


de animales que resulten una plaga en tu casa o en tu
ciudad.
Una plaga es el aumento del nmero de individuos de una
poblacin por encima de la capacidad de carga que puede
soportar el medio. Ejemplos de plaga en nuestra casa o ciudad seran las cucarachas, las ratas, las chinches

128

Los conejos, loros...


20 Define los siguientes trminos:

Sucesin ecolgica: el proceso de evolucin de un ecosistema desde sus inicios hasta que alcanza la madurez
recibe el nombre de sucesin ecolgica.

Clmax: el estadio final de la sucesin en el que el ecosistema alcanza su grado mximo de diversidad y complejidad, recibe el nombre de clmax.

21 Ordena las siguientes figuras segn las etapas de


una sucesin primaria:

Regresin ecolgica: las regresiones ecolgicas son


alteraciones de los ecosistemas que suponen una vuelta
atrs en la sucesin, es decir, que conducen a estadios de
menor diversidad y complejidad.

25 De los siguientes animales, indica cules son estrategas de la r y cules, estrategas de la k:


a)
b)
c)
d)

Elefante.
Ratn.
Conejo.
Gato.

Respuesta correcta: b) y c) son estrategas de la r, mientras a)


y d) son estrategas de la k.

Respuesta correcta: d), b), c), e) y a).


22 Relaciona con flechas los siguientes trminos:
Arbustos
Ciprs
Musgo
Roca madre
Hierba

Etapa 4
Etapa 5
Etapa 2
Etapa 1
Etapa 3

23 Responde a las siguientes cuestiones con verdadero


(V) o falso (F), justificando la respuesta:
a) En los primeros estadios de la sucesin predominan
los seres vivos llamados estrategas de la k. FALSO. En
los primeros estadios de la sucesin predominan los seres
vivos llamados estrategas de la r.
b) Aunque puede ser por causas naturales, la mayor parte de las regresiones actualmente, tienen relacin
con la actividad humana. VERDADERO.
c) Las regresiones ecolgicas conducen a estadios de
mayor diversidad y complejidad. FALSO. Las regresiones ecolgicas conducen a estadios de menor diversidad
y complejidad.
d) Una isla volcnica o una duna recin formada son
ejemplos de sucesin secundaria. FALSO. Una isla
volcnica o una duna recin formada son ejemplos de
sucesin primaria.
24 Define:

Sucesin primaria: cuando una sucesin se establece


a partir de la roca madre, en un terreno sin seres vivos,
como pueden ser una isla volcnica o una duna recin
formada, se denomina sucesin primaria.
Sucesin secundaria: cuando la sucesin se establece
sobre un terreno previamente colonizado, como puede
ser un campo de cultivo abandonado, recibe el nombre
de sucesin secundaria.

26 Completa el siguiente prrafo sobre las malas


hierbas:
Las llamadas malas hierbas que invaden los campos de cultivo o los jardines abandonados son estrategas de la r. Son
especies que basan su supervivencia en la produccin de un
gran nmero de descendientes en muy poco tiempo.
27 La meteorizacin es la desintegracin y descomposicin de una roca en la superficie terrestre o prxima a
ella, como consecuencia de su exposicin a los agentes
atmosfricos, con la participacin de agentes biolgicos.
Responde a las siguientes cuestiones:
a) Enumera los distintos tipos de meteorizacin que
hay.
Fsica, qumica y biolgica.
b) Qu es la termoclastia? A qu tipo de meteorizacin
pertenece? Indica en qu ecosistemas suele darse.
Termoclastia es la fisura de las rocas aflorantes como consecuencia de la diferencia de temperatura entre interior y
superficie.
La diferencia trmica da-noche es la causa. Durante el da,
al calentarse, la roca se dilata. Sin embargo, por la noche, al
enfriarse, se contrae. Al cabo de un tiempo acaba rompindose. Es un tipo de meteorizacin fsica.
Este tipo de meteorizacin es importante en climas extremos
con gran oscilacin trmica entre el da y la noche (como el
desierto).
c) Define el trmino hidrlisis, se trata de una meteorizacin fsica?
Es la rotura en la estructura de algunos minerales por la accin de los iones de H+ y OH- de agua, fundamentalmente en
la meteorizacin del feldespato.

129

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


d) Enumera algunos animales que favorezcan la meteorizacin.
Las lombrices de tierra, las hormigas, los topos
28 De los siguientes trminos, seala cules favorecen
los incendios:
a)
b)
c)
d)

Altas temperaturas.
Inexistencia de viento.
Zonas llanas.
rboles como los pinos.

Respuesta correcta: a) y d).


29 Por qu se dice que un incendio es difcil de controlar una vez se ha declarado?
Porque las altas temperaturas que generan resecan la vegetacin prxima al foco del incendio y, cuando las llamas la
alcanzan, arde con mucha facilidad.
30 El ser humano ha creado distintos mtodos para prevenir la propagacin de los incendios. Uno de ellos son
los cortafuegos. En qu consiste un cortafuego?
Un cortafuego es un impedimento para que se extienda el
fuego en el campo, consistente en una franja de terreno sin
vegetacin.
31 La mayora de los incendios forestales que suceden
en la actualidad han sido provocados. Responde:
a) Cules son las causas ms frecuentes de incendios?
Algunas de las causas ms frecuentes de incendios son:

La quema de rastrojos sin control que llevan a cabo algunos agricultores y ganaderos.
Las fogatas que se realizan en el campo, en lugares poco
apropiados y sin que los responsables se aseguren de
que quedan totalmente apagadas despus de su utilizacin.
Las colillas sin apagar que se lanzan desde los coches.

b) Cules son los orgenes de los incendios provocados


voluntariamente?
Los incendios provocados voluntariamente son cada vez
ms frecuentes y llegan a superar, en los ltimos aos, a los
provocados de forma involuntaria. Suelen tener su origen en
intereses econmicos y en la especulacin inmobiliaria.
32 Responde a las siguientes cuestiones con verdadero
(V) o falso (F), justificando tu respuesta:
a) La destruccin de la flora en los incendios no es total,
ya que siempre sobreviven los tallos subterrneos y

130

las semillas de las plantas. FALSO. La destruccin de la


vegetacin es total, aunque las races, los tallos subterrneos y las semillas de algunas plantas pueden sobrevivir
y rebrotar o germinar cuando se alcanza la humedad necesaria.
b) Como consecuencia de la desaparicin de la cubierta vegetal el suelo pierde su cohesin acelerando su
degradacin. VERDADERO.
c) Muchos de los animales que forman parte del ecosistema logran huir. FALSO. Muchos animales que forman
parte del ecosistema mueren, y los que consiguen escapar pueden morir tambin si no encuentran un hbitat
semejante al que abandonaron.
d) La mejor manera de luchar contra los incendios es
evitarlos. VERDADERO.
33 Indica si los siguientes fenmenos u objetos representan causas naturales o provocadas por el ser humano
en caso de un incendio:
a) Un rayo. Causas naturales, el resto son causas de incendios cuyo origen es el ser humano.
b) Un cristal en un bosque. Causa de incendio cuyo origen
es el ser humano.
c) Una hoguera. Causa de incendio cuyo origen es el ser
humano.
34 Define brevemente el trmino adaptacin.
Las adaptaciones son las modificaciones anatmicas, fisiolgicas o de comportamiento que experimentan los seres
vivos para adecuarse a las condiciones fsico-qumicas del
medio que les rodea.
35 Los seres vivos y el medio en el que se desenvuelven
interaccionan continuamente? Razona la respuesta.
Los seres vivos y el medio en el que se desenvuelven interaccionan continuamente:

Las caractersticas del medio influyen sobre los seres


vivos, de tal manera que condicionan su anatoma, su
fisiologa y su comportamiento.
Los organismos, por su parte, ejercen su influencia sobre el
medio modificando las condiciones fsico-qumicas de ste.

36 Cul es la causa por la que se encuentran diferencias anatmicas entre los animales acuticos y los
terrestres?
La notable desigualdad entre la densidad del agua y del aire,
por ejemplo, es la responsable de muchas de las diferencias
anatmicas entre los animales acuticos y los terrestres.
37 Hemos visto que el pez Bothus podas cambia el color
de su piel y se adapta a la coloracin del fondo para pasar
desapercibido. Responde:

a) Existe un reptil muy conocido que tambin posee


esta capacidad. Sabes cul es?
El camalen.
b) Este cambio de color es provocado por la proximidad
de un adversario, pero puede darse por alguna condicin ms?
Tambin se debe por condiciones fisiolgicas relacionadas
con la temperatura o la hora del da, tambin el cambio de
color tambin tiene un papel importante en la comunicacin
durante las luchas entre camaleones: los colores indican si el
oponente est asustado o furioso.
c) Enumera las clulas pigmentarias que provocan este
cambio de color.
Cromatforos, melanforos y guanforos.
38 Por qu los animales acuticos han desarrollado
formas hidrodinmicas?
La elevada densidad del agua condiciona enormemente el
movimiento de los animales en su seno. Por este motivo, la
mayora de los animales acuticos han desarrollado formas
hidrodinmicas que reducen el rozamiento y extremidades
en forma de aletas, cuya funcin no es sostener el cuerpo,
sino impulsarles y dirigir el movimiento.
39 Indica cmo modifica las caractersticas fsico-qumicas una encina.
A travs de las hojas, aportan oxgeno y vapor del agua a la
atmsfera. Las races disgregan las rocas, retienen el agua
de lluvia y aumentan la aireacin y la cohesin del suelo.
Las copas de los rboles actan como una gran cubierta que
amortigua los cambios de temperatura y dificulta la llegada
de la luz al suelo.
40 Completa el siguiente prrafo sobre las adaptaciones al medio terrestre:
En el medio terrestre, sin embargo, la baja densidad del
aire obliga a la mayora de los seres vivos a vivir sobre el suelo
y condiciona la anatoma de los animales que, en su mayora,
han desarrollado potentes extremidades que los sostienen
y permiten su desplazamiento.
41 Responde a las siguientes cuestiones con verdadero
(V) o falso (F), justificando tu respuesta:
a) Las bacterias, a diferencia de los hongos, descomponen la materia orgnica y enriquecen el suelo con
amoniaco y sales. FALSO. Los hongos y las bacterias
descomponen la materia orgnica y enriquecen el suelo
en amoniaco y sales, como nitratos y fosfatos.

b) Los excrementos de los animales aportan material


orgnica al suelo. VERDADERO.
c) La densidad del agua es menor que la del aire. FALSO.
La densidad del agua es mayor que la del aire.
42 Hemos visto que los peces han desarrollado formas
hidrodinmicas para reducir el rozamiento y extremidades en forma de aleta para poder desplazarse en el medio acutico. Algunos de estos animales tambin poseen
la llamada vejiga natatoria. Responde:
a) Qu es la vejiga natatoria?
La vejiga natatoria es un rgano de flotacin que poseen
muchos peces.
b) Cul es su funcin?
Controla la flotabilidad mediante un complejo sistema de intercambio gaseoso con la sangre y permite al pez ascender o
descender en el agua sin necesidad de utilizar la musculatura.
c) Qu ocurre cuando la vejiga natatoria se desinfla?
Cuando expulsa gases por compresin muscular, aumenta el
peso especfico del pez, facilitando su descenso en el agua.
43 Por qu las cianobacterias han sido tan importantes
para la historia de nuestro planeta?
En la historia de nuestro planeta, las cianobacterias han jugado un papel muy importante. La composicin qumica de
la atmsfera que disfrutamos actualmente todos los seres
vivos ha sido gracias a ellas. Las cianobacterias fueron los
primeros organismos fotosintticos que habitaron la Tierra.
De esto hace 2 500 millones de aos.
Debido a su actividad fotosinttica, estos organismos comenzaron a liberar oxgeno a la atmsfera, lo que supuso
la desaparicin de los organismos anaerobios o su reclusin
en aquellos lugares donde el oxgeno no les alcanzase. Por
otro lado, el hecho de que la atmsfera estuviera compuesta
de oxgeno en un porcentaje elevado hizo que aparecieran
organismos que utilizaban ese oxgeno en sus reacciones
metablicas. Esto hizo posible la evolucin de los seres vivos
hasta las formas de vida que hoy conocemos.
44 Explica los cambios que el ser humano genera en el
medio ambiente y las repercusiones que dichos cambios
tienen sobre el resto de los seres vivos.
Actualmente, la especie humana es la que tiene una mayor
capacidad de modificar el entorno. Somos responsables
del vertido de sustancias contaminantes a los mares, aguas
continentales, suelos y atmsfera. Estas sustancias son muy
variadas, desde petrleo o sus derivados a gases de efecto
invernadero como los CFC, que provocan la destruccin de
la capa de ozono.

131

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


Los enormes cambios ambientales producidos por el ser humano alteran gravemente el equilibrio de los ecosistemas y
provocan la extincin de muchas especies que no son capaces de adaptarse a dichos cambios en un espacio de tiempo
tan reducido.
45 Piensa en una especie cualquiera de ser vivo y detalla alguna de las repercusiones que su actividad vital
tiene sobre las condiciones medioambientales.
Podemos pensar, por ejemplo, en un ciervo. Los vertebrados
terrestres, como es el caso del ciervo, toman gran cantidad de
oxgeno mientras respiran. Por lo tanto, estn disminuyendo
la concentracin de oxgeno en la atmsfera. Este oxgeno lo
utilizan en sus actividades metablicas generndose importantes cantidades de CO2 que es liberado a la atmsfera.
Junto a esto, podemos destacar tambin sus repercusiones
sobre las caractersticas del suelo en el que habitan. Los excrementos de estos animales son depositados en el suelo, por
lo que una vez que se descomponen varan las caractersticas
fsico-qumicas de dicho suelo.
46 Ordena de mayor a menor grado de proteccin las
siguientes figuras correspondientes a espacios naturales
protegidos:
a)
b)
c)
d)
e)
f)
g)

Parque Natural.
Paisaje Protegido.
Parque Nacional.
Paraje Natural.
Parque Regional.
Monumento Natural.
Reserva Natural.

Respuesta correcta: c), a), e), d), b), f), g).


47 Completa el siguiente prrafo acerca de la teora de
la conservacin ex situ.
La conservacin ex situ se realiza fuera del hbitat natural
de la especie. Los zoolgicos y acuarios poseen instalaciones dedicadas a la conservacin de los animales. Del
mismo modo que los jardines botnicos para las especies
vegetales. La intencin de estos programas es reproducir
en cautividad animales en peligro de extincin con el
fin de recuperar sus poblaciones. Entre las especies de
vertebrados ms amenazadas de la pennsula Ibrica se
encuentran: el urogallo, el quebrantahuesos y el guila
imperial.
48 Define brevemente los siguientes trminos:

132

Conservacin ex situ: la que se lleva a cabo fuera del hbitat


natural de la especie, normalmente en zoolgicos, acuarios
y jardines botnicos, en un intento de salvar de la extincin
inminente a ciertas especies animales y vegetales.
Programa de cra en cautividad: proyecto consistente
en reproducir animales en instalaciones para ello, con el

fin de reintroducirlos en su hbitat natural e incrementar


el tamao de sus poblaciones.
Banco de semillas: coleccin de semillas desecadas, en
un ambiente de muy baja humedad y temperatura. Con
ellos se pretende que en caso de que una especie vegetal
se extinga pueda ser regenerada a travs de sus semillas
y reintroducidas en su ambiente natural.

49 En la sabana africana existen los siguientes animales


ramoneadores que se alimentan de ramas:

Las jirafas.
Los antlopes.
Los rinocerontes.
Los antlopes dik-dik.

A pesar de compartir el mismo hbitat y nicho ecolgico


no tienen competencia. Responde:
a) A qu es debido?
A que han desarrollado adaptaciones selectivas que han
posibilitado la coexistencia de estas especies en el mismo
hbitat.
b) Explica el porqu de este hecho.
Se reparten el alimento de esta forma:
Jirafas: ramas mas altas, a 3-4 m suelo
Antlopes: ramas intermedias
Rinocerontes: ramas ms bajas, a 1 m del suelo
Antlope dik-dik: brotes, ramitas nuevas, vainas con semilla.
50 Si una poblacin tiene una curva de crecimiento exponencial, contesta estas cuestiones:
a) Puede darse esta curva de crecimiento en condiciones normales en la naturaleza?
Esta curva de crecimiento solamente se da cuando existen las
condiciones ideales de la poblacin, sin lmites de recursos.
Este caso no se da en la naturaleza.
b) Pon algn ejemplo de poblacin que pueda tener
esta curva de crecimiento.
Estas curvas se dan en laboratorios. Por ejemplo, en cultivos
de bacterias.
51 Si la poblacin de bhos de una regin determinada
aumentara de una manera significativa, responde:
a) Afectara a la poblacin de ratones? En qu medida?
Los bhos son depredadores de los ratones, por lo que este aumento afectara a la poblacin de ratones hacindola disminuir.

b) En caso positivo, cul es la causa?


Se debe al sistema depredador-presa; existe una retroalimentacin negativa: un aumento en la poblacin de depredadores
tiene una influencia negativa sobre la poblacin de presas.
52 El trmino hbitat es un sinnimo de ecosistema?
Razona la respuesta.
No, el hbitat es el lugar que ocupa una determinada especie
en un ecosistema.
53 Jaime cultiva limoneros y tiene una plaga de cochinilla de los ctricos (Iverva purchasy). Jaime quiere erradicar
esta plaga, pero no sabe si usar un plaguicida o introducir
en los cultivos la mariquita Verdalia cardinales. Qu le
recomendaras? Qu ventajas tiene cada una de ellas?
Recomendara a Jaime el uso de la mariquita Verdalia cardinales. Con un plaguicida Jaime matara todas las cochinillas
y erradicara la plaga, pero su uso tiene efectos nocivos para
el resto de seres vivos y el medio ambiente que se evitan si
usa la mariquita Verdalia cardinales, que no erradicara por
completo la plaga, pero controlara su poblacin.
54 En cierto bosque ha cado un rayo, lo que ha producido un incendio.
a) Qu ha causado este incendio en la evolucin del
ecosistema?
Ha causado una regresin que supone la vuelta atrs en la sucesin del bosque, es decir, menos diversidad y complejidad.
b) Puede recuperarse este bosque?
El bosque puede reanudar su evolucin iniciando una sucesin secundaria siempre y cuando no haya habido prdida
del suelo.
55 Por qu cuando introducimos un pez de agua dulce
en agua salada se muere y viceversa?
Aunque un pez de agua dulce est adaptado a vivir en el
medio acutico, dentro de ste hay distintos tipos entre
ellos: agua dulce y agua salada. Por tanto, estos peces han
adaptado su sistema osmtico, y estas adaptaciones son las
causantes de que no puedan sobrevivir.

a)
b)
c)
d)

Densidad.
ndice de mortalidad.
Tamao.
ndice de inmigracin.

2 Las relaciones interespecficas que mayor repercusin tienen sobre el equilibrio de los ecosistemas son:
a)
b)
c)
d)

Parasitismo.
Competencia.
Depredacin.
Inmigracin.

3 El proceso de la sucesin ecolgica comprende las


siguientes etapas:
a)
b)
c)
d)

Meteorizacin de la roca madre.


Clmax.
Nitrificacin.
Primeros colonizadores

4 Cules de los siguientes trminos no son causas de


regresiones ecolgicas?
a)
b)
c)
d)

Reforestacin.
Sistema depredador-presa.
Incendios forestales.
Introduccin de especies exticas.

5 Algunos de los principales factores que favorecen


los incendios son:
a)
b)
c)
d)

Plagas.
Zonas montaosas.
Viento.
Zonas llanas.

6 Los seres vivos para adecuarse a las condiciones


fsico-qumicas del medio que les rodea experimentan
modificaciones:
a.
b.
c.
d.

Ecolgicas.
Anatmicas.
Fisiolgicas.
De comportamiento.

7 La aparicin de las cianobacterias hace 2 500 millones de aos provoc:

Marca la/s respuesta/s correcta/s en las siguientes cuestiones:

a) Aparicin de oxgeno en la atmsfera.


b) Desaparicin de microorganismos anaerobios.
c) Desplazamiento de microorganismos anaerobios a
lugares donde no hay oxgeno.
d) Regresin.

1 Los factores que intervienen en el crecimiento de


las poblaciones son:

8 Las estrategias para preservar animales y vegetales


en peligro de extincin son:

EXAMEN TIPO TEST

133

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


a)
b)
c)
d)

Conservacin in situ.
Conservacin ex situ.
Zoolgicos.
Espacio natural.
9 Algunos ejemplos de conservacin ex situ son:

a)
b)
c)
d)

Bancos de semillas.
Parques naturales.
Acuarios.
Prevencin de incendios forestales.

10 Medidas para la lucha de plagas son:


a)
b)
c)
d)

Insecticidas.
Lucha biolgica.
Plaguicidas.
Especies introducidas.

EXAMEN DE
DESARROLLO
1 Explica el sistema depredador-presa. Cules son
las caractersticas de las poblaciones?
Entre los depredadores y las presas de un ecosistema se
establece un tipo de interaccin que puede representarse
mediante un circuito de retroalimentacin negativa como
el siguiente:
La poblacin de presas influye positivamente sobre la poblacin de depredadores, es decir, a mayor nmero de presas habr mayor nmero de depredadores. En cambio, la
poblacin de depredadores tiene una influencia negativa
sobre la poblacin de presas; cuanto mayor es el nmero de
depredadores, menor ser el de presas.
Debido a la influencia mutua, el nmero de individuos de
presas y de depredadores se mantiene constante dentro de
unos valores que representan el estado de equilibrio. As,
las fluctuaciones que se producen en la poblacin de presas
son compensadas por las que aparecen en la poblacin de
depredadores.
Si se representa la variacin en el nmero de individuos de las
poblaciones de presas y depredadores a lo largo del tiempo,
se obtienen grficas semejantes, pero con los picos de los
mximos y los mnimos ligeramente desplazados. A un mximo en la poblacin de la presa le sigue, con un cierto retraso,
un mximo en la poblacin de depredadores. Despus de un
mnimo en la poblacin de presas aparecer un mnimo en
la poblacin de depredadores.
El tamao de una poblacin viene dado por el nmero de
individuos que la forman. La capacidad de supervivencia
de una poblacin depende en buena medida de su tamao.

134

Un nmero demasiado bajo puede conducir a su extincin;


pero un nmero excesivo tambin puede ser negativo para
la poblacin, porque provoca el agotamiento de los recursos
de que dispone.
La densidad de poblacin es el nmero de individuos
de una poblacin por unidad de superficie o de volumen
en un momento dado. Es un parmetro que aporta ms
informacin que el tamao, ya que es muy diferente. Por
ejemplo, una poblacin de 1 000 liebres en 1 hectrea o
en 100 hectreas.
2 Responde lo que sepas acerca de las plagas, desarrollando especialmente los siguientes puntos:

Definicin.
Origen.
Lucha biolgica.

Una plaga es el aumento del nmero de individuos de una


poblacin por encima de la capacidad de carga que puede
soportar el medio.
Las plagas pueden tener su origen en un desequilibrio del
ecosistema producido por causas naturales, como una sequa prolongada, un periodo de excesivas lluvias, etc. Sin
embargo, es muy frecuente que las plagas se produzcan
como consecuencia de la actividad humana. Por ejemplo,
la drstica disminucin de las poblaciones de aves rapaces, debida a la caza incontrolada y a la destruccin de su
hbitat, ha producido tal proliferacin de las poblaciones
de sus presas, ratas y conejos, que, en algunos lugares,
se han convertido en plagas. Las especies introducidas,
voluntaria o involuntariamente, acaban muchas veces convirtindose en plagas porque, al carecer de depredadores
naturales en el ecosistema, crecen sin control. Es el caso
del galpago de Florida, una tortuga de origen americano
que se comercializa en nuestro pas como mascota. Muchos ejemplares de este animal han llegado a nuestros ros
y humedales cuando sus propietarios, cansados de ellas,
las han liberado y, hoy da se han convertido en una plaga
difcil de erradicar.
Las plagas de la agricultura estn producidas, generalmente,
por el crecimiento incontrolado de poblaciones de insectos
o de sus larvas, debido a la gran cantidad de recursos disponibles. Tradicionalmente, se han combatido con insecticidas
y plaguicidas, que, si bien matan a los agentes responsables
de la plaga, tienen efectos nocivos para el resto los seres
vivos y para el medio ambiente. Para evitar este problema,
actualmente se tiende a controlar las plagas mediante la denominada lucha biolgica.
Este sistema no persigue destruir totalmente a los agentes
causantes de la plaga, sino controlar el crecimiento de la poblacin mediante sus depredadores naturales. Por ejemplo,
se lucha contra la cochinilla de los ctricos (Iverva purchasy)

con la introduccin en los cultivos de una mariquita (Verdalia


cardinalis) que se alimenta de la cochinilla.
3 Contesta a los siguientes puntos acerca del concepto
de sucesiones ecolgicas:

Proceso.
Tendencias.

Una sucesin ecolgica tiene lugar en una serie de etapas


durante las cuales unas comunidades van siendo sustituidas por otras. Los seres vivos de las primeras etapas de la
sucesin modifican las caractersticas de su entorno y lo van
haciendo ms adecuado para que en l se establezcan otras
especies, describiendo un proceso que podramos resumir
en 5 puntos:
1. Se produce la meteorizacin de la roca madre por los
agentes atmosfricos. La lluvia, los continuos cambios
de temperatura, el efecto cua del hielo, etc., disgregan
la roca y la hacen apta para acoger los primeros vegetales.
2. Los primeros colonizadores son los lquenes y los musgos, que retienen las partculas del suelo incipiente y contribuyen al proceso de meteorizacin de la roca.
3. Cuando hay suelo suficiente se establecen las primeras
plantas herbceas. Se trata de especies oportunistas de
escasa biomasa y crecimiento rpido que, en poco tiempo, colonizan el terreno. Junto con las plantas aparecen
los primeros herbvoros y sus depredadores.
4. Las plantas herbceas son sustituidas, de forma gradual,
por otras de mayor biomasa y reproduccin ms lenta, es
decir, por las primeras matas y arbustos. Asociados a estos
vegetales aparecen nuevos herbvoros y carnvoros, generalmente de mayor tamao que los de la etapa anterior.
5. Finalmente aparecen los rboles de crecimiento lento que
requieren unas condiciones de humedad o de profundidad del suelo, por ejemplo, que previamente no existan.
El estadio final de la sucesin, en el que el ecosistema alcanza su grado mximo de diversidad y complejidad, recibe el
nombre de clmax. La comunidad clmax que se establece
finalmente en un lugar depende del tipo de terreno y del
clima de la regin. En las regiones polares o en las regiones
ridas del continente africano una sucesin nunca culminar
en un bosque.
A lo largo de la sucesin, el nmero de individuos y de especies
aumenta gradualmente, es decir, en las ltimas etapas aumenta la diversidad. El ecosistema se hace ms complejo porque se
establecen mltiples relaciones entre las distintas poblaciones
y, como consecuencia de ello, se hacen ms estables.

En los primeros estadios de la sucesin predominan los


seres vivos llamados estrategas de la r. Son organismos
con una tasa de reproduccin elevada y poca biomasa,
adaptados a vivir en ambientes inestables.

En las fases finales, sin embargo, predominan los denominados estrategas de la k. Estos organismos son de crecimiento lento, generan pocos descendientes y tienen un
gran desarrollo. Son caractersticos de ambientes estables.

4 Explica los factores que favorecen los incendios. Cita


algunas de las causas ms frecuentes de incendios.
Los principales factores que favorecen los incendios son las
condiciones atmosfricas, el tipo de vegetacin y el relieve.

Las condiciones atmosfricas: las precipitaciones, la


temperatura, la humedad y el viento pueden favorecer
o dificultar el inicio y la propagacin de un incendio. En
general, los incendios se producen en verano, cuando
no hay apenas precipitaciones, el calor es elevado y, por
lo tanto, el bosque est reseco. El viento contribuye a
la propagacin del incendio porque aviva las llamas y
arrastra rescoldos que pueden encender el fuego en
otros lugares.
El tipo de vegetacin: algunos rboles, como los pinos,
facilitan la propagacin del fuego porque producen aceites y resinas muy combustibles.
El relieve: en los terrenos llanos el fuego avanza ms
lentamente que en las zonas montaosas, y, en stas,
la velocidad de propagacin es ms rpida en direccin
ascendente que en direccin descendente.

Algunas de las causas ms frecuentes de incendios son:

La quema de rastrojos sin control que llevan a cabo algunos agricultores y ganaderos.
Las fogatas que se realizan en el campo, en lugares poco
apropiados y sin que los responsables se aseguren de
que quedan totalmente apagadas despus de su utilizacin.
Las colillas sin apagar que se lanzan desde los coches.

5 Acerca de la proteccin de la naturaleza, explica qu


es cada uno de estos puntos:

Conservacin in situ.
Conservacin ex situ.

La conservacin in situ es la mejor manera de conservar la


diversidad biolgica, ya que se protegen, no slo determinadas especies, sino los espacios en los que estas especies
habitan de forma natural.
En nuestro pas existen varias categoras de proteccin para
los espacios naturales, la mxima corresponde a los Parques
nacionales. En stos, adems de proteger la vida silvestre,
se llevan a cabo programas de recuperacin de especies en
peligro de extincin y campaas de concienciacin de la poblacin sobre la necesidad de proteger los seres vivos y su
medio ambiente.

135

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


La conservacin ex situ se lleva a cabo fuera del hbitat natural de la especie, normalmente en zoolgicos,
acuarios y jardines botnicos, en un intento de salvar
de la extincin inminente a ciertas especies animales y
vegetales.
En muchos zoolgicos y acuarios y en las instalaciones de
algunos Parques Naturales se llevan a cabo programas
de reproduccin de animales en peligro de extincin, con

136

la intencin de reintroducirlos posteriormente en su hbitat


natural e incrementar el tamao de sus poblaciones.
En nuestro pas, en el centro El Acebuche del Parque Nacional de Doana, por ejemplo, se est llevando a cabo un programa de cra en cautividad del lince ibrico (Lynx pardinus), con
el fin de recuperar sus poblaciones naturales. El lince ibrico se
considera la especie de felino ms amenazada del mundo, pues,
en estado salvaje, quedan apenas unos 200 ejemplares.

LA EVOLUCIN DE LOS SERES VIVOS


ACTIVIDADES
1 Responde verdadero (V) o falso (F) justificando la
respuesta:
a) La evolucin comenz hace unos 3 000 millones de
aos, en el mismo momento en que los seres vivos
aparecieron sobre la Tierra. FALSO. La evolucin comenz hace unos 3 800 millones de aos, en el mismo
momento en que los seres vivos aparecieron sobre la
Tierra.
b) La evolucin es una propiedad de los seres vivos y no
se ha detenido jams. VERDADERO.
c) Los fsiles constituyen una de las pruebas ms contundentes en favor de la evolucin de los seres vivos
porque demuestran que los organismos que vivieron
en pocas geolgicas pretritas son distintos a los
actuales. VERDADERO.
d) Tiktaalik es una pieza clave en la evolucin de los tetrpodos. VERDADERO.
2 Cita algunas de las pruebas que demuestran la existencia de la evolucin.
La evolucin es un proceso natural que no puede ser comprobado directamente porque no podemos volver atrs
en el tiempo y ver qu ocurri. Pero existen multitud de
pruebas que demuestran su existencia, algunas de stas
las obtenemos del estudio de los fsiles, la anatoma
comparada, el desarrollo embrionario de los animales,
la bioqumica y la biologa molecular, y, por ltimo, de la
biogeografa.
3 Rellena el siguiente prrafo con las palabras que
faltan.
En 2004 se descubrieron en la isla Ellesmere, al norte de
Canad, los restos fsiles, en un excelente estado de conservacin, de un pez que vivi hace unos 375 millones
de aos. Este animal, al que se le ha denominado Tiktaalik roseae, tena caractersticas anatmicas propias de
los tetrpodos, por lo que su hallazgo ha contribuido
a esclarecer la evolucin de los anfibios a partir de los
peces.
4 Hemos visto que los fsiles son pruebas de la existencia de la evolucin. En algunos casos se encuentran
eslabones perdidos entre dos grandes grupos de seres
vivos, este es el caso del Archaeopterix. Por qu decimos
que el Archaeopterix es una forma intermedia?
Algunos fsiles que presentan caractersticas intermedias
entre dos clases diferentes de seres vivos actuales, como es
el caso del fsil Archaeopterix, que presenta una forma intermedia entre los reptiles y la de las aves actuales, lo que nos
indica que las aves actuales provienen del resultado de la
evolucin de los antiguos reptiles.

5 De los siguientes animales indica cules poseen rganos homlogos:


a)
b)
c)
d)

guila.
Liblula.
Ballena.
Caballo.

Respuesta correcta: b), c) y d).


6 Define:

rganos homlogos: los rganos de diferentes seres


vivos que son semejantes porque tienen su origen en
un antepasado comn, reciben el nombre de rganos
homlogos.
rganos anlogos: rganos que son semejantes porque cumplen la misma funcin, pero tienen un origen
distinto. Por este motivo reciben el nombre de rganos
anlogos.

7 Por qu podemos decir que los reptiles evolucionaron a partir de los tetrpodos?
La presencia de los huesos de las caderas en las serpientes,
por ejemplo, cobra sentido al suponer que estos animales,
como el resto de los reptiles, evolucionaron a partir de primitivos tetrpodos en los que dichos huesos sostenan las
extremidades posteriores.
8 La estructura de una extremidad de un len presenta semejanza con el ala de un buitre. Qu implica
esto?
En los vertebrados terrestres, por ejemplo, la disposicin de
los huesos en las extremidades responde a un mismo patrn,
lo que sugiere que los vertebrados evolucionaron a partir de
un antepasado comn que posea esa disposicin sea. Las
diferencias en la estructura de las extremidades responden
a las posteriores adaptaciones evolutivas a distintas formas
de locomocin.
9 Pablo y David estn haciendo un trabajo sobre rganos homlogos y tienen un problema. Poseen tres tipos
de alas: una de un ave, otra de una mosca y otro de un
murcilago y no saben si son o no rganos homlogos.
Ayuda a Pablo y a David a terminar el trabajo.
Son rganos homlogos el ala del ave y la del murcilago. El
ala de la mosca es un rgano anlogo de los otros dos.
10 Responde verdadero (V) o falso (F) a las siguientes
afirmaciones razonando en caso negativo:
a) Las diferencias anatmicas entre los diferentes
grupos de animales vertebrados son poco notorias.
FALSO. Las diferencias anatmicas entre los diferentes
grupos de animales vertebrados son muy notorias.

137

9 LA EVOLUCIN DE LOS SERES VIVOS


b) Todos los seres vivos, desde las bacterias a las ballenas, estamos formados por las mismas molculas:
glcidos, lpidos, protenas y cidos nucleicos. VERDADERO.
c) La gran diferencia entre los embriones de los peces,
anfibios, reptiles, aves y mamferos se considera una
prueba a favor del proceso evolutivo. FALSO. La gran
semejanza entre los embriones de los peces, anfibios,
reptiles, aves y mamferos se considera una prueba a favor del proceso evolutivo.
11 Qu quiere decir que el cdigo gentico es universal?
Otro dato de gran importancia que ha aportado la biologa
molecular para apoyar la evolucin de los seres vivos a
partir de un antecesor comn es que el cdigo gentico
es el mismo para todos los seres vivos sin excepcin. Es
decir, el mensaje cifrado en forma de secuencia de bases nitrogenadas que contiene el ADN se interpreta de la
misma manera en cualquier ser vivo, sea una bacteria, un
alga, un hongo o un hipoptamo: el cdigo gentico es
universal.
12 Rellena el siguiente prrafo sobre las pruebas embriolgicas.
Todos los embriones, en las etapas tempranas de su desarrollo, presentan estructuras, como las hendiduras branquiales o el corazn simple, sin segmentar, que son propias
de los peces y que permanecen en estos animales en estado
adulto, pero que son eliminadas en posteriores estadios de
su desarrollo, en el resto de los grupos.
13 Ernest Heinrich Philipp August Haeckel, bilogo
y filsofo alemn que populariz el trabajo de Charles
Darwin en Alemania, creando nuevos trminos como
phylum y ecologa, aport sus estudios sobre la similitud de los embriones de peces, anfibios, reptiles, aves
y mamferos formulando la teora de la recapitulacin.
En qu consiste dicha teora?
La teora de la recapitulacin sostiene que el desarrollo embrionario de cada especie (ontogenia) repite completamente
su historia evolutiva (filogenia). De otro modo: cada uno de
los estadios que el individuo de una especie atraviesa a lo largo de su desarrollo embrionario representa una de las formas
adultas que apareci en su historia evolutiva.
14 Responde verdadero (V) o falso (F) a las siguientes
afirmaciones razonando en caso negativo:
a) La biogeografa muestra que la distribucin de las
distintas especies de seres vivos en el planeta es uniforme. FALSA. La biogeografa muestra que la distribucin de las distintas especies de seres vivos en el planeta
no es uniforme.

138

b) Las especies surgen una sola vez y, a partir de su punto de origen, se dispersan hasta que encuentran una
barrera que las detiene. VERDADERA.
c) La distribucin de los organismos en los distintos
continentes puede ser explicada como consecuencia
de su dispersin desigual desde su lugar de origen.
VERDADERA.
15 Define el trmino biogeografa.
La biogeografa es la rama de la biologa que estudia la distribucin de los seres vivos sobre la Tierra.
16 Cules de las siguientes floras presentan entre ellas
ms semejanzas: la de Europa frente la de Norteamrica
o la de frica frente a la de Sudamrica?
Wegener encontr rocas semejantes y de la misma antigedad en frica y Sudamrica, como es el caso de algunas rocas
gneas.
17 El fijismo fue la teora aceptada en Europa hasta bien
entrado el siglo XVIII. Qu representaban los fsiles para
los fijistas?
Para los fijistas, los fsiles, por ejemplo, no representaban los
restos petrificados de organismos que vivieron en pocas
geolgicas anteriores, sino las caprichosas formas que en
ocasiones tomaban las rocas.
18 Responde verdadero (V) o falso (F) a las siguientes
afirmaciones razonando en caso negativo:
a) El fijismo, o creacionismo, se debe a la creencia de
la religin cristiana en la existencia del mundo y de
todos los seres vivos por un acto de creacin divina.
VERDADERA.
b) Uno de los principios fundamentales del lamarckismo es la sobreproduccin. FALSA. Los principios fundamentales del lamarckismo son el uso y el
desuso del rgano y la herencia de los caracteres adquiridos.
c) Segn Lamarck, el carcter adquirido por una generacin de individuos, se conserva y es transmitido a
las nuevas generaciones. VERDADERA.
19 Rellena el siguiente prrafo sobre el ejemplo que
utiliz Lamarck sobre el cuello de las jirafas.
Los antepasados de las jirafas deban tener el cuello corto, pero al escasear la vegetacin en pocas de sequa,
tuvieron que estirar el cuello para alcanzar las hojas
de los rboles. Esto produjo un alargamiento progresivo del cuello que fue transmitido a los descendientes.
El carcter adquirido por la utilizacin continua de un
rgano, el cuello largo, era transmitido a la descendencia.

20 Hemos visto que la teora de Lamarck tuvo poca


aceptacin porque, entre otras, George Cuvier realiz
una campaa de descrdito. Infrmate ms sobre este
naturalista francs.
Se puede encontrar una breve biografa de George Cuvier en
la pgina: http://www.geocities.com/paleoweb_chile/biografias/cuvier.htm
21 Tenemos la siguiente situacin: dos individuos de
la misma especie que se alimentan de las hojas altas
de ciertos rboles: el individuo A posee las siguientes
caractersticas: patas cortas, cuello ancho y corto;
mientras que el individuo B presenta un cuello ms
fino y largo que el individuo A, y sus patas no presentan diferencias caractersticas. Segn Darwin, cul de
los individuos tiene ms probabilidades de sobrevivir?
Razona la respuesta.
El individuo B, ya que posee caractersticas ms favorables
(cuello ms largo) y, por tanto, tiene mayor probabilidad de
sobrevivir y reproducirse, transmitiendo, entonces, sus rasgos
a la siguiente generacin.

24 Por qu la variante negra de la mariposa nocturna


Biston betularia es ms comn en ciertas zonas que las
blancas?
Existe una forma mutante de color negro que es muy poco
frecuente. Sin embargo, hacia finales del siglo XIX, la forma
negra era la ms comn en algunas zonas industrializadas
en las que la contaminacin haba provocado el ennegrecimiento de la corteza de los abedules.
25 Completa el siguiente prrafo sobre la mutacin de
Biston betularia:
La mutacin oscura era una mutacin perjudicial y, por
tanto, poco frecuente cuando las cortezas de los rboles
eran de color claro. Sin embargo, se convirti en una mutacin adaptativa cuando las condiciones ambientales
cambiaron por la contaminacin provocada por las industrias. Entonces, la seleccin natural favoreci su supervivencia y reproduccin y su frecuencia aument.
26 Define brevemente los siguientes trminos:

Especie: un conjunto de individuos semejantes que pueden reproducirse entre ellos.


Especiacin: es el proceso mediante el cual una poblacin de una determinada especie da lugar a otra u otras
poblaciones, aisladas reproductivamente de la poblacin
anterior y entre s, que con el tiempo irn acumulando
otras diferencias genticas.

22 Responde verdadero (V) o falso (F) a las siguientes


afirmaciones:

a) Fruto de las observaciones realizadas por Darwin durante su viaje en el Beagle dieron lugar a la formulacin de su teora sobre la evolucin. VERDADERO.
b) La evolucin es una consecuencia de la seleccin natural de los ms aptos. VERDADERO.
c) Los individuos de una poblacin son idnticos entre
s y presentan variacin en sus caractersticas. FALSO.
Los individuos de una poblacin no son idnticos entre
s y presentan variacin en sus caractersticas.

27 Ordena las siguientes fases para que se pueda dar


la formacin de una nueva especie:

23 Responde a las siguientes cuestiones con verdadero


(V) o falso (F), justificando tu respuesta:

Respuesta correcta: b) c) a).

a) La teora sinttica de la evolucin, tambin denominada neodarwinismo, fue formulada por Huxley,
Dobzhansky y Mayr. VERDADERO.
b) Uno de los principios del neodarwinismo se basa
en que la variacin en los rasgos entre los individuos de una especie son producto del azar. FALSO.
La variacin en los rasgos entre los individuos de una
poblacin se deben a la recombinacin gentica que
tiene lugar en la reproduccin sexual y a la existencia
de mutaciones.
c) La mayor parte de las mutaciones son perjudiciales
e incluso letales. VERDADERO.
d) El neodarwinismo incorpora a la teora de Darwin los
conocimientos aportados por la gentica y la geoqumica. FALSO. El neodarwinismo incorpora a la teora de
Darwin los conocimientos aportados por la gentica y la
biologa molecular.

a) Aparicin de barreras reproductivas.


b) Aislamiento de poblaciones.
c) Evolucin en ambientes distintos.

28 Completa el siguiente prrafo sobre especiacin


ocurrida en Porto Santo.
Un caso curioso de especiacin ocurri cuando una pequea poblacin de conejos fue liberada en la pequea
isla de Porto Santo, frente a Portugal, a principios del siglo
XV. Tan slo cuatro siglos despus, los conejos de la isla eran
muy diferentes a los del continente, ms pequeos, con
un pelaje distinto y sus hbitos eran nocturnos.
29 Define brevemente los siguientes trminos:

Microevolucin: es la adaptacin de los organismos al


medio.
Macroevolucin: es la formacin de nuevas especies.

30 Completa el siguiente cuadro con S (s) o N (no) segn corresponda:

139

Gradual

Rpida

Seleccin natural
nivel individuos

Seleccin natural
nivel especie

9 LA EVOLUCIN DE LOS SERES VIVOS


Gradualismo

Puntualismo

31 Realiza un dibujo en el que se ponga de manifiesto


la diferencia existente entre el gradualismo y el puntualismo.

34 Responde a las siguientes cuestiones con verdadero


(V) o falso (F), justificando tu respuesta:
a) El proceso que condujo a la formacin de las primeras clulas a partir de molculas inanimadas se
denomina evolucin orgnica. FALSO. El proceso que
condujo a la formacin de las primeras clulas a partir
de molculas inanimadas se denomina evolucin qumica.
b) La evolucin qumica fue un proceso lento y gradual
determinado por la composicin y las propiedades
de la atmsfera de la Tierra hace 4 000 millones de
aos. VERDADERO.
c) En 1950 el cientfico norteamericano Stanley Oparn llev a cabo un experimento para demostrar la
hiptesis sobre el origen de la vida por evolucin
qumica. FALSO. En 1950, el cientfico norteamericano
Stanley Millar llev a cabo un experimento para demostrar la hiptesis sobre el origen de la vida por evolucin
qumica.
35 Ordena los siguientes trminos segn la evolucin
qumica:

32 La biloga Lynn Margulis afirma que la simbiosis


es el principal resultado forzado por la evolucin, y reivindica que la evolucin est fuertemente basada en la
cooperacin, interaccin y dependencia mutua entre
organismos. Responde:
a) Define el trmino simbiosis.
La simbiosis es un tipo de interaccin biolgica entre dos o
ms organismos de distinta especie. A los organismos involucrados se les denomina simbiontes.
b) Cita algn ejemplo en la naturaleza en la que exista
una relacin de simbiosis entre dos especies.
Un ejemplo es la simbiosis mutua entre el pez payaso que
nada entre los tentculos de las anmonas. El pez protege
su territorio de otros peces comedores de la anmona, y a
cambio, los tentculos de la anmona le protegen de otros
predadores.
33 Completa el siguiente prrafo sobre la radiacin
adaptativa:
Para que la radiacin adaptativa se produzca, deben existir nuevas posibilidades de adaptacin y evolucin. stas
pueden deberse a la adquisicin de una caracterstica que
permita la colonizacin de nuevos ambientes. As, el desarrollo del huevo amnitico, permiti a los primitivos reptiles
independizarse totalmente del agua y dar lugar, entre finales
del Paleozoico y principios de Mesozoico, a un gran nmero
de tipos distintos.

140

a)
b)
c)
d)
e)

Clulas primitivas.
Polmeros.
Molculas inorgnicas.
Monmeros.
Protobiontes.

Respuesta correcta: c), d), b), e), a).


36 Una de las propiedades de la atmsfera que hizo
posible la evolucin qumica fue la ausencia de oxgeno
libre. Explica en qu medida afect esta propiedad.
El oxgeno libre habra degradado las molculas orgnicas
recin formadas. Su ausencia en la atmsfera favoreci la
estabilidad de las nuevas molculas.
37 Ordena las siguientes clulas siguiendo el modelo
de la teora endosimbintica formulado por Margullis.
1. Cianobacterias.
2. Espiroquetas.
3. Bacteria fermentadora.
4. Quimera.
5. Bacteria aerobia.
6. Protista primitivo.
7. Plantas.
8. Animales.
9. Hongos.
Se recomienda consultar la Figura 9.16 del libro del alumno.
38 Los procariotas auttrofos fotosintticos favorecieron un gran cambio ambiental. Explica el porqu y en
qu consista este cambio ambiental.

Surgieron los procariotas auttrofos fotosintticos que liberaban O2. Estos organismos, que tuvieron un gran xito biolgico, provocaron el progresivo enriquecimiento en O2 de la
atmsfera. Este importante cambio ambiental desencaden
la extincin de gran parte de los organismos anaerobios y
favoreci la evolucin de los seres vivos aerobios mucho ms
eficientes en la obtencin de energa a partir de la materia
orgnica.
39 En qu consiste la teora endosimbintica? Quin
la formul?
La teora endosimbintica sobre el origen de las clulas
eucariotas, propuesta por Lynn Margulis, sugiere que estas
clulas se formaron por la unin cooperativa, simbitica, de
clulas procariotas. Las primeras clulas eucariotas estuvieron, pues, formadas por la unin de diversos tipos de clulas
procariotas.
40 Hemos visto que los primeros seres vivos fueron seres unicelulares, procariotas que obtenan la energa por
fermentacin. Responde a estos puntos:

Define fermentacin: un proceso catablico de oxidacin incompleto, totalmente anaerbico, siendo el


producto final un compuesto orgnico. Estos productos
finales son los que caracterizan los diversos tipos de fermentaciones.
Nombra los distintos tipos de fermentacin que
existen:
Fermentacin actica.
Fermentacin alcohlica.
Fermentacin butrica.
Fermentacin de la glicerina.
Fermentacin lctica.
Fermentacin ptrida.
Nombra algn organismo actual que utilice la fermentacin: son propias de los microorganismos, como
algunas bacterias y levaduras. Tambin se produce la fermentacin en la mayora de las clulas de los animales
(incluido el ser humano), excepto en las neuronas que
mueren rpidamente si no pueden realizar la respiracin
celular. Algunas clulas, como los eritrocitos, carecen de
mitocondrias y se ven obligadas a fermentar.

41 Responde a las siguientes cuestiones con verdadero


(V) o falso (F), justificando tu respuesta:
a) Las clulas eucariotas primitivas debieron de dar
lugar a un grupo muy diverso de seres unicelulares.
VERDADERO.
b) Los animales se originaron a partir de primitivos hongos unicelulares. FALSO. Los animales se originaron a
partir de protozoos primitivos.
c) Del estudio de la morfologa y la diversidad de los
protistas actuales se ha deducido la actual teora de
la evolucin de las clulas. VERDADERO.

42 Define:

Colonia: entre estos organismos pronto debi surgir una


tendencia a la multicelularidad, es decir, a formar agregados de clulas semejantes denominados colonias.
Protozoo: los protozoos, tambin llamados protozoarios,
son organismos microscpicos, unicelulares eucariticos;
hetertrofos, generalmente fagtrofos, depredadores o
saprtrofos, a veces mixtrofos.

43 Completa el siguiente prrafo sobre la teora de la


expansin del fondo ocenico.
Las primitivas algas verdes unicelulares habran dado lugar a formas ms complejas que acabaran originando los
diferentes grupos de vegetales actuales. Los animales se
habran originado, de modo semejante, a partir de protozoos primitivos; y descenderan, a su vez, de los primitivos
hongos unicelulares.
44 Cita las diferencias existentes entre los prosimios y
los antropoideos.

Prosimios: animales de pequeo tamao y costumbres nocturnas. Los lemures y los trsidos pertenecen a este grupo.
Antropoideos: animales diurnos, de mayor talla y con un
encfalo mayor que los prosimios. Incluye los monos del
Nuevo Mundo, los monos del Viejo Mundo y los hominoideos. Los hominoideos son monos de gran tamao,
sin cola. Entre ellos se encuentran los gibones, los orangutanes, los gorilas, los chimpancs y los seres humanos
que, junto a sus antepasados extintos, forman la familia
de los homnidos.

45 Responder a las siguientes cuestiones con verdadero (V) o falso (F), justificando la respuesta:
a) Los antepasados de los chimpancs y de los humanos
vivieron en la selva africana y eran individuos arborcolas que se alimentaban bsicamente de frutos.
VERDADERO.
b) Hace tres millones de aos aparecieron los Australopithecus, un grupo heterogneo de homnidos en el
que se incluyen varias especies. FALSO. Hace cuatro
millones de aos aparecieron los Australopithecus, un
grupo heterogneo de homnidos en el que se incluyen
varias especies.
c) Los primeros homnidos tenan un crneo pequeo
comparado al nuestro y presentaban poco dimorfismo sexual. FALSO. Los primeros homnidos tenan un
crneo pequeo comparado al nuestro y presentaban
gran dimorfismo sexual.
46 De la siguiente lista indica cules son caractersticas
de los Australopithecus:
a) Marcha bpeda.
b) Tamao medio alrededor de 1,50 m.

141

9 LA EVOLUCIN DE LOS SERES VIVOS


c)
d)
e)
f)

Mentn saliente.
Crneo pequeo de 250 cm3.
Pequeos dientes caninos.
Bordes supraorbitarios pronunciados.

la nueva especie en expansin. Algunos autores consideran la posibilidad de que H.neanderthalensis se cruzara
con H. sapiens.
51 Completa el siguiente cuadro con S (s) o N (no) segn corresponda:

Respuesta correcta: a), c) y f).

a) Quin era Selam?


Selam es el nombre dado a los restos de una nia de Australopithecus afarensis de 3 aos de edad, cuyos huesos fueron
encontrados e identificados por primera vez en el ao 2000,
en el yacimiento de Dikika.
b) Qu antigedad tiene?
Los restos tienen una antigedad de 3,3 millones de aos,
y son los ms antiguos y completos de un homnido encontrados hasta la fecha.
c) Por qu Selam es un fsil tan importante?
Selam es el fsil ms completo de un nio del pasado, pues, a
diferencia de Lucy, se han encontrado algunos dedos, un pie,
el trax completo y sobre todo la cara, que posee los rasgos
simiescos propios de la especie. Su volumen cerebral es de
330 cc, parecido al de un chimpanc de su edad. La nia, de
tres aos, tiene los dientes de leche todava completos y los
dientes permanentes an por salir. Sus hombros, omplatos
y dedos curvados parecen indicar que poda trepar a los rboles, y sus caderas y piernas, especialmente el ngulo del
fmur hasta la cadera, muy parecidas a las de un humano,
que caminaba sobre los pies.
49 Relaciona con flechas los siguientes trminos:
Homo erectus
Homo habilis
Homo neardenthalensis

Usaron el fuego
Diseo tiles
Rituales funerarios

50 Cules fueron las causas de la extincin del Homo


neardenthalensis?
Su extincin coincidi con la llegada a Europa de una nueva especie, Homo sapiens. Las causas de su desaparicin no
estn claras, pero es probable que fueran desplazados por

142

Llegaron
a Europa

Ritos funerarios

48 Otro de los fsiles ms conocidos de Australopithecus afarensis, adems de Lucy, es Selam. Responde:

Herramientas

Las pisadas de Laetoli (Tanzania) se piensa que son las huellas fsiles que tres Australopithecus afarensis dejaron,
hace unos 3,6 millones de aos sobre cenizas volcnicas.
Su hallazgo sirvi para reforzar el argumento de que los Australopithecus eran bpedos.

25 mill. de aos

47 Completa el siguiente prrafo sobre las pisadas de


Laetoli.

H. habilis

H. erectus

H. neanderthalensis

52 Hemos visto en esta Unidad las caractersticas del


Homo erectus. Existe otra especie, el Homo ergaster, que
est relacionada con el Homo erectus. Responde:
a) Por qu se relacionan el Homo erectus con el Homo
habilis?
Homo ergaster procede probablemente de Homo habilis y es
bsicamente la versin africana de Homo erectus, del que es
antecesor. Actualmente, se considera que podran haber sido
una misma especie, debido a su gran parecido anatmico.
b) Cules son las caractersticas ms destacables del
Homo ergaster?
Homo ergaster tiene un crneo menos robusto y con toros
supraorbitales menos acusados que el Homo erectus, y se
asocia, en sus comienzos, a la industria ltica olduvayense, o
modo 1. A excepcin del crneo, tanto Homo erectus como
Homo ergaster tienen una constitucin fsica bastante parecida a la del ser humano actual, siendo similar en altura,
aunque en general son de complexin ms robusta y fuerte,
y tienden a ser algo ms anchos de caderas. Las proporciones
de piernas y brazos, ya son tambin totalmente modernas.
c) Cundo vivi y cundo se estima que desapareci
el Homo ergaster?
Se estima que apareci hace unos 2 millones de aos, y desapareci hace 1 milln de aos.
53 En qu consiste la hiptesis sobre el origen de nuestra especie?
Aunque no existe un acuerdo total entre los cientficos sobre
el lugar en que surgi nuestra especie, una de las hiptesis
con mayor aceptacin es la de que Homo sapiens se origin
en frica, hace entre 200 000 y 150 000 aos, a partir de las
poblaciones Homo erectus que permanecieron en aquel con-

tinente. Desde all, los primitivos Homo sapiens se dispersaron


hacia Europa, Asia, Amrica y Oceana.
54 Indica cules de los siguientes trminos son caractersticas del Homo sapiens:
a) Postura erecta bpeda.
b) Capacidad cerebral de 1 150 cm3.
c) Desarrollo de la inteligencia.
Respuesta correcta: a) y c).
55 Explica en qu consiste la adaptacin por medio de
la cultura.
La inteligencia ha permitido a los seres humanos una nueva
forma de adaptacin por medio de la cultura, que es mucho ms rpida que la adaptacin biolgica. Esta forma de
adaptacin nos ha permitido colonizar prcticamente todo el
planeta, pero tambin ha sido la causa de la superpoblacin,
de la degradacin del ambiente y, consecuentemente, de la
extincin de muchas especies vegetales y animales.
56 Responde a las siguientes cuestiones:
a) A qu denominamos Homo sapiens idaltu?
Se denomina Homo sapiens idaltu a especmenes fsiles
encontrados en las proximidades de la localidad etope de
Herto durante el ao 1997 por el equipo de paleoantroplogos dirigido por Tim White.
b) Por qu el descubrimiento de los fsiles del Homo
sapiens idaltu ha suscitado polmica?
Varios investigadores an consideran al Homo sapiens idaltu
como una subespecie extinta del Homo sapiens y es por esto
que se mantiene la denominacin taxonmica Homo sapiens
sapiens para el ser humano actual como diferenciacin con
respecto al Homo sapiens idaltu. Otros, en cambio, consideran
que Homo sapiens idaltu es slo un ser humano de la actual
especie que mantiene ligeros rasgos morfolgicos arcaicos
en relacin a otros fsiles que son indiscutiblemente de Homo
sapiens sapiens (i. e.: los Cro-Magnon, los hombres de Grimaldi,
etctera.).
57 Qu es Tiktaali roseae? Por qu es importante su
hallazgo?
Son los restos fsiles de una forma intermedia. En 2004 se
descubrieron en la isla Ellesmere, al norte de Canad, los restos fsiles, en un excelente estado de conservacin, de un
pez que vivi hace unos 375 millones de aos. Este animal, al
que se le ha denominado Tiktaalik roseae, tena caractersticas
anatmicas propias de los tetrpodos, por lo que su hallazgo ha contribuido a esclarecer la evolucin de los anfibios a
partir de los peces.

Los hallazgos de fsiles que constituyen formas intermedias


entre dos grandes grupos de seres vivos sirven, en ocasiones,
para confirmar las lneas evolutivas que algunos cientficos
ya haban trazado.
58 A qu llamamos rganos vestigiales? Cita algn
ejemplo de rgano vestigial en el ser humano.
Algunos rganos, como los huesos de las caderas que tienen
algunas especies de serpiente, el apndice o el cccix humanos, que no son funcionales, reciben el nombre de rganos
vestigiales.
59 Unir con flechas los trminos relacionados:
Lamarckismo
Neodarwinismo
Darwinismo

Herencia, Caracteres adquiridos


Mutaciones adaptativas
Lucha por la vida

60 Une el nombre de cada cientfico con su teora correspondiente:


Margu llis
Eldredge
Mayr

Endosimbintica
Puntualismo
Neodarwinismo

61 Qu debe ocurrir para que la radiacin adaptativa


se produzca? Cita algn ejemplo.
Para que la radiacin adaptativa se produzca, deben existir nuevas posibilidades de adaptacin y evolucin. stas
pueden deberse a la adquisicin de una caracterstica que
permita la colonizacin de nuevos ambientes. As, el desarrollo del huevo amnitico permiti a los primitivos reptiles
independizarse totalmente del agua y dar lugar, entre finales
del Paleozoico y principios de Mesozoico, a un gran nmero
de tipos distintos.
62 De la siguiente lista indica cules fueron las propiedades de la atmsfera que hicieron posible la evolucin
qumica:
a)
b)
c)
d)
e)

Gran cantidad de energa.


Aparicin de organismos fotosintticos.
Abundancia de molculas simples.
Ausencia de luz.
Ausencia de oxgeno libre.

Respuesta correcta: a), c) y e).


63 Cules son las caractersticas de los primates?
Los primates son un grupo de mamferos adaptados a la vida
arborcola. Tienen extremidades largas y esbeltas con dedos
prensiles, ojos en el frente (lo que permite la visin en tres
dimensiones) y un encfalo muy desarrollado. Su comportamiento social es complejo y las hembras suelen parir un solo

143

9 LA EVOLUCIN DE LOS SERES VIVOS


oxidante. Actualmente son abundantes en aguas someras
de Shark Bay (Australia).

65 Une cada unos de los trminos de la primera lista


con los trminos correspondientes de la segunda:
1. Australopithecus, Homo neardenthalensis, Homo sapiens, Homo erectus, Homo habilis.
2. Pinturas rupestres, primeros en abandonar frica,
primeros diseos de herramientas, ritos fnebres,
primeros en desarrollar marcha bpeda.
Respuesta correcta:
Australopithecus con Primeros en desarrollar marcha bpeda.
Homo neardenthalensis con Ritos fnebres.
Homo sapiens con Pinturas rupestres.
Homo erectus con Primeros en abandonar frica.
Homo habilis con Primeros diseos de herramientas.
66 Responde a las siguientes preguntas:

b) Cmo es posible que no hayan sufrido cambios evolutivos?


Debido a su gran poder de adaptacin o bien porque han
quedado relegados a pequeas zonas del planeta que variaron muy poco sus caractersticas ambientales.
c) Cita algn ejemplo de fsil viviente.
Los estromatolitos son agrupaciones de cianobacterias
capaces de acumular capas de arena formando estructuras rocosas con apariencia de hongo. Tambin se conocen
vulgarmente con el nombre de roca viva. Estas bacterias
fotosintticas fueron muy abundantes en el Precmbrico,
hace unos 3 800 millones de aos (la Tierra se form hace
unos 4 500 millones de aos), y a ellas se debe la incorporacin del oxgeno a la atmsfera terrestre, modificando el
ambiente reductor originario de la tierra por un ambiente

144

Ser humano

ACTIVIDAD PRCTICA
La cerilla se apaga porque combustiona con el oxgeno.
Al no haber oxgeno la tinta ocupa su lugar incrementando
el nivel, pero no aumenta indefinidamente debido a que se
encuentra otro gas, el nitrgeno, que es el principal componente de la atmsfera.

EXAMEN TIPO TEST


Marca la/s respuesta/s correcta/s en las siguientes cuestiones:

a) Qu son los fsiles vivientes?


Son especies que abundaron en otros periodos geolgicos
dejando gran abundancia de restos fsiles. Lograron llegar
hasta nuestros das sin grandes cambios evolutivos.

30 000 aos H. Neanderthalensis

1,8 m. a. H. Erectus

2,5 m. a. H. Habilis

Marcha bpeda, habitaban en frica, bordes supraorbitarios pronunciados, mentn saliente y grandes dientes caninos.

3,5 m. a. Lucy

Orangutn

64 Qu tienen en comn el Australopithecus afarensis


y el Homo habilis?

Chimpanc

67 Realiza un grfico en el que representes un esquema


sobre el origen del ser humano. Aade las fechas aproximadas de los homnidos.
Gorila

hijo en cada parto, el cual necesita un largo periodo de crianza


y proteccin. Surgieron hace unos cincuenta millones de aos,
poco despus de que se extinguieran los dinosaurios y de que
los mamferos, al ocupar los nichos ecolgicos abandonados
por ellos, comenzasen su rpida radiacin adaptativa.

1 Algunas de las pruebas de la evolucin son:


a)
b)
c)
d)

Los fsiles.
Climatologa.
Bioqumica.
Biogeografa.
2 Todos los seres vivos estamos formados por:

a)
b)
c)
d)

Pulmones.
Protenas.
Hormonas.
Lpidos.
3 Los principios fundamentales del lamarckismo son:

a.
b.
c.
d.

Uso y desuso del rgano.


Lucha por la vida.
Seleccin de los ms aptos.
Herencia de los caracteres adquiridos.

4 Los principios fundamentales del neodarwinismo


son:

a.
b.
c.
d.

Recombinacin gentica.
Mutaciones adaptativas.
Variacin.
Simbiosis.

5 Las etapas fundamentales para que surja una especie son:


a.
b.
c.
d.

Mutaciones en la poblacin.
Evolucin en ambientes distintos.
Aislamiento de la poblacin.
Aparicin de barreras reproductivas.

6 Cules fueron las propiedades de la atmsfera que


hicieron posible la evolucin qumica?
a.
b.
c.
d.

Ausencia de luz.
Ausencia de oxgeno libre.
Abundancia de molculas simples.
Gran cantidad de energa.

7 Cules de las siguientes especies no son antropideos?


a.
b.
c.
d.

Lemridos.
Monos del Nuevo Mundo.
Gibones.
Chimpancs.

8 Cules de las siguientes caractersticas son propias


del Australopithecus afarensis?
a. Vivi hace 2,5 millones de aos.
b. Eran individuos de pequeo tamao, no superaban
los 1,20 m.
c. Enterraban a sus muertos.
d. Posean grandes dientes caninos.
9 Cules de las siguientes caractersticas son propias
del Homo erectus?
a

Los primeros en disear toscas herramientas de piedra.


b. Posean unas cortas piernas que hacan que no superaran el 1,20 m de altura.
c. Fueron los primeros en abandonar el continente africano.
d. Andaban totalmente erguidos.
10 Las caractersticas ms importantes del Homo sapiens son:
a.
b.
c.
d.

Primeros en enterrar sus muertos.


Cultura muy desarrollada.
Desarrollaron el arte.
Fabricaban armas y herramientas complejas.

EXAMEN DE
DESARROLLO
1 Cita las distintas pruebas de la evolucin que existen. Explica el estudio comparativo de la anatoma.
Existen multitud de pruebas que demuestran su existencia,
algunas de estas pruebas las obtenemos del estudio de los
fsiles, la anatoma comparada, el desarrollo embrionario
de los animales, la bioqumica y la biologa molecular y, por
ltimo, de la biogeografa.
El estudio comparativo de la anatoma de cualquier sistema o aparato, entre los miembros de los diversos grupos de
animales y vegetales, revela semejanzas que pueden ser
explicadas si se supone la existencia un antepasado comn
que al evolucionar y diversificarse dio lugar a los diferentes
tipos actuales.
En los vertebrados terrestres, por ejemplo, la disposicin de
los huesos en las extremidades responde a un mismo patrn,
lo que sugiere que los vertebrados evolucionaron a partir de
un antepasado comn que posea esa disposicin sea. Las
diferencias en la estructura de las extremidades responden
a las posteriores adaptaciones evolutivas a distintas formas
de locomocin.
Los rganos de diferentes seres vivos, que son semejantes
porque tienen su origen en un antepasado comn, reciben
el nombre de rganos homlogos.
Algunos rganos, como los huesos de las caderas que tienen
algunas especies de serpiente, el apndice o el cccix humanos, que no son funcionales, reciben el nombre de rganos
vestigiales.
Los rganos vestigiales son considerados tambin como
una importante prueba de la evolucin ya que su presencia en un organismo no tiene otra explicacin que la de
ser formas residuales de rganos que, en otro momento,
tuvieron una funcin. La presencia de los huesos de las
caderas en las serpientes, por ejemplo, cobra sentido al
suponer que estos animales, como el resto de los reptiles,
evolucionaron a partir de primitivos tetrpodos en los que
dichos huesos sostenan las extremidades posteriores.
2 Darwinismo.

Cmo se explica la evolucin mediante la seleccin


natural?
Cul es la principal diferencia entre el darwinismo y
el lamarckismo?

Darwin conoca la seleccin artificial que practicaban los ganaderos y agricultores que cruzaban entre s los ejemplares
que presentaban caractersticas ventajosas, haban sido ca-

145

9 LA EVOLUCIN DE LOS SERES VIVOS


paces de obtener numerosas razas de ganado y variedades
de hortalizas. Segn Darwin la lucha por la existencia que
se produca en la naturaleza actuaba de forma semejante a
como lo hacan ganaderos y agricultores, porque seleccionaba y favoreca la reproduccin de los individuos mejor
dotados y eliminaba a los menos aptos. La evolucin, por
tanto, era una consecuencia de la seleccin natural de los
ms aptos. La teora de la evolucin por seleccin natural que
formul Darwin puede resumirse de la siguiente manera:

Sobreproduccin: los seres vivos producen ms descendientes de los que pueden sobrevivir.

Variacin: los individuos de una poblacin no son idnticos entre s sino que presentan variacin en sus caractersticas. Algunos rasgos favorecen la supervivencia,
otros no. Aunque Darwin desconoca los mecanismos
de la herencia, apuntaba la necesidad de que las variaciones que presentaban los individuos de una poblacin
fueran hereditarias para que influyeran en la evolucin
de la especie.

Lucha por la vida: dado que en la naturaleza los recursos son limitados y que hay ms individuos de los que
el ambiente puede sostener, se produce la lucha por la
supervivencia.

Seleccin de los ms aptos: Los individuos que poseen las


caractersticas ms favorables tienen mayor probabilidad
de sobrevivir y reproducirse y, por tanto, de transmitir sus
rasgos a la siguiente generacin. Al cabo de varias generaciones se habr producido una seleccin de los rasgos
que ms favorecen la supervivencia y, en consecuencia,
la poblacin estar mejor adaptada al ambiente.

Ambas teoras explican la evolucin por la adaptacin de los


organismos al ambiente. La diferencia estriba en el mecanismo de adaptacin.
Para Lamarck la adaptacin se produce como resultado de la
presin del ambiente sobre los individuos que se ven obligados a cambiar, a estirar el cuello, por ejemplo, en el caso de
las jirafas. Segn Lamarck la funcin hace al rgano.
Para Darwin la adaptacin surge debido a la seleccin natural
de los individuos que poseen las caractersticas que les hacen
ms aptos para sobrevivir en un ambiente determinado. En el
caso de las jirafas la naturaleza selecciona en cada generacin
aquellas jirafas que tienen el cuello ms largo porque son las
que ms probabilidades tienen de sobrevivir y reproducirse.
Segn Darwin la naturaleza selecciona al rgano mejor adaptado para una funcin de entre las variedades espontneas
que surgen en la poblacin.
3 Explica las fases necesarias para la formacin de una
nueva especie. Define radiacin adaptativa.
En la formacin de una especie nueva pueden distinguirse
tres fases:

146

Aislamiento de las poblaciones: puede deberse a que


alguna de las poblaciones migre o a que surja una barrera
geogrfica que las separe como la desviacin del cauce
de un ro, la aparicin de grietas en el terreno, la formacin de pequeas lagunas a partir de un lago, etc. Al estar
separadas, el cruzamiento entre los individuos de las distintas poblaciones y, por tanto, el intercambio gentico
entre ellas, resultar imposible.

Evolucin en ambientes distintos: la seleccin natural


actuar de forma independiente sobre cada poblacin,
es decir, favorecer mutaciones distintas; por lo que los
cambios evolutivos que experimenten tambin sern
diferentes.

Aparicin de barreras reproductivas: si transcurre un


periodo de tiempo suficientemente largo pueden haberse producido tal cantidad de cambios que la reproduccin entre los individuos de una y otra poblacin sea
imposible. Cuando esto ocurre, se puede afirmar que las
poblaciones han dado lugar especies distintas.

La radiacin adaptativa es el fenmeno que se observa en


la historia evolutiva de algunos grupos de seres vivos que,
en un momento determinado, dan origen a varios grupos
distintos que se adaptan a diferentes formas de vida y, en
poco tiempo, dan lugar a una gran diversidad de tipos.
4 Evolucin qumica:

Definicin.
Propiedades de la atmsfera.
Esquema de las etapas de la evolucin qumica.

El proceso que condujo a la formacin de las primeras clulas


a partir de molculas inanimadas se denomina evolucin
qumica.
La evolucin qumica fue un proceso lento y gradual determinado por la composicin y las propiedades de la atmsfera de la
Tierra hace unos 4 000 millones de aos, que eran muy distintas
a las de la atmsfera actual. Algunas de las propiedades de la
atmsfera que hicieron posible la evolucin qumica fueron:

Abundancia de molculas simples: como vapor de


H2O, iones minerales y gases como CO2, CO, H2 y N2 que
sirvieron como bloques de construccin para formar molculas ms complejas.
Ausencia de oxgeno libre: que habra degradado las molculas orgnicas recin formadas. Su ausencia en la atmsfera favoreci la estabilidad de las nuevas molculas.
Gran cantidad de energa: en forma de violentas tormentas elctricas, impactos de meteoritos y de una intensa radiacin ultravioleta que propiciaron la formacin
de enlaces.

La evolucin qumica puede dividirse en cinco etapas:

su periferia, en la denominada sabana arbrea. Su aspecto


cambi poco, pero se produjo una modificacin importante
en su manera de desplazarse porque, como ya no podan
saltar de rbol en rbol, empezaron a desplazarse por el suelo
y desarrollaron la marcha bpeda.

5 Origen de la especie humana:

Caractersticas comunes de los primates.


Australopithecus afarensis.
Homo erectus.

Los primates son un grupo de mamferos adaptados a la vida


arborcola. Tienen extremidades largas y esbeltas con dedos
prensiles, ojos en el frente (lo que permite la visin en tres
dimensiones) y un encfalo muy desarrollado. Su comportamiento social es complejo y las hembras suelen parir un
solo hijo en cada parto, el cual necesita un largo periodo de
crianza y proteccin. Surgieron hace unos cincuenta millones
de aos, poco despus de que se extinguieran los dinosaurios y de que los mamferos, al ocupar los nichos ecolgicos
abandonados por ellos, comenzasen su rpida radiacin
adaptativa.
Los antepasados de los chimpancs y de los humanos vivieron en la selva africana. Eran individuos arborcolas que se
alimentaban bsicamente de frutos. Su aspecto deba ser
parecido al de los chimpancs actuales porque tenan los
brazos largos y las piernas cortas y su estatura era reducida.
Su crneo era pequeo comparado al nuestro y presentaban
gran dimorfismo sexual. Apenas se conocen fsiles de esta
poca, probablemente porque las condiciones de la vida en
la selva eran muy poco favorables para la fosilizacin.
Parece ser que algunos de estos simios debieron abandonar
la selva hace unos seis millones de aos y establecerse en

Hace unos cuatro millones de aos aparecieron los Australopithecus, un grupo heterogneo de homnidos en el que
se incluyen varias especies. Eran individuos de pequeo
tamao, apenas 1,20 m y marcha bpeda cuyos restos fsiles
se han encontrado en diferentes regiones de frica. Tenan
un crneo pequeo, de unos 500 cm3, bordes supraorbitarios pronunciados, mentn saliente y grandes dientes
caninos.
La especie mejor conocida de este grupo de homnidos es,
sin duda, Australopithecus afarensis, de la que se han hallado
restos de unos 300 individuos. Uno de los esqueletos fsiles
mejor conservados fue descubierto en 1974 por Donald
Johanson y, aunque su denominacin cientfica es AL 288-1,
es ms conocida como Lucy.
Lucy era una hembra joven que vivi en Etiopa hace unos
3,5 millones de aos. Tena alrededor de veinte aos de edad,
meda aproximadamente 1 m y debi pesar unos 27 kg. La
forma de su pelvis y la articulacin de su rodilla demuestran
que poda andar erguida.
Los fsiles de Homo erectus tienen una antigedad de entre
1,8 y 0,2 millones de aos. La estructura de su esqueleto indica que andaban totalmente erguidos, de ah su nombre.
Tenan los brazos ms cortos y las piernas ms largas que
Australopitecus y su capacidad craneana, 1 000 cm3, era prcticamente el doble.
Asociados a los fsiles de Homo erectus se han encontrado
herramientas fabricadas en piedra ms avanzadas que las
asociadas a Homo habilis. Tambin existen evidencias de
que utilizaron el fuego. Se considera que estos homnidos
fueron los primeros en abandonar el continente africano,
pues sus fsiles han sido hallados tambin en Asia y en
Europa.

147

SOLUCIONARIO

ATENCIN
A LA
DIVERSIDAD

DINMICA TERRESTRE:
LA DERIVA CONTINENTAL

ACTIVIDADES
1 Cules de estas razones crees que hizo prevalecer
durante mucho a la teora fijista como cierta?
a) No haba pruebas que demostraran lo contrario.
b) La formacin de las cordilleras es un proceso tan lento que
no se puede percibir en el periodo de vida humana.
c) No haba pruebas de que los continentes se acercaran
o se separaran. (Sealar sta.)

Las imgenes muestran lugares diferentes ocupados por las


masas continentales. Buscara fsiles parecidos en las zonas
en una imagen separada y en la otra unida.
7 En un momento dado de la historia de la Tierra sta era
la posicin que ocupaban algunos continentes. Escribe en
el dibujo el nombre de cada uno. Qu clima habra sobre
las zonas blancas? Qu tipo de flora y fauna habra? Qu
formas de erosin encontraramos sobre el terreno?

2 Escribe cuatro trminos o expresiones que signifiquen lo mismo que: fijista, contraccionismo, movilismo.
Fijista: inmvil, que no se mueve, que permanece siempre
igual, permanente.
Contraccionismo: que mengua, que se hace ms pequeo,
que disminuye, que se contrae.
Movilismo: que se mueve, que evoluciona, que cambia, que
se transforma.
3 Cul es la diferencia fundamental entre las teoras
fijistas y las teoras movilistas?
La teora fijista afirma que las grandes formas de relieve (cordilleras) que hoy observamos han existido siempre tal y como
hoy las conocemos.
La teora movilista afirma que las grandes formas de relieve
(cordilleras) han evolucionado, cambian, tienen un origen y
tendrn un final.
4 Explica la siguiente expresin: expansin de los fondos ocenicos.
Ha de pedrsele al alumno que exponga las ideas clave de las
teoras fijistas y movilistas.
5 Escribe alguna razn que explique la presencia de
fsiles de seres vivos parecidos en lugares tan alejados
actualmente.
Es posible que esos lugares en otro tiempo no hayan estado
tan separados como actualmente. Es decir, estuviesen mucho
ms prximos, es probable que unidos.
6 Qu te sugieren las imgenes? Qu tipo de pruebas
buscaras para saber si estas dos imgenes de la Tierra
son ciertas?

a) Clima polar.
b) Fauna y flora adaptada a ambientes extremadamente
fros.
c) Rastros de erosin glaciar.
8 Crees que el movimiento de los continentes ha finalizado o, por el contrario, contina? Razona la respuesta.
No hay razones evidentes que hagan pensar que el desplazamiento de las masas continentales haya finalizado. Es ms,
actualmente se conoce con total exactitud cunto supone
ese movimiento.
9 Cul es la hiptesis fundamental de la teora de la
deriva continental?
Las masas continentales se desplazan.
10 Clasifica en directos o indirectos los siguientes mtodos utilizados para estudiar el interior de la Tierra:
a)
b)
c)
d)
e)

Ondas ssmicas Indirecto.


Afloramientos Directo.
Sondeos Directo.
Magnetismo Indirecto.
Muestras volcnicas Directo.

11 Completa el siguiente texto:


Los materiales terrestres que forman la astenosfera, debido
a sus condiciones de presin y temperatura se comportan
de manera plstica, por lo que los materiales ms rgidos que
descansan sobre ellos (los de la litosfera) pueden deslizarse
sobre ellos. Este lento desplazamiento ha provocado a lo
largo de cientos de miles de aos el desplazamiento de las
masas continentales, las colisiones entre ellas y la aparicin
de los sistemas montaosos.

150

12 Escribe un texto que incluya los siguientes trminos:


isostasia, movimiento vertical, cordilleras, depresiones,
corteza.
Respuesta libre.
El fenmeno de la isostasia explica el movimiento vertical de
las masas continentales de la corteza terrestre y el hundimiento
de las cordilleras y elevacin de las depresiones.
13 Cmo puede una cordillera como los Alpes tener
un movimiento ascendente? Y una depresin como el
mar Mediterrneo un movimiento descendente?

17 Indica si las siguientes afirmaciones son verdaderas


o falsas:
a) Segn el fijismo, las cordilleras seran las arrugas de
la corteza al reducir la Tierra a su volumen a medida
que se enfra. FALSO.
b) Las dorsales son grandes ejes montaosos que atraviesan el centro de los ocanos. VERDADERO.
c) La litosfera es ms fluida y menos densa que la astenosfera por lo que flota sobre ella. FALSO.
d) Las tillitas que encontr Wegener demostraban que
ciertas zonas, hoy con climas mucho ms clidos, tuvieron en su da un clima polar. VERDADERO.

El movimiento ascendente puede ser debido a la prdida de


masa causada por la erosin de la cordillera.
Un movimiento descendente podra ser explicado por un aumento de la masa debido a la acumulacin de sedimentos.

18 Relaciona los conceptos con su definicin:

14 Qu le sucedera al continente antrtico si, por efecto del calentamiento global, desaparecieran los glaciares
que lo cubren?

dorsal

Equilibrio de flotacin ante


la litosfera y la astenosfera

isostasia

Estudio de la edad de las rocas


por su orientacin magntica

paleomagnetismo

Depresin con grieta en el interior


de las dorsales

rif

Cordillera submarina en la que


se forma nueva litosfera

Al disminuir la masa (por el deshielo) se producira una elevacin del mismo.

ACTIVIDADES FINALES
15 Sobre la siguiente imagen dibuja las flechas que representan las corrientes de conveccin del manto.

19 Escribe un texto en el que utilices las siguientes palabras. Si es necesario, consulta el diccionario:

En la imagen deben aparecer dos movimientos circulares uno


a cada lado de la dorsal ocenica, el de la derecha en sentido
horario y el de la izquierda en sentido antihorario.
Deben aparecer marcadas las dos zonas justo donde la corteza ocenica colisiona con la continental en os extremos de
la zona franjeada.
16 Localiza diez palabras relacionadas con el tema.
D
O
R
S
A
L
A
S
G

E
U
M
U
C
R
T
T
O

R
A
L
V
F
U
S
P
N

I
F
T
A
D
V
I
U
D

V
O
M
X
T
A
J
A
W

A
S
A
R
A
F
I
R
A

P
I
N
B
G
I
F
M
N

S
L
T
P
A
N
G
E
A

I
S
O
S
T
A
S
I
A

Talud.
Abisal.
Conveccin.
Sismgrafo.
Contraccin.

Talud: el talud continental es una parte de la morfologa submarina ubicada entre los 200 y 4 000 metros bajo el nivel del
mar. Se extiende a partir del borde de la plataforma continental hasta una profundidad de 1 000 a 4 500 m.
Abisal: uno de los niveles en los que est dividido el ocano
segn su profundidad, est entre 3 000 y 6 000 metros de
profundidad.
Conveccin: la conveccin es una de las tres formas de transferencia de calor y se caracteriza porque se produce por intermedio de un fluido (aire, agua) que transporta el calor entre
zonas con diferentes temperaturas.
Sismgrafo: instrumento para medir terremotos para la sismologa o pequeos temblores provocados, en el caso de la
sismologa de exploracin.
Contraccin: accin de contraer, estrechar, reducir a un menor volumen o extensin.

151

2 LA TECTNICA DE PLACAS
ACTIVIDADES

A)

1 Por qu crees que existen los volcanes y los terremotos?


Volcanes y terremotos son consecuencia del progresivo
enfriamiento del planeta, es decir, mecanismos por los que
libera al exterior la energa interna del planeta.
2 Qu sucedera si slo se generase litosfera nueva
en las dorsales ocenicas y no existiesen fosas de subduccin?

B)

La cantidad de masa en la astenosfera disminuira, por lo que


la Tierra se ira quedando hueca en su interior; el volumen
del planeta aumentara.
3 Observa en la imagen la situacin de las masas continentales dentro de 250 millones de aos.

a) Explica cul es la diferencia entre las dos imgenes.


En la imagen A hay una colisin entre dos placas continentales, mientras que en la B la colisin es entre una placa continental y otra ocenica.
b) Qu sucede si la situacin B contina hasta que subduce toda la placa ocenica?
La masa continental situada a la derecha (que no aparece en
la imagen) se acercar progresivamente hacia la situada a la
izquierda hasta colisionar directamente con ella, por lo que
tendremos una situacin semejante a la figura A.

a) Qu tipo de clima habr en el actual desierto del


Shara?
El desierto del Shara tendr un clima hmedo puesto que
ocupar latitudes mucho ms al norte que actualmente.
b) Cules sern las condiciones de vida en lo que hoy
es Centroeuropa?
Centroeuropa tambin estar mucho ms al norte (cercano al crculo polar), por lo que su clima ser mucho
ms fro.
4 Clasifica en intracontinentales y pericontinentales
las siguientes cordilleras: Himalaya, Andes, Alpes, Pirineos, Atlas, Cucaso, Urales.
Intracontinentales

Himalaya, Alpes, Pirineos, Atlas, Urales y


Cacaso

Pericontinentales Andes
5 Estas dos imgenes representan situaciones en
las que se producen los dos tipos de orgenos existentes.

152

6 Completa el siguiente texto:


Hay dos tipos de procesos geolgicos: los externos que
suceden en la superficie y los internos que ocurren en las
capas interiores del planeta. Estos procesos se suceden unos
a otros constituyendo el ciclo geolgico.
7 Relaciona cada concepto con su definicin:
Corrientes de
conveccin

Subduccin

Placas pequeas en las que est fragmentada la


litosfera
Lugares en los que las placas se separan y se
forma una dorsal

Lmites
convergentes

Movimientos de las partculas en el seno de un


fluido caliente

Microplacas

Bordes de las placas que se mueven uno frente


a otro

Bordes
constructivos

Moviendo por el que una placa se introduce por


debajo de otra

8 Cita ejemplos de materiales que conozcas que tengan un comportamiento: elstico, plstico, rgido.
Respuesta libre.

Elstico: goma del pelo, pelota de goma.


Plstico: arcilla hmeda, plastilina.
Rgido: roca, hierro, cristal.

d) Las cordilleras intracontinentales se forman siempre


al colisionar una placa ocenica con una continental.
FALSO.

9 Observa la imagen y contesta las cuestiones:


a) Por qu se han doblado las rocas?
Por las fuertes presiones y altas temperaturas que han tenido
que soportar los materiales.
b) Qu tipo de comportamiento han tenido las rocas?
Un comportamiento plstico (han sufrido una deformacin
y la deformacin permanece).

ACTIVIDADES FINALES
10 Explica el significado de los trminos tectnica y
placas tectnicas.
Tectnica: especialidad de la geologa que estudia las estructuras geolgicas producidas por deformacin, las que
las rocas adquieren despus de haberse formado, as como
los procesos que las originan.
Placas tectnicas: cada uno de los fragmentos en los que
se divide la litosfera terrestre para comprender su funcionamiento dinmico.
11 Localiza en la sopa de letras diez palabras relacionadas con la tectnica de placas.

13 Relaciona los conceptos con su definicin:


FALLA

Pliegue del terreno con forma convexa, forma de A

DIACLASA

Deformacin plstica de las rocas sometidas a presin

PLIEGUE

Fractura de la roca con desplazamiento de los bloques

ANTICLINAL

Fracturas de rocas en la que los bloques siguen unidos

14 Define los siguientes conceptos:


a)
b)
c)
d)
e)
f)

Plano axial de un pliegue


Escarpe de una falla
Ciclo geolgico
Procesos geolgicos
Bordes constructivos
Micropliegues

Plano axial de un pliegue: superficie imaginaria que pasa


por las charnelas de cada estrato.
Escarpe de una falla: diferencia de nivel entre los labios de
una falla.
Ciclo geolgico: conjunto de procesos internos y externos
que afectan a las estructuras geolgicas.
Procesos geolgicos: las trasformaciones que afectan a las
distintas estructuras geolgicas.
Bordes constructivos: extremos de las placas en los que se
genera litosfera.
Micropliegues: pliegues muy pequeos.
15 Escribe un texto en el que utilices las siguientes
palabras: desplazamiento, conveccin, placas, bordes,
cordilleras.

Charnelas

Falla

Labio levantado

Pliegue

Dorsal

Borde constructivo

12 Indica si las siguientes afirmaciones son verdaderas


o falsas:
a) Las masas continentales actualmente se estn separando y nunca ms volvern a juntarse en un nico
continente. FALSO.
b) Los bordes destructivos se producen cuando se acercan dos placas tectnicas en direcciones contrarias.
FALSO.
c) Las placas litosfricas se mueven por las corrientes de
conveccin existentes en la astenosfera. VERDADERO.

Las corrientes de conveccin de los materiales de la astenosfera provocan el desplazamiento de las placas que al
colisionar entre ellas, provocan la aparicin en los bordes
de las cordilleras.
16 Relaciona las columnas:

Charnelas. Pliegue
Labio levantado.. Falla
DorsalBorde constructivo
17 Cuando el planeta se enfre completamente y no
haya corrientes de conveccin en la astenosfera, qu
suceder? Explcalo.
Respuesta libre con evaluacin personal por parte del profesor.

153

3 LA HISTORIA DE LA TIERRA
ACTIVIDADES
1 La imagen representa un momento de la teora planetesimal. Dibjala en tu cuaderno y seala los planetesimales.

5 En una muestra tomada de un estrato hay siete


veces ms tomos de plomo 206 que de uranio 238.
Suponiendo que todos los tomos de plomo proceden de los tomos de uranio, cul es la edad de la
muestra?
Si cada parte de desintegra en 4 510 m. a., para que la proporcin de plomo/uranio llegue a ser 1/8 se necesitan tres
transformaciones as que 4 500 m. a. x 3 = 13 500 m. a.
6 Cmo haramos una datacin relativa de los alumnos
de clase? Qu dato necesitaremos conocer para realizar
una datacin absoluta de los mismos?

a) Cmo se form el Sol?


La acumulacin de materia en el centro del Sistema Solar,
los impactos y la presin produjeron reacciones nucleares
originando nuestra estrella.
b) Cmo se formaron los planetas?
La fuerza gravitatoria fue atrayendo materia sobre los cuerpos mayores (planetesimales), que fueron creciendo hasta
formar los actuales planetas.

Comparar unos con otros, por ejemplo, por orden de edad.


Necesitaramos conocer la fecha de nacimiento de cada uno
de ellos.
7 Por qu no podemos encontrar fsiles en las rocas
magmticas o gneas?
En el proceso de formacin de las rocas magmticas intervienen altsimas temperaturas (en ocasiones se llega a la fusin
de los materiales), por lo que de haber restos fosilizados stos
desapareceran.
8 Observa el dibujo y responde a las preguntas.

2 Completa el siguiente texto:


Para explicar los cambios que a lo largo de su historia ha
ido sufriendo el planeta hay diversas teoras. Por una parte la teora del catastrofismo considera que los cambios
se deben a acontecimientos catastrficos a nivel planetario. Por otra parte la teora del actualismo o gradualismo
considera que los cambios se producen de manera lenta y
gradual. Una tercera teora, el neocatastrofismo, aboga
por cambios graduales, pero no descarta la influencia de
los cambios catastrficos.
3 Escribe un texto en el que se incluyan las siguientes
palabras: nebulosa, supernova, planetesimales, radiactividad.
Respuesta libre.
4 Clasifica en catastrficos y graduales los siguientes sucesos: terremoto, erosin de un ro, tsunami, erosin de un
glaciar, glaciacin, formacin de un meandro, sedimentacin
marina, formacin de un valle en V, erupcin volcnica.

154

CATASTRFICOS

GRADUALES

Terremoto
Tsunami
Erupcin volcnica

Erosin de un ro
Erosin de un glaciar
formacin de un meandro
Glaciacin
Sedimentacin marina
Formacin de un valle en V

a) Crees que es fcil que se hayan fosilizado muchos


restos de seres vivos? Razona la respuesta.
No, las condiciones que han de darse son bastante excepcionales.
b) Relaciona una serie de circunstancias que hayan podido influir en la no formacin de fsiles de algunas
especies.

Descomposicin del cadver.


Regin no sedimentaria.
Cadver devorado por otro ser vivo.
Erosin del estrato en que se encuentra.

ACTIVIDADES FINALES

a) Qu tipo de clima tendran esas zonas en el Carbonfero?

9 Indica si las siguientes afirmaciones son verdaderas


o falsas:

Clima hmedo, tropical, lluvioso y clido.

a) Todas las etapas en las que se divide la historia geolgica de la Tierra tienen la misma duracin. FALSO.
b) La especie humana (Homo sapiens) apareci sobre el
planeta en el Cuaternario hace 200 millones de aos.
FALSO.
c) El estrato que ocupa un nivel superior es de formacin ms reciente que el estrato que ocupa un nivel
inferior. VERDADERO.
d) La teora Gaia afirma que los seres vivos son capaces
de regular las condiciones ambientales para que favorezcan su supervivencia y evolucin. VERDADERO.
10 Haz una breve descripcin de las condiciones ambientales del planeta en el Mesozoico.
Del 251 al 60 m. a. y se conoce como la era de los reptiles. El supercontinente Pangea II se divide en el Trisico en
Laurasia al norte y Gondwana al sur. Durante el Jursico
y el Cretcico los continentes actuales se van formando y
separando.
Al principio predomina el clima rido y continental, al ir fragmentndose el continente; la influencia de los ocanos hace
predominar un clima tropical generalizado.

b) Cul crees que sera la causa de ese clima?


Una diferente situacin de esas masas continentales en el
globo terrqueo.
c) Dnde estaran situadas esas zonas en ese momento
para poder tener ese clima?
Situacin de dichas zonas continentales en la zona ecuatorial
del planeta.
14 Relaciona los conceptos con su definicin:
Eon

Cada una de las tres grandes etapas en que se divide la


historia de la Tierra.

Gradualismo

Afirma que los cambios se producen lentamente y con


los procesos actuales.

Orogenia
Paleontologa

Procesos geolgicos que dan lugar a la formacin de las


cordilleras.
Estudia los fsiles.

15 Interpreta el siguiente corte geolgico:

11 Explica la siguiente afirmacin: La vida en el planeta


ha evolucionado desde formas muy simples hacia las ms
complejas.
Los primeros seres vivos que aparecieron sobre la Tierra eran
formas muy sencillas, unicelulares, bacterias y clulas de tipo
procariota y de nutricin auttrofa. A partir de estas formas
tan simples y gracias a la evolucin natural han ido apareciendo formas de vida ms complejas (pluricelulares, plantas
y por ltimo animales).

a) Qu estrato se form primero, el D o el E?


Primero se forma el estrato inferior, por lo tanto el estrato D
se form antes que el E.

12 Intenta dar una explicacin de cmo se han formado


y cmo han llegado hasta nuestros das las icnitas.

b) Si en M se encuentran huesos de mamut, en qu poca


diras que se form este estrato?

Una pisada o huella de un ser vivo queda marcada en un


material blando (terreno arcilloso) que antes de ser erosionada se endurece, queda sepultada bajo capas de sedimentos cuya presin hace que los materiales sobre los que se
hizo la huella se petrifiquen. Posteriormente, los sedimentos
que la ocultan son erosionados y la icnita aparece en la
superficie.

El mamut es una especie que vivi a principios del Cuaternario, por lo que ese sedimento se form en dicha poca.

13 Sobre un planisferio mudo, colorea las principales


zonas del planeta en las que existen grandes yacimientos
carbonferos.

d) Si en C hay fsiles de peces acorazados, en qu poca


se habr formado este sedimento?

Valoracin del trabajo elaborado por parte del profesor.

c) Cundo tuvo lugar el corte (falla) F?


Por lo dicho anteriormente el sedimento por encima del corte
se form a principios del Cuaternario, por lo que la ruptura
de los estratos es anterior a dicho periodo.

Los peces acorazados habitaron la Tierra en el Cmbrico, por


lo que el sedimento se form en esa poca.

155

4 LA CLULA, UNIDAD DE VIDA


ACTIVIDADES
1 Por qu es necesario cortar tan finamente los materiales para poderlos observar al microscopio?
Para que puedan ser atravesados por los rayos luminosos
(microscopio ptico) o por los electrones (microscopio electrnico).
2 Todas las clulas vegetales tienen cloroplastos?
Razona tu respuesta.

Bacteria
Camello
Bandada de golondrinas
Seres vivos de un bosque
y su medio

Nivel pluricelular
Nivel poblacin
Nivel celular
Nivel de ecosistema

Bacteria - nivel celular


Camello - nivel pluricelular
Bandada de golondrinas - nivel poblacin
Seres vivos de un bosque y su medio - nivel de ecosistema

Tendrn cloroplastos las clulas verdes, esto es, la mayor


parte de las clulas de una hoja y las hojas ms externas de
los tallos jvenes. En ningn caso habr cloroplastos en las
clulas de ninguna raz.

8 Qu diferencias existen entre las imgenes obtenidas con un microscopio ptico y las imgenes de uno
electrnico?

3 Qu tienen de parecido y de diferente los siguientes conceptos: ADN, cromatina, cromosoma?

El microscopio ptico no puede ampliar las imgenes mucho


ms de 1 500 veces y el electrnico permite ampliaciones de
200 000 veces.

La cromatina y el cromosoma estn formados por ADN con


distinto grado de empaquetamiento: la cromatina se observa
slo cuando la clula se encuentra en interfase, y el cromosoma, cuando se est dividiendo.
4 Las clulas de una mosca tienen ocho cromosomas.
Indica cuntos cromosomas poseer una clula de un ala,
de una pata y de un espermatozoide de mosca.
El nmero de cromosomas ser de ocho en las clulas del ala
y en la pata, mientras que ser de cuatro en el espermatozoide, teniendo en cuenta que ese espermatozoide se unir
a un gameto femenino para dar lugar a una clula de ocho
cromosomas.

9 Es correcto decir que los microorganismos son todos unicelulares? Razona la respuesta.
La mayor parte son unicelulares, pero tambin hay algunos
pluricelulares. Y es que microorganismo hace referencia a
que para su estudio se requiere el microscopio ptico.
10 Enuncia los aspectos fundamentales de la teora celular.
La clula es la unidad estructural, fisiolgica y gentica de
los seres vivos.
11 Cul es la diferencia principal entre las clulas procariotas y las eucariotas?

ACTIVIDADES FINALES

Las procariotas carecen de ncleo y las eucariotas s tienen


ncleo.

5 A qu nivel de organizacin pertenecen las siguientes materias?

12 Quin es mayor, el ncleo de una clula eucariota


o el de una procariota?

a) Pirita
c) Hgado
e) Bacteria

La procariota no tiene ncleo.

b) Agua
d) Sodio
f) Msculo

a) abitico; b) abitico; c) bitico; d) abitico; e) bitico; f)


bitico.
6 El individuo es el nivel ms complejo que se puede
alcanzar? Razona la respuesta.
No. Ms complejo es el nivel de poblacin (formado por individuos de la misma especie que viven en un determinado
territorio) y el de ecosistema (formado por diferentes poblaciones de individuos distintos que se relacionan entre s y
con el medio).

156

7 Relaciona con flechas las dos columnas:

13 Con los datos que se indican a continuacin indica


si las clulas son animales, vegetales o de los dos tipos:
a)
b)
c)
d)
e)

Posee centriolo. Animal.


Tiene mitocondrias. Animal y vegetal.
Tiene pared celular. Vegetal.
Tiene ADN. Animal y vegetal.
Posee cloroplastos. Vegetal.

14 Completa el siguiente texto:


El cido desoxirribonucleico, tambin llamado ADN, es una
molcula muy grande, formada por la unin de muchos mi-

les de molculas llamadas nucletidos. Estos nucletidos


son de cuatro tipos: de adenina, de guanina, de citosina
y de timina.

f)

15 Explica si son verdaderas o falsas las siguientes afirmaciones:

g)

a) Los ejemplares transgnicos tienen genes que no son


buenos. FALSO. Los ejemplares transgnicos tienen genes (ADN) de otras especies.
b) La citocinesis es la meiosis. FALSO. La citocinesis es
la divisin del citoplasma al final de la mitosis o de la
meiosis.
c) Una clula del rin humano tiene 23 cromosomas.
FALSO. Una clula del rin humano tiene 46 cromosomas.
d) Una mujer tiene 46 vulos. FALSO. Una mujer tiene cientos de miles de vulos (al principio de su poca frtil).
e) La divisin del citoplasma de una clula de un jazmn
se realiza por estrangulamiento. FALSO. La divisin del

h)

i)

citoplasma de una clula de un jazmn (vegetal) se realiza


por tabicacin.
Para ver una clula necesitamos el microscopio electrnico. FALSO. Para ver una clula nos sobra el microscopio ptico.
La interfase es una fase del ciclo de vida de una clula
en la que sta se est dividiendo. FALSO. En la interfase
la clula no se est dividiendo.
La informacin gentica es distinta en los distintos
seres vivos porque cada uno tiene diferentes nucletidos. FALSO. Todos los seres vivos tienen los mismos
cuatro tipos de nucletidos; la informacin gentica es
distinta porque cada ser vivo posee los nucletidos ordenados de forma diferente.
Los virus son bacterias procariotas. FALSO. Los virus no son
bacterias, ni, por tanto, procariotas. Son formas acelulares.

16 Dibuja una clula vegetal.


Respuesta abierta.

157

5 GENES Y HERENCIA
ACTIVIDADES
1 Razona si un individuo puede tener un fenotipo diferente de lo que indica su genotipo.
Casi todos los genotipos pueden ser modificados por el ambiente. Por ejemplo: un genotipo pelo rubio se va modificando con la edad a un fenotipo pelo castao, un fenotipo varn
no calvo es muy probable que en la vejez se manifieste como
varn calvo, etctera.
2 En qu se diferencia un gen de un alelo? Razona la
respuesta.
Los alelos son las diferentes formas que tiene un gen de manifestarse. Por ejemplo, el gen para el color de las semillas de
los guisantes se puede expresar de dos maneras, es decir, posee dos alelos: semillas de color amarillo y de color verde.
3 Un ratn blanco y homocigoto (aa) se cruza con otro
negro heterocigoto. Sabiendo que el alelo negro domina
sobre el blanco, razona cul es la proporcin de fenotipos y genotipos de la descendencia.
aa
blanco
gametos

Aa
negro

x
a

Sea A el alelo responsable del color negro, y a el que determina los ojos rojos. En la poblacin puede haber, por tanto,
tres genotipos: AA, Aa y aa; y dos fenotipos: ojos negros (AA
y Aa) y ojos rojos (aa).
6 En una cierta planta, el color de las flores es producido
por un gen que tiene dos alelos: F es dominante y determina el color rojo y f es recesivo y es responsable de las flores
blancas. Escribe el genotipo de las siguientes plantas:
a)
b)
c)
d)

Heterocigotos Ff
Homocigotos FF y ff
De flores rojas FF y Ff
De flores blancas ff
7 Qu diferencia hay entre homocigoto y raza pura?

Ninguna. La diferencia es histrica: en un primer momento


se utiliz raza pura.
8 Una especie posee un total de 20 cromosomas. Responde razonadamente:
a) Cuntos cromosomas sexuales tendr?
Poseer 2, uno X y otro Y.

b) Cuntos autosomas tendr?


Si dos son sexuales, el resto sern los autosomas, es decir, 18.

Aa
negro

Aa
negro

aa
blanco

aa
blanco

De acuerdo con el cruzamiento, la proporcin de fenotipos


es: por cada dos descendientes de color negro se obtienen
otros tantos de color blanco, luego: 1 negro:1 blanco.
En cuanto al genotipo, por cada dos descendientes Aa se
obtienen otros tantos aa, luego: 1 Aa:1 aa.
4 Explica si hay alguna diferencia, en cuanto al nmero de cromosomas, entre las clulas de un testculo y un
espermatozoide.
S, las clulas que forman un testculo son clulas somticas
y, por tanto, son diploides, mientras que los espermatozoides
son haploides. En consecuencia, los espermatozoides poseen
la mitad de cromosomas que las clulas de los testculos.

ACTIVIDADES FINALES
5 Supongamos que en una determinada poblacin
de animales el color de los ojos se debe a una pareja de
alelos: uno dominante determina ojos negros y otro recesivo es responsable de los ojos rojos. Razona cuntos
genotipos y fenotipos diferentes habr en esa poblacin
animal.

158

c) Cuntos cromosomas poseern los individuos monosmicos de esa especie? Y los trismicos?
Los monosmicos tendrn un cromosoma de menos: 19.
Los trismicos poseern un cromosoma de ms: 21.
9 En la especie humana, el albinismo es debido a un
alelo recesivo respecto al dominante normal. Una mujer
albina se casa con un varn que no lo es y tienen un solo
hijo albino. Se puede saber cul es el genotipo de los
miembros de la familia?
Llamemos A al alelo que determina la coloracin normal
y a al responsable del albinismo.
Si la mujer es albina, necesariamente es aa. Si el varn no lo
es, llevar al menos un alelo A con toda seguridad. Si han
tenido un hijo albino, que es aa, es porque cada uno de los
dos progenitores ha aportado un alelo a. En consecuencia,
el varn ser heterocigoto normal.
El cruzamiento es:
aa
albina
gametos

x
a

Aa
Aa
normal normal

Aa
normal
A

aa
albino

aa
albino

10 El sndrome de Patau es una enfermedad que se


manifiesta con unos importantes problemas cardiacos,
la presencia de labio leporino y otras anomalas. Esta
alteracin es una trisoma del par 13. Explica cmo ser
el idiograma de una persona con este sndrome.

c) Separa las parejas para formar la dotacin de cromosomas caracterstica de los gametos. Cuntos
cromosomas contienen esos gametos?

Las personas con esta alteracin tendrn una pareja de todos los cromosomas menos del par 13, de la que habr tres
representantes. Poseern, por tanto, 47 cromosomas.

d) Cuntos cromosomas hay? A qu especie pertenecern?

11 Si te dicen que un determinado gen es autosmico


recesivo, qu te estn diciendo?
Que es un gen recesivo respecto a otro dominante y que
se encuentra en los cromosomas no sexuales, en los autosomas.

23 cromosomas.

46 cromosomas. Probablemente de la especie humana.


e) De qu sexo es el individuo con ese cariotipo?
Varn (XY).

12 Fotocopia y ampla el recuadro con los cromosomas


que aparece ms abajo y realiza las siguientes operaciones:
a) Recorta los cromosomas de la fotocopia por las lneas
de puntos.
b) Empareja los cromosomas homlogos y ordena las
parejas por tamaos. Aydate de los nmeros de la
base y de las letras que figuran en su interior. Qu
representan esas letras?
Diferentes alelos del mismo gen.

159

6 LA EVOLUCIN DE LA BIOLOGA
ACTIVIDADES

5 Cules son los pasos para realizar una transferencia


gnica entre organismos?

1 Explica cules son las etapas necesarias para modificar genticamente un determinado ser vivo.

Localizar el gen que se quiere transferir. Sacar el gen. Introducir ese gen en la clula receptora mediante un vector.

Localizar el gen que se quiere transferir y extraerlo del ser


vivo; introducir ese gen en la clula receptora. Requiere un
vector: un virus o unos fragmentos especiales de ADN de las
bacterias que se denominan plsmidos; una vez unido el gen
al vector, se introduce ste en la clula receptora.

6 Identifica los conceptos de las siguientes definiciones:

2 Explica si la ingeniera gentica podr mejorar la


vida en los prximos aos. Puedes imaginar los efectos
beneficiosos de esta tcnica biolgica? Y los perjudiciales?
Evidentemente. Un uso correcto de la ingeniera gentica
puede mejorar la vida de muchas personas en determinadas
regiones:
Si se consiguen ejemplares resistentes a los herbicidas y plaguicidas, esto supondr un ahorro en el cultivo al no tener
que utilizar esos productos, lo que podr generar una rebaja
de los precios.
La produccin de plantas resistentes a condiciones climticas
desfavorables puede permitir la utilizacin de vegetales en
regiones muy alejadas de su ambiente natural.
Insertar genes puede permitir que se produzcan alimentos
con sustancias qumicas que no contienen de una manera
natural: vitaminas, hormonas, etctera.
El uso de la ingeniera gentica sin los controles de seguridad
adecuados tambin puede producir sustancias que al ser
ingeridas daen nuestro organismo.

ACTIVIDADES FINALES
3 Qu es la biotecnologa? Cules son sus principales
aplicaciones?
La biotecnologa es un conjunto de tcnicas en las que se
manipula el material gentico de diferentes seres vivos para
obtener sustancias de inters para el ser humano y el medio
natural.
Se utiliza en la fabricacin de algunas hormonas como la
insulina, el diagnstico y la deteccin precoz de algunas enfermedades genticas, mejora de las producciones agrcola
y animal, lucha contra la contaminacin, produccin de energas alternativas, etctera.
4 Qu es el ADN pasajero? Para qu se utiliza?
Es el ADN que se introduce en un ser vivo procedente de
otro. Contiene la informacin gentica que se desea incorporar.

160

a) Tcnicas en las que se manipula el material gentico


de diferentes seres vivos con el fin de conseguir sustancias tiles para el ser humano y el medio natural.
Ingeniera gentica.
b) Estructura u organismo biolgico que se usa para
introducir un gen en una clula. Vector.
c) Tambin se llaman as los organismos modificados
genticamente. Transgnicos.
d) Hormona producida por la hipfisis en condiciones
naturales, pero que tambin se puede obtener por
ingeniera gentica. Hormona de crecimiento.
e) Proceso que permite obtener una o varias copias
idnticas de un determinado individuo. Clonacin.
7 Explica qu es una clula totipotente. Indica, razonadamente, si las siguientes clulas lo son: clula de la piel, clula
del hgado, clula del tallo de una planta, vulo, cigoto.
Son las clulas que pueden especializarse en cualquier tipo
de tejido adulto. Slo son totipotentes las clulas del tallo de
una planta y el cigoto.
8 Completa el siguiente texto:
La clonacin reproductiva es la introduccin del ncleo de
una clula adulta en un ovocito, que es un vulo inmaduro,
al que previamente se le ha quitado el ncleo. Despus se
activa la divisin del ovocito para conseguir un embrin
que se implantar en el tero donde se desarrollar el
embarazo.
9 Responde brevemente:
a) Cuntas molculas de ADN hay en una clula del rin de cualquier persona? 46.
b) Cuntos genes tenemos los humanos? Alrededor de
25 000.
c) En qu ao se finaliz el Proyecto Genoma Humano?
2003.
d) Cuntos cromosomas tiene un vulo de mujer? 23.
e) Qu es la hemofilia? Una enfermedad en la que en las
hemorragias no se produce la coagulacin de la sangre.
10 Explica razonadamente qu importancia tiene en la
agricultura que una planta sea resistente a los herbicidas
que destruyen las malas hierbas.
Si una planta es resistente a los herbicidas, cuando se utilizan
estos compuestos se eliminan las malas hierbas, pero la plan-

ta no se ve afectada por ellos. Al eliminar las malas hierbas, se


destruyen las plantas que pueden competir por el agua y los
nutrientes del suelo con el vegetal que se quiere cultivar. Por
tanto, destruir las malas hierbas mejora los cultivos.
11 Indica si son verdaderas o falsas las siguientes afirmaciones y si son falsas explica por qu:
a) La insulina es una hormona que fabrica el hgado y que
se puede obtener por ingeniera gentica. FALSO.
La insulina es una hormona pero no la fabrica el hgado
sino el pncreas.
b) Un padre y su hijo deben ser idnticos genticamente. FALSO.
Un padre y su hijo slo coinciden en la mitad de la informacin gentica.
c) T y yo nos diferenciamos en el 2 % del ADN. FALSO.
Las diferencias entre las personas se deben al 0,02 % de
su ADN, no al 2 %.
d) Los plsmidos son vectores que se encuentran en los
virus y que se utilizan para introducir genes en ciertas clulas. FALSO.
Los virus no poseen plsmidos, son propios de bacterias.
e) Si tuvieras un hermano gemelo podras decir que es
un clon tuyo. VERDADERO.

12 Explica razonadamente qu sucedera si hacemos el


siguiente experimento y suponemos que todo el proceso
llega felizmente a trmino: de una de tus clulas sacamos
un ncleo que introducimos en un vulo de mujer al que
previamente tambin le hemos extrado el ncleo. La
nueva clula con tu informacin gentica se desarrolla
hasta el estado adulto.
a) Cmo sera el nuevo ser en relacin contigo?
Sera idntica a m desde el punto de vista gentico, ya
que posee los mismos genes, en todas las clulas, que
tengo yo en todas las clulas (excepcin hecha de los
gametos).
b) Crees que si se pudiera realizar tendra algn inters?
Ninguno. Dado que es un ser humano tendra la misma categora de persona que yo. Puede acaso utilizarse como
donante de mis rganos?
c) Ves algn problema tico a este proceso?
Es un asunto para discutir en la clase.

161

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

ACTIVIDADES
1 Nombra cinco seres auttrofos y cinco hetertrofos
que pudieras encontrar al pasear por los alrededores del
centro.
Respuesta abierta.
2 Identifica a qu procesos corresponden las reacciones siguientes:

La diferencia corresponder al gasto en respiracin:


R = 20 810 kcal/m2/ao 12 050 kcal/m2/ao = 8 760 kcal/m2/ao
6 En mi jardn tengo un rosal en el que viven 40 pulgones, que beben su savia, y dos mariquitas, que se
alimentan de los pulgones. Representa la pirmide de
individuos. Tiene forma de pirmide?
La pirmide de individuos es proporcional al nmero de individuos. Quedara algo similar a sta y, por tanto, no tiene
forma de pirmide.

a) 6 CO2 + 6 H2O + energa del Sol C6 H12 O6 + 6 O2


Fotosntesis.
b) C6 H12 O6 + 6 O2 6 CO2 + 6 H2O + energa
Respiracin.
3 Reconoce cuatro cadenas trficas que forman la red
de la Figura 7.4 e indica a qu nivel trfico pertenece cada
individuo.
1) Bellota (fruto del roble), Productor Ardilla, Consumidor
primario guila, Consumidor secundario.
2) Hojas del roble, Productor Oruga (larva de mariposa),
Consumidor primario Coleptero, Consumidor secundario Rana, Consumidor secundario Zorro, Consumidor
secundario.
3) Hojarasca del roble, Productor Lombriz, Consumidor
primario Pjaro insectvoro, Consumidor secundario
guila, Consumidor secundario.
4) Hojas del roble, Productor Oruga (larva de mariposa),
Consumidor primario Pjaro insectvoro, Consumidor
secundario guila, Consumidor secundario.
4 Teniendo en cuenta la regla del 10 %, cul de las siguientes cadenas trficas permite alimentar a un mayor
nmero de personas?
a) Maz Personas
b) Maz Gallinas Personas
La primera cadena (Maz Personas) permite alimentar a un
mayor nmero de personas, ya que disponen del 10 % de la
biomasa contenida en el nivel maz.
En la segunda cadena (Maz Gallinas Personas), al tener
un nivel ms, slo llega un 1 % de la biomasa del nivel del maz.
De ste ha pasado el 10 % al nivel de las gallinas y slo pasa un
10 % de este ltimo al nivel ocupado por las personas.
5 En una pradera, los productores tienen una produccin bruta de 20 810 kcal/m2/ao y una produccin neta
de 12 050 kcal/m2/ao. A qu se debe esa diferencia?

162

7 Representa la cadena trfica del ejercicio anterior.


Podra tener ms eslabones esa cadena?
Rosal Pulgones Mariquitas
No, por la regla del 10 % (el nivel de las mariquitas tiene poca
biomasa).
8 Vuelve a responder ahora las preguntas de la pgina
inicial de la Unidad.
1. Qu tiene una planta que puedan necesitar los animales?
Materia orgnica que les sirva de alimento.
2. Qu reciben los hongos tanto de los animales como
de las plantas?
Materia orgnica, en forma de restos y cadveres, que ser
utilizada como alimento por los hongos.
3. Por qu parece que hay un hueco entre los hongos
y las plantas?
Los hongos descomponen la materia orgnica y la transforman en materia inorgnica, que pasa al suelo. Los vegetales
toman estas sales del suelo. Parece que hay un hueco en
este ciclo, porque los vegetales no toman las sales directamente de los hongos.
4. Qu es lo que estn cogiendo las plantas?
Sales minerales del suelo.
5. Para qu lo necesitan?
Para sintetizar la materia orgnica mediante la fotosntesis.
6. Qu crees que representa el esquema?
El ciclo de la materia en los ecosistemas

7. Crees que alguna vez se detiene esta rueda?

Productor

Si se detuviera, desaparecera el ecosistema.

Consumidor primario

8. Si no es as, con qu energa se mueve?

Consumidor secundario

Con la energa del Sol, que es la que utilizan los productores


para sintetizar materia orgnica. Esta materia orgnica va pasando de unos niveles a otros y vuelve al suelo como materia
inorgnica gracias a los descomponedores.

Descomponedor

9 Es posible que algn tomo de carbono que forma


tu cuerpo haya sido parte de un dinosaurio en el pasado?
Describe cmo ha podido ocurrir.

a)
b)
c)
d)

La forma de conectar la materia orgnica de los dinosaurios


con la actualidad sera a travs de los combustibles fsiles.
Es decir, los restos de la materia orgnica del pasado pueden haberse transformado en combustibles fsiles. stos son
utilizados y transformados en CO2, que puede ser captado
por una planta e incorporado a su organismo mediante la
fotosntesis. Si sa es una planta comestible, puedes haberte alimentado de ella y ahora ese tomo de carbono forma
parte de tu organismo.
10 Podra llegar a agotarse el fsforo en un ecosistema?
S, porque puede ser arrastrado por el agua hacia el mar. En el
ecosistema marino, los restos de los seres vivos van cayendo
al fondo, donde son transformados de nuevo en sales minerales por los descomponedores. Pero en las profundidades,
donde no llega la luz, no hay organismos fotosintticos. Los
fosfatos pueden permanecer en el fondo y transformarse
en rocas que al cabo de miles o millones de aos volvern
a emerger.
Es decir, los fosfatos pueden perderse de los ecosistemas
terrestres al quedar atrapados en los fondos marinos.

14 Completa los huecos de las siguientes cadenas trficas:


Fitoplancton zooplancton sardina
Margarita saltamontes golondrina
Hiedra pulgn mariquita
Trigo ratn halcn

15 Qu diferencia existe entre la produccin neta y la


produccin bruta de un ecosistema?
La produccin neta es la que queda despus de haber restado el gasto en respiracin.
16 En una dehesa viven encinas, brezos, hongos, conejos, linces, guilas, gorriones, orugas, araas.
a) Cules de estos organismos realizan la fotosntesis?
Y la respiracin?
Las encinas y los brezos realizan la fotosntesis. La respiracin
la realizan todos.
b) Construye la red trfica de la dehesa.
Encina

guila
Lince

Orugas

ACTIVIDADES FINALES
11 De qu forma obtienen la materia orgnica los seres auttrofos? Y los hetertrofos?

Liebre
Rosal
Halcn
Zorro
Roble
Vaca
Champin

Gorrin
Conejo
Araas
Brezo

Los auttrofos obtienen la materia orgnica mediante la fotosntesis. Los hetertrofos la obtienen alimentndose de los
auttrofos o de otros hetertrofos.
12 Mediante qu proceso obtienen energa de la materia orgnica los seres hetertrofos? Y los auttrofos?
Tanto los hetertrofos como los auttrofos obtienen energa
mediante la respiracin.
13 Relaciona los trminos de la columna de la izquierda
con los organismos de la columna de la derecha:

Hongos

c) A qu nivel trfico pertenece cada organismo?


Productores: encina y brezo.
Consumidores primarios: orugas y conejos.
Consumidores secundarios: araas, gorriones, linces y guilas.
Descomponedores: hongos.

163

LA MATERIA Y LA ENERGA
EN LOS ECOSISTEMAS

d) Hay alguno que ocupe ms de un nivel trfico?


El gorrin puede ser consumidor primario y secundario, ya
que tiene una dieta variada.
e) Cmo entra la energa en esta red? Cmo circula
por ella? Cmo sale?
La energa entra en forma de energa del Sol. Es captada por
los productores y circula de unos niveles a otros contenida
en la materia orgnica que forma el alimento. Y sale en forma
de calor liberado al medio por todos los organismos cuando
utilizan la energa.

Se transmite un 10 % del nivel anterior. Se cumple la regla


del 10 %.
b) Calcula la produccin neta de cada nivel y representa
el ecosistema en forma de pirmide.
Pn = Pb R
Productores: Pn = 900 150 = 750 cal/cm2/ao

f) Qu ocurrira en este ecosistema si desapareciesen


los productores? Y si desaparecieran los descomponedores?

Consumidores primarios: Pn = 90 30 = 60 cal/cm2/ao

Si desapareciesen los productores se parara el ciclo de la


materia. Los consumidores primarios desapareceran al no
tener alimento. Y, por la misma razn, desapareceran los
consumidores secundarios.

18 De dnde obtienen los productores el carbono, el


nitrgeno y el fsforo para sintetizar sus molculas? Y
los consumidores? Y los depredadores?

Si desapareciesen los descomponedores, tambin se parara el ciclo de la materia. Los productores agotaran las sales
minerales del suelo y no podran sintetizar ms materia orgnica.
17 En un ecosistema se obtienen los siguientes datos:

164

a) Qu proporcin de la energa que contiene cada


nivel se transmite al siguiente? Se cumple alguna
regla?

Nivel trfico

Produccin bruta
cal/cm2/ao

Gasto respiratorio
cal/cm2/ao

Productores

900

150

Consumidores
primarios

90

30

Consumidores
secundarios

Consumidores secundarios: Pn = 9 6 = 3 cal/cm2/ao

Los productores obtienen el carbono de la atmsfera en forma de CO2 y el nitrgeno y el fsforo del suelo, en forma
de nitratos y fosfatos. Los consumidores obtienen los tres
elementos de los alimentos. Y los descomponedores tambin los obtienen de los restos de los que se alimentan.
19 El uso de derivados del petrleo ha aumentado la
cantidad de CO2 en la atmsfera, y eso ha producido un
incremento del efecto invernadero. Con qu impacto
medioambiental se relaciona este problema?
Este problema se relaciona con el cambio climtico y sus
consecuencias.

EL EQUILIBRIO DE LOS ECOSISTEMAS


ACTIVIDADES
1 En una isla hay 842 gaviotas, de las que 520 estn en
edad reproductora (aproximadamente el 50 % son hembras). Por trmino medio se obtienen dos cras por cada
pareja. En ese mismo ao se mueren 230 entre adultos y
polluelos. Calcula la tasa de crecimiento de la poblacin.
La poblacin est en fase de crecimiento o en vas de
extincin?
Si se obtienen 2 cras por pareja de media y hay 520 adultos (50 %
machos y 50 % hembras), quiere decir que nacen 520 cras.
b = 520
d = 230
La tasa de crecimiento ser: r = b d = 520 230 = 290
La poblacin est en fase de crecimiento, porque la tasa de
crecimiento es mayor que cero.
2 Qu ocurrira con las poblaciones de presa y depredador si se instala en el ecosistema una nueva especie
que tambin se alimenta de esas presas?
Si se instala un nuevo depredador que tambin vive de esas
presas, la poblacin de presas disminuir, porque hay el doble de depredadores.
La primera poblacin depredadora tambin disminuir, al
menos al principio. Se establece una competencia por el
alimento entre ambas poblaciones y una de las dos puede
llegar a desaparecer.
3 Un talud de una carretera recin construida puede
ser un buen ejemplo de sucesin primaria. Describe las
etapas por las que pasar hasta llegar a ser un ecosistema maduro.
Se puede resumir en las siguientes etapas:
Se produce la meteorizacin de la roca madre por los
agentes atmosfricos. Eso disgrega y altera la roca.
Contina la alteracin al instalarse los primeros colonizadores: lquenes y musgos.
Cuando hay suelo suficiente se establecen las primeras
plantas herbceas de crecimiento rpido. Y, junto con
ellas, los primeros herbvoros y sus depredadores.
Algunas plantas herbceas son sustituidas por matas y
arbustos. Aparecen nuevos animales, generalmente de
mayor tamao que los anteriores.
Por ltimo, se instalan los rboles que requieren mayor
profundidad de suelo.
4 Describe los pasos de la sucesin secundaria que se
dar en un bosque en el que ha habido un incendio y
se ha perdido prcticamente todo el suelo por erosin.
La sucesin es similar al caso anterior, pero saltndose los
dos primeros pasos. Las primeras plantas que se instalan son
plantas pirfilas como la jara, entre los arbustos, y los eucaliptos y pinos resineros, entre los rboles.

5 Busca informacin sobre la plaga de topillos sufrida


en Castilla y Len en el verano de 2007.
Los alumnos, tras buscar informacin, fundamentalmente va
Internet, comprobarn cmo el crecimiento desmesurado
del tamao de una poblacin tiene consecuencias negativas
para el resto de las poblaciones.
En Castilla y Len, la plaga, que se inici como un brote focalizado en Tierra de Campos, lleg a afectar a 400 000 hectreas de siete provincias de la comunidad, con una densidad
de unos 1 500 topillos por hectrea. Esta especie se reproduce en ciclos cada 21 das, con camadas de entre cinco y doce
cras. Afectaron a los cultivos, al agua...
Tambin se puede hacer hincapi en los mtodos de lucha
biolgicos contra las plagas. Por ejemplo, en este caso, existen depredadores naturales (rapaces, comadrejas, zorros,
cigeas...) y plantas que los ahuyentan (estramonio, belladona, ruda, cebolla, ricino...).
6 Existen animales que mantienen constante su temperatura corporal y otros que son incapaces de regularla.
Qu estrategias utilizan estos ltimos para hacer frente
a las temperaturas extremas?
Buscando informacin, encontrarn adaptaciones como los
animales que hibernan o se aletargan en pocas fras, las
vboras y lagartijas que toman sol en las rocas, los peces que
cambian de profundidad dentro del agua para encontrar
una temperatura adecuada, los animales del desierto que
se entierran bajo la arena durante el da, los insectos que
calientan sus msculos de vuelo hacindolos vibrar en su
lugar...
7 En el centro El Acebuche del parque nacional de
Doana est realizando un programa de cra en cautividad del lince ibrico. Lee la informacin sobre esta
especie que hay en la primera pgina de la Unidad y
responde:
Crees que se pueden reintroducir los animales obtenidos
en su hbitat natural en las actuales condiciones o deberamos tomar algunas otras medidas para que tuviera xito
el programa?
Adems de continuar con programas de cra en cautividad,
deberamos incidir sobre los aspectos que han llevado al lince
al borde de la extincin: proteger las reas donde habita,
controlar sus presas, etctera.

ACTIVIDADES FINALES
8 Se denomina resistencia ambiental al lmite que impone el ambiente al crecimiento de una poblacin. Qu
factores componen esta resistencia ambiental?

165

8 EL EQUILIBRIO DE LOS ECOSISTEMAS


Los factores que componen la resistencia ambiental pueden ser tanto recursos (agua, refugio, alimento) como interacciones con otras poblaciones.
9 En una pradera de 1 hectrea viven 600 conejos.
En una granja de 300 m2 viven 500 conejos.
a. Cul de las dos poblaciones de conejos tiene mayor densidad? Y mayor tamao?
1 hectrea = 10 000 m2, luego tiene mayor densidad la
poblacin que vive en la granja (500/300 = 1,7 conejos/
m2) que la que vive en la pradera (600/10 000 = 0,06 conejos/m2).
Sin embargo, tiene mayor tamao la poblacin de conejos
que vive en la pradera (600 conejos > 500 conejos).
b. Cul de los dos parmetros, tamao y densidad,
nos indica mejor la situacin de la poblacin?
La densidad de la poblacin es un mejor indicativo de
la situacin en la que se encuentra la poblacin, ya que
nos puede dar una idea de la disponibilidad de recursos:
alimento, refugio, etctera.

12 Tanto la depredacin como la competencia son relaciones en las que una de las especies sale perjudicada. Por qu decimos entonces que son beneficiosas
para el ecosistema porque mantienen el equilibrio y
la diversidad en los mismos?
Son beneficiosas para el equilibrio de las poblaciones que
constituyen la comunidad del ecosistema. Un ejemplo lo
tenemos en el ejercicio anterior.
13 El galpago de Florida es una tortuga de origen
americano que se vende en nuestro pas como mascota. Algunos animales se han escapado y otros han
sido abandonados por sus dueos. Esto ha provocado
que en algunas zonas esta especie se haya convertido
en una plaga. Describe por qu ha aumentado tanto
su nmero. Se te ocurre alguna medida que se podra
adoptar para resolver este problema?

10 Podrn ocupar el mismo nicho ecolgico dos especies que habitan en ecosistemas distintos?

Esta especie, que no es autctona, no tiene depredadores, ni parsitos, ni competidores en los ecosistemas de
nuestro pas, por lo que crece desmesuradamente y se
transforma en plaga.

Si habitan en ecosistemas distintos no se encontrarn y no


competirn por los mismos recursos. Por lo tanto, podrn
tener el mismo nicho ecolgico. Se denominan especies
vicarias.

Las medidas que se pueden adoptar en estos casos van


desde la educacin ambiental para evitar su abandono
hasta la bsqueda de depredadores que controlen el tamao de estas poblaciones en la naturaleza.

11 El rebao de ciervos de la meseta del Kaibab (Arizona) tena 4 000 individuos. En 1907 se concedi licencia
para cazar pumas, coyotes y lobos, que son depredadores de los ciervos. En 1918, la poblacin de ciervos
haba aumentado hasta 40 000 individuos, pero la escasez de alimentos provoc que en los inviernos de
1925 y 1926 muriera el 60 % del rebao.

14 Los pinginos son aves adaptadas a vivir en el


agua. Cundo se desplazan, nadan o vuelan? En qu
consiste su adaptacin?

a. Cul fue la causa del aumento de la poblacin entre 1907 y 1918? Y de la gran mortandad de 1925
y 1926?
En 1907 se empiezan a matar los depredadores de los ciervos, por lo que, al haber menos, matarn a menos ciervos
y la poblacin aumentar esos aos.

166

Controlar la poblacin de ciervos, concediendo, por


ejemplo, licencias para su caza, y vedando la caza de
las especies depredadoras hasta restablecer el equilibrio.

Es una especie que ya no vuela en sentido estricto, es decir, por el aire. Se ha adaptado a pescar y a vivir en las
aguas ocenicas. Nada utilizando sus alas transformadas
y parece que vuela en el agua.
15 La primitiva atmsfera de la Tierra no tena oxgeno. A qu se debi el cambio a las condiciones actuales?

La gran mortandad de 1925-1926 se debi a la escasez de


alimentos provocada por la superpoblacin de los aos
anteriores.

A la actividad de las primeras bacterias fotosintticas que


liberaban O2 a la atmsfera. Como el proceso fotosinttico era muy ventajoso, stas se hicieron muy abundantes y la atmsfera se fue enriqueciendo tanto en este
elemento, que condicion la evolucin posterior de los
seres vivos.

b. Qu soluciones sugeriras para recuperar el equilibrio?

16 Busca en esta sopa de letras los nombres de 18 animales en peligro de extincin.

H
U
C
K
B
A
L
L
E
N
A
A
Z
U
L

Y
G
T
B
S
J
I
A
J
O
U
D
S
S
I

X
R
H
U
D
B
N
S
N
V
A
T
A
L
O

B
U
C
S

F
C
E
O
I
S
R
R
A
B

O
L
O
J
U
S
E
G
M
E
C
O
G
I
E

M
L
D
O
L
L
I
D
A
M
R
A
B
H
A

A
A
R
C
L
P
B
C
C
E
U
G
I
E
T

T
C
A
N
A
A
E
K
O
A
L
A
I
S
U

O
A
P
K
Z
I
R
H
F
A
A
S
F
T
N

P
N
O
A
G
U
I
L
A
R
E
A
L
U
R

O
T
S
H
N
A
C
F
I
O
I
I
A
R
O

P
O
O
S
O
P
O
L
A
R
O
N
I
I
J

I
R
I
N
O
C
E
R
O
N
T
E
E
O
O

H
A
L
C
O
N
P
E
R
E
G
R
I
N
O

N
D
I
D
A
L
C
E
G
I
G
A
N
T
E

17 Explica la siguiente frase: La conservacin ex situ


de una especie no tiene sentido sin la conservacin de los
espacios naturales.
Cuando una especie se encuentra en peligro de extincin,
suele deberse a alteraciones provocadas en su hbitat natural. Por eso, para recuperar una especie en esa situacin, no
slo debemos cuidarla en espacios destinados a ese fin, sino
que, adems, debemos resolver los problemas de su espacio
natural que han llevado a la situacin de riesgo.

167

9 LA EVOLUCIN DE LOS SERES VIVOS


ACTIVIDADES
1 Un delfn es un mamfero adaptado a la vida en el
mar. Si comparas sus aletas con los brazos de un ser humano, diras que son rganos homlogos o anlogos?
Y si las comparas con las aletas de una sardina?
Son rganos homlogos, ya que en ambos casos se trata de
extremidades anteriores que salen de la cintura escapular.
Si las comparamos con las aletas de una sardina ocurrira lo
mismo.
2 Sabiendo que Australia se separ del resto de los
continentes hace 140 millones de aos, intenta explicar
por qu el canguro y el koala slo viven en Australia.
Hace 140 millones de aos, cuando Australia se separ del
resto de los fragmentos que formaban Gondwana, comenz
la evolucin por separado de las especies de la flora y la
fauna de todos esos fragmentos. Por eso existen especies
exclusivas de cada una de esas zonas. En Australia se generalizaron los marsupiales, que no existen en ningn otro
continente.

Unos ratones de pradera migran al bosque. Las mutaciones


que se seleccionen en el nuevo ambiente no sern las mismas
que las que se seleccionen en la pradera, por lo que ambas
poblaciones evolucionarn de forma independiente. Transcurrido un largo periodo de tiempo, las dos poblaciones de
ratones presentarn mltiples diferencias; algunas de ellas,
como el tamao del cuerpo, pueden hacer imposible la reproduccin entre ellos. De esta forma, habr aparecido una
nueva especie.
5 Qu debera ocurrir para que las dos variedades
de la mariposa del abedul descritas en la actividad inicial de
la Unidad dieran lugar a especies distintas?

3 Compara la explicacin que daban Lamarck y Darwin al origen de las actuales jirafas. Cul es la principal
diferencia entre las dos teoras?

Que surgiera una barrera reproductiva entre las dos variedades y durante un cierto tiempo evolucionaran por separado
de tal forma que se diferenciasen y no pudieran ya reproducirse, originando una descendencia frtil.

Segn Lamarck, las primitivas jirafas se estiraran para alcanzar las ramas ms altas de las acacias, por lo que se les alarg
el cuello y las patas. Estas nuevas caractersticas fueron transmitidas a su descendencia, que naci con patas y cuello ms
largos. Y as hasta el tamao actual.

6 Dibuja una clula eucariota e indica cules de sus


orgnulos pudieron surgir a partir de clulas procariotas por endosimbiosis, y cules no parece que surgieran
as.

Segn Darwin, el alimento escaseara y las jirafas que tuvieran


el cuello y las patas largos podran alcanzar las ramas ms altas de los rboles, por lo que podran alimentarse y sobrevivir.
Por ello, al reproducirse sus caractersticas se transmitan a
la descendencia.

EUCARIOTA

Cloroplasto
PROCARIOTA

Ambas teoras explican la evolucin por la adaptacin de los


organismos al ambiente. La diferencia estriba en el mecanismo de adaptacin.
4 Basndote en los mecanismos de aparicin de nuevas especies, intenta explicar cmo pudieron originarse
las especies A y B de la figura.

Flagelo

Mitocondrias

Pudieron surgir por endosimbiosis: mitocondrias, cloroplastos


y flagelos, el resto no.
7 Razona si es correcto afirmar que el hombre procede
del mono.
Al reconstruir el rbol evolutivo de los primates comprobamos que los humanos tienen un origen comn con los monos, pero no descienden de ellos.

168

ACTIVIDADES FINALES
8 Cmo puede explicarse y qu nos revela el que dos
especies distintas tengan rganos homlogos?
La existencia de rganos homlogos en dos especies distintas nos indica que tuvieron un antepasado comn y por el
proceso evolutivo ambas se han adaptado a distintos ambientes. Por tanto, esos rganos presentan diferencias morfolgicas y funcionales debido a la adaptacin diferente en
ambas, pero tienen estructura interna y origen embriolgico
similares.
9 Comparando la globina humana con la de otras
especies se obtienen los datos de la siguiente tabla, en la
que se indica el porcentaje de aminocidos diferentes:
Tiburn Carpa Tritn Gallina Canguro Perro
Humano

53,2

48,6

44,0

24,8

19,1

16,3

Qu puedes decir acerca del parecido evolutivo de estas


especies?
El porcentaje de aminocidos diferentes que presenta una
determinada protena (globina en este caso) en dos especies distintas nos indica la proximidad evolutiva.
Los seres humanos estamos ms prximos evolutivamente
al perro (que es tambin un mamfero placentado), despus
al canguro (mamfero marsupial) y los ms alejados son los
tiburones (pez elasmobranquio).
10 Si sabes que Europa y Norteamrica han estado unidas hasta hace 40 millones de aos, mientras que frica
y Sudamrica han estado separadas desde hace 80 millones de aos, podras explicar por qu se parecen ms
la flora y fauna de Europa y Norteamrica que las de los
otros dos continentes entre s?
Las especies de frica y Sudamrica llevan 80 millones de
aos evolucionando por separado, por lo que se habrn distanciado ms que las de Europa y Norteamrica, que slo
llevan 40 millones de aos.
11 Cmo explicaban los fijistas la existencia de algunos animales fsiles?
Los fijistas, que crean que todos los seres vivos fueron creados tal y como son en la actualidad, pensaban que los animales fsiles que aparecan correspondan a especies que
desaparecieron durante alguna catstrofe (por ejemplo, el
diluvio universal) o que correspondan a formas caprichosas
de las rocas.
12 A quin se podra atribuir el texto siguiente: a Lamarck, a Darwin o a un neodarwinista? Cmo lo explicaran los otros dos?

Los topos viven bajo tierra y presentan una visin reducida. Ciertos antepasados suyos, que tenan amplia visin,
con el hbito a la oscuridad fueron perdiendo visibilidad,
caracterstica que transmitieron a sus hijos que ya nacen
con visin reducida.
Este texto corresponde a Lamarck porque explica la visin
reducida de los topos por su falta de uso; y sugiere que este
carcter adquirido se transmite a los descendientes.
13 Los pinginos son aves marinas. La mayora pesca en
las aguas antrticas de los ocanos del Hemisferio Sur.
No pueden volar por el aire, pero s nadar durante largos
periodos de tiempo porque tienen las alas transformadas en aletas. Cmo crees que surgi esta adaptacin?
En las zonas antrticas, sobre el hielo no hay mucho alimento
para los pinginos. Si algunos individuos tenan alguna mutacin que les permitiera nadar, conseguiran alimento en el agua,
sobreviviran y dejaran descendientes, con lo que esta variedad
aumentara su frecuencia en las siguientes generaciones.
14 Construye tres frases usando de forma lgica los
siguientes trminos:
a. Barrera geogrfica - formacin de especies - poblacin
b. Mutacin - variacin (variabilidad) - evolucin
c. Especiacin - aislamiento reproductivo - diferenciacin gradual
Posibles frases:
Un mecanismo de formacin de especies nuevas consiste
en la aparicin de una barrera geogrfica que asle grupos
de una poblacin original.
La mutacin es la fuente de variabilidad en las poblaciones naturales, lo que permite la evolucin de stas por
seleccin natural.
Con el aislamiento reproductivo de dos poblaciones de
una misma especie se favorece su diferenciacin gradual
y, en ltimo trmino, la especiacin.
15 Cmo determinaras si dos grupos de organismos
parecidos son especies distintas o variedades de la misma especie?
Cruzndolos y comprobando si pueden tener descendencia
frtil.
16 Para probar la eficacia de un determinado antibitico en un laboratorio farmacutico se realiza un cultivo
de bacterias. Posteriormente, se aade el antibitico al
medio de cultivo y van desapareciendo prcticamente
todas las bacterias, excepto una pequea colonia. Al
cabo de un tiempo, se aprecia que esa colonia se ha
multiplicado y que las bacterias son resistentes a dicho
antibitico. Explica lo ocurrido utilizando en tu expli-

169

9 LA EVOLUCIN DE LOS SERES VIVOS


cacin los conceptos de seleccin natural, mutacin y
evolucin.
Dentro del cultivo bacteriano exista variabilidad. Algunas
bacterias posean una mutacin que les permiti ser resistentes al antibitico y sobrevivieron. Estas bacterias, por
seleccin natural, consiguieron ser las nicas que se reprodujeron y transmitieron la caracterstica de la resistencia a sus
descendientes. Podemos decir que en la colonia bacteriana
se ha producido evolucin en ese sentido, ya que ahora todas las bacterias resisten al antibitico.
17 Indica si son ciertas o falsas las siguientes afirmaciones y corrige las errneas:

170

a. El darwinismo intenta explicar el origen del primer


ser vivo sobre la Tierra. FALSO.
El darwinismo intenta explicar el origen de toda la diversidad de seres vivos.
b. Los homnidos se caracterizan por la marcha bpeda.
VERDADERO.
c. Las primeras clulas eran procariotas, fotosintticas
y aerobias. FALSO.
Las primeras clulas eran procariotas, hetertrofas y anaerobias.
d. Los embriones de distintos tipos de vertebrados se
asemejan durante las primeras etapas del desarrollo.
VERDADERO.

notas

171

notas

172

notas

173

notas

174

notas

175